Directory of Open Access Journals (Sweden)
Anna Hammer
2017-12-01
Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele
2014-01-01
Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.
Directory of Open Access Journals (Sweden)
Annalisa LoGerfo
2014-01-01
Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan
2016-01-01
Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.
Ha, Ae Wha; Kim, Woo Kyoung
2017-06-01
Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.
A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders
International Nuclear Information System (INIS)
Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon
2010-01-01
Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.
A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders
Energy Technology Data Exchange (ETDEWEB)
Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)
2010-08-07
Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.
Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique
2017-07-11
Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alessandro Di Tullio
2017-07-01
Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.
Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S
2012-01-01
Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited
Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan
2018-01-01
Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Watanabe, T.; Oishi, M.
1987-01-01
A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed
Studies of globin gene expression in differentiating erythroid cells
International Nuclear Information System (INIS)
Sullivan, T.D.
1985-01-01
The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation
Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina
2011-10-15
4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Biaoru Li
Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34
Directory of Open Access Journals (Sweden)
Jian-Guo Ren
2010-09-01
Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel
Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D
2010-04-01
The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.
Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells
International Nuclear Information System (INIS)
Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.
1987-01-01
The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes
A hanging drop culture method to study terminal erythroid differentiation.
Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak
2005-10-01
To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.
Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu
2012-08-01
Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.
Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A
2004-10-01
A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.
Benchekroun, Mohamed; Romero, Alejandro; Egea, Javier; León, Rafael; Michalska, Patrycja; Buendía, Izaskun; Jimeno, María Luisa; Jun, Daniel; Janockova, Jana; Sepsova, Vendula; Soukup, Ondrej; Bautista-Aguilera, Oscar M; Refouvelet, Bernard; Ouari, Olivier; Marco-Contelles, José; Ismaili, Lhassane
2016-11-10
Novel multifunctional tacrines for Alzheimer's disease were obtained by Ugi-reaction between ferulic (or lipoic acid), a melatonin-like isocyanide, formaldehyde, and tacrine derivatives, according to the antioxidant additive approach in order to modulate the oxidative stress as therapeutic strategy. Compound 5c has been identified as a promising permeable agent showing excellent antioxidant properties, strong cholinesterase inhibitory activity, less hepatotoxicity than tacrine, and the best neuroprotective capacity, being able to significantly activate the Nrf2 transcriptional pathway.
Directory of Open Access Journals (Sweden)
Ali Dehghanifard
2012-07-01
Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.
Mu, Jingyao; Zhuang, Xiaoying; Wang, Qilong; Jiang, Hong; Deng, Zhong-Bin; Wang, Baomei; Zhang, Lifeng; Kakar, Sham; Jun, Yan; Miller, Donald; Zhang, Huang-Ge
2014-07-01
Exosomes, small vesicles participating in intercellular communication, have been extensively studied recently; however, the role of edible plant derived exosomes in interspecies communication has not been investigated. Here, we investigate the biological effects of edible plant derived exosome-like nanoparticles (EPDENs) on mammalian cells. In this study, exosome-like nanoparticles from four edible plants were isolated and characterized. We show that these EPDENs contain proteins, lipids, and microRNA. EPDENs are taken up by intestinal macrophages and stem cells. The results generated from EPDEN-transfected macrophages indicate that ginger EPDENs preferentially induce the expression of the antioxidation gene, heme oxygenase-1 and the anti-inflammatory cytokine, IL-10; whereas grapefruit, ginger, and carrot EPDENs promote activation of nuclear factor like (erythroid-derived 2). Furthermore, analysis of the intestines of canonical Wnt-reporter mice, i.e. B6.Cg-Tg(BAT-lacZ)3Picc/J mice, revealed that the numbers of β-galactosidase(+) (β-Gal) intestinal crypts are increased, suggesting that EPDEN treatment of mice leads to Wnt-mediated activation of the TCF4 transcription machinery in the crypts. The data suggest a role for EPDEN-mediated interspecies communication by inducing expression of genes for anti-inflammation cytokines, antioxidation, and activation of Wnt signaling, which are crucial for maintaining intestinal homeostasis. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D
2014-10-01
This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
Energy Technology Data Exchange (ETDEWEB)
Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)
2009-12-11
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
International Nuclear Information System (INIS)
Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.
2009-01-01
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
Ma, Y F; Wu, Z H; Gao, M; Loor, J J
2018-03-21
The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2
Natural product-derived pharmacological modulators of Nrf2/ARE pathway for chronic diseases.
Kumar, Hemant; Kim, In-Su; More, Sandeep Vasant; Kim, Byung-Wook; Choi, Dong-Kug
2014-01-01
Covering: 2000 to 2013. Oxidative stress is the central component of chronic diseases. The nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2/ARE) pathway is vital in the up-regulation of cytoprotective genes and enzymes in response to oxidative stress and treatment with certain dietary phytochemicals. Herein, we classify bioactive compounds derived from natural products that are Nrf2/ARE pathway activators and recapitulate the molecular mechanisms for inducing Nrf2 to provide favorable effects in experimental models of chronic diseases. Moreover, pharmacological inhibition of Nrf2 signalling has emerged as promising strategy against multi-drug resistance thereby improving the treatment efficacy. We have also enlisted natural product-derived inhibitors of Nrf2/ARE pathway.
MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
International Nuclear Information System (INIS)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun
2012-01-01
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2012-11-15
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.
Directory of Open Access Journals (Sweden)
Eyayu Belay
Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.
Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie
2017-09-01
Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.
Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali
2017-03-01
Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.
Directory of Open Access Journals (Sweden)
Heung Bum Lee
2012-06-01
Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.
Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases
Directory of Open Access Journals (Sweden)
Marta Pajares
2017-04-01
Full Text Available Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2-like 2. NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.
DEFF Research Database (Denmark)
Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio
2015-01-01
Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...
International Nuclear Information System (INIS)
Porter, P.N.; Ogawa, M.
1982-01-01
Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture
Bmi-1 Regulates Extensive Erythroid Self-Renewal
Directory of Open Access Journals (Sweden)
Ah Ram Kim
2015-06-01
Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.
Gao, Wenqi; Xiao, Changyi; Hu, Jun; Chen, Biaoxin; Wang, Chunyan; Cui, Bangping; Deng, Pengyi; Yang, Jian; Deng, Zhifang
2018-04-18
Qing brick tea (QBT), traditional and popular beverage for Chinese people, is an important post-fermentation dark tea. Our present study was performed to investigate the ameliorative effects of QBT aqueous extract on metabolic syndrome (Mets) in monosodium glutamate-induced obese mice and the potential mechanisms. Monosodium glutamate-induced obese mice were used to evaluate the anti-Mets effects of QBT. Content levels of malonaldehyde (MDA), reactive oxygen species (ROS) and protein carbonylation, antioxidant enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione reductase (GR) in the skeletal muscle were assessed by commercial kits, respectively. Western blot and Q-PCR were used to detect the expressions of Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) signaling pathway and downstream antioxidant factors. In addition, activity of AKT signaling and expression of glucose transporter type 4 (GLUT4) in the skeletal muscle were investigated by western blot. QBT treatment limited gain of body weight, waistline and LEE index, improved insulin resistance and glucose intolerance, reduced lipid level in MSG mice. Content levels of MDA, ROS and protein carbonylation in skeletal muscle of QBT group were significantly improved compared to those of MSG mice. The antioxidant enzyme activities of SOD, GPx, CAT, and GR were increased in skeletal muscle of MSG mice intervened with QBT. After 20-week QBT treatment, Nrf2 signaling pathway and downstream antioxidant factors were both increased in the skeletal muscle. In addition, QBT treatment improved insulin signaling by preferentially augmenting AKT signaling, as well as increased the protein expression of GLUT4 in the skeletal muscle. Our results showed that QBT intake was effective in protecting monosodium glutamate-induced obese mice against metabolic syndrome and involved in the Nrf2 signaling pathway in the skeletal muscle. Copyright © 2018
Directory of Open Access Journals (Sweden)
Schmidt Enrico K
2004-05-01
Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.
Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm
2015-01-01
Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.
TMEM14C is required for erythroid mitochondrial heme metabolism.
Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H
2014-10-01
The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.
International Nuclear Information System (INIS)
Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia
2016-01-01
Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating
Energy Technology Data Exchange (ETDEWEB)
Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)
2016-08-01
Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating
Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata
2016-09-01
Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.
Energy Technology Data Exchange (ETDEWEB)
Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca
2013-07-15
Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.
International Nuclear Information System (INIS)
Lo, Raymond; Matthews, Jason
2013-01-01
Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.
Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells
International Nuclear Information System (INIS)
Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)
Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells
Energy Technology Data Exchange (ETDEWEB)
Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.
Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.
2016-01-01
Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578
Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M
2014-05-13
Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.
Directory of Open Access Journals (Sweden)
Ji Yeon Seo
2018-01-01
Full Text Available As soy-derived glyceollins are known to induce antioxidant enzymes in various types of cells and tissues, we hypothesized that the compounds could protect neurons from damage due to reactive oxygen species (ROS. In order to examine the neuroprotective effect of glyceollins, primary cortical neurons collected from mice and mouse hippocampal HT22 cells were challenged with glutamate. Glyceollins attenuated glutamate-induced cytotoxicity in primary cortical neuron isolated from mice carrying wild-type nuclear factor (erythroid-derived 2-like 2 (Nrf2, but the compounds were ineffective in those isolated from Nrf2 knockout mice, suggesting the involvement of the Nrf2 signaling pathway in glyceollin-mediated neuroprotection. Furthermore, the inhibition of heme oxygenase-1 (HO-1, a major downstream enzyme of Nrf2, abolished the suppressive effect of glyceollins against glutamate-induced ROS production and cytotoxicity, confirming that activation of HO-1 by glyceollins is responsible for the neuroprotection. To examine whether glyceollins also improve cognitive ability, mice pretreated with glyceollins were challenged with scopolamine and subjected to behavioral tests. Glyceollins attenuated scopolamine-induced cognitive impairment of mice, but failed to enhance memory in Nrf2 knockout mice, suggesting that the memory-enhancing effect is also mediated by the Nrf2 signaling pathway. Overall, glyceollins showed neuroprotection against glutamate-induced damage, and attenuated scopolamine-induced memory deficits in an Nrf2-dependent manner.
Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin
2018-01-01
Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.
Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation
International Nuclear Information System (INIS)
Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella
2010-01-01
Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment
Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit
2015-01-01
We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632
Directory of Open Access Journals (Sweden)
Xiaojing Ye
Full Text Available Insulin like growth factor 2 (Igf2 is known as a maternally imprinted gene involved in growth and development. Recently, Igf2 was found to also be regulated and required in the adult rat hippocampus for long-term memory formation, raising the question of its allelic regulation in adult brain regions following experience and in cognitive processes. We show that, in adult rats, Igf2 is abundantly expressed in brain regions involved in cognitive functions, like hippocampus and prefrontal cortex, compared to the peripheral tissues. In contrast to its maternal imprinting in peripheral tissues, Igf2 is mainly expressed from the maternal allele in these brain regions. The training-dependent increase in Igf2 expression derives proportionally from both parental alleles, and, hence, is mostly maternal. Thus, Igf2 parental expression in the adult rat brain does not follow the imprinting rules found in peripheral tissues, suggesting differential expression regulation and functions of imprinted genes in the brain.
Modulation of Nrf2 by Olive Oil and Wine Polyphenols and Neuroprotection
Directory of Open Access Journals (Sweden)
Miriam Martínez-Huélamo
2017-09-01
Full Text Available Strong adherence to a Mediterranean diet is associated with improved cognitive function and a lower prevalence of mild cognitive impairment. Olive oil and red wine are rich sources of polyphenols which are responsible in part for the beneficial effects on cognitive functioning. Polyphenols induce endogenous antioxidant defense mechanisms by modulating transcription factors such as the nuclear factor (erythroid-derived 2-like 2 (Nrf2. This review discusses the scientific data supporting the modulating effect of olive oil and red wine polyphenols on Nrf2 expression, and the potential health benefits associated with cognitive functioning.
Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela
2017-07-01
Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Bardoxolone methyl in type 2 diabetes and stage 4 chronic kidney disease
DEFF Research Database (Denmark)
de Zeeuw, Dick; Akizawa, Tadao; Audhya, Paul
2013-01-01
Although inhibitors of the renin-angiotensin-aldosterone system can slow the progression of diabetic kidney disease, the residual risk is high. Whether nuclear 1 factor (erythroid-derived 2)-related factor 2 activators further reduce this risk is unknown....
Chen, Tao; Wu, Yu; Wang, Yuzi; Zhu, Jigao; Chu, Haiying; Kong, Li; Yin, Liangwei; Ma, Haiying
2017-11-01
Brain-derived neurotrophic factor (BDNF) plays an important role in promoting the growth, differentiation, survival and synaptic stability of neurons. Presently, the transplantation of neural stem cells (NSCs) is known to induce neural repair to some extent after injury or disease. In this study, to investigate whether NSCs genetically modified to encode the BDNF gene (BDNF/NSCs) would further enhance synaptogenesis, BDNF/NSCs or naive NSCs were directly engrafted into lesions in a rat model of traumatic brain injury (TBI). Immunohistochemistry, western blotting and RT-PCR were performed to detect synaptic proteins, BDNF-TrkB and its downstream signaling pathways, at 1, 2, 3 or 4 weeks after transplantation. Our results showed that BDNF significantly increased the expression levels of the TrkB receptor gene and the phosphorylation of the TrkB protein in the lesions. The expression levels of Ras, phosphorylated Erk1/2 and postsynaptic density protein-95 were elevated in the BDNF/NSCs-transplanted groups compared with those in the NSCs-transplanted groups throughout the experimental period. Moreover, the nuclear factor (erythroid-derived 2)-like 2/Thioredoxin (Nrf2/Trx) axis, which is a specific therapeutic target for the treatment of injury or cell death, was upregulated by BDNF overexpression. Therefore, we determined that the increased synaptic proteins level implicated in synaptogenesis might be associated with the activation of the MAPK/Erk1/2 signaling pathway and the upregulation of the antioxidant agent Trx modified by BDNF-TrkB following the BDNF/NSCs transplantation after TBI.
Energy Technology Data Exchange (ETDEWEB)
Chiou, Shyh-Shin, E-mail: chiouss@kmu.edu.tw [Division of Hematology-Oncology, Department of Pediatrics, Kaohsiung Medical University Hospital, Kaohsiung 807, Taiwan (China); Department of Pediatrics, Faculty of Medicine, School of Medicine, Kaohsiung Medical University, 807 Kaohsiung 807, Taiwan (China); Wang, Sophie Sheng-Wen; Wu, Deng-Chyang [Department of Gastroenterology, Kaohsiung Medical University Hospital, Kaohsiung 807, Taiwan (China); Lin, Ying-Chu [School of Dentistry, College of Dentistry, Kaohsiung Medical University, Kaohsiung 807, Taiwan (China); Kao, Li-Pin [Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, 807 Kaohsiung 807, Taiwan (China)
2013-07-26
We report here that the Jun dimerization protein 2 (JDP2) plays a critical role as a cofactor for the transcription factors nuclear factor-erythroid 2-related factor 2 (Nrf2) and MafK in the regulation of the antioxidants and production of reactive oxygen species (ROS). JDP2 associates with Nrf2 and MafK (Nrf2-MafK) to increase the transcription of antioxidant response element-dependent genes. Oxidative-stress-inducing reagent led to an increase in the intracellular accumulation of ROS and cell proliferation in Jdp2 knock-out mouse embryonic fibroblasts. In Jdp2-Cre mice mated with reporter mice, the expression of JDP2 was restricted to granule cells in the brain cerebellum. The induced pluripotent stem cells (iPSC)-like cells were generated from DAOY medulloblastoma cell by introduction of JDP2, and the defined factor OCT4. iPSC-like cells expressed stem cell-like characteristics including alkaline phosphatase activity and some stem cell markers. However, such iPSC-like cells also proliferated rapidly, became neoplastic, and potentiated cell malignancy at a later stage in SCID mice. This study suggests that medulloblastoma cells can be reprogrammed successfully by JDP2 and OCT4 to become iPSC-like cells. These cells will be helpful for studying the generation of cancer stem cells and ROS homeostasis.
Directory of Open Access Journals (Sweden)
Naoto Yamaguchi
2013-07-01
Full Text Available We report here that the Jun dimerization protein 2 (JDP2 plays a critical role as a cofactor for the transcription factors nuclear factor-erythroid 2-related factor 2 (Nrf2 and MafK in the regulation of the antioxidants and production of reactive oxygen species (ROS. JDP2 associates with Nrf2 and MafK (Nrf2-MafK to increase the transcription of antioxidant response element-dependent genes. Oxidative-stress-inducing reagent led to an increase in the intracellular accumulation of ROS and cell proliferation in Jdp2 knock-out mouse embryonic fibroblasts. In Jdp2-Cre mice mated with reporter mice, the expression of JDP2 was restricted to granule cells in the brain cerebellum. The induced pluripotent stem cells (iPSC-like cells were generated from DAOY medulloblastoma cell by introduction of JDP2, and the defined factor OCT4. iPSC-like cells expressed stem cell-like characteristics including alkaline phosphatase activity and some stem cell markers. However, such iPSC-like cells also proliferated rapidly, became neoplastic, and potentiated cell malignancy at a later stage in SCID mice. This study suggests that medulloblastoma cells can be reprogrammed successfully by JDP2 and OCT4 to become iPSC-like cells. These cells will be helpful for studying the generation of cancer stem cells and ROS homeostasis.
Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway
Directory of Open Access Journals (Sweden)
Michelle R. Campbell
2013-01-01
Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.
Enhancement of erythroid colony growth in culture by hemin
International Nuclear Information System (INIS)
Porter, P.N.; Meints, R.H.; Mesner, K.
1979-01-01
Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria
2017-10-20
The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.
Lyons, Amy; Coleman, Michael; Riis, Sarah; Favre, Cedric; O'Flanagan, Ciara H; Zhdanov, Alexander V; Papkovsky, Dmitri B; Hursting, Stephen D; O'Connor, Rosemary
2017-10-13
Mitochondrial activity and metabolic reprogramming influence the phenotype of cancer cells and resistance to targeted therapy. We previously established that an insulin-like growth factor 1 (IGF-1)-inducible mitochondrial UTP carrier (PNC1/SLC25A33) promotes cell growth. This prompted us to investigate whether IGF signaling is essential for mitochondrial maintenance in cancer cells and whether this contributes to therapy resistance. Here we show that IGF-1 stimulates mitochondrial biogenesis in a range of cell lines. In MCF-7 and ZR75.1 breast cancer cells, IGF-1 induces peroxisome proliferator-activated receptor γ coactivator 1β (PGC-1β) and PGC-1α-related coactivator (PRC). Suppression of PGC-1β and PRC with siRNA reverses the effects of IGF-1 and disrupts mitochondrial morphology and membrane potential. IGF-1 also induced expression of the redox regulator nuclear factor-erythroid-derived 2-like 2 (NFE2L2 alias NRF-2). Of note, MCF-7 cells with acquired resistance to an IGF-1 receptor (IGF-1R) tyrosine kinase inhibitor exhibited reduced expression of PGC-1β, PRC, and mitochondrial biogenesis. Interestingly, these cells exhibited mitochondrial dysfunction, indicated by reactive oxygen species expression, reduced expression of the mitophagy mediators BNIP3 and BNIP3L, and impaired mitophagy. In agreement with this, IGF-1 robustly induced BNIP3 accumulation in mitochondria. Other active receptor tyrosine kinases could not compensate for reduced IGF-1R activity in mitochondrial protection, and MCF-7 cells with suppressed IGF-1R activity became highly dependent on glycolysis for survival. We conclude that IGF-1 signaling is essential for sustaining cancer cell viability by stimulating both mitochondrial biogenesis and turnover through BNIP3 induction. This core mitochondrial protective signal is likely to strongly influence responses to therapy and the phenotypic evolution of cancer. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.
Directory of Open Access Journals (Sweden)
Abigail A Lamikanra
2009-12-01
Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that
Directory of Open Access Journals (Sweden)
Lina Dahl
Full Text Available The molecular mechanisms regulating the expansion of the hematopoietic system including hematopoietic stem cells (HSCs in the fetal liver during embryonic development are largely unknown. The LIM-homeobox gene Lhx2 is a candidate regulator of fetal hematopoiesis since it is expressed in the fetal liver and Lhx2(-/- mice die in utero due to severe anemia. Moreover, expression of Lhx2 in embryonic stem (ES cell-derived embryoid bodies (EBs can lead to the generation of HSC-like cell lines. To further define the role of this transcription factor in hematopoietic regulation, we generated ES cell lines that enabled tet-inducible expression of Lhx2. Using this approach we observed that Lhx2 expression synergises with specific signalling pathways, resulting in increased frequency of colony forming cells in developing EB cells. The increase in growth factor-responsive progenitor cells directly correlates to the efficiency in generating HSC-like cell lines, suggesting that Lhx2 expression induce self-renewal of a distinct multipotential hematopoietic progenitor cell in EBs. Signalling via the c-kit tyrosine kinase receptor and the gp130 signal transducer by IL-6 is necessary and sufficient for the Lhx2 induced self-renewal. While inducing self-renewal of multipotential progenitor cells, expression of Lhx2 inhibited proliferation of primitive erythroid precursor cells and interfered with early ES cell commitment, indicating striking lineage specificity of this effect.
Acute erythroid neoplastic proliferations. A biological study based on 62 patients.
Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad
2002-02-01
The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was
Tepakhan, Wanicha; Yamsri, Supawadee; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan
2015-07-01
The basis for variability of hemoglobin (Hb) F in homozygous Hb E disease is not well understood. We have examined multiple mutations of the Krüppel-like factor 1 (KLF1) gene; an erythroid specific transcription factor and determined their associations with Hbs F and A2 expression in homozygous Hb E. Four KLF1 mutations including G176AfsX179, T334R, R238H, and -154 (C-T) were screened using specific PCR assays on 461 subjects with homozygous Hb E and 100 normal controls. None of these four mutations were observed in 100 normal controls. Among 461 subjects with homozygous Hb E, 306 had high (≥5 %) and 155 had low (<5 %) Hb F. DNA analysis identified the KLF1 mutations in 35 cases of the former group with high Hb F, including the G176AfsX179 mutation (17/306 = 5.6 %), T334R mutation (9/306 = 2.9 %), -154 (C-T) mutation (7/306 = 2.3 %), and R328H mutation (2/306 = 0.7 %). Only two subjects in the latter group with low Hb F carried the G176AfsX179 and -154 (C-T) mutations. Significant higher Hb A2 level was observed in those of homozygous Hb E with the G176AfsX179 mutation as compared to those without KLF1 mutations. These results indicate that KLF1 is among the genetic factors associated with increased Hbs F and A2, and in combination with other factors could explain the variabilities of these Hb expression in Hb E syndrome.
Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong
2016-04-01
Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could
Directory of Open Access Journals (Sweden)
Zita Garate
2015-12-01
Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.
Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan
2015-12-01
Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.
Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan
2015-01-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...
Energy Technology Data Exchange (ETDEWEB)
Yang, Bin [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Li, Wei [Department of Gerontology, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Zheng, Qichang [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Qin, Tao [Department of Hepatobiliary Pancreatic Surgery, People' s Hospital of Zhengzhou University, School of Medicine, Zhengzhou University, Zhengzhou 450003 (China); Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Liu, Sanguang, E-mail: sanguang1998@sina.com [Department of Hepatobiliary Surgery, The Second Hospital, Hebei Medical University, Shijiazhuang 050000 (China); Song, Zifang, E-mail: zsong@hust.edu.cn [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China)
2015-07-17
Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation.
International Nuclear Information System (INIS)
Yang, Bin; Li, Wei; Zheng, Qichang; Qin, Tao; Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen; Liu, Sanguang; Song, Zifang
2015-01-01
Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation
Hu, Xinyue; Rajesh, Mohanraj; Zhang, Jian; Zhou, Shanshan; Wang, Shudong; Sun, Jian; Tan, Yi; Zheng, Yang; Cai, Lu
2018-05-01
Oxidative stress and inflammation play key roles in the development of diabetic cardiomyopathy (DCM). Dimethyl fumarate (DMF), an FDA approved medicine for relapsing multiple sclerosis, has manifested its antioxidant and anti-inflammatory function mostly in the central nervous system. In this study, we investigated whether DMF could attenuate the development of DCM. Type 1 diabetes mouse model was established using multiple low-dose streptozotocin, and the diabetic mice were treated with DMF (10 mg/kg body weight) for 3 months. Cardiac functions were determined using echocardiography. Oxidative stress, pro-inflammatory cytokines and pro-fibrotic markers were determined with commercially available kits, real-time quantitative PCR or western blot techniques. DCM was characterized by diminished cardiac function, accompanied by oxidative stress and enhanced expression of pro-inflammatory cytokines. Diabetic cardiac tissue exhibited marked fibrosis, revealed by extracellular matrix deposition as determined by Sirius red staining of the myocardial tissues. Furthermore, Nrf2 and its downstream effectors were repressed in diabetic myocardium. On the contrary, diabetic animals treated with DMF exhibited blunted oxidative stress, inflammation, fibrosis and this correlated with Nrf2 activation. Our findings suggest that DMF could potentially thwart diabetes-induced myocardial tissue injury, likely via activation of Nrf2 function, providing firm impetus for future repurposing of DMF in the management of DCM. Copyright © 2018 Elsevier B.V. All rights reserved.
Insulin-Like Growth Factor Axis Expression in Dental Pulp Cells Derived From Carious Teeth
Directory of Open Access Journals (Sweden)
Hanaa Esa Alkharobi
2018-04-01
Full Text Available The insulin-like growth factor (IGF axis plays an important role in dental tissue regeneration and most components of this axis are expressed in human dental pulp cells (DPCs. In our previous study, we analyzed IGF axis gene expression in DPCs and demonstrated a novel role of IGF binding protein (IGFBP-2 and -3 in coordinating mineralized matrix formation in differentiating DPCs. A more recent study from our laboratory partially characterized dental pulp stem cells from teeth with superficial caries (cDPCs and showed that their potential to differentiate odontoblasts and/or into osteoblasts is enhanced by exposure to the mild inflammatory conditions characteristic of superficial caries. In the present study, we examine whether changes apparent in IGF axis expression during osteogenic differentiation of healthy DPCs are also apparent in DPCs derived from carious affected teeth.
Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang
2017-07-01
Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Prasuna Paluru
2014-03-01
Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.
Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F
2018-06-15
In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.
Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S
2015-11-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.
PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.
Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C
2017-05-01
Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.
Directory of Open Access Journals (Sweden)
Deepti Jain
2015-06-01
Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.
Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.
2010-01-01
Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494
Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle
International Nuclear Information System (INIS)
Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella
2012-01-01
Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.
Tumor-Induced Generation of Splenic Erythroblast-like Ter-Cells Promotes Tumor Progression.
Han, Yanmei; Liu, Qiuyan; Hou, Jin; Gu, Yan; Zhang, Yi; Chen, Zhubo; Fan, Jia; Zhou, Weiping; Qiu, Shuangjian; Zhang, Yonghong; Dong, Tao; Li, Ning; Jiang, Zhengping; Zhu, Ha; Zhang, Qian; Ma, Yuanwu; Zhang, Lianfeng; Wang, Qingqing; Yu, Yizhi; Li, Nan; Cao, Xuetao
2018-04-19
Identifying tumor-induced leukocyte subsets and their derived circulating factors has been instrumental in understanding cancer as a systemic disease. Nevertheless, how primary tumor-induced non-leukocyte populations in distal organs contribute to systemic spread remains poorly defined. Here, we report one population of tumor-inducible, erythroblast-like cells (Ter-cells) deriving from megakaryocyte-erythroid progenitor cells with a unique Ter-119 + CD45 - CD71 + phenotype. Ter-cells are enriched in the enlarged spleen of hosts bearing advanced tumors and facilitate tumor progression by secreting neurotrophic factor artemin into the blood. Transforming growth factor β (TGF-β) and Smad3 activation are important in Ter-cell generation. In vivo blockade of Ter-cell-derived artemin inhibits hepatocellular carcinoma (HCC) growth, and artemin deficiency abolishes Ter-cells' tumor-promoting ability. We confirm the presence of splenic artemin-positive Ter-cells in human HCC patients and show that significantly elevated serum artemin correlates with poor prognosis. We propose that Ter-cells and the secreted artemin play important roles in cancer progression with prognostic and therapeutic implications. Copyright © 2018 Elsevier Inc. All rights reserved.
Kawata, Kazumi; Kubota, Satoshi; Eguchi, Takanori; Aoyama, Eriko; Moritani, Norifumi H; Oka, Morihiko; Kawaki, Harumi; Takigawa, Masaharu
2017-11-01
The platelet-derived growth factor receptor-like (PDGFRL) gene is regarded as a tumor suppressor gene. However, nothing is known about the molecular function of PDGFRL. In this study, we initially clarified its function in chondrocytes. Among all cell lines examined, the PDGFRL mRNA level was the highest in chondrocytic HCS-2/8 cells. Interestingly, the proliferation of chondrocytic HCS-2/8 cells was promoted by PDGFRL overexpression, whereas that of the breast cancer-derived MDA-MB-231 cells was inhibited. Of note, in PDGFRL-overexpressing HCS-2/8 cells, the expression of chondrocyte differentiation marker genes, SOX9, ACAN, COL2A1, COL10A1, and ALP, was decreased. Moreover, we confirmed the expression of PDGFRL mRNA in normal cartilage tissue and chondrocytes. Eventually, the expression of PDGFRL mRNA in condrocytes except in the case of hypertrophic chondrocytes was demonstrated in vivo and in vitro. These findings suggest that PDGFRL plays the different roles, depending upon cell types. Particularly, in chondrocytes, PDGFRL may play a new and important role which is distinct from the function previously reported. J. Cell. Biochem. 118: 4033-4044, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Amos, Peter J; Fung, Susan; Case, Amanda; Kifelew, Jerusalem; Osnis, Leah; Smith, Carole L; Green, Kevin; Naydenov, Alipi; Aloi, Macarena; Hubbard, Jesse J; Ramakrishnan, Aravind; Garden, Gwenn A; Jayadev, Suman
2017-01-01
Microglia are the primary innate immune cell type in the brain, and their dysfunction has been linked to a variety of central nervous system disorders. Human microglia are extraordinarily difficult to obtain for experimental investigation, limiting our ability to study the impact of human genetic variants on microglia functions. Previous studies have reported that microglia-like cells can be derived from human monocytes or pluripotent stem cells. Here, we describe a reproducible relatively simple method for generating microglia-like cells by first deriving embryoid body mesoderm followed by exposure to microglia relevant cytokines. Our approach is based on recent studies demonstrating that microglia originate from primitive yolk sac mesoderm distinct from peripheral macrophages that arise during definitive hematopoiesis. We hypothesized that functional microglia could be derived from human stem cells by employing BMP-4 mesodermal specification followed by exposure to microglia-relevant cytokines, M-CSF, GM-CSF, IL-34, and TGF-β. Using immunofluorescence microscopy, flow cytometry, and reverse transcription polymerase chain reaction, we observed cells with microglia morphology expressing a repertoire of markers associated with microglia: Iba1, CX3CR1, CD11b, TREM2, HexB, and P2RY12. These microglia-like cells maintain myeloid functional phenotypes including Aβ peptide phagocytosis and induction of pro-inflammatory gene expression in response to lipopolysaccharide stimulation. Addition of small molecules BIO and SB431542, previously demonstrated to drive definitive hematopoiesis, resulted in decreased surface expression of TREM2. Together, these data suggest that mesodermal lineage specification followed by cytokine exposure produces microglia-like cells in vitro from human pluripotent stem cells and that this phenotype can be modulated by factors influencing hematopoietic lineage in vitro.
Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A
1998-06-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and
Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun
1998-01-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited
Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.
Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C
2017-05-01
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.
Energy Technology Data Exchange (ETDEWEB)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.
International Nuclear Information System (INIS)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-01-01
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation
Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.
Kruppel-like factor 2 (KLF2) regulates proinflammatory activation of monocytes
Das, Hiranmoy; Kumar, Ajay; Lin, Zhiyong; Patino, Willmar D.; Hwang, Paul M.; Feinberg, Mark W.; Majumder, Pradip K.; Jain, Mukesh K.
2006-01-01
The mechanisms regulating activation of monocytes remain incompletely understood. Herein we provide evidence that Kruppel-like factor 2 (KLF2) inhibits proinflammatory activation of monocytes. In vitro, KLF2 expression in monocytes is reduced by cytokine activation or differentiation. Consistent with this observation, KLF2 expression in circulating monocytes is reduced in patients with chronic inflammatory conditions such as coronary artery disease. Adenoviral overexpression of KLF2 inhibits the LPS-mediated induction of proinflammatory factors, cytokines, and chemokines and reduces phagocytosis. Conversely, short interfering RNA-mediated reduction in KLF2 increased inflammatory gene expression. Reconstitution of immunodeficient mice with KLF2-overexpressing monocytes significantly reduced carrageenan-induced acute paw edema formation. Mechanistically, KLF2 inhibits the transcriptional activity of both NF-κB and activator protein 1, in part by means of recruitment of transcriptional coactivator p300/CBP-associated factor. These observations identify KLF2 as a novel negative regulator of monocytic activation. PMID:16617118
International Nuclear Information System (INIS)
Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P
2013-01-01
Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository
Montoya, Tatiana; Aparicio-Soto, Marina; Castejón, María Luisa; Rosillo, María Ángeles; Sánchez-Hidalgo, Marina; Begines, Paloma; Fernández-Bolaños, José G; Alarcón-de-la-Lastra, Catalina
2018-03-18
The present study was designed to investigate the anti-inflammatory effects of a new derivative of hydroxytyrosol (HTy), peracetylated hydroxytyrosol (Per-HTy), compared with its parent, HTy, on lipopolysaccharide (LPS)-stimulated murine macrophages as well as potential signaling pathways involved. In particular, we attempted to characterize the role of the inflammasome underlying Per-HTy possible anti-inflammatory effects. Isolated murine peritoneal macrophages were treated with HTy or its derivative in the presence or absence of LPS (5 μg/ml) for 18 h. Cell viability was determined using sulforhodamine B (SRB) assay. Nitric oxide (NO) production was analyzed by Griess method. Production of pro-inflammatory cytokines was evaluated by enzyme-linked immunosorbent assay (ELISA) and inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2, janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway (STAT3), haem oxigenase 1 (HO1), nuclear factor (erythroid-derived 2)-like 2 (Nrf2) expression and mitogen-activated protein kinases (MAPKs) activation was determined by Western blot. Per-HTy significantly reduced the levels of NO and pro-inflammatory cytokines as well as both COX-2 and iNOS expressions. Furthermore, Per-HTy treatment inhibited STAT3 and increased Nrf2 and HO1 protein levels in murine macrophages exposed to LPS. In addition, Per-HTy anti-inflammatory activity was related with an inhibition of non-canonical nucleotide binding domain (NOD)-like receptor (NLRP3) inflammasome pathways by decreasing pro-inflammatory interleukin (IL)-1β and IL-18 cytokine levels as consequence of regulation of cleaved caspase-11 enzyme. These results support that this new HTy derivative may offer a new promising nutraceutical therapeutic strategy in the management of inflammatory-related pathologies. Copyright © 2018. Published by Elsevier Inc.
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna
2017-01-01
are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark
Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.
Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem
2016-12-01
In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.
Rivera, Francisco J; Sierralta, Walter D; Minguell, Jose J; Aigner, Ludwig
2006-10-02
Bone marrow-derived mesenchymal stem cells (MSCs) are not restricted in their differentiation fate to cells of the mesenchymal lineage. They acquire a neural phenotype in vitro and in vivo after transplantation in the central nervous system. Here we investigated whether soluble factors derived from different brain regions are sufficient to induce a neuronal phenotype in MSCs. We incubated bone marrow-derived MSCs in conditioned medium (CM) derived from adult hippocampus (HCM), cortex (CoCM) or cerebellum (CeCM) and analyzed the cellular morphology and the expression of neuronal and glial markers. In contrast to muscle derived conditioned medium, which served as control, conditioned medium derived from the different brain regions induced a neuronal morphology and the expression of the neuronal markers GAP-43 and neurofilaments in MSCs. Hippocampus derived conditioned medium had the strongest activity. It was independent of NGF or BDNF; and it was restricted to the neuronal differentiation fate, since no induction of the astroglial marker GFAP was observed. The work indicates that soluble factors present in the brain are sufficient to induce a neuronal phenotype in MSCs.
Energy Technology Data Exchange (ETDEWEB)
Park, Gunhyuk, E-mail: uranos5@kiom.re.kr [The K-herb Research Center, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054 (Korea, Republic of); Oh, Dal-Seok [The K-herb Research Center, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054 (Korea, Republic of); Lee, Mi Gi; Lee, Chang Eon [Major in Cosmeceutical Science, Division of Bio-technology and Convergence, Daegu Haany University, Gyeongsan (Korea, Republic of); Kim, Yong-ung, E-mail: ykim@dhu.ac.kr [Department of Pharmaceutical Engineering, College of Biomedical Science, Daegu Haany University (Korea, Republic of)
2016-11-01
Allergic dermatitis (AD) clinically presents with skin erythematous plaques, eruption, and elevated serum IgE, and T helper cell type 2 and 1 (Th2 and Th1) cytokine levels. 6-Shogaol [1-(4-hydroxy-methoxyphenyl)-4-decen-one], a pungent compound isolated from ginger, has shown anti-inflammatory effects, but its inhibitory effects on AD are unknown. The aim of this study was to examine whether 6-shogaol inhibits AD-like skin lesions and their underlying mechanism in vivo and in vitro. An AD-like response was induced by tumor necrosis factor-α (TNF-α) + IFN-γ in human keratinocytes or by 2,4-dinitrochlorobenzene (DNCB) in mice. In vivo, 6-shogaol inhibited the development of DNCB-induced AD-like skin lesions and scratching behavior, and showed significant reduction in Th2/1-mediated inflammatory cytokines, IgE, TNF-α, IFN-γ, thymus and activation-regulated chemokine, IL-1, 4, 12, and 13, cyclooxygenase-2, and nitric oxide synthase levels. In vitro, 6-shogaol inhibited reactive oxygen species (ROS) and mitogen-activated protein kinases (MAPKs) signaling, and increased the levels of total glutathione, heme oxygenase-1, and quinone 1 via nuclear factor erythroid 2 related factor 2 (Nrf2) activation. 6-Shogaol can alleviate AD-like skin lesions by inhibiting immune mediators via regulating the ROS/MAPKs/Nrf2 signaling pathway, and may be an effective alternative therapy for AD. - Highlights: • 6-Shogaol inhibited Th2/1-mediated inflammatory mediators in vitro and in vivo. • 6-Shogaol regulated ROS/MAPKs/Nrf2 signaling pathway. • 6-Shogaol can protect against the development of AD-like skin lesions.
International Nuclear Information System (INIS)
Park, Gunhyuk; Oh, Dal-Seok; Lee, Mi Gi; Lee, Chang Eon; Kim, Yong-ung
2016-01-01
Allergic dermatitis (AD) clinically presents with skin erythematous plaques, eruption, and elevated serum IgE, and T helper cell type 2 and 1 (Th2 and Th1) cytokine levels. 6-Shogaol [1-(4-hydroxy-methoxyphenyl)-4-decen-one], a pungent compound isolated from ginger, has shown anti-inflammatory effects, but its inhibitory effects on AD are unknown. The aim of this study was to examine whether 6-shogaol inhibits AD-like skin lesions and their underlying mechanism in vivo and in vitro. An AD-like response was induced by tumor necrosis factor-α (TNF-α) + IFN-γ in human keratinocytes or by 2,4-dinitrochlorobenzene (DNCB) in mice. In vivo, 6-shogaol inhibited the development of DNCB-induced AD-like skin lesions and scratching behavior, and showed significant reduction in Th2/1-mediated inflammatory cytokines, IgE, TNF-α, IFN-γ, thymus and activation-regulated chemokine, IL-1, 4, 12, and 13, cyclooxygenase-2, and nitric oxide synthase levels. In vitro, 6-shogaol inhibited reactive oxygen species (ROS) and mitogen-activated protein kinases (MAPKs) signaling, and increased the levels of total glutathione, heme oxygenase-1, and quinone 1 via nuclear factor erythroid 2 related factor 2 (Nrf2) activation. 6-Shogaol can alleviate AD-like skin lesions by inhibiting immune mediators via regulating the ROS/MAPKs/Nrf2 signaling pathway, and may be an effective alternative therapy for AD. - Highlights: • 6-Shogaol inhibited Th2/1-mediated inflammatory mediators in vitro and in vivo. • 6-Shogaol regulated ROS/MAPKs/Nrf2 signaling pathway. • 6-Shogaol can protect against the development of AD-like skin lesions.
MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B
Directory of Open Access Journals (Sweden)
Dongsheng Wang
2018-03-01
Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.
International Nuclear Information System (INIS)
Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.
1982-01-01
Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)
Houghton, Christine A.; Fassett, Robert G.; Coombes, Jeff S.
2016-01-01
The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2), comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements. PMID:26881038
Defining the Minimal Factors Required for Erythropoiesis through Direct Lineage Conversion
Directory of Open Access Journals (Sweden)
Sandra Capellera-Garcia
2016-06-01
Full Text Available Erythroid cell commitment and differentiation proceed through activation of a lineage-restricted transcriptional network orchestrated by a group of well characterized genes. However, the minimal set of factors necessary for instructing red blood cell (RBC development remains undefined. We employed a screen for transcription factors allowing direct lineage reprograming from fibroblasts to induced erythroid progenitors/precursors (iEPs. We show that Gata1, Tal1, Lmo2, and c-Myc (GTLM can rapidly convert murine and human fibroblasts directly to iEPs. The transcriptional signature of murine iEPs resembled mainly that of primitive erythroid progenitors in the yolk sac, whereas addition of Klf1 or Myb to the GTLM cocktail resulted in iEPs with a more adult-type globin expression pattern. Our results demonstrate that direct lineage conversion is a suitable platform for defining and studying the core factors inducing the different waves of erythroid development.
Kabel, Ahmed M; Omar, Mohamed S; Alhadhrami, A; Alharthi, Salman S; Alrobaian, Majed M
2018-05-01
Our aim was to assess the effect of different doses of linagliptin with or without l-dopa/Carbidopa on 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced parkinsonism in mice. Eighty Balb/c mice were divided into 8 equal groups: Control; MPTP; MPTP + l-dopa/Carbidopa; MPTP + linagliptin 3 mg/kg/day; MPTP + linagliptin 10 mg/kg/day; MPTP + Carboxymethyl cellulose; MPTP + l-dopa/Carbidopa + linagliptin 3 mg/kg/day and MPTP + l-dopa/Carbidopa + linagliptin 10 mg/kg/day. Striatal dopamine, tumor necrosis factor alpha (TNF-α), interleukin 10 (IL-10), transforming growth factor beta 1 (TGF-β1), toll-like receptor 4 (TLR4), antioxidant enzymes, adenosine triphosphate (ATP), glucagon-like peptide-1 (GLP-1), receptors of advanced glycation end products (RAGE), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), heme oxygenase-1 (HO-1), mitochondrial complex I activity, catalepsy and total swim scores were measured. Also, the substantia nigra was subjected to immunohistochemical examination. The combination of l-dopa/Carbidopa and linagliptin in a dose-dependent manner resulted in significant improvement of the behavioural changes, striatal dopamine, antioxidant parameters, Nrf2/HO-1 content, GLP-1, ATP and mitochondrial complex I activity with significant decrease in striatal RAGE, TGF-β1, TNF-α, IL-10, TLR4 and alleviated the immunohistochemical changes better than the groups that received either l-dopa/Carbidopa or linagliptin alone. The combination of l-dopa/Carbidopa and linagliptin might represent a promising therapeutic modality for management of parkinsonism. Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Christine A. Houghton
2016-01-01
Full Text Available The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2, comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements.
Wang, Chun-Yan; Xu, Ye; Wang, Xu; Guo, Chuang; Wang, Tao; Wang, Zhan-You
2018-04-25
Oxidative stress and neuroinflammation play important roles in the pathology of Alzheimer's disease (AD). Thioredoxin-interacting protein (TXNIP), an endogenous inhibitor of antioxidant thioredoxin, is suspected to be an important modulator of oxidative stress and inflammation. However, the underlying mechanism involved in the abnormal homeostasis of TXNIP-thioredoxin (TrX) in AD pathogenesis remains unclear. Using the Swedish mutant form of APP (APPswe)/PSEN1dE9 transgenic mouse (APP/PS1) and human-derived neuronal cells as model systems, we disclosed the impairment of the nuclear factor erythroid 2-related factor 2 (Nrf2)-TXNIP-TrX signaling in Alzheimer's-like pathology. We observed that the immune staining of TXNIP was increased in postmortem AD brain. The chronic accumulation of inflammatory mediator in neuronal cells facilitates interactions of TXNIP-nucleotide binding oligomerization domain-like receptor family, pyrin domain containing 3 (NLRP3) and NLRP3-ASC, which increases β-amyloid (Aβ) secretion. The antioxidant Dl-3-n-butylphthalide (Dl-NBP) is commonly used for cerebral ischemia treatment. In our study, we elucidated for new mechanisms by which Dl-NBP enhanced TrX activity, suppressed TXNIP, and ameliorated neuronal apoptosis in the APP/PS1 mouse brains. In human glioblastoma A172 cells and neuroblastoma SH-SY5Y cells, we delineated the Dl-NBP-mediated signaling pathways by which Dl-NBP-dependent upregulation of Nrf2 mediated the reciprocal regulation of reducing proinflammatory cytokine and inhibiting Aβ production in the glial and neuronal cells overexpressing APPswe. Our data provide a novel insight into the molecular mechanism that impairments of Nrf2-TXNIP-TrX system may be involved in the imbalance of cellular redox homeostasis and inflammatory damage in the AD brain. Dl-NBP treatment could suppress TXNIP-NLRP3 interaction and inhibit NLRP3 inflammasome activation via upregulating Nrf2. These findings may provide an instrumental therapeutic
Erythroid cells in vitro: from developmental biology to blood transfusion products.
Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni
2009-07-01
Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.
Directory of Open Access Journals (Sweden)
Karina Sánchez-Reyes
2014-01-01
Full Text Available Cervical cancer (CC is the second most common cancer among women worldwide. Infection with human papillomavirus (HPV is the main risk factor for developing CC. Macrophages are important immune effector cells; they can be differentiated into two phenotypes, identified as M1 (classically activated and M2 (alternatively activated. Macrophage polarization exerts profound effects on the Toll-like receptor (TLR profile. In this study, we evaluated whether the supernatant of human CC cells HeLa, SiHa, and C-33A induces a shift of M1 macrophage toward M2 macrophage in U937-derived macrophages. Results. The results showed that soluble factors secreted by CC cells induce a change in the immunophenotype of macrophages from macrophage M1 into macrophage M2. U937-derived macrophages M1 released proinflammatory cytokines and nitric oxide; however, when these cells were treated with the supernatant of CC cell lines, we observed a turnover of M1 toward M2. These cells increased CD163 and IL-10 expression. The expression of TLR-3, -7, and -9 is increased when the macrophages were treated with the supernatant of CC cells. Conclusions. Our result strongly suggests that CC cells may, through the secretion of soluble factors, induce a change of immunophenotype M1 into M2 macrophages.
International Nuclear Information System (INIS)
Goda, Natsuko; Tenno, Takeshi; Inomata, Kosuke; Shirakawa, Masahiro; Tanaka, Toshiki; Hiroaki, Hidekazu
2008-01-01
Insulin-like growth factor binding proteins (IGFBPs) have various IGF-independent cellular activities, including receptor-independent cellular uptake followed by transcriptional regulation, although mechanisms of cellular entry remain unclear. Herein, we focused on their receptor-independent cellular entry mechanism in terms of protein transduction domain (PTD) activity, which is an emerging technique useful for clinical applications. The peptides of 18 amino acid residues derived from IGFBP-3 and IGFBP-5, which involve heparin-binding regions, mediated cellular delivery of an exogenous protein into NIH3T3 and HeLa cells. Relative protein delivery activities of IGFBP-3/5-derived peptides were approximately 20-150% compared to that of the HIV-Tat peptide, a potent PTD. Heparin inhibited the uptake of the fusion proteins with IGFBP-3 and IGFBP-5, indicating that the delivery pathway is heparin-dependent endocytosis, similar to that of HIV-Tat. The delivery of GST fused to HIV-Tat was competed by either IGFBP-3 or IGFBP-5-derived synthetic peptides. Therefore, the entry pathways of the three PTDs are shared. Our data has shown a new approach for designing protein delivery systems using IGFBP-3/5 derived peptides based on the molecular mechanisms of IGF-independent activities of IGFBPs
Ghosh, Debolina; LeVault, Kelsey R; Brewer, Gregory J
2014-01-01
To determine whether glutathione (GSH) loss or increased reactive oxygen species (ROS) are more important to neuron loss, aging, and Alzheimer's disease (AD), we stressed or boosted GSH levels in neurons isolated from aging 3xTg-AD neurons compared with those from age-matched nontransgenic (non-Tg) neurons. Here, using titrating with buthionine sulfoximine, an inhibitor of γ-glutamyl cysteine synthetase (GCL), we observed that GSH depletion increased neuronal death of 3xTg-AD cultured neurons at increasing rates across the age span, whereas non-Tg neurons were resistant to GSH depletion until old age. Remarkably, the rate of neuron loss with ROS did not increase in old age and was the same for both genotypes, which indicates that cognitive deficits in the AD model were not caused by ROS. Therefore, we targeted for neuroprotection activation of the redox sensitive transcription factor, nuclear erythroid-related factor 2 (Nrf2) by 18 alpha glycyrrhetinic acid to stimulate GSH synthesis through GCL. This balanced stimulation of a number of redox enzymes restored the lower levels of Nrf2 and GCL seen in 3xTg-AD neurons compared with those of non-Tg neurons and promoted translocation of Nrf2 to the nucleus. By combining the Nrf2 activator together with the NADH precursor, nicotinamide, we increased neuron survival against amyloid beta stress in an additive manner. These stress tests and neuroprotective treatments suggest that the redox environment is more important for neuron survival than ROS. The dual neuroprotective treatment with nicotinamide and an Nrf2 inducer indicates that these age-related and AD-related changes are reversible. Copyright © 2014 Elsevier Inc. All rights reserved.
Xiang, Yang; Yan, Chao; Guo, Xiaolong; Zhou, Kaifeng; Li, Sheng'an; Gao, Qian; Wang, Xuan; Zhao, Feng; Liu, Jie; Lee, Wen-Hui; Zhang, Yun
2014-05-06
Aerolysins are virulence factors belonging to the bacterial β-pore-forming toxin superfamily. Surprisingly, numerous aerolysin-like proteins exist in vertebrates, but their biological functions are unknown. βγ-CAT, a complex of an aerolysin-like protein subunit (two βγ-crystallin domains followed by an aerolysin pore-forming domain) and two trefoil factor subunits, has been identified in frogs (Bombina maxima) skin secretions. Here, we report the rich expression of this protein, in the frog blood and immune-related tissues, and the induction of its presence in peritoneal lavage by bacterial challenge. This phenomena raises the possibility of its involvement in antimicrobial infection. When βγ-CAT was administrated in a peritoneal infection model, it greatly accelerated bacterial clearance and increased the survival rate of both frogs and mice. Meanwhile, accelerated Interleukin-1β release and enhanced local leukocyte recruitments were determined, which may partially explain the robust and effective antimicrobial responses observed. The release of interleukin-1β was potently triggered by βγ-CAT from the frog peritoneal cells and murine macrophages in vitro. βγ-CAT was rapidly endocytosed and translocated to lysosomes, where it formed high molecular mass SDS-stable oligomers (>170 kDa). Lysosomal destabilization and cathepsin B release were detected, which may explain the activation of caspase-1 inflammasome and subsequent interleukin-1β maturation and release. To our knowledge, these results provide the first functional evidence of the ability of a host-derived aerolysin-like protein to counter microbial infection by eliciting rapid and effective host innate immune responses. The findings will also largely help to elucidate the possible involvement and action mechanisms of aerolysin-like proteins and/or trefoil factors widely existing in vertebrates in the host defense against pathogens.
FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia
International Nuclear Information System (INIS)
Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K
2011-01-01
The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6
Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming
2017-05-01
Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.
Czech Academy of Sciences Publication Activity Database
Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.
2007-01-01
Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007
von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.
1999-01-01
Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors
Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki
2011-06-01
Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.
Directory of Open Access Journals (Sweden)
Ikuta T
2013-12-01
Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to
Saha, Debarchana; Koli, Swanand; Reddy, Kudumula Venkata Rami
2017-06-01
Hemoglobin (Hb), a major protein involved in transport of oxygen (O 2 ), is expressed by erythroid lineages. Until recently, it was not known whether non-erythroid cells express Hb. The objective was to evaluate the expression and functional significance of Hb-α and Hb-β in human primary vaginal epithelial cells (hPVECs) and decipher downstream signaling. RT-PCR, qRT-PCR, flow cytometry, Western blot, immunofluorescence were used to evaluate the expression of Hb-α, Hb-β, and nuclear factor E2-related factor-2(Nrf2) after hydrogen peroxide (H 2 O 2 ) induction. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay were used to determine the binding efficiency of Nrf2 on the Hb-α promoter. Stimulation of hPVECs and human vaginal epithelial cell line, VK2/E6E7 with H 2 O 2 augmented the expression of Hb-α, Hb-β, Nrf2, heme oxygenase-1 (HO-1), and reactive oxygen species (ROS). Treatment of these cells with Nrf2 inhibitor, trigonelline (Trig) inhibited Hb-α and Hb-β expressions. Hb-α and Hb-β overexpression downregulated H 2 O 2 -induced ROS. The presence of Nrf2 binding domain was demonstrated within Hb-α promoter. The results revealed for the first time that Hb-α and Hb-β were induced by oxidative stress through the activation of Nrf2. Overexpression of Hb-α and Hb-β ameliorated H 2 O 2 -induced oxidative stress, indicating one of the possible mechanism(s) to protect hPVECS from oxidative stress. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Derivation of corneal endothelial cell-like cells from rat neural crest cells in vitro.
Directory of Open Access Journals (Sweden)
Chengqun Ju
Full Text Available The aim of this study was to investigate the feasibility of inducing rat neural crest cells (NCC to differentiate to functional corneal endothelial cell (CEC-like cells in vitro. Rat NCC were induced with adult CEC-derived conditioned medium. Immunofluorescence, flow cytometry and real time RT-PCR assay were used to detect expression of the corneal endothelium differentiation marker N-cadherin and transcription factors FoxC1 and Pitx2. CFDA SE-labeled CEC-like cells were transplanted to the corneal endothelium of a rat corneal endothelium deficiency model, and an eye-down position was maintained for 24 hours to allow cell attachment. The animals were observed for as long as 2 months after surgery and underwent clinical and histological examination. Spindle-like NCC turned to polygonal CEC-like after induction and expressed N-cadherin, FoxC1, Pitx2, zonula occludens-1 and sodium-potassium pump Na(+/K(+ ATPase. The corneas of the experimental group were much clearer than those of the control group and the mean corneal thickness in the experimental group was significantly less than in the control group7, 14, 21 and 28 days after surgery. Confocal microscopy through focusing and histological analysis confirmed that green fluorescence-positive CEC-like cells formed a monolayer covering the Descemet's membrane in the experimental group. In conclusion, CEC-like cells derived from NCCs displayed characters of native CEC, and the induction protocol provides guidance for future human CEC induction from NCC.
Mori, Yoshikazu; Hirokawa, Takatsugu; Aoki, Katsuyuki; Satomi, Hisanori; Takeda, Shuichi; Aburada, Masaki; Miyamoto, Ken-ichi
2008-05-01
We previously reported a quinoxalin-2-one compound (Compound 1) that had inhibitory activity equivalent to existing platelet-derived growth factor-beta receptor (PDGFbeta R) inhibitors. Lead optimization of Compound 1 to increase its activity and selectivity, using structural information regarding PDGFbeta R-ligand interactions, is urgently needed. Here we present models of the PDGFbeta R kinase domain complexed with quinoxalin-2-one derivatives. The models were constructed using comparative modeling, molecular dynamics (MD) and ligand docking. In particular, conformations derived from MD, and ligand binding site information presented by alpha-spheres in the pre-docking processing, allowed us to identify optimal protein structures for docking of target ligands. By carrying out molecular modeling and MD of PDGFbeta R in its inactive state, we obtained two structural models having good Compound 1 binding potentials. In order to distinguish the optimal candidate, we evaluated the structural activity relationships (SAR) between the ligand-binding free energies and inhibitory activity values (IC50 values) for available quinoxalin-2-one derivatives. Consequently, a final model with a high SAR was identified. This model included a molecular interaction between the hydrophobic pocket behind the ATP binding site and the substitution region of the quinoxalin-2-one derivatives. These findings should prove useful in lead optimization of quinoxalin-2-one derivatives as PDGFb R inhibitors.
Directory of Open Access Journals (Sweden)
Ryo Kurita
Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.
THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA
DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
1994-01-01
Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using
Prospective identification of erythroid elements in cultured peripheral blood.
Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P
1999-04-01
We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.
Directory of Open Access Journals (Sweden)
A KHoramroodi
2009-10-01
Full Text Available Introduction & Objective: Umbilical cord blood (UCB is a source of Hematopoietic Stem Cells (HSC and progenitor cells that can reconstitute the hematopoietic system in patients with malignant and nonmalignant disorders. Mesenchymal stem cell-derived from umbilical cord blood (UCB have been differentiated to some kind of cells, such as osteobblast, adipoblast and chondroblast in Vitro. This study examined the differentiation of Umbilical Cord Blood (UCB derived stem cells to functional hepatocytes. Materials & Methods: The present study was an experimental study which was carried out in the Payam-e-Noor University of Tehran in cooperation with Hamedan University of Medical Sciences in 2008. Umbilical cord blood (UCB was obtained from Fatemieh hospital (Hamadan, Iran. Stem cells were isolated from the cord blood by combining density gradient centrifugation with plastic adherence. When the isolated cells reached 80% confluence, they differentiated to hepatocyte like cells. The medium which was used was consists of DMEM and 10% Fetal Bovine Serum (FBS supplemented with 20 ng/mL Hepatocyte Growth Factor (HGF, 10 ng/mL basic Fibroblast Growth Factor (bFGF and 20 ng/mL Oncostatin M (OSM.The medium was changed every 3 days and stored for Albumin (ALB, Alpha Fetoprotein (AFP, Alkaline Phosphatase (ALP, and urea assay. Finally PAS stain was done to study Glycogen storage in the differentiated cell. Results: Measurement of biochemical factors in different days showed that concentration of albumin (ALB, alpha fetoprotein (AFP, alkaline phosphatase (ALP, and Urea gradually increased. Also, PAS staining showed the storage of glycogen in these cells. Conclusion: Stem cell-derived from human umbilical cord blood (HUCB is a new source of cell types for cell transplantation therapy of hepatic diseases and under certain conditions these cells can differentiate into liver cells.
Ulu, Ramazan; Gozel, Nevzat; Tuzcu, Mehmet; Orhan, Cemal; Yiğit, İrem Pembegül; Dogukan, Ayhan; Telceken, Hafize; Üçer, Özlem; Kemeç, Zeki; Kaman, Dilara; Juturu, Vijaya; Sahin, Kazim
2018-05-31
In the present study, we evaluated the effects of M. pruriens administration on metabolic parameters, oxidative stress and kidney nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and nuclear factor (erythroid-derived 2)-like 2 (Nrf2) signaling pathways in high-fructose fed rats. Male rats (n = 28) were divided into 4 groups as control, M. pruriens, fructose, and M. pruriens plus fructose. All rats were fed a standard diet supplemented or no supplemented with M. pruriens (200 mg/kg/d by gavage). Fructose was given in drinking water for 8 weeks. High fructose consumption led to an increase in the serum level of glucose, triglyceride, urea and renal malondialdehyde (MDA) levels. Although M. pruriens treatment reduced triglyceride and MDA levels, it did not affect other parameters. M. pruriens supplementation significantly decreased the expression of NF-ҡB and decreased expression of Nrf2 and HO-1 proteins in the kidney. This study showed that the adverse effects of high fructose were alleviated by M. pruriens supplementation via modulation of the expression of kidney nuclear transcription factors in rats fed high fructose diet. Copyright © 2018 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Yamada, Yoji; Sakurada, Kazuhiro; Takeda, Yukiji; Gojo, Satoshi; Umezawa, Akihiro
2007-01-01
Bone marrow-derived stromal cells can give rise to cardiomyocytes as well as adipocytes, osteocytes, and chondrocytes in vitro. The existence of mesenchymal stem cells has been proposed, but it remains unclear if a single-cell-derived stem cell stochastically commits toward a cardiac lineage. By single-cell marking, we performed a follow-up study of individual cells during the differentiation of 9-15c mesenchymal stromal cells derived from bone marrow cells. Three types of cells, i.e., cardiac myoblasts, cardiac progenitors and multipotent stem cells were differentiated from a single cell, implying that cardiomyocytes are generated stochastically from a single-cell-derived stem cell. We also demonstrated that overexpression of Csx/Nkx2.5 and GATA4, precardiac mesodermal transcription factors, enhanced cardiomyogenic differentiation of 9-15c cells, and the frequency of cardiomyogenic differentiation was increased by co-culturing with fetal cardiomyocytes. Single-cell-derived mesenchymal stem cells overexpressing Csx/Nkx2.5 and GATA4 behaved like cardiac transient amplifying cells, and still retained their plasticity in vivo
Directory of Open Access Journals (Sweden)
Shin-ichi Kawaguchi
2018-04-01
Full Text Available Induction of a series of anti-hypoxic proteins protects cells during exposure to hypoxic conditions. Hypoxia-inducible factor-α (HIF-α is a major transcription factor that orchestrates this protective effect. To activate HIF exogenously, without exposing cells to hypoxic conditions, many small-molecule inhibitors targeting prolyl hydroxylase domain-containing protein have been developed. In addition, suppression of factor inhibiting HIF-1 (FIH-1 has also been shown to have the potential to activate HIF-α. However, few small-molecule inhibitors of FIH-1 have been developed. In this study, we synthesized a series of furan- and thiophene-2-carbonyl amino acid derivatives having the potential to inhibit FIH-1. The inhibitory activities of these compounds were evaluated in SK-N-BE(2c cells by measuring HIF response element (HRE promoter activity. Several furan- and thiophene-2-carbonyl amino acid derivatives inhibited FIH-1 based on correlations among the docking score of the FIH-1 active site, the chemical structure of the compounds, and biological HIF-α/HRE transcriptional activity.
Directory of Open Access Journals (Sweden)
Luo C
2016-11-01
Full Text Available Chun Luo,1,* Yuting Ke,1,* Yanyan Yuan,1 Ming Zhao,1 Fuyan Wang,1 Yisheng Zhang,2 Shizhong Bu1 1Runliang Diabetes Laboratory, Diabetes Research Center, Ningbo University, 2Department of Gynaecology and Obstetrics, Ningbo Medical Center, Li Huili Eastern Hospital, Ningbo, Zhejiang, People’s Republic of China *These authors contributed equally to this work Background: Radix Puerariae and hawthorn fruit have been demonstrated to treat diabetes. They offer potential benefits for preventing depression in diabetes. Objective: The aim of this study was to investigate whether the combination of Radix Puerariae and hawthorn fruit (CRPHF could prevent depression in a diabetic rat model generated by feeding the rats with a high-fat diet and a low-dose streptozotocin (STZ. Methods: The CRPHF was provided by the Shanghai Chinese Traditional Medical University. Twenty-four rats were randomly divided into four groups: normal control, normal-given-CRPHF (NC, diabetic control, and diabetic-given-CRPHF (DC groups. The type 2 diabetic model was created by feeding the rats with a high-fat diet for 4 weeks followed by injection of 25 mg/kg STZ. CRPHF was given at 2 g/kg/d to the rats of NC and DC groups by intragastric gavage daily for 4 weeks after the type 2 diabetic model was successfully created. Body weight, random blood glucose (RBG, oral glucose tolerance test, total cholesterol (TC, triglyceride (TG, high-density lipoprotein cholesterol (HDL-C, and low-density lipoprotein cholesterol (LDL-C were measured during the study. Depressive-like behavior was evaluated at the end of the treatment by using the open field test (OFT, the elevated plus-maze test (EPMT, locomotor activity test (LAT, and forced swimming test (FST. Levels of extracellular signal-regulated protein kinase (ERK and brain-derived neurotrophic factor (BDNF in the prefrontal cortex were evaluated by using Western blot. Results: 1 CRPHF reduced RBG and improved glucose tolerance in diabetic rats
Brain-derived neurotrophic factor (BDNF) and type 2 diabetes
DEFF Research Database (Denmark)
Krabbe, K. S.; Nielsen, A. R.; Krogh-Madsen, R.
2006-01-01
Aims/hypothesis Decreased levels of brain-derived neurotrophic factor (BDNF) have been implicated in the pathogenesis of Alzheimer's disease and depression. These disorders are associated with type 2 diabetes, and animal models suggest that BDNF plays a role in insulin resistance. We therefore...... explored whether BDNF plays a role in human glucose metabolism. Subjects and methods We included (Study 1) 233 humans divided into four groups depending on presence or absence of type 2 diabetes and presence or absence of obesity; and (Study 2) seven healthy volunteers who underwent both a hyperglycaemic...... and a hyperinsulinaemic-euglycaemic clamp. Results Plasma levels of BDNF in Study 1 were decreased in humans with type 2 diabetes independently of obesity. Plasma BDNF was inversely associated with fasting plasma glucose, but not with insulin. No association was found between the BDNF G196A (Val66Met) polymorphism...
Directory of Open Access Journals (Sweden)
Jozef Madzo
2014-01-01
Full Text Available Hematopoietic stem cell differentiation involves the silencing of self-renewal genes and induction of a specific transcriptional program. Identification of multiple covalent cytosine modifications raises the question of how these derivatized bases influence stem cell commitment. Using a replicative primary human hematopoietic stem/progenitor cell differentiation system, we demonstrate dynamic changes of 5-hydroxymethylcytosine (5-hmC during stem cell commitment and differentiation to the erythroid lineage. Genomic loci that maintain or gain 5-hmC density throughout erythroid differentiation contain binding sites for erythroid transcription factors and several factors not previously recognized as erythroid-specific factors. The functional importance of 5-hmC was demonstrated by impaired erythroid differentiation, with augmentation of myeloid potential, and disrupted 5-hmC patterning in leukemia patient-derived CD34+ stem/early progenitor cells with TET methylcytosine dioxygenase 2 (TET2 mutations. Thus, chemical conjugation and affinity purification of 5-hmC-enriched sequences followed by sequencing serve as resources for deciphering functional implications for gene expression during stem cell commitment and differentiation along a particular lineage.
Pilar-Cuéllar, F; Vidal, R; Pazos, A
2012-02-01
5-HT(2A) receptor antagonists improve antidepressant responses when added to 5-HT-selective reuptake inhibitors (SSRIs) or tricyclic antidepressants. Here, we have studied the involvement of neuroplasticity pathways and/or the 5-hydroxytryptaminergic system in the antidepressant-like effect of this combined treatment, given subchronically. Expression of brain-derived neurotrophic factor (BDNF) and its receptor (TrkB), 5-bromo-2'-deoxyuridine (BrdU) incorporation, and β-catenin protein expression in different cellular fractions, as well as 5-HT(1A) receptor function were measured in the hippocampus of rats treated with fluoxetine, ketanserin and fluoxetine + ketanserin for 7 days, followed by a forced swimming test (FST) to analyse antidepressant efficacy. mRNA for BDNF was increased in the CA3 field and dentate gyrus of the hippocampus by combined treatment with fluoxetine + ketanserin. Expression of β-catenin was increased in total hippocampal homogenate and in the membrane fraction, but unchanged in the nuclear fraction after combined treatment with fluoxetine + ketanserin. These effects were paralleled by a decreased immobility time in the FST. There were no changes in BrdU incorporation, TrkB expression and 5-HT(1A) receptor function in any of the groups studied. The antidepressant-like effect induced by subchronic co-treatment with a SSRI and a 5-HT(2A) receptor antagonist may mainly be because of modifications in hippocampal neuroplasticity (BDNF and membrane-associated β-catenin), without a significant role for other mechanisms involved in chronic antidepressant response, such as hippocampal neuroproliferation or 5-HT(1A) receptor desensitization in the dorsal raphe nucleus. © 2011 The Authors. British Journal of Pharmacology © 2011 The British Pharmacological Society.
Directory of Open Access Journals (Sweden)
Doaa Aboalola
2017-01-01
Full Text Available Insulin-like growth factors (IGFs are critical components of the stem cell niche, as they regulate proliferation and differentiation of stem cells into different lineages, including skeletal muscle. We have previously reported that insulin-like growth factor binding protein-6 (IGFBP-6, which has high affinity for IGF-2, alters the differentiation process of placental mesenchymal stem cells (PMSCs into skeletal muscle. In this study, we determined the roles of IGF-1 and IGF-2 and their interactions with IGFBP-6. We showed that IGF-1 increased IGFBP-6 levels within 24 hours but decreased after 3 days, while IGF-2 maintained higher levels of IGFBP-6 throughout myogenesis. IGF-1 increased IGFBP-6 in the early phase as a requirement for muscle commitment. In contrast, IGF-2 enhanced muscle differentiation as shown by the expression of muscle differentiation markers MyoD, MyoG, and MHC. IGF-1 and IGF-2 had different effects on muscle differentiation with IGF-1 promoting early commitment to muscle and IGF-2 promoting complete muscle differentiation. We also showed that PMSCs acquired increasing capacity to synthesize IGF-2 during muscle differentiation, and the capacity increased as the differentiation progressed suggesting an autocrine and/or paracrine effect. Additionally, we demonstrated that IGFBP-6 could enhance the muscle differentiation process in the absence of IGF-2.
Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice
Directory of Open Access Journals (Sweden)
Ibrahim Mansur
2016-01-01
Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.
Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S
2015-07-01
Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.
Transcription factor 7-like 2 gene links increased in vivo insulin synthesis to type 2 diabetes
S. Jainandunsing (Sjaam); Koole, H.R. (H. Rita); van Miert, J.N.I. (Joram N.I.); T. Rietveld (Trinet); J.L.D. Wattimena (Josias); E.J.G. Sijbrands (Eric); F.W.M. de Rooij (Felix)
2018-01-01
textabstractTranscription factor 7-like 2 (TCF7L2) is the main susceptibility gene for type 2 diabetes, primarily through impairing the insulin secretion by pancreatic β cells. However, the exact in vivo mechanisms remain poorly understood. We performed a family study and determined if the T risk
International Nuclear Information System (INIS)
Gardner, L.C.; Cox, T.M.
1988-01-01
Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation
DEFF Research Database (Denmark)
Pedersen, Bente K; Pedersen, Maria; Krabbe, Karen S
2009-01-01
identifies BDNF as a player not only in central metabolism, but also in regulating energy metabolism in peripheral organs. Low levels of BDNF are found in patients with neurodegenerative diseases, including Alzheimer's disease and major depression. In addition, BDNF levels are low in obesity...... and independently so in patients with type 2 diabetes. Brain-derived neurotrophic factor is expressed in non-neurogenic tissues, including skeletal muscle, and exercise increases BDNF levels not only in the brain and in plasma, but in skeletal muscle as well. Brain-derived neurotrophic factor mRNA and protein...... diabetes may explain the clustering of these diseases. Brain-derived neurotrophic factor is likely to mediate some of the beneficial effects of exercise with regard to protection against dementia and type 2 diabetes....
Abdelwahed, O M; Tork, O M; Gamal El Din, M M; Rashed, L; Zickri, M
2018-02-05
Brain derived neurotrophic factor (BDNF) is one of the most essential neurotrophic factors in the brain. BDNF is involved in learning, memory and locomotion suggesting it as a target in type 2 diabetes mellitus (T2DM) associated cognitive changes. Visfatin; an adipokine discovered to be expressed in the brain; was found to have multiple effects including its participation in keeping energy supply to the cell and is consequentially involved in cell survival. Its role in cognitive functions in T2DM was not studied before. Recent studies point to the possible neuro-protective mechanisms of glucagon-like peptide 1 analogue: Exendin-4 (Ex-4) in many cognitive disorders, but whether BDNF or Visfatin are involved or not in its neuro-protective mechanisms; is still unknown. to study the changes in cognitive functions in T2DM, either not treated or treated with Glucagon-like peptide 1 (GLP-1) analogue: Ex-4, and to identify the possible underlying mechanisms of these changes and whether BDNF and brain Visfatin are involved. A total of 36 adult male wistar albino rats were divided into 4 groups; Control, Exendin-4 control, Diabetic and Exendin-4 treated groups. At the end of the study, Y-maze and open field tests were done the day before scarification to assess spatial working memory and locomotion, respectively. Fasting glucose and insulin, lipid profile and tumor necrosis factor- alpha (TNF-α) were measured in the serum. Homeostasis model assessment insulin resistance was calculated. In the brain tissue, malondialdehyde (MDA) level, gene expression and protein levels of BDNF and Visfatin, area of degenerated neurons, area of glial cells and area % of synaptophysin immunoexpression were assessed. Compared with the control, the untreated diabetic rats showed insulin resistance, dyslipidemia and elevation of serum TNF-α. The brain tissue showed down-regulation of BDNF gene expression and reduction of its protein level, up-regulation of Visfatin gene expression and elevation
Detection of trans-acting factors for hemoglobin switching by cell fusions
International Nuclear Information System (INIS)
Broyles, R.H.; Palmer, J.C.; Smith, D.J.; Ramseyer, T.H.
1986-01-01
The authors have devised protocols for chemically fusing erythroid cells from amphibians of different developmental stages, so that we may study the short-term effects of trans-acting factors on globin gene expression. The authors are performing both homospecifc (Rana x Rana) and heterospecific (Rana x Xenopus) fusions; and they are detecting the expression of specific globin genes with selective radioactive labeling ( 35 S-methionine is incorporated only into adult globins), polyacrylamide gel electrophoresis, monospecific antisera, and cDNA probes that are species-and developmental stage-specific. Their results indicate that: (1) there are factors in tadpole erythroblasts that can reactivate adult Hb synthesis in mature, synthetically-inactive adult RBCs; (2) there are factors in tadpole erythroblasts that can reactivate tadpole globin genes in adult RBCs; and (3) there are factors in adult erythroid cells that apparently activate adult globin genes in tadpole RBCs. These results suggests that erythroid cells from animals of different developmental stages possess different sets of globin gene-specific trans-acting factors which can be studied with a system that exhibits normal developmental Hb switching
LENUS (Irish Health Repository)
Cooley, Sharon M
2010-07-01
To investigate the relationship between levels of insulin-like growth factors 1 and 2 (IGF-1, IGF-2) and insulin-like growth factor binding protein 3 (IGFBP-3) in antenatal maternal serum and gestational hypertension and pre-eclampsia (PET).
Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun; Oh, Won Keun
2017-01-01
Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata , and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (A β ) 42 -induced microglial activation related to Nrf2 and nuclear factor κ B (NF- κ B)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular A β 42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1 β , prostaglandin (PG)E 2 , and nitric oxide (NO) because of artificial phagocytic A β 42 . It decreased pNF- κ B accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits A β 42 -overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.
Directory of Open Access Journals (Sweden)
Ji Yeon Seo
2017-01-01
Full Text Available Therapeutic approach of Alzheimer’s disease (AD has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1/nuclear factor (erythroid-derived 2-like 2 (Nrf2-mediated heme oxygenase (HO-1-inducing effects and the inhibitory activity of amyloid beta (Aβ42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL-6, IL-1β, prostaglandin (PGE2, and nitric oxide (NO because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS and cyclooxygenase II (COX-II in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.
Mauck, Catherine M; Hartnett, Patrick E; Margulies, Eric A; Ma, Lin; Miller, Claire E; Schatz, George C; Marks, Tobin J; Wasielewski, Michael R
2016-09-14
Singlet fission (SF) in polycrystalline thin films of four 3,6-bis(thiophen-2-yl)diketopyrrolopyrrole (TDPP) chromophores with methyl (Me), n-hexyl (C6), triethylene glycol (TEG), and 2-ethylhexyl (EH) substituents at the 2,5-positions is found to involve an intermediate excimer-like state. The four different substituents yield four distinct intermolecular packing geometries, resulting in variable intermolecular charge transfer (CT) interactions in the solid. SF from the excimer state of Me, C6, TEG, and EH takes place in τSF = 22, 336, 195, and 1200 ps, respectively, to give triplet yields of 200%, 110%, 110%, and 70%, respectively. The transient spectra of the excimer-like state and its energetic proximity to the lowest excited singlet state in these derivatives suggests that this state may be the multiexciton (1)(T1T1) state that precedes formation of the uncorrelated triplet excitons. The excimer decay rates correlate well with the SF efficiencies and the degree of intermolecular donor-acceptor interactions resulting from π-stacking of the thiophene donor of one molecule with the DPP core acceptor in another molecule as observed in the crystal structures. Such interactions are found to also increase with the SF coupling energies, as calculated for each derivative. These structural and spectroscopic studies afford a better understanding of the electronic interactions that enhance SF in chromophores having strong intra- and intermolecular CT character.
Modulating Leukemia-Initiating Cell Quiescence to Improve Leukemia Treatment
2015-09-01
T- cells and in innate immunity (Lacorazza et al., 2002). It controls the proliferation and homing of CD8+ T- cells via the Kruppel-like factors...Lin2Sca12IL7R2Kit1FccRII/ IIIhighCD34high), megakaryocyte-erythroid progenitor cell (MEP) (Lin2Sca12IL7R2Kit1FccRII/IIIlowCD34low), and common lymphoid ...to this model, the first wave gives rise exclusively to innate immune B cells in early embryonic life and may be derived from progenitor cells
Thomas, Dolly D.; Sommer, Andreia Gianotti; Balazs, Alejandro B.; Beerman, Isabel; Murphy, George J.; Rossi, Derrick; Mostoslavsky, Gustavo
2017-01-01
Hematopoietic stem cells (HSC) rely on a highly regulated molecular network to balance self-renewal and lineage specification to sustain life-long hematopoiesis. Despite a plethora of studies aimed at identifying molecules governing HSC fate, our current knowledge of the genes responsible is limited. We have found Insulin-like growth factor 2 (IGF2) to be predominantly expressed within long-term HSC. This study examines IGF2 expression patterns and the effects of the gene in HSC. Through the overexpression and knockdown of IGF2 within purified HSC, we demonstrate that IGF2 expression increases HSC-derived multilineage colonies in vitro and enhances hematopoietic contribution in vivo upon competitive bone marrow transplantation. The effects of IGF2 are mediated by direct upregulation of the CDKi p57, exclusively within long-term HSC, via activation of the PI3K-Akt pathway. Increased expression of p57 resulted in a concomitant increase of HSC in the G0/G1 stage of the cell cycle. Analysis of genomic DNA methylation revealed that HSC exhibited a hypomethylated state within the promoter region of the CDKN1C (p57) gene, providing a potential mechanism for the exclusive effects of IGF2 within HSC. Our studies demonstrate a novel role for IGF2 in regulating HSC cell cycle and illustrate potential novel therapeutic targets for hematological diseases. PMID:26872540
Fibroblast growth factor-2 stimulates adipogenic differentiation of human adipose-derived stem cells
International Nuclear Information System (INIS)
Kakudo, Natsuko; Shimotsuma, Ayuko; Kusumoto, Kenji
2007-01-01
Adipose-derived stem cells (ASCs) have demonstrated a capacity for differentiating into a variety of lineages, including bone, cartilage, or fat, depending on the inducing stimuli and specific growth and factors. It is acknowledged that fibroblast growth factor-2 (FGF-2) promotes chondrogenic and inhibits osteogenic differentiation of ASCs, but thorough investigations of its effects on adipogenic differentiation are lacking. In this study, we demonstrate at the cellular and molecular levels the effect of FGF-2 on adipogenic differentiation of ASCs, as induced by an adipogenic hormonal cocktail consisting of 3-isobutyl-1-methylxanthine (IBMX), dexamethasone, insulin, and indomethacin. FGF-2 significantly enhances the adipogenic differentiation of human ASCs. Furthermore, in cultures receiving FGF-2 before adipogenic induction, mRNA expression of peroxisome proliferator-activated receptor γ2 (PPARγ2), a key transcription factor in adipogenesis, was upregulated. The results of FGF-2 supplementation suggest the potential applications of FGF-2 and ASCs in adipose tissue regeneration
Tryptophan derivatives regulate the transcription of Oct4 in stem-like cancer cells.
Cheng, Jie; Li, Wenxin; Kang, Bo; Zhou, Yanwen; Song, Jiasheng; Dan, Songsong; Yang, Ying; Zhang, Xiaoqian; Li, Jingchao; Yin, Shengyong; Cao, Hongcui; Yao, Hangping; Zhu, Chenggang; Yi, Wen; Zhao, Qingwei; Xu, Xiaowei; Zheng, Min; Zheng, Shusen; Li, Lanjuan; Shen, Binghui; Wang, Ying-Jie
2015-06-10
The aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor that responds to environmental toxicants, is increasingly recognized as a key player in embryogenesis and tumorigenesis. Here we show that a variety of tryptophan derivatives that act as endogenous AhR ligands can affect the transcription level of the master pluripotency factor Oct4. Among them, ITE enhances the binding of the AhR to the promoter of Oct4 and suppresses its transcription. Reduction of endogenous ITE levels in cancer cells by tryptophan deprivation or hypoxia leads to Oct4 elevation, which can be reverted by administration with synthetic ITE. Consequently, synthetic ITE induces the differentiation of stem-like cancer cells and reduces their tumorigenic potential in both subcutaneous and orthotopic xenograft tumour models. Thus, our results reveal a role of tryptophan derivatives and the AhR signalling pathway in regulating cancer cell stemness and open a new therapeutic avenue to target stem-like cancer cells.
Yoon, Il-Sub; Park, Hyelim; Kwak, Hye-Won; Woo Jung, Yong; Nam, Jae-Hwan
2017-08-24
The level of antibody production induced by a vaccine involves a variety of host factors. One of these, insulin-like growth factor-1 (IGF-1), plays an important role in lymphocyte maturation and antibody expression. Here, we investigated the role of macrophage-derived IGF-1 in the induction of influenza vaccine-specific antibodies using macrophage-derived IGF-1 gene knockout (MIKO) mice. The titers of vaccine-specific total immunoglobulin G (IgG) and IgG1 after immunization were about two- to fourfold lower in MIKO mice than in WT mice. Moreover, MIKO mice showed a relatively weak booster effect of repeated immunization. In contrast, antigen-nonspecific total IgG was about threefold higher in MIKO mice than in WT mice. After viral challenge, the viral titer and the pathological damage in lungs of MIKO mice were higher than those in WT mice despite vaccination. Interestingly, the proportions of proinflammatory immune cells including M1 macrophages, Th1 and Th17 cells was higher in unvaccinated MIKO mice than in unvaccinated WT mice. This suggests that nonspecific activation of immune cells may paradoxically impair the response to the vaccine. In addition, although the proportions of T follicular helper (Tfh) cells and GL-7 + germinal center (GC) B cells were higher in MIKO mice than in WT mice, the population of CD138 + B220 + antibody-secreting plasmablasts was lower in MIKO mice, which may be a cause of the low influenza-specific antibody titer in MIKO mice. Taken together, these results suggest that macrophage-derived IGF-1 might play an important role in the vaccine-triggered immune response by regulating immune cell homeostasis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Xue-man Lv
2016-01-01
Full Text Available The optic nerve is a viscoelastic solid-like biomaterial. Its normal stress relaxation and creep properties enable the nerve to resist constant strain and protect it from injury. We hypothesized that stress relaxation and creep properties of the optic nerve change after injury. More-over, human brain-derived neurotrophic factor or umbilical cord blood-derived stem cells may restore these changes to normal. To validate this hypothesis, a rabbit model of optic nerve injury was established using a clamp approach. At 7 days after injury, the vitreous body re-ceived a one-time injection of 50 µg human brain-derived neurotrophic factor or 1 × 106 human umbilical cord blood-derived stem cells. At 30 days after injury, stress relaxation and creep properties of the optic nerve that received treatment had recovered greatly, with patho-logical changes in the injured optic nerve also noticeably improved. These results suggest that human brain-derived neurotrophic factor or umbilical cord blood-derived stem cell intervention promotes viscoelasticity recovery of injured optic nerves, and thereby contributes to nerve recovery.
Chatterjee, Anwesha; Ronghe, Amruta; Singh, Bhupendra; Bhat, Nimee K; Chen, Jie; Bhat, Hari K
2014-12-01
The objective of the present study was to characterize the role of resveratrol (Res) and vitamin C (VC) in prevention of estrogen-induced breast cancer through regulation of cap "n"collar (CNC) b-zip transcription factors. Human breast epithelial cell line MCF-10A was treated with 17β-estradiol (E2) and VC or Res with or without E2. mRNA and protein expression levels of CNC b-zip transcription factors nuclear factor erythroid 2-related factor 1 (Nrf1), nuclear factor erythroid 2 related factor 2 (Nrf2), nuclear factor erythroid 2 related factor 3 (Nrf3), and Nrf2-regulated antioxidant enzymes superoxide dismutase 3 (SOD3) and quinone oxidoreductase 1 (NQO1) were quantified. The treatment with E2 suppressed, whereas VC and Res prevented E2-mediated decrease in the expression levels of SOD3, NQO1, Nrf2 mRNA, and protein in MCF-10A cells. The treatment with E2, Res, or VC significantly increased mRNA and protein expression levels of Nrf1. 17β-Estradiol treatment significantly increased but VC or Res decreased Nrf3 mRNA and protein expression levels. Our studies demonstrate that estrogen-induced breast cancer might be prevented through upregulation of antioxidant enzymes via Nrf-dependent pathways. © 2014 Wiley Periodicals, Inc.
Mondal, Nandan Kumar; Saha, Hirak; Mukherjee, Bidisha; Tyagi, Neetu; Ray, Manas Ranjan
2018-01-24
The study was carried out to examine whether chronic exposure to smoke during daily household cooking with biomass fuel (BMF) elicits changes in airway cytology and expressions of Nrf2 (nuclear factor erythroid 2 [NF-E2]-related factor 2 [Nrf2]), Keap1 (Kelch-like erythroid-cell-derived protein with CNC homology [ECH]-associated protein 1), and NQO1 (NAD(P)H:quinone oxidoreductase 1) proteins in the airways. For this, 282 BMF-using women (median age 34 year) and 236 age-matched women who cooked with liquefied petroleum gas (LPG) were enrolled. Particulate matter with diameters of LPG. Compared with LPG users, BMF users had 32% more leukocytes in circulation and their sputa were 1.4-times more cellular with significant increase in absolute number of neutrophils, lymphocytes, eosinophils, and alveolar macrophages, suggesting airway inflammation. ROS generation was 1.5-times higher in blood neutrophils and 34% higher in sputum cells of BMF users while erythrocyte SOD was 31% lower and plasma catalase was relatively unchanged, suggesting oxidative stress. In BMF users, Keap1 expression was reduced, the percentage of AEC with nuclear expression of Nrf2 was two- to three-times more, and NQO1 level in sputum cell lysate was two-times higher than that of LPG users. In conclusion, cooking with BMF was associated with Nrf2 activation and elevated NQO1 protein level in the airways. The changes may be adaptive cellular response to counteract biomass smoke-elicited oxidative stress and inflammation-related tissue injury in the airways.
Directory of Open Access Journals (Sweden)
Nafiz Öncü Can
2018-03-01
Full Text Available Novel thiadiazole derivatives were synthesized through the reaction of acetylated 2-aminothiadiazole and piperazine derivatives. The chemical structures of the compounds were clarified by Infrared Spectroscopy (IR, 1H Nuclear Magnetic Resonance Spectroscopy (1H-NMR, 13C Nuclear Magnetic Resonance Spectroscopy (13C-NMR and Electronspray Ionisation Mass Spectroscopy (ESI-MS spectroscopic methods. Antidepressant-like activities were evaluated by the tail-suspension (TST and modified forced swimming (MFST methods. Besides, possible influence of the test compounds on motor activities of the animals were examined by activity cage tests. In the TST, administration of the compounds 2c, 2d, 2e, 2f, 2g and 2h significantly decreased the immobility time of mice regarding the control values. Further, in the MFST, the same compounds reduced the total number of immobility behaviors while increasing swimming performance. However, no change was observed in the total number of climbing behaviors. These data suggested that compounds 2c, 2d, 2e, 2f, 2g and 2h possess notable antidepressant-like activities. Reference drug fluoxetine (10 mg/kg was also exhibited its antidepressant activity, as expected. No significant difference was seen between the locomotor activity values of the test groups signifying that observed antidepressant-like activities are specific. Theoretical calculation of absorption, distribution, metabolism, excretion (ADME properties for the obtained compounds were performed and obtained data supported the antidepressant-like potential of these novel thiadiazole derivatives.
Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage
Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.
2013-01-01
Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...
Directory of Open Access Journals (Sweden)
Pyles Richard B
2009-11-01
Full Text Available Abstract Background Herpes simplex virus type 2 (HSV-2 is a leading cause of genital ulceration that can predispose individuals to an increased risk of acquiring other sexually transmitted infections. There are no approved HSV-2 vaccines and current suppressive therapies require daily compound administration that does not prevent all recurrences. A promising experimental strategy is the use of toll-like receptor (TLR agonists to induce an innate immune response that provides resistance to HSV-2 infection. Previous studies showed that anti-herpetic activity varied based on origin of the agonists and activation of different TLR indicating that activity likely occurs through elaboration of a specific innate immune response. To test the hypothesis, we evaluated the ability of a bacterial-derived TLR2/6 agonist (FSL-1 to increase resistance to experimental genital HSV-2 infection. Methods Vaginal application of FSL-1 at selected doses and times was evaluated to identify potential increased resistance to genital HSV-2 infection in the mouse model. The FSL-1 induced cytokine profile was quantified using kinetically collected vaginal lavages. Additionally, cytokine elaboration and organ weights were evaluated after single or multiple FSL-1 doses to establish a preliminary safety profile. Human vaginal EC cultures were used to confirm the mouse model outcomes. Results The results showed that vaginally-applied FSL-1 created an environment resistant to a 25-fold higher HSV-2 challenge dose. Mechanistically, vaginal FSL-1 application led to transient elaboration of cytokines linked to anti-herpetic innate immune responses. No gross local or peripheral immunotoxicity was observed even after multiple dosing. FSL-1 also created an anti-herpetic environment in cultures of human vaginal epithelial cells (EC. Conclusion The results showed, for the first time, that the bacterial-derived TLR2/6 agonist FSL-1 induced significant resistance to HSV-2 infection when
A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review
Directory of Open Access Journals (Sweden)
Pablo Manresa
2017-12-01
Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.
Directory of Open Access Journals (Sweden)
Shlomi Toobiak
Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.
Directory of Open Access Journals (Sweden)
Ribeiro-Resende Victor
2012-07-01
Full Text Available Abstract Background Among the essential biological roles of bone marrow-derived cells, secretion of many soluble factors is included and these small molecules can act upon specific receptors present in many tissues including the nervous system. Some of the released molecules can induce proliferation of Schwann cells (SC, satellite cells and lumbar spinal cord astrocytes during early steps of regeneration in a rat model of sciatic nerve transection. These are the major glial cell types that support neuronal survival and axonal growth following peripheral nerve injury. Fibroblast growth factor-2 (FGF-2 is the main mitogenic factor for SCs and is released in large amounts by bone marrow-derived cells, as well as by growing axons and endoneurial fibroblasts during development and regeneration of the peripheral nervous system (PNS. Results Here we show that bone marrow-derived cell treatment induce an increase in the expression of FGF-2 in the sciatic nerve, dorsal root ganglia and the dorsolateral (DL region of the lumbar spinal cord (LSC in a model of sciatic nerve transection and connection into a hollow tube. SCs in culture in the presence of bone marrow derived conditioned media (CM resulted in increased proliferation and migration. This effect was reduced when FGF-2 was neutralized by pretreating BMMC or CM with a specific antibody. The increased expression of FGF-2 was validated by RT-PCR and immunocytochemistry in co-cultures of bone marrow derived cells with sciatic nerve explants and regenerating nerve tissue respectivelly. Conclusion We conclude that FGF-2 secreted by BMMC strongly increases early glial proliferation, which can potentially improve PNS regeneration.
Expression of assayable residual stem cell damage in erythroid differentiation
International Nuclear Information System (INIS)
Huebner, G.E.; Miller, M.E.; Cronkite, E.P.
1985-01-01
In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)
von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.
2001-01-01
Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal
LENUS (Irish Health Repository)
Cooley, Sharon M
2010-05-01
To investigate the relationship between levels of insulin-like growth factors 1 and 2 (IGF-1, IGF-2), and insulin-like growth factor binding protein 3 (IGFBP-3) in antenatal maternal serum and gestational age at delivery.
Directory of Open Access Journals (Sweden)
Laurie A Steiner
Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.
Brain derived neurotrophic factor
DEFF Research Database (Denmark)
Mitchelmore, Cathy; Gede, Lene
2014-01-01
Brain Derived Neurotrophic Factor (BDNF) is a neurotrophin with important functions in neuronal development and neuroplasticity. Accumulating evidence suggests that alterations in BDNF expression levels underlie a variety of psychiatric and neurological disorders. Indeed, BDNF therapies are curre......Brain Derived Neurotrophic Factor (BDNF) is a neurotrophin with important functions in neuronal development and neuroplasticity. Accumulating evidence suggests that alterations in BDNF expression levels underlie a variety of psychiatric and neurological disorders. Indeed, BDNF therapies...
Fusion of ZMYND8 and RELA genes in acute erythroid leukemia
DEFF Research Database (Denmark)
Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim
2013-01-01
Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...
Parvovirus B19 integration into human CD36+ erythroid progenitor cells.
Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik
2017-11-01
The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.
van Vliet-Ostaptchouk, J.V.; Shiri-Sverdlov, R.; Zhernakova, A.; Strengman, E.; van Haeften, T.W.; Hofker, M.H.; Wijmenga, C.
Aim/hypothesis A strong association between susceptibility to type 2 diabetes and common variants of transcription factor 7-like 2 (TCF7L2), encoding an enteroendocrine transcription factor involved in glucose homeostasis, has been reported in three different populations (Iceland, Denmark and USA)
Toloza, F J K; Pérez-Matos, M C; Ricardo-Silgado, M L; Morales-Álvarez, M C; Mantilla-Rivas, J O; Pinzón-Cortés, J A; Pérez-Mayorga, M; Arévalo-García, M L; Tolosa-González, G; Mendivil, C O
2017-09-01
To evaluate and compare the association of four potential insulin resistance (IR) biomarkers (pigment-epithelium-derived factor [PEDF], retinol-binding-protein-4 [RBP-4], chitinase-3-like protein 1 [YKL-40] and brain-derived neurotrophic factor [BDNF]) with objective measures of IR. We studied 81 subjects with different metabolic profiles. All participants underwent a 5-point OGTT with calculation of multiple IR indexes. A subgroup of 21 participants additionally underwent a hyperinsulinemic-euglycemic clamp. IR was defined as belonging to the highest quartile of incremental area under the insulin curve (iAUCins), or to the lowest quartile of the insulin sensitivity index (ISI). PEDF was associated with adiposity variables. PEDF and RBP4 increased linearly across quartiles of iAUCins (for PEDF p-trend=0.029; for RBP-4 p-trend=0.053). YKL-40 and BDNF were not associated with any adiposity or IR variable. PEDF and RBP-4 levels identified individuals with IR by the iAUCins definition: A PEDF cutoff of 11.9ng/mL had 60% sensitivity and 68% specificity, while a RBP-4 cutoff of 71.6ng/mL had 70% sensitivity and 57% specificity. In multiple regression analyses simultaneously including clinical variables and the studied biomarkers, only BMI, PEDF and RBP-4 remained significant predictors of IR. Plasma PEDF and RBP4 identified IR in subjects with no prior diagnosis of diabetes. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Birinyi, L.K.; Warner, S.J.; Salomon, R.N.; Callow, A.D.; Libby, P.
1989-01-01
Prosthetic bypass grafts placed to the distal lower extremity often fail because of an occlusive tissue response in the perianastomotic region. The origin of the cells that comprise this occlusive lesion and the causes of the cellular proliferation are not known. To increase our understanding of this process we cultured cells from hyperplastic lesions obtained from patients at the time of reexploration for lower extremity graft failure, and we studied their identity and growth factor production in tissue culture. These cultures contain cells that express muscle-specific actin isoforms, shown by immunohistochemical staining, consistent with vascular smooth muscle origin. These cultures also released material that stimulated smooth muscle cell growth. A portion of this activity was similar to platelet-derived growth factor, since preincubation with antibody-to-human platelet-derived growth factor partially blocked the mitogenic effect of medium conditioned by human anastomotic hyperplastic cells. These conditioned media also contained material that competed with platelet-derived growth factor for its receptor, as measured in a radioreceptor assay. Northern blot analysis showed that these cells contain messenger RNA that encodes the A chain but not the B chain of platelet-derived growth factor. In addition, these cells contain messenger RNA that encodes a platelet-derived growth factor receptor. We conclude that cultured smooth muscle cells from human anastomotic hyperplastic lesions express genes for platelet-derived growth factor A chain and a platelet-derived growth factor receptor and secrete biologically active molecules similar to platelet-derived growth factor
Directory of Open Access Journals (Sweden)
Valentina Guzmán-Pérez
Full Text Available Nasturtium (Tropaeolum majus L. contains high concentrations of benzylglcosinolate. We found that a hydrolysis product of benzyl glucosinolate-the benzyl isothiocyanate (BITC-modulates the intracellular localization of the transcription factor Forkhead box O 1 (FOXO1. FoxO transcription factors can antagonize insulin effects and trigger a variety of cellular processes involved in tumor suppression, longevity, development and metabolism. The current study evaluated the ability of BITC-extracted as intact glucosinolate from nasturtium and hydrolyzed with myrosinase-to modulate i the insulin-signaling pathway, ii the intracellular localization of FOXO1 and, iii the expression of proteins involved in gluconeogenesis, antioxidant response and detoxification. Stably transfected human osteosarcoma cells (U-2 OS with constitutive expression of FOXO1 protein labeled with GFP (green fluorescent protein were used to evaluate the effect of BITC on FOXO1. Human hepatoma HepG2 cell cultures were selected to evaluate the effect on gluconeogenic, antioxidant and detoxification genes and protein expression. BITC reduced the phosphorylation of protein kinase B (AKT/PKB and FOXO1; promoted FOXO1 translocation from cytoplasm into the nucleus antagonizing the insulin effect; was able to down-regulate the gene and protein expression of gluconeogenic enzymes; and induced the gene expression of antioxidant and detoxification enzymes. Knockdown analyses with specific siRNAs showed that the expression of gluconeogenic genes was dependent on nuclear factor (erythroid derived-like2 (NRF2 and independent of FOXO1, AKT and NAD-dependent deacetylase sirtuin-1 (SIRT1. The current study provides evidence that BITC might have a role in type 2 diabetes T2D by reducing hepatic glucose production and increasing antioxidant resistance.
Directory of Open Access Journals (Sweden)
Manasi Jiwrajka
2016-01-01
Full Text Available Chalcones are plant metabolites with potential for therapeutic exploitation as antioxidant, anti-inflammatory, and antiproliferative agents. Here we explored the neuroprotective effects of 2,2′,5′-trihydroxychalcone (225THC, a potent antioxidant with radical-scavenging properties. 225THC was found to be a potent inhibitor of apoptosis in stimulated primary rat neuronal cultures. This was likely mediated by an anti-inflammatory effect on microglial cells since 225THC inhibited LPS-stimulated TNF-α and IL-6 secretion from primary rat microglia and modulated the cytokine/chemokine profile of BV2 microglial cells. Additionally, 225THC inhibited LPS-evoked inducible nitric oxide synthase expression but did not influence endogenous superoxide generation. Microglial flow cytometric analyses indicated the 225THC treatment induced a shift from an M1-like phenotype to a more downregulated microglial profile. Taken together these data suggest that the chalcone 2,2′,5′-trihydroxychalcone can modulate neuroinflammatory activation in brain-derived microglia and holds promise as a therapeutic in neuroinflammatory conditions.
International Nuclear Information System (INIS)
Alexanian, Arshak R.
2005-01-01
Several recent reports suggest that there is far more plasticity that previously believed in the developmental potential of bone-marrow-derived cells (BMCs) that can be induced by extracellular developmental signals of other lineages whose nature is still largely unknown. In this study, we demonstrate that bone-marrow-derived mesenchymal stem cells (MSCs) co-cultured with mouse proliferating or fixed (by paraformaldehyde or methanol) neural stem cells (NSCs) generate neural stem cell-like cells with a higher expression of Sox-2 and nestin when grown in NS-A medium supplemented with N2, NSC conditioned medium (NSCcm) and bFGF. These neurally induced MSCs eventually differentiate into β-III-tubulin and GFAP expressing cells with neuronal and glial morphology when grown an additional week in Neurobasal/B27 without bFGF. We conclude that juxtacrine interaction between NSCs and MSCs combined with soluble factors released from NSCs are important for generation of neural-like cells from bone-marrow-derived adherent MSCs
Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes
International Nuclear Information System (INIS)
Shi, Ge; Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin; Ou, Bai-sheng; Kim, Sooil; Lee, Young Ho; Yoon, Tae-Jin; Kim, Seong-Jin; Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon; Kim, Chang Deok
2010-01-01
Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.
Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes
Energy Technology Data Exchange (ETDEWEB)
Shi, Ge [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Ou, Bai-sheng [Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Kim, Sooil; Lee, Young Ho [Department of Anatomy, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Yoon, Tae-Jin [Department of Dermatology, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Kim, Seong-Jin [Department of Dermatology, Chonnam National University Medical School, Gwangju, 501-757 (Korea, Republic of); Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Kim, Chang Deok, E-mail: cdkimd@cnu.ac.kr [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of)
2010-11-15
Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.
Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.
Directory of Open Access Journals (Sweden)
Fang Liu
Full Text Available The productivity of maize (Zea mays L. depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59 were divided into seven groups (I-VII. By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses.
Directory of Open Access Journals (Sweden)
Kai-Hsin Chang
2011-01-01
Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.
Yukawa couplings in Superstring derived Standard-like models
International Nuclear Information System (INIS)
Faraggi, A.E.
1991-01-01
I discuss Yukawa couplings in Standard-like models which are derived from Superstring in the free fermionic formulation. I introduce new notation for the construction of these models. I show how choice of boundary conditions selects a trilevel Yukawa coupling either for +2/3 charged quark or for -1/3 charged quark. I prove this selection rule. I make the conjecture that in this class of standard-like models a possible connection may exist between the requirements of F and D flatness at the string level and the heaviness of the top quark relative to lighter quarks and leptons. I discuss how the choice of boundary conditions determines the non vanishing mass terms for quartic order terms. I discuss the implication on the mass of the top quark. (author)
Nordqvist, A C; Peyrard, M; Pettersson, H; Mathiesen, T; Collins, V P; Dumanski, J P; Schalling, M
1997-07-01
Insulin-like growth factors (IGFs) I and II have been implicated as autocrine or paracrine growth promoters. These growth factors bind to specific receptors, and the response is modulated by interaction with IGF-binding proteins (IGFBPs). We observed a strong correlation between anaplastic/atypical histopathology and a high IGF-II/IGFBP-2 mRNA ratio in a set of 68 sporadic meningiomas. A strong correlation was also found between clinical outcome and IGF-II/IGFBP-2 ratio, whereas previously used histochemical markers were less correlated to outcome. We suggest that a high IGF-II/IGFBP-2 mRNA ratio may be a sign of biologically aggressive behavior in meningiomas that can influence treatment strategies. We propose that low IGFBP-2 levels in combination with increased levels of IGF-II would result in more free IGF-II and consequently greater stimulation of proliferation.
Xu, Cong; Wang, Li; Yu, Yue; Yin, Fangchao; Zhang, Xiaoqing; Jiang, Lei; Qin, Jianhua
2017-08-22
Organized cardiomyocyte alignment is critical to maintain the mechanical properties of the heart. In this study, we present a new and simple strategy to fabricate a biomimetic microchip designed with an onion epithelium-like structure and investigate the guided behavior of human induced pluripotent stem cell derived cardiomyocytes (hiPSC-CMs) on the substrate. The hiPSC-CMs were observed to be confined by the three dimensional surficial features morphologically, analogous to the in vivo microenvironment, and exhibited an organized anisotropic alignment on the onion epithelium-like structure with good beating function. The calcium imaging of hiPSC-CMs demonstrated a more mature Ca 2+ spark pattern as well. Furthermore, the expression of sarcomere genes (TNNI3, MYH6 and MYH7), potassium channel genes (KCNE1 and KCNH2), and calcium channel genes (RYR2) was significantly up-regulated on the substrate with an onion epithelium-like structure instead of the surface without the structure, indicating a more matured status of cardiomyocytes induced by this structure. It appears that the biomimetic micropatterned structure, analogous to in vivo cellular organization, is an important factor that might promote the maturation of hiPSC-CMs, providing new biological insights to guide hiPSC-CM maturation by biophysical factors. The established approach may offer an effective in vitro model for investigating cardiomyocyte differentiation, maturation and tissue engineering applications.
International Nuclear Information System (INIS)
Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.
1991-01-01
These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase
Cao, Shandong
2012-08-01
The purpose of the present study was to develop in silico models allowing for a reliable prediction of polo-like kinase inhibitors based on a large diverse dataset of 136 compounds. As an effective method, quantitative structure activity relationship (QSAR) was applied using the comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA). The proposed QSAR models showed reasonable predictivity of thiophene analogs (Rcv2=0.533, Rpred2=0.845) and included four molecular descriptors, namely IC3, RDF075m, Mor02m and R4e+. The optimal model for imidazopyridine derivatives (Rcv2=0.776, Rpred2=0.876) was shown to perform good in prediction accuracy, using GATS2m and BEHe1 descriptors. Analysis of the contour maps helped to identify structural requirements for the inhibitors and served as a basis for the design of the next generation of the inhibitor analogues. Docking studies were also employed to position the inhibitors into the polo-like kinase active site to determine the most probable binding mode. These studies may help to understand the factors influencing the binding affinity of chemicals and to develop alternative methods for prescreening and designing of polo-like kinase inhibitors.
Directory of Open Access Journals (Sweden)
Nikolay T. Tzvetkov
2012-09-01
Full Text Available Dihydroimidazo[5,1-c][1,2,4]triazine-3,6(2H,4H-dione derivatives were prepared by successive N3- and N1-alkylation of hydantoins, followed by regioselective thionation and subsequent cyclization under mild conditions. In a final alkylation step a further substituent may be introduced. The synthetic strategy allows broad structural variation of this new drug-like heterobicyclic scaffold. In addition to extensive NMR and MS analyses, the structure of one derivative was confirmed by X-ray crystallography.
Human insulin-like growth factor II leader 2 mediates internal initiation of translation
DEFF Research Database (Denmark)
Pedersen, Susanne; Christiansen, Jan; Hansen, T.O.
2002-01-01
Insulin-like growth factor II (IGF-II) is a fetal growth factor, which belongs to the family of insulin-like peptides. During fetal life, the IGF-II gene generates three mRNAs with different 5' untranslated regions (UTRs), but identical coding regions and 3' UTRs. We have shown previously that IG...
Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T
1987-02-01
The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.
Liby, Karen T; Sporn, Michael B
2012-10-01
We review the rationale for the use of synthetic oleanane triterpenoids (SOs) for prevention and treatment of disease, as well as extensive biological data on this topic resulting from both cell culture and in vivo studies. Emphasis is placed on understanding mechanisms of action. SOs are noncytotoxic drugs with an excellent safety profile. Several hundred SOs have now been synthesized and in vitro have been shown to: 1) suppress inflammation and oxidative stress and therefore be cytoprotective, especially at low nanomolar doses, 2) induce differentiation, and 3) block cell proliferation and induce apoptosis at higher micromolar doses. Animal data on the use of SOs in neurodegenerative diseases and in diseases of the eye, lung, cardiovascular system, liver, gastrointestinal tract, and kidney, as well as in cancer and in metabolic and inflammatory/autoimmune disorders, are reviewed. The importance of the cytoprotective Kelch-like erythroid cell-derived protein with CNC homology-associated protein 1/nuclear factor (erythroid-derived 2)-like 2/antioxidant response element (Keap1/Nrf2/ARE) pathway as a mechanism of action is explained, but interactions with peroxisome proliferator-activated receptor γ (PARPγ), inhibitor of nuclear factor-κB kinase complex (IKK), janus tyrosine kinase/signal transducer and activator of transcription (JAK/STAT), human epidermal growth factor receptor 2 (HER2)/ErbB2/neu, phosphatase and tensin homolog (PTEN), the phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) pathway, mammalian target of rapamycin (mTOR), and the thiol proteome are also described. In these interactions, Michael addition of SOs to reactive cysteine residues in specific molecular targets triggers biological activity. Ultimately, SOs are multifunctional drugs that regulate the activity of entire networks. Recent progress in the earliest clinical trials with 2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oic acid (CDDO) methyl ester (bardoxolone methyl) is also
Reduction of erythroid progenitors in protein-energy malnutrition.
Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio
2007-02-01
Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.
Identification of a potent endothelium-derived angiogenic factor.
Directory of Open Access Journals (Sweden)
Vera Jankowski
Full Text Available The secretion of angiogenic factors by vascular endothelial cells is one of the key mechanisms of angiogenesis. Here we report on the isolation of a new potent angiogenic factor, diuridine tetraphosphate (Up4U from the secretome of human endothelial cells. The angiogenic effect of the endothelial secretome was partially reduced after incubation with alkaline phosphatase and abolished in the presence of suramin. In one fraction, purified to homogeneity by reversed phase and affinity chromatography, Up4U was identified by MALDI-LIFT-fragment-mass-spectrometry, enzymatic cleavage analysis and retention-time comparison. Beside a strong angiogenic effect on the yolk sac membrane and the developing rat embryo itself, Up4U increased the proliferation rate of endothelial cells and, in the presence of PDGF, of vascular smooth muscle cells. Up4U stimulated the migration rate of endothelial cells via P2Y2-receptors, increased the ability of endothelial cells to form capillary-like tubes and acts as a potent inducer of sprouting angiogenesis originating from gel-embedded EC spheroids. Endothelial cells released Up4U after stimulation with shear stress. Mean total plasma Up4U concentrations of healthy subjects (N=6 were sufficient to induce angiogenic and proliferative effects (1.34 ± 0.26 nmol L(-1. In conclusion, Up4U is a novel strong human endothelium-derived angiogenic factor.
Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.
Sherazi, Syed Furqan Haider; Butt, Zeeshan
2012-09-01
AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.
Cino, E.A.; Wong-ekkabut, J.; Karttunen, M.E.J.; Choy, W.-Y.
2011-01-01
Intrinsically disordered proteins (IDPs) are abundant in cells and have central roles in protein-protein interaction networks. Interactions between the IDP Prothymosin alpha (ProTa) and the Neh2 domain of Nuclear factor erythroid 2-related factor 2 (Nrf2), with a common binding partner, Kelch-like
Energy Technology Data Exchange (ETDEWEB)
Williams, Larissa M., E-mail: lwillia2@bates.edu [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Lago, Briony A., E-mail: lagoba@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); McArthur, Andrew G., E-mail: mcarthua@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Raphenya, Amogelang R., E-mail: raphenar@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Pray, Nicholas, E-mail: pray.nicholas@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); Saleem, Nabil, E-mail: nabilsaleem@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Salas, Sophia, E-mail: sophia.salas2@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Paulson, Katherine, E-mail: krpaulson@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Mangar, Roshni S., E-mail: rmangar@coa.edu [The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); College of the Atlantic, 105 Eden Street, Bar Harbor, ME 04609 (United States); and others
2016-11-15
Highlights: • Nfe2 is involved in erythropoiesis in zebrafish. • Nfe2 is a novel regulator of pro-oxidant induced oxidative stress. • Embryos mount a molecularly unique oxidative stress response compared to larvae. • Nfe2 regulates a wide-variety of genes beyond erythropoiesis. - Abstract: Development is a complex and well-defined process characterized by rapid cell proliferation and apoptosis. At this stage in life, a developmentally young organism is more sensitive to toxicants as compared to an adult. In response to pro-oxidant exposure, members of the Cap’n’Collar (CNC) basic leucine zipper (b-ZIP) transcription factor family (including Nfe2 and Nfe2-related factors, Nrfs) activate the expression of genes whose protein products contribute to reduced toxicity. Here, we studied the role of the CNC protein, Nfe2, in the developmental response to pro-oxidant exposure in the zebrafish (Danio rerio). Following acute waterborne exposures to diquat or tert-buytlhydroperoxide (tBOOH) at one of three developmental stages, wildtype (WT) and nfe2 knockout (KO) embryos and larvae were morphologically scored and their transcriptomes sequenced. Early in development, KO animals suffered from hypochromia that was made more severe through exposure to pro-oxidants; this phenotype in the KO may be linked to decreased expression of alas2, a gene involved in heme synthesis. WT and KO eleutheroembryos and larvae were phenotypically equally affected by exposure to pro-oxidants, where tBOOH caused more pronounced phenotypes as compared to diquat. Comparing diquat and tBOOH exposed embryos relative to the WT untreated control, a greater number of genes were up-regulated in the tBOOH condition as compared to diquat (tBOOH: 304 vs diquat: 148), including those commonly found to be differentially regulated in the vertebrate oxidative stress response (OSR) (e.g. hsp70.2, txn1, and gsr). When comparing WT and KO across all treatments and times, there were 1170 genes that were
Chemoresistance in Pancreatic Cancer Is Driven by Stroma-Derived Insulin-Like Growth Factors
Ahmed, Muhammad S.; Rainer, Carolyn; Nielsen, Sebastian R.; Quaranta, Valeria; Weyer-Czernilofsky, Ulrike; Engle, Danielle D.; Perez-Mancera, Pedro A.; Coupland, Sarah E.; Taktak, Azzam; Bogenrieder, Thomas; Tuveson, David A.; Campbell, Fiona; Schmid, Michael C.; Mielgo, Ainhoa
2017-01-01
Tumor-associated macrophages (TAM) and myofibroblasts are key drivers in cancer that are associated with drug resistance in many cancers, including pancreatic ductal adenocarcinoma (PDAC). However, our understanding of the molecular mechanisms by which TAM and fibroblasts contribute to chemoresistance is unclear. In this study, we found that TAM and myofibroblasts directly support chemoresistance of pancreatic cancer cells by secreting insulin-like growth factors (IGF) 1 and 2, which activate insulin/IGF receptors on pancreatic cancer cells. Immunohistochemical analysis of biopsies from patients with pancreatic cancer revealed that 72% of the patients expressed activated insulin/IGF receptors on tumor cells, and this positively correlates with increased CD163+ TAM infiltration. In vivo, we found that TAM and myofibroblasts were the main sources of IGF production, and pharmacologic blockade of IGF sensitized pancreatic tumors to gemcitabine. These findings suggest that inhibition of IGF in combination with chemotherapy could benefit patients with PDAC, and that insulin/IGF1R activation may be used as a biomarker to identify patients for such therapeutic intervention. PMID:27742686
Directory of Open Access Journals (Sweden)
Uchida Daisuke
2009-08-01
Full Text Available Abstract Background We have demonstrated that the stromal cell-derived factor-1 (SDF-1; CXCL12/CXCR4 system is involved in the establishment of lymph node metastasis in oral squamous cell carcinoma (SCC. Chemotherapy is a powerful tool for the treatment of oral cancer, including oral SCC; however, the effects of chemotherapeutic agents on the expression of CXCR4 are unknown. In this study, we examined the expression of CXCR4 associated with the chemotherapeutic agents in oral cancer cells. Results The expression of CXCR4 was examined using 3 different chemotherapeutic agents; 5-fluorouracil, cisplatin, and vesnarinone (3,4-dihydro-6-[4-(3,4-dimethoxybenzoyl-1-piperazinyl]-2-(1H-quinolinone in B88, a line of oral cancer cells that exhibits high levels of CXCR4 and lymph node metastatic potential. Of the 3 chemotherapeutic agents that we examined, only vesnarinone downregulated the expression of CXCR4 at the mRNA as well as the protein level. Vesnarinone significantly inhibited lymph node metastasis in tumor-bearing nude mice. Moreover, vesnarinone markedly inhibited 2.7-kb human CXCR4 promoter activity, and we identified the transcription factor, Krüppel-like factor 2 (KLF2, as a novel vesnarinone-responsive molecule, which was bound to the CXCR4 promoter at positions -300 to -167 relative to the transcription start site. The forced-expression of KLF2 led to the downregulation of CXCR4 mRNA and impaired CXCR4 promoter activity. The use of siRNA against KLF2 led to an upregulation of CXCR4 mRNA. Conclusion These Results indicate that vesnarinone downregulates CXCR4 via the upregulation of KLF2 in oral cancer.
Farmer, John T; Weigent, Douglas A
2007-01-01
In the present study, we report the upregulation of functional IGF-2Rs in cells overexpressing growth hormone (GH). EL4 lymphoma cells stably transfected with an rGH cDNA overexpression vector (GHo) exhibited an increase in the binding of (125)I-IGF-2 with no change in the binding affinity compared to vector alone controls. An increase in the expression of the insulin-like growth factor-2 receptor (IGF-2R) in cells overexpressing GH was confirmed by Western blot analysis and IGF-2R promoter luciferase assays. EL4 cells produce insulin-like growth factor-2 (IGF-2) as detected by the reverse transcription-polymerase chain reaction (RT-PCR); however, no IGF-2 protein was detected by Western analysis. The increase in the expression of the IGF-2R resulted in greater levels of IGF-2 uptake in GHo cells compared to vector alone controls. The data suggest that one of the consequences of the overexpression of GH is an increase in the expression of the IGF-2R.
Voskuil, Dorien W.; Vrieling, Alina; Korse, Catharina M.; Beijnen, Jos H.; Bonfrer, Johannes M. G.; van Doorn, Jaap; Kaas, Reinie; Oldenburg, Hester S. A.; Russell, Nicola S.; Rutgers, Emiel J. T.; Verhoef, Senno; van Leeuwen, Flora E.; van't Veer, Laura J.; Rookus, Matti A.
2008-01-01
Insulin-like growth factor-I (IGF-I) is an important growth factor associated with increased risk of premenopausal breast cancer. We conducted a randomized, placebo-controlled, double-blind, crossover trial to evaluate whether tomato-derived lycopene supplementation (30 mg/day for 2 mo) decreases
Voskuil, Dorien W.; Vrieling, Alina; Korse, Catharina M.; Beijnen, Jos H.; Bonfrer, Johannes M. G.; van Doorn, Jaap; Kaas, Reinie; Oldenburg, Hester S. A.; Russell, Nicola S.; Rutgers, Emiel J. T.; Verhoef, Senno; van Leeuwen, Flora E.; van't Veer, Laura J.; Rookus, Matti A.
2008-01-01
Insulin-like growth factor-I (IGF-I) is an important growth factor associated with increased risk of premenopausal breast cancer. We conducted a randomized, placebo-controlled, double-blind, crossover trial to evaluate whether tomato-derived lycopene supplementation (30 mg/day for 2 mo) decreases
Rh antigen expression during erythropoeisis: Comparison of cord and adult derived CD34 + cells
Directory of Open Access Journals (Sweden)
Gupta Namita
2008-01-01
Full Text Available Objectives: Concentrations of O 2 and CO 2 in the fetal circulation differ to that in maternal blood. Previous studies done in algae demonstrate the functional role of Rh antigen as CO 2 transporter. As a preliminary study, it was the aim of this project to compare the expression of Rh polypeptides on cord and adult red blood cell progenitors during ex vivo proliferation and differentiation of CD34 + cells during erythropoeisis. Materials and Methods: CD34 positive hematopoeitic progenitor cells were isolated from umbilical cord blood and adult peripheral blood using an immunomagnetic system and cultured in serum free medium containing erythropoietin in order to compel them along the erythroid lineage. Cultured cells were analyzed for cell surface marker expression by flow cytometry, using monoclonal antibodies to RhAG, Glycophorin A, Rh polypeptides, CD47 and Band 3. Cytospin analysis was also done to study the morphology of cultured cells. Results: The appearance of cell surface markers analyzed on different days of culture varied slightly between samples. There was no evidence to suggest that RhAG, GPA, CD47 and Band 3 expression was any different between adult and cord derived cells. Nevertheless, the results of Rh antigenic expression suggest a reasonable difference between the two groups with adult sample derived cells showing higher and earlier expression than cord blood derived cells. These preliminary findings require further investigation. Conclusion: Comparing the expression of cell surface markers especially Rh polypeptides between adult and cord blood derived erythroid progenitors might assist in discerning their functions and could be valuable in the study of erythropoeisis.
Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway
Directory of Open Access Journals (Sweden)
W. Rungratanawanich
2018-01-01
Full Text Available γ-Oryzanol (ORY is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293. The 24 h ORY exposure significantly prevented hydrogen peroxide- (H2O2- induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD and glutathione peroxidase (GPX. Interestingly, ORY induced the nuclear factor (erythroid-derived 2-like 2 (Nrf2 nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(PH quinone reductase (NQO1, heme oxygenase-1 (HO-1, and glutathione synthetase (GSS at mRNA and protein levels in both basal condition and after H2O2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.
Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway.
Rungratanawanich, W; Abate, G; Serafini, M M; Guarienti, M; Catanzaro, M; Marziano, M; Memo, M; Lanni, C; Uberti, D
2018-01-01
γ -Oryzanol (ORY) is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS) scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293). The 24 h ORY exposure significantly prevented hydrogen peroxide- (H 2 O 2 -) induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD) and glutathione peroxidase (GPX). Interestingly, ORY induced the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(P)H quinone reductase (NQO1), heme oxygenase-1 (HO-1), and glutathione synthetase (GSS) at mRNA and protein levels in both basal condition and after H 2 O 2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.
Han, Han; Wei, Wei; Nie, Yonggang; Zhou, Wenliang; Hu, Yibo; Wu, Qi; Wei, Fuwen
2016-11-01
Stable isotope analysis is very useful in animal ecology, especially in diet reconstruction and trophic studies. Differences in isotope ratios between consumers and their diet, termed discrimination factors, are essential for studies of stable isotope ecology and are species-specific and tissue-specific. Given the specialized bamboo diet and clear foraging behavior, here, we calculated discrimination factors for carbon and nitrogen isotopes from diet to tissues (tooth enamel, hair keratin and bone collagen) for the giant panda (Ailuropoda melanoleuca), a species derived from meat-eating ancestors. Our results showed that carbon discrimination factor obtained from giant panda tooth enamel (ε 13 C diet-enamel = 10.0‰) and nitrogen discrimination factors from hair keratin (Δ 15 N diet-hair = 2.2‰) and bone collagen (Δ 15 N diet-collagen = 2.3‰) were lower, and carbon discrimination factors from hair keratin (Δ 13 C diet-hair = 5.0‰) and bone collagen (Δ 13 C diet-collagen = 6.1‰) were higher than those of other mammalian carnivores, omnivores and herbivores. Such distinctive values are likely the result of a low-nutrient and specialized bamboo diet, carnivore-like digestive system and exceptionally low metabolism in giant pandas. © 2016 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.
Directory of Open Access Journals (Sweden)
Kuan-Teh Jeang
2012-07-01
Full Text Available A major challenge in studies of human diseases involving macrophages is low yield and heterogeneity of the primary cells and limited ability of these cells for transfections and genetic manipulations. To address this issue, we developed a simple and efficient three steps method for somatic 293T cells reprogramming into monocytes and macrophage-like cells. First, 293T cells were reprogrammed into induced pluripotent stem cells (iPSCs through a transfection-mediated expression of two factors, Oct-4 and Sox2, resulting in a high yield of iPSC. Second, the obtained iPSC were differentiated into monocytes using IL-3 and M-CSF treatment. And third, monocytes were differentiated into macrophage-like cells in the presence of M-CSF. As an example, we developed HIV-1-resistant macrophage-like cells from 293T cells with knockdown of CDK2, a factor critical for HIV-1 transcription. Our study provides a proof-of-principle approach that can be used to study the role of host cell factors in HIV-1 infection of human macrophages.
Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.
2015-01-01
Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726
DEFF Research Database (Denmark)
Valleh, Mehdi Vafaye; Hyttel, Poul; Rasmussen, Mikkel Aabech
2014-01-01
Intrinsic defects within the embryos, reflected by elevated cell death and low proliferative ability, are considered the most critical factors associated with bovine infertility. The identification of embryonic factors, which are responsible for successful embryo development, is thus critical...
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.
Directory of Open Access Journals (Sweden)
Gloria Bua
Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells
Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio
2016-01-01
The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771
Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M
1981-01-01
Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...
Directory of Open Access Journals (Sweden)
Simona Adesso
2018-03-01
Full Text Available Astragalus membranaceus, dried root extract, also known as Astragali radix, is used in traditional Chinese medicine as a tonic remedy. Moreover, it has been reported that Astragalus membranaceus could attenuate intestinal inflammation; however, the underlying mechanism for its anti-inflammatory activity in intestinal epithelial cells (IECs remains unclear. In this study, we evaluated Astragalus membranaceus extract (5–100 µg/mL in a model of inflammation and oxidative stress for IECs. We showed that Astragalus membranaceus extract reduced the inflammatory response induced by lipopolysaccharide from E. coli (LPS plus interferon-γ (IFN, decreasing tumor necrosis factor-α (TNF-α release, cycloxygenase-2 (COX-2 and inducible nitric oxide synthase (iNOS expression, nitrotyrosine formation, nuclear factor-κB (NF-κB activation, and reactive oxygen species (ROS release in the non-tumorigenic intestinal epithelial cell line (IEC-6. The antioxidant potential of Astragalus membranaceus extract was also evaluated in a model of hydrogen peroxide (H2O2-induced oxidative stress in IEC-6, indicating that this extract reduced ROS release and increased nuclear factor (erythroid-derived 2-like 2 (Nrf2 activation and the expression of antioxidant cytoprotective factors in these cells. The results contributed to clarify the mechanisms involved in Astragalus membranaceus extract-reduced inflammation and highlighted the potential use of this extract as an anti-inflammatory and antioxidant remedy for intestinal diseases.
Bone marrow-derived fibrocytes promote stem cell-like properties of lung cancer cells.
Saijo, Atsuro; Goto, Hisatsugu; Nakano, Mayuri; Mitsuhashi, Atsushi; Aono, Yoshinori; Hanibuchi, Masaki; Ogawa, Hirohisa; Uehara, Hisanori; Kondo, Kazuya; Nishioka, Yasuhiko
2018-05-01
Cancer stem cells (CSCs) represent a minor population that have clonal tumor initiation and self-renewal capacity and are responsible for tumor initiation, metastasis, and therapeutic resistance. CSCs reside in niches, which are composed of diverse types of stromal cells and extracellular matrix components. These stromal cells regulate CSC-like properties by providing secreted factors or by physical contact. Fibrocytes are differentiated from bone marrow-derived CD14 + monocytes and have features of both macrophages and fibroblasts. Accumulating evidence has suggested that stromal fibrocytes might promote cancer progression. However, the role of fibrocytes in the CSC niches has not been revealed. We herein report that human fibrocytes enhanced the CSC-like properties of lung cancer cells through secreted factors, including osteopontin, CC-chemokine ligand 18, and plasminogen activator inhibitor-1. The PIK3K/AKT pathway was critical for fibrocytes to mediate the CSC-like functions of lung cancer cells. In human lung cancer specimens, the number of tumor-infiltrated fibrocytes was correlated with high expression of CSC-associated protein in cancer cells. These results suggest that fibrocytes may be a novel cell population that regulates the CSC-like properties of lung cancer cells in the CSC niches. Copyright © 2018. Published by Elsevier B.V.
Zhao, Liping; Kim, Ki Woo; Ikeda, Yayoi; Anderson, Kimberly K; Beck, Laurel; Chase, Stephanie; Tobet, Stuart A; Parker, Keith L
2008-06-01
Steroidogenic factor 1 (SF-1) plays key roles in adrenal and gonadal development, expression of pituitary gonadotropins, and development of the ventromedial hypothalamic nucleus (VMH). If kept alive by adrenal transplants, global knockout (KO) mice lacking SF-1 exhibit delayed-onset obesity and decreased locomotor activity. To define specific roles of SF-1 in the VMH, we used the Cre-loxP system to inactivate SF-1 in a central nervous system (CNS)-specific manner. These mice largely recapitulated the VMH structural defect seen in mice lacking SF-1 in all tissues. In multiple behavioral tests, mice with CNS-specific KO of SF-1 had significantly more anxiety-like behavior than wild-type littermates. The CNS-specific SF-1 KO mice had diminished expression or altered distribution in the mediobasal hypothalamus of several genes whose expression has been linked to stress and anxiety-like behavior, including brain-derived neurotrophic factor, the type 2 receptor for CRH (Crhr2), and Ucn 3. Moreover, transfection and EMSAs support a direct role of SF-1 in Crhr2 regulation. These findings reveal important roles of SF-1 in the hypothalamic expression of key regulators of anxiety-like behavior, providing a plausible molecular basis for the behavioral effect of CNS-specific KO of this nuclear receptor.
Survey and evaluation of mutations in the human KLF1 transcription unit.
Gnanapragasam, Merlin Nithya; Crispino, John D; Ali, Abdullah M; Weinberg, Rona; Hoffman, Ronald; Raza, Azra; Bieker, James J
2018-04-26
Erythroid Krüppel-like Factor (EKLF/KLF1) is an erythroid-enriched transcription factor that plays a global role in all aspects of erythropoiesis, including cell cycle control and differentiation. We queried whether its mutation might play a role in red cell malignancies by genomic sequencing of the KLF1 transcription unit in cell lines, erythroid neoplasms, dysplastic disorders, and leukemia. In addition, we queried published databases from a number of varied sources. In all cases we only found changes in commonly notated SNPs. Our results suggest that if there are mutations in KLF1 associated with erythroid malignancies, they are exceedingly rare.
Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y
2016-04-01
The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Radzimanowski, Jens; Ravaud, Stephanie; Schott, Andrea; Strahl, Sabine; Sinning, Irmgard
2009-01-01
Overexpression, purification, crystallization and preliminary X-ray diffraction of the stromal-cell-derived factor 2-like protein of Arabidopsis thaliana are reported. The crystals belonged to the space group P6 1 and diffracted to 1.95 Å resolution. The stromal-cell-derived factor 2-like protein of Arabidopsis thaliana (AtSDL) has been shown to be highly up-regulated in response to unfolded protein response (UPR) inducing reagents, suggesting that it plays a crucial role in the plant UPR pathway. AtSDL has been cloned, overexpressed, purified and crystallized using the vapour-diffusion method. Two crystal forms have been obtained under very similar conditions. The needle-shaped crystals did not diffract X-rays, while the other form diffracted to 1.95 Å resolution using a synchrotron-radiation source and belonged to the hexagonal space group P6 1 , with unit-cell parameters a = b = 96.1, c = 69.3 Å
Paternal Insulin-like Growth Factor 2 (Igf2 Regulates Stem Cell Activity During Adulthood
Directory of Open Access Journals (Sweden)
Vilma Barroca
2017-02-01
Full Text Available Insulin-like Growth Factor 2 (IGF2 belongs to the IGF/Insulin pathway, a highly conserved evolutionarily network that regulates growth, aging and lifespan. Igf2 is highly expressed in the embryo and in cancer cells. During mouse development, Igf2 is expressed in all sites where hematopoietic stem cells (HSC successively expand, then its expression drops at weaning and becomes undetectable when adult HSC have reached their niches in bones and start to self-renew. In the present study, we aim to discover the role of IGF2 during adulthood. We show that Igf2 is specifically expressed in adult HSC and we analyze HSC from adult mice deficient in Igf2 transcripts. We demonstrate that Igf2 deficiency avoids the age-related attrition of the HSC pool and that Igf2 is necessary for tissue homeostasis and regeneration. Our study reveals that the expression level of Igf2 is critical to maintain the balance between stem cell self-renewal and differentiation, presumably by regulating the interaction between HSC and their niche. Our data have major clinical interest for transplantation: understanding the changes in adult stem cells and their environments will improve the efficacy of regenerative medicine and impact health- and life-span.
Directory of Open Access Journals (Sweden)
Claus Larsen
2007-10-01
Full Text Available A series of model phenol carbonate ester prodrugs encompassing derivatives with fatty acid-like structures were synthesized and their stability as a function of pH (range 0.4 – 12.5 at 37°C in aqueous buffer solutions investigated. The hydrolysis rates in aqueous solutions differed widely, depending on the selected pro-moieties (alkyl and aryl substituents. The observed reactivity differences could be rationalized by the inductive and steric properties of the substituent groups when taking into account that the mechanism of hydrolysis may change when the type of pro-moiety is altered, e.g. n-alkyl vs. t-butyl. Hydrolysis of the phenolic carbonate ester 2-(phenoxycarbonyloxy-acetic acid was increased due to intramolecular catalysis, as compared to the derivatives synthesized from É-hydroxy carboxylic acids with longer alkyl chains. The carbonate esters appear to be less reactive towards specific acid and base catalyzed hydrolysis than phenyl acetate. The results underline that it is unrealistic to expect that phenolic carbonate ester prodrugs can be utilized in ready to use aqueous formulations. The stability of the carbonate ester derivatives with fatty acid-like structures, expected to interact with the plasma protein human serum albumin, proved sufficient for further in vitro and in vivo evaluation of the potential of utilizing HSA binding in combination with the prodrug approach for optimization of drug pharmacokinetics.
Directory of Open Access Journals (Sweden)
Yuko Ono
Full Text Available Circulating lipopolysaccharide (LPS concentrations are often elevated in patients with sepsis or with various endogenous diseases that are associated with metabolic endotoxemia. Involuntary loss of skeletal muscle, termed muscle wasting, is commonly observed in these conditions, suggesting that circulating LPS might play an essential role in its development. Although impairment of muscle regeneration is an important determinant of skeletal muscle wasting, it is unclear whether LPS affects this process and, if so, by what mechanism. Here, we used the C2C12 myoblast cell line to investigate the effects of LPS on myogenesis.C2C12 myoblasts were grown to 80% confluence and induced to differentiate in the absence or presence of LPS (0.1 or 1 μg/mL; TAK-242 (1 μM, a specific inhibitor of Toll-like receptor 4 (TLR4 signaling; and a tumor necrosis factor (TNF-α neutralizing antibody (5 μg/mL. Expression of a skeletal muscle differentiation marker (myosin heavy chain II, two essential myogenic regulatory factors (myogenin and MyoD, and a muscle negative regulatory factor (myostatin was analyzed by western blotting. Nuclear factor-κB (NF-κB DNA-binding activity was measured using an enzyme-linked immunosorbent assay.LPS dose-dependently and significantly decreased the formation of multinucleated myotubes and the expression of myosin heavy chain II, myogenin, and MyoD, and increased NF-κB DNA-binding activity and myostatin expression. The inhibitory effect of LPS on myogenic differentiation was reversible, suggesting that it was not caused by nonspecific toxicity. Both TAK-242 and anti-TNF-α reduced the LPS-induced increase in NF-κB DNA-binding activity, downregulation of myogenic regulatory factors, and upregulation of myostatin, thereby partially rescuing the impairment of myogenesis.Our data suggest that LPS inhibits myogenic differentiation via a TLR4-NF-κB-dependent pathway and an autocrine/paracrine TNF-α-induced pathway. These pathways
Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G
1996-01-01
Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.
Relativistic and QED corrections to the g factor of Li-like ions
International Nuclear Information System (INIS)
Glazov, D.A.; Shabaev, V.M.; Volotka, A.V.; Tupitsyn, I.I.; Yerokhin, V.A.; Plunien, G.; Soff, G.
2004-01-01
Calculations of various corrections to the g factor of Li-like ions are presented, which result in a significant improvement of the theoretical accuracy in the region Z=6-92. The configuration-interaction Dirac-Fock method is employed for the evaluation of the interelectronic-interaction correction of order 1/Z 2 and higher. This correction is combined with the 1/Z interelectronic-interaction term derived within a rigorous QED approach. The one-electron QED correction of first order in α is obtained by employing our recent results for the self-energy term and by evaluating the vacuum-polarization contribution. The screening of QED corrections is taken into account to the leading orders in αZ and 1/Z
Directory of Open Access Journals (Sweden)
Irina Vladimirovna Gatskikh
2016-02-01
Full Text Available One of the heavy progressive vascular complications of type 2 diabetes is a central nervous system, manifesting cognitive dysfunction due to metabolic changes. Goal. Defining the role of brain-derived neurotrophic factor (BDNF in the diagnosis of cognitive dysfunction in patients with type 2 diabetes. Materials and methods. The study involved 83 patients with type 2 diabetes at the age of 40 - 70 years. Complex examination included clinical and laboratory examination, neuropsychological testing. To screen for cognitive impairment used the Montreal Cognitive Assessment Scale (MOS test. To identify early markers of cognitive impairment was determined the level of brain-derived neurotrophic factor (BDNF. Results. The study found a negative correlation between the level of BDNF and the HbA1c (r = - 0,494, p = 0.01, fasting glucose (r = - 0,499, p = 0.01, and a positive relationship between the level of BDNF and cognitive function in patients with type 2 diabetes. Conclusion. In patients with type 2 diabetes revealed cognitive dysfunction in the form of reduced memory, attention, optical-dimensional activity that correlated with chronic hyperglycemia. The role of brain-derived neurotrophic factor (BDNF in the complex diagnosis of cognitive dysfunction in patients with type 2 diabetes. With an increase in HbA1c in patients with type 2 diabetes reduces the level of BDNF in the blood plasma, and a decline in cognitive function. Recommended use of BDNF as an additional marker of cognitive dysfunction in patients with type 2 diabetes.
Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.
Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired
Enteroendocrine-derived glucagon-like peptide-2 controls intestinal amino acid transport.
Lee, Jennifer; Koehler, Jacqueline; Yusta, Bernardo; Bahrami, Jasmine; Matthews, Dianne; Rafii, Mahroukh; Pencharz, Paul B; Drucker, Daniel J
2017-03-01
Glucagon-like peptide-2 (GLP-2) is co-secreted with GLP-1 from gut endocrine cells, and both peptides act as growth factors to expand the surface area of the mucosal epithelium. Notably, GLP-2 also enhances glucose and lipid transport in enterocytes; however, its actions on control of amino acid (AA) transport remain unclear. Here we examined the mechanisms linking gain and loss of GLP-2 receptor (GLP-2R) signaling to control of intestinal amino acid absorption in mice. Absorption, transport, and clearance of essential AAs, specifically lysine, were measured in vivo by Liquid Chromatography triple quadrupole Mass Spectrometry (LC-MS/MS) and ex vivo with Ussing chambers using intestinal preparations from Glp2 r +/+ and Glp2r - / - mice. Immunoblotting determined jejunal levels of protein components of signaling pathways (PI3K-AKT, and mTORC1-pS6-p4E-BP1) following administration of GLP-2, protein gavage, and rapamycin to fasted Glp2 r +/+ and Glp2r - / - mice. Expression of AA transporters from full thickness jejunum and 4F2hc from brush border membrane vesicles (BBMVs) was measured by real-time PCR and immunoblotting, respectively. Acute administration of GLP-2 increased basal AA absorption in vivo and augmented basal lysine transport ex vivo . GLP-2-stimulated lysine transport was attenuated by co-incubation with wortmannin, rapamycin, or tetrodotoxin ex vivo . Phosphorylation of mTORC1 effector proteins S6 and 4E-BP1 was significantly increased in wild-type mice in response to GLP-2 alone, or when co-administered with protein gavage, and abolished following oral gavage of rapamycin. In contrast, activation of GLP-1R signaling did not enhance S6 phosphorylation. Disruption of GLP-2 action in Glp2r -/- mice reduced lysine transport ex vivo and attenuated the phosphorylation of S6 and 4E-BP1 in response to oral protein. Moreover, the expression of cationic AA transporter slc7a9 in response to refeeding, and the abundance of 4F2hc in BBMVs following protein
Kitajima, Kenji; Kawaguchi, Manami; Iacovino, Michelina; Kyba, Michael; Hara, Takahiko
2013-12-01
We previously demonstrated that hematopoietic stem cell (HSC)-like cells are robustly expanded from mouse embryonic stem cells (ESCs) by enforced expression of Lhx2, a LIM-homeobox domain (LIM-HD) transcription factor. In this study, we analyzed the functions of Lhx2 in that process using an ESC line harboring an inducible Lhx2 gene cassette. When ESCs are cultured on OP9 stromal cells, hematopoietic progenitor cells (HPCs) are differentiated and these HPCs are prone to undergo rapid differentiation into mature hematopoietic cells. Lhx2 inhibited differentiation of HPCs into mature hematopoietic cells and this effect would lead to accumulation of HSC-like cells. LIM-HD factors interact with LIM domain binding (Ldb) protein and this interaction abrogates binding of LIM-only (Lmo) protein to Ldb. We found that one of Lmo protein, Lmo2, was unstable due to dissociation of Lmo2 from Ldb1 in the presence of Lhx2. This effect of Lhx2 on the amount of Lmo2 contributed into accumulation of HSC-like cells, since enforced expression of Lmo2 into HSC-like cells inhibited their self-renewal. Expression of Gata3 and Tal1/Scl was increased in HSC-like cells and enforced expression of Lmo2 reduced expression of Gata3 but not Tal1/Scl. Enforced expression of Gata3 into HPCs inhibited mature hematopoietic cell differentiation, whereas Gata3-knockdown abrogated the Lhx2-mediated expansion of HPCs. We propose that multiple transcription factors/cofactors are involved in the Lhx2-mediated expansion of HSC-like cells from ESCs. Lhx2 appears to fine-tune the balance between self-renewal and differentiation of HSC-like cells. © AlphaMed Press.
Kibbey, Megan M; Jameson, Mark J; Eaton, Erin M; Rosenzweig, Steven A
2006-03-01
Signaling by the insulin-like growth factor (IGF)-1 receptor (IGF-1R) has been implicated in the promotion and aggressiveness of breast, prostate, colorectal, and lung cancers. The IGF binding proteins (IGFBPs) represent a class of natural IGF antagonists that bind to and sequester IGF-1/2 from the IGF-1R, making them attractive candidates as therapeutics for cancer prevention and control. Recombinant human IGFBP-2 significantly attenuated IGF-1-stimulated MCF-7 cell proliferation with coaddition of 20 or 100 nM IGFBP-2 (50 or 80% inhibition, respectively). We previously identified IGF-1 contact sites both upstream and downstream of the CWCV motif (residues 247-250) in human IGFBP-2 (J Biol Chem 276:2880-2889, 2001). To further test their contributions to IGFBP-2 function, the single tryptophan in human IGFBP-2, Trp-248, was selectively cleaved with 2-(2'nitrophenylsulfenyl)-3-methyl-3 bromoindolenine (BNPS-skatole) and the BNPS-skatole products IGFBP-2(1-248) and IGFBP-2(249-289) as well as IGFBP-2(1-190) were expressed as glutathione S-transferase-fusion proteins and purified. Based on competition binding analysis, deletion of residues 249 to 289 caused an approximately 20-fold decrease in IGF-1 binding affinity (IGFBP-2 EC50 = 0.35 nM and IGFBP-2(1-248) = 7 nM). Removal of the remainder of the C-terminal domain had no further effect on affinity (IGFBP-2(1-190) EC50 = 9.2 nM). In kinetic assays, IGFBP-2(1-248) and IGFBP-2(1-190) exhibited more rapid association and dissociation rates than full-length IGFBP-2. These results confirm that regions upstream and downstream of the CWCV motif participate in IGF-1 binding. They further support the development of full-length IGFBP-2 as a cancer therapeutic.
Iser, Isabele C; Ceschini, Stefanie M; Onzi, Giovana R; Bertoni, Ana Paula S; Lenz, Guido; Wink, Márcia R
2016-12-01
Mesenchymal stem cells (MSCs) have recently been described to home to brain tumors and to integrate into the tumor-associated stroma. Understanding the communication between cancer cells and MSCs has become fundamental to determine whether MSC-tumor interactions should be exploited as a vehicle for therapeutic agents or considered a target for intervention. Therefore, we investigated whether conditioned medium from adipose-derived stem cells (ADSCs-CM) modulate glioma tumor cells by analyzing several cell biology processes in vitro. C6 rat glioma cells were treated with ADSCs-CM, and cell proliferation, cell cycle, cell viability, cell morphology, adhesion, migration, and expression of epithelial-mesenchymal transition (EMT)-related surface markers were analyzed. ADSCs-CM did not alter cell viability, cell cycle, and growth rate of C6 glioma cells but increased their migratory capacity. Moreover, C6 cells treated with ADSC-CM showed reduced adhesion and underwent changes in cell morphology. Up-regulation of EMT-associated markers (vimentin, MMP2, and NRAS) was also observed following treatment with ADSC-CM. Our findings demonstrate that the paracrine factors released by ADSCs are able to modulate glioma cell biology. Therefore, ADSC-tumor cell interactions in a tumor microenvironment must be considered in the design of clinical application of stem cell therapy. Graphical Abstract Factors released by adipose-derived stem cells (ADSCs) may modulate the biology of C6 glioma cells. When C6 cells are exposed to a conditioned medium from adipose-derived stem cells (ADSCs-CM), some of these cells can undergo an EMT-like process and trans-differentiate into cells with a more mesenchymal phenotype, characterized by enhanced expression of EMT-related surface markers, reduced cell adhesion capacity, increased migratory capacity, as well as changes in cell and nuclei morphology.
The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice
International Nuclear Information System (INIS)
Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.
1981-01-01
The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)
Paternal Insulin-like Growth Factor 2 (Igf2) Regulates Stem Cell Activity During Adulthood.
Barroca, Vilma; Lewandowski, Daniel; Jaracz-Ros, Agnieszka; Hardouin, Sylvie-Nathalie
2017-02-01
Insulin-like Growth Factor 2 (IGF2) belongs to the IGF/Insulin pathway, a highly conserved evolutionarily network that regulates growth, aging and lifespan. Igf2 is highly expressed in the embryo and in cancer cells. During mouse development, Igf2 is expressed in all sites where hematopoietic stem cells (HSC) successively expand, then its expression drops at weaning and becomes undetectable when adult HSC have reached their niches in bones and start to self-renew. In the present study, we aim to discover the role of IGF2 during adulthood. We show that Igf2 is specifically expressed in adult HSC and we analyze HSC from adult mice deficient in Igf2 transcripts. We demonstrate that Igf2 deficiency avoids the age-related attrition of the HSC pool and that Igf2 is necessary for tissue homeostasis and regeneration. Our study reveals that the expression level of Igf2 is critical to maintain the balance between stem cell self-renewal and differentiation, presumably by regulating the interaction between HSC and their niche. Our data have major clinical interest for transplantation: understanding the changes in adult stem cells and their environments will improve the efficacy of regenerative medicine and impact health- and life-span. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Jeffrey R Shearstone
Full Text Available Therapeutic intervention aimed at reactivation of fetal hemoglobin protein (HbF is a promising approach for ameliorating sickle cell disease (SCD and β-thalassemia. Previous studies showed genetic knockdown of histone deacetylase (HDAC 1 or 2 is sufficient to induce HbF. Here we show that ACY-957, a selective chemical inhibitor of HDAC1 and 2 (HDAC1/2, elicits a dose and time dependent induction of γ-globin mRNA (HBG and HbF in cultured primary cells derived from healthy individuals and sickle cell patients. Gene expression profiling of erythroid progenitors treated with ACY-957 identified global changes in gene expression that were significantly enriched in genes previously shown to be affected by HDAC1 or 2 knockdown. These genes included GATA2, which was induced greater than 3-fold. Lentiviral overexpression of GATA2 in primary erythroid progenitors increased HBG, and reduced adult β-globin mRNA (HBB. Furthermore, knockdown of GATA2 attenuated HBG induction by ACY-957. Chromatin immunoprecipitation and sequencing (ChIP-Seq of primary erythroid progenitors demonstrated that HDAC1 and 2 occupancy was highly correlated throughout the GATA2 locus and that HDAC1/2 inhibition led to elevated histone acetylation at well-known GATA2 autoregulatory regions. The GATA2 protein itself also showed increased binding at these regions in response to ACY-957 treatment. These data show that chemical inhibition of HDAC1/2 induces HBG and suggest that this effect is mediated, at least in part, by histone acetylation-induced activation of the GATA2 gene.
International Nuclear Information System (INIS)
Evans, T.; Reitman, M.; Felsenfeld, G.
1988-01-01
The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites
Tu, Zhi-Shan; Wang, Qi; Sun, Dan-Dan; Dai, Fang; Zhou, Bo
2017-07-07
Activation of nuclear factor erythroid-2-related factor 2 (Nrf2) has been proven to be an effective means to prevent the development of cancer, and natural curcumin stands out as a potent Nrf2 activator and cancer chemopreventive agent. In this study, we synthesized a series of curcumin analogs by introducing the geminal dimethyl substituents on the active methylene group to find more potent Nrf2 activators and cytoprotectors against oxidative death. The geminally dimethylated and catechol-type curcumin analog (compound 3) was identified as a promising lead molecule in terms of its increased stability and cytoprotective activity against the tert-butyl hydroperoxide (t-BHP)-induced death of HepG2 cells. Mechanism studies indicate that its cytoprotective effects are mediated by activating the Nrf2 signaling pathway in the Michael acceptor- and catechol-dependent manners. Additionally, we verified by using copper and iron ion chelators that the two metal ion-mediated oxidations of compound 3 to its corresponding electrophilic o-quinone, contribute significantly to its Nrf2-dependent cytoprotection. This work provides an example of successfully designing natural curcumin-directed Nrf2 activators by a stability-increasing and proelectrophilic strategy. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Let-7 microRNAs are developmentally regulated in circulating human erythroid cells
Directory of Open Access Journals (Sweden)
Reed Christopher
2009-11-01
Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.
Nuclear RNA sequencing of the mouse erythroid cell transcriptome.
Directory of Open Access Journals (Sweden)
Jennifer A Mitchell
Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.
Directory of Open Access Journals (Sweden)
M. Habibian
2017-04-01
Full Text Available Aims: Blood neurotrophins, such as Brain-Derived Neurotrophic Factor (BDNF and Insulin-like Growth Factor 1 (IGF-1, mediate exercise- induced health benefits in humans. The purpose of this study was to compare the response of BDNF and IGF-1 to different endurance training intensities in runner men. Materials & Methods: In this semi-experimental study with pre-test-posttest design in 2015, 10 people of male runners from Gorgan were selected through purposeful and accessible sampling. The endurance training protocol was 6 km running with moderate (70-75% of heart rate reserve or severe (80-85% of heart rate reserve intensity, which was performed within a week's interval. Fasting blood samples were collected before and immediately after both acute training sessions and serum levels of BDNF and IGF-1 were measured by ELISA and radioimmunoassay enzyme. Data were analyzed by SPSS 20 software using independent t-test and paired t-test. Findings: Both acute endurance training significantly increased serum levels of BDNF and IGF-1 in runners, but high intensity endurance exercises increased BDNF levels in comparison with moderate intensity (p0.05. Conclusion: Serum BDNF response in endurance athletes is affected by the intensity of exercise, so that the effect of high intensity endurance training on BDNF levels is greater than moderate intensity exercise, but the response of IGF-1 to acute endurance training is independent of the intensity of exercise.
Discerning the Mauve factor, Part 2.
McGinnis, Woody R; Audhya, Tapan; Walsh, William J; Jackson, James A; McLaren-Howard, John; Lewis, Allen; Lauda, Peter H; Bibus, Douglas M; Jurnak, Frances; Lietha, Roman; Hoffer, Abram
2008-01-01
"Mauve Factor" was once mistaken for kryptopyrrole but is the hydroxylactam of hemopyrrole, hydroxyhemopyrrolin-2-one (HPL). Treatment with nutrients--particularly vitamin B6 and zinc--reduces urinary excretion of HPL and improves diverse neurobehavioral symptoms in subjects with elevated urinary HPL. Heightened HPL excretion classically associates with emotional stress, which in turn is known to associate with oxidative stress. For this review, markers for nutritional status and for oxidative stress were examined in relationship to urinary HPL. In cohorts with mixed diagnoses, 24-hour urinary HPL correlated negatively with vitamin B6 activity and zinc concentration in red cells (P stress. HPL is known to cause non-erythroid heme depression, which lowers zinc, increases nitric oxide, and increases oxidative stress. Administration of prednisone reportedly provoked HPL excretion in animals. Since adrenocorticoid (and catecholamine) stress hormones mediate intestinal permeability, urinary HPL was examined in relationship to urinary indicans, presumptive marker for intestinal permeability. Urinary HPL associated with higher levels ofindicans (P role in production. Potentially, gut is reservoir for HPL or its precursor, and stress-related changes in intestinal permeability mediate systemic and urinary concentrations.
Effects of Nrf2 Deficiency on Bone Microarchitecture in an Experimental Model of Osteoporosis
Directory of Open Access Journals (Sweden)
Lidia Ibáñez
2014-01-01
Full Text Available Objective. Redox imbalance contributes to bone fragility. We have evaluated the in vivo role of nuclear factor erythroid derived 2-related factor-2 (Nrf2, an important regulator of cellular responses to oxidative stress, in bone metabolism using a model of postmenopausal osteoporosis. Methods. Ovariectomy was performed in both wild-type and mice deficient in Nrf2 (Nrf2−/−. Bone microarchitecture was analyzed by μCT. Serum markers of bone metabolism were also measured. Reactive oxygen species production was determined using dihydrorhodamine 123. Results. Sham-operated or ovariectomized Nrf2−/− mice exhibit a loss in trabecular bone mineral density in femur, accompanied by a reduction in cortical area in vertebrae. Nrf2 deficiency tended to increase osteoblastic markers and significantly enhanced osteoclastic markers in sham-operated animals indicating an increased bone turnover with a main effect on bone resorption. We have also shown an increased production of oxidative stress in bone marrow-derived cells from sham-operated or ovariectomized Nrf2−/− mice and a higher responsiveness of bone marrow-derived cells to osteoclastogenic stimuli in vitro. Conclusion. We have demonstrated in vivo a key role of Nrf2 in the maintenance of bone microarchitecture.
International Nuclear Information System (INIS)
Zeng, Xiaoyuan; Leng, Limin; Liu, Fangfang; Wang, Guanghua; Dong, Yuanyuan; Du, Li; Liu, Lina; Liao, Shijun
2016-01-01
Highlights: • Graphene-like nori-derived carbon was prepared as a new cathode of Li-O_2 battery. • The battery showed superior round-trip efficiency and good cycling stability. • The NORI catalyst with LiI dramatically enhanced the performance of Li-O_2 battery. • The added LiI changed the morphology and chemical nature of the discharge products. - Abstract: To rapidly promote the development of electric vehicles, an efficient cathode catalyst for Li-O_2 batteries is urgently needed. In the present study, we prepared a new type of doped carbon catalyst derived from nori biomass for the cathode of Li-O_2 batteries, using a hydrothermal carbonization and pyrolysis method. The catalyst presented a graphene-like nanosheet structure, a high surface area, and excellent ORR/OER activity. Li-O_2 batteries with this catalyst exhibited superior round-trip efficiency (at current densities of 500 mA/g, the corresponding coulombic efficiency was 99.8%) and excellent cycling stability (100 stable cycles at 200 mA/g under capacity limitation). Furthermore, the charge–discharge overpotential could be reduced dramatically by adding LiI to the electrolyte, resulting in greatly enhanced battery performance. The battery’s energy efficiency was over 90%, even after 100 cycles at limited capacity. We concluded the following: (i) the high surface area and nanosheet structure of the nori catalyst provided sufficient space not only to accommodate the discharge products but also to guarantee that oxygen, soluble catalyst, and lithium ions could be freely transported; and (ii) these combined with the redox mediator LiI that was added to the electrolyte, which could freely access the interior of the air electrode, easily reacting with the solid discharge products and effectively changing the morphology and chemical nature of the discharge products. We believe these factors were responsible for the significantly enhanced performance of the resulting Li-O_2 batteries, suggesting
LENUS (Irish Health Repository)
Cooley, Sharon M
2012-02-01
OBJECTIVE: To investigate the relationship between levels of insulin-like growth factors 1 and 2 (IGF-1, IGF-2) and insulin-like growth factor binding protein 3 (IGFBP-3) in antenatal maternal serum and gestational hypertension and pre-eclampsia (PET). METHODS: Prospective cohort study of 1650 low-risk Caucasian women in a University teaching hospital in London. Statistical analysis was performed using commercial software (SPSS for Windows, version 6.1, SPSS, Chicago, IL), with P < 0.05 as significant. Maternal IGF 1, IGF 2 and IGF BP-3 were assessed on maternal blood at booking. Blood pressure was checked at each visit in conjunction with urine analysis. The Davey & MacGillivray 1988 classification system was used in making the diagnosis of PET. RESULTS: There was no significant correlation between maternal IGF-1 or IGFBP-3 levels and gestational hypertension or PET. However, a significant positive correlation does exist between maternal IGF-2 levels and PET. CONCLUSIONS: Maternal IGF-2 has a significant positive correlation with PET.
Kheradmand, Fatemeh; Hashemnia, Seyyed Mohammad Reza; Valizadeh, Nasim; Roshan-Milani, Shiva
2016-01-01
Growth factors play an essential role in the development of tumor and normal cells like testicular leydig cells. Treatment of cancer with anti-cancer agents like imatinib mesylate may interfere with normal leydig cell activity, growth and fertility through failure in growth factors' production or their signaling pathways. The purpose of the study was to determine cellular viability and the levels of, platelet derived growth factor (PDGF) and stem cell factor (SCF) in normal mouse leydig cells exposed to imatinib, and addressing the effect of imatinib on fertility potential. The mouse TM3 leydig cells were treated with 0 (control), 2.5, 5, 10 and 20 μM imatinib for 2, 4 and 6 days. Each experiment was repeated three times (15 experiments in each day).The cellular viability and growth factors levels were assessed by MTT and ELISA methods, respectively. For statistical analysis, one-way ANOVA with Tukey's post hoc and Kruskal-Wallis test were performed. A p-value less than 0.05 was considered statistically significant. With increasing drug concentration, cellular viability decreased significantly (pcellular viability, PDGF and SCF levels. Imatinib may reduce fertility potential especially at higher concentrations in patients treated with this drug by decreasing cellular viability. The effect of imatinib on leydig cells is associated with PDGF stimulation. Of course future studies can be helpful in exploring the long term effects of this drug.
Grieco, Steven F.; Cheng, Yuyan; Eldar-Finkelman, Hagit; Jope, Richard S.; Beurel, Eléonore
2016-01-01
An antidepressant dose of the rapidly-acting ketamine inhibits glycogen synthase kinase-3 (GSK3) in mouse hippocampus, and this inhibition is required for the antidepressant effect of ketamine in learned helplessness depression-like behavior. Here we report that treatment with an antidepressant dose of ketamine (10 mg/kg) increased expression of insulin-like growth factor 2 (IGF2) in mouse hippocampus, an effect that required ketamine-induced inhibition of GSK3. Ketamine also inhibited hippocampal GSK3 and increased expression of hippocampal IGF2 in mice when administered after the induction of learned helplessness. Treatment with the specific GSK3 inhibitor L803-mts was sufficient to up-regulate hippocampal IGF2 expression. Administration of IGF2 siRNA reduced ketamine's antidepressant effect in the learned helplessness paradigm. Mice subjected to the learned helplessness paradigm were separated into two groups, those that were resilient (non-depressed) and those that were susceptible (depressed). Non-depressed resilient mice displayed higher expression of IGF2 than susceptible mice. These results indicate that IGF2 contributes to ketamine's antidepressant effect and that IGF2 may confer resilience to depression-like behavior. PMID:27542584
Gauge coupling unification in superstring derived standard-like models
International Nuclear Information System (INIS)
Faraggi, A.E.
1992-11-01
I discuss gauge coupling unification in a class of superstring standard-like models, which are derived in the free fermionic formulation. Recent calculations indicate that the superstring unification scale is at O(10 18 GeV) while the minimal supersymmetric standard model is consistent with LEP data if the unification scale is at O(10 16 )GeV. A generic feature of the superstring standard-like models is the appearance of extra color triplets (D,D), and electroweak doublets (l,l), in vector-like representations, beyond the supersymmetric standard model. I show that the gauge coupling unification at O(10 18 GeV) in the superstring standard-like models can be consistent with LEP data. I present an explicit standard-like model that can realize superstring gauge coupling unification. (author)
Todd, Levi; Volkov, Leo I.; Zelinka, Chris; Squires, Natalie; Fischer, Andy J.
2015-01-01
Müller glia can be stimulated to de-differentiate, proliferate and form Müller glia-derived progenitor cells (MGPCs) that regenerate retinal neurons. In the zebrafish retina, Heparin-Binding EGF-like Growth Factor (HB-EGF) may be one of the key factors that stimulate the formation of proliferating MGPCs. Currently nothing is known about the influence of HB-EGF on the proliferative potential of Müller glia in retinas of birds and rodents. In the chick retina, we found that levels of both hb-egf and egf-receptor are rapidly and transiently up-regulated following NMDA-induced damage. Although intraocular injections of HB-EGF failed to stimulate cell-signaling or proliferation of Müller glia in normal retinas, HB-EGF stimulated proliferation of MGPCs in damaged retinas. By comparison, inhibition of the EGF-receptor (EGFR) decreased the proliferation of MGPCs in damaged retinas. HB-EGF failed to act synergistically with FGF2 to stimulate the formation of MGPCs in the undamaged retina and inhibition of EGF-receptor did not suppress FGF2-mediated formation of MGPCs. In the mouse retina, HB-EGF stimulated the proliferation of Müller glia following NMDA-induced damage. Furthermore, HB-EGF stimulated not only MAPK-signaling in Müller glia/MGPCs, but also activated mTor- and Jak/Stat-signaling. We propose that levels of expression of EGFR are rate-limiting to the responses of Müller glia to HB-EGF and the expression of EGFR can be induced by retinal damage, but not by FGF2-treatment. We conclude that HB-EGF is mitogenic to Müller glia in both chick and mouse retinas, and HB-EGF is an important player in the formation of MGPCs in damaged retinas. PMID:26500021
Role of Stress-Related Brain-Derived Neurotrophic Factor (BDNF) in the Rat Submandibular Gland
International Nuclear Information System (INIS)
Tsukinoki, Keiichi; Saruta, Juri
2012-01-01
The nerve growth factor (NGF) family comprises NGF, brain-derived neurotrophic factor (BDNF) and neurotrophins (NTs)-3, -4/5, -6 and -7, all of which are collectively referred to as neurotrophins. However, the expression of neurotrophins other than NGF in the salivary gland has not been described in detail. Through interaction with the TrkB receptor, BDNF plays an important role in long-term potentiation. We found that BDNF expression increased within submandibular gland tissue in response to stress, suggesting that the salivary glands are sensitive to stress. In addition, stress caused increases in plasma BDNF derived from the submandibular gland and in TrkB receptor mRNA in the adrenal medulla. Plasma BDNF might activate TrkB receptors in the adrenal medulla during acute stress. The salivary glands are likely to influence not only oral health, but also systemic organs. This review addressed the relationship between hormone-like effects and stress-related BDNF expression in the rat submandibular gland
Mathijssen, Natascha C J; Masereeuw, Rosalinde; Holme, Pal Andre; van Kraaij, Marian G J; Laros-van Gorkom, Britta A P; Peyvandi, Flora; van Heerde, Waander L
2013-08-01
Prophylaxis with plasma-derived or recombinant activated factor VII is beneficial in severe factor VII deficiency. To understand why prophylactic treatment with both products is efficacious, we conducted a pharmacokinetic study. Ten factor VII deficient patients were treated with either recombinant activated (20 μg/kg) or plasma-derived (25 IU/kg) factor VII in a cross-over design. Pharmacokinetic parameters were analyzed through activated factor VII activity, factor VII clotting activity, and factor VII antigen levels on depicted time points. Factor VII activity half-lifes, determined by non-compartmental and one-compartmental analysis (results in brackets), were shorter for recombinant activated (1.4h; 0.7h) than for plasma-derived factor VII (6.8h; 3.2h); both recombinant activated (5.1h; 2.1h and plasma-derived factor VII (5.8h; 3.2h) resulted in longer half-lives of factor VII antigen. Activated factor VII half-lives (based on activated factor VII activity levels) were significantly higher compared to factor VII clotting activity (1.6h; 0.9h). Volumes of distribution were significantly higher for activated factor VII (236 ml/kg; 175 ml/kg, measured by activated factor VII) as compared to plasma-derived factor VII (206 ml/kg; 64 ml/kg, measured by factor FVII activity), suggesting a plasma- and extracellular fluid distribution for recombinant activated factor VII. Recombinant activated factor VII showed significantly shorter half-lifes than plasma-derived factor VII. Volumes of distribution were significantly higher for treatment with recombinant activated factor VII. The longer half-life for plasma-derived factor VII, compared to recombinant activated factor VII, and the increased volume of distribution for recombinant activated factor VII, compared to plasma-derived factor VII may further elucidate the beneficial effect of prophylactic treatment of both products. Copyright © 2013 Elsevier Ltd. All rights reserved.
Bennewith, Kevin L; Huang, Xin; Ham, Christine M; Graves, Edward E; Erler, Janine T; Kambham, Neeraja; Feazell, Jonathan; Yang, George P; Koong, Albert; Giaccia, Amato J
2009-02-01
Pancreatic cancer is highly aggressive and refractory to existing therapies. Connective tissue growth factor (CTGF/CCN2) is a fibrosis-related gene that is thought to play a role in pancreatic tumor progression. However, CCN2 can be expressed in a variety of cell types, and the contribution of CCN2 derived from either tumor cells or stromal cells as it affects the growth of pancreatic tumors is unknown. Using genetic inhibition of CCN2, we have discovered that CCN2 derived from tumor cells is a critical regulator of pancreatic tumor growth. Pancreatic tumor cells derived from CCN2 shRNA-expressing clones showed dramatically reduced growth in soft agar and when implanted s.c. We also observed a role for CCN2 in the growth of pancreatic tumors implanted orthotopically, with tumor volume measurements obtained by positron emission tomography imaging. Mechanistically, CCN2 protects cells from hypoxia-mediated apoptosis, providing an in vivo selection for tumor cells that express high levels of CCN2. We found that CCN2 expression and secretion was increased in hypoxic pancreatic tumor cells in vitro, and we observed colocalization of CCN2 and hypoxia in pancreatic tumor xenografts and clinical pancreatic adenocarcinomas. Furthermore, we found increased CCN2 staining in clinical pancreatic tumor tissue relative to stromal cells surrounding the tumor, supporting our assertion that tumor cell-derived CCN2 is important for pancreatic tumor growth. Taken together, these data improve our understanding of the mechanisms responsible for pancreatic tumor growth and progression, and also indicate that CCN2 produced by tumor cells represents a viable therapeutic target for the treatment of pancreatic cancer.
Nrf2, the Master Regulator of Anti-Oxidative Responses
Directory of Open Access Journals (Sweden)
Sandra Vomund
2017-12-01
Full Text Available Tight regulation of inflammation is very important to guarantee a balanced immune response without developing chronic inflammation. One of the major mediators of the resolution of inflammation is the transcription factor: the nuclear factor erythroid 2-like 2 (Nrf2. Stabilized following oxidative stress, Nrf2 induces the expression of antioxidants as well as cytoprotective genes, which provoke an anti-inflammatory expression profile, and is crucial for the initiation of healing. In view of this fundamental modulatory role, it is clear that both hyper- or hypoactivation of Nrf2 contribute to the onset of chronic diseases. Understanding the tight regulation of Nrf2 expression/activation and its interaction with signaling pathways, known to affect inflammatory processes, will facilitate development of therapeutic approaches to prevent Nrf2 dysregulation and ameliorate chronic inflammatory diseases. We discuss in this review the principle mechanisms of Nrf2 regulation with a focus on inflammation and autophagy, extending the role of dysregulated Nrf2 to chronic diseases and tumor development.
Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu
2018-04-01
During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.
Wan Hasan, Wan Nuraini; Kwak, Mi-Kyoung; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum
2014-02-23
Nuclear factor-erythroid 2 p45 related factor 2 (Nrf2) is a primary transcription factor, protecting cells from oxidative stress by regulating a number of antioxidants and phase II detoxifying enzymes. Dietary components such as sulforaphane in broccoli and quercetin in onions have been shown to be inducers of Nrf2. Piper betle (PB) grows well in tropical climate and the leaves are used in a number of traditional remedies for the treatment of stomach ailments and infections among Asians. The aim of this study was to elucidate the effect of Piper betle (PB) leaves extract in Nrf2 signaling pathway by using 2 types of cells; mouse embryonic fibroblasts (MEFs) derived from wild-type (WT) and Nrf2 knockout (N0) mice. WT and N0 cells were treated with 5 and 10 μg/ml of PB for 10 and 12-h for the determination of nuclear translocation of Nrf2 protein. Luciferase reporter gene activity was performed to evaluate the antioxidant response element (ARE)-induction by PB. Real-time PCR and Western blot were conducted on both WT and N0 cells after PB treatment for the determination of antioxidant enzymes [superoxide dismutase (SOD1) and heme-oxygenase (HO-1)], phase I oxidoreductase enzymes [ quinone oxidoreductase (NQO1)] and phase II detoxifying enzyme [glutathione S-transferase (GST)]. Nuclear translocation of Nrf2 by PB in WT cells was better after 10 h incubation compared to 12 h. Real time PCR and Western blot analysis showed increased expressions of Nrf2, NQO1 and GSTA1 genes with corresponding increases in glutathione, NQO1 and HO-1 proteins in WT cells. Reporter gene ARE was stimulated by PB as shown by ARE/luciferase assay. Interestingly, PB induced SOD1 gene and protein expressions in N0 cells but not in WT cells. The results of this study confirmed that PB activated Nrf2-ARE signaling pathway which subsequently induced some phase I oxidoreductase, phase II detoxifying and antioxidant genes expression via ARE reporter gene involved in the Nrf2 pathway with the
Directory of Open Access Journals (Sweden)
Mojdeh Abbasi
2018-03-01
Full Text Available SH2 domain-containing tyrosine phosphatase-2 (PTPN11 or Shp2 is a ubiquitously expressed protein that plays a key regulatory role in cell proliferation, differentiation and growth factor (GF signaling. This enzyme is well expressed in various retinal neurons and has emerged as an important player in regulating survival signaling networks in the neuronal tissues. The non-receptor phosphatase can translocate to lipid rafts in the membrane and has been implicated to regulate several signaling modules including PI3K/Akt, JAK-STAT and Mitogen Activated Protein Kinase (MAPK pathways in a wide range of biochemical processes in healthy and diseased states. This review focuses on the roles of Shp2 phosphatase in regulating brain-derived neurotrophic factor (BDNF neurotrophin signaling pathways and discusses its cross-talk with various GF and downstream signaling pathways in the retina.
Directory of Open Access Journals (Sweden)
Si Qin
2017-10-01
Full Text Available Reactive oxygen species (ROS can be caused by mechanical, thermal, infectious, and chemical stimuli, and their negative effects on the health of humans and other animals are of considerable concern. The nuclear factor (erythroid-derived 2-like 2/Kelch-like ECH-associated protein 1 (Nrf2/Keap1 system plays a major role in maintaining the balance between the production and elimination of ROS via the regulation of a series of detoxifying and antioxidant enzyme gene expressions by means of the antioxidant response element (ARE. Dietary phytochemicals, which are generally found in vegetables, fruits, grains, and herbs, have been reported to have health benefits and to improve the growth performance and meat quality of farm animals through the regulation of Nrf2-mediated phase II enzymes in a variety of ways. However, the enormous quantity of somewhat chaotic data that is available on the effects of phytochemicals needs to be properly classified according to the functions or mechanisms of phytochemicals. In this review, we first introduce the antioxidant properties of phytochemicals and their relation to the Nrf2/Keap1 system. We then summarize the effects of phytochemicals on the growth performance, meat quality, and intestinal microbiota of farm animals via targeting the Nrf2/Keap1 system. These exhaustive data contribute to better illuminate the underlying biofunctional properties of phytochemicals in farm animals.
Marcantonio, F.; Lyle, M. W.; Ibrahim, R.
2013-12-01
of the paired sites, with the higher MARs always at the potentially winnowed sites. The 'thick' Carnegie Ridge site has a 230Th-derived focusing factor of about 6. However, we believe that, given our observations of the radiocarbon-derived fluxes of sand, the high 230Th-derived focusing factor is likely an overestimate of the degree of focusing, and the average 230Th-derived MAR is likely an underestimate of the true MAR. Similarly, the biasing for the 'thin' Cocos site that has a 230Th-derived focusing factor of 0.2 (i.e., potential winnowing) is expected to be the opposite, namely, 230Th-derived fluxes are likely being overestimated there. The quantitative extent to which 230Th-derived focusing factors have been over- and under-estimated in the Panama Basin will be discussed. We hypothesize that size fractionation, as well as 230Th focusing errors, occur most frequently at lower current velocities where the fine and coarse fraction of the sediment components are more effectively sorted from each other.
DEFF Research Database (Denmark)
Lambers Heerspink, Hiddo J; Chertow, Glenn M; Akizawa, Tadao
2013-01-01
Type 2 diabetes mellitus (T2DM) is the most important contributing cause of end-stage renal disease (ESRD) worldwide. Bardoxolone methyl, a nuclear factor-erythroid-2-related factor 2 activator, augments estimated glomerular filtration. The Bardoxolone methyl EvAluation in patients with Chronic...
Shukla, Praveen; Ghatta, Srinivas; Dubey, Nidhi; Lemley, Caleb O; Johnson, Mary Lynn; Modgil, Amit; Vonnahme, Kimberly; Caton, Joel S; Reynolds, Lawrence P; Sun, Chengwen; O'Rourke, Stephen T
2014-07-15
The mechanisms underlying developmental programming are poorly understood but may be associated with adaptations by the fetus in response to changes in the maternal environment during pregnancy. We hypothesized that maternal nutrient restriction during pregnancy alters vasodilator responses in fetal coronary arteries. Pregnant ewes were fed a control [100% U.S. National Research Council (NRC)] or nutrient-restricted (60% NRC) diet from days 50 to 130 of gestation (term = 145 days); fetal tissues were collected at day 130. In coronary arteries isolated from control fetal lambs, relaxation to bradykinin was unaffected by nitro-l-arginine (NLA). Iberiotoxin or contraction with KCl abolished the NLA-resistant response to bradykinin. In fetal coronary arteries from nutrient-restricted ewes, relaxation to bradykinin was fully suppressed by NLA. Large-conductance, calcium-activated potassium channel (BKCa) currents did not differ in coronary smooth muscle cells from control and nutrient-restricted animals. The BKCa openers, BMS 191011 and NS1619, and 14,15-epoxyeicosatrienoic acid [a putative endothelium-derived hyperpolarizing factor (EDHF)] each caused fetal coronary artery relaxation and BKCa current activation that was unaffected by maternal nutrient restriction. Expression of BKCa-channel subunits did not differ in fetal coronary arteries from control or undernourished ewes. The results indicate that maternal undernutrition during pregnancy results in loss of the EDHF-like pathway in fetal coronary arteries in response to bradykinin, an effect that cannot be explained by a decreased number or activity of BKCa channels or by decreased sensitivity to mediators that activate BKCa channels in vascular smooth muscle cells. Under these conditions, bradykinin-induced relaxation is completely dependent on nitric oxide, which may represent an adaptive response to compensate for the absence of the EDHF-like pathway. Copyright © 2014 the American Physiological Society.
LENUS (Irish Health Repository)
Cooley, Sharon M
2012-02-01
AIMS: To investigate the relationship between levels of insulin-like growth factors 1 and 2 (IGF-1, IGF-2), and insulin-like growth factor binding protein 3 (IGFBP-3) in antenatal maternal serum and gestational age at delivery. METHODS: Prospective cohort study of 1650 low-risk Caucasian women in a London University teaching hospital. Maternal IGF-1, IGF-2 and IGFBP-3 were measured in maternal blood at booking and analyzed with respect to gestational age at delivery. RESULTS: There was no significant association between maternal IGF-1 or IGF-2 and preterm birth (PTB). A significant reduction in mean IGFBP-3 levels was noted with delivery <32 completed weeks (P=0.02). CONCLUSION: Maternal mean IGFBP-3 levels are significantly reduced in cases complicated by delivery <32 completed weeks.
Age-related retinopathy in NRF2-deficient mice.
Directory of Open Access Journals (Sweden)
Zhenyang Zhao
2011-04-01
Full Text Available Cumulative oxidative damage is implicated in the pathogenesis of age-related macular degeneration (AMD. Nuclear factor erythroid 2-related factor 2 (NRF2 is a transcription factor that plays key roles in retinal antioxidant and detoxification responses. The purposes of this study were to determine whether NRF2-deficient mice would develop AMD-like retinal pathology with aging and to explore the underlying mechanisms.Eyes of both wild type and Nrf2(-/- mice were examined in vivo by fundus photography and electroretinography (ERG. Structural changes of the outer retina in aged animals were examined by light and electron microscopy, and immunofluorescence labeling. Our results showed that Nrf2(-/- mice developed age-dependent degenerative pathology in the retinal pigment epithelium (RPE. Drusen-like deposits, accumulation of lipofuscin, spontaneous choroidal neovascularization (CNV and sub-RPE deposition of inflammatory proteins were present in Nrf2(-/- mice after 12 months. Accumulation of autophagy-related vacuoles and multivesicular bodies was identified by electron microscopy both within the RPE and in Bruch's membrane of aged Nrf2(-/- mice.Our data suggest that disruption of Nfe2l2 gene increased the vulnerability of outer retina to age-related degeneration. NRF2-deficient mice developed ocular pathology similar to cardinal features of human AMD and deregulated autophagy is likely a mechanistic link between oxidative injury and inflammation. The Nrf2(-/- mice can provide a novel model for mechanistic and translational research on AMD.
DEFF Research Database (Denmark)
Krogh, T N; Bachmann, E; Teisner, B
1997-01-01
By means of sequence analysis, murine fetal antigen 1 (mFA1) isolated from Mus musculus amniotic fluid was shown to be the circulating protein of the delta-like protein, stromal-cell-derived protein 1 (SCP-1) and preadipocyte factor 1 (Pref-1) gene products. The protein contains 36 cysteine...... residues arranged in six epidermal-growth-factor-like domains. The purification of several C-terminal peptides of varying lengths showed mFA1 to be C-terminal heterogeneous. O-linked glycosylations of the NeuNAc alpha2-3Gal beta1-3(NeuNAc alpha2-6)GalNAc type were present on all C-terminal peptides...... at residues Thr235, Thr244 and Thr248, although glycosylation on Thr244 was only partial. Three N-linked glycosylations were localized in mFA1 (Asn77, Asn142 and Asn151), two of which (Asn142 and Asn151) were in the unusual Asn-Xaa-Cys motif. Fucosylated biantennary complex-type and small amounts (less than 5...
Directory of Open Access Journals (Sweden)
Dantzer Robert
2011-02-01
Full Text Available Abstract Exogenous administration of insulin-like growth factor (IGF-I has anti-depressant properties in rodent models of depression. However, nothing is known about the anti-depressant properties of IGF-I during inflammation, nor have mechanisms by which IGF-I alters behavior following activation of the innate immune system been clarified. We hypothesized that central IGF-I would diminish depressive-like behavior on a background of an inflammatory response and that it would do so by inducing expression of the brain-derived neurotrophic factor (BDNF while decreasing pro-inflammatory cytokine expression in the brain. IGF-I (1,000 ng was administered intracerebroventricularly (i.c.v. to CD-1 mice. Mice were subsequently given lipopolysaccharide i.c.v. (LPS, 10 ng. Sickness and depressive-like behaviors were assessed followed by analysis of brain steady state mRNA expression. Central LPS elicited typical transient signs of sickness of mice, including body weight loss, reduced feed intake and decreased social exploration toward a novel juvenile. Similarly, LPS increased time of immobility in the tail suspension test (TST. Pretreatment with IGF-I or antidepressants significantly decreased duration of immobility in the TST in both the absence and presence of LPS. To elucidate the mechanisms underlying the anti-depressant action of IGF-I, we quantified steady-state mRNA expression of inflammatory mediators in whole brain using real-time RT-PCR. LPS increased, whereas IGF-I decreased, expression of inflammatory markers interleukin-1ß (IL-1ß, tumor necrosis factor-(TNFα, inducible nitric oxide synthase (iNOS and glial fibrillary acidic protein (GFAP. Moreover, IGF-I increased expression of BDNF. These results indicate that IGF-I down regulates glial activation and induces expression of an endogenous growth factor that shares anti-depressant activity. These actions of IGF-I parallel its ability to diminish depressive-like behavior.
2011-01-01
Exogenous administration of insulin-like growth factor (IGF)-I has anti-depressant properties in rodent models of depression. However, nothing is known about the anti-depressant properties of IGF-I during inflammation, nor have mechanisms by which IGF-I alters behavior following activation of the innate immune system been clarified. We hypothesized that central IGF-I would diminish depressive-like behavior on a background of an inflammatory response and that it would do so by inducing expression of the brain-derived neurotrophic factor (BDNF) while decreasing pro-inflammatory cytokine expression in the brain. IGF-I (1,000 ng) was administered intracerebroventricularly (i.c.v.) to CD-1 mice. Mice were subsequently given lipopolysaccharide i.c.v. (LPS, 10 ng). Sickness and depressive-like behaviors were assessed followed by analysis of brain steady state mRNA expression. Central LPS elicited typical transient signs of sickness of mice, including body weight loss, reduced feed intake and decreased social exploration toward a novel juvenile. Similarly, LPS increased time of immobility in the tail suspension test (TST). Pretreatment with IGF-I or antidepressants significantly decreased duration of immobility in the TST in both the absence and presence of LPS. To elucidate the mechanisms underlying the anti-depressant action of IGF-I, we quantified steady-state mRNA expression of inflammatory mediators in whole brain using real-time RT-PCR. LPS increased, whereas IGF-I decreased, expression of inflammatory markers interleukin-1ß (IL-1ß), tumor necrosis factor-(TNF)α, inducible nitric oxide synthase (iNOS) and glial fibrillary acidic protein (GFAP). Moreover, IGF-I increased expression of BDNF. These results indicate that IGF-I down regulates glial activation and induces expression of an endogenous growth factor that shares anti-depressant activity. These actions of IGF-I parallel its ability to diminish depressive-like behavior. PMID:21306618
Pathogenetic Role of JAK2 V617F Mutation in Chronic Myeloproliferative Disorders
Directory of Open Access Journals (Sweden)
Hui-Chi Hsu
2007-03-01
Full Text Available The molecular pathogenesis of chronic myeloproliferative disorders (MPDs is poorly understood. The hematopoietic progenitor cells of patients with polycythemia vera (PV or essential thrombocythemia (ET are characterized by hypersensitiv-ity to hematopoietic growth factors and formation of endogenous erythroid colonies. Recently, 4 groups reported almost simultaneously Janus kinase 2 (JAK2 V617F mutation in more than 80% of PV patients, 30% of patients with ET and in about 50% of patients with idiopathic myelofibrosis. The identification of the JAK2 mutation represents a major advance in the understanding of the molecular pathogenesis of MPDs that will likely permit a new classification and the development of novel therapeutic strategies for these diseases.
Polyacrylonitrile-Derived Sponge-Like Micro/Macroporous Carbon for Selective CO2 Separation.
Guo, Li-Ping; Hu, Qing-Tao; Zhang, Peng; Li, Wen-Cui; Lu, An-Hui
2018-03-25
CO 2 capture under a dynamical flow situation requires adsorbents possessing balanced proportion of macropores as diffusion path and micropores as adsorption reservoir. However, the construction of interconnected micro-/macropores structure coupled with abundant nitrogen species into one carbon skeleton remains a challenge. Here, we report a new approach to prepare sponge-like carbon with a well-developed micro-/macroporous structure and enriched nitrogen species through aqueous phase polymerization of acrylonitrile in the presence of graphene oxide. The tension stress caused by the uniform thermal shrinkage of polyacrylonitrile during the pyrolysis together with the favorable flexibility of graphene oxide sheets are responsible for the formation of the sponge-like morphology. The synergistic effect of micro-/macroporous framework and rich CO 2 -philic site enables such carbon to decrease resistance to mass transfer and show high CO 2 dynamic selectivity over N 2 (454) and CH 4 (11), as well as good CO 2 capacity at 298 K under low CO 2 partial pressure (0.17 bar, a typical CO 2 partial pressure in flue gas). The above attributes make this porous carbon a promising candidate for CO 2 capture from flue gas, methane sources and other relevant applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Zeuthen, Louise; Fink, Lisbeth Nielsen; Frøkiær, Hanne
2008-01-01
-marrow-derived DC lacking NOD2 produce higher levels of interleukin-10 (IL-10) and reduced levels of IL-12 and tumour necrosis factor-[alpha] (TNF-[alpha]) in response to LAB. This indicates that peptidoglycan is partly responsible for the T helper type 1 skewing effect of certain LAB. Dendritic cells that are TLR2......-[alpha]-inducing bifidobacteria inhibit the T helper type 1 skewing effect induced by strong immunostimulatory lactobacilli. Here we show that this immunoinhibitory effect of bifidobacteria is dependent on TLR2 and independent of NOD2. Moreover, independently of the cytokine pattern induced by intact LAB, cell wall fractions...
Directory of Open Access Journals (Sweden)
Hui Wang
2014-01-01
Full Text Available Diabetic retinopathy (DR is a major microvascular complication in diabetics, and its mechanism is not fully understood. Toll-like receptor 4 (TLR4 plays a pivotal role in the maintenance of the inflammatory state during DR, and the deletion of TLR4 eventually alleviates the diabetic inflammatory state. To further elucidate the mechanism of DR, we used bone marrow transplantation to establish reciprocal chimeric animals of TLR4 mutant mice and TLR4 WT mice combined with diabetes mellitus (DM induction by streptozotocin (STZ treatment to identify the role of TLR4 in different cell types in the development of the proinflammatory state during DR. TLR4 mutation did not block the occurrence of high blood glucose after STZ injection compared with WT mice but did alleviate the progression of DR and alter the expression of the small vessel proliferation-related genes, vascular endothelial growth factor (VEGF, and hypoxia inducible factor-1α (HIF-1α. Grafting bone marrow-derived cells from TLR4 WT mice into TLR4 mutant mice increased the levels of TNF-α, IL-1β, and MIP-2 and increased the damage to the retina. Similarly, VEGF and HIF-1α expression were restored by the bone marrow transplantation. These findings identify an essential role for TLR4 in bone marrow-derived cells contributing to the progression of DR.
Sahin, K; Orhan, C; Tuzcu, M; Sahin, N; Hayirli, A; Bilgili, S; Kucuk, O
2016-05-01
This study was conducted to evaluate the effects of dietary lycopene supplementation on growth performance, antioxidant status, and muscle nuclear transcription factor [Kelch like-ECH-associated protein 1 (Keap1) and (erythroid-derived 2)-like 2 (Nrf2)] expressions in broiler chickens exposed to heat stress (HS). A total of 180 one-day-old male broiler chicks (Ross 308) were assigned randomly to one of 2×3 factorially arranged treatments: two housing temperatures (22°C for 24 h/d; thermoneutral, TN or 34°C for 8 h/d HS) and three dietary lycopene levels (0, 200, or 400 mg/kg). Each treatment consisted of three replicates of 10 birds. Birds were reared to 42 d of age. Heat stress caused reductions in feed intake and weight gain by 12.2 and 20.7% and increased feed efficiency by 10.8% (Plycopene level improved performance in both environments. Birds reared under the HS environment had lower serum and muscle lycopene concentration (0.34 vs. 0.50 μg/mL and 2.80 vs. 2.13 μg/g), activities of superoxide dismutase (151 vs. 126 U/mL and 131 vs. 155 U/mg protein), glutathione peroxidase (184 vs. 154 U/mL and 1.39 vs. 1.74 U/mg protein), and higher malondialdehyde (MDA) concentration (0.53 vs. 0.83 μg/mL and 0.78 vs. 0.45 μg/ mg protein) than birds reared under the TN environment. Changes in levels of lycopene and MDA and activities of enzymes in serum and muscle varied by the environmental temperature as dietary lycopene level increased. Moreover, increasing dietary lycopene level suppressed muscle Keap1 expression and enhanced muscle Nrf2 expression, which had increased by 150% and decreased by 40%, respectively in response to HS. In conclusion, lycopene supplementation alleviates adverse effects of HS on performance through modulating expressions of stress-related nuclear transcription factors. © 2016 Poultry Science Association Inc.
Directory of Open Access Journals (Sweden)
Sae-lo-oom Lee
2016-01-01
Full Text Available Although many studies have examined the roles of hypoxia and transforming growth factor- (TGF- β separately in the tumor microenvironment, the effects of simultaneous treatment with hypoxia/reoxygenation and TGF-β on tumor malignancy are unclear. Here, we investigated the effects of redox signaling and oncogenes on cell proliferation and radioresistance in A549 human lung cancer cells in the presence of TGF-β under hypoxia/reoxygenation conditions. Combined treatment with TGF-β and hypoxia activated epidermal growth factor receptor (EGFR and nuclear factor (erythroid-derived 2-like 2 (Nrf2, a redox-sensitive transcription factor. Interestingly, Nrf2 knockdown suppressed the effects of combined treatment on EGFR phosphorylation. In addition, blockade of EGFR signaling also suppressed induction of Nrf2 following combined treatment with hypoxia and TGF-β, indicating that the combined treatment induced positive crosstalk between Nrf2 and EGFR. TGF-β and hypoxia/reoxygenation increased the accumulation of reactive oxygen species (ROS, while treatment with N-acetyl-L-cysteine abolished the activation of Nrf2 and EGFR. Treatment with TGF-β under hypoxic conditions increased the proliferation of A549 cells compared with that after vehicle treatment. Moreover, cells treated with the combined treatment exhibited resistance to ionizing radiation (IR, and knockdown of Nrf2 increased IR-induced cell death under these conditions. Thus, taken together, our findings suggested that TGF-β and hypoxia/reoxygenation promoted tumor progression and radioresistance of A549 cells through ROS-mediated activation of Nrf2 and EGFR.
Kubo, Atsuhiko; Yoshida, Tetsuhiko; Kobayashi, Nahoko; Yokoyama, Takaakira; Mimura, Toshiro; Nishiguchi, Takao; Higashida, Tetsuhiro; Yamamoto, Isao; Kanno, Hiroshi
2009-12-01
Skin-derived precursors (SKPs) from mammalian dermis represent neural crest-related stem cells capable of differentiating into both neural and mesodermal progency. SKPs are of clinical interest because they serve as accessible autologous donor cells for neuronal repair for neuronal intractable diseases. However, little is known about the efficient generation of neurons from SKPs, and phenotypes of neurons generated from SKPs have been restricted. In addition, the neuronal repair using their generated neurons as donor cells has not been achieved. The von Hippel-Lindau protein (pVHL) is one of the proteins that play an important role during neuronal differentiation, and recently neuronal differentiation of neural progenitor cells by intracellular delivery of a synthetic VHL peptide derived from elongin BC-binding site has been demonstrated. In the present study, a synthetic VHL peptide derived from elongin BC-binding site was conjugated to the protein transduction domain (PTD) of HIV-TAT protein (TATVHL peptide) to facilitate entry into cells, and we demonstrate the efficient generation of cells with dopaminergic phenotype from SKPs with the intracellular delivery of TATVHL peptide, and characterized the generated cells. The TATVHL peptide-treated SKPs expressed neuronal marker proteins, particularly dopamine neuron markers, and also up-regulated mRNA levels of proneural basic helix-loop-helix factors. After the TATVHL peptide treatment, transplanted SKPs into Parkinson's disease (PD) model rats sufficiently differentiated into dopamine neuron-like cells in PD model rats, and partially but significantly corrected behavior of PD model rats. The generated dopamine neuron-like cells are expected to serve as donor cells for neuronal repair for PD.
Insulin-like growth factors and pancreas beta cells.
Haeften, T.W. van; Twickler, M.
2004-01-01
Abstract Insulin-like growth factors (IGFs) have been implicated in normal growth, and especially foetal pancreas beta-cell development. As low birth weight has been implicated in the development of obesity and type 2 diabetes, much research has evolved into the importance of IGF and their
Insulin-like growth factors and pancreas beta cells
van Haeften, T. W.; Twickler, TB
Insulin-like growth factors (IGFs) have been implicated in normal growth, and especially foetal pancreas beta-cell development. As low birth weight has been implicated in the development of obesity and type 2 diabetes, much research has evolved into the importance of IGF and their signalling
Insulin-like growth factors and pancreas beta cells
van Haeften, T. W.; Twickler, Th B.
2004-01-01
Abstract Insulin-like growth factors (IGFs) have been implicated in normal growth, and especially foetal pancreas beta-cell development. As low birth weight has been implicated in the development of obesity and type 2 diabetes, much research has evolved into the importance of IGF and their
Directory of Open Access Journals (Sweden)
Ruisong Li
Full Text Available Human milk contains a wide variety of nutrients that contribute to the fulfillment of its functions, which include the regulation of newborn development. However, few studies have investigated the concentrations of S100B protein, brain-derived neurotrophic factor (BDNF, and glial cell line-derived neurotrophic factor (GDNF in human milk. The associations of the concentrations of S100B protein, BDNF, and GDNF with maternal factors are not well explored.To investigate the concentrations of S100B protein, BDNF, and GDNF in human milk and characterize the maternal factors associated with their levels in human milk, human milk samples were collected at days 3, 10, 30, and 90 after parturition. Levels of S100B protein, BDNF, and GDNF, and their mRNAs in the samples were detected. Then, these concentrations were compared with lactation and other maternal factors. S100B protein levels in human milk samples collected at 3, 10, 30, and 90 d after parturition were 1249.79±398.10, 1345.05±539.16, 1481.83±573.30, and 1414.39±621.31 ng/L, respectively. On the other hand, the BDNF concentrations in human milk samples were 10.99±4.55, 13.01±5.88, 13.35±6.43, and 2.83±5.47 µg/L, while those of GDNF were 10.90±1.65, 11.38±1., 11.29±3.10, and 11.40±2.21 g/L for the same time periods. Maternal post-pregnancy body mass index was positively associated with S100B levels in human milk (r = 0.335, P = 0.030<0.05. In addition, there was a significant correlation between the levels of S100B protein and BDNF (z = 2.09, P = 0.037<0.05. Delivery modes were negatively associated with the concentration of GDNF in human milk.S100B protein, BDNF, and GDNF are present in all samples of human milk, and they may be responsible for the long term effects of breast feeding.
Directory of Open Access Journals (Sweden)
Joseph Saliba
Full Text Available JAK2(V617F is the predominant mutation in myeloproliferative neoplasms (MPN. Modeling MPN in a human context might be helpful for the screening of molecules targeting JAK2 and its intracellular signaling. We describe here the derivation of induced pluripotent stem (iPS cell lines from 2 polycythemia vera patients carrying a heterozygous and a homozygous mutated JAK2(V617F, respectively. In the patient with homozygous JAK2(V617F, additional ASXL1 mutation and chromosome 20 allowed partial delineation of the clonal architecture and assignation of the cellular origin of the derived iPS cell lines. The marked difference in the response to erythropoietin (EPO between homozygous and heterozygous cell lines correlated with the constitutive activation level of signaling pathways. Strikingly, heterozygous iPS cells showed thrombopoietin (TPO-independent formation of megakaryocytic colonies, but not EPO-independent erythroid colony formation. JAK2, PI3K and HSP90 inhibitors were able to block spontaneous and EPO-induced growth of erythroid colonies from GPA(+CD41(+ cells derived from iPS cells. Altogether, this study brings the proof of concept that iPS can be used for studying MPN pathogenesis, clonal architecture, and drug efficacy.
4-Hydroxy hexenal derived from docosahexaenoic acid protects endothelial cells via Nrf2 activation.
Directory of Open Access Journals (Sweden)
Atsushi Ishikado
Full Text Available Recent studies have proposed that n-3 polyunsaturated fatty acids (n-3 PUFAs have direct antioxidant and anti-inflammatory effects in vascular tissue, explaining their cardioprotective effects. However, the molecular mechanisms are not yet fully understood. We tested whether n-3 PUFAs showed antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (Nrf2, a master transcriptional factor for antioxidant genes. C57BL/6 or Nrf2(-/- mice were fed a fish-oil diet for 3 weeks. Fish-oil diet significantly increased the expression of heme oxygenase-1 (HO-1, and endothelium-dependent vasodilation in the aorta of C57BL/6 mice, but not in the Nrf2(-/- mice. Furthermore, we observed that 4-hydroxy hexenal (4-HHE, an end-product of n-3 PUFA peroxidation, was significantly increased in the aorta of C57BL/6 mice, accompanied by intra-aortic predominant increase in docosahexaenoic acid (DHA rather than that in eicosapentaenoic acid (EPA. Human umbilical vein endothelial cells were incubated with DHA or EPA. We found that DHA, but not EPA, markedly increased intracellular 4-HHE, and nuclear expression and DNA binding of Nrf2. Both DHA and 4-HHE also increased the expressions of Nrf2 target genes including HO-1, and the siRNA of Nrf2 abolished these effects. Furthermore, DHA prevented oxidant-induced cellular damage or reactive oxygen species production, and these effects were disappeared by an HO-1 inhibitor or the siRNA of Nrf2. Thus, we found protective effects of DHA through Nrf2 activation in vascular tissue, accompanied by intra-vascular increases in 4-HHE, which may explain the mechanism of the cardioprotective effects of DHA.
Naert, Gaelle; Ixart, Guy; Maurice, Tangui; Tapia-Arancibia, Lucia; Givalois, Laurent
2011-01-01
Depression is potentially life-threatening. The most important neuroendocrine abnormality in this disorder is hypothalamo-pituitary-adrenocortical (HPA) axis hyperactivity. Recent findings suggest that all depression treatments may boost the neurotrophin production especially brain-derived neurotrophic factor (BDNF). Moreover, BDNF is highly involved in the regulation of HPA axis activity. The aim of this study was to determine the impact of chronic stress (restraint 3h/day for 3 weeks) on animal behavior and HPA axis activity in parallel with hippocampus, hypothalamus and pituitary BDNF levels. Chronic stress induced changes in anxiety (light/dark box test) and anhedonic states (sucrose preference test) and in depressive-like behavior (forced swimming test); general locomotor activity and body temperature were modified and animal body weight gain was reduced by 17%. HPA axis activity was highly modified by chronic stress, since basal levels of mRNA and peptide hypothalamic contents in CRH and AVP and plasma concentrations in ACTH and corticosterone were significantly increased. The HPA axis response to novel acute stress was also modified in chronically stressed rats, suggesting adaptive mechanisms. Basal BDNF contents were increased in the hippocampus, hypothalamus and pituitary in chronically stressed rats and the BDNF response to novel acute stress was also modified. This multiparametric study showed that chronic restraint stress induced a depressive-like state that was sustained by mechanisms associated with BDNF regulation. Copyright © 2010 Elsevier Inc. All rights reserved.
Endogenous Digitalis-like Factors: An Overview of the History
Directory of Open Access Journals (Sweden)
Vardaman eBuckalew
2015-04-01
Full Text Available The sodium pump is a ubiquitous cell surface enzyme, a Na, K ATPase, which maintains ion gradients between cells and the extracellular fluid (ECF. The extracellular domain of this enzyme contains a highly conserved binding site, a receptor for a plant derived family of compounds, the digitalis glycosides. These compounds inhibit the enzyme and are used in the treatment of congestive heart failure, and certain cardiac arrhythmias. The highly conserved nature of this enzyme and its digitalis receptor led to early suggestions that endogenous regulators might exist. Recent examination of this hypothesis emerged from research in two separate areas: the regulation of ECF volume by a natriuretic hormone (NH, and the regulation of peripheral vascular resistance by a circulating inhibitor of vascular Na, K ATPase. These two areas merged with the hypothesis that NH and the vascular Na, K ATPase inhibitor were in fact the same entity, and that it played a causative role in the pathophysiology of certain types of hypertension. The possibility that multiple endogenous digitalis-like factors (EDLFs exist emerged from efforts to characterize the circulating enzyme inhibitory activity. In this review, the development of this field from its beginnings is traced, the current status of the structure of EDLFs is briefly discussed, and areas for future development are suggested. Key Words: natriuretic hormone, digitalis-like factor, hypertension, Na, K ATPase, ouabain, marinobufagenin, bufodienolides, cardenolides
Directory of Open Access Journals (Sweden)
Hongxiu Ning
Full Text Available Efforts to develop peripheral blood-derived nature killer (NK cells into therapeutic products have been hampered by these cells' low abundance and histoincompatibility. On the other hand, derivation of NK-like cells from more abundant cell sources such as embryonic stem cells (ESCs and umbilical cord blood (UCB requires the selection of rare CD34+ cells. Thus, we sought to convert adipose-derived stem cells (ADSCs, which are abundant and natively CD34+, into NK-like cells. When grown in hematopoietic induction medium, ADSCs formed sphere clusters and expressed hematopoietic markers CD34, CD45, and KDR. Further induction in NK cell-specific medium resulted in a population of cells that expressed NK cell marker CD56, and thus termed ADSC-NK. Alternatively, the hematopoietically induced ADSCs were transduced with NK cell-specific transcription factor E4BP4 prior to induction in NK cell-specific medium. This latter population of cells, termed ADSC-NKE, expressed CD56 and additional NK cell markers such as CD16, CD94, CD158, CD314, FasL, and NKp46. ADSC-NKE was as potent as NK leukemia cell NKL in killing breast cancer cell MCF7 and prostate cancer cells DU145, PC3, LnCap, DuPro, C4-2 and CWR22, but exhibited no killing activity toward normal endothelial and smooth muscle cells. In nude mice test ADSC-NKE was able to significantly delay the progression of tumors formed by MCF7 and PC3. When injected into immunocompetent rats, ADSC-NKE was detectable in bone marrow and spleen for at least 5 weeks. Together, these results suggest that ADSCs can be converted into NK-like cells with anti-tumor activities.
Ricci, A; Bertoletti, C
2009-05-01
Urea derivatives are synthetic compounds, some of which have proved to be positive regulators of cell division and differentiation. N-phenyl-N'-(2-chloro-4-pyridyl)urea (forchlorofenuron, CPPU) and N-phenyl-N'-(1,2,3-thiadiazol-5-yl)urea (thidiazuron, TDZ), well known urea cytokinin representatives, are extensively used in in vitro plant morphogenesis studies, as they show cytokinin-like activity often exceeding that of adenine compounds. In recent years, renewed interest in structure-activity relationship studies allowed identification of new urea cytokinins and other urea derivatives that specifically enhance adventitious root formation. In this review, we report the research history of urea derivatives, new insights into their biological activity, and recent progress on their mode of action.
Park, S; Park, H-L; Lee, S-Y; Nam, J-H
2016-03-01
Various pathogens are implicated in the induction of obesity. Previous studies have confirmed that human adenovirus 36 (Ad36) is associated with increased adiposity, improved glycemic control and induction of inflammation. The Ad36-induced inflammation is reflected in the infiltration of macrophages into adipose tissue. However, the characteristics and role of adipose tissue macrophages (ATMs) and macrophage-secreted factors in virus-induced obesity (VIO) are unclear. Although insulin-like growth factor-1 (IGF-1) is involved in obesity metabolism, the contribution of IGF secreted by macrophages in VIO has not been studied. Four-week-old male mice were studied 1 week and 12 weeks after Ad36 infection for determining the characteristics of ATMs in VIO and diet-induced obesity (DIO). In addition, macrophage-specific IGF-1-deficient (MIKO) mice were used to study the involvement of IGF-1 in VIO. In the early stage of VIO (1 week after Ad36 infection), the M1 ATM sub-population increased, which increased the M1/M2 ratio, whereas DIO did not cause this change. In the late stage of VIO (12 weeks after Ad36 infection), the M1/M2 ratio did not change because the M1 and M2 ATM sub-populations increased to a similar extent, despite an increase in adiposity. By contrast, DIO increased the M1/M2 ratio. In addition, VIO in wild-type mice upregulated angiogenesis in adipose tissue and improved glycemic control. However, MIKO mice showed no increase in adiposity, angiogenesis, infiltration of macrophages into adipose tissue, or improvement in glycemic control after Ad36 infection. These data suggest that IGF-1 secreted by macrophages may contribute to hyperplasia and hypertrophy in adipose tissue by increasing angiogenesis, which helps to maintain the 'adipose tissue robustness'.
International Nuclear Information System (INIS)
Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.
1986-01-01
Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells
Platelet-derived growth factor inhibits platelet activation in heparinized whole blood.
Selheim, F; Holmsen, H; Vassbotn, F S
1999-08-15
We previously have demonstrated that human platelets have functionally active platelet-derived growth factor alpha-receptors. Studies with gel-filtered platelets showed that an autocrine inhibition pathway is transduced through this tyrosine kinase receptor during platelet activation. The physiological significance of this inhibitory effect of platelet-derived growth factor on gel-filtered platelets activation is, however, not known. In the present study, we investigated whether platelet-derived growth factor inhibits platelet activation under more physiological conditions in heparinized whole blood, which represents a more physiological condition than gel-filtered platelets. Using flow cytometric assays, we demonstrate here that platelet-derived growth factor inhibits thrombin-, thrombin receptor agonist peptide SFLLRN-, and collagen-induced platelet aggregation and shedding of platelet-derived microparticles from the platelet plasma membrane during platelet aggregation in stirred heparinized whole blood. The inhibitory effect of platelet-derived growth factor was dose dependent. However, under nonaggregating conditions (no stirring), we could not demonstrate any significant effect of platelet-derived growth factor on thrombin- and thrombin receptor agonist peptide-induced platelet surface expression of P-selectin. Our results demonstrate that platelet-derived growth factor appears to be a true antithrombotic agent only under aggregating conditions in heparinized whole blood.
Buhrke, Thorsten; Schultrich, Katharina; Braeuning, Albert; Lampen, Alfonso
2017-08-01
3-Chloro-1,2-propanediol (3-MCPD) and its isomer 2-chloro-1,3-propanediol (2-MCPD) are heat-induced food contaminants present in oil- and fat-containing foodstuff. Kidney and testes are among the main target organs of 3-MCPD. Almost no data on 2-MCPD toxicity are available. Here, transcriptomic responses following repeated-dose exposure of rats to non-toxic doses of 10 mg/kg body weight per day 2-MCPD or 3-MCPD for 28 days were characterized by microarray analysis of kidney, liver, and testes. 3-MCPD exerted more pronounced effects than 2-MCPD in all organs. The limited overlap between the datasets indicates that 2-MCPD and 3-MCPD do not share the same molecular mechanisms of toxicity. By combining transcriptomic data with datasets on proteomic regulation by 3-MCPD, a comprehensive view on 3-MCPD-induced regulation of glucose utilization and oxidative stress response was developed. Bioinformatic analyses revealed that Nrf2 (nuclear factor (erythroid-derived 2)-like 2) signaling is likely to be involved in mediating the oxidative stress response to 3-MCPD. In summary, this study for the first time presents data on alterations in global gene expression by two important food contaminants, 2-MCPD and 3-MCPD. Data demonstrate profound differences between the effects of the two compounds and substantially broaden our knowledge on molecular details of 3-MCPD-induced disturbance of glucose utilization and redox balance. Copyright © 2017 Elsevier Ltd. All rights reserved.
Sulforaphane Prevents Angiotensin II-Induced Testicular Cell Death via Activation of NRF2
Directory of Open Access Journals (Sweden)
Yonggang Wang
2017-01-01
Full Text Available Although angiotensin II (Ang II was reported to facilitate sperm motility and intratesticular sperm transport, recent findings shed light on the efficacy of Ang II in stimulating inflammatory events in testicular peritubular cells, effect of which may play a role in male infertility. It is still unknown whether Ang II can induce testicular apoptotic cell death, which may be a more direct action of Ang II in male infertility. Therefore, the present study aims to determine whether Ang II can induce testicular apoptotic cell death and whether this action can be prevented by sulforaphane (SFN via activating nuclear factor (erythroid-derived 2-like 2 (NRF2, the governor of antioxidant-redox signalling. Eight-week-old male C57BL/6J wild type (WT and Nrf2 gene knockout mice were treated with Ang II, in the presence or absence of SFN. In WT mice, SFN activated testicular NRF2 expression and function, along with a marked attenuation in Ang II-induced testicular oxidative stress, inflammation, endoplasmic reticulum stress, and apoptotic cell death. Deletion of the Nrf2 gene led to a complete abolishment of these efficacies of SFN. The present study indicated that Ang II may result in testicular apoptotic cell death, which can be prevented by SFN via the activation of NRF2.
Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication
Energy Technology Data Exchange (ETDEWEB)
Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo [Food and Drug Administration, Silver Spring, MD (United States); Yamada, Kenneth M. [National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Food and Drug Administration, Silver Spring, MD (United States)
2017-03-15
We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.
Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication
International Nuclear Information System (INIS)
Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo; Yamada, Kenneth M.; Dhawan, Subhash
2017-01-01
We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.
Tohidnezhad, Mersedeh; Wruck, Christoph-Jan; Slowik, Alexander; Kweider, Nisreen; Beckmann, Rainer; Bayer, Andreas; Houben, Astrid; Brandenburg, Lars-Ove; Varoga, Deike; Sönmez, Tolga-Taha; Stoffel, Marcus; Jahr, Holger; Lippross, Sebastian; Pufe, Thomas
2014-08-01
Oxidative stress can impair fracture healing. To protect against oxidative damage, a system of detoxifying and antioxidative enzymes works to reduce the cellular stress. The transcription of these enzymes is regulated by antioxidant response element (ARE). The nuclear factor (erythroid-derived 2)-like2 (Nrf2) plays a major role in transcriptional activation of ARE-driven genes. Recently it has been shown that vascular endothelial growth factor (VEGF) prevents oxidative damage via activation of the Nrf2 pathway in vitro. Platelet-released growth factor (PRGF) is a mixture of autologous proteins and growth factors, prepared from a determined volume of platelet-rich plasma (PRP). It has already used to enhance fracture healing in vitro. The aim of the present study was to elucidate if platelets can lead to upregulation of VEGF and if platelets can regulate the activity of Nrf2-ARE system in primary human osteoblast (hOB) and in osteoblast-like cell line (SAOS-2). Platelets and PRGF were obtained from healthy human donors. HOB and SAOS-2 osteosarcoma cell line were used. The ARE activity was analysed using a dual luciferase reporter assay system. We used Western blot to detect the nuclear accumulation of Nrf2 and the amount of cytosolic antioxidant Thioredoxin Reductase-1 (TXNRD-1), Heme Oxygenase-1 (HO-1) and NAD(P)H quinine oxidoreductase-1 (NQO1). Gene expression analysis was performed by real-time RT PCR. ELISA was used for the quantification of growth factors. The activity of ARE was increased in the presence of PRGF up to 50%. Western blotting demonstrated enhanced nuclear accumulation of Nrf2. This was followed by an increase in the protein expression of the aforementioned downstream targets of Nrf2. Real-time RT PCR data showed an upregulation in the gene expression of the VEGF after PRGF treatment. This was confirmed by ELISA, where the treatment with PRGF induced the protein level of VEGF in both cells. These results provide a new insight into PRGF's mode of
DEFF Research Database (Denmark)
Koopmann, Matthew C; Nelson, David W; Murali, Sangita G
2008-01-01
BACKGROUND: Glucagon-like peptide-2 (GLP-2) is a nutrient-dependent proglucagon-derived hormone that stimulates intestinal adaptive growth. Our aim was to determine whether exogenous GLP-2 increases resection-induced adaptation without diminishing endogenous proglucagon and GLP-2 receptor express...... augments adaptive growth and digestive capacity of the residual small intestine in a rat model of mid-small bowel resection by increasing plasma GLP-2 concentrations and GLP-2 receptor expression without diminishing endogenous proglucagon expression.......BACKGROUND: Glucagon-like peptide-2 (GLP-2) is a nutrient-dependent proglucagon-derived hormone that stimulates intestinal adaptive growth. Our aim was to determine whether exogenous GLP-2 increases resection-induced adaptation without diminishing endogenous proglucagon and GLP-2 receptor...
ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN
Directory of Open Access Journals (Sweden)
Marco Gabbianelli
2009-11-01
In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF. In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.
Directory of Open Access Journals (Sweden)
Bohan Wang
2017-02-01
Full Text Available Low-intensity extracorporeal shock wave therapy (Li-ESWT is used in the treatment of erectile dysfunction, but its mechanisms are not well understood. Previously, we found that Li-ESWT increased the expression of brain-derived neurotrophic factor (BDNF. Here we assessed the underlying signaling pathways in Schwann cells in vitro and in penis tissue in vivo after nerve injury. The result indicated that BDNF were significantly increased by the Li-ESWT after nerve injury, as well as the expression of BDNF in Schwann cells (SCs, RT4-D6P2T in vitro. Li-ESWT activated the protein kinase RNA-like endoplasmic reticulum (ER kinase (PERK pathway by increasing the phosphorylation levels of PERK and eukaryotic initiation factor 2a (eIF2α, and enhanced activating transcription factor 4 (ATF4 in an energy-dependent manner. In addition, GSK2656157—an inhibitor of PERK—effectively inhibited the effect of Li-ESWT on the phosphorylation of PERK, eIF2α, and the expression of ATF4. Furthermore, silencing ATF4 dramatically attenuated the effect of Li-ESWT on the expression of BDNF, but had no effect on hypoxia-inducible factor (HIF1α or glial cell-derived neurotrophic factor (GDNF in Schwann cells. In conclusion, our findings shed new light on the underlying mechanisms by which Li-ESWT may stimulate the expression of BDNF through activation of PERK/ATF4 signaling pathway. This information may help to refine the use of Li-ESWT to further improve its clinical efficacy.
Embryonic stem cell-like cells derived from adult human testis
Mizrak, S. C.; Chikhovskaya, J. V.; Sadri-Ardekani, H.; van Daalen, S.; Korver, C. M.; Hovingh, S. E.; Roepers-Gajadien, H. L.; Raya, A.; Fluiter, K.; de Reijke, Th M.; de la Rosette, J. J. M. C. H.; Knegt, A. C.; Belmonte, J. C.; van der Veen, F.; de rooij, D. G.; Repping, S.; van Pelt, A. M. M.
2010-01-01
Given the significant drawbacks of using human embryonic stem (hES) cells for regenerative medicine, the search for alternative sources of multipotent cells is ongoing. Studies in mice have shown that multipotent ES-like cells can be derived from neonatal and adult testis. Here we report the
Directory of Open Access Journals (Sweden)
Jin Liu
2018-03-01
Full Text Available Activating transcription factor 4 (ATF4 plays important physiologic roles in the brain including regulation of learning and memory as well as neuronal survival and death. Yet, outside of translational regulation by the eIF2α-dependent stress response pathway, there is little information about how its levels are controlled in neurons. Here, we show that brain-derived neurotrophic factor (BDNF promotes a rapid and sustained increase in neuronal ATF4 transcripts and protein levels. This increase is dependent on tropomyosin receptor kinase (TrkB signaling, but independent of levels of phosphorylated eIF2α. The elevation in ATF4 protein occurs both in nuclei and processes. Transcriptome analysis revealed that ATF4 mediates BDNF-promoted induction of Sesn2 which encodes Sestrin2, a protector against oxidative and genotoxic stresses and a mTor complex 1 inhibitor. In contrast, BDNF-elevated ATF4 did not affect expression of a number of other known ATF4 targets including several with pro-apoptotic activity. The capacity of BDNF to elevate neuronal ATF4 may thus represent a means to maintain this transcription factor at levels that provide neuroprotection and optimal brain function without risk of triggering neurodegeneration.
Chen, Xiaoqian; Wang, Qingxiang; Wang, Liheng; Gao, Feng; Wang, Wei; Hu, Zhengshui
2015-04-15
A broccoli-like bismuth sulfide (bBi2S3) was synthesized via a solvothermal method using a self-made imidazoline derivative of 2-undecyl-1-dithioureido-ethyl-imidazoline as the soft template. The morphology and chemical constitution of the product were characterized by scanning electron microscope (SEM), transmission electron microscope (TEM) and X-ray diffraction (XRD). Electrochemical characterization experiments show that the bBi2S3 has the higher specific surface area and standard heterogeneous electron transfer rate constant than the rod-like Bi2S3 (rBi2S3). Hemoglobin (Hb) was then chosen as a protein model to investigate the electrocatalytic property of the synthesized bBi2S3. The results show that Hb entrapped in the composite film of chitosan and bBi2S3 displays an excellent direct electrochemistry, and retains its biocatalytic activity toward the electro-reduction of hydrogen peroxide. The current response in the amperometry shows a linear response to H2O2 concentrations in the range from 0.4 to 4.8µM with high sensitivity (444µAmM(-1)) and low detection limit (0.096µM). The Michaelis-Menten constant (KM(app)) of the fabricated bioelectrode for H2O2 was determined as low as 1µM. These results demonstrate that the synthesized bBi2S3 offers a new path for the immobilization of redox-active protein and the construction of the third-generation biosensors. Copyright © 2014 Elsevier B.V. All rights reserved.
Mechanism governing heme synthesis reveals a GATA factor/heme circuit that controls differentiation.
Tanimura, Nobuyuki; Miller, Eli; Igarashi, Kazuhiko; Yang, David; Burstyn, Judith N; Dewey, Colin N; Bresnick, Emery H
2016-02-01
Metal ion-containing macromolecules have fundamental roles in essentially all biological processes throughout the evolutionary tree. For example, iron-containing heme is a cofactor in enzyme catalysis and electron transfer and an essential hemoglobin constituent. To meet the intense demand for hemoglobin assembly in red blood cells, the cell type-specific factor GATA-1 activates transcription of Alas2, encoding the rate-limiting enzyme in heme biosynthesis, 5-aminolevulinic acid synthase-2 (ALAS-2). Using genetic editing to unravel mechanisms governing heme biosynthesis, we discovered a GATA factor- and heme-dependent circuit that establishes the erythroid cell transcriptome. CRISPR/Cas9-mediated ablation of two Alas2 intronic cis elements strongly reduces GATA-1-induced Alas2 transcription, heme biosynthesis, and surprisingly, GATA-1 regulation of other vital constituents of the erythroid cell transcriptome. Bypassing ALAS-2 function in Alas2 cis element-mutant cells by providing its catalytic product 5-aminolevulinic acid rescues heme biosynthesis and the GATA-1-dependent genetic network. Heme amplifies GATA-1 function by downregulating the heme-sensing transcriptional repressor Bach1 and via a Bach1-insensitive mechanism. Through this dual mechanism, heme and a master regulator collaborate to orchestrate a cell type-specific transcriptional program that promotes cellular differentiation. © 2015 The Authors.
Energy Technology Data Exchange (ETDEWEB)
Nagamine, Tadashi; Nomada, Shohgo; Onouchi, Takashi; Kameshita, Isamu; Sueyoshi, Noriyuki, E-mail: sueyoshi@ag.kagawa-u.ac.jp
2014-03-28
Highlights: • Doublecortin-like protein kinase (DCLK) is a microtubule-associated protein kinase. • In living cells, DCLK was cleaved into two functional fragments. • zDCLK(kinase) was translocated into the nucleus by osmotic stresses. • Jun dimerization protein 2 (JDP2) was identified as zDCLK(kinase)-binding protein. • JDP2 was efficiently phosphorylated by zDCLK(kinase) only when histone was present. - Abstract: Doublecortin-like protein kinase (DCLK) is a microtubule-associated protein kinase predominantly expressed in brain. In a previous paper, we reported that zebrafish DCLK2 (zDCLK) was cleaved into two functional fragments; the N-terminal zDCLK(DC + SP) with microtubule-binding activity and the C-terminal zDCLK(kinase) with a Ser/Thr protein kinase activity. In this study, we demonstrated that zDCLK(kinase) was widely distributed in the cytoplasm and translocated into the nucleus when the cells were treated under hyperosmotic conditions with NaCl or mannitol. By two-hybrid screening using the C-terminal domain of DCLK, Jun dimerization protein 2 (JDP2), a nuclear transcription factor, was identified as zDCLK(kinase)-binding protein. Furthermore, JDP2 served as an efficient substrate for zDCLK(kinase) only when histone was present. These results suggest that the kinase fragment of DCLK is translocated into the nucleus upon hyperosmotic stresses and that the kinase efficiently phosphorylates JDP2, a possible target in the nucleus, with the aid of histones.
Doherty, Leo F; Taylor, Hugh S
2015-03-01
To determine whether transforming growth factor (TGF)-β3 is a paracrine signal secreted by leiomyoma that inhibits bone morphogenetic protein (BMP)-mediated endometrial receptivity and decidualization. Experimental. Laboratory. Women with symptomatic leiomyomas. Endometrial stromal cells (ESCs) and leiomyoma cells were isolated from surgical specimens. Leiomyoma-conditioned media (LCM) was applied to cultured ESC. The TGF-β was blocked by two approaches: TGF-β pan-specific antibody or transfection with a mutant TGF-β receptor type II. Cells were then treated with recombinant human BMP-2 to assess BMP responsiveness. Expression of BMP receptor types 1A, 1B, 2, as well as endometrial receptivity mediators HOXA10 and leukemia inhibitory factor (LIF). Enzyme-linked immunosorbent assay showed elevated TGF-β levels in LCM. LCM treatment of ESC reduced expression of BMP receptor types 1B and 2 to approximately 60% of pretreatment levels. Preincubation of LCM with TGF-β neutralizing antibody or mutant TGF receptor, but not respective controls, prevented repression of BMP receptors. HOXA10 and LIF expression was repressed in recombinant human BMP-2 treated, LCM exposed ESC. Pretreatment of LCM with TGF-β antibody or transfection with mutant TGF receptor prevented HOXA10 and LIF repression. Leiomyoma-derived TGF-β was necessary and sufficient to alter endometrial BMP-2 responsiveness. Blockade of TGF-β prevents repression of BMP-2 receptors and restores BMP-2-stimulated expression of HOXA10 and LIF. Blockade of TGF signaling is a potential strategy to improve infertility and pregnancy loss associated with uterine leiomyoma. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Campbell Craig I
2011-11-01
Full Text Available Abstract Background Targeted therapies are becoming an essential part of breast cancer treatment and agents targeting the type I insulin-like growth factor receptor (IGF-IR are currently being investigated in clinical trials. One of the limitations of targeted therapies is the development of resistant variants and these variants typically present with unique gene expression patterns and characteristics compared to the original tumor. Results MTB-IGFIR transgenic mice, with inducible overexpression of the IGF-IR were used to model mammary tumors that develop resistance to IGF-IR targeting agents. IGF-IR independent mammary tumors, previously shown to possess characteristics associated with EMT, were found to express elevated levels of PDGFRα and PDGFRβ. Furthermore, these receptors were shown to be inversely expressed with the IGF-IR in this model. Using cell lines derived from IGF-IR-independent mammary tumors (from MTB-IGFIR mice, it was demonstrated that PDGFRα and to a lesser extent PDGFRβ was important for cell migration and invasion as RNAi knockdown of PDGFRα alone or PDGFRα and PDGFRβ in combination, significantly decreased tumor cell migration in Boyden chamber assays and suppressed cell migration in scratch wound assays. Somewhat surprisingly, concomitant knockdown of PDGFRα and PDGFRβ resulted in a modest increase in cell proliferation and a decrease in apoptosis. Conclusion During IGF-IR independence, PDGFRs are upregulated and function to enhance tumor cell motility. These results demonstrate a novel interaction between the IGF-IR and PDGFRs and highlight an important, therapeutically relevant pathway, for tumor cell migration and invasion.
Cognitive Factors Affecting Freeze-like Behavior in Humans.
Alban, Michael W; Pocknell, Victoria
2017-01-01
Contemporary research on survival-related defensive behaviors has identified physiological markers of freeze/flight/fight. Our research focused on cognitive factors associated with freeze-like behavior in humans. Study 1 tested if an explicit decision to freeze is associated with the psychophysiological state of freezing. Heart rate deceleration occurred when participants chose to freeze. Study 2 varied the efficacy of freezing relative to other defense options and found "freeze" was responsive to variations in the perceived effectiveness of alternative actions. Study 3 tested if individual differences in motivational orientation affect preference for a "freeze" option when the efficacy of options is held constant. A trend in the predicted direction suggested that naturally occurring cognitions led loss-avoiders to select "freeze" more often than reward-seekers. In combination, our attention to the cognitive factors affecting freeze-like behavior in humans represents a preliminary step in addressing an important but neglected research area.
DEFF Research Database (Denmark)
Frödin, M; Gammeltoft, S
1994-01-01
We have investigated the effects of insulin-like growth factors (IGFs), basic fibroblast growth factor (bFGF), and nerve growth factor (NGF) on DNA synthesis in cultured chromaffin cells from fetal, neonatal, and adult rats by using 5-bromo-2'-deoxyuridine (BrdUrd) pulse labeling for 24 or 48 h...... implications for improving the survival of chromaffin cell implants in diseased human brain....
Arentsen, Tim; Khalid, Roksana; Qian, Yu; Diaz Heijtz, Rochellys
2018-01-01
Peptidoglycan recognition proteins (PGRPs) are key sensing-molecules of the innate immune system that specifically detect bacterial peptidoglycan (PGN) and its derivates. PGRPs have recently emerged as potential key regulators of normal brain development and behavior. To test the hypothesis that PGRPs play a role in motor control and anxiety-like behavior in later life, we used 15-month old male and female peptidoglycan recognition protein 2 (Pglyrp2) knockout (KO) mice. Pglyrp2 is an N-acetylmuramyl-l-alanine amidase that hydrolyzes PGN between the sugar backbone and the peptide chain (which is unique among the mammalian PGRPs). Using a battery of behavioral tests, we demonstrate that Pglyrp2 KO male mice display decreased levels of anxiety-like behavior compared with wild type (WT) males. In contrast, Pglyrp2 KO female mice show reduced rearing activity and increased anxiety-like behavior compared to WT females. In the accelerated rotarod test, however, Pglyrp2 KO female mice performed better compared to WT females (i.e., they had longer latency to fall off the rotarod). Further, Pglyrp2 KO male mice exhibited decreased expression levels of synaptophysin, gephyrin, and brain-derived neurotrophic factor in the frontal cortex, but not in the amygdala. Pglyrp2 KO female mice exhibited increased expression levels of spinophilin and alpha-synuclein in the frontal cortex, while exhibiting decreased expression levels of synaptophysin, gephyrin and spinophilin in the amygdala. Our findings suggest a novel role for Pglyrp2asa key regulator of motor and anxiety-like behavior in late life. Copyright © 2017. Published by Elsevier Inc.
Forslund, Carina; Aspenberg, Per
2003-01-01
Achilles tendon ruptures in humans might be treated more efficiently with the help of a growth factor. Cartilage-derived morphogenetic protein-2 has been shown to induce formation of tendon-like tissue. Cartilage-derived morphogenetic protein-2 has a positive effect on mechanical parameters for tendon healing in a rabbit model with Achilles tendon transection. Controlled laboratory study. The right Achilles tendon of 40 rabbits was transected without tendon suture. Cartilage-derived morphogenetic protein-2 (10 micro g) or vehicle control (acetate buffer) was injected locally 2 hours postoperatively. All tendons were tested biomechanically at 8 and 14 days, and treated tendons were histologically and radiographically evaluated at 56 days. At 14 days, both failure load and stiffness of treated tendons were increased by 35%. The treated tendons had significantly larger callus size at 8 and 14 days. Histologic and radiographic examination showed no signs of ossification in the treated tendons after 56 days. A single injection of cartilage-derived morphogenetic protein-2 led to a stronger and stiffer tendon callus than that in the controls without inducing bone formation. Similar results from a larger animal model would suggest a possible future use of cartilage-derived morphogenetic protein-2 in the treatment of human Achilles tendon ruptures.
Determinants of serum brain-derived neurotrophic factor
Bus, B. A. A.; Molendijk, M. L.; Penninx, B. J. W. H.; Buitelaar, J. K.; Kenis, G.; Prickaerts, J.; Elzinga, B. M.; Voshaar, R. C. Oude
Background: Brain-derived neurotrophic factor (BDNF) belongs to the neurotrophin family of growth factors and affects the survival and plasticity of neurons in the adult central nervous system. The high correlation between cortical and serum BDNF levels has led to many human studies on BDNF levels
PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia
DEFF Research Database (Denmark)
Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta
2004-01-01
markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...
Energy Technology Data Exchange (ETDEWEB)
Taki-Nakano, Nozomi [Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259-B-65 Nagatsuta-cho, Midori-ku, Yokohama 226-8501 (Japan); Advanced Drug Research Laboratories, Sohyaku. Innovative Research Division, Mitsubishi Tanabe Pharma Corporation, 2-2-50, Kawagishi, Toda, Saitama 335-8505 (Japan); Kotera, Jun [Advanced Drug Research Laboratories, Sohyaku. Innovative Research Division, Mitsubishi Tanabe Pharma Corporation, 2-2-50, Kawagishi, Toda, Saitama 335-8505 (Japan); Ohta, Hiroyuki, E-mail: ohta.h.ab@m.titech.ac.jp [Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259-B-65 Nagatsuta-cho, Midori-ku, Yokohama 226-8501 (Japan); School of Life Science and Technology, Tokyo Institute of Technology, 4259-B-65 Nagatsuta-cho, Midori-ku, Yokohama 226-8501 (Japan)
2016-05-13
Jasmonates are plant lipid–derived oxylipins that act as key signaling compounds in plant immunity, germination, and development. Although some physiological activities of natural jasmonates in mammalian cells have been investigated, their anti-inflammatory actions in mammalian cells remain unclear. Here, we investigated whether jasmonates protect mouse microglial MG5 cells against lipopolysaccharide (LPS)–induced inflammation. Among the jasmonates tested, only 12-oxo-phytodienoic acid (OPDA) suppressed LPS-induced expression of the typical inflammatory cytokines interleukin-6 and tumor necrosis factor α. In addition, only OPDA reduced LPS-induced nitric oxide production through a decrease in the level of inducible nitric oxide synthase. Further mechanistic studies showed that OPDA suppressed neuroinflammation by inhibiting nuclear factor κB and p38 mitogen-activated protein kinase signaling in LPS-activated MG5 cells. In addition, OPDA induced expression of suppressor of cytokine signaling-1 (SOCS-1), a negative regulator of inflammation, in MG5 cells. Finally, we found that the nuclear factor erythroid 2-related factor 2 signaling cascade induced by OPDA is not involved in the anti-inflammatory effects of OPDA. These results demonstrate that OPDA inhibited LPS-induced cell inflammation in mouse microglial cells via multiple pathways, including suppression of nuclear factor κB, inhibition of p38, and activation of SOCS-1 signaling. -- Highlights: •OPDA attenuates LPS-induced inflammatory cytokines such as IL-6 and TNF-α. •OPDA reduces LPS-induced iNOS expression and NO production. •OPDA suppresses NF-κB and p38 pathways and activates SOCS-1 signaling.
International Nuclear Information System (INIS)
Taki-Nakano, Nozomi; Kotera, Jun; Ohta, Hiroyuki
2016-01-01
Jasmonates are plant lipid–derived oxylipins that act as key signaling compounds in plant immunity, germination, and development. Although some physiological activities of natural jasmonates in mammalian cells have been investigated, their anti-inflammatory actions in mammalian cells remain unclear. Here, we investigated whether jasmonates protect mouse microglial MG5 cells against lipopolysaccharide (LPS)–induced inflammation. Among the jasmonates tested, only 12-oxo-phytodienoic acid (OPDA) suppressed LPS-induced expression of the typical inflammatory cytokines interleukin-6 and tumor necrosis factor α. In addition, only OPDA reduced LPS-induced nitric oxide production through a decrease in the level of inducible nitric oxide synthase. Further mechanistic studies showed that OPDA suppressed neuroinflammation by inhibiting nuclear factor κB and p38 mitogen-activated protein kinase signaling in LPS-activated MG5 cells. In addition, OPDA induced expression of suppressor of cytokine signaling-1 (SOCS-1), a negative regulator of inflammation, in MG5 cells. Finally, we found that the nuclear factor erythroid 2-related factor 2 signaling cascade induced by OPDA is not involved in the anti-inflammatory effects of OPDA. These results demonstrate that OPDA inhibited LPS-induced cell inflammation in mouse microglial cells via multiple pathways, including suppression of nuclear factor κB, inhibition of p38, and activation of SOCS-1 signaling. -- Highlights: •OPDA attenuates LPS-induced inflammatory cytokines such as IL-6 and TNF-α. •OPDA reduces LPS-induced iNOS expression and NO production. •OPDA suppresses NF-κB and p38 pathways and activates SOCS-1 signaling.
Angiopoietin-like protein 2 induces proinflammatory responses in peritoneal cells
Energy Technology Data Exchange (ETDEWEB)
Umikawa, Masato, E-mail: umikawa@med.u-ryukyu.ac.jp [Department of Medical Biochemistry, Graduate School of Medicine, University of the Ryukyus, Okinawa (Japan); Umikawa, Asako; Asato, Tsuyoshi; Takei, Kimiko [Department of Medical Biochemistry, Graduate School of Medicine, University of the Ryukyus, Okinawa (Japan); Matsuzaki, Goro [Department of Tropical Infectious Diseases, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Kariya, Ken-ichi [Department of Medical Biochemistry, Graduate School of Medicine, University of the Ryukyus, Okinawa (Japan); Zhang, Cheng Cheng, E-mail: alec.zhang@utsouthwestern.edu [Department of Physiology, University of Texas Southwestern Medical Center, Dallas, TX (United States)
2015-11-13
Monocytes and macrophages are important effectors and regulators of inflammation, and both their differentiation and activation are regulated strictly in response to environmental cues. Angiopoietin-like protein 2 (Angptl2) is a multifaceted protein, displaying many physiological and pathological functions in inflammation, angiogenesis, hematopoiesis, and tumor development. Although recent studies implicate Angptl2 in chronic inflammation, the mechanisms of inflammation caused by Angptl2 remain unclear. The purpose of the present study was to elucidate the role of Angptl2 in inflammation by understanding the effects of Angptl2 on monocytes/macrophages. We showed that Angptl2 directly activates resident murine peritoneal monocytes and macrophages and induces a drastic upregulation of the transcription of several inflammatory genes including nitric oxide synthase 2 and prostaglandin-endoperoxide synthase 2, and several proinflammatory cytokine genes such as interleukin (IL)-1β, IL-6, TNFα, and CSF2, along with activation of ERK, JNK, p38, and nuclear factor kappa B signaling pathways. Concordantly, proinflammatory cytokines IL-1β, IL-6, TNFα, and GM-CSF, were rapidly elevated from murine peritoneal monocytes and macrophages. These results demonstrate a novel role for Angptl2 in inflammation via the direct activation of peritoneal monocytes and macrophages. - Highlights: • Angptl2 directly activates resident murine peritoneal monocytes and macrophages. • Angptl2 induces a drastic upregulation of expression of inflammatory genes. • Angptl2 induces activation of ERK, JNK, p38, and nuclear factor kappa B signaling pathways. • Angptl2 does not activate bone marrow derived macrophages or macrophage cell lines.
Auden, Alana; Caddy, Jacinta; Wilanowski, Tomasz; Ting, Stephen B; Cunningham, John M; Jane, Stephen M
2006-10-01
The Drosophila transcription factor Grainyhead (grh) is expressed in ectoderm-derived tissues where it regulates several key developmental events including cuticle formation, tracheal elongation and dorsal closure. Our laboratory has recently identified three novel mammalian homologues of the grh gene, Grainyhead-like 1, -2 and -3 (Grhl1-3) that rewrite the phylogeny of this family. Using gene targeting in mice, we have shown that Grhl3 is essential for neural tube closure, skin barrier formation and wound healing. Despite their extensive sequence homology, Grhl1 and Grhl2 are unable to compensate for loss of Grhl3 in these developmental processes. To explore this lack of redundancy, and to gain further insights into the functions of this gene family in mammalian development we have performed an extensive in situ hybridisation analysis. We demonstrate that, although all three Grhl genes are highly expressed in the developing epidermis, they display subtle differences in the timing and level of expression. Surprisingly, we also demonstrate differential expression patterns in non-ectoderm-derived tissues, including the heart, the lung, and the metanephric kidney. These findings expand our understanding of the unique role of Grhl3 in neurulation and epidermal morphogenesis, and provide a focus for further functional analysis of the Grhl genes during mouse embryogenesis.
Insulin-like growth factor 1: common mediator of multiple enterotrophic hormones and growth factors.
Bortvedt, Sarah F; Lund, P Kay
2012-03-01
To summarize the recent evidence that insulin-like growth factor 1 (IGF1) mediates growth effects of multiple trophic factors and discuss clinical relevance. Recent reviews and original reports indicate benefits of growth hormone (GH) and long-acting glucagon-like peptide 2 (GLP2) analogs in short bowel syndrome and Crohn's disease. This review highlights the evidence that biomarkers of sustained small intestinal growth or mucosal healing and evaluation of intestinal epithelial stem cell biomarkers may improve clinical measures of intestinal growth or response to trophic hormones. Compelling evidence that IGF1 mediates growth effects of GH and GLP2 on intestine or linear growth in preclinical models of resection or Crohn's disease is presented, along with a concept that these hormones or IGF1 may enhance sustained growth if given early after bowel resection. Evidence that suppressor of cytokine signaling protein induction by GH or GLP2 in normal or inflamed intestine may limit IGF1-induced growth, but protect against risk of dysplasia or fibrosis, is reviewed. Whether IGF1 receptor mediates IGF1 action and potential roles of insulin receptors are addressed. IGF1 has a central role in mediating trophic hormone action in small intestine. Better understanding of benefits and risks of IGF1, receptors that mediate IGF1 action, and factors that limit undesirable growth are needed.
MicroRNA-1 Regulates the Differentiation of Adipose-Derived Stem Cells into Cardiomyocyte-Like Cells
Directory of Open Access Journals (Sweden)
Can Chen
2018-01-01
Full Text Available Stem cell transplantation is one of most valuable methods in the treatment of myocardial infarction, and adipose-derived stem cells (ASCs are becoming a hot topic in medical research. Previous studies have shown that ASCs can be differentiated into cardiomyocyte-like cells, but the efficiency and survival rates are low. We investigated the role and mechanism of microRNA-1 (miR-1 in the differentiation of ASCs into cardiomyocyte-like cells. ASCs and cardiomyocytes were isolated from neonatal rats. We constructed lentivirus for overexpressing miR-1 and used DAPT, an antagonist of the Notch1 pathway, for in vitro analyses. We performed cocultures with ASCs and cardiomyocytes. The differentiation efficiency of ASCs was detected by cell-specific surface antigens. Our results showed that miR-1 can promote the expression of Notch1 and reduce the expression of Hes1, a Notch pathway factor, and overexpression of miR-1 can promote the differentiation of ASCs into cardiomyocyte-like cells, which may occur by regulating Notch1 and Hes1.
A measurement of the space-like pion electromagnetic form factor
International Nuclear Information System (INIS)
Amendolia, S.R.; Badelek, B.; Batignani, G.; Bedeschi, F.; Bertolucci, E.; Bettoni, D.; Bosisio, L.; Bradaschia, C.; Dell'Orso, M.; Fidecaro, F.; Foa, L.; Focardi, E.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Scribano, A.; Tonelli, G.; Triggiani, G.; Codino, A.; Enorini, M.; Fabbri, F.L.; Laurelli, P.; Satta, L.; Spillantini, P.; Zallo, A.
1986-01-01
The pion form factor has been measured in the space-like q 2 region 0.014 to 0.26 (GeV/c) 2 by scattering 300 GeV pions from the electrons of a liquid hydrogen target. A detailed description is given of the apparatus, data analysis and corrections to the data. The mean square charge radius extracted from the data is model-dependent. We find that a form which includes a realistic description of the form factor phase gives a similar result to the naive pole form, and conclude π 2 >=0.439±0.008 fm 2 . (orig.)
International Nuclear Information System (INIS)
Marshman, Emma; Streuli, Charles H
2002-01-01
Insulin-like growth factor (IGF)-mediated proliferation and survival are essential for normal development in the mammary gland during puberty and pregnancy. IGFs interact with IGF-binding proteins and regulate their function. The present review focuses on the role of IGFs and IGF-binding proteins in the mammary gland and describes how modulation of their actions occurs by association with hormones, other growth factors and the extracellular matrix. The review will also highlight the involvement of the IGF axis in breast cancer
Chiba, Shuichi; Numakawa, Tadahiro; Ninomiya, Midori; Richards, Misty C; Wakabayashi, Chisato; Kunugi, Hiroshi
2012-10-01
Stress and the resulting increase in glucocorticoid levels have been implicated in the pathophysiology of depressive disorders. We investigated the effects of chronic restraint stress (CRS: 6 hours × 28 days) on anxiety- and depression-like behaviors in rats and on the possible changes in glucocorticoid receptor (GR) expression as well as brain-derived neurotrophic factor (BDNF)-dependent neural function in the prefrontal cortex (PFC). We observed significant reductions in body weight gain, food intake and sucrose preference from 1 week after the onset of CRS. In the 5th week of CRS, we conducted open-field (OFT), elevated plus-maze (EPM) and forced swim tests (FST). We observed a decrease in the number of entries into open arms during the EPM (anxiety-like behavior) and increased immobility during the FST (depression-like behavior). When the PFC was removed after CRS and subject to western blot analysis, the GR expression reduced compared with control, while the levels of BDNF and its receptors remained unchanged. Basal glutamate concentrations in PFC acute slice which were measured by high performance liquid chromatography were not influenced by CRS. However, BDNF-induced glutamate release was attenuated after CRS. These results suggest that reduced GR expression and altered BDNF function may be involved in chronic stress-induced anxiety--and depression-like behaviors. Copyright © 2012 Elsevier Inc. All rights reserved.
Protection from cyanide-induced brain injury by the Nrf2 transcriptional activator carnosic acid.
Zhang, Dongxian; Lee, Brian; Nutter, Anthony; Song, Paul; Dolatabadi, Nima; Parker, James; Sanz-Blasco, Sara; Newmeyer, Traci; Ambasudhan, Rajesh; McKercher, Scott R; Masliah, Eliezer; Lipton, Stuart A
2015-06-01
Cyanide is a life-threatening, bioterrorist agent, preventing cellular respiration by inhibiting cytochrome c oxidase, resulting in cardiopulmonary failure, hypoxic brain injury, and death within minutes. However, even after treatment with various antidotes to protect cytochrome oxidase, cyanide intoxication in humans can induce a delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Additional mechanisms are thought to underlie cyanide-induced neuronal damage, including generation of reactive oxygen species. This may account for the fact that antioxidants prevent some aspects of cyanide-induced neuronal damage. Here, as a potential preemptive countermeasure against a bioterrorist attack with cyanide, we tested the CNS protective effect of carnosic acid (CA), a pro-electrophilic compound found in the herb rosemary. CA crosses the blood-brain barrier to up-regulate endogenous antioxidant enzymes via activation of the Nrf2 transcriptional pathway. We demonstrate that CA exerts neuroprotective effects on cyanide-induced brain damage in cultured rodent and human-induced pluripotent stem cell-derived neurons in vitro, and in vivo in various brain areas of a non-Swiss albino mouse model of cyanide poisoning that simulates damage observed in the human brain. Cyanide, a potential bioterrorist agent, can produce a chronic delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Here, cyanide poisoning treated with the proelectrophillic compound carnosic acid, results in reduced neuronal cell death in both in vitro and in vivo models through activation of the Nrf2/ARE transcriptional pathway. Carnosic acid is therefore a potential treatment for the toxic central nervous system (CNS) effects of cyanide poisoning. ARE, antioxidant responsive element; Nrf2 (NFE2L2, Nuclear factor (erythroid-derived 2)-like 2). © 2015 International Society for Neurochemistry.
Heslop, James A.; Kia, Richard; Pridgeon, Christopher S.; Sison‐Young, Rowena L.; Liloglou, Triantafillos; Elmasry, Mohamed; Fenwick, Stephen W.; Mills, John S.; Kitteringham, Neil R.; Park, Bong K.
2017-01-01
Abstract Drug‐induced liver injury is the greatest cause of post‐marketing drug withdrawal; therefore, substantial resources are directed toward triaging potentially dangerous new compounds at all stages of drug development. One of the major factors preventing effective screening of new compounds is the lack of a predictive in vitro model of hepatotoxicity. Primary human hepatocytes offer a metabolically relevant model for which the molecular initiating events of hepatotoxicity can be examined; however, these cells vary greatly between donors and dedifferentiate rapidly in culture. Induced pluripotent stem cell (iPSC)‐derived hepatocyte‐like cells (HLCs) offer a reproducible, physiologically relevant and genotypically normal model cell; however, current differentiation protocols produce HLCs with a relatively immature phenotype. During the reprogramming of somatic cells, the epigenome undergoes dramatic changes; however, this “resetting” is a gradual process, resulting in an altered differentiation propensity, skewed toward the lineage of origin, particularly in early passage cultures. We, therefore, performed a comparison of human hepatocyte‐ and dermal fibroblast‐derived iPSCs, assessing the impact of epigenetic memory at all stages of HLC differentiation. These results provide the first isogenic assessment of the starting cell type in human iPSC‐derived HLCs. Despite a trend toward improvement in hepatic phenotype in albumin secretion and gene expression, few significant differences in hepatic differentiation capacity were found between hepatocyte and fibroblast‐derived iPSCs. We conclude that the donor and inter‐clonal differences have a greater influence on the hepatocyte phenotypic maturity than the starting cell type. Therefore, it is not necessary to use human hepatocytes for generating iPSC‐derived HLCs. Stem Cells Translational Medicine 2017;6:1321–1331 PMID:28456008
Potential differentiation of islet-like cells from pregnant cow-derived placental stem cells.
Peng, Shao-Yu; Chou, Chien-Wen; Kuo, Yu-Hsuan; Shen, Perng-Chih; Shaw, S W Steven
2017-06-01
Type 1 diabetes is an autoimmune disease that destroys islet cells and results in insufficient insulin secretion by pancreatic β-cells. Islet transplantation from donors is an approach used for treating patients with diabetes; however, this therapy is difficult to implement because of the lack of donors. Nevertheless, several stem cells have the potential to differentiate from islet-like cells and enable insulin secretion for treating diabetes in animal models. For example, placenta is considered a waste material and can be harvested noninvasively during delivery without ethical or moral concerns. To date, the differentiation of islet-like cells from cow-derived placental stem cells (CPSCs) has yet to be demonstrated. The investigation of potential differentiation of islet-like cells from CPSCs was conducted by supplementation with nicotinamide, exendin-4, glucose, and poly-d-lysine and was detected through reverse transcription polymerase chain reaction, dithizone staining, and immunocytochemical methods. Our results indicated that CPSCs are established and express mesenchymal stem cell surface antigen markers, such as CD73, CD166, β-integrin, and Oct-4, but not hematopoietic stem cell surface antigen markers, such as CD45. After induction, the CPSCs successfully differentiated into islet-like cells. The CPSC-derived islet-like cells expressed islet cell development-related genes, such as insulin, glucagon, pax-4, Nkx6.1, pax-6, and Fox. Moreover, CPSC-derived islet-like cells can be stained with zinc ions, which are widely distributed in the islet cells and enable insulin secretion. Altogether, islet-like cells have the potential to be differentiated from CPSCs without gene manipulation, and can be used in diabetic animal models in the future for preclinical and drug testing trial investigations. Copyright © 2017. Published by Elsevier B.V.
Derivation of Batho's correction factor for heterogeneities
International Nuclear Information System (INIS)
Lulu, B.A.; Bjaerngard, B.E.
1982-01-01
Batho's correction factor for dose in a heterogeneous, layered medium is derived from the tissue--air ratio method (TARM). The reason why the Batho factor is superior to the TARM factor at low energy is ascribed to the fact that it accounts for the distribution of the scatter-generating matter along the centerline. The poor behavior of the Batho factor at high energies is explained as a consequence of the lack of electron equilibrium at appreciable depth below the surface. Key words: Batho factor, heterogeneity, inhomogeneity, tissue--air ratio method
Feed-Back Regulation of Haemopoiesis
Energy Technology Data Exchange (ETDEWEB)
Feldman, M. [Department of Cell Biology, Weizmann Institute of Science, Rehovoth (Israel)
1968-08-15
Studies ate reported on the feed-back regulation of erythropoiesis by means of the intrasplenic cloning system of haemopoietic cells. Polycythaemia, produced by passive transfusion of synzeneic, allogeneic or xenogeneic red blood cells, inhibited the formation of bone-marrow derived erythroid clones. Polycythaemia also inhibited the formation of erythroid clones of endogenous stem cells. Oxygen overloading was found to be a necessary factor in the suppression of erythroid clone formation: no suppression of erythroid colonies was observed when polycythaemic animals were kept under hypoxic conditions. Erythropoietin, either of exogenous or of endogenous origin, elicited a reformation of erythroid clones in 'suppressed' animals. Studies on the kinetics of reformation of erythroid clones after the administration of erythropoietin suggested that the colony-forming stem cell can replicate a few times in the absence of erythropoietin and the cell progeny thus formed are the target cells for erythropoietin action. If, indeed, the colony-forming cell replicates in the absence of the specific inducer, then the cells thus formed should themselves be stem cells. This was substantiated by demonstrating that the cloning efficiency of spleens of polycythaemic recipients was higher than that of non-polycythaemic animals. Experiments indicating that erythroid clones produced by erythropoietin in polycythaemic animals disappeared after the discontinuance of erythropoietin application demonstrated the distinction between the 'mitogenic' and the 'morphogenetic' effects of erythropoietin. The latter seemed to be operated by an early transcription of RNA for proteins necessary for the complete maturation of the red blood cell, Erythroid clones produced by foetal haemopoietic stem cells seemed to be regulated by a different mechanism from that which controls the formation of bone-marrow derived clones. Clones produced by foetal cells were only partially suppressed in the polycythaemic
Expression of Hepatoma-derived growth factor family members in the adult central nervous system
Directory of Open Access Journals (Sweden)
Abouzied Mekky M
2006-01-01
Full Text Available Abstract Background Hepatoma-derived growth factor (HDGF belongs to a polypeptide family containing five additional members called HDGF related proteins 1–4 (HRP-1 to -4 and Lens epithelial derived growth factor. Whereas some family members such as HDGF and HRP-2 are expressed in a wide range of tissues, the expression of others is very restricted. HRP-1 and -4 are only expressed in testis, HRP-3 only in the nervous system. Here we investigated the expression of HDGF, HRP-2 and HRP-3 in the central nervous system of adult mice on the cellular level by immunohistochemistry. In addition we performed Western blot analysis of various brain regions as well as neuronal and glial cell cultures. Results HDGF was rather evenly expressed throughout all brain regions tested with the lowest expression in the substantia nigra. HRP-2 was strongly expressed in the thalamus, prefrontal and parietal cortex, neurohypophysis, and the cerebellum, HRP-3 in the bulbus olfactorius, piriform cortex and amygdala complex. HDGF and HRP-2 were found to be expressed by neurons, astrocytes and oligodendrocytes. In contrast, strong expression of HRP-3 in the adult nervous system is restricted to neurons, except for very weak expression in oligodendrocytes in the brain stem. Although the majority of neurons are HRP-3 positive, some like cerebellar granule cells are negative. Conclusion The coexpression of HDGF and HRP-2 in glia and neurons as well as the coexpression of all three proteins in many neurons suggests different functions of members of the HDGF protein family in cells of the central nervous system that might include proliferation as well as cell survival. In addition the restricted expression of HRP-3 point to a special function of this family member for neuronal cells.
Directory of Open Access Journals (Sweden)
Ruth Merkle
2016-08-01
Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in
Sada, Aiko; Hasegawa, Kazuteru; Pin, Pui Han; Saga, Yumiko
2012-02-01
Stem cells are maintained by both stem cell-extrinsic niche signals and stem cell-intrinsic factors. During murine spermatogenesis, glial cell line-derived neurotrophic factor (GDNF) signal emanated from Sertoli cells and germ cell-intrinsic factor NANOS2 represent key regulators for the maintenance of spermatogonial stem cells. However, it remains unclear how these factors intersect in stem cells to control their cellular state. Here, we show that GDNF signaling is essential to maintain NANOS2 expression, and overexpression of Nanos2 can alleviate the stem cell loss phenotype caused by the depletion of Gfra1, a receptor for GDNF. By using an inducible Cre-loxP system, we show that NANOS2 expression is downregulated upon the conditional knockout (cKO) of Gfra1, while ectopic expression of Nanos2 in GFRA1-negative spermatogonia does not induce de novo GFRA1 expression. Furthermore, overexpression of Nanos2 in the Gfra1-cKO testes prevents precocious differentiation of the Gfra1-knockout stem cells and partially rescues the stem cell loss phenotypes of Gfra1-deficient mice, indicating that the stem cell differentiation can be suppressed by NANOS2 even in the absence of GDNF signaling. Taken together, we suggest that NANOS2 acts downstream of GDNF signaling to maintain undifferentiated state of spermatogonial stem cells. Copyright © 2011 AlphaMed Press.
Lai, De-Wei; Lin, Keng-Hung; Sheu, Wayne Huey-Herng; Lee, Maw-Rong; Chen, Chung-Yu; Lee, Wen-Jane; Hung, Yi-Wen; Shen, Chin-Chang; Chung, Tsung-Ju; Liu, Shing-Hwa; Sheu, Meei-Ling
2017-09-01
Diabetic retinopathy is characterized by vasopermeability, vascular leakage, inflammation, blood-retinal barrier breakdown, capillary degeneration, and neovascularization. However, the mechanisms underlying the association between diabetes mellitus and progression retinopathy remain unclear. TPL2 (tumor progression locus 2), a serine-threonine protein kinase, exerts a pathological effect on vascular angiogenesis. This study investigated the role of N ε -(carboxymethyl)lysine, a major advanced glycation end products, and the involved TPL2-related molecular signals in diabetic retinopathy using models of in vitro and in vivo and human samples. Serum N ε -(carboxymethyl)lysine levels and TPL2 kinase activity were significantly increased in clinical patients and experimental animals with diabetic retinopathy. Intravitreal administration of pharmacological blocker or neutralizing antibody inhibited TPL2 and effectively suppressed the pathological characteristics of retinopathy in streptozotocin-induced diabetic animal models. Intravitreal VEGF (vascular endothelial growth factor) neutralization also suppressed the diabetic retinopathy in diabetic animal models. Mechanistic studies in primary human umbilical vein endothelial cells and primary retinal microvascular endothelial cells from streptozotocin-diabetic rats, db/db mice, and samples from patients with diabetic retinopathy revealed a positive parallel correlation between N ε -(carboxymethyl)lysine and the TPL2/chemokine SDF1α (stromal cell-derived factor-α) axis that is dependent on endoplasmic reticulum stress-related molecules, especially ATF4 (activating transcription factor-4). This study demonstrates that inhibiting the N ε -(carboxymethyl)lysine-induced TPL2/ATF4/SDF1α axis can effectively prevent diabetes mellitus-mediated retinal microvascular dysfunction. This signaling axis may include the therapeutic potential for other diseases involving pathological neovascularization or macular edema. © 2017
Directory of Open Access Journals (Sweden)
Kin-Hing William Lau
Full Text Available The present study sought to evaluate the functional role of osteocyte-derived IGF-I in the bone repletion process by determining whether deficient expression of Igf1 in osteocytes would impair the bone repletion response to one week of dietary calcium repletion after two weeks of dietary calcium deprivation. As expected, the two-week dietary calcium depletion led to hypocalcemia, secondary hyperparathyroidism, and increases in bone resorption and bone loss in both Igf1 osteocyte conditional knockout (cKO mutants and WT control mice. Thus, conditional disruption of Igf1 in osteocytes did not impair the calcium depletion-induced bone resorption. After one week of calcium repletion, both cKO mutants and WT littermates showed an increase in endosteal bone formation attended by the reduction in osteoclast number, indicating that deficient Igf1 expression in osteocytes also did not have deleterious effects on the bone repletion response. The lack of an effect of deficient osteocyte-derived IGF-I expression on bone repletion is unexpected since previous studies show that these Igf1 osteocyte cKO mice exhibited impaired developmental growth and displayed complete resistance to bone anabolic effects of loading. These studies suggest that there is a dichotomy between the mechanisms necessary for anabolic responses to mechanical loading and the regulatory hormonal and anabolic skeletal repletion following low dietary calcium challenge. In conclusion, to our knowledge this study has demonstrated for the first time that osteocyte-derived IGF-I, which is essential for anabolic bone response to mechanical loading, is not a key regulatory factor for bone repletion after a low calcium challenge.
Loveley, M. R.; Marcantonio, F.; Lyle, M. W.; Wang, J. K.
2013-12-01
In this study, we attempt to understand how preferential sorting of fine particles during redistribution processes in the Panama Basin affects the 230Th constant-flux proxy. Fine particles likely contain greater amounts of 230Th, so that preferential sorting of fine particles may bias sediment mass accumulation rates (MARs). We examined sediments that span the past 25 kyr from two new sediment cores retrieved within about 56 km of each other in the northern part of the basin (MV1013-01-'4JC', 5° 44.699'N 85° 45.498' W, 1730 m depth; MV1014-01-'8JC', 6° 14.038'N 86° 2.613' W, 1993 m depth). Core 4JC, closer to the ridge top that bounds the basin (Cocos Ridge), has a thin sediment drape, while the deeper core 8JC, has a thicker sediment drape and lies further from the ridge top. 230Th-derived focusing factors from 4JC are similar and suggest winnowing with average values of about 0.5 and 0.6 during the Holocene and the last glacial, respectively. For 8JC, calculated average focusing factors are significantly different and suggest focusing with values of about 2 during the Holocene and 4 during the last glacial. Since the two sites are close to each other, one would expect similar rain rates and, therefore, similar 230Th-derived MARs within similar windows of time, i.e., the rain rate should not vary significantly at each site temporally. In addition, the radiocarbon-derived sand (>63μm) MARs should behave similarly since coarser particles are likely not transported by bottom currents. Sand MARs are, indeed, similar during the Holocene and the last glacial at each site. During the last glacial, however, sand MARs are about a factor of 3 higher than those during the Holocene. On the other hand, there is little variability in the 230Th-derived MARs both spatially and temporally. We interpret the discrepancies between the radiocarbon-derived sand and 230Th-derived MARs as being due to preferential sorting of fine particles during the redistribution of sediments by
Insulin-like growth factor system in amyotrophic lateral sclerosis
Wilczak, N; de Keyser, J; Cianfarani, S; Clemmons, DR; Savage, MO
2005-01-01
Insulin-like growth factor-I (IGF-I) is a neurotrophic factor with insulin-like metabolic activities, and possesses potential clinical applications, particularly in neurodegenerative disorders. Amyotrophic lateral sclerosis (ALS) is a chronic progressive devastating disorder of the central nervous
Moloney, G P; Martin, G R; Mathews, N; Milne, A; Hobbs, H; Dodsworth, S; Sang, P Y; Knight, C; Williams, M; Maxwell, M; Glen, R C
1999-07-15
The synthesis and vascular 5-HT(1B)-like receptor activity of a novel series of substituted 2, N-benzylcarboxamido-5-(2-ethyl-1-dioxoimidazolidinyl)-N, N-dimethyltryptamine derivatives are described. Modifications to the 5-ethylene-linked heterocycle and to substituents on the 2-benzylamide side chain have been explored. Several compounds were identified which exhibited affinity at the vascular 5-HT(1B)-like receptor of pK(B) > 7.0, up to 100-fold selectivity over alpha(1)-adrenoceptor affinity and 5-HT(2A) receptor affinity, and which exhibited a favorable pharmacokinetic profile. N-Benzyl-3-[2-(dimethylamino)ethyl]-5-[2-(4,4-dimethyl-2, 5-dioxo-1-imidazolidinyl)ethyl]-1H-indole-2-carboxamide (23) was identified as a highly potent, silent (as judged by the inability of angiotensin II to unmask 5-HT(1B)-like receptor-mediated agonist activity in the rabbit femoral artery), and competitive vascular 5-HT(1B)-like receptor antagonist with a plasma elimination half-life of approximately 4 h in dog plasma and with good oral bioavailability. The selectivity of compounds from this series for the vascular 5-HT(1B)-like receptors over other receptor subtypes is discussed as well as a proposed mode of binding to the receptor pharmacophore. It has been proposed that the aromatic ring of the 2, N-benzylcarboxamide group can occupy an aromatic binding site rather than the indole ring. The resulting conformation allows an amine-binding site to be occupied by the ethylamine nitrogen and a hydrogen-bonding site to be occupied by one of the hydantoin carbonyls. The electronic nature of the 2,N-benzylcarboxamide aromatic group as well as the size of substituents on this aromatic group is crucial for producing potent and selective antagonists. The structural requirement on the 3-ethylamine side chain incorporating the protonatable nitrogen is achieved by the bulky 2, N-benzylcarboxamide group and its close proximity to the 3-side chain.
Nishinaka, Takashi; Kinoshita, Megumi; Nakamoto, Kazuo; Tokuyama, Shogo
2015-04-10
We recently demonstrated that exposure to early life stress exacerbates nerve injury-induced thermal and mechanical hypersensitivity in adult male and female mice. Accumulating evidence suggests that chronic pain causes emotional dysfunction, such as anxiety and depression. In the present study, we investigated the impact of early life stress on depression-like behavior after nerve injury in mice. In addition, we examined the expression of brain-derived neurotrophic factor (BDNF), which is known to be involved in the pathogenesis of depression. Early life stress was induced by maternal separation between 2 and 3 weeks of age combined with social isolation after weaning (MSSI). At 9 weeks of age, the sciatic nerve was partially ligated to elicit neuropathic pain. Depression-like behavior was evaluated using the forced swim test at 12 weeks of age. Tissue samples from different regions of the brain were collected at the end of maternal separation (3 weeks of age) or after the forced swim test (12 weeks of age). At 12 weeks of age, immobility time in the forced swim test was increased only in MSSI-stressed female mice with nerve injury. BDNF expression was increased in male, but not female, MSSI-stressed mice at 3 weeks of age. However, MSSI stress did not impact BDNF expression in male or female mice at 12 weeks of age. Our findings suggest that exposure to early life stress exacerbates emotional dysfunction induced by neuropathic pain in a sex-dependent manner. Changes in BDNF expression after early life stress may be associated with neuropathic pain-induced depression-like behavior in adulthood. Furthermore, sex differences in BDNF expression after exposure to early life stress may contribute to sex-specific susceptibility to neuropathic pain-induced emotional dysfunction. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Determinants of the epithelial-muscular axis on embryonic stem cell-derived gut-like structures.
Luo, Yi; Takaki, Miyako; Misawa, Hiromi; Matsuyoshi, Hiroko; Sasahira, Tomonori; Chihara, Yoshitomo; Fujii, Kiyomu; Ohmori, Hitoshi; Kuniyasu, Hiroki
2010-01-01
Dome-like structures with epithelial-muscular layers resembling the gut have been derived from mouse embryonic stem (ES) cells. These domes have been reported to show spontaneous contractions and are called ES gut. In the present study, we examined the epithelial-muscular axis of these domes by detecting differentiation markers. A normal epithelial-muscular axis was exhibited in the domes with spontaneous motility, whereas the domes without spontaneous motility showed either an inverted or obscure axis. To investigate the factors affecting the epithelial-muscular axis, we examined the expression of hedgehog signaling factors in the domes. Expression of hedgehog family factors was detected in the epithelial components of the domes with motility, whereas this expression was inverted or obscure in the domes without motility. Out of the 25 domes, 10 of the 10 motility (+) domes showed a normal epithelial-muscular axis, whereas 14 of the 15 motility (-) domes lacked a normal epithelial-muscular axis. This implies that activin A upregulated the expression of sonic hedgehog and intestinal alkaline phosphatase in the embryoid bodies. These findings suggest that the motility of the ES gut depends on the domes' epithelial-muscular axis. Copyright © 2010 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Yunna Kim
2017-12-01
Conclusion: HJ11 improves depressive-like behaviors in the stress-induced mouse model of depression, and the results indicate that the neuroprotective effect of HJ11, identified by brain-derived neurotrophic factor expression, may play a critical role in its antidepressant effect.
Brod, J M; Demasi, Ana Paula Dias; Montalli, V A; Teixeira, L N; Furuse, C; Aguiar, M C; Soares, A B; Sperandio, M; Araujo, V C
2017-12-01
Polymorphous adenocarcinoma (PAC) is a malignant epithelial neoplasm that affects almost exclusively the minor salivary glands, generally described as having a relatively good prognosis. Aberrant nuclear factor erythroid 2 (NF-E2)-related factor (Nrf2) activation in tumor cells has been associated with induction of antioxidant enzymes, such as peroxiredoxin I (Prx I) and increased matrix metalloproteinase (MMP) expression. In this context, the aim of the present study was to evaluate the expression of Nrf2 and correlate it with Prx I and MMP-2 secretion in PAC. Thirty-one cases of PAC from oral biopsies were selected and immunohistochemically analyzed for Nrf2 and Prx I. MMP-2 quantification was performed on primary cell cultures derived from PAC. Oral squamous cell carcinoma (OSCC) cell cultures were used as control. A high immunoexpression of Nrf2 was observed in both the cytoplasm and the nucleus of neoplastic cells from PAC. Nuclear staining for Nrf2 suggested its activation in the majority of the PAC cells, which was confirmed by the high expression of its target gene, Prx I. Quantification of MMP-2 secretion showed lower levels in PAC cell cultures when compared to OSCC cell cultures (p high-grade malignancies, such relationship is not infallible and, in fact, the opposite may occur in low-grade tumors, such as PAC of minor salivary glands.
International Nuclear Information System (INIS)
Amendolia, S.R.; Badelek, B.; Bertolucci, E.; Bettoni, D.; Bizzeti, A.; Bosisio, L.; Bradaschia, C.; Dell'Orso, M.; Foa, L.; Focardi, E.; Giannetti, P.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Scribano, A.; Tenchini, R.; Tonelli, G.; Triggiani, G.; Frank, S.G.F.; Harvey, J.; Menasce, D.; Meroni, E.; Moroni, L.; Milan Univ.
1984-01-01
The EM form factor of the pion has been studied in the time-like region by measuring sigma(e + e - ->π + π - ) normalization to sigma(e + e - ->μ + μ - ). Results have been obtained for q 2 down to the physical threshold. (orig.)
Dewi, Vitri; Kwok, Alister; Lee, Stella; Lee, Ming Min; Tan, Yee Mun; Nicholas, Hannah R; Isono, Kyo-ichi; Wienert, Beeke; Mak, Ka Sin; Knights, Alexander J; Quinlan, Kate G R; Cordwell, Stuart J; Funnell, Alister P W; Pearson, Richard C M; Crossley, Merlin
2015-03-27
Krüppel-like factor 3 (KLF3/BKLF), a member of the Krüppel-like factor (KLF) family of transcription factors, is a widely expressed transcriptional repressor with diverse biological roles. Although there is considerable understanding of the molecular mechanisms that allow KLF3 to silence the activity of its target genes, less is known about the signal transduction pathways and post-translational modifications that modulate KLF3 activity in response to physiological stimuli. We observed that KLF3 is modified in a range of different tissues and found that the serine/threonine kinase homeodomain-interacting protein kinase 2 (HIPK2) can both bind and phosphorylate KLF3. Mass spectrometry identified serine 249 as the primary phosphorylation site. Mutation of this site reduces the ability of KLF3 to bind DNA and repress transcription. Furthermore, we also determined that HIPK2 can phosphorylate the KLF3 co-repressor C-terminal binding protein 2 (CtBP2) at serine 428. Finally, we found that phosphorylation of KLF3 and CtBP2 by HIPK2 strengthens the interaction between these two factors and increases transcriptional repression by KLF3. Taken together, our results indicate that HIPK2 potentiates the activity of KLF3. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Zhao, Kong-Nan; Masci, Paul P.; Lavin, Martin F.
2011-01-01
Spectrin is a central component of the cytoskeletal protein network in a variety of erythroid and non-erythroid cells. In keratinocytes, this protein has been shown to be pericytoplasmic and plasma membrane associated, but its characteristics and function have not been established in these cells. Here we demonstrate that spectrin increases dramatically in amount and is assembled into the cytoskeleton during differentiation in mouse and human keratinocytes. The spectrin-like cytoskeleton was predominantly organized in the granular and cornified layers of the epidermis and disrupted by actin filament inhibitors, but not by anti-mitotic drugs. When the cytoskeleton was disrupted PKCδ was activated by phosphorylation on Thr505. Specific inhibition of PKCδ(Thr505) activation with rottlerin prevented disruption of the spectrin-like cytoskeleton and the associated morphological changes that accompany differentiation. Rottlerin also inhibited specific phosphorylation of the PKCδ substrate adducin, a cytoskeletal protein. Furthermore, knock-down of endogenous adducin affected not only expression of adducin, but also spectrin and PKCδ, and severely disrupted organization of the spectrin-like cytoskeleton and cytoskeletal distribution of both adducin and PKCδ. These results demonstrate that organization of a spectrin-like cytoskeleton is associated with keratinocytes differentiation, and disruption of this cytoskeleton is mediated by either PKCδ(Thr505) phosphorylation associated with phosphorylated adducin or due to reduction of endogenous adducin, which normally connects and stabilizes the spectrin-actin complex. PMID:22163289
Directory of Open Access Journals (Sweden)
Wei Xu
2017-12-01
Full Text Available Background/Aims: Parkinson’s disease (PD is a common neurodegenerative disease in the old population, characterized by dopaminergic neuron loss, inflammation and oxidative stress injury in the substantia nigra. Glaucocalyxin B (GLB, an ent-kauranoid diterpenoid isolated from Rabdosia japonica, has anti-inflammation and anti-tumor effects. However, its effects on PD remain unclear. Methods: PD was introduced in rats via injection of lipopolysaccharide (LPS into cerebral corpus striatum, and GLB was given intracerebroventricularly to these rats. Their walking, climbing and sensory states were detected by Stepping, Whisker and Cylinder Tests. The expression of tyrosine hydroxylase (TH, glial fibrillary acidic protein (GFAP, CD11b and ionized calcium binding adaptor molecule (IBA-1 were detected by immunohischemical staining. The levels of a series of inflammatory factors, oxidative stress-related factors and apoptosis-related factors were measured by real-time PCR, immunoblotting and ELISA. In addition, Toll-like receptor (TLR/nuclear factor kappa B (NF-κB and nuclear factor erythroid 2-related factor 2 (Nrf2/heme oxygenase (HO-1 pathways were investigated to illustrate the underlying mechanism. In vitro, microglial cells exposed to LPS were treated with GLB. Results: The injection of LPS caused walking, climbing and sensory disturbances in rats, induced inflammation, oxidative stress response and apoptosis, and activated TLR/NF-κB and Nrf2/ HO-1 pathways in the cerebral tissue. GLB administration attenuated LPS-induced alterations. The TLR/NF-κB pathway was deactivated and Nrf2/HO-1 was activated after application of GLB. In vitro, cytotoxic effects induced by the conditioned medium derived from microglial cells exposed to LPS in PC12 cells were attenuated by GLB. Conclusion: GLB suppresses LPS-induced PD symptoms by modification of TLR/NF-κB and Nrf2/HO-1 pathways in vivo and in vitro.
Yang, Chunzhang; Zhuang, Zhengping; Fliedner, Stephanie M J; Shankavaram, Uma; Sun, Michael G; Bullova, Petra; Zhu, Roland; Elkahloun, Abdel G; Kourlas, Peter J; Merino, Maria; Kebebew, Electron; Pacak, Karel
2015-01-01
We have investigated genetic/pathogenetic factors associated with a new clinical entity in patients presenting with pheochromocytoma/paraganglioma (PHEO/PGL) and polycythemia. Two patients without hypoxia-inducible factor 2α (HIF2A) mutations, who presented with similar clinical manifestations, were analyzed for other gene mutations, including prolyl hydroxylase (PHD) mutations. We have found for the first time a germ-line mutation in PHD1 in one patient and a novel germ-line PHD2 mutation in a second patient. Both mutants exhibited reduced protein stability with substantial quantitative protein loss and thus compromised catalytic activities. Due to the unique association of patients' polycythemia with borderline or mildly elevated erythropoietin (EPO) levels, we also performed an in vitro sensitivity assay of erythroid progenitors to EPO and for EPO receptor (EPOR) expression. The results show inappropriate hypersensitivity of erythroid progenitors to EPO in these patients, indicating increased EPOR expression/activity. In addition, the present study indicates that HIF dysregulation due to PHD mutations plays an important role in the pathogenesis of these tumors and associated polycythemia. The PHD1 mutation appears to be a new member contributing to the genetic landscape of this novel clinical entity. Our results support the existence of a specific PHD1- and PHD2-associated PHEO/PGL-polycythemia disorder. • A novel germ-l i n e PHD1 mutation causing heochromocytoma/paraganglioma and polycythemia. • Increased EPOR activity and inappropriate hypersensitivity of erythroid progenitors to EPO.
Sollazzo, Daria; Forte, Dorian; Polverelli, Nicola; Romano, Marco; Perricone, Margherita; Rossi, Lara; Ottaviani, Emanuela; Luatti, Simona; Martinelli, Giovanni; Vianelli, Nicola; Cavo, Michele; Palandri, Francesca; Catani, Lucia
2016-07-12
Along with molecular abnormalities (mutations in JAK2, Calreticulin (CALR) and MPL genes), chronic inflammation is the major hallmark of Myelofibrosis (MF). Here, we investigated the in vitro effects of crucial factors of the inflammatory microenvironment (Interleukin (IL)-1β, Tumor Necrosis Factor (TNF)-α, Tissue Inhibitor of Metalloproteinases (TIMP)-1 and ATP) on the functional behaviour of MF-derived circulating CD34+ cells.We found that, regardless mutation status, IL-1β or TNF-α increases the survival of MF-derived CD34+ cells. In addition, along with stimulation of cell cycle progression to the S-phase, IL-1β or TNF-α ± TIMP-1 significantly stimulate(s) the in vitro clonogenic ability of CD34+ cells from JAK2V617 mutated patients. Whereas in the JAK2V617F mutated group, the addition of IL-1β or TNF-α + TIMP-1 decreased the erythroid compartment of the CALR mutated patients. Megakaryocyte progenitors were stimulated by IL-1β (JAK2V617F mutated patients only) and inhibited by TNF-α. IL-1β + TNF-α + C-X-C motif chemokine 12 (CXCL12) ± TIMP-1 highly stimulates the in vitro migration of MF-derived CD34+ cells. Interestingly, after migration toward IL-1β + TNF-α + CXCL12 ± TIMP-1, CD34+ cells from JAK2V617F mutated patients show increased clonogenic ability.Here we demonstrate that the interplay of these inflammatory factors promotes and selects the circulating MF-derived CD34+ cells with higher proliferative activity, clonogenic potential and migration ability. Targeting these micro-environmental interactions may be a clinically relevant approach.
Multiple Factors Related to the Secretion of Glucagon-Like Peptide-1
Directory of Open Access Journals (Sweden)
XingChun Wang
2015-01-01
Full Text Available The glucagon-like peptide-1 is secreted by intestinal L cells in response to nutrient ingestion. It regulates the secretion and sensitivity of insulin while suppressing glucagon secretion and decreasing postprandial glucose levels. It also improves beta-cell proliferation and prevents beta-cell apoptosis induced by cytotoxic agents. Additionally, glucagon-like peptide-1 delays gastric emptying and suppresses appetite. The impaired secretion of glucagon-like peptide-1 has negative influence on diabetes, hyperlipidemia, and insulin resistance related diseases. Thus, glucagon-like peptide-1-based therapies (glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 inhibitors are now well accepted in the management of type 2 diabetes. The levels of glucagon-like peptide-1 are influenced by multiple factors including a variety of nutrients. The component of a meal acts as potent stimulants of glucagon-like peptide-1 secretion. The levels of its secretion change with the intake of different nutrients. Some drugs also have influence on GLP-1 secretion. Bariatric surgery may improve metabolism through the action on GLP-1 levels. In recent years, there has been a great interest in developing effective methods to regulate glucagon-like peptide-1 secretion. This review summarizes the literature on glucagon-like peptide-1 and related factors affecting its levels.
Heslop, James A; Kia, Richard; Pridgeon, Christopher S; Sison-Young, Rowena L; Liloglou, Triantafillos; Elmasry, Mohamed; Fenwick, Stephen W; Mills, John S; Kitteringham, Neil R; Goldring, Chris E; Park, Bong K
2017-05-01
Drug-induced liver injury is the greatest cause of post-marketing drug withdrawal; therefore, substantial resources are directed toward triaging potentially dangerous new compounds at all stages of drug development. One of the major factors preventing effective screening of new compounds is the lack of a predictive in vitro model of hepatotoxicity. Primary human hepatocytes offer a metabolically relevant model for which the molecular initiating events of hepatotoxicity can be examined; however, these cells vary greatly between donors and dedifferentiate rapidly in culture. Induced pluripotent stem cell (iPSC)-derived hepatocyte-like cells (HLCs) offer a reproducible, physiologically relevant and genotypically normal model cell; however, current differentiation protocols produce HLCs with a relatively immature phenotype. During the reprogramming of somatic cells, the epigenome undergoes dramatic changes; however, this "resetting" is a gradual process, resulting in an altered differentiation propensity, skewed toward the lineage of origin, particularly in early passage cultures. We, therefore, performed a comparison of human hepatocyte- and dermal fibroblast-derived iPSCs, assessing the impact of epigenetic memory at all stages of HLC differentiation. These results provide the first isogenic assessment of the starting cell type in human iPSC-derived HLCs. Despite a trend toward improvement in hepatic phenotype in albumin secretion and gene expression, few significant differences in hepatic differentiation capacity were found between hepatocyte and fibroblast-derived iPSCs. We conclude that the donor and inter-clonal differences have a greater influence on the hepatocyte phenotypic maturity than the starting cell type. Therefore, it is not necessary to use human hepatocytes for generating iPSC-derived HLCs. Stem Cells Translational Medicine 2017;6:1321-1331. © 2017 The Authors Stem Cells Translational Medicine published by Wiley Periodicals, Inc. on behalf of Alpha
Liu, Heng; Chen, Xiao; Xue, Wei; Chu, Chengchao; Liu, Yu; Tong, Haipeng; Du, Xuesong; Xie, Tian; Liu, Gang; Zhang, Weiguo
The highly infiltrative and invasive nature of glioma cells often leads to blurred tumor margins, resulting in incomplete tumor resection and tumor recurrence. Accurate detection and precise delineation of glioma help in preoperative delineation, surgical planning and survival prediction. In this study, recombinant epidermal growth factor-like domain-1, derived from human coagulation factor VII, was conjugated to iron oxide nanoparticles (IONPs) for targeted glioma magnetic resonance (MR) imaging. The synthesized EGF1-EGFP-IONPs exhibited excellent targeting ability toward tissue factor (TF)-positive U87MG cells and human umbilical vein endothelial cells in vitro, and demonstrated persistent and efficient MR contrast enhancement up to 12 h for preclinical glioma models with high targeting specificity in vivo. They hold great potential for clinical translation and developing targeted theranostics against brain glioma.
Spaceflight Activates Autophagy Programs and the Proteasome in Mouse Liver.
Blaber, Elizabeth A; Pecaut, Michael J; Jonscher, Karen R
2017-09-27
Increased oxidative stress is an unavoidable consequence of exposure to the space environment. Our previous studies showed that mice exposed to space for 13.5 days had decreased glutathione levels, suggesting impairments in oxidative defense. Here we performed unbiased, unsupervised and integrated multi-'omic analyses of metabolomic and transcriptomic datasets from mice flown aboard the Space Shuttle Atlantis. Enrichment analyses of metabolite and gene sets showed significant changes in osmolyte concentrations and pathways related to glycerophospholipid and sphingolipid metabolism, likely consequences of relative dehydration of the spaceflight mice. However, we also found increased enrichment of aminoacyl-tRNA biosynthesis and purine metabolic pathways, concomitant with enrichment of genes associated with autophagy and the ubiquitin-proteasome. When taken together with a downregulation in nuclear factor (erythroid-derived 2)-like 2-mediated signaling, our analyses suggest that decreased hepatic oxidative defense may lead to aberrant tRNA post-translational processing, induction of degradation programs and senescence-associated mitochondrial dysfunction in response to the spaceflight environment.
Spaceflight Activates Autophagy Programs and the Proteasome in Mouse Liver
Directory of Open Access Journals (Sweden)
Elizabeth A. Blaber
2017-09-01
Full Text Available Increased oxidative stress is an unavoidable consequence of exposure to the space environment. Our previous studies showed that mice exposed to space for 13.5 days had decreased glutathione levels, suggesting impairments in oxidative defense. Here we performed unbiased, unsupervised and integrated multi-‘omic analyses of metabolomic and transcriptomic datasets from mice flown aboard the Space Shuttle Atlantis. Enrichment analyses of metabolite and gene sets showed significant changes in osmolyte concentrations and pathways related to glycerophospholipid and sphingolipid metabolism, likely consequences of relative dehydration of the spaceflight mice. However, we also found increased enrichment of aminoacyl-tRNA biosynthesis and purine metabolic pathways, concomitant with enrichment of genes associated with autophagy and the ubiquitin-proteasome. When taken together with a downregulation in nuclear factor (erythroid-derived 2-like 2-mediated signaling, our analyses suggest that decreased hepatic oxidative defense may lead to aberrant tRNA post-translational processing, induction of degradation programs and senescence-associated mitochondrial dysfunction in response to the spaceflight environment.
Directory of Open Access Journals (Sweden)
Ceren Eyileten
2017-01-01
Full Text Available Brain-derived neurotrophic factor (BDNF is a neurotrophin, which plays an important role in the central nervous system, and systemic or peripheral inflammatory conditions, such as acute coronary syndrome and type 2 diabetes mellitus (T2DM. BDNF is also expressed in several nonneuronal tissues, and platelets are the major source of peripheral BDNF. Here, we reviewed the potential role of BDNF in platelet reactivity in T2DM and its association with selected inflammatory and platelet activation mediators. Besides that, we focused on adipocytokines such as leptin, resistin, and adiponectin which are considered to take part in inflammation and both lipid and glucose metabolism in diabetic patients as previous studies showed the relation between adipocytokines and BDNF. We also reviewed the evidences of the antidiabetic effect of BDNF and the association with circulating inflammatory cytokines in T2DM.
Saw, Constance Lay Lay; Guo, Yue; Yang, Anne Yuqing; Paredes-Gonzalez, Ximena; Ramirez, Christina; Pung, Douglas; Kong, Ah-Ng Tony
2014-10-01
Quercetin, kaempferol, and pterostilbene are abundant in berries. The anti-oxidative properties of these constituents may contribute to cancer chemoprevention. However, their precise mechanisms of action and their combinatorial effects are not completely understood. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates anti-oxidative stress enzymes and Phase II drug metabolizing/detoxifying enzymes by binding to antioxidant response element (ARE). This study aimed to investigate the anti-oxidative stress activities of quercetin, kaempferol, and pterostilbene individually and in combination, as well as the involvement of the Nrf2-ARE signaling pathway. Quercetin, kaempferol, and pterostilbene all exhibited strong free-radical scavenging activity in the DPPH assay. The MTS assay revealed that low concentration combinations we tested were relatively non-toxic to HepG2-C8 cells. The results of the DCFH-DA assay and combination index (CI) indicated that quercetin, kaempferol, and pterostilbene attenuated intracellular reactive oxygen species (ROS) levels when pretreated individually and had synergistic effects when used in combination. In addition, the combination treatment significantly induced ARE and increased the mRNA and protein expression of Nrf2-regulated genes. Collectively, our study demonstrated that the berry constituents quercetin, kaempferol, and pterostilbene activated the Nrf2-ARE signaling pathway and exhibited synergistic anti-oxidative stress activity at appropriate concentrations. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Susana González-Reyes
2013-01-01
Full Text Available Curcumin is a bifunctional antioxidant derived from Curcuma longa. This study identifies curcumin as a neuroprotectant against hemin-induced damage in primary cultures of cerebellar granule neurons (CGNs of rats. Hemin, the oxidized form of heme, is a highly reactive compound that induces cellular injury. Pretreatment of CGNs with 5–30 μM curcumin effectively increased by 2.3–4.9 fold heme oxygenase-1 (HO-1 expression and by 5.6–14.3-fold glutathione (GSH levels. Moreover, 15 μM curcumin attenuated by 55% the increase in reactive oxygen species (ROS production, by 94% the reduction of GSH/glutathione disulfide (GSSG ratio, and by 49% the cell death induced by hemin. The inhibition of heme oxygenase system or GSH synthesis with tin mesoporphyrin and buthionine sulfoximine, respectively, suppressed the protective effect of curcumin against hemin-induced toxicity. These data strongly suggest that HO-1 and GSH play a major role in the protective effect of curcumin. Furthermore, it was found that 24 h of incubation with curcumin increases by 1.4-, 2.3-, and 5.2-fold the activity of glutathione reductase, glutathione S-transferase and superoxide dismutase, respectively. Additionally, it was found that curcumin was capable of inducing nuclear factor (erythroid-derived 2-like 2 (Nrf2 translocation into the nucleus. These data suggest that the pretreatment with curcumin induces Nrf2 and an antioxidant response that may play an important role in the protective effect of this antioxidant against hemin-induced neuronal death.
González-Reyes, Susana; Guzmán-Beltrán, Silvia; Medina-Campos, Omar Noel; Pedraza-Chaverri, José
2013-01-01
Curcumin is a bifunctional antioxidant derived from Curcuma longa. This study identifies curcumin as a neuroprotectant against hemin-induced damage in primary cultures of cerebellar granule neurons (CGNs) of rats. Hemin, the oxidized form of heme, is a highly reactive compound that induces cellular injury. Pretreatment of CGNs with 5–30 μM curcumin effectively increased by 2.3–4.9 fold heme oxygenase-1 (HO-1) expression and by 5.6–14.3-fold glutathione (GSH) levels. Moreover, 15 μM curcumin attenuated by 55% the increase in reactive oxygen species (ROS) production, by 94% the reduction of GSH/glutathione disulfide (GSSG) ratio, and by 49% the cell death induced by hemin. The inhibition of heme oxygenase system or GSH synthesis with tin mesoporphyrin and buthionine sulfoximine, respectively, suppressed the protective effect of curcumin against hemin-induced toxicity. These data strongly suggest that HO-1 and GSH play a major role in the protective effect of curcumin. Furthermore, it was found that 24 h of incubation with curcumin increases by 1.4-, 2.3-, and 5.2-fold the activity of glutathione reductase, glutathione S-transferase and superoxide dismutase, respectively. Additionally, it was found that curcumin was capable of inducing nuclear factor (erythroid-derived 2)-like 2 (Nrf2) translocation into the nucleus. These data suggest that the pretreatment with curcumin induces Nrf2 and an antioxidant response that may play an important role in the protective effect of this antioxidant against hemin-induced neuronal death. PMID:24454990
Directory of Open Access Journals (Sweden)
Xinjing Luo
2016-01-01
Full Text Available Human fibroblast-like synoviocytes play a vital role in joint synovial inflammation in rheumatoid arthritis (RA. Proinflammatory cytokines induce fibroblast-like synoviocyte activation and dysfunction. The inflammatory mediator Krüppel-like factor 4 is upregulated during inflammation and plays an important role in endothelial and macrophage activation during inflammation. However, the role of Krüppel-like factor 4 in fibroblast-like synoviocyte activation and RA inflammation remains to be defined. In this study, we identify the notion that Krüppel-like factor 4 is higher expressed in synovial tissues and fibroblast-like synoviocytes from RA patients than those from osteoarthritis patients. In vitro, the expression of Krüppel-like factor 4 in RA fibroblast-like synoviocytes is induced by proinflammatory cytokine tumor necrosis factor-α. Overexpression of Krüppel-like factor 4 in RA fibroblast-like synoviocytes robustly induced interleukin-6 production in the presence or absence of tumor necrosis factor-α. Conversely, knockdown of Krüppel-like factor 4 markedly attenuated interleukin-6 production in the presence or absence of tumor necrosis factor-α. Krüppel-like factor 4 not only can bind to and activate the interleukin-6 promoter, but also may interact directly with nuclear factor-kappa B. These results suggest that Krüppel-like factor 4 may act as a transcription factor mediating the activation of fibroblast-like synoviocytes in RA by inducing interleukin-6 expression in response to tumor necrosis factor-α.
Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow
International Nuclear Information System (INIS)
Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.
1976-01-01
The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors
Nutraceutical Antioxidants as Novel Neuroprotective Agents
Directory of Open Access Journals (Sweden)
Daniel A. Linseman
2010-11-01
Full Text Available A variety of antioxidant compounds derived from natural products (nutraceuticals have demonstrated neuroprotective activity in either in vitro or in vivo models of neuronal cell death or neurodegeneration, respectively. These natural antioxidants fall into several distinct groups based on their chemical structures: (1 flavonoid polyphenols like epigallocatechin 3-gallate (EGCG from green tea and quercetin from apples; (2 non-flavonoid polyphenols such as curcumin from tumeric and resveratrol from grapes; (3 phenolic acids or phenolic diterpenes such as rosmarinic acid or carnosic acid, respectively, both from rosemary; and (4 organosulfur compounds including the isothiocyanate, L-sulforaphane, from broccoli and the thiosulfonate allicin, from garlic. All of these compounds are generally considered to be antioxidants. They may be classified this way either because they directly scavenge free radicals or they indirectly increase endogenous cellular antioxidant defenses, for example, via activation of the nuclear factor erythroid-derived 2-related factor 2 (Nrf2 transcription factor pathway. Alternative mechanisms of action have also been suggested for the neuroprotective effects of these compounds such as modulation of signal transduction cascades or effects on gene expression. Here, we review the literature pertaining to these various classes of nutraceutical antioxidants and discuss their potential therapeutic value in neurodegenerative diseases.
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Vinter-Jensen, L
2000-01-01
BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...
Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio
2016-07-15
Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.
Choi, Yohan; Wilson, Kalin; Hannon, Patrick R; Rosewell, Katherine L; Brännström, Mats; Akin, James W; Curry, Thomas E; Jo, Misung
2017-06-01
In animal models, the luteinizing hormone surge increases progesterone (P4) and progesterone receptor (PGR), prostaglandins (PTGs), and epidermal growth factor (EGF)-like factors that play essential roles in ovulation. However, little is known about the expression, regulation, and function of these key ovulatory mediators in humans. To determine when and how these key ovulatory mediators are induced after the luteinizing hormone surge in human ovaries. Timed periovulatory follicles were obtained from cycling women. Granulosa/lutein cells were collected from in vitro fertilization patients. The in vivo and in vitro expression of PGR, PTG synthases and transporters, and EGF-like factors were examined at the level of messenger RNA and protein. PGR binding to specific genes was assessed. P4 and PTGs in conditioned media were measured. PGR, PTGS2, and AREG expressions dramatically increased in ovulatory follicles at 12 to 18 hours after human chorionic gonadotropin (hCG). In human granulosa/lutein cell cultures, hCG increased P4 and PTG production and the expression of PGR, specific PTG synthases and transporters, and EGF-like factors, mimicking in vivo expression patterns. Inhibitors for P4/PGR and EGF-signaling pathways reduced hCG-induced increases in PTG production and the expression of EGF-like factors. PGR bound to the PTGS2, PTGES, and SLCO2A1 genes. This report demonstrated the time-dependent induction of PGR, AREG, and PTGS2 in human periovulatory follicles. In vitro studies indicated that collaborative actions of P4/PGR and EGF signaling are required for hCG-induced increases in PTG production and potentiation of EGF signaling in human periovulatory granulosa cells. Copyright © 2017 Endocrine Society
Townsend, Philip D; Dixon, Christopher H; Slootweg, Erik J; Sukarta, Octavina C A; Yang, Ally W H; Hughes, Timothy R; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Goverse, Aska; Cann, Martin J
2018-03-02
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable the immune system to recognize and respond to pathogen attack. An early consequence of immune activation is transcriptional reprogramming, and some NLRs have been shown to act in the nucleus and interact with transcription factors. The Rx1 NLR protein of potato is further able to bind and distort double-stranded DNA. However, Rx1 host targets that support a role for Rx1 in transcriptional reprogramming at DNA are unknown. Here, we report a functional interaction between Rx1 and Nb Glk1, a Golden2-like transcription factor. Rx1 binds to Nb Glk1 in vitro and in planta. Nb Glk1 binds to known Golden2-like consensus DNA sequences. Rx1 reduces the binding affinity of Nb Glk1 for DNA in vitro. Nb Glk1 activates cellular responses to potato virus X, whereas Rx1 associates with Nb Glk1 and prevents its assembly on DNA in planta unless activated by PVX. This study provides new mechanistic insight into how an NLR can coordinate an immune signaling response at DNA following pathogen perceptions. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Interaction of insulin-like growth factor I with porcine thyroid cells cultured in monolayer
International Nuclear Information System (INIS)
Saji, M.; Tsushima, T.; Isozaki, O.; Murakami, H.; Ohba, Y.; Sato, K.; Arai, M.; Mariko, A.; Shizume, K.
1987-01-01
The interaction of insulin-like growth factor I (IGF-I) with porcine thyroid cells cultured in monolayer was studied. Specific binding of [ 125 I]iodo-IGF-I to thyroid cells was a reversible process dependent on the time and temperature of incubation. A steady state was achieved in 18 h at 4 C and averaged 14.2 +/- 2% (mean +/- SD)/10(6) cells. Binding of [ 125 I]iodo-IGF-I was inhibited by unlabeled IGF-I; half-maximal inhibition occurred at concentrations of 2-5 ng/ml. Multiplication-stimulating activity (rat IGF-II) and pork insulin had relative potencies of 1:20 and 1:300 compared with IGF-I. Scatchard analysis of binding data revealed a single class of IGF-I receptors with a Ka of 4.3 X 10(10) M-1, 49,000 binding sites were estimated per cell. Affinity cross-linking and autoradiography demonstrated the presence of type I IGF receptors. Thyroid cells also had specific receptors for insulin, but specific binding of [ 125 I]iodoinsulin was much lower than that of [ 125 I]iodo-IGF-I. Preincubation of thyroid cells with IGF-I or insulin caused a concentration-dependent decrease in [ 125 I]iodo-IGF-I binding due to an apparent loss of receptors. Preincubation with epidermal growth factor, fibroblast growth factor, platelet-derived growth factor, or TSH did not alter subsequent binding of [ 125 I]iodo-IGF-I. Low concentrations of IGF-I stimulated DNA synthesis and proliferation of thyroid cells and acted synergistically with epidermal growth factor. Multiplication-stimulating activity and insulin had relative potencies in stimulating DNA synthesis comparable to their abilities to inhibit the binding of [ 125 I]iodo-IGF-I to thyroid cells
Wang, Ming; Chen, Qian; Li, Mei; Zhou, Wei; Ma, Tengfei; Wang, Yun; Gu, Shuling
2014-06-01
Alarin is a newly identified member of the galanin family of peptides. Galanin has been shown to exert regulatory effects on depression. Similar to galanin in distribution, alarin is also expressed in the medial amygdala and hypothalamus, i.e., regions interrelated with depression. However, it remains a puzzle whether alarin is involved in depression. Accordingly, we established the depression-like mouse model using behavioral tests to ascertain the possible involvement of alarin, with fluoxetine as a positive control. With the positive antidepressant-like effects of alarin, we further examined its relationship to HPA axis activity and brain-derived neurotrophic factor (BDNF) levels in different brain areas in a chronic unpredictable mild stress (CUMS) paradigm. In the acute studies, alarin produced a dose-related reduction in the immobility duration in tail suspension test (TST) in mice. In the open-field test, intracerebroventricular (i.c.v.) injection of alarin (1.0 nmol) did not impair locomotion or motor coordination in the treated mice. In the CUMS paradigm, alarin administration (1.0 nmol, i.c.v.) significantly improved murine behaviors (FST and locomotor activity), which was associated with a decrease in corticotropin-releasing hormone (CRH) mRNA levels in the hypothalamus, as well as a decline in serum levels of CRH, adrenocorticotropic hormone (ACTH) and corticosterone (CORT), all of which are key hormones of the HPA axis. Furthermore, alarin upregulated BDNF mRNA levels in the prefrontal cortex and hippocampus. These findings suggest that alarin may potentiate the development of new antidepressants, which would be further secured with the identification of its receptor(s). Copyright © 2014 Elsevier Inc. All rights reserved.
[Update on the biology of heme synthesis in erythroid cells].
Fujiwara, Tohru; Harigae, Hideo
2015-02-01
Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.
Directory of Open Access Journals (Sweden)
Noriyuki Seta
Full Text Available BACKGROUND: We previously described a primitive cell population derived from human circulating CD14(+ monocytes, named monocyte-derived multipotential cells (MOMCs, which are capable of differentiating into mesenchymal and endothelial lineages. To generate MOMCs in vitro, monocytes are required to bind to fibronectin and be exposed to soluble factor(s derived from circulating CD14(- cells. The present study was conducted to identify factors that induce MOMC differentiation. METHODS: We cultured CD14(+ monocytes on fibronectin in the presence or absence of platelets, CD14(- peripheral blood mononuclear cells, platelet-conditioned medium, or candidate MOMC differentiation factors. The transformation of monocytes into MOMCs was assessed by the presence of spindle-shaped adherent cells, CD34 expression, and the potential to differentiate in vitro into mesenchymal and endothelial lineages. RESULTS: The presence of platelets or platelet-conditioned medium was required to generate MOMCs from monocytes. A screening of candidate platelet-derived soluble factors identified stromal cell-derived factor (SDF-1 as a requirement for generating MOMCs. Blocking an interaction between SDF-1 and its receptor CXCR4 inhibited MOMC generation, further confirming SDF-1's critical role in this process. Finally, circulating MOMC precursors were found to reside in the CD14(+CXCR4(high cell population. CONCLUSION: The interaction of SDF-1 with CXCR4 is essential for the transformation of circulating monocytes into MOMCs.
Energy Technology Data Exchange (ETDEWEB)
Zeng, Xiao-Qing, E-mail: zeng.xiaoqing@zs-hospital.sh.cn [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Li, Na, E-mail: Linala.2009@163.com [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Pan, Du-Yi, E-mail: lasikesmi@hotmail.com [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Miao, Qing, E-mail: sadsadvenus@163.com [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Ma, Gui-Fen, E-mail: ma.guifen@zs-hospital.sh.cn [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Liu, Yi-Mei, E-mail: liuyimei1988@163.com [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Tseng, Yu-Jen, E-mail: dianatseng14@gmail.com [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Li, Feng, E-mail: li.feng2@zs-hospital.sh.cn [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Xu, Li-Li, E-mail: xu.lili3@zs-hospital.sh.cn [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Chen, Shi-Yao, E-mail: chen.shiyao@zs-hospital.sh.cn [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Institute of Endoscopic Research of Zhongshan Hospital, Fudan University, Shanghai (China)
2015-09-04
Kruppel-like factor 2 (KLF2) is a crucial anti-angiogenic factor. However, its precise role in hepatic angiogenesis induced by liver sinusoidal endothelial cells (LSECs) remain unclear. This study was aimed to evaluate the effect of KLF2 on angiogenesis of LSECs and to explore the corresponding mechanism. Cultured human LSECs were infected with different lentiviruses to overexpress or suppress KLF2 expression. The CCK-8 assay, transwell migration assay and tube formation test, were used to investigate the roles of KLF2 in the proliferation, migration and vessel tube formation of LSECs, respectively. The expression and phosphorylation of ERK1/2 were detected by western blot. We discovered that the up-regulation of KLF2 expression dramatically inhibited proliferation, migration and tube formation in treated LSECs. Correspondingly, down-regulation of KLF2 expression significantly promoted proliferation, migration and tube formation in treated LSECs. Additionally, KLF2 inhibited the phosphorylation of ERK1/2 pathway, followed by the function of KLF2 in the angiogenesis of LSECs disrupted. In conclusion, KLF2 suppressed the angiogenesis of LSECs through inhibition of cell proliferation, migration, and vessel tube formation. These functions of KLF2 may be mediated through the ERK1/2 signaling pathway. - Highlights: • Overexpression of KLF2 inhibits the proliferation and migration of LSECs. • Overexpression of KLF2 inhibits the angiogenesis of LSECs. • ERK1/2 signaling pathway involved in the anti-angiogenic process of KLF2 on LSECs.
Li, Meng; Fu, Qiang; Li, Ying; Li, Shanshan; Xue, Jinsong; Ma, Shiping
2014-10-01
Emodin, the major active component of Rhubarb, has shown neuroprotective activity. This study is attempted to investigate whether emodin possesses beneficial effects on chronic unpredictable mild stress (CUMS)-induced behavioral deficits (depression-like behaviors) and explore the possible mechanisms. ICR mice were subjected to chronic unpredictable mild stress for 42 consecutive days. Then, emodin and fluoxetine (positive control drug) were administered for 21 consecutive days at the last three weeks of CUMS procedure. The classical behavioral tests: open field test (OFT), sucrose preference test (SPT), tail suspension test (TST) and forced swimming test (FST) were applied to evaluate the antidepressant effects of emodin. Then plasma corticosterone concentration, hippocampal glucocorticoid receptor (GR) and brain-derived neurotrophic factor (BDNF) levels were tested to probe the mechanisms. Our results indicated that 6 weeks of CUMS exposure induced significant depression-like behavior, with high, plasma corticosterone concentration and low hippocampal GR and BDNF expression levels. Whereas, chronic emodin (20, 40 and 80 mg/kg) treatments reversed the behavioral deficiency induced by CUMS exposure. Treatment with emodin normalized the change of plasma corticosterone level, which demonstrated that emodin could partially restore CUMS-induced HPA axis impairments. Besides, hippocampal GR (mRNA and protein) and BDNF (mRNA) expressions were also up-regulated after emodin treatments. In conclusion, emodin remarkably improved depression-like behavior in CUMS mice and its antidepressant activity is mediated, at least in part, by the up-regulating GR and BDNF levels in hippocampus. Copyright © 2014 Elsevier B.V. All rights reserved.
Humic derivatives as promising hormone-like materials
Koroleva, R. P.; Khudaibergenova, E. M.; Kydralieva, K. A.; Jorobekova, Sh. J.
2009-04-01
significant increase of H/C and O/C was also found in the HS. It can be attributed to formation new aliphatic and O-containing structures and decrease aromatic ones. Accumulation of fulvic acids was recorded in 6 months incubation. In 9 months, natural microbial populations from soil, biohumus, and wood rot had reduced the absorbance of HS media by 79, 75, and 62%, respectively. A relative reduction of the molecular weight was noticed after 3 months incubation, and accumulation of new low molecular weight fraction after 6 months incubation was recorded after chromatography on Toyopearl HW-50S. Reductions in amount were due to a random degradation of substances in all molecular size classes. A formation the high molecular weight fraction has been found, that can be caused by cross-linking of structural constituents of molecules due to radicals forming after biodestruction or by their interaction with metabolites. Data obtained by spectroscopic methods (UV/vis/FTIR) and element analysis indicated a decrease in particle size and a loss in aromaticity and aliphatic carbon in HS reisolated from microbial cultures. Simultaneously an increase in the N content of HS was observed, which probably from some constituents of microbial biomass such as proteins and aminosugars. The microbial degradation of HS strongly depended on the composition of the HS, the species selection of the microorganisms, and to a lesser extent on the culture conditions. A hormone-like activity has been showed by HS preparations which were characterized with low molecular weights (~5-15 kD). Each of these preparations was endowed with a single specific (auxin-like or gibberellin-like) activity. Biosolubilized HS with low molecular weight were displayed two kinds of activity. Acknowledgement. This research was supported by the ISTC grants of the projects KR-993.2.
DEFF Research Database (Denmark)
Markljung, Ellen; Jiang, Lin; Jaffe, Jacob D
2009-01-01
and find that the protein, named ZBED6, is previously unknown, specific for placental mammals, and derived from an exapted DNA transposon. Silencing of Zbed6 in mouse C2C12 myoblasts affected Igf2 expression, cell proliferation, wound healing, and myotube formation. Chromatin immunoprecipitation (Ch......, including development and transcriptional regulation. The phenotypic effects in mutant pigs and ZBED6-silenced C2C12 myoblasts, the extreme sequence conservation, its nucleolar localization, the broad tissue distribution, and the many target genes with essential biological functions suggest that ZBED6...... is an important transcription factor in placental mammals, affecting development, cell proliferation, and growth....
Novel series of 1,2,4-trioxane derivatives as antimalarial agents.
Rudrapal, Mithun; Chetia, Dipak; Singh, Vineeta
2017-12-01
Among three series of 1,2,4-trioxane derivatives, five compounds showed good in vitro antimalarial activity, three compounds of which exhibited better activity against P. falciparum resistant (RKL9) strain than the sensitive (3D7) one. Two best compounds were one from aryl series and the other from heteroaryl series with IC 50 values of 1.24 µM and 1.24 µM and 1.06 µM and 1.17 µM, against sensitive and resistant strains, respectively. Further, trioxane derivatives exhibited good binding affinity for the P. falciparum cysteine protease falcipain 2 receptor (PDB id: 3BPF) with well defined drug-like and pharmacokinetic properties based on Lipinski's rule of five with additional physicochemical and ADMET parameters. In view of having antimalarial potential, 1,2,4-trioxane derivative(s) reported herein may be useful as novel antimalarial lead(s) in the discovery and development of future antimalarial drug candidates as P. falciparum falcipain 2 inhibitors against resistant malaria.
Generation of a Nrf2 homozygous knockout human embryonic stem cell line using CRISPR/Cas9
Directory of Open Access Journals (Sweden)
So-Jung Kim
2017-03-01
Full Text Available Nuclear factor erythroid 2-related factor 2 (NFE2L2 or Nrf2 is a well-known transcription factor that regulates the expression of a large number of anti-oxidant genes in mammalian cells (J.H. Kim et al., 2014. Here, we generated a homozygous Nrf2 knockout human embryonic stem cell (hESC line, H9Nrf2KO-A13, using the CRISPR/Cas9 genome editing method. The Nrf2 homozygous knockout H9 cell line maintains pluripotency, differentiation potential into three germ layers, and a normal karyotype.
Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster
International Nuclear Information System (INIS)
Vognsen, Tina; Kristensen, Ole
2012-01-01
Highlights: ► The crystal structure of the NTF2-like domain of Rasputin protein is presented. ► Differences to known ligand binding sites of nuclear transport factor 2 are discussed. ► A new ligand binding site for the Rasputin and G3BP proteins is proposed. -- Abstract: The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7 Å resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a β-sheet and three α-helices forming a cone-like shape. However, known binding sites for RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site.
The pion electromagnetic form factor in the time-like energy range 1.35≤√s≤2.4 GeV
International Nuclear Information System (INIS)
1988-10-01
The e + e - → π + π - cross section has been measured from about 280 events (an order of magnitude more than the previous world statistics) in the energy interval 1.35≤√s≤2.4 GeV with the DM2 detector at DCI. The pion squared form factor shows a deep minimum around 1.6 GeV/c 2 and is best fit under the hypothesis of two ρ like resonances ≅ 0.2 GeV/c 2 wide with 1.43 and 1.76 GeV/c 2 masses
Li, Wenhui; Wu, Xiaofeng; Li, Shuangde; Tang, Wenxiang; Chen, Yunfa
2018-04-01
The synthesis of effective and recyclable Fenton-like catalyst is still a key factor for advanced oxidation processes. Herein, magnetic porous Fe3O4/carbon octahedra were constructed by a two-step controlled calcination of iron-based metal organic framework. The porous octahedra were assembled by interpenetrated Fe3O4 nanoparticles coated with graphitic carbon layer, offering abundant mesoporous channels for the solid-liquid contact. Moreover, the oxygen-containing functional groups on the surface of graphitic carbon endow the catalysts with hydrophilic nature and well-dispersion into water. The porous Fe3O4/carbon octahedra show efficiently heterogeneous Fenton-like reactions for decomposing the organic dye methylene blue (MB) with the help of H2O2, and nearly 100% removal efficiency within 60 min. Furthermore, the magnetic catalyst retains the activity after ten cycles and can be easily separated by external magnetic field, indicating the long-term catalytic durability and recyclability. The good Fenton-like catalytic performance of the as-synthesized Fe3O4/carbon octahedra is ascribed to the unique mesoporous structure derived from MOF-framework, as well as the sacrificial role and stabilizing effect of graphitic carbon layer. This work provides a facile strategy for the controllable synthesis of integrated porous octahedral structure with graphitic carbon layer, and thereby the catalyst holds significant potential for wastewater treatment.
Derivation of Sky-View Factors from LIDAR Data
Kidd, Christopher; Chapman, Lee
2013-01-01
The use of Lidar (Light Detection and Ranging), an active light-emitting instrument, is becoming increasingly common for a range of potential applications. Its ability to provide fine resolution spatial and vertical resolution elevation data makes it ideal for a wide range of studies. This paper demonstrates the capability of Lidar data to measure sky view factors (SVF). The Lidar data is used to generate a spatial map of SVFs which are then compared against photographically-derived SVF at selected point locations. At each location three near-surface elevations measurements were taken and compared with collocated Lidar-derived estimated. It was found that there was generally good agreement between the two methodologies, although with decreasing SVF the Lidar-derived technique tended to overestimate the SVF: this can be attributed in part to the spatial resolution of the Lidar sampling. Nevertheless, airborne Lidar systems can map sky view factors over a large area easily, improving the utility of such data in atmospheric and meteorological models.
Dealing With A Controllable Risk Factor Like Diet In The ...
African Journals Online (AJOL)
Cardiovascular disease (CVD) is a silent killer in Nigeria and many parts of the world. Certain factors increase the risk of CVD. While there are controllable factors that contribute and predispose to the development of CVD like diet, exercise, tobacco use, high blood pressure and obesity, there are uncontrollable factors like ...
Expressions of toll-like receptors 2 and 4, and relative cellular ...
African Journals Online (AJOL)
Purpose: To investigate the expressions of toll-like receptor 2 (TLR2), toll-like receptor 4 (TLR4), tumor necrosis factor alpha (TNF-α), IFN-γ (IFN- gamma), interleukin 2 (IL-2), interleukin 6 (IL-6) and interleukin 10 (IL-10) in human immunodeficiency virus (HIV) patients with tuberculosis (TB) infection. Methods: Two groups of ...
International Nuclear Information System (INIS)
Hoeflich, A.; Reisinger, R.; Schuett, B.S.; Elmlinger, M.W.; Russo, V.C.; Vargas, G.A.; Jehle, P.M.; Lahm, H.; Renner-Mueller, I.; Wolf, E.
2004-01-01
Insulin-like growth factor binding protein-2 (IGFBP-2) as one of the most important IGFBPs has never been assessed in the intracellular compartment in vivo. Since there is evidence for novel intracellular functions of distinct IGFBPs, we investigated the presence of IGFBP-2 inside the cell. In peri/nuclear fractions of various tissues isolated from IGFBP-2 transgenic and non-transgenic mice we were able to show the presence of intact IGFBP-2. In addition, we demonstrate the presence of a highly conserved carboxyl-terminal IGFBP-2 fragment in the peri/nuclear fraction by using different peptide-induced antibodies. In pancreatic sections, confocal microscopy revealed the presence of IGFBP-2 on the nuclear surface but not within the nucleus. Our findings suggest novel functions of intact IGFBP-2 and IGFBP-2 fragments within the cell
Genetic variation in insulin-like growth factor 2 may play a role in ovarian cancer risk
DEFF Research Database (Denmark)
Pearce, Celeste Leigh; Doherty, Jennifer A; Van Den Berg, David J
2011-01-01
The insulin-like growth factor (IGF) signaling axis plays an important role in cancer biology. We hypothesized that genetic variation in this pathway may influence risk of ovarian cancer. A three-center study of non-Hispanic whites including 1880 control women, 1135 women with invasive epithelial...... disease, whereas five tSNPs in IGF2 were associated with risk of invasive epithelial ovarian cancer at Pcases and 5382 additional controls and were able to independently replicate our initial...... findings. In the combined set of studies, rs4320932 was associated with a 13% decreased risk of ovarian cancer per copy of the minor allele carried (95% confidence interval 0.81–0.93, P-trend=7.4 × 10-5). No heterogeneity of effect across study centers was observed (phet=0.25). IGF2 is emerging...
Walker, Aisha L.; Ofori-Acquah, Solomon
2016-01-01
The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...
Directory of Open Access Journals (Sweden)
Gracielle Vieira Ramos
2018-01-01
Full Text Available Background. The present study aimed to analyze the effects of physical training on an antioxidant canonical pathway and metalloproteinases activity in diaphragm muscle in a model of cigarette smoke-induced chronic obstructive pulmonary disease (COPD. Methods. Male mice were randomized into control, smoke, exercise, and exercise + smoke groups, which were maintained in trial period of 24 weeks. Gene expression of kelch-like ECH-associated protein 1; nuclear factor erythroid-2 like 2; and heme-oxygenase1 by polymerase chain reaction was performed. Metalloproteinases 2 and 9 activities were analyzed by zymography. Exercise capacity was evaluated by treadmill exercise test before and after the protocol. Results. Aerobic training inhibited diaphragm muscle wasting induced by cigarette smoke exposure. This inhibition was associated with improved aerobic capacity in those animals that were submitted to 24 weeks of aerobic training, when compared to the control and smoke groups, which were not submitted to training. The aerobic training also downregulated the increase of matrix metalloproteinases (MMP-2 and MMP-9 and upregulated antioxidant genes, such as nuclear factor erythroid-2 like 2 (NRF2 and heme-oxygenase1 (HMOX1, in exercise + smoke group compared to smoke group. Conclusions. Treadmill aerobic training protects diaphragm muscle wasting induced by cigarette smoke exposure involving upregulation of antioxidant genes and downregulation of matrix metalloproteinases.
Directory of Open Access Journals (Sweden)
Sara P. Y. Che
2017-11-01
Full Text Available Tissue factor (TF-expressing tumor-derived extracellular vesicles (EVs can promote metastasis and pre-metastatic niche formation, but the mechanisms by which this occurs remain largely unknown. We hypothesized that generation of activated factor X (FXa by TF expressed on tumor-derived EV could activate protease-activated receptors (PARs on non-activated endothelial cells to induce a pro-adhesive and pro-inflammatory phenotype. We obtained EV from TF-expressing breast (MDA-MB-231 and pancreatic (BxPC3 and Capan-1 tumor cell lines. We measured expression of E-selectin and secretion of interleukin-8 (IL-8 in human umbilical vein endothelial cells after exposure to EV and various immunologic and chemical inhibitors of TF, FXa, PAR-1, and PAR-2. After 6 h of exposure to tumor-derived EV (pretreated with factor VIIa and FX in vitro, endothelial cells upregulated E-selectin expression and secreted IL-8. These changes were decreased with an anti-TF antibody, FXa inhibitors (FPRCK and EGRCK, and PAR-1 antagonist (E5555, demonstrating that FXa generated by TF-expressing tumor-derived EV was signaling through endothelial PAR-1. Due to weak constitutive PAR-2 expression, these endothelial responses were not induced by a PAR-2 agonist peptide (SLIGKV and were not inhibited by a PAR-2 antagonist (FSLLRY after exposure to tumor-derived EV. In conclusion, we found that TF-expressing cancer-derived EVs activate quiescent endothelial cells, upregulating E-selectin and inducing IL-8 secretion through generation of FXa and cleavage of PAR-1. Conversion of resting endothelial cells to an activated phenotype by TF-expressing cancer-derived EV could promote cancer metastases.
Embryonic stem-like cells derived from in vitro produced bovine blastocysts
Directory of Open Access Journals (Sweden)
Erika Regina Leal de Freitas
2011-06-01
Full Text Available The aim of this work was to study the derivation of bovine embryonic stem-like (ES-like cells from the inner cell mass (ICM of in vitro produced blastocysts. The ICMs were mechanically isolated and six out of seventeen (35% ICMs could attach to a monolayer of murine embryonic fibroblasts (MEF. Ten days after, primary outgrowths were mechanically dissected into several small clumps and transferred to a new MEF layer. Cells were further propagated and passaged by physical dissociation over a 60 days period. The pluripotency of the bovine ES-like cells was confirmed by RT-PCR of Oct-4 and STAT-3 gene markers. The colonies were weakly stained for alkaline phosphatase and the mesoderm and endoderm differentiation gene markers such as GATA-4 and Flk-1, respectively, were not expressed. Embryoid bodies were spontaneously formed at the seventh passage. Results showed that bovine ES-like cells could be obtained and passaged by mechanical procedures from the fresh in vitro produced blastocysts.
Directory of Open Access Journals (Sweden)
Nalo Hamilton
2015-01-01
Full Text Available Triple-negative breast cancer (TNBC occurs in 10–15% of patients yet accounts for almost half of all breast cancer deaths. TNBCs lack expression of estrogen and progesterone receptors and HER-2 overexpression and cannot be treated with current targeted therapies. TNBCs often occur in African American and younger women. Although initially responsive to some chemotherapies, TNBCs tend to relapse and metastasize. Thus, it is critical to find new therapeutic targets. A second ER gene product, termed ERβ, in the absence of ERα may be such a target. Using human TNBC specimens with known clinical outcomes to assess ERβ expression, we find that ERβ1 associates with significantly worse 5-year overall survival. Further, a panel of TNBC cell lines exhibit significant levels of ERβ protein. To assess ERβ effects on proliferation, ERβ expression in TNBC cells was silenced using shRNA, resulting in a significant reduction in TNBC proliferation. ERβ-specific antagonists similarly suppressed TNBC growth. Growth-stimulating effects of ERβ may be due in part to downstream actions that promote VEGF, amphiregulin, and Wnt-10b secretion, other factors associated with tumor promotion. In vivo, insulin-like growth factor-2 (IGF-2, along with ERβ1, is significantly expressed in TNBC and stimulates high ERβ mRNA in TNBC cells. This work may help elucidate the interplay of metabolic and growth factors in TNBC.
DEFF Research Database (Denmark)
Klein, A B; Santini, M A; Aznar, S
2010-01-01
Changes in brain-derived neurotrophic factor (BDNF) expression have been implicated in the etiology of psychiatric disorders. To investigate pathological mechanisms elicited by perturbed BDNF signaling, we examined mutant mice with central depletion of BDNF (BDNF(2L/2LCk-cre)). A severe impairmen...
Yang, Yiqiong; Dong, Han; Wang, Yin; He, Chi; Wang, Yuxin; Zhang, Xiaodong
2018-02-01
A series of octahedral structure Cu-BTC derivatives were successfully achieved through direct calcination of copper based metal organic framework Cu-BTC under different atmosphere (CO reaction gas, oxidizing gas O2, reducing gas H2, inert gas Ar). The Cu-BTC derivatives were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM), transmission electron microscopy (TEM), high-resolution transmission electron microscopy (HRTEM), laser Raman spectroscopy (LRS), N2 adsorption-desorption isotherm, element analysis, H2-temperature program reduction (H2-TPR) and X-ray photoelectron spectroscopic (XPS). It is found that Cu-BTC derivative derived from MOF calcined under reaction gas/O2 (Cu-BTC-CO/Cu-BTC-O) only retain Cu2O and CuO species. In addition, a weak Cu-BTC structure and Cu particles were observed on Cu-BTC derivative derived from MOF calcined under H2 (Cu-BTC-H). Obviously differently, Cu-BTC derivative derived from MOF calcined under Ar (Cu-BTC-Ar) still retains good MOF structure. The catalytic performance for CO oxidation over Cu-BTC derivatives was studied. It was found that Cu-BTC-CO showed a smaller specific surface area (8.0 m2/g), but presented an excellent catalytic performance, long-term stability and cycling stability with a complete CO conversion temperature (T100) of 140 °C, which was ascribed to the higher Cu2O/CuO ratio, good low temperature reduction behavior and a high quantity of surface active oxygen species.
Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster
Energy Technology Data Exchange (ETDEWEB)
Vognsen, Tina, E-mail: tv@farma.ku.dk [Biostructural Research, Department of Drug Design and Pharmacology, Faculty of Health Sciences, University of Copenhagen, Universitetsparken 2, DK-2100 Copenhagen (Denmark); Kristensen, Ole, E-mail: ok@farma.ku.dk [Biostructural Research, Department of Drug Design and Pharmacology, Faculty of Health Sciences, University of Copenhagen, Universitetsparken 2, DK-2100 Copenhagen (Denmark)
2012-03-30
Highlights: Black-Right-Pointing-Pointer The crystal structure of the NTF2-like domain of Rasputin protein is presented. Black-Right-Pointing-Pointer Differences to known ligand binding sites of nuclear transport factor 2 are discussed. Black-Right-Pointing-Pointer A new ligand binding site for the Rasputin and G3BP proteins is proposed. -- Abstract: The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7 A resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a {beta}-sheet and three {alpha}-helices forming a cone-like shape. However, known binding sites for RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site.
Czech Academy of Sciences Publication Activity Database
Dulebo, A.; Ettrich, Rüdiger; Lucas, R.; Kaftan, D.
2012-01-01
Roč. 18, č. 27 (2012), s. 4236-4243 ISSN 1381-6128 Institutional support: RVO:67179843 Keywords : lectin-like domain * tumor necrosis factor * TIP peptide * oligosaccharides * molecular docking * molecular dynamics simulation * alveolar liquid clearance Subject RIV: CE - Biochemistry Impact factor: 3.311, year: 2012
Synthesis and secretion of platelet-derived growth factor by human breast cancer cell lines
International Nuclear Information System (INIS)
Bronzert, D.A.; Pantazis, P.; Antoniades, H.N.; Kasid, A.; Davidson, N.; Dickson, R.B.; Lippman, M.E.
1987-01-01
The authors report that human breast cancer cells secrete a growth factor that is biologically and immunologically similar to platelet-derived growth factor (PDGF). Serum-free medium conditioned by estrogen-independent MDA-MB-231 or estrogen-dependent MCF-7 cells contains a mitogenic or competence activity that is capable of inducing incorporation of [ 3 H] thymidine into quiescent Swiss 3T3 cells in the presence of platelet-poor plasma. Like authentic PDGF, the PDGF-like activity produced by breast cancer cells is stable after acid and heat treatment (95 0 C) and inhibited by reducing agents. The mitogenic activity comigrates with a material of ≅30 kDa on NaDodSO 4 /polyacrylamide gels. Immunoprecipitation with PDGF antiserum of proteins from metabolically labeled cell lysates and conditioned medium followed by analysis on nonreducing NaDodSO 4 /polyacrylamide gels identified proteins of 30 and 34 kDa. Upon reduction, the 30- and 34-kDa bands were converted to 15- and 16-kDa bands suggesting that the immunoprecipitated proteins were made up of two disulfide-linked polypeptides similar to PDGF. Hybridization studies with cDNA probes for the A chain PDGF and the B chain of PDGF/SIS identified transcripts for both PDGF chains in the MCF-7 and MDA-MB-231 cells. The data summarized above provide conclusive evidence for the synthesis and hormonally regulated secretion of a PDGF-like mitogen by breast carcinoma cells. Production of a PDGF-like growth factor by breast cancer cell lines may be important in mediating paracrine stimulation of tumor growth
Spherical oligo-silicic acid SOSA disclosed as possible endogenous digitalis-like factor
Directory of Open Access Journals (Sweden)
Franz eKerek
2015-01-01
Full Text Available Na+/K+-ATPase is a membrane ion-transporter protein, specifically inhibited by digitalis glycosides used in cardiac-therapy. The existence in mammals of some endogenous digitalis-like factors (EDLF as presumed ATPase ligands is generally accepted. But the chemical structure of these factors remained elusive because no weighable amounts of pure EDLF have been isolated. Recent high resolution crystal structure data of Na+/K+-ATPase have located the hydrophobic binding pocket of the steroid glycoside ouabain. Our recently disclosed spherical oligo-silicic acids (SOSA fulfill the main criteria to be identified with the presumed EDL factor. SOSA was found as a very potent inhibitor of the Na+/K+-ATPase, Ca2+-ATPase, H+/K+-ATPase and of K-dp-ATPase, with IC50 values between 0.2-0.5µg/ml. These findings are even more astonishing while so far, neither mono silicic acid nor its poly-condensed derivatives have been remarked biologically active. With the diameter ϕ between 1 - 3nm, SOSA still belong to molecular species definitely smaller than silica nano-particles with ϕ >5nm. In SOSA molecules almost all Si-OH bonds are displayed on the external shell which facilitates the binding to hydrophilic ATPase domains. SOSA is stable for long-term in solution but is sensitive to freeze-drying which could explain the failure of countless attempts to isolate pure EDLF. There is a strong resemblance between SOSA and vanadates, the previously known general inhibitors of P-type ATPases. SOSA may be generated endogenously by spherical oligomerization of the mono-silicic acid ubiquitously present in animal cells and fluids. Based on the finding that the SOSA structure is sensitive to the concentration and nature of the cationic species a presumably archaic mechanism to regulate the activity of the ATPase pumps is proposed.
von Lindern, Marieke; Schmidt, Uwe; Beug, Hartmut
2004-01-01
Erythropoietin (Epo) and stem cell factor (SCF) are essential factors in the control of survival, expansion and differentiation of erythroid progenitors. Upon activation, their receptors, the EpoR and c-Kit, initiate multiple signalling pathways that control many cellular processes. To control
Mayrhofer, Severine; Pöggeler, Stefanie
2005-04-01
The homothallic filamentous ascomycete Sordaria macrospora possesses genes which are thought to encode two pheromone precursors and two seven-transmembrane pheromone receptors. The pheromone precursor genes are termed ppg1 and ppg2. The putative products derived from the gene sequence show structural similarity to the alpha-factor precursors and a-factor precursors of the yeast Saccharomyces cerevisiae. Likewise, sequence similarity has been found between the putative products of the pheromone receptor genes pre2 and pre1 and the S. cerevisiae Ste2p alpha-factor receptor and Ste3p a-factor receptor, respectively. To investigate whether the alpha-factor-like pheromone-receptor pair of S. macrospora is functional, a heterologous yeast assay was used. Our results show that the S. macrospora alpha-factor-like pheromone precursor PPG1 is processed into an active pheromone by yeast MATalpha cells. The S. macrospora PRE2 protein was demonstrated to be a peptide pheromone receptor. In yeast MATa cells lacking the endogenous Ste2p receptor, the S. macrospora PRE2 receptor facilitated all aspects of the pheromone response. Using a synthetic peptide, we can now predict the sequence of one active form of the S. macrospora peptide pheromone. We proved that S. macrospora wild-type strains secrete an active pheromone into the culture medium and that disruption of the ppg1 gene in S. macrospora prevents pheromone production. However, loss of the ppg1 gene does not affect vegetative growth or fertility. Finally, we established the yeast assay as an easy and useful system for analyzing pheromone production in developmental mutants of S. macrospora.
Energy Technology Data Exchange (ETDEWEB)
Xu, Jialin [Institute of Biochemistry and Molecular Biology, College of Life and Health Sciences, Northeastern University, Shenyang 110819 (China); Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Shimpi, Prajakta; Armstrong, Laura; Salter, Deanna [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Slitt, Angela L., E-mail: aslitt@uri.edu [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States)
2016-01-01
PFOS is a chemical of nearly ubiquitous exposure in humans. Recent studies have associated PFOS exposure to adipose tissue-related effects. The present study was to determine whether PFOS alters the process of adipogenesis and regulates insulin-stimulated glucose uptake in mouse and human preadipocytes. In murine-derived 3T3-L1 preadipocytes, PFOS enhanced hormone-induced differentiation to adipocytes and adipogenic gene expression, increased insulin-stimulated glucose uptake at concentrations ranging from 10 to 100 μM, and enhanced Glucose transporter type 4 and Insulin receptor substrate-1 expression. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2), NAD(P)H dehydrogenase, quinone 1 and Glutamate-cysteine ligase, catalytic subunit were significantly induced in 3T3-L1 cells treated with PFOS, along with a robust induction of Antioxidant Response Element (ARE) reporter in mouse embryonic fibroblasts isolated from ARE-hPAP transgenic mice by PFOS treatment. Chromatin immunoprecipitation assays further illustrated that PFOS increased Nrf2 binding to ARE sites in mouse Nqo1 promoter, suggesting that PFOS activated Nrf2 signaling in murine-derived preadipocytes. Additionally, PFOS administration in mice (100 μg/kg/day) induced adipogenic gene expression and activated Nrf2 signaling in epididymal white adipose tissue. Moreover, the treatment on human visceral preadipocytes illustrated that PFOS (5 and 50 μM) promoted adipogenesis and increased cellular lipid accumulation. It was observed that PFOS increased Nrf2 binding to ARE sites in association with Nrf2 signaling activation, induction of Peroxisome proliferator-activated receptor γ and CCAAT/enhancer-binding protein α expression, and increased adipogenesis. This study points to a potential role of PFOS in dysregulation of adipose tissue expandability, and warrants further investigations on the adverse effects of persistent pollutants on human health. - Highlights: • PFOS induces adipogenesis in association
International Nuclear Information System (INIS)
Bellis, Cédric; Bonnet, Marc; Cakoni, Fioralba
2013-01-01
Originally formulated in the context of topology optimization, the concept of topological derivative has also proved effective as a qualitative inversion tool for a wave-based identification of finite-sized objects. This approach remains, however, largely based on a heuristic interpretation of the topological derivative, whereas most other qualitative approaches to inverse scattering are backed by a mathematical justification. As an effort toward bridging this gap, this study focuses on a topological derivative approach applied to the L 2 -norm of the misfit between far-field measurements. Either an inhomogeneous medium or a finite number of point-like scatterers are considered, using either the Born approximation or a full-scattering model. Topological derivative-based imaging functionals are analyzed using a suitable factorization of the far-field operator, for each of the considered cases, in order to characterize their behavior and assess their ability to reconstruct the unknown scatterer(s). Results include the justification of the usual sign heuristic underpinning the method for (i) the Born approximation and (ii) full-scattering models limited to moderately strong scatterers. Semi-analytical and numerical examples are presented. Within the chosen framework, the topological derivative approach is finally discussed and compared to other well-known qualitative methods. (paper)
DEFF Research Database (Denmark)
Järås, Marcus; Johnels, Petra; Agerstam, Helena
2009-01-01
OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...
Energy Technology Data Exchange (ETDEWEB)
Ahn, Ji Yeon; Park, Sa Rah; Yun, Yeon Sook; Song, Jie Young [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)
2009-05-15
Lung cancer is the leading cause of cancer death in both men and women in the United States. Non-small cell lung cancer (NSCLC) accounts for more than 75% of all lung cancers and radiotherapy (RT) is the general treatment modality for these lung cancer patients. Nuclear factor erythroid-2. related factor 2 (Nrf2) is a redox-sensitive transcription factor that regulates the expression of genes encoding electrophiles and xenobiotic detoxification enzymes and efflux proteins, which confer cytoprotection against oxidative stress and xenobiotics in normal cells. Kelch-like ECH-associated protein (Keap1) sequesters Nrf2 and leads to proteasomal degradation of Nrf2 in non-stressed condition. Keap1 is often found with biallelic mutation in NSCLC cell lines and NSCLC patients, results in constitutive activation of Nrf2 function, and contributes to resistance of chemotherapy (CT) or RT (3, 4). We thus postulated that inhibition of Nrf2 in cancer cells could increase sensitivity to RT. Our primary results show that IM3829, a putative Nrf2 inhibitor, enhances the efficacy of RT and CT in H1299 lung cancer cell.
Koel, Mariann; Võsa, Urmo; Krjutškov, Kaarel; Einarsdottir, Elisabet; Kere, Juha; Tapanainen, Juha; Katayama, Shintaro; Ingerpuu, Sulev; Jaks, Viljar; Stenman, Ulf-Hakan; Lundin, Karolina; Tuuri, Timo; Salumets, Andres
2017-09-01
Several studies have demonstrated that human embryonic stem cells (hESC) can be differentiated into trophoblast-like cells if exposed to bone morphogenic protein 4 (BMP4) and/or inhibitors of fibroblast growth factor 2 (FGF2) and the transforming growth factor beta (TGF-β)/activin/nodal signalling pathways. The goal of this study was to investigate how the inhibitors of these pathways improve the efficiency of hESC differentiation when compared with basic BMP4 treatment. RNA sequencing was used to analyse the effects of all possible inhibitor combinations on the differentiation of hESC into trophoblast-like cells over 12 days. Genes differentially expressed compared with untreated cells were identified at seven time points. Additionally, expression of total human chorionic gonadotrophin (HCG) and its hyperglycosylated form (HCG-H) were determined by immunoassay from cell culture media. We showed that FGF2 inhibition with BMP4 activation up-regulates syncytiotrophoblast-specific genes (CGA, CGB and LGALS16), induces several molecular pathways involved in embryo implantation and triggers HCG-H production. In contrast, inhibition of the TGF-β/activin/nodal pathway decreases the ability of hESC to form trophoblast-like cells. Information about the conditions needed for hESC differentiation toward trophoblast-like cells helps us to find an optimal model for studying the early development of human trophoblasts in normal and in complicated pregnancy. Copyright © 2017 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
A test of the Veneziano - like πNN form factor
International Nuclear Information System (INIS)
Cass, A.; Mckellar, H.J.
1978-01-01
Dominguez' Veneziano-like πNN form factor has been investigated by attempting to use it to fit dsigma/dt data for np → pn and (antiproton)p → (antineutron)n at 8 GeV/c and 23.5 GeV/c in the interval 0 2 . With n=5/2 as proposed by Dominguez it is not possible to fit the data. A fit can be obtaine for other values of n
Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.
Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio
2017-07-15
Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.
The insulin-like growth factor axis and collagen turnover during prednisolone treatment
DEFF Research Database (Denmark)
Wolthers, O D; Juul, A; Hansen, M
1994-01-01
Serum concentrations of insulin-like growth factor I (IGF-I) and insulin-like growth factor binding protein 3 (IGFBP-3), the carboxyterminal propeptide of type I collagen (PICP), the carboxyterminal pyridinoline crosslinked telopeptide of type I collagen (ICTP), and the aminoterminal propeptide...... of type III procollagen (PIIINP) were studied in 10 prepubertal children with asthma (mean age 9.0 years). The children were treated with 2.5 and 5.0 mg/day prednisolone in a randomised double blind crossover trial with run in, treatment, and washout periods of two weeks. No statistically significant...... effects on serum concentrations of IGF-I and IGFBP-3 were found. Dose related reductions of PICP, ICTP, and PIIINP were observed: the mean (SEM) reduction in PICP was 33.4 (26.3) and 68.4 (20.6) micrograms/l, in ICTP 2.5 (0.5) and 2.9 (0.6) micrograms/l, and in PIIINP 2.1 (0.7) and 3.1 (1.8) micrograms...
Best, Sarah A; De Souza, David P; Kersbergen, Ariena; Policheni, Antonia N; Dayalan, Saravanan; Tull, Dedreia; Rathi, Vivek; Gray, Daniel H; Ritchie, Matthew E; McConville, Malcolm J; Sutherland, Kate D
2018-04-03
The lung presents a highly oxidative environment, which is tolerated through engagement of tightly controlled stress response pathways. A critical stress response mediator is the transcription factor nuclear factor erythroid-2-related factor 2 (NFE2L2/NRF2), which is negatively regulated by Kelch-like ECH-associated protein 1 (KEAP1). Alterations in the KEAP1/NRF2 pathway have been identified in 23% of lung adenocarcinomas, suggesting that deregulation of the pathway is a major cancer driver. We demonstrate that inactivation of Keap1 and Pten in the mouse lung promotes adenocarcinoma formation. Notably, metabolites identified in the plasma of Keap1 f/f /Pten f/f tumor-bearing mice indicate that tumorigenesis is associated with reprogramming of the pentose phosphate pathway. Furthermore, the immune milieu was dramatically changed by Keap1 and Pten deletion, and tumor regression was achieved utilizing immune checkpoint inhibition. Thus, our study highlights the ability to exploit both metabolic and immune characteristics in the detection and treatment of lung tumors harboring KEAP1/NRF2 pathway alterations. Copyright © 2018 Elsevier Inc. All rights reserved.
Chen, Chu; Doherty, Jennifer A; Lewis, S Kay; Ray, Roberta M; Gao, Dao Li; Stalsberg, Helge; Feng, Ziding; Thomas, David B
2006-05-01
We investigated whether circulating insulin-like growth factor-I (IGF-I) and insulin-like growth factor binding protein-3 (IGFBP-3) levels are associated with the risk of fibrocystic breast conditions (FBC), in a case-control study nested within a randomized trial of breast self-examination conducted in Shanghai, China. Participants were enrolled during 1989-1991 and were followed over 10 years for the development of breast diseases. Controls (n = 897) were frequency-matched by age to cases (n = 451), who were diagnosed with FBC between 1995 and 2000. Circulating IGF-I and IGFBP-3 levels and their molar ratio were positively associated with risk of FBC. The odds ratios (ORs) and 95% confidence intervals (CI) for the upper fourth of the distribution compared to the lowest fourth for IGF-I, IGFBP3 and their molar ratio were 3.02 (2.02-4.52), 1.92 (1.37-2.71) and 2.26 (1.52-3.36), respectively. The strength of the association between IGF-I levels and FBC was attenuated after adjustment for IGFBP-3 and that for IGFBP-3 was largely eliminated after adjustment for IGF-I. Increasing levels of IGF-I were particularly associated with increasing risk of FBC with proliferative elements (ORs and 95% CIs for the 2nd, 3rd and upper fourth of the distribution of IGF-I: 3.13 (1.50-6.53), 4.57 (2.22-9.39) and 6.30 (3.08-12.89), compared with the lowest fourth. Our results suggest that elevated levels of IGF-I may contribute to the development of FBC. 2005 Wiley-Liss, Inc.
Tobacco Transcription Factor NtWRKY12 Interacts With TGA2.2 in vitro and in vivo
Directory of Open Access Journals (Sweden)
Marcel evan Verk
2011-07-01
Full Text Available The promoter of the salicylic acid-inducible PR-1a gene of Nicotiana tabacum contains binding sites for transcription factor NtWRKY12 (WK-box at position -564 and TGA factors (as-1-like element at position -592. Transactivation experiments in Arabidopsis protoplasts derived from wild type, npr1-1, tga256 and tga2356 mutant plants revealed that NtWRKY12 alone was able to induce a PR-1a::β-glucuronidase (GUS reporter gene to high levels, independent of co-expressed tobacco NtNPR1, TGA2.1, TGA2.2 or endogenous Arabidopsis NPR1, TGA2/3/5/6. By in vitro pull-down assays with GST and Strep fusion proteins and by Fluorescence Resonance Energy Transfer assays with protein-CFP and protein-YFP fusions in transfected protoplasts, it was shown that NtWRKY12 and TGA2.2 could interact in vitro and in vivo. Interaction of NtWRKY12 with TGA1a or TGA2.1 was not detectable by these techniques. A possible mechanism for the role of NtWRKY12 and TGA2.2 in PR-1a gene expression is discussed.
Institute of Scientific and Technical Information of China (English)
Yan-Rong Kang; Pei-Li Gu
2016-01-01
Objective:To investigate the content of insulin-like growth factor-1 (IGF-1) in serum and the relationship with type 2 diabetes, osteoporosis and type 2 diabetic osteoporosis.Methods:A total of 86 cases of patients with type 2 diabetes, 82 cases of patients with osteoporosis, 79 cases of patients with type 2 diabetic osteoporosis and 86 cases of healthy person were selected, the levels of IGF-1, diabetes related factors (fasting plasma c-peptide, FIN, HbA1c, GLU) and osteoporosis related factors (BMP, osteocalcin,β-CTx, P1NP, lumbar vertebra BMD) were detected, the relationship between the above indicators were compared with those of the disease.Results: In each group, content change of IGF-1 was not statistically significant; content changes of IGF-1, BMP and osteocalcin were control group>type 2 diabetes group>osteoporosis group>type 2 diabetic osteoporosis group. Diabetic osteoporosis enhanced the decrease of IGF-1 content. The contents ofβ-CTx and P1NP in osteoporosis group and diabetic osteoporosis group were similar, which were significantly lower than that in control group and type 2 diabetes group. The level of lumbar vertebra BMD in osteoporosis group and diabetic osteoporosis group were the lowest. Fasting plasma c-peptide in diabetes group and diabetic osteoporosis group were significantly lower than that in control group and osteoporosis group, and the content of fasting plasma c-peptide in diabetic osteoporosis group was the lowest. The contents of FIN, HbA1c and GLU in type 2 diabetes group and type 2 diabetic osteoporosis group were significantly higher than that in control group and osteoporosis group.Conclusion:IGF-1 was related with type 2 diabetes, osteoporosis and type 2 diabetic osteoporosis, and could offer help for predicting type 2 diabetes and osteoporosis in the future.
Directory of Open Access Journals (Sweden)
Pengcheng Liu
2016-06-01
Full Text Available Skin factor is often regarded as a constant in most of the mathematical model for well test analysis in oilfields, but this is only a kind of simplified treatment with the actual skin factor changeable. This paper defined the average permeability of a damaged area as a function of time by using the definition of skin factor. Therefore a relationship between a variable skin factor and time was established. The variable skin factor derived was introduced into existing traditional models rather than using a constant skin factor, then, this newly derived mathematical model for well test analysis considering variable skin factor was solved by Laplace transform. The dimensionless wellbore pressure and its derivative changed with dimensionless time were plotted with double logarithm and these plots can be used for type curve fitting. The effects of all the parameters in the expression of variable skin factor were analyzed based on the dimensionless wellbore pressure and its derivative. Finally, actual well testing data were used to fit the type curves developed which validates the applicability of the mathematical model from Sheng-2 Block, Shengli Oilfield, China.
Wang, Linlin; Schulz, Thomas C.; Sherrer, Eric S.; Dauphin, Derek S.; Shin, Soojung; Nelson, Angelique M.; Ware, Carol B.; Zhan, Mei; Song, Chao-Zhong; Chen, Xiaoji; Brimble, Sandii N.; McLean, Amanda; Galeano, Maria J.; Uhl, Elizabeth W.; D'Amour, Kevin A.; Chesnut, Jonathan D.; Rao, Mahendra S.
2007-01-01
Despite progress in developing defined conditions for human embryonic stem cell (hESC) cultures, little is known about the cell-surface receptors that are activated under conditions supportive of hESC self-renewal. A simultaneous interrogation of 42 receptor tyrosine kinases (RTKs) in hESCs following stimulation with mouse embryonic fibroblast (MEF) conditioned medium (CM) revealed rapid and prominent tyrosine phosphorylation of insulin receptor (IR) and insulin-like growth factor-1 receptor (IGF1R); less prominent tyrosine phosphorylation of epidermal growth factor receptor (EGFR) family members, including ERBB2 and ERBB3; and trace phosphorylation of fibroblast growth factor receptors. Intense IGF1R and IR phosphorylation occurred in the absence of MEF conditioning (NCM) and was attributable to high concentrations of insulin in the proprietary KnockOut Serum Replacer (KSR). Inhibition of IGF1R using a blocking antibody or lentivirus-delivered shRNA reduced hESC self-renewal and promoted differentiation, while disruption of ERBB2 signaling with the selective inhibitor AG825 severely inhibited hESC proliferation and promoted apoptosis. A simple defined medium containing an IGF1 analog, heregulin-1β (a ligand for ERBB2/ERBB3), fibroblast growth factor-2 (FGF2), and activin A supported long-term growth of multiple hESC lines. These studies identify previously unappreciated RTKs that support hESC proliferation and self-renewal, and provide a rationally designed medium for the growth and maintenance of pluripotent hESCs. PMID:17761519
Autologous Pluripotent Stem Cell-Derived β-Like Cells for Diabetes Cellular Therapy.
Millman, Jeffrey R; Pagliuca, Felicia W
2017-05-01
Development of stem cell technologies for cell replacement therapy has progressed rapidly in recent years. Diabetes has long been seen as one of the first applications for stem cell-derived cells because of the loss of only a single cell type-the insulin-producing β-cell. Recent reports have detailed strategies that overcome prior hurdles to generate functional β-like cells from human pluripotent stem cells in vitro, including from human induced pluripotent stem cells (hiPSCs). Even with this accomplishment, addressing immunological barriers to transplantation remains a major challenge for the field. The development of clinically relevant hiPSC derivation methods from patients and demonstration that these cells can be differentiated into β-like cells presents a new opportunity to treat diabetes without immunosuppression or immunoprotective encapsulation or with only targeted protection from autoimmunity. This review focuses on the current status in generating and transplanting autologous β-cells for diabetes cell therapy, highlighting the unique advantages and challenges of this approach. © 2017 by the American Diabetes Association.
Directory of Open Access Journals (Sweden)
Kei Kohno
Full Text Available Erythroid abnormalities including anemia and polycythemia are often observed in the general clinical setting. Because recent studies reported that adiponectin negatively affects hematopoiesis, we performed a prospective observational study to assess the relationship between anemia and adiponectin, as well as other parameters, in 1029 Japanese subjects (477 men and 552 women 40 years of age and older. Body measurements, blood tests, and nutrition intake studies were performed at baseline, and 5 to 7 years later (follow-up. Hemoglobin (Hb and hematocrit (Hct levels in men with high serum adiponectin levels were lower at follow-up than at baseline. Multiple regression analysis showed that age, body mass index, adiponectin, and glutamic-pyruvic transaminase were significantly associated with erythroid-related variables (red blood cells, Hb, and Hct in both men and women (P <0.05. In a logistic regression analysis, adiponectin, fasting blood glucose, and β-natriuretic peptide were significant risk factors for anemia in men, and blood urea nitrogen and amylase were significant risk factors in women. Physical features and nutrient intake were not risk factors for anemia. Our study demonstrates, both clinically and epidemiologically, that a high serum adiponectin level decreases the amounts of erythroid-related variables and is a risk factor for anemia in Japanese men.
International Nuclear Information System (INIS)
Sawada, Keigo; Takedachi, Masahide; Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki; Lee, Chun Man; Okura, Hanayuki; Matsuyama, Akifumi; Kitamura, Masahiro; Murakami, Shinya
2015-01-01
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation
Energy Technology Data Exchange (ETDEWEB)
Sawada, Keigo [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Takedachi, Masahide, E-mail: takedati@dent.osaka-u.ac.jp [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Lee, Chun Man [Medical Center for Translational Research, Osaka University Hospital, Osaka (Japan); Okura, Hanayuki; Matsuyama, Akifumi [Research on Disease Bioresources, Platform of Therapeutics for Rare Disease, National Institute of Biomedical Innovation, Osaka (Japan); Kitamura, Masahiro; Murakami, Shinya [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan)
2015-08-14
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation.
Ververis, J J; Ku, L; Delafontaine, P
1993-06-01
Insulin-like growth factor I (IGF I) is an important mitogen for vascular smooth muscle cells. To characterize regulation of vascular IGF I receptors, we performed radioligand displacement experiments using rat aortic smooth muscle cells (RASMs). Serum deprivation for 48 hours caused a 40% decrease in IGF I receptor number. Exposure of quiescent RASMs to platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), or angiotensin II (Ang II) caused a 1.5-2.0-fold increase in IGF I receptors per cell. After FGF exposure, there was a marked increase in the mitogenic response to IGF I. IGF I downregulated its receptors in the presence of platelet-poor plasma. Stimulation of protein kinase C (PKC) by exposure of quiescent RASMs to phorbol 12-myristate 13-acetate caused a biphasic response in IGF I binding; there was a 42% decrease in receptor number at 45 minutes and a 238% increase at 24 hours. To determine the role of PKC in growth factor-induced regulation of IGF I receptors, we downregulated PKC by exposing RASMs to phorbol 12,13-dibutyrate (PDBu) for 48 hours. PDGF- and FGF- but not Ang II-mediated upregulation of IGF I receptors was completely inhibited in PDBu-treated cells. Thus, acute PKC activation by phorbol esters inhibits IGF I binding, whereas chronic PKC activation increases IGF I binding. PDGF and FGF but not Ang II regulate vascular IGF I receptors through a PKC-dependent pathway. These data provide new insights into the regulation of vascular smooth muscle cell IGF I receptors in vitro and are of potential importance in characterizing vascular proliferative responses in vivo.
Chieosilapatham, Panjit; Niyonsaba, François; Kiatsurayanon, Chanisa; Okumura, Ko; Ikeda, Shigaku; Ogawa, Hideoki
2017-10-01
In addition to their microbicidal properties, host defense peptides (HDPs) display various immunomodulatory functions, including keratinocyte production of cytokines/chemokines, proliferation, migration and wound healing. Recently, a novel HDP named AMP-IBP5 (antimicrobial peptide derived from insulin-like growth factor-binding protein 5) was shown to exhibit antimicrobial activity against numerous pathogens, even at concentrations comparable to those of human β-defensins and LL-37. However, the immunomodulatory role of AMP-IBP5 in cutaneous tissue remains unknown. To investigate whether AMP-IBP5 triggers keratinocyte activation and to clarify its mechanism. Production of cytokines/chemokines and growth factors was determined by appropriate ELISA kits. Cell migration was assessed by in vitro wound closure assay, whereas cell proliferation was analyzed using BrdU incorporation assay complimented with XTT assay. MAPK and NF-κB activation was determined by Western blotting. Intracellular cAMP levels were assessed using cAMP enzyme immunoassay kit. Among various cytokines/chemokines and growth factors tested, AMP-IBP5 selectively increased the production of IL-8 and VEGF. Moreover, AMP-IBP5 markedly enhanced keratinocyte migration and proliferation. AMP-IBP5-induced keratinocyte activation was mediated by Mrg X1-X4 receptors with MAPK and NF-κB pathways working downstream, as evidenced by the inhibitory effects of MrgX1-X4 siRNAs and ERK-, JNK-, p38- and NF-κB-specific inhibitors. We confirmed that AMP-IBP5 indeed induced MAPK and NF-κB activation. Furthermore, AMP-IBP5-induced VEGF but not IL-8 production correlated with an increase in intracellular cAMP. Our findings suggest that in addition to its antimicrobial function, AMP-IBP5 might contribute to wound healing process through activation of keratinocytes. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.
Tryggestad, Jeanie B; Wang, Joshua J; Zhang, Sarah X; Thompson, David M; Short, Kevin R
2015-12-01
Pigment epithelium-derived factor (PEDF) is a member of the serpin family secreted by adipocytes. Plasma PEDF is increased in obese children and adults. Adults with type 2 diabetes mellitus (T2DM) have higher circulating PEDF but there are no reports in children with T2DM. To compare PEDF concentration in children with T2DM to normal weight and obese children without T2DM and determine associations with anthropometric or serum factors. Participants were 34 obese children with T2DM diagnosed by American Diabetes Association (ADA) criteria, 61 normal weight [body mass index (BMI) 25-75 percentile] and 63 obese (BMI ≥ 95 percentile) children of age 8-18 yr. Plasma PEDF was measured in fasting plasma samples. Anthropometric, serum, and body composition (dual-energy x-ray absorptiometry, DXA) data were obtained for each subject to identify potential predictor variables. PEDF was 55% higher (p = 0.001) in the T2DM group compared with normal weight children, but did not differ from obese children. In the T2DM group, fat mass and lean mass both individually predicted PEDF (r² = 0.22 and 0.17, p = 0.02 and p obese groups, therefore, obesity, rather than diabetes, may account for the higher PEDF in children with T2DM compared with normal weight children. PEDF was positively associated with both lean mass and fat mass both of which may contribute to the circulating level of the protein, and potentially to PEDF's association with insulin resistance in obese children with and without diabetes. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Phase 1 Study of a Sulforaphane-Containing Broccoli Sprout Homogenate for Sickle Cell Disease.
Directory of Open Access Journals (Sweden)
Jennifer F Doss
Full Text Available Sickle cell disease (SCD is the most common inherited hemoglobinopathy worldwide. Our previous results indicate that the reduced oxidative stress capacity of sickle erythrocytes may be caused by decreased expression of NRF2 (Nuclear factor (erythroid-derived 2-like 2, an oxidative stress regulator. We found that activation of NRF2 with sulforaphane (SFN in erythroid progenitors significantly increased the expression of NRF2 targets HMOX1, NQO1, and HBG1 (subunit of fetal hemoglobin in a dose-dependent manner. Therefore, we hypothesized that NRF2 activation with SFN may offer therapeutic benefits for SCD patients by restoring oxidative capacity and increasing fetal hemoglobin concentration. To test this hypothesis, we performed a Phase 1, open-label, dose-escalation study of SFN, contained in a broccoli sprout homogenate (BSH that naturally contains SFN, in adults with SCD. The primary and secondary study endpoints were safety and physiological response to NRF2 activation, respectively. We found that BSH was well tolerated, and the few adverse events that occurred during the trial were not likely related to BSH consumption. We observed an increase in the mean relative whole blood mRNA levels for the NRF2 target HMOX1 (p = 0.02 on the last day of BSH treatment, compared to pre-treatment. We also observed a trend toward increased mean relative mRNA levels of the NRF2 target HBG1 (p = 0.10 from baseline to end of treatment, but without significant changes in HbF protein. We conclude that BSH, in the provided doses, is safe in stable SCD patients and may induce changes in gene expression levels. We therefore propose investigation of more potent NRF2 inducers, which may elicit more robust physiological changes and offer clinical benefits to SCD patients. Trial registration: ClinicalTrials.gov NCT01715480.
Krüppel-like factor 2 is required for normal mouse cardiac development.
Directory of Open Access Journals (Sweden)
Aditi R Chiplunkar
Full Text Available Krüppel-like factor 2 (KLF2 is expressed in endothelial cells in the developing heart, particularly in areas of high shear stress, such as the atrioventricular (AV canal. KLF2 ablation leads to myocardial thinning, high output cardiac failure and death by mouse embryonic day 14.5 (E14.5 in a mixed genetic background. This work identifies an earlier and more fundamental role for KLF2 in mouse cardiac development in FVB/N mice. FVB/N KLF2-/- embryos die earlier, by E11.5. E9.5 FVB/N KLF2-/- hearts have multiple, disorganized cell layers lining the AV cushions, the primordia of the AV valves, rather than the normal single layer. By E10.5, traditional and endothelial-specific FVB/N KLF2-/- AV cushions are hypocellular, suggesting that the cells accumulating at the AV canal have a defect in endothelial to mesenchymal transformation (EMT. E10.5 FVB/N KLF2-/- hearts have reduced glycosaminoglycans in the cardiac jelly, correlating with the reduced EMT. However, the number of mesenchymal cells migrating from FVB/N KLF2-/- AV explants into a collagen matrix is reduced considerably compared to wild-type, suggesting that the EMT defect is not due solely to abnormal cardiac jelly. Echocardiography of E10.5 FVB/N KLF2-/- embryos indicates that they have abnormal heart function compared to wild-type. E10.5 C57BL/6 KLF2-/- hearts have largely normal AV cushions. However, E10.5 FVB/N and C57BL/6 KLF2-/- embryos have a delay in the formation of the atrial septum that is not observed in a defined mixed background. KLF2 ablation results in reduced Sox9, UDP-glucose dehydrogenase (Ugdh, Gata4 and Tbx5 mRNA in FVB/N AV canals. KLF2 binds to the Gata4, Tbx5 and Ugdh promoters in chromatin immunoprecipitation assays, indicating that KLF2 could directly regulate these genes. In conclusion, KLF2-/- heart phenotypes are genetic background-dependent. KLF2 plays a role in EMT through its regulation of important cardiovascular genes.
Directory of Open Access Journals (Sweden)
Josephine Wesely
2017-01-01
Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.
International Nuclear Information System (INIS)
Campbell, P.G.
1988-01-01
This is the first study to characterize both insulin-like growth factor-I (IGF-I) and insulin-like growth factor binding proteins (IGFBPs) in bovine milk, to characterize the IGF-I receptor in the dry and lactating mammary gland, and to report de novo synthesis and secretion of IGF-I and IGFBP from normal mammary tissue. Immunoreactive IGF-I was principally associated with 45 kDa IGFBP in milk. Multiparous cows had a higher IGF-I concentration of 307 ng/ml than primiparous cows at 147 ng/ml. IGF-I concentration on day 56 of lactation was 34 ng/ml for combined parity groups. At parturition, IGF-I mass in blood and milk pools was 1.4 and 1.2 mg, respectively. Binding of 125 I-IGF-I was specific for IGF-I with anIC 50 of 2.2 ng which was a 10- and 1273-fold greater affinity than IGF-II and insulin, respectively. Association constants, as determined by Scatchard analysis, were similar for both pregnant and lactating cows at 3.5 and 4.0 L/nM, respectively. In addition, estimated mean receptor concentration was 0.25 and 0.23 pM/mg protein for pregnant and lactating cows, respectively. In a survey of mammary microscomes prepared from 48 cows, 125 I-IGF-I binding declined with progressing lactation and a similar trend was observed during pregnancy
Lin, Jiaying; Liu, Xishi; Ding, Ding
2015-01-01
The cancer stem cell (CSC) paradigm is one possible way to understand the genesis of cancer, and cervical cancer in particular. We quantified and enriched ALDH1(+) cells within cervical cancer cell lines and subsequently characterized their phenotypical and functional properties like invasion capacity and epithelial-mesenchymal transition (EMT). ALDH1 expression in spheroid-derived cells (SDC) and the parental monolayer-derived cell (MDC) line was compared by flow-cytometry. Invasion capability was evaluated by Matrigel assay and expression of EMT-related genes Twist 1, Twist 2, Snail 1, Snail 2, Vimentin and E-cadherin by real-time PCR. ALDH1 expression was significantly higher in SDC. ALDH1(+) cells showed increased colony-formation. SDC expressed lower levels of E-cadherin and elevated levels of Twist 1, Twist 2, Snail 1, Snail 2 and Vimentin compared to MDC. Cervical cancer cell lines harbor potential CSC, characterized by ALDH1 expression as well as properties like invasiveness, colony-forming ability, and EMT. CSC can be enriched by anchorage-independent culture techniques, which may be important for the investigation of their contribution to therapy resistance, tumor recurrence and metastasis.
The Role of the Nrf2/ARE Antioxidant System in Preventing Cardiovascular Diseases
Directory of Open Access Journals (Sweden)
Robert E. Smith
2016-11-01
Full Text Available It is widely believed that consuming foods and beverages that have high concentrations of antioxidants can prevent cardiovascular diseases and many types of cancer. As a result, many articles have been published that give the total antioxidant capacities of foods in vitro. However, many antioxidants behave quite differently in vivo. Some of them, such as resveratrol (in red wine and epigallocatechin gallate or EGCG (in green tea can activate the nuclear erythroid-2 like factor-2 (Nrf2 transcription factor. It is a master regulator of endogenous cellular defense mechanisms. Nrf2 controls the expression of many antioxidant and detoxification genes, by binding to antioxidant response elements (AREs that are commonly found in the promoter region of antioxidant (and other genes, and that control expression of those genes. The mechanisms by which Nrf2 relieves oxidative stress and limits cardiac injury as well as the progression to heart failure are described. Also, the ability of statins to induce Nrf2 in the heart, brain, lung, and liver is mentioned. However, there is a negative side of Nrf2. When over-activated, it can cause (not prevent cardiovascular diseases and multi-drug resistance cancer.
DEFF Research Database (Denmark)
Grønbæk, Henning; Flyvbjerg, Allan; Mellemkjær, L.
2004-01-01
BACKGROUND: Studies have shown a positive association between serum insulin-like growth factor (IGF)-I and breast cancer risk in premenopausal but not postmenopausal women. IGF-II and estrogen receptor (ER) status has never been investigated. We examined the association between IGF-I, IGF-II, IGF...
Hartog, H.; Boezen, H.M.; Jong, M.M. de; Schaapveld, M.; Wesseling, J.; Graaf, W.T.A. van der
2013-01-01
High circulating insulin-like growth factor 1 (IGF-1) levels are firmly established as a risk factor for developing breast cancer, especially estrogen positive tumors. The effect of circulating IGF-1 on prognosis once a tumor is established is unknown. The authors explored the effect of IGF-1 blood
Hartog, H; Boezen, H M; de Jong, M M; Schaapveld, M; Wesseling, J; van der Graaf, W T A
2013-01-01
High circulating insulin-like growth factor 1 (IGF-1) levels are firmly established as a risk factor for developing breast cancer, especially estrogen positive tumors. The effect of circulating IGF-1 on prognosis once a tumor is established is unknown. The authors explored the effect of IGF-1 blood
Coenzyme Q10 Supplementation Modulates NFκB and Nrf2 Pathways in Exercise Training
Directory of Open Access Journals (Sweden)
Ragip Pala, Cemal Orhan, Mehmet Tuzcu, Nurhan Sahin, Shakir Ali, Vedat Cinar, Mustafa Atalay, Kazim Sahin
2016-03-01
Full Text Available This study reports the effects of Q10, coenzyme Q10 or ubiquinone, a component of the electron transport chain in mitochondria, on nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB, inhibitors of kappa B (IκB, nuclear factor (erythroid-derived 2-like 2 (Nrf2 and hemeoxygenase 1 (HO-1 in rats after chronic exercise training for 6 weeks. 8-week old male Wistar rats were assigned randomly to one of four treatments planned in a 2 x 2 factorial arrangement of two condition (sedentary vs. exercise training, and two coenzyme Q10 levels (0 and 300 mg/kg per day for 6 weeks. The expression levels of the target proteins were determined in the heart, liver and muscle, and biochemical parameters including creatinine, urea, glucose and lipid profile were investigated in plasma. When compared with sedentary group, significant decreases in heart, liver and muscle NFκB levels by 45%, 26% and 44% were observed in Q10 supplemented rats after exercise training, respectively, while the inhibitory protein IκB increased by 179%, 111% and 127% in heart, liver and muscle tissues. Q10 supplementation caused an increase in Nrf2 (167%, 165% and 90% and HO-1 (107%, 156% and 114% after exercise training in heart, liver and muscle tissues (p < 0.05. No significant change was observed in any of the parameters associated with protein, carbohydrate and lipid metabolism, except that exercise caused a decrease in plasma triglyceride, which was further decreased by Q10. In conclusion, these results suggest that Q10 modulates the expression of NFκB, IκB, Nrf2 and HO-1 in exercise training, indicating an anti-inflammatory effect of Q10 and emphasizes its role in antioxidant defense.
MAO, JINGJIE; LI, ZUANFANG; LIN, RUHUI; ZHU, XIAOQIN; LIN, JIUMAO; PENG, JUN; CHEN, LIDIAN
2015-01-01
Spasticity is common in various central neurological conditions, including after a stroke. Such spasticity may cause additional problems, and often becomes a primary concern for afflicted individuals. A number of studies have identified nuclear factor (erythroid-derived 2)-like 2 (Nrf2) as a key regulator in the adaptive survival response to oxidative stress. Elevated expression of Nrf2, combined with heme oxygenase 1 (HO-1) resistance, in the central nervous system is known to elicit key internal and external oxidation protection. Gua Lou Gui Zhi decoction (GLGZD) is a popular traditional Chinese formula with a long history of clinical use in China for the treatment of muscular spasticity following a stroke, epilepsy or a spinal cord injury. However, the mechanism underlying the efficacy of the medicine remains unclear. In the present study, the antioxidative effects of GLGZD were evaluated and the underlying molecular mechanisms were investigated, using hydrogen peroxide (H2O2)-induced rat pheochromocytoma cells (PC12 cells) as an in vitro oxidative stress model of neural cells. Upon application of different concentrations of GLGZD, a 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay and ATP measurement were conducted to assess the impact on PC12 cell proliferation. In addition, inverted microscopy observations, and the MTT and ATP assessments, revealed that GLGZD attenuated H2O2-induced oxidative damage and signaling repression in PC12 cells. Furthermore, the mRNA and protein expression levels of Nrf2 and HO-1, which are associated with oxidative stress, were analyzed using reverse transcription quantitative polymerase chain reaction (PCR) and confocal microscopy. Confocal microscopy observations, as well as the quantitative PCR assay, revealed that GLGZD exerted a neuroprotective function against H2O2-induced oxidative damage in PC12 cells. Therefore, the results demonstrated that GLGZD protected PC12 cells injured by H2O2, which may be
Chromate adsorption mechanism on nanodiamond-derived onion-like carbon
Energy Technology Data Exchange (ETDEWEB)
Ko, Young-Jin [Center for Electronic Materials, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Choi, Keunsu [Computational Science Research Center, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Lee, Soonjae [Department of Earth and Environmental Sciences, Korea University, 145, Anam-ro, Seongbuk-gu, Seoul 02841, Republic of Korea (Korea, Republic of); Cho, Jung-Min [Center for Electronic Materials, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Department of Materials Science and Engineering, Yonsei University, 262 Seongsanno, Seodaemun-Gu, Seoul 120-749, Republic of Korea (Korea, Republic of); Choi, Heon-Jin [Department of Materials Science and Engineering, Yonsei University, 262 Seongsanno, Seodaemun-Gu, Seoul 120-749, Republic of Korea (Korea, Republic of); Hong, Seok Won [Center for Water Resource Cycle Research, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Choi, Jae-Woo, E-mail: plead36@kist.re.kr [Center for Water Resource Cycle Research, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Department of Energy and Environmental Engineering, University of Science and Technology (UST), Daejeon 305-350, Republic of Korea (Korea, Republic of); Mizuseki, Hiroshi, E-mail: mizuseki@kist.re.kr [Computational Science Research Center, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Lee, Wook-Seong, E-mail: wsleemk@gmail.com [Center for Electronic Materials, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of)
2016-12-15
The onion-like carbon (OLC) was prepared as adsorbent and tested for the removal of chromate ions from aqueous solutions. The OLC was thermally derived from nanodiamond by vacuum annealing at 1000-2000 °C. An investigation was conducted the chromate adsorption mechanism of OLC, by analysing the temperature-dependent evolution of the various oxygen-carbon bonds and the chemisorbed water by X-ray photo electron spectroscopy, as well as by the first principle calculation of the bond energies for relevant bond configurations. The present work demonstrated the importance of the carbon-oxygen bond type and carbon dangling bonds for chromate adsorption, as well as for other anionic heavy metals adsorbed from wastewater and sewage.
Czech Academy of Sciences Publication Activity Database
Pechar, Michal; Brus, Jiří; Kostka, Libor; Koňák, Čestmír; Urbanová, Martina; Šlouf, Miroslav
2007-01-01
Roč. 7, č. 1 (2007), s. 56-69 ISSN 1616-5187 R&D Projects: GA ČR GA204/05/2255; GA AV ČR IAA100500501 Institutional research plan: CEZ:AV0Z40500505 Keywords : elastin -like peptides * self-assembly * poly(ethylene glycol) Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.831, year: 2007
Neuroprotective and Cognition-Enhancing Effects of Compound K Isolated from Red Ginseng.
Seo, Ji Yeon; Ju, Sung Hee; Oh, Jisun; Lee, Seung Kwon; Kim, Jong-Sang
2016-04-13
The present study was aimed at elucidating the effect of compound K derived from red ginseng on memory function in mouse model and glutamate-induced cytotoxicity in mouse hippocampal HT22 cells. Compound K induced antioxidant enzymes in nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated manner, and effectively attenuated cytotoxicity and mitochondrial damage induced by glutamate in HT22 cells. However, the cytoprotective effect by compound K was abolished by heme oxygenase-1 inhibitor, tin protophorphyrin IX, suggesting that neuroprotective effect of compound K was caused by its Nrf2-mediated induction of antioxidant enzymes. Further, memory deficit induced by scopolamine was restored by compound K, which did not inhibit acetylcholine esterase, in C57BL/6 mice but not in Nrf2 knockout mice as assessed by passive avoidance test, Y-maze and water maze tests, suggesting that scopolamine-induced memory impairment was overcome by the induction of Nrf2-mediated antioxidant enzymes by the compound K. Overall, our data indicate that compound K could be useful in prevention and treatment of reactive oxygen species-induced neurological disorders such as Alzheimer's disease.
N-6 substituted deoxygenated derivatives of L-like 5'-noraristeromycin
African Journals Online (AJOL)
Several N-6 substituted derivatives (4-11) of (+)-4'-deoxy-5'-noraristeromycin (2) and its unsaturated counterpart (3) have been prepared. The derivatives are designed to systematically vary the hydrophobic/hydrophilic balance of the lead compounds. These compounds were evaluated against a large number of viruses but ...
GOLDEN2-LIKE transcription factors coordinate the tolerance to Cucumber mosaic virus in Arabidopsis
International Nuclear Information System (INIS)
Han, Xue-Ying; Li, Peng-Xu; Zou, Li-Juan; Tan, Wen-rong; Zheng, Ting; Zhang, Da-Wei; Lin, Hong-Hui
2016-01-01
Arabidopsis thaliana GOLDEN2-LIKE (GLKs) transcription factors play important roles in regulation of photosynthesis-associated nuclear genes, as well as participate in chloroplast development. However, the involvement of GLKs in plants resistance to virus remains largely unknown. Here, the relationship between GLKs and Cucumber mosaic virus (CMV) stress response was investigated. Our results showed that the Arabidopsis glk1glk2 double-mutant was more susceptible to CMV infection and suffered more serious damages (such as higher oxidative damages, more compromised in PSII photochemistry and more reactive oxygen species accumulation) when compared with the wild-type plants. Interestingly, there was little difference between single mutant (glk1 or glk2) and wild-type plants in response to CMV infection, suggesting GLK1 and GLK2 might function redundant in virus resistance in Arabidopsis. Furthermore, the induction of antioxidant system and defense-associated genes expression in the double mutant were inhibited when compared with single mutant or wild-type plants after CMV infection. Further evidences showed that salicylic acid (SA) and jasmonic acid (JA) might be involved in GLKs-mediated virus resistance, as SA or JA level and synthesis-related genes transcription were impaired in glk1glk2 mutant. Taken together, our results indicated that GLKs played a positively role in virus resistance in Arabidopsis. - Highlights: • GLKs play a positive role in CMV resistance in Arabidopsis. • Defective of GLKs suffered more ROS accumulation. • Arabidopsis lacking GLKs have damaged photosynthesis. • Arabidopsis lacking GLKs show low SA and JA accumulation.
GOLDEN2-LIKE transcription factors coordinate the tolerance to Cucumber mosaic virus in Arabidopsis
Energy Technology Data Exchange (ETDEWEB)
Han, Xue-Ying; Li, Peng-Xu; Zou, Li-Juan; Tan, Wen-rong; Zheng, Ting; Zhang, Da-Wei, E-mail: yuanmiao1892@163.com; Lin, Hong-Hui, E-mail: hhlin@scu.edu.cn
2016-09-02
Arabidopsis thaliana GOLDEN2-LIKE (GLKs) transcription factors play important roles in regulation of photosynthesis-associated nuclear genes, as well as participate in chloroplast development. However, the involvement of GLKs in plants resistance to virus remains largely unknown. Here, the relationship between GLKs and Cucumber mosaic virus (CMV) stress response was investigated. Our results showed that the Arabidopsis glk1glk2 double-mutant was more susceptible to CMV infection and suffered more serious damages (such as higher oxidative damages, more compromised in PSII photochemistry and more reactive oxygen species accumulation) when compared with the wild-type plants. Interestingly, there was little difference between single mutant (glk1 or glk2) and wild-type plants in response to CMV infection, suggesting GLK1 and GLK2 might function redundant in virus resistance in Arabidopsis. Furthermore, the induction of antioxidant system and defense-associated genes expression in the double mutant were inhibited when compared with single mutant or wild-type plants after CMV infection. Further evidences showed that salicylic acid (SA) and jasmonic acid (JA) might be involved in GLKs-mediated virus resistance, as SA or JA level and synthesis-related genes transcription were impaired in glk1glk2 mutant. Taken together, our results indicated that GLKs played a positively role in virus resistance in Arabidopsis. - Highlights: • GLKs play a positive role in CMV resistance in Arabidopsis. • Defective of GLKs suffered more ROS accumulation. • Arabidopsis lacking GLKs have damaged photosynthesis. • Arabidopsis lacking GLKs show low SA and JA accumulation.
International Nuclear Information System (INIS)
Ichiki, Toshihiro; Tokunou, Tomotake; Fukuyama, Kae; Iino, Naoko; Masuda, Satoko; Takeshita, Akira
2004-01-01
Proliferation of vascular smooth muscle cells (VSMCs) is induced by various mitogens through activation of extracellular signal-regulated protein kinase (ERK) pathway. We recently reported that peroxisome proliferator-activated receptor (PPAR)γ activators such as 15-deoxy-Δ 12,14 -prostaglandin J2 (15-d-PGJ2) and thiazolidinediones (TZDs) activated MEK/ERK pathway through phosphatidylinositol 3-kinase (PI3-K) and induced proliferation of VSMCs. However, the precise mechanisms of PPARγ activators-induced activation of PI3-K/ERK pathway have not been determined. We examined whether transactivation of growth factor receptor is involved in this process. Stimulation of VSMCs with 15-d-PGJ2 or TZDs for 15 min induced phosphorylation of ERK1/2 and Akt. 15-d-PGJ2- or TZDs-induced phosphorylation of ERK1/2 and Akt was inhibited by AG1478, an inhibitor of epidermal growth factor receptor (EGF-R) as well as AG1295, an inhibitor of platelet derived growth factor receptor (PDGF-R). 15-d-PGJ2-induced phosphorylation of both EGF-R and PDGF-R. GM6001, a matrix metalloproteinase inhibitor, and PP2, a Src family protein kinase inhibitor, suppressed 15-d-PGJ2- and TZDs-induced phosphorylation of EGF-R and PDGFβ-R as well as activation of ERK1/2 and Akt. PDGFβ-R was co-immunoprecipitated with EGF-R, regardless of the presence or absence of 15-d-PGJ2. These data suggest that 15-d-PGJ2 and TZDs activate PI3-K/ERK pathway through Src family kinase- and matrix metalloproteinase-dependent transactivation of EGF-R and PDGF-R. Both receptors seemed to associate constitutively. This novel signaling mechanisms may contribute to diverse biological functions of PPARγ activators
Derivation of Stromal (Skeletal, Mesenchymal) Stem-like cells from Human Embryonic Stem Cells
DEFF Research Database (Denmark)
Mahmood, Amer; Harkness, Linda; Abdallah, Basem
2012-01-01
EBs using BMP2 (bone morphogenic protein 2) combined with standard osteoblast induction medium led to weak osteoblastic induction. Conversely, subcutaneous in vivo implantation of day 20 hEBs in immune deficient mice, mixed with hydroxyapatite/tricalcium phosphate (HA/TCP) as an osteoconductive scaffold......Derivation of bone forming cells (osteoblasts) from human embryonic stem cells (hESC) is a pre-requisite for their use in clinical applications. However, there is no standard protocol for differentiating hESC into osteoblastic cells. The aim of this study was to identify the emergence of a human...... stromal (mesenchymal, skeletal) stem cell (hMSC)-like population, known to be osteoblastic cell precursors and to test their osteoblastic differentiation capacity in ex vivo cultures and in vivo. We cultured hESC in a feeder-free environment using serum replacement and as suspension aggregates (embryoid...
Directory of Open Access Journals (Sweden)
Pascariello Caterina
2008-05-01
Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of
Brain-derived neurotrophic factor and early-life stress
Indian Academy of Sciences (India)
2016-10-24
Oct 24, 2016 ... The brain-derived neurotrophic factor (BDNF) is a key regulator of neural development and ... forms are produced by splicing individual non-coding ..... VII and. IX m. RNA. ↑. mBDNF. ↓. (MS). 5. BDNF expression was unch;.
Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster.
Vognsen, Tina; Kristensen, Ole
2012-03-30
The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7Å resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a β-sheet and three α-helices forming a cone-like shape. However, known binding sites for RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site. Copyright © 2012 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Bayne, M.L.; Applebaum, J.; Chicchi, G.G.; Hayes, N.S.; Green, B.G.; Cascieri, M.A.
1988-01-01
Four structural analogs of human insulin-like growth factor I (hIGF-I) have been prepared by site-directed mutagenesis of a synthetic IGF-I gene and subsequent expression and purification of the mutant protein from the conditioned media of transformed yeast. [Phe -1 , Val 1 , Asn 2 , Gln 3 , His 4 , Ser 8 , His 9 , Glu 12 , Tyr 15 , Leu 16 ]IGF-I (B-chain mutant), in which the first 16 amino acids of hIGF-I were replaced with the first 17 amino acids of the B-chain of insulin, has >1000-, 100-, and 2-fold reduced potency for human serum binding proteins, the rat liver type 2 IGF receptor, and the human placental type 1 IGF receptor, respectively. The B-chain mutant also has 4-fold increased affinity for the human placental insulin receptor. [Gln 3 , Ala 4 ] IGF-I has 4-fold reduced affinity for human serum binding proteins, but is equipotent to hIGF-I at the types 1 and 2 IGF and insulin receptors. [Tyr 15 , Leu 16 ] IGH-I has 4-fold reduced affinity for human serum binding proteins and 10-fold increased affinity for the insulin receptor. The peptide in which these four-point mutations are combined, [Gln 3 , Ala 4 , Tyr 15 ,Leu 16 ]IGF-I, has 600-fold reduced affinity for the serum binding proteins. All four of these mutants stimulate DNA synthesis in the rat vascular smooth muscle cell line A10 with potencies reflecting their potency at the type 1 IGF receptor. These studies identify some of the domains of hIGF-I which are responsible for maintaining high affinity binding with the serum binding protein and the type 2 IGF receptor. In addition, These peptides will be useful in defining the role of the type 2 IGF receptor and serum binding proteins in the physiological actions of hIGF-I
Association assessment of platelet derived growth factor B gene ...
African Journals Online (AJOL)
Background: Coronary artery disease (CAD) is the most frequent cause of morbidity and mortality in the world and it is known as a multifactorial disorder which is influenced by both genetic and environmental factors. Based on different assays, the platelet derived growth factor B (PDGF-B) gene is shown to be amongst the ...
Energy Technology Data Exchange (ETDEWEB)
Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu
2013-08-01
Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.
Kos, L; Aronzon, A; Takayama, H; Maina, F; Ponzetto, C; Merlino, G; Pavan, W
1999-02-01
The mechanisms governing development of neural crest-derived melanocytes, and how alterations in these pathways lead to hypopigmentation disorders, are not completely understood. Hepatocyte growth factor/scatter factor (HGF/SF) signaling through the tyrosine-kinase receptor, MET, is capable of promoting the proliferation, increasing the motility, and maintaining high tyrosinase activity and melanin synthesis of melanocytes in vitro. In addition, transgenic mice that ubiquitously overexpress HGF/SF demonstrate hyperpigmentation in the skin and leptomenigenes and develop melanomas. To investigate whether HGF/ SF-MET signaling is involved in the development of neural crest-derived melanocytes, transgenic embryos, ubiquitously overexpressing HGF/SF, were analyzed. In HGF/SF transgenic embryos, the distribution of melanoblasts along the characteristic migratory pathway was not affected. However, additional ectopically localized melanoblasts were also observed in the dorsal root ganglia and neural tube, as early as 11.5 days post coitus (p.c.). We utilized an in vitro neural crest culture assay to further explore the role of HGF/SF-MET signaling in neural crest development. HGF/SF added to neural crest cultures increased melanoblast number, permitted differentiation into pigmented melanocytes, promoted melanoblast survival, and could replace mast-cell growth factor/Steel factor (MGF) in explant cultures. To examine whether HGF/SF-MET signaling is required for the proper development of melanocytes, embryos with a targeted Met null mutation (Met-/-) were analysed. In Met-/- embryos, melanoblast number and location were not overtly affected up to 14 days p.c. These results demonstrate that HGF/SF-MET signaling influences, but is not required for, the initial development of neural crest-derived melanocytes in vivo and in vitro.
Yuldasheva, Nadira Y; Rashid, Sheikh Tawqeer; Haywood, Natalie J; Cordell, Paul; Mughal, Romana; Viswambharan, Hema; Imrie, Helen; Sukumar, Piruthivi; Cubbon, Richard M; Aziz, Amir; Gage, Matthew; Mbonye, Kamatamu Amanda; Smith, Jessica; Galloway, Stacey; Skromna, Anna; Scott, D Julian A; Kearney, Mark T; Wheatcroft, Stephen B
2014-09-01
Defective endothelial regeneration predisposes to adverse arterial remodeling and is thought to contribute to cardiovascular disease in type 2 diabetes mellitus. We recently demonstrated that the type 1 insulin-like growth factor receptor (IGF1R) is a negative regulator of insulin sensitivity and nitric oxide bioavailability. In this report, we examined partial deletion of the IGF1R as a potential strategy to enhance endothelial repair. We assessed endothelial regeneration after wire injury in mice and abundance and function of angiogenic progenitor cells in mice with haploinsufficiency of the IGF1R (IGF1R(+/-)). Endothelial regeneration after arterial injury was accelerated in IGF1R(+/-) mice. Although the yield of angiogenic progenitor cells was lower in IGF1R(+/-) mice, these angiogenic progenitor cells displayed enhanced adhesion, increased secretion of insulin-like growth factor-1, and enhanced angiogenic capacity. To examine the relevance of IGF1R manipulation to cell-based therapy, we transfused IGF1R(+/-) bone marrow-derived CD117(+) cells into wild-type mice. IGF1R(+/-) cells accelerated endothelial regeneration after arterial injury compared with wild-type cells and did not alter atherosclerotic lesion formation. Haploinsufficiency of the IGF1R is associated with accelerated endothelial regeneration in vivo and enhanced tube forming and adhesive potential of angiogenic progenitor cells in vitro. Partial deletion of IGF1R in transfused bone marrow-derived CD117(+) cells enhanced their capacity to promote endothelial regeneration without altering atherosclerosis. Our data suggest that manipulation of the IGF1R could be exploited as novel therapeutic approach to enhance repair of the arterial wall after injury. © 2014 American Heart Association, Inc.
El-Sayed, Wael M; Hussin, Warda A; Al-Faiyz, Yasair S; Ismail, Mohamed A
2013-09-05
The antimutagenic activity of eight novel imidazo[1,2-a]pyridine derivatives (I-VIII) against sodium azide (NaN3) and benzo[a]pyrene (B[a]P) was evaluated using the Salmonella reverse mutation assay. At non-toxic concentrations (12.5-50 µM), imidazopyridines I, II, III, and V with a terminal imidazopyridine group were mutagenic, while derivatives VII and VIII with a central imidazopyridine group were not mutagenic. Compounds IV, VII, and VIII exerted a moderate antimutagenic activity against NaN3 under pre-exposure conditions, and a strong activity (>40%) against B[a]P in the presence of S9 under both pre- and co-exposure conditions and mostly independent on the dose. Imidazopyridines possibly inhibited the microsomal-dependent activation of B[a]P. The demethylated derivative VII was the most active antimutagen. All imidazopyridines had a low to moderate antioxidant activity. The antibacterial activity of imidazopyridines was sporadic and moderate probably due to the failure of bacteria to convert imidazopyridines into active metabolites. The position of imidazopyridine was a pivotal factor in the mutagenic/antimutagenic activity. The strong antimutagenic compounds were dicationic planar compounds with a centered imidazo[1,2-a]pyridine spacer. With LD50 of 60 mg/kg in mice for both derivatives VII and VIII, it is safe to investigate the anticancer activity of these derivatives in animal models. © 2013 Elsevier B.V. All rights reserved.
Gong, Meng-Juan; Han, Bin; Wang, Shu-mei; Liang, Sheng-wang; Zou, Zhong-jie
2016-05-10
Previously published reports have revealed the antidepressant-like effects of icariin in a chronic mild stress model of depression and in a social defeat stress model in mice. However, the therapeutic effect of icariin in an animal model of glucocorticoid-induced depression remains unclear. This study aimed to investigate antidepressant-like effect and the possible mechanisms of icariin in a rat model of corticosterone (CORT)-induced depression by using a combination of behavioral and biochemical assessments and NMR-based metabonomics. The depression model was established by subcutaneous injections of CORT for 21 consecutive days in rats, as evidenced by reduced sucrose intake and hippocampal brain-derived neurotrophic factor (BDNF) levels, together with an increase in immobility time in a forced swim test (FST). Icariin significantly increased sucrose intake and hippocampal BDNF level and decreased the immobility time in FST in CORT-induced depressive rats, suggesting its potent antidepressant activity. Moreover, metabonomic analysis identified eight, five and three potential biomarkers associated with depression in serum, urine and brain tissue extract, respectively. These biomarkers are primarily involved in energy metabolism, lipid metabolism, amino acid metabolism and gut microbe metabolism. Icariin reversed the pathological process of CORT-induced depression, partially via regulation of the disturbed metabolic pathways. These results provide important mechanistic insights into the protective effects of icariin against CORT-induced depression and metabolic dysfunction. Copyright © 2016 Elsevier B.V. All rights reserved.
Liver-Derived Insulin-Like Growth Factor-I is Involved in the Regulation of Blood Pressure in Mice
DEFF Research Database (Denmark)
Tivesten, Asa; Bollano, Entela; Andersson, Irene
2002-01-01
IGF-I has been suggested to be of importance for cardiovascular structure and function, but the relative role of locally produced and liver-derived endocrine IGF-I remains unclear. Using the Cre-LoxP recombination system, we have previously created transgenic mice with a liver-specific, inducible...... IGF-I knockout (LI-IGF-I-/-). To examine the role of liver-derived IGF-I in cardiovascular physiology, liver-derived IGF-I was inactivated at 4 wk of age, resulting in a 79% reduction of serum IGF-I levels. At 4 months of age, systolic blood pressure (BP) was increased in LI-IGF-I-/- mice...... to endothelial dysfunction associated with increased expression of endothelin-1 and impaired vasorelaxation of resistance vessels. In conclusion, our findings suggest that liver-derived IGF-I is involved in the regulation of BP in mice....
Synthesis of novel kavain-like derivatives and evaluation of their cytotoxic activity
Energy Technology Data Exchange (ETDEWEB)
Amaral, Patricia de A.; Agustini, Taciane; Eifler-Lima, Vera L. [Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre (Brazil). Faculdade de Farmacia. Lab. de Sintese Organica Medicinal; Petrignet, Julien; Cariou, Alexandre; Gree, Rene [Universite de Rennes 1, Rennes (France). Lab. de Chimie Therapeutique; Gouault, Nicolas; Lohezic-Ledevehat, Francoise; David, Michele [CNRS UMR, Universite de Rennes 1, Rennes (France). Lab. de Chimie et Photonique Moleculaires
2009-07-01
Palladium-catalyzed cross coupling reactions (Sonogashira-Hagihara, Suzuki-Miyaura, and Heck) coupling and nickel hydride-mediated tandem isomerization aldolisation have been used for the synthesis of three series of {delta}-valerolactones substituted in positions 3, 4, 5 and 6 of the lactone ring. The 26 kavaien-like derivatives were tested against three cell lines and five of them exhibited a weak cytotoxic activity. (author)
Directory of Open Access Journals (Sweden)
Sreoshi Chatterjee
Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.
Gravitational lens effect of wall-like objects and its cosmological implications
International Nuclear Information System (INIS)
Tomita, Kenji.
1990-08-01
First we derive the gravitational deflection angle of light rays passing through a disk consisting of pressureless matter, and show that it behaves like a convex lens. Next we derive the two-ray difference of deflection angles by help of the Raychaudhuri equation, in the cases when the wall-like objects are dust walls and domain-walls. Moreover we derive the two-ray difference of deflection angles in a low mass-density regions lying between wall-like objects. This region plays a role of a concave lens, but it is shown that its effect is minor, compared with the effect of wall-like objects. On the basis of these deflection angle differences, we consider the gravitational lens effect of uniform wall-like objects which may exist homogeneously on the cosmological scale, and show that, in the case when the wall-like objects appear at the epoch of z = 5, the measured angles of the cosmic background radiation may be increased about 3-2 times owing to the integrated convex lens effect and so its measured anisotropy may be smaller by a factor of about 10-6 than the intrinsic one. (author)
Hu, Z.
2018-04-01
This research explores the use of PM2.5 gird derived from remote sensing for assessing the effect of long-term exposure to PM2.5 (ambient air pollution of particulate matter with an aerodynamic diameter of 2.5 μm or less) on stroke, adjusting for unhealthy behaviors and medical risk factors. Health data was obtained from the newly published CDC "500 Cities Project" which provides city- and census tract-level small area estimates for chronic disease risk factors, and clinical preventive service use for the largest 500 cities in the United States. PM2.5 data was acquired from the "The Global Annual PM2.5 Grids from MODIS, MISR and SeaWiFS Aerosol Optical Depth (AOD), V1 (1998-2012)" datasets. Average PM2.5 were calculated for each city using a GIS zonal statistics function. Map data visualization and pattern comparison, univariate linear regression, and a multivariate linear regression model fitted using a generalized linear model via penalized maximum likelihood found that long-term exposure to ambient PM2.5 may increase the risk of stroke. Increasing physical activity, reducing smoking and body weight, enough sleeping, controlling diseases such as blood pressure, coronary heart disease, diabetes, and cholesterol, may mitigate the effect. PM2.5 grids derived from moderate resolution satellite remote sensing imagery may offer a unique opportunity to fill the data gap due to limited ground monitoring at broader scales. The evidence of raised stroke prevalence risk in high PM2.5 areas would support targeting of policy interventions on such areas to reduce pollution levels and protect human health.
Directory of Open Access Journals (Sweden)
Z. Hu
2018-04-01
Full Text Available This research explores the use of PM2.5 gird derived from remote sensing for assessing the effect of long-term exposure to PM2.5 (ambient air pollution of particulate matter with an aerodynamic diameter of 2.5 μm or less on stroke, adjusting for unhealthy behaviors and medical risk factors. Health data was obtained from the newly published CDC “500 Cities Project” which provides city- and census tract-level small area estimates for chronic disease risk factors, and clinical preventive service use for the largest 500 cities in the United States. PM2.5 data was acquired from the “The Global Annual PM2.5 Grids from MODIS, MISR and SeaWiFS Aerosol Optical Depth (AOD, V1 (1998–2012” datasets. Average PM2.5 were calculated for each city using a GIS zonal statistics function. Map data visualization and pattern comparison, univariate linear regression, and a multivariate linear regression model fitted using a generalized linear model via penalized maximum likelihood found that long-term exposure to ambient PM2.5 may increase the risk of stroke. Increasing physical activity, reducing smoking and body weight, enough sleeping, controlling diseases such as blood pressure, coronary heart disease, diabetes, and cholesterol, may mitigate the effect. PM2.5 grids derived from moderate resolution satellite remote sensing imagery may offer a unique opportunity to fill the data gap due to limited ground monitoring at broader scales. The evidence of raised stroke prevalence risk in high PM2.5 areas would support targeting of policy interventions on such areas to reduce pollution levels and protect human health.
Peng, Kanfu; Zhao, Hongwen; Xie, Pan; Hu, Shuang; Yuan, Yali; Yuan, Ruo; Wu, Xiongfei
2016-07-15
In this work, we developed a sensitive and universal aptasensor for nuclear factor kappa B (NF-κB) detection based on peroxidase-like mimic coupled DNA nanoladders for signal amplification. The dsDNA formed by capture DNA S1 and NF-κB binding aptamer (NBA) was firstly assembled on electrode surface. The presence of target NF-κB then led to the leave of NBA from electrode surface and thus provided the binding sites for immobilizing initiator to trigger in situ formation of DNA nanoladders on electrode surface. Since the peroxidase-like mimic manganese (III) meso-tetrakis (4-Nmethylpyridyl)-porphyrin (MnTMPyP) interacts with DNA nanoladders via groove binding, the insoluble benzo-4-chlorohexadienone (4-CD) precipitation derived from the oxidation of 4-chloro-1-naphthol (4-CN) could be formed on electrode surface in the presence of H2O2, resulting in a significantly amplified EIS signal output for quantitative target analysis. As a result, the developed aptasensor showed a low detection limit of 7pM and a wide linear range of 0.01-20nM. Featured with high sensitivity and label-free capability, the proposed sensing scheme can thus offer new opportunities for achieving sensitive, selective and stable detection of different types of target proteins. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rebecca Josowitz
Full Text Available The use of human stem cell-derived cardiomyocytes to study atrial biology and disease has been restricted by the lack of a reliable method for stem cell-derived atrial cell labeling and purification. The goal of this study was to generate an atrial-specific reporter construct to identify and purify human stem cell-derived atrial-like cardiomyocytes. We have created a bacterial artificial chromosome (BAC reporter construct in which fluorescence is driven by expression of the atrial-specific gene sarcolipin (SLN. When purified using flow cytometry, cells with high fluorescence specifically express atrial genes and display functional calcium handling and electrophysiological properties consistent with atrial cardiomyocytes. Our data indicate that SLN can be used as a marker to successfully monitor and isolate hiPSC-derived atrial-like cardiomyocytes. These purified cells may find many applications, including in the study of atrial-specific pathologies and chamber-specific lineage development.
Directory of Open Access Journals (Sweden)
Nahyun Choi
2018-02-01
Full Text Available Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs. We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif ligand 1 (CXCL1, platelet-derived endothelial cell growth factor (PD-ECGF, and platelet-derived growth factor-C (PDGF-C. Minoxidil increased extracellular signal–regulated kinases 1/2 (ERK1/2 phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration.
Choi, Nahyun; Shin, Soyoung; Song, Sun U.; Sung, Jong-Hyuk
2018-01-01
Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP) and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs). We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif) ligand 1 (CXCL1), platelet-derived endothelial cell growth factor (PD-ECGF), and platelet-derived growth factor-C (PDGF-C). Minoxidil increased extracellular signal–regulated kinases 1/2 (ERK1/2) phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration. PMID:29495622
Kim, Kwan-Woo; Kim, Hye Jin; Sohn, Jae Hak; Yim, Joung Han; Kim, Youn-Chul; Oh, Hyuncheol
2018-02-01
In the course of searching for anti-neuroinflammatory metabolites from marine-derived fungi, three fungal metabolites, 6,8,1'-tri-O-methylaverantin, 6,8-di-O-methylaverufin, and 5-methoxysterigmatocystin were isolated from a marine-derived fungal strain Aspergillus sp. SF-6796. Among these, 6,8,1'-tri-O-methylaverantin induced the expression of heme oxygenase (HO)-1 protein in BV2 microglial cells. The induction of HO-1 protein was mediated by the activation of nuclear transcription factor erythroid-2 related factor 2 (Nrf2), and was regulated by the p38 mitogen-activated protein kinase and phosphatidylinositol 3-kinase/protein kinase B signaling pathways. Furthermore, 6,8,1'-tri-O-methylaverantin suppressed the overproduction of pro-inflammatory mediators, such as nitric oxide, prostaglandin E 2 , inducible nitric oxide synthase, and cyclooxygenase-2 in lipopolysaccharide (LPS)-stimulated BV2 microglial cells. These anti-neuroinflammatory effects were mediated through the negative regulation of the nuclear factor kappa B pathway, repressing the phosphorylation and degradation of inhibitor kappa B-α, translocation into the nucleus of p65/p50 heterodimer, and DNA-binding activity of p65 subunit. The anti-neuroinflammatory effect of 6,8,1'-tri-O-methylaverantin was partially blocked by a selective HO-1 inhibitor, suggesting that its anti-neuroinflammatory effect is at least partly mediated by HO-1 induction. In this study, 6,8,1'-tri-O-methylaverantin also induced HO-1 protein expression in primary microglial cells, and this correlated with anti-neuroinflammatory effects observed in LPS-stimulated primary microglial cells. In conclusion, 6,8,1'-tri-O-methylaverantin represents a potential candidate for use in the development of therapeutic agents for the regulation of neuroinflammation in neurodegenerative diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Bilgiç, Ayhan; Toker, Aysun; Işık, Ümit; Kılınç, İbrahim
2017-03-01
It has been suggested that neurotrophins are involved in the etiopathogenesis of attention-deficit/hyperactivity disorder (ADHD). This study aimed to investigate whether there are differences in serum brain-derived neurotrophic factor (BDNF), glial-derived neurotrophic factor (GDNF), nerve growth factor (NGF), and neurotrophin-3 (NTF3) levels between children with ADHD and healthy controls. A total of 110 treatment-naive children with the combined presentation of ADHD and 44 healthy controls aged 8-18 years were enrolled in this study. The severity of ADHD symptoms was determined by scores on the Conners' Parent Rating Scale-Revised Short and Conners' Teacher Rating Scale-Revised Short. The severity of depression and anxiety symptoms of the children were evaluated by the self-report inventories. Serum levels of neurotrophins were measured using commercial enzyme-linked immunosorbent assay kits. The multivariate analysis of covariance (MANCOVA) revealed a significant main effect of groups in the levels of serum neurotrophins, an effect that was independent of age, sex, and the severity of the depression and anxiety. The analysis of covariance (ANCOVA) indicated that the mean serum GDNF and NTF3 levels of ADHD patients were significantly higher than that of controls. However, serum BDNF and NGF levels did not show any significant differences between groups. No correlations between the levels of serum neurotrophins and the severity of ADHD were observed. These results suggest that elevated serum GDNF and NTF3 levels may be related to ADHD in children.
Hong, Mi-Na; Nam, Ky-Youb; Kim, Kyung Kon; Kim, So-Young; Kim, InKi
2016-05-01
By environmental stresses, cells can initiate a signaling pathway in which eukaryotic translation initiation factor 2-alpha (eIF2-α) is involved to regulate the response. Phosphorylation of eIF2-α results in the reduction of overall protein neogenesis, which allows cells to conserve resources and to reprogram energy usage for effective stress control. To investigate the role of eIF2-α in cell stress responses, we conducted a viability-based compound screen under endoplasmic reticulum (ER) stress condition, and identified 1-(4-biphenylylcarbonyl)-4-(5-bromo-2-methoxybenzyl) piperazine oxalate (AMC-01) and its derivatives as eIF2-α-inactivating chemical. Molecular characterization of this signaling pathway revealed that AMC-01 induced inactivation of eIF2-α by phosphorylating serine residue 51 in a dose- and time-dependent manner, while the negative control compounds did not affect eIF2-α phosphorylation. In contrast with ER stress induction by thapsigargin, phosphorylation of eIF2-α persisted for the duration of incubation with AMC-01. By pathway analysis, AMC-01 clearly induced the activation of protein kinase RNA-activated (PKR) kinase and nuclear factor-κB (NF-κB), whereas it did not modulate the activity of PERK or heme-regulated inhibitor (HRI). Finally, we could detect a lower protein translation rate in cells incubated with AMC-01, establishing AMC-01 as a potent chemical probe that can regulate eIF2-α activity. We suggest from these data that AMC-01 and its derivative compounds can be used as chemical probes in future studies of the role of eIF2-α in protein synthesis-related cell physiology.
Directory of Open Access Journals (Sweden)
Ayaka Yanagida
Full Text Available Hepatoblasts, hepatic stem/progenitor cells in liver development, have a high proliferative potential and the ability to differentiate into both hepatocytes and cholangiocytes. In regenerative medicine and drug screening for the treatment of severe liver diseases, human induced pluripotent stem (iPS cell-derived mature functional hepatocytes are considered to be a potentially good cell source. However, induction of proliferation of these cells is difficult ex vivo. To circumvent this problem, we generated hepatic progenitor-like cells from human iPS cells using serial cytokine treatments in vitro. Highly proliferative hepatic progenitor-like cells were purified by fluorescence-activated cell sorting using antibodies against CD13 and CD133 that are known cell surface markers of hepatic stem/progenitor cells in fetal and adult mouse livers. When the purified CD13(highCD133(+ cells were cultured at a low density with feeder cells in the presence of suitable growth factors and signaling inhibitors (ALK inhibitor A-83-01 and ROCK inhibitor Y-27632, individual cells gave rise to relatively large colonies. These colonies consisted of two types of cells expressing hepatocytic marker genes (hepatocyte nuclear factor 4α and α-fetoprotein and a cholangiocytic marker gene (cytokeratin 7, and continued to proliferate over long periods of time. In a spheroid formation assay, these cells were found to express genes required for mature liver function, such as cytochrome P450 enzymes, and secrete albumin. When these cells were cultured in a suitable extracellular matrix gel, they eventually formed a cholangiocytic cyst-like structure with epithelial polarity, suggesting that human iPS cell-derived hepatic progenitor-like cells have a bipotent differentiation ability. Collectively these data indicate that this novel procedure using an in vitro expansion system is useful for not only liver regeneration but also for the determination of molecular mechanisms that
Comparison of different methods for erythroid differentiation in the K562 cell line.
Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein
2016-08-01
To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.
Doulatov, Sergei; Vo, Linda T.; Chou, Stephanie S.; Kim, Peter G.; Arora, Natasha; Li, Hu; Hadland, Brandon K.; Bernstein, Irwin D.; Collins, James J.; Zon, Leonard I.; Daley, George Q.
2013-01-01
Summary Human pluripotent stem cells (hPSCs) represent a promising source of patient-specific cells for disease modeling, drug screens, and cellular therapies. However, the inability to derive engraftable human hematopoietic stem and progenitor (HSPCs) has limited their characterization to in vitro assays. We report a strategy to re-specify lineage-restricted CD34+CD45+ myeloid precursors derived from hPSCs into multilineage progenitors that can be expanded in vitro and engraft in vivo. HOXA9, ERG, and RORA conferred self-renewal and multilineage potential in vitro and maintained primitive CD34+CD38− cells. Screening cells via transplantation revealed that two additional factors, SOX4 and MYB, were required for engraftment. Progenitors specified with all five factors gave rise to reproducible short-term engraftment with myeloid and erythroid lineages. Erythroid precursors underwent hemoglobin switching in vivo, silencing embryonic and activating adult globin expression. Our combinatorial screening approach establishes a strategy for obtaining transcription factor-mediated engraftment of blood progenitors from human pluripotent cells. PMID:24094326
Foresti, Roberta; Bains, Sandip K; Pitchumony, Tamil Selvi; de Castro Brás, Lisandra E; Drago, Filippo; Dubois-Randé, Jean-Luc; Bucolo, Claudio; Motterlini, Roberto
2013-10-01
The nuclear factor erythroid derived 2-related factor 2 (Nrf2) and the antioxidant protein heme oxygenase-1 (HO-1) are crucial components of the cellular stress response. These two systems work together to combat oxidative stress and inflammation and are attractive drug targets for counteracting different pathologies, including neuroinflammation. We aimed to identify the most effective Nrf2/HO-1 activators that modulate the inflammatory response in microglia cells. In the present study, we searched the literature and selected 56 compounds reported to activate Nrf2 or HO-1 and analyzed them for HO-1 induction at 6 and 24h and cytotoxicity in BV2 microglial cells in vitro. Approximately 20 compounds up-regulated HO-1 at the concentrations tested (5-20 μM) with carnosol, supercurcumin, cobalt protoporphyrin-IX and dimethyl fumarate exhibiting the best induction/low cytotoxicity profile. Up-regulation of HO-1 by some compounds resulted in increased cellular bilirubin levels but did not augment the expression of proteins involved in heme synthesis (ALAS 1) or biliverdin reductase. Bilirubin production by HO-1 inducers correlated with their potency in inhibiting nitrite production after challenge with interferon-γ (INF-γ) or lipopolysaccharide (LPS). The compounds down-regulated the inflammatory response (TNF-α, PGE2 and nitrite) more strongly in cells challenged with INF-γ than LPS, and silencing HO-1 or Nrf2 with shRNA differentially affected the levels of inflammatory markers. These findings indicate that some small activators of Nrf2/HO-1 are effective modulators of microglia inflammation and highlight the chemical scaffolds that can serve for the synthesis of potent new derivatives to counteract neuroinflammation and neurodegeneration. Copyright © 2013 Elsevier Ltd. All rights reserved.
Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.
Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong
2017-02-03
Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.
Carnicella, Sebastien; Ahmadiantehrani, Somayeh; He, Dao-Yao; Nielsen, Carsten K; Bartlett, Selena E; Janak, Patricia H; Ron, Dorit
2009-07-15
Cabergoline is an ergotamine derivative that increases the expression of glial cell line-derived neurotrophic factor (GDNF) in vitro. We recently showed that GDNF in the ventral tegmental area (VTA) reduces the motivation to consume alcohol. We therefore set out to determine whether cabergoline administration decreases alcohol-drinking and -seeking behaviors via GDNF. Reverse transcription polymerase chain reaction (RT-PCR) and Enzyme-Linked ImmunoSorbent Assay (ELISA) were used to measure GDNF levels. Western blot analysis was used for phosphorylation experiments. Operant self-administration in rats and a two-bottle choice procedure in mice were used to assess alcohol-drinking behaviors. Instrumental performance tested during extinction was used to measure alcohol-seeking behavior. The [35S]GTPgammaS binding assay was used to assess the expression and function of the dopamine D2 receptor (D2R). We found that treatment of the dopaminergic-like cell line SH-SY5Y with cabergoline and systemic administration of cabergoline in rats resulted in an increase in GDNF level and in the activation of the GDNF pathway. Cabergoline treatment decreased alcohol-drinking and -seeking behaviors including relapse, and its action to reduce alcohol consumption was localized to the VTA. Finally, the increase in GDNF expression and the decrease in alcohol consumption by cabergoline were abolished in GDNF heterozygous knockout mice. Together, these findings suggest that cabergoline-mediated upregulation of the GDNF pathway attenuates alcohol-drinking behaviors and relapse. Alcohol abuse and addiction are devastating and costly problems worldwide. This study puts forward the possibility that cabergoline might be an effective treatment for these disorders.
Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress
International Nuclear Information System (INIS)
Mercado, Nicolas; Thimmulappa, Rajesh; Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E.; Biswal, Shyam; Ito, Kazuhiro; Barnes, Peter J.
2011-01-01
Research highlights: → Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. → HDAC inhibition decreases Nrf2 protein stability. → HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. → HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H 2 O 2 ) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H 2 O 2 -induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.
Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress
Energy Technology Data Exchange (ETDEWEB)
Mercado, Nicolas [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Thimmulappa, Rajesh [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E. [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Biswal, Shyam [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Ito, Kazuhiro [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Barnes, Peter J., E-mail: p.j.barnes@imperial.ac.uk [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom)
2011-03-11
Research highlights: {yields} Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. {yields} HDAC inhibition decreases Nrf2 protein stability. {yields} HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. {yields} HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H{sub 2}O{sub 2}) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H{sub 2}O{sub 2}-induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.
Serum insulin-like growth factor 1 in the aging horse
DEFF Research Database (Denmark)
Lygren, Tone; Hansen, Sanni; Langberg, Henning
2014-01-01
BACKGROUND: Insulin-like growth factor 1 (IGF-1) has important roles in anabolic processes in the musculoskeletal system and has been reported to decrease with age in both people and horses. OBJECTIVES: The objective of this study was to determine serum IGF-1 levels in the aging horse from early...... was found between serum IGF-1 levels and age in the cross-sectional study. In the longitudinal study, a latent variable model fitted to the data revealed that horses in general experienced a 5.2% increase of serum IGF-1 levels over a 5-year period, but horses crossing a change point around 9 years of age...... between the 2 samples experienced an 11.0% decrease. CONCLUSIONS: In this study, there was no evidence for aging being a factor in changes of IGF-1 levels in an adult and old horse population....
INSULIN-LIKE GROWTH FACTOR (IGF-1 IN CNS AND CEREBROVASCULAR AGING
Directory of Open Access Journals (Sweden)
William E Sonntag
2013-07-01
Full Text Available Insulin-like growth factor-1 (IGF-1 is an important anabolic hormone that decreases with age. In the past two decades extensive research has determined that the reduction in IGF-1 is an important component of the age-related decline in cognitive function in multiple species including humans. Deficiency in circulating IGF-1 results in impairment in processing speed and deficiencies in both spatial and working memory. Replacement of IGF-1 or factors that increase IGF-1 to old animals and humans reverses many of these cognitive deficits. Despite the overwhelming evidence for IGF-1 as an important neurotrophic agent, the specific mechanisms through which IGF-1 acts have remained elusive. Recent evidence indicates that IGF-1 is both produced by and has important actions on the cerebrovasculature as well as neurons and glia. Nevertheless, the specific regulation and actions of brain- and vascular-derived IGF-1 is poorly understood. The diverse effects of IGF-1 discovered thus far reveal a complex endocrine and paracrine system essential for integrating many of the functions necessary for brain health. Identification of the mechanisms of IGF-1 actions will undoubtedly provide critical insight into regulation of brain function in general and the causes of cognitive decline with age.
Directory of Open Access Journals (Sweden)
Maria Teresa Valenti
Full Text Available BACKGROUND: Mesenchymal stem cells (MSCs can differentiate into osteoblasts and adipocytes and conditions causing bone loss may induce a switch from the osteoblast to adipocyte lineage. In addition, the expression of Runx2 and the PPARγ2 transcription factor genes is essential for cellular commitment to an osteogenic and adipogenic differentiation, respectively. Modified lipoproteins derived from the oxidation of arachidonate-containing phospholipids (ox-PAPCs: POVPC, PGPC and PEIPC are considered important factors in atherogenesis. METHODOLOGY: We investigated the effect of ox-PAPCs on osteogenesis and adipogenesis in human mesenchymal stem cells (hMSCs. In particular, we analyzed the transcription factor Runx2 and the PPARγ2 gene expression during osteogenic and adipogenic differentiation in absence and in presence of ox-PAPCs. We also analyzed gene expression level in a panel of osteoblastic and adipogenic differentiation markers. In addition, as circulating blood cells can be used as a "sentinel" that responds to changes in the macro- or micro-environment, we analyzed the Runx2 and the PPARγ2 gene expression in MSCs-like and ox-PAPC levels in serum of osteoporotic patients (OPs. Finally, we examined the effects of sera obtained from OPs in hMSCs comparing the results with age-matched normal donors (NDs. PRINCIPAL FINDINGS: Quantitative RT-PCR demonstrated that ox-PAPCs enhanced PPARγ2 and adipogenic gene expression and reduced Runx2 and osteoblast differentiation marker gene expression in differentiating hMSCs. In OPs, ox-PAPC levels and PPARγ2 expression were higher than in NDs, whereas Runx2 was lower than in ND circulant MSCs-like. CONCLUSIONS: Ox-PAPCs affect the osteogenic differentiation by promoting adipogenic differentiation and this effect may appear involved in bone loss in OPs.
Measurements of brain-derived neurotrophic factor
DEFF Research Database (Denmark)
Trajkovska, Viktorija; Klein, Anders Bue; Vinberg, Maj
2007-01-01
Although numerous studies have dealt with changes in blood brain-derived neurotrophic factor (BDNF), methodological issues about BDNF measurements have only been incompletely resolved. We validated BDNF ELISA with respect to accuracy, reproducibility and the effect of storage and repeated freezing...... (18.6+/-1.3 ng/ml versus 16.5+/-1.4 ng/ml), and showed a right-skewed BDNF concentration distribution. No association between whole blood BDNF concentrations and thrombocyte count, age, or BDNF genotype was found. In conclusion, the BDNF ELISA assay determines whole blood BDNF accurately and with high...
Williamson, Tracy P; Johnson, Delinda A; Johnson, Jeffrey A
2012-06-01
Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that binds to the antioxidant response element, a cis-acting regulatory element that increases expression of detoxifying enzymes and antioxidant proteins. Kelch-like ECH associating protein 1 (Keap1) protein is a negative regulator of Nrf2. Previous work has shown that genetic overexpression of Nrf2 is protective in vitro and in vivo. To modulate the Nrf2-ARE system without overexpressing Nrf2, we used short interfering RNA (siRNA) directed against Keap1. Keap1 siRNA administration in primary astrocytes increased the levels of Nrf2-ARE driven genes and protected against oxidative stress. Moreover, Keap1 siRNA resulted in a persistent upregulation of the Nrf2-ARE pathway and protection against oxidative stress in primary astrocytes. Keap1 siRNA injected into the striatum was also modestly protective against MPTP-induced dopaminergic terminal damage. These data indicate that activation of endogenous intracellular levels of Nrf2 is sufficient to protect in models of oxidative stress and Parkinson's disease. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Yu Xue
2012-11-01
Full Text Available An efficient and convenient approach for one-pot synthesis of 3-substituted chroman-2,4-diones via a three-component reaction of aromatic aldehydes, 4-hydroxy- coumarins and diverse pyrazolone derivatives was described. The combinatorial synthesis for this methodology was achieved by applying ultrasound irradiation in the absence of activator while making use of water as green solvent. Additionally, novel chroman-2,4-dione derivatives attached to an edaravone moiety represent an exploitable source of brand new anticancer agents. In comparison with conventional methods, experimental simplicity, good functional group tolerance, excellent yields, short routine, and atom efficiency are prominent features of this sonocatalyzed procedure.
Directory of Open Access Journals (Sweden)
Qiong-Hui Huang
2017-01-01
Full Text Available Excessive alcohol consumption leads to serious liver injury, associating with oxidative stress and inflammatory response. Previous study has demonstrated that polydatin (PD exerted antioxidant and anti-inflammatory effects and attenuated ethanol-induced liver damage, but the research remained insufficient. Hence, this experiment aimed to evaluate the hepatoprotective effect and potential mechanisms of PD on ethanol-induced hepatotoxicity. Our results showed that PD pretreatment dramatically decreased the levels of alanine aminotransferase (ALT, aspartate aminotransferase (AST, alkaline phosphatase (ALP, and lactate dehydrogenase (LDH in the serum, suppressed the malonaldehyde (MDA and triglyceride (TG content and the production of reactive oxygen species (ROS, and enhanced the activities of superoxide dismutase (SOD, glutathione peroxidase (GSH-Px, catalase (CAT, andalcohol dehydrogenase (ADH, and aldehyde dehydrogenase (ALDH, paralleled by an improvement of histopathology alterations. The protective effect of PD against oxidative stress was probably associated with downregulation of cytochrome P450 2E1 (CYP2E1 and upregulation of nuclear factor erythroid 2-related factor 2 (Nrf2 and its target gene haem oxygenase-1 (HO-1. Moreover, PD inhibited the release of proinflammatory cytokines (TNF-α, IL-1β, and IL-6 via downregulating toll-like receptor 4 (TLR4 and nuclear factor kappa B (NF-κB p65. To conclude, PD pretreatment protects against ethanol-induced liver injury via suppressing oxidative stress and inflammation.
Aayadi, Hoda; Mittal, Smriti P K; Deshpande, Anjali; Gore, Makarand; Ghaskadbi, Saroj S
2017-11-01
Geraniin, a hydrolysable tannin, used in traditional medicine in Southeast Asia, is known to exhibit various biological activities. As an antioxidant it is known to up-regulate phase II enzyme Heme oxygenase-1 (HO-1). However its mechanism is not clearly understood. Nuclear factor erythroid-derived 2 related factor 2 (Nrf-2) is transcriptionally up-regulated by Extracellular signal-regulated kinase (ERK) 1/2 and retained in nucleus due to inactivated Glycogen synthase kinase 3 beta (GSK-3β). Geraniin additionally down-regulates expression of microRNA 217 and 377 (miR-217 and miR-377) which target HO-1 mRNA. Expression of BTB and CNC homolog 1 (BACH-1), another regulator of HO-1, is also down-regulated by up-regulating microRNA 98 (miR-98), a negative regulator of BACH-1. Thus, geraniin up-regulates HO-1 expression both through activating its positive regulator Nrf-2 and by down-regulating its negative regulator BACH-1. Up-regulation of HO-1 also confers protection to HepG2 cells from tertiary butyl hydroperoxide (TBH) induced cytotoxicity. [BMB Reports 2017; 50(11): 560-565].
Factors Most Likely to Contribute to Positive Course Evaluations
VanMaaren, Victoria G.; Jaquett, Caroline M.; Williams, Robert L.
2016-01-01
The purpose of this study was to determine the extent to which students differentially rated ten factors likely to affect their ratings on overall course evaluations. Students (N = 148) in several sections of an undergraduate educational psychology course indicated their preferences among several designated factors. We found remarkable similarity…
Insulin-like growth factor-I, physical activity, and control of cellular anabolism.
Nindl, Bradley C
2010-01-01
The underlying mechanisms responsible for mediating the beneficial outcomes of exercise undoubtedly are many, but the insulin-like growth factor-I (IGF-I) system is emerging as an important and central hormonal axis that plays a significant role concerning cellular anabolism. This introductory article summarizes the intent and the content for papers presented as part of a 2008 American College of Sports Medicine national symposium entitled "Insulin-like Growth Factor-I, Physical Activity, and Control of Cellular Anabolism." The individual authors and their papers are as follows: Jan Frystyk authoring "The relationship between exercise and the growth hormone/insulin-like growth factor-I axis," Greg Adams authoring "IGF-I signaling in skeletal muscle and the potential for cytokine interactions," and Brad Nindl authoring "Insulin-like growth factor-I as a biomarker of health, fitness, and training status." These papers focus on 1) different assay methodologies for IGF-I within the paradigm of exercise studies, 2) research demonstrating that intracellular signaling components associated with several proinflammatory cytokines have the potential to interact with anabolic signaling processes in skeletal muscle, and 3) an overview of IGF-I as a biomarker related to exercise training, muscle and bone remodeling, body composition, cognition, and cancer. When summed in total, the contribution that these papers will make will undoubtedly involve bringing attention to the vast regulatory complexity of the IGF-I system and will hopefully convince the reader that the IGF-I system warrants further detailed scientific inquiry to resolve many unanswered questions and paradoxical experimental findings. The IGF-I system remains one of the most intriguing and captivating marvels of human physiology that seems central in mediating numerous adaptations from physical activity.
Transcription factors: normal and malignant development of blood cells
National Research Council Canada - National Science Library
Ravid, Katya; Licht, Jonathan
2001-01-01
... and the Development of the Erythroid Lineage James J. Bieker 71 II TRANSCRIPTION FACTORS AND THE MYELOID LINEAGE 85 6 RUNX1(AML1) and CBFB: Genes Required for the Development of All Definitive Hematopoietic Lineages 87 Nancy A. Speck and Elaine Dzierzak 7 PU.1 and the Development of the Myeloid Lineage Daniel G. Tenen 103 vvi CONTENTS 8 CCAAT/Enhancer-...
Two-loop SL(2) form factors and maximal transcendentality
International Nuclear Information System (INIS)
Loebbert, Florian; Sieg, Christoph; Wilhelm, Matthias; Yang, Gang
2016-01-01
Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.
Two-loop SL(2) form factors and maximal transcendentality
Energy Technology Data Exchange (ETDEWEB)
Loebbert, Florian [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Sieg, Christoph [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Wilhelm, Matthias [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Niels Bohr Institute, Copenhagen University,Blegdamsvej 17, 2100 Copenhagen Ø (Denmark); Yang, Gang [CAS Key Laboratory of Theoretical Physics,Institute of Theoretical Physics, Chinese Academy of Sciences,Beijing 100190 (China); Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany)
2016-12-19
Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.
Liu, Yi; Zhang, Lingyun; Zhu, Xiangxiang; Wang, Yuehua; Liu, WenWei; Gong, Wei
2015-11-01
Gr-1(+) CD11b(+) myeloid-derived suppressor cells (MDSCs) accumulate in tumor-bearing animals and play a critical negative role during tumor immunotherapy. Strategies for inhibition of MDSCs are expected to improve cancer immunotherapy. Polysaccharide Agaricus blazei Murill (pAbM) has been found to have anti-cancer activity, but the underlying mechanism of this is poorly understood. Here, pAbM directly activated the purified MDSCs through inducing the expression of interleukin-6 (IL-6), IL-12, tumour necrosis factor and inducible nitric oxide synthase (iNOS), CD86, MHC II, and pSTAT1 of it, and only affected natural killer and T cells in the presence of Gr-1(+) CD11b(+) monocytic MDSCs. On further analysis, we demonstrated that pAbM could selectively block the Toll-like receptor 2 (TLR2) signal of Gr-1(+) CD11b(+) MDSCs and increased their M1-type macrophage characteristics, such as producing IL-12, lowering expression of Arginase 1 and increasing expression of iNOS. Extensive study showed that Gr-1(+) CD11b(+) MDSCs by pAbM treatment had less ability to convert the CD4(+) CD25(-) cells into CD4(+) CD25(+) phenotype. Moreover, result from selective depletion of specific cell populations in xenograft mice model suggested that the anti-tumour effect of pAbM was dependent on Gr-1(+ ) CD11b(+) monocytes, nether CD8(+) T cells nor CD4(+) T cells. In addition to, pAbM did not inhibit tumour growth in TLR2(-/-) mice. All together, these results suggested that pAbM, a natural product commonly used for cancer treatment, was a specific TLR2 agonist and had potent anti-tumour effects through the opposite of the suppressive function of Gr-1(+) CD11b(+) MDSCs. © 2015 John Wiley & Sons Ltd.
Czech Academy of Sciences Publication Activity Database
Rozložník, Miroslav; Okulicka-Dłużewska, F.; Smoktunowicz, A.
2015-01-01
Roč. 36, č. 2 (2015), s. 727-751 ISSN 0895-4798 R&D Projects: GA ČR(CZ) GAP108/11/0853 Institutional support: RVO:67985807 Keywords : symmetric indefinite matrices * Cholesky-like factorization * orthogonalization techniques * indefinite bilinear forms * Gram-Schmidt process * rounding error analysis Subject RIV: BA - General Mathematics Impact factor: 1.883, year: 2015
Ververis, J; Ku, L; Delafontaine, P
1994-02-01
Insulin-like growth factor I is an important mitogen for vascular smooth muscle cells, and its effects are regulated by several binding proteins. Western ligand blotting of conditioned medium from rat aortic smooth muscle cells detected a 24 kDa binding protein and a 28 kDa glycosylated variant of this protein, consistent with insulin-like growth factor binding protein-4 by size. Low amounts of a glycosylated 38 to 42 kDa doublet (consistent with binding protein-3) and a 31 kDa non-glycosylated protein also were present. Basic fibroblast growth factor markedly increased secretion of the 24 kDa binding protein and its 28 kDa glycosylated variant. This effect was dose- and time-dependent and was inhibited by co-incubation with cycloheximide. Crosslinking of [125I]-insulin-like growth factor I to cell monolayers revealed no surface-associated binding proteins, either basally or after agonist treatment. Induction of binding protein production by fibroblast growth factor at sites of vascular injury may be important in vascular proliferative responses in vivo.
Hepatoma-derived growth factor-related protein-3 is a novel angiogenic factor.
Directory of Open Access Journals (Sweden)
Michelle E LeBlanc
Full Text Available Hepatoma-derived growth factor-related protein-3 (Hdgfrp3 or HRP-3 was recently reported as a neurotrophic factor and is upregulated in hepatocellular carcinoma to promote cancer cell survival. Here we identified HRP-3 as a new endothelial ligand and characterized its in vitro and in vivo functional roles and molecular signaling. We combined open reading frame phage display with multi-round in vivo binding selection to enrich retinal endothelial ligands, which were systematically identified by next generation DNA sequencing. One of the identified endothelial ligands was HRP-3. HRP-3 expression in the retina and brain was characterized by Western blot and immunohistochemistry. Cell proliferation assay showed that HRP-3 stimulated the growth of human umbilical vein endothelial cells (HUVECs. HRP-3 induced tube formation of HUVECs in culture. Wound healing assay indicated that HRP-3 promoted endothelial cell migration. HRP-3 was further confirmed for its in vitro angiogenic activity by spheroid sprouting assay. HRP-3 extrinsically activated the extracellular-signal-regulated kinase ½ (ERK1/2 pathway in endothelial cells. The angiogenic activity of HRP-3 was independently verified by mouse cornea pocket assay. Furthermore, in vivo Matrigel plug assay corroborated HRP-3 activity to promote new blood vessel formation. These results demonstrated that HRP-3 is a novel angiogenic factor.
International Nuclear Information System (INIS)
Dietz, T.M.; Koch, T.H.
1987-01-01
Direct irradiation of 5-bromouracil (BU) in aqueous fluid solution in the presence of tryptophan (trp), tyrosine (tyr) or histidine (his) derivatives using a XeCl excimer laser at 308 nm yielded photocoupling of BU to the aromatic ring of each amino acid. Irradiation of BU at 308 nm most likely results in excitation of the n-π* transition, intersystem crossing to the triplet manifold, and coupling via electron transfer from the aromatic amino acid. The coupling observed was regiospecific between the 5-position of uracil (U) and the 2-position of the indole and phenol rings and the 5-position of the imidazole ring of the respective amino acids. Quantum yields of photocoupling to BU ranged from 1 x 10 -3 to 7 x 10 -3 and paralleled known rates of electron transfer and ionization potentials of the aromatic rings. The photocoupling between BU and some of the aromatic amino acid peptide-like derivatives possibly mimics photocrosslinking of BU-DNA to associated proteins, a potentially useful photoreaction for studying nucleic acid-protein interactions. Formation of crosslinks of the type proposed here might be detected by the characteristic fluorescence emission of the uracil amino acid adducts. (author)
International Nuclear Information System (INIS)
Fujiwara, Tohru; Okamoto, Koji; Niikuni, Ryoyu; Takahashi, Kiwamu; Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi; Ishizawa, Kenichi; Ichinohasama, Ryo; Nakamura, Yukio; Nakajima, Motowo; Tanaka, Tohru; Harigae, Hideo
2014-01-01
Highlights: • Treatment with ALA induces erythroid differentiation of K562 cells. • Transportation of ALA into erythroid cells occurs predominantly via SLC36A1. • ALA restores defects in ALAS2 in human iPS cell-derived erythroblasts. • ALA may represent a novel therapeutic option for CSA caused by ALAS2 mutations. - Abstract: Congenital sideroblastic anemia (CSA) is a hereditary disorder characterized by microcytic anemia and bone marrow sideroblasts. The most common form of CSA is attributed to mutations in the X-linked gene 5-aminolevulinic acid synthase 2 (ALAS2). ALAS2 is a mitochondrial enzyme, which utilizes glycine and succinyl-CoA to form 5-aminolevulinic acid (ALA), a crucial precursor in heme synthesis. Therefore, ALA supplementation could be an effective therapeutic strategy to restore heme synthesis in CSA caused by ALAS2 defects. In a preclinical study, we examined the effects of ALA in human erythroid cells, including K562 cells and human induced pluripotent stem cell-derived erythroid progenitor (HiDEP) cells. ALA treatment resulted in significant dose-dependent accumulation of heme in the K562 cell line. Concomitantly, the treatment substantially induced erythroid differentiation as assessed using benzidine staining. Quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis confirmed significant upregulation of heme-regulated genes, such as the globin genes [hemoglobin alpha (HBA) and hemoglobin gamma (HBG)] and the heme oxygenase 1 (HMOX1) gene, in K562 cells. Next, to investigate the mechanism by which ALA is transported into erythroid cells, quantitative RT-PCR analysis was performed on previously identified ALA transporters, including solute carrier family 15 (oligopeptide transporter), member (SLC15A) 1, SLC15A2, solute carrier family 36 (proton/amino acid symporter), member (SLC36A1), and solute carrier family 6 (neurotransmitter transporter), member 13 (SLC6A13). Our analysis revealed that SLC36A1 was abundantly
Energy Technology Data Exchange (ETDEWEB)
Fujiwara, Tohru [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Department of Molecular Hematology/Oncology, Tohoku University Graduate School, Sendai (Japan); Okamoto, Koji; Niikuni, Ryoyu [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Takahashi, Kiwamu [SBI Pharmaceuticals Co., Ltd., Tokyo (Japan); Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Ishizawa, Kenichi [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Clinical Research, Innovation and Education Center, Tohoku University Hospital, Sendai (Japan); Ichinohasama, Ryo [Department of Hematopathology, Tohoku University Graduate School, Sendai (Japan); Nakamura, Yukio [Cell Engineering Division, RIKEN BioResource Center, Tsukuba, Ibaraki (Japan); Nakajima, Motowo; Tanaka, Tohru [SBI Pharmaceuticals Co., Ltd., Tokyo (Japan); Harigae, Hideo, E-mail: harigae@med.tohoku.ac.jp [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Department of Molecular Hematology/Oncology, Tohoku University Graduate School, Sendai (Japan)
2014-11-07
Highlights: • Treatment with ALA induces erythroid differentiation of K562 cells. • Transportation of ALA into erythroid cells occurs predominantly via SLC36A1. • ALA restores defects in ALAS2 in human iPS cell-derived erythroblasts. • ALA may represent a novel therapeutic option for CSA caused by ALAS2 mutations. - Abstract: Congenital sideroblastic anemia (CSA) is a hereditary disorder characterized by microcytic anemia and bone marrow sideroblasts. The most common form of CSA is attributed to mutations in the X-linked gene 5-aminolevulinic acid synthase 2 (ALAS2). ALAS2 is a mitochondrial enzyme, which utilizes glycine and succinyl-CoA to form 5-aminolevulinic acid (ALA), a crucial precursor in heme synthesis. Therefore, ALA supplementation could be an effective therapeutic strategy to restore heme synthesis in CSA caused by ALAS2 defects. In a preclinical study, we examined the effects of ALA in human erythroid cells, including K562 cells and human induced pluripotent stem cell-derived erythroid progenitor (HiDEP) cells. ALA treatment resulted in significant dose-dependent accumulation of heme in the K562 cell line. Concomitantly, the treatment substantially induced erythroid differentiation as assessed using benzidine staining. Quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis confirmed significant upregulation of heme-regulated genes, such as the globin genes [hemoglobin alpha (HBA) and hemoglobin gamma (HBG)] and the heme oxygenase 1 (HMOX1) gene, in K562 cells. Next, to investigate the mechanism by which ALA is transported into erythroid cells, quantitative RT-PCR analysis was performed on previously identified ALA transporters, including solute carrier family 15 (oligopeptide transporter), member (SLC15A) 1, SLC15A2, solute carrier family 36 (proton/amino acid symporter), member (SLC36A1), and solute carrier family 6 (neurotransmitter transporter), member 13 (SLC6A13). Our analysis revealed that SLC36A1 was abundantly
Krüppel-like factors: Three fingers in control
Directory of Open Access Journals (Sweden)
Swamynathan Shivalingappa K
2010-04-01
Full Text Available Abstract Krüppel-like factors (KLFs, members of the zinc-finger family of transcription factors capable of binding GC-rich sequences, have emerged as critical regulators of important functions all over the body. They are characterised by a highly conserved C-terminal DNA-binding motif containing three C2H2 zinc-finger domains, with variable N-terminal regulatory domains. Currently, there are 17 KLFs annotated in the human genome. In spite of their structural similarity to one another, the genes encoding different KLFs are scattered all over the genome. By virtue of their ability to activate and/or repress the expression of a large number of genes, KLFs regulate a diverse array of developmental events and cellular processes, such as erythropoiesis, cardiac remodelling, adipogenesis, maintenance of stem cells, epithelial barrier formation, control of cell proliferation and neoplasia, flow-mediated endothelial gene expression, skeletal and smooth muscle development, gluconeogenesis, monocyte activation, intestinal and conjunctival goblet cell development, retinal neuronal regeneration and neonatal lung development. Characteristic features, nomenclature, evolution and functional diversities of the human KLFs are reviewed here.
Krüppel-like factors: three fingers in control.
Swamynathan, Shivalingappa K
2010-04-01
Krüppel-like factors (KLFs), members of the zinc-finger family of transcription factors capable of binding GC-rich sequences, have emerged as critical regulators of important functions all over the body. They are characterised by a highly conserved C-terminal DNA-binding motif containing three C2H2 zinc-finger domains, with variable N-terminal regulatory domains. Currently, there are 17 KLFs annotated in the human genome. In spite of their structural similarity to one another, the genes encoding different KLFs are scattered all over the genome. By virtue of their ability to activate and/or repress the expression of a large number of genes, KLFs regulate a diverse array of developmental events and cellular processes, such as erythropoiesis, cardiac remodelling, adipogenesis, maintenance of stem cells, epithelial barrier formation, control of cell proliferation and neoplasia, flow-mediated endothelial gene expression, skeletal and smooth muscle development, gluconeogenesis, monocyte activation, intestinal and conjunctival goblet cell development, retinal neuronal regeneration and neonatal lung development. Characteristic features, nomenclature, evolution and functional diversities of the human KLFs are reviewed here.
Zhou, Xiangyang; Chen, Sanmei; Yang, Juan; Bai, Tao; Ren, Yongpeng; Tian, Hangyu
2017-04-26
A facile process is developed to prepare SnO 2 -based composites through using metal-organic frameworks (MOFs) as precursors. The nitrogen-doped graphene wrapped okra-like SnO 2 composites (SnO 2 @N-RGO) are successfully synthesized for the first time by using Sn-based metal-organic frameworks (Sn-MOF) as precursors. When utilized as an anode material for lithium-ion batteries, the SnO 2 @N-RGO composites possess a remarkably superior reversible capacity of 1041 mA h g -1 at a constant current of 200 mA g -1 after 180 charge-discharge processes and excellent rate capability. The excellent performance can be primarily ascribed to the unique structure of 1D okra-like SnO 2 in SnO 2 @N-RGO which are actually composed of a great number of SnO 2 primary crystallites and numerous well-defined internal voids, can effectively alleviate the huge volume change of SnO 2 , and facilitate the transport and storage of lithium ions. Besides, the structural stability acquires further improvement when the okra-like SnO 2 are wrapped by N-doped graphene. Similarly, this synthetic strategy can be employed to synthesize other high-capacity metal-oxide-based composites starting from various metal-organic frameworks, exhibiting promising application in novel electrode material field of lithium-ion batteries.
Insulin like growth factor 2 regulation of aryl hydrocarbon receptor in MCF-7 breast cancer cells
International Nuclear Information System (INIS)
Tomblin, Justin K.; Salisbury, Travis B.
2014-01-01
Highlights: •IGF-2 stimulates concurrent increases in AHR and CCND1 expression. •IGF-2 promotes the binding of AHR to the endogenous cyclin D1 promoter. •AHR knockdown inhibits IGF-2 stimulated increases in CCND1 mRNA and protein. •AHR knockdown inhibits IGF-2 stimulated increases in MCF-7 proliferation. -- Abstract: Insulin like growth factor (IGF)-1 and IGF-2 stimulate normal growth, development and breast cancer cell proliferation. Cyclin D1 (CCND1) promotes cell cycle by inhibiting retinoblastoma protein (RB1). The aryl hydrocarbon receptor (AHR) is a major xenobiotic receptor that also regulates cell cycle. The purpose of this study was to investigate whether IGF-2 promotes MCF-7 breast cancer proliferation by inducing AHR. Western blot and quantitative real time PCR (Q-PCR) analysis revealed that IGF-2 induced an approximately 2-fold increase (P < .001) in the expression of AHR and CCND1. Chromatin immunoprecipitation (ChIP), followed by Q-PCR indicated that IGF-2 promoted (P < .001) a 7-fold increase in AHR binding on the CCND1 promoter. AHR knockdown significantly (P < .001) inhibited IGF-2 stimulated increases in CCND1 mRNA and protein. AHR knockdown cells were less (P < .001) responsive to the proliferative effects of IGF-2 than control cells. Collectively, our findings have revealed a new regulatory mechanism by which IGF-2 induction of AHR promotes the expression of CCND1 and the proliferation of MCF-7 cells. This previously uncharacterized pathway could be important for the proliferation of IGF responsive cancer cells that also express AHR
Insulin like growth factor 2 regulation of aryl hydrocarbon receptor in MCF-7 breast cancer cells
Energy Technology Data Exchange (ETDEWEB)
Tomblin, Justin K.; Salisbury, Travis B., E-mail: salisburyt@marshall.edu
2014-01-17
Highlights: •IGF-2 stimulates concurrent increases in AHR and CCND1 expression. •IGF-2 promotes the binding of AHR to the endogenous cyclin D1 promoter. •AHR knockdown inhibits IGF-2 stimulated increases in CCND1 mRNA and protein. •AHR knockdown inhibits IGF-2 stimulated increases in MCF-7 proliferation. -- Abstract: Insulin like growth factor (IGF)-1 and IGF-2 stimulate normal growth, development and breast cancer cell proliferation. Cyclin D1 (CCND1) promotes cell cycle by inhibiting retinoblastoma protein (RB1). The aryl hydrocarbon receptor (AHR) is a major xenobiotic receptor that also regulates cell cycle. The purpose of this study was to investigate whether IGF-2 promotes MCF-7 breast cancer proliferation by inducing AHR. Western blot and quantitative real time PCR (Q-PCR) analysis revealed that IGF-2 induced an approximately 2-fold increase (P < .001) in the expression of AHR and CCND1. Chromatin immunoprecipitation (ChIP), followed by Q-PCR indicated that IGF-2 promoted (P < .001) a 7-fold increase in AHR binding on the CCND1 promoter. AHR knockdown significantly (P < .001) inhibited IGF-2 stimulated increases in CCND1 mRNA and protein. AHR knockdown cells were less (P < .001) responsive to the proliferative effects of IGF-2 than control cells. Collectively, our findings have revealed a new regulatory mechanism by which IGF-2 induction of AHR promotes the expression of CCND1 and the proliferation of MCF-7 cells. This previously uncharacterized pathway could be important for the proliferation of IGF responsive cancer cells that also express AHR.
Czech Academy of Sciences Publication Activity Database
Macháčková, Kateřina; Chrudinová, Martina; Radosavljević, Jelena; Potalitsyn, Pavlo; Křížková, Květoslava; Fábry, Milan; Selicharová, Irena; Collinsová, Michaela; Brzozowski, A. M.; Žáková, Lenka; Jiráček, Jiří
2018-01-01
Roč. 57, č. 16 (2018), s. 2373-2382 ISSN 0006-2960 R&D Projects: GA ČR GA15-19018S Institutional support: RVO:61388963 ; RVO:68378050 Keywords : insulin-like growth factor * insulin * receptor * analog Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 2.938, year: 2016 https://pubs.acs.org/doi/10.1021/acs.biochem.7b01260
H19 RNA binds four molecules of insulin-like growth factor II mRNA-binding protein
DEFF Research Database (Denmark)
Runge, Steffen; Nielsen, Finn Cilius; Nielsen, Jacob
2000-01-01
H19 RNA is a major oncofetal 2.5-kilobase untranslated RNA of unknown function. The maternally expressed H19 gene is located 90 kilobase pairs downstream from the paternally expressed insulin-like growth factor II (IGF-II) gene on human chromosome 11 and mouse chromosome 7; and due to their recip......H19 RNA is a major oncofetal 2.5-kilobase untranslated RNA of unknown function. The maternally expressed H19 gene is located 90 kilobase pairs downstream from the paternally expressed insulin-like growth factor II (IGF-II) gene on human chromosome 11 and mouse chromosome 7; and due...
Sharma, Ruchi; George, Aman; Kamble, Nitin M; Chauhan, Manmohan S; Singla, Suresh; Manik, Radhey S; Palta, Prabhat
2012-01-01
The present study examined the expression profile of buffalo fetal fibroblasts (BFF) used as a feeder layer for embryonic stem (ES) cell-like cells. The expression of important growth factors was detected in cells at different passages. Mitomycin-C inactivation increased relative expression levels of ACTIVIN-A, TGF-β1, BMP-4 and GREMLIN but not of fibroblast growth factor-2 (FGF-2). The expression level of ACTIVIN-A, transforming growth factor-β1 (TGF-β1), bone morphogenetic protein-4 (BMP-4) and FGF-2 was similar in buffalo fetal fibroblast (BFF) cultured in stem cell medium (SCM), SCM+1000IU mL(-1) leukemia inhibitory factor (LIF), SCM+5 ngmL(-1) FGF-2 or SCM+LIF+FGF-2 for 24 h whereas GREMLIN expression was higher in FGF-2-supplemented groups. In spent medium, the concentration of ACTIVIN-A was higher in FGF-2-supplemented groups whereas that of TGF-β1 was similar in SCM and LIF+FGF-2, which was higher than when either LIF or FGF-2 was used alone. Following culture of ES cell-like cells on a feeder layer for 24 h, the TGF-β1 concentration was higher with LIF+FGF-2 than with LIF or FGF-2 alone which, in turn, was higher than that in SCM. In the LIF+FGF-2 group, the concentration of TGF-β1 was lower and that of ACTIVIN-A was higher in spent medium at 24 h than at 48 h of culture. These results suggest that BFF produce signalling molecules that may help in self-renewal of buffalo ES cell-like cells.
Directory of Open Access Journals (Sweden)
Xingguo Zhu
Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.
Yamashita, Yasunobu; Ueyama, Takashi; Nishi, Toshio; Yamamoto, Yuta; Kawakoshi, Akatsuki; Sunami, Shogo; Iguchi, Mikitaka; Tamai, Hideyuki; Ueda, Kazuki; Ito, Takao; Tsuruo, Yoshihiro; Ichinose, Masao
2014-01-01
Lansoprazole is a potent anti-gastric ulcer drug that inhibits gastric proton pump activity. We identified a novel function for lansoprazole, as an inducer of anti-oxidative stress responses in the liver. Gastric administration of lansoprazole (10-100 mg/kg) to male Wistar rats produced a dose-dependent increase in hepatic mRNA levels of nuclear factor, erythroid-derived 2, -like 2 (Nrf2), a redox-sensitive transcription factor, at 3 h and Nrf2 immunoreactivity (IR) in whole hepatic lysates at 6 h. Conversely, the levels of Kelch-like ECH-associated protein (Keap1), which sequesters Nrf2 in the cytoplasm under un-stimulated conditions, were unchanged. Translocation of Nrf2 into the nuclei of hepatocytes was observed using western blotting and immunohistochemistry. Expression of mRNAs for Nrf2-dependent antioxidant and phase II enzymes, such as heme oxygenase 1 (HO-1), NAD (P) H dehydrogenase, quinone 1 (Nqo1), glutathione S-transferase A2 (Gsta2), UDP glucuronosyltransferase 1 family polypeptide A6 (Ugt1a6), were dose-dependently up-regulated at 3 h. Furthermore, the levels of HO-1 IR were dose-dependently increased in hepatocytes at 6 h. Subcutaneous administration of lansoprazole (30 mg/kg/day) for 7 successive days resulted in up-regulation and nuclear translocation of Nrf2 IR in hepatocytes and up-regulation of HO-1 IR in the liver. Pretreatment with lansoprazole attenuated thioacetamide (500 mg/kg)-induced acute hepatic damage via both HO-1-dependent and -independent pathways. Up-stream networks related to Nrf2 expression were investigated using microarray analysis, followed by data mining with Ingenuity Pathway Analysis. Up-regulation of the aryl hydrocarbon receptor (AhR)-cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1) pathway was associated with up-regulation of Nrf2 mRNA. In conclusion, lansoprazole might have an alternative indication in the prevention and treatment of oxidative hepatic damage through the induction of both phase I and phase
Yamashita, Yasunobu; Ueyama, Takashi; Nishi, Toshio; Yamamoto, Yuta; Kawakoshi, Akatsuki; Sunami, Shogo; Iguchi, Mikitaka; Tamai, Hideyuki; Ueda, Kazuki; Ito, Takao; Tsuruo, Yoshihiro; Ichinose, Masao
2014-01-01
Lansoprazole is a potent anti-gastric ulcer drug that inhibits gastric proton pump activity. We identified a novel function for lansoprazole, as an inducer of anti-oxidative stress responses in the liver. Gastric administration of lansoprazole (10–100 mg/kg) to male Wistar rats produced a dose-dependent increase in hepatic mRNA levels of nuclear factor, erythroid-derived 2, -like 2 (Nrf2), a redox-sensitive transcription factor, at 3 h and Nrf2 immunoreactivity (IR) in whole hepatic lysates at 6 h. Conversely, the levels of Kelch-like ECH-associated protein (Keap1), which sequesters Nrf2 in the cytoplasm under un-stimulated conditions, were unchanged. Translocation of Nrf2 into the nuclei of hepatocytes was observed using western blotting and immunohistochemistry. Expression of mRNAs for Nrf2-dependent antioxidant and phase II enzymes, such as heme oxygenase 1 (HO-1), NAD (P) H dehydrogenase, quinone 1 (Nqo1), glutathione S-transferase A2 (Gsta2), UDP glucuronosyltransferase 1 family polypeptide A6 (Ugt1a6), were dose-dependently up-regulated at 3 h. Furthermore, the levels of HO-1 IR were dose-dependently increased in hepatocytes at 6 h. Subcutaneous administration of lansoprazole (30 mg/kg/day) for 7 successive days resulted in up-regulation and nuclear translocation of Nrf2 IR in hepatocytes and up-regulation of HO-1 IR in the liver. Pretreatment with lansoprazole attenuated thioacetamide (500 mg/kg)-induced acute hepatic damage via both HO-1-dependent and -independent pathways. Up-stream networks related to Nrf2 expression were investigated using microarray analysis, followed by data mining with Ingenuity Pathway Analysis. Up-regulation of the aryl hydrocarbon receptor (AhR)-cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1) pathway was associated with up-regulation of Nrf2 mRNA. In conclusion, lansoprazole might have an alternative indication in the prevention and treatment of oxidative hepatic damage through the induction of both phase I and
Safety of recombinant human platelet-derived growth factor-BB in Augment® Bone Graft
Directory of Open Access Journals (Sweden)
Luis A Solchaga
2012-12-01
Full Text Available This article discusses nonclinical and clinical data regarding the safety of recombinant human platelet-derived growth factor-BB as a component of the Augment® Bone Graft (Augment. Augment is a bone graft substitute intended to be used as an alternative to autologous bone graft in the fusion of hindfoot and ankle joints. Nonclinical studies included assessment of the pharmacokinetic profile of intravenously administered recombinant human platelet-derived growth factor-BB in rat and dog, effects of intravenous administration of recombinant human platelet-derived growth factor-BB in a reproductive and development toxicity study in rats, and chronic toxicity and carcinogenicity of Augment in a 12-month implantation model. These studies showed that systemic exposure was brief and clearance was rapid. No signs of toxicity, carcinogenicity, or tumor promotion were observed even with doses far exceeding the maximum clinical dose. Results of clinical trials (605 participants and commercial use of recombinant human platelet-derived growth factor-BB containing products indicate that these products are not associated with increased incidence of adverse events or cancer. The safety data presented provide evidence that recombinant human platelet-derived growth factor-BB is a safe therapeutic when used in combination products as a single administration during surgical procedures for bone repair and fusion. There is no evidence associating use of recombinant human platelet-derived growth factor-BB in Augment with chronic toxicity, carcinogenicity, or tumor promotion.
International Nuclear Information System (INIS)
Tobón-Velasco, Julio C.; Limón-Pacheco, Jorge H.; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F.
2013-01-01
6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage
Nrf2 protects against airway disorders
International Nuclear Information System (INIS)
Cho, Hye-Youn; Kleeberger, Steven R.
2010-01-01
Nuclear factor-erythroid 2 related factor 2 (Nrf2) is a ubiquitous master transcription factor that regulates antioxidant response elements (AREs)-mediated expression of antioxidant enzyme and cytoprotective proteins. In the unstressed condition, Kelch-like ECH-associated protein 1 (Keap1) suppresses cellular Nrf2 in cytoplasm and drives its proteasomal degradation. Nrf2 can be activated by diverse stimuli including oxidants, pro-oxidants, antioxidants, and chemopreventive agents. Nrf2 induces cellular rescue pathways against oxidative injury, abnormal inflammatory and immune responses, apoptosis, and carcinogenesis. Application of Nrf2 germ-line mutant mice has identified an extensive range of protective roles for Nrf2 in experimental models of human disorders in the liver, gastrointestinal tract, airway, kidney, brain, circulation, and immune or nerve system. In the lung, lack of Nrf2 exacerbated toxicity caused by multiple oxidative insults including supplemental respiratory therapy (e.g., hyperoxia, mechanical ventilation), cigarette smoke, allergen, virus, bacterial endotoxin and other inflammatory agents (e.g., carrageenin), environmental pollution (e.g., particles), and a fibrotic agent bleomycin. Microarray analyses and bioinformatic studies elucidated functional AREs and Nrf2-directed genes that are critical components of signaling mechanisms in pulmonary protection by Nrf2. Association of loss of function with promoter polymorphisms in NRF2 or somatic and epigenetic mutations in KEAP1 and NRF2 has been found in cohorts of patients with acute lung injury/acute respiratory distress syndrome or lung cancer, which further supports the role for NRF2 in these lung diseases. In the current review, we address the role of Nrf2 in airways based on emerging evidence from experimental oxidative disease models and human studies.
Park, Kyeong Seon; Kwak, SooHeon; Cho, Young Min; Park, Kyong Soo; Jang, Hak C; Kim, Seong Yeon; Jung, Hye Seung
2017-03-01
Dipeptidyl peptidase-4 inhibitors might have pleiotropic protective effects on cardiovascular disease (CVD), in contrast to sulfonylureas. Therefore, we compared various CVD risk factors between vildagliptin and glimepiride. We carried out a randomized, prospective and crossover trial. A total of 16 patients with type 2 diabetes whose glycated hemoglobin was >7% were randomized to add vildagliptin or glimepiride. After 12-week treatment, each drug was replaced with the other for another 12 weeks. Before and after each treatment, glucose homeostasis and CVD risk factors were assessed, and the continuous glucose monitoring system was applied to calculate glycemic variability. The mean age of the participants was 60 years, 31% were men, body mass index 25.5 kg/m 2 and HbA1c 8.41%. Both vildagliptin and glimepiride significantly decreased glycated hemoglobin and glycemic variability indices. Despite the improved glucose homeostasis, favorable change of CVD markers was not prominent in both the arms, along with significant weight gain. Only plasma stromal cell-derived factor (SDF)-1α decreased by 30% in the vildagliptin arm. According to regression analyses, the reduction of SDF-1α was independently associated with vildagliptin usage and serum interleukin-6 changes, but white blood cells were not related with the SDF-1α changes. Compared with glimepiride, vildagliptin arrestingly decreased plasma SDF-1α, and its clinical implications should be further investigated. © 2016 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.
Directory of Open Access Journals (Sweden)
Xiaoxia Zhu
2014-01-01
Full Text Available Xiao Yao San (XYS is a classical Chinese medicine formula that has been widely used to treat mood disorders for hundreds of years. To confirm the effect of XYS and better understand its underlying mechanism, high-performance liquid chromatography-mass spectrometry analysis-based quality control of XYS extracts and proteomics-based identification of differential proteins in the hippocampus were adopted in social isolation and chronic unpredictable mild stress- (CUMS- treated rats. The depressive-like behavior of rats induced by CUMS resembled the manifestation of human depression. The upregulated corticosterone (CORT and urocortin 2 (UCN2 levels demonstrated the existence of hypothalamic-pituitary-adrenal (HPA axis hyperactivity. XYS was effective in ameliorating the depressive-like behavior and downregulating UCN2 and CORT. XYS decreased the expression of serine/threonine-protein phosphatase 2A subunit B and increased the expression of β-arrestin 2. The expressions of brain-derived neurotrophic factor (BDNF, tyrosine receptor kinase B (TrkB, and mammalian target of rapamycin (mTOR were also elevated by XYS. In conclusion, XYS improves social isolation and CUMS-induced depressive-like behavior and ameliorates HPA hyperactivation through the downregulation of corticotrophin releasing hormone (CRH receptor 2. The upregulation of BDNF/TrkB and the phosphorylation of mTOR require β-arrestin 2 as a scaffold to regulate stress signaling.
Liu, Yi; Shi, Zi; Maximova, Siela N; Payne, Mark J; Guiltinan, Mark J
2015-06-25
The flavan-3-ols catechin and epicatechin, and their polymerized oligomers, the proanthocyanidins (PAs, also called condensed tannins), accumulate to levels of up to 15 % of the total weight of dry seeds of Theobroma cacao L. These compounds have been associated with several health benefits in humans. They also play important roles in pest and disease defense throughout the plant. In Arabidopsis, the R2R3 type MYB transcription factor TT2 regulates the major genes leading to the synthesis of PA. To explore the transcriptional regulation of the PA synthesis pathway in cacao, we isolated and characterized an R2R3 type MYB transcription factor MYBPA from cacao. We examined the spatial and temporal gene expression patterns of the Tc-MYBPA gene and found it to be developmentally expressed in a manner consistent with its involvement in PAs and anthocyanin synthesis. Functional complementation of an Arabidopsis tt2 mutant with Tc-MYBPA suggested that it can functionally substitute the Arabidopsis TT2 gene. Interestingly, in addition to PA accumulation in seeds of the Tc-MYBPA expressing plants, we also observed an obvious increase of anthocyanidin accumulation in hypocotyls. We observed that overexpression of the Tc-MYBPA gene resulted in increased expression of several key genes encoding the major structural enzymes of the PA and anthocyanidin pathway, including DFR (dihydroflavanol reductase), LDOX (leucoanthocyanidin dioxygenase) and BAN (ANR, anthocyanidin reductase). We conclude that the Tc-MYBPA gene that encodes an R2R3 type MYB transcription factor is an Arabidopsis TT2 like transcription factor, and may be involved in the regulation of both anthocyanin and PA synthesis in cacao. This research may provide molecular tools for breeding of cacao varieties with improved disease resistance and enhanced flavonoid profiles for nutritional and pharmaceutical applications.
Lang, Charles H; Frost, Robert A
2002-05-01
The erosion of lean body mass resulting from protracted critical illness remains a significant risk factor for increased morbidity and mortality in this patient population. Previous studies have documented the well known impairment in nitrogen balance results from both an increase in muscle protein degradation as well as a decreased rate of both myofibrillar and sacroplasmic protein synthesis. This protein imbalance may be caused by an increased presence or activity of various catabolic agents, such as tumor necrosis factor-alpha, interleukin-1 beta, interleukin-6 or glucocorticoids, or may be mediated via a decreased concentration or responsiveness to various anabolic hormones, such as growth hormone or insulin-like growth factor-I. This review focuses on recent developments pertaining to the importance of alterations in the growth hormone-insulin-like growth factor-I axis as a mechanism for the observed defects in muscle protein balance.
Energy Technology Data Exchange (ETDEWEB)
Raman, Dayanidhi; Milatovic, Snjezana-Zaja [Department of Cancer Biology, Vanderbilt University, School of Medicine, Nashville, TN 37232 (United States); Milatovic, Dejan [Department of Pediatrics/Pediatric Toxicology, Vanderbilt University, School of Medicine, Nashville, TN 37232 (United States); Splittgerber, Ryan [Department of Cancer Biology, Vanderbilt University, School of Medicine, Nashville, TN 37232 (United States); Fan, Guo-Huang [Department of Neurobiology and Neurotoxicology, Meharry Medical College, Nashville, TN 37221 (United States); Richmond, Ann, E-mail: ann.richmond@vanderbilt.edu [VA Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, School of Medicine, Nashville, TN 37232 (United States)
2011-11-15
Alzheimer's disease (AD) is characterized by a progressive cognitive decline and accumulation of neurotoxic oligomeric peptides amyloid-{beta} (A{beta}). Although the molecular events are not entirely known, it has become evident that inflammation, environmental and other risk factors may play a causal, disruptive and/or protective role in the development of AD. The present study investigated the ability of the chemokines, macrophage inflammatory protein-2 (MIP-2) and stromal cell-derived factor-1{alpha} (SDF-1{alpha}), the respective ligands for chemokine receptors CXCR2 and CXCR4, to suppress A{beta}-induced neurotoxicity in vitro and in vivo. Pretreatment with MIP-2 or SDF-1{alpha} significantly protected neurons from A{beta}-induced dendritic regression and apoptosis in vitro through activation of Akt, ERK1/2 and maintenance of metalloproteinase ADAM17 especially with SDF-1{alpha}. Intra-cerebroventricular (ICV) injection of A{beta} led to reduction in dendritic length and spine density of pyramidal neurons in the CA1 area of the hippocampus and increased oxidative damage 24 h following the exposure. The A{beta}-induced morphometric changes of neurons and increase in biomarkers of oxidative damage, F{sub 2}-isoprostanes, were significantly inhibited by pretreatment with the chemokines MIP-2 or SDF-1{alpha}. Additionally, MIP-2 or SDF-1{alpha} was able to suppress the aberrant mislocalization of p21-activated kinase (PAK), one of the proteins involved in the maintenance of dendritic spines. Furthermore, MIP-2 also protected neurons against A{beta} neurotoxicity in CXCR2-/- mice, potentially through observed up regulation of CXCR1 mRNA. Understanding the neuroprotective potential of chemokines is crucial in defining the role for their employment during the early stages of neurodegeneration. -- Research highlights: Black-Right-Pointing-Pointer Neuroprotective ability of the chemokines MIP2 and CXCL12 against A{beta} toxicity. Black-Right-Pointing-Pointer MIP
International Nuclear Information System (INIS)
Raman, Dayanidhi; Milatovic, Snjezana-Zaja; Milatovic, Dejan; Splittgerber, Ryan; Fan, Guo-Huang; Richmond, Ann
2011-01-01
Alzheimer's disease (AD) is characterized by a progressive cognitive decline and accumulation of neurotoxic oligomeric peptides amyloid-β (Aβ). Although the molecular events are not entirely known, it has become evident that inflammation, environmental and other risk factors may play a causal, disruptive and/or protective role in the development of AD. The present study investigated the ability of the chemokines, macrophage inflammatory protein-2 (MIP-2) and stromal cell-derived factor-1α (SDF-1α), the respective ligands for chemokine receptors CXCR2 and CXCR4, to suppress Aβ-induced neurotoxicity in vitro and in vivo. Pretreatment with MIP-2 or SDF-1α significantly protected neurons from Aβ-induced dendritic regression and apoptosis in vitro through activation of Akt, ERK1/2 and maintenance of metalloproteinase ADAM17 especially with SDF-1α. Intra-cerebroventricular (ICV) injection of Aβ led to reduction in dendritic length and spine density of pyramidal neurons in the CA1 area of the hippocampus and increased oxidative damage 24 h following the exposure. The Aβ-induced morphometric changes of neurons and increase in biomarkers of oxidative damage, F 2 -isoprostanes, were significantly inhibited by pretreatment with the chemokines MIP-2 or SDF-1α. Additionally, MIP-2 or SDF-1α was able to suppress the aberrant mislocalization of p21-activated kinase (PAK), one of the proteins involved in the maintenance of dendritic spines. Furthermore, MIP-2 also protected neurons against Aβ neurotoxicity in CXCR2−/− mice, potentially through observed up regulation of CXCR1 mRNA. Understanding the neuroprotective potential of chemokines is crucial in defining the role for their employment during the early stages of neurodegeneration. -- Research highlights: ► Neuroprotective ability of the chemokines MIP2 and CXCL12 against Aβ toxicity. ► MIP-2 or CXCL12 prevented dendritic regression and apoptosis in vitro. ► Neuroprotection through activation of Akt, ERK
Directory of Open Access Journals (Sweden)
Jong Hun Lee
2013-01-01
Full Text Available Excessive oxidative stress induced by reactive oxygen species (ROS, reactive nitrogen species (RNS, and reactive metabolites of carcinogens alters cellular homeostasis, leading to genetic/epigenetic changes, genomic instability, neoplastic transformation, and cancer initiation/progression. As a protective mechanism against oxidative stress, antioxidant/detoxifying enzymes reduce these reactive species and protect normal cells from endo-/exogenous oxidative damage. The transcription factor nuclear factor-erythroid 2 p45 (NF-E2-related factor 2 (Nrf2, a master regulator of the antioxidative stress response, plays a critical role in the expression of many cytoprotective enzymes, including NAD(PH:quinine oxidoreductase (NQO1, heme oxygenase-1 (HO-1, UDP-glucuronosyltransferase (UGT, and glutathione S-transferase (GST. Recent studies demonstrated that many dietary phytochemicals derived from various vegetables, fruits, spices, and herbal medicines induce Nrf2-mediated antioxidant/detoxifying enzymes, restore aberrant epigenetic alterations, and eliminate cancer stem cells (CSCs. The Nrf2-mediated antioxidant response prevents many age-related diseases, including cancer. Owing to their fundamental contribution to carcinogenesis, epigenetic modifications and CSCs are novel targets of dietary phytochemicals and traditional Chinese herbal medicine (TCHM. In this review, we summarize cancer chemoprevention by dietary phytochemicals, including TCHM, which have great potential as a safer and more effective strategy for preventing cancer.
Bakir, B; Sari, E K; Aydin, B D; Yildiz, S E
2015-04-01
We investigated using immunohistochemistry the effects of kefir, koumiss and commercial probiotic capsules on the expression of platelet derived growth factor-c (PDGF-C) and platelet derived growth factor receptor-alpha (PDGFR-α) in mouse liver and kidney. Mice were assigned to four groups: group 1 was given commercial probiotic capsules, group 2 was given kefir, group 3 was given koumiss and group 4 was untreated. After oral administration for 15 days, body weights were recorded and liver and kidney tissue samples were obtained. Hematoxylin and eosin staining was used to examine histology. PDGF-C and PDGFR-α in liver and kidney were localized using the streptavidin-biotin peroxidase complex method (ABC). We found that the weights of the mice in the kefir, koumiss and commercial probiotic capsules groups increased compared to the control group. No differences in liver and kidney histology were observed in any of the experimental groups. Kefir, koumiss and the commercial probiotic preparation increased PDGF-C and PDGFR-α expression.
DEFF Research Database (Denmark)
Olesen, Jens L; Heinemeier, Katja M; Haddad, Fadia
2006-01-01
Insulin-like growth factor I (IGF-I) is known to exert an anabolic effect on tendon fibroblast production of collagen. IGF-I's regulation is complex and involves six different IGF binding proteins (IGFBPs). Of these, IGFBP-4 and -5 could potentially influence the effect of IGF-I in the tendon...... because they both are produced in fibroblast; however, the response of IGFBP-4 and -5 to mechanical loading and their role in IGF-I regulation in tendinous tissue are unknown. A splice variant of IGF-I, mechano-growth factor (MGF) is upregulated and known to be important for adaptation in loaded muscle....... However, it is not known whether MGF is expressed and upregulated in mechanically loaded tendon. This study examined the effect of mechanical load on tendon collagen mRNA in relation to changes in the IGF-I systems mRNA expression. Data were collected at 2, 4, 8 and 16 days after surgical removal...
Directory of Open Access Journals (Sweden)
Jung-Tung Liu
2017-01-01
Full Text Available The inflammation and oxidative stress of bone marrow-derived proangiogenic cells (PACs, also named endothelial progenitor cells, triggered by hyperglycemia contributes significantly to vascular dysfunction. There is supporting evidence that the consumption of red yeast rice (RYR; Monascus purpureus-fermented rice reduces the vascular complications of diabetes; however, the underlying mechanism remains unclear. This study aimed to elucidate the effects of RYR extract in PACs, focusing particularly on the role of a potent antioxidative enzyme, heme oxygenase-1 (HO-1. We found that treatment with RYR extract induced nuclear factor erythroid-2-related factor nuclear translocation and HO-1 mRNA and protein levels in PACs. RYR extract inhibited high-glucose-induced (30 mM PAC senescence and the development of reactive oxygen species (ROS in a dose-dependent manner. The HO-1 inducer cobalt protoporphyrin IX also decreased high-glucose-induced cell senescence and oxidative stress, whereas the HO-1 enzyme inhibitor zinc protoporphyrin IX and HO-1 small interfering RNA significantly reversed RYR extract-caused inhibition of senescence and reduction of oxidative stress in high-glucose-treated PACs. These results suggest that RYR extract serves as alternative and complementary medicine in the treatment of these diseases, by inducing HO-1, thereby decreasing the vascular complications of diabetes.
International Nuclear Information System (INIS)
Lund, P.K.; Moats-Staats, B.M.; Hynes, M.A.; Simmons, J.G.; Jansen, M.; D'ercole, A.J.; Van Wyk, J.J.
1986-01-01
Somatomedin-C or insulin-like growth factor I (Sm-C/IGF-I) and insulin-like growth factor II (IGF-II) have been implicated in the regulation of fetal growth and development. In the present study 32 P-labeled complementary DNA probes encoding human and mouse Sm-C/IGF-I and human IGF-II were used in Northern blot hybridizations to analyze rat Sm-C/IGF-I and IGF-II mRNAs in poly(A + ) RNAs from intestine, liver, lung, and brain of adult rats and fetal rats between day 14 and 17 of gestation. In fetal rats, all four tissues contained a major mRNA of 1.7 kilobase (kb) that hybridized with the human Sm-C/IGF-I cDNA and mRNAs of 7.5, 4.7, 1.7, and 1.2 kb that hybridized with the mouse Sm-C/IGF-I cDNA. Adult rat intestine, liver, and lung also contained these mRNAs but Sm-C/IGF-I mRNAs were not detected in adult rat brain. These findings provide direct support for prior observations that multiple tissues in the fetus synthesize immunoreactive Sm-C/IGF-I and imply a role for Sm-C/IGF-I in fetal development as well as postnatally. Multiple IGF-II mRNAs of estimated sizes 4.7, 3.9, 2.2, 1.75, and 1.2 kb were observed in fetal rat intestine, liver, lung, and brain. The 4.7- and 3.9-kb mRNAs were the major hybridizing IGF-II mRNAs in all fetal tissues. Higher abundance of IGF-II mRNAs in rat fetal tissues compared with adult tissues supports prior hypotheses, based on serum IGF-II concentrations, that IGF-II is predominantly a fetal somatomedin. IGF-II mRNAs are present, however, in some poly(A + ) RNAs from adult rat tissues. The brain was the only tissue in the adult rat where the 4.7- and 3.9-kb IGF-II mRNAs were consistently detected. These findings suggest that a role for IGF-II in the adult rat, particularly in the central nervous system, cannot be excluded
Directory of Open Access Journals (Sweden)
Abbasali Palizban
2017-01-01
Full Text Available Background: The transcription factor 7-like 2 gene (TCF7L2 is an element of the Wnt signaling pathway. There is lack of evidence if TCF7L2 has a functional role in lipid metabolism and regulation of the components constitutes the metabolic syndrome (MetSyn. The aims of this study were to evaluate whether the risk allele of TCF7L2 gene polymorphism is associated with dyslipidemia and MetSyn. Materials and Methods: The MetSyn subjects were participated only based on the National Cholesterol Education Program – Third Adult Treatment Panel criteria. In this case–control study, the DNA from MetSyn patients without (n = 90 and with type 2 diabetes (T2D (n = 94 were genotyped. Results: The results show that the genotype-phenotype for CC, CT/TT of TCF7L2 gene polymorphism correlated with body mass index and waist circumference in MetSyn and MetSyn + T2D subjects (r = −0.949 and r = −0.963, respectively. The subjects that only possess MetSyn but are not diabetics show the 2 h postprandial glucose and fasting blood glucose, glycated hemoglobin significantly lower (P < 0.05 than those subjects have both abnormality. The level of triglyceride in CT/TT carriers in MetSyn was higher than CC carriers (P = 0.025. A comparison with the controls subjects, the frequencies of the T allele in the groups of MetSyn (46.66% and MetSyn + T2D (47.34% show significantly different (P < 0.05. The odds ratios for T allele in (MetSyn/(normal, (MetSyn + T2D/(normal, and in (MetSyn + T2D/(MetSyn were 3.59 (95% confidence interval [CI], 1.33–9.67, P = 0.0093, 3.76 (95% CI, 1.40–10.07, P = 0.0068, and 1.08 (95% CI: 0.55– 2.11, P = 0.834, respectively. Conclusion: The results revealed the important insights essential for the role of TCF7L2 that the T allele of TCF7L2 plays a significant role in the susceptibility to dyslipidemia, MetSyn, and T2D.
Profil Ekspresi mRNA Gen Murine Double Minute2, Kruppel-Like Factor4, dan c-Myc pada Fibrosarkoma
Directory of Open Access Journals (Sweden)
- Humaryanto
2017-02-01
Full Text Available Abstrak Fibrosarkoma hanya terjadi 1–3% dari seluruh keganasan jaringan lunak. Hingga saat ini etiologi fibrosarkoma belum diketahui dengan pasti. Beberapa faktor dapat menjadi penyebab patogenesis fibrosarkoma antara lain radiasi, terpapar zat kimia tertentu, serta infeksi human herpes virus 8 (HHV8 dan Epstein-Barr virus (EBV. Penelitian terkini menunjukkan bahwa banyak sarkoma terkait dengan mutasi genetik. Penelitian ini bertujuan melihat profil ekspresi mRNA gen Krüppel-like Factor4, Murine Double Minute2, dan c-Myc pada fibrosarkoma menggunakan teknik real time PCR kuantitatif (quantitative real time PCR, qRT-PCR. Analisis data menggunakan metode kuantititatif relatif 2-ΔΔCt. Penelitian ini menggunakan 10 sampel kasus fibrosarkoma yang ditemukan di Kota Jambi dari tahun 2011–2015. Hasil ΔCt (+SD MDM2, KLF-4, dan c-Myc disusun dari nilai yang terkecil hingga tertinggi adalah 1,85±2,14; 2,06±3,86; 2,9±2,66 secara berurutan. Dibanding dengan level ekspresi dengan GAPDH sebagai housekeeping gene, gen MDM2 dan KLF-4 relatif menurun dua kali lipat, sedangkan gen c-Myc relatif menurun lebih dari tiga kali lipat. Simpulan, penelitian ini menunjukkan bahwa pada kasus fibrosarkoma, gen c-Myc disupresi lebih kuat dibanding dengan gen MDM2 dan KLF-4. Abstract Fibrosarcoma is a rare soft tissue sarcoma, reported only 1–3% of all soft tissue sarcomas. Like any other soft-tissue sarcomas the definitive caused has not yet understood. Recognized causes include exposure to ionizing radiation, various physical and chemical factors, infection with human herpes virus (HHV8 and Epstein-Barr virus (EBV. Current research indicates many sarcomas are associated with genetic mutations. In this study, we investigated profile of mRNA gene expression KLF4, MDM2, and c-Myc of RNA in fibrosarcoma cases. The genes expression was examined using quantitative real time PCR (qRT-PCR and we analyzed the relative gene expression using the 2-ΔΔCt method. Ten
Purification of human platelet-derived growth factor
International Nuclear Information System (INIS)
Raines, E.W.; Ross, R.
1985-01-01
The paper describes a method for purification of human platelet-derived growth factor (PDGF) from outdated platelet-rich plasma (PRP) using commonly available laboratory reagents and yielding a mitogen purified 800,000-fold over the starting material. [ 3 H]thymidine incorporation into DNA of cultured cells responsive to PDGF represents the most readily available method to follow its purification and define the biological activity of a purified preparation. Other assays to quantitate PDGF include radioreceptor assay and radioimmunoassay
Decreased "ineffective erythropoiesis" preserves polycythemia in mice under long-term hypoxia.
Harada, Tomonori; Tsuboi, Isao; Hirabayashi, Yukio; Kosaku, Kazuhiro; Naito, Michiko; Hara, Hiroyuki; Inoue, Tohru; Aizawa, Shin
2015-05-01
Hypoxia induces innumerable changes in humans and other animals, including an increase in peripheral red blood cells (polycythemia) caused by the activation of erythropoiesis mediated by increased erythropoietin (EPO) production. However, the elevation of EPO is limited and levels return to normal ranges under normoxia within 5-7 days of exposure to hypoxia, whereas polycythemia continues for as long as hypoxia persists. We investigated erythropoiesis in bone marrow and spleens from mouse models of long-term normobaric hypoxia (10 % O2) to clarify the mechanism of prolonged polycythemia in chronic hypoxia. The numbers of erythroid colony-forming units (CFU-E) in the spleen remarkably increased along with elevated serum EPO levels indicating the activation of erythropoiesis during the first 7 days of hypoxia. After 14 days of hypoxia, the numbers of CFU-E returned to normoxic levels, whereas polycythemia persisted for >140 days. Flow cytometry revealed a prolonged increase in the numbers of TER119-positive cells (erythroid cells derived from pro-erythroblasts through mature erythrocyte stages), especially the TER119 (high) CD71 (high) population, in bone marrow. The numbers of annexin-V-positive cells among the TER119-positive cells particularly declined under chronic hypoxia, suggesting that the numbers of apoptotic cells decrease during erythroid cell maturation. Furthermore, RT-PCR analysis showed that the RNA expression of BMP-4 and stem cell factor that reduces apoptotic changes during erythroid cell proliferation and maturation was increased in bone marrow under hypoxia. These findings indicated that decreased apoptosis of erythroid cells during erythropoiesis contributes to polycythemia in mice during chronic exposure to long-term hypoxia.