WorldWideScience

Sample records for factor erythroid-derived 2-like

  1. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  2. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  3. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  4. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  5. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  6. The nuclear factor (erythroid-derived 2)-like 2 (NRF2) antioxidant response promotes melanocyte viability and reduces toxicity of the vitiligo-inducing phenol monobenzone.

    Science.gov (United States)

    Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela

    2017-07-01

    Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. The Antioxidant Additive Approach for Alzheimer's Disease Therapy: New Ferulic (Lipoic) Acid Plus Melatonin Modified Tacrines as Cholinesterases Inhibitors, Direct Antioxidants, and Nuclear Factor (Erythroid-Derived 2)-Like 2 Activators.

    Science.gov (United States)

    Benchekroun, Mohamed; Romero, Alejandro; Egea, Javier; León, Rafael; Michalska, Patrycja; Buendía, Izaskun; Jimeno, María Luisa; Jun, Daniel; Janockova, Jana; Sepsova, Vendula; Soukup, Ondrej; Bautista-Aguilera, Oscar M; Refouvelet, Bernard; Ouari, Olivier; Marco-Contelles, José; Ismaili, Lhassane

    2016-11-10

    Novel multifunctional tacrines for Alzheimer's disease were obtained by Ugi-reaction between ferulic (or lipoic acid), a melatonin-like isocyanide, formaldehyde, and tacrine derivatives, according to the antioxidant additive approach in order to modulate the oxidative stress as therapeutic strategy. Compound 5c has been identified as a promising permeable agent showing excellent antioxidant properties, strong cholinesterase inhibitory activity, less hepatotoxicity than tacrine, and the best neuroprotective capacity, being able to significantly activate the Nrf2 transcriptional pathway.

  8. Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.

    Directory of Open Access Journals (Sweden)

    Fang Liu

    Full Text Available The productivity of maize (Zea mays L. depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59 were divided into seven groups (I-VII. By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses.

  9. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

    Science.gov (United States)

    Ha, Ae Wha; Kim, Woo Kyoung

    2017-06-01

    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  10. GOLDEN2-LIKE transcription factors coordinate the tolerance to Cucumber mosaic virus in Arabidopsis

    Energy Technology Data Exchange (ETDEWEB)

    Han, Xue-Ying; Li, Peng-Xu; Zou, Li-Juan; Tan, Wen-rong; Zheng, Ting; Zhang, Da-Wei, E-mail: yuanmiao1892@163.com; Lin, Hong-Hui, E-mail: hhlin@scu.edu.cn

    2016-09-02

    Arabidopsis thaliana GOLDEN2-LIKE (GLKs) transcription factors play important roles in regulation of photosynthesis-associated nuclear genes, as well as participate in chloroplast development. However, the involvement of GLKs in plants resistance to virus remains largely unknown. Here, the relationship between GLKs and Cucumber mosaic virus (CMV) stress response was investigated. Our results showed that the Arabidopsis glk1glk2 double-mutant was more susceptible to CMV infection and suffered more serious damages (such as higher oxidative damages, more compromised in PSII photochemistry and more reactive oxygen species accumulation) when compared with the wild-type plants. Interestingly, there was little difference between single mutant (glk1 or glk2) and wild-type plants in response to CMV infection, suggesting GLK1 and GLK2 might function redundant in virus resistance in Arabidopsis. Furthermore, the induction of antioxidant system and defense-associated genes expression in the double mutant were inhibited when compared with single mutant or wild-type plants after CMV infection. Further evidences showed that salicylic acid (SA) and jasmonic acid (JA) might be involved in GLKs-mediated virus resistance, as SA or JA level and synthesis-related genes transcription were impaired in glk1glk2 mutant. Taken together, our results indicated that GLKs played a positively role in virus resistance in Arabidopsis. - Highlights: • GLKs play a positive role in CMV resistance in Arabidopsis. • Defective of GLKs suffered more ROS accumulation. • Arabidopsis lacking GLKs have damaged photosynthesis. • Arabidopsis lacking GLKs show low SA and JA accumulation.

  11. GOLDEN2-LIKE transcription factors coordinate the tolerance to Cucumber mosaic virus in Arabidopsis

    International Nuclear Information System (INIS)

    Han, Xue-Ying; Li, Peng-Xu; Zou, Li-Juan; Tan, Wen-rong; Zheng, Ting; Zhang, Da-Wei; Lin, Hong-Hui

    2016-01-01

    Arabidopsis thaliana GOLDEN2-LIKE (GLKs) transcription factors play important roles in regulation of photosynthesis-associated nuclear genes, as well as participate in chloroplast development. However, the involvement of GLKs in plants resistance to virus remains largely unknown. Here, the relationship between GLKs and Cucumber mosaic virus (CMV) stress response was investigated. Our results showed that the Arabidopsis glk1glk2 double-mutant was more susceptible to CMV infection and suffered more serious damages (such as higher oxidative damages, more compromised in PSII photochemistry and more reactive oxygen species accumulation) when compared with the wild-type plants. Interestingly, there was little difference between single mutant (glk1 or glk2) and wild-type plants in response to CMV infection, suggesting GLK1 and GLK2 might function redundant in virus resistance in Arabidopsis. Furthermore, the induction of antioxidant system and defense-associated genes expression in the double mutant were inhibited when compared with single mutant or wild-type plants after CMV infection. Further evidences showed that salicylic acid (SA) and jasmonic acid (JA) might be involved in GLKs-mediated virus resistance, as SA or JA level and synthesis-related genes transcription were impaired in glk1glk2 mutant. Taken together, our results indicated that GLKs played a positively role in virus resistance in Arabidopsis. - Highlights: • GLKs play a positive role in CMV resistance in Arabidopsis. • Defective of GLKs suffered more ROS accumulation. • Arabidopsis lacking GLKs have damaged photosynthesis. • Arabidopsis lacking GLKs show low SA and JA accumulation.

  12. The intracellular immune receptor Rx1 regulates the DNA-binding activity of a Golden2-like transcription factor.

    Science.gov (United States)

    Townsend, Philip D; Dixon, Christopher H; Slootweg, Erik J; Sukarta, Octavina C A; Yang, Ally W H; Hughes, Timothy R; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Goverse, Aska; Cann, Martin J

    2018-03-02

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable the immune system to recognize and respond to pathogen attack. An early consequence of immune activation is transcriptional reprogramming, and some NLRs have been shown to act in the nucleus and interact with transcription factors. The Rx1 NLR protein of potato is further able to bind and distort double-stranded DNA. However, Rx1 host targets that support a role for Rx1 in transcriptional reprogramming at DNA are unknown. Here, we report a functional interaction between Rx1 and Nb Glk1, a Golden2-like transcription factor. Rx1 binds to Nb Glk1 in vitro and in planta. Nb Glk1 binds to known Golden2-like consensus DNA sequences. Rx1 reduces the binding affinity of Nb Glk1 for DNA in vitro. Nb Glk1 activates cellular responses to potato virus X, whereas Rx1 associates with Nb Glk1 and prevents its assembly on DNA in planta unless activated by PVX. This study provides new mechanistic insight into how an NLR can coordinate an immune signaling response at DNA following pathogen perceptions. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. The intracellular immune receptor Rx1 regulates the DNA-binding activity of a Golden2-like transcription factor

    NARCIS (Netherlands)

    Townsend, Philip D.; Dixon, Christopher H.; Slootweg, Erik J.; Sukarta, Octavina C.A.; Yang, Ally W.H.; Hughes, Timothy R.; Sharples, Gary J.; Palsson, Lars-Olof; Takken, Frank L.W.; Goverse, Aska; Cann, Martin J.

    2018-01-01

    Plant NLR proteins enable the immune system to recognise and respond to pathogen attack. An early consequence of immune activation is transcriptional reprogramming and some NLRs have been shown to act in the nucleus and interact with transcription factors. The Rx1 NLR protein of potato is further

  14. Nuclear factor 90 uses an ADAR2-like binding mode to recognize specific bases in dsRNA.

    Science.gov (United States)

    Jayachandran, Uma; Grey, Heather; Cook, Atlanta G

    2016-02-29

    Nuclear factors 90 and 45 (NF90 and NF45) form a protein complex involved in the post-transcriptional control of many genes in vertebrates. NF90 is a member of the dsRNA binding domain (dsRBD) family of proteins. RNA binding partners identified so far include elements in 3' untranslated regions of specific mRNAs and several non-coding RNAs. In NF90, a tandem pair of dsRBDs separated by a natively unstructured segment confers dsRNA binding activity. We determined a crystal structure of the tandem dsRBDs of NF90 in complex with a synthetic dsRNA. This complex shows surprising similarity to the tandem dsRBDs from an adenosine-to-inosine editing enzyme, ADAR2 in complex with a substrate RNA. Residues involved in unusual base-specific recognition in the minor groove of dsRNA are conserved between NF90 and ADAR2. These data suggest that, like ADAR2, underlying sequences in dsRNA may influence how NF90 recognizes its target RNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Tc-MYBPA an Arabidopsis TT2-like transcription factor and functions in the regulation of proanthocyanidin synthesis in Theobroma cacao.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela N; Payne, Mark J; Guiltinan, Mark J

    2015-06-25

    The flavan-3-ols catechin and epicatechin, and their polymerized oligomers, the proanthocyanidins (PAs, also called condensed tannins), accumulate to levels of up to 15 % of the total weight of dry seeds of Theobroma cacao L. These compounds have been associated with several health benefits in humans. They also play important roles in pest and disease defense throughout the plant. In Arabidopsis, the R2R3 type MYB transcription factor TT2 regulates the major genes leading to the synthesis of PA. To explore the transcriptional regulation of the PA synthesis pathway in cacao, we isolated and characterized an R2R3 type MYB transcription factor MYBPA from cacao. We examined the spatial and temporal gene expression patterns of the Tc-MYBPA gene and found it to be developmentally expressed in a manner consistent with its involvement in PAs and anthocyanin synthesis. Functional complementation of an Arabidopsis tt2 mutant with Tc-MYBPA suggested that it can functionally substitute the Arabidopsis TT2 gene. Interestingly, in addition to PA accumulation in seeds of the Tc-MYBPA expressing plants, we also observed an obvious increase of anthocyanidin accumulation in hypocotyls. We observed that overexpression of the Tc-MYBPA gene resulted in increased expression of several key genes encoding the major structural enzymes of the PA and anthocyanidin pathway, including DFR (dihydroflavanol reductase), LDOX (leucoanthocyanidin dioxygenase) and BAN (ANR, anthocyanidin reductase). We conclude that the Tc-MYBPA gene that encodes an R2R3 type MYB transcription factor is an Arabidopsis TT2 like transcription factor, and may be involved in the regulation of both anthocyanin and PA synthesis in cacao. This research may provide molecular tools for breeding of cacao varieties with improved disease resistance and enhanced flavonoid profiles for nutritional and pharmaceutical applications.

  16. Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Marta Pajares

    2017-04-01

    Full Text Available Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2-like 2. NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.

  17. The effects of Mucuna pruriens on the renal oxidative stress and transcription factors in high-fructose-fed rats.

    Science.gov (United States)

    Ulu, Ramazan; Gozel, Nevzat; Tuzcu, Mehmet; Orhan, Cemal; Yiğit, İrem Pembegül; Dogukan, Ayhan; Telceken, Hafize; Üçer, Özlem; Kemeç, Zeki; Kaman, Dilara; Juturu, Vijaya; Sahin, Kazim

    2018-05-31

    In the present study, we evaluated the effects of M. pruriens administration on metabolic parameters, oxidative stress and kidney nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and nuclear factor (erythroid-derived 2)-like 2 (Nrf2) signaling pathways in high-fructose fed rats. Male rats (n = 28) were divided into 4 groups as control, M. pruriens, fructose, and M. pruriens plus fructose. All rats were fed a standard diet supplemented or no supplemented with M. pruriens (200 mg/kg/d by gavage). Fructose was given in drinking water for 8 weeks. High fructose consumption led to an increase in the serum level of glucose, triglyceride, urea and renal malondialdehyde (MDA) levels. Although M. pruriens treatment reduced triglyceride and MDA levels, it did not affect other parameters. M. pruriens supplementation significantly decreased the expression of NF-ҡB and decreased expression of Nrf2 and HO-1 proteins in the kidney. This study showed that the adverse effects of high fructose were alleviated by M. pruriens supplementation via modulation of the expression of kidney nuclear transcription factors in rats fed high fructose diet. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Insulin-like growth factor 1 signaling is essential for mitochondrial biogenesis and mitophagy in cancer cells.

    Science.gov (United States)

    Lyons, Amy; Coleman, Michael; Riis, Sarah; Favre, Cedric; O'Flanagan, Ciara H; Zhdanov, Alexander V; Papkovsky, Dmitri B; Hursting, Stephen D; O'Connor, Rosemary

    2017-10-13

    Mitochondrial activity and metabolic reprogramming influence the phenotype of cancer cells and resistance to targeted therapy. We previously established that an insulin-like growth factor 1 (IGF-1)-inducible mitochondrial UTP carrier (PNC1/SLC25A33) promotes cell growth. This prompted us to investigate whether IGF signaling is essential for mitochondrial maintenance in cancer cells and whether this contributes to therapy resistance. Here we show that IGF-1 stimulates mitochondrial biogenesis in a range of cell lines. In MCF-7 and ZR75.1 breast cancer cells, IGF-1 induces peroxisome proliferator-activated receptor γ coactivator 1β (PGC-1β) and PGC-1α-related coactivator (PRC). Suppression of PGC-1β and PRC with siRNA reverses the effects of IGF-1 and disrupts mitochondrial morphology and membrane potential. IGF-1 also induced expression of the redox regulator nuclear factor-erythroid-derived 2-like 2 (NFE2L2 alias NRF-2). Of note, MCF-7 cells with acquired resistance to an IGF-1 receptor (IGF-1R) tyrosine kinase inhibitor exhibited reduced expression of PGC-1β, PRC, and mitochondrial biogenesis. Interestingly, these cells exhibited mitochondrial dysfunction, indicated by reactive oxygen species expression, reduced expression of the mitophagy mediators BNIP3 and BNIP3L, and impaired mitophagy. In agreement with this, IGF-1 robustly induced BNIP3 accumulation in mitochondria. Other active receptor tyrosine kinases could not compensate for reduced IGF-1R activity in mitochondrial protection, and MCF-7 cells with suppressed IGF-1R activity became highly dependent on glycolysis for survival. We conclude that IGF-1 signaling is essential for sustaining cancer cell viability by stimulating both mitochondrial biogenesis and turnover through BNIP3 induction. This core mitochondrial protective signal is likely to strongly influence responses to therapy and the phenotypic evolution of cancer. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Brain-Derived Neurotrophic Factor Increases Synaptic Protein Levels via the MAPK/Erk Signaling Pathway and Nrf2/Trx Axis Following the Transplantation of Neural Stem Cells in a Rat Model of Traumatic Brain Injury.

    Science.gov (United States)

    Chen, Tao; Wu, Yu; Wang, Yuzi; Zhu, Jigao; Chu, Haiying; Kong, Li; Yin, Liangwei; Ma, Haiying

    2017-11-01

    Brain-derived neurotrophic factor (BDNF) plays an important role in promoting the growth, differentiation, survival and synaptic stability of neurons. Presently, the transplantation of neural stem cells (NSCs) is known to induce neural repair to some extent after injury or disease. In this study, to investigate whether NSCs genetically modified to encode the BDNF gene (BDNF/NSCs) would further enhance synaptogenesis, BDNF/NSCs or naive NSCs were directly engrafted into lesions in a rat model of traumatic brain injury (TBI). Immunohistochemistry, western blotting and RT-PCR were performed to detect synaptic proteins, BDNF-TrkB and its downstream signaling pathways, at 1, 2, 3 or 4 weeks after transplantation. Our results showed that BDNF significantly increased the expression levels of the TrkB receptor gene and the phosphorylation of the TrkB protein in the lesions. The expression levels of Ras, phosphorylated Erk1/2 and postsynaptic density protein-95 were elevated in the BDNF/NSCs-transplanted groups compared with those in the NSCs-transplanted groups throughout the experimental period. Moreover, the nuclear factor (erythroid-derived 2)-like 2/Thioredoxin (Nrf2/Trx) axis, which is a specific therapeutic target for the treatment of injury or cell death, was upregulated by BDNF overexpression. Therefore, we determined that the increased synaptic proteins level implicated in synaptogenesis might be associated with the activation of the MAPK/Erk1/2 signaling pathway and the upregulation of the antioxidant agent Trx modified by BDNF-TrkB following the BDNF/NSCs transplantation after TBI.

  20. Purification, crystallization and preliminary X-ray diffraction of the G3BP1 NTF2-like domain

    DEFF Research Database (Denmark)

    Vognsen, Tina; Möller, Ingvar Rúnar; Kristensen, Ole

    2011-01-01

    The nuclear transport factor 2-like (NTF2-like) domain of human G3BP1 was subcloned, overexpressed in Escherichia coli and purified. Crystals were obtained using the hanging-drop vapour-diffusion method. Diffraction data were collected to 3.6 Å resolution using synchrotron radiation. The crystals...

  1. Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster

    DEFF Research Database (Denmark)

    Vognsen, Tina Reinholdt; Kristensen, Ole

    2012-01-01

    The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7Å resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a ß-sheet and three a-helices forming...

  2. Role of platelet-released growth factors in detoxification of reactive oxygen species in osteoblasts.

    Science.gov (United States)

    Tohidnezhad, Mersedeh; Wruck, Christoph-Jan; Slowik, Alexander; Kweider, Nisreen; Beckmann, Rainer; Bayer, Andreas; Houben, Astrid; Brandenburg, Lars-Ove; Varoga, Deike; Sönmez, Tolga-Taha; Stoffel, Marcus; Jahr, Holger; Lippross, Sebastian; Pufe, Thomas

    2014-08-01

    Oxidative stress can impair fracture healing. To protect against oxidative damage, a system of detoxifying and antioxidative enzymes works to reduce the cellular stress. The transcription of these enzymes is regulated by antioxidant response element (ARE). The nuclear factor (erythroid-derived 2)-like2 (Nrf2) plays a major role in transcriptional activation of ARE-driven genes. Recently it has been shown that vascular endothelial growth factor (VEGF) prevents oxidative damage via activation of the Nrf2 pathway in vitro. Platelet-released growth factor (PRGF) is a mixture of autologous proteins and growth factors, prepared from a determined volume of platelet-rich plasma (PRP). It has already used to enhance fracture healing in vitro. The aim of the present study was to elucidate if platelets can lead to upregulation of VEGF and if platelets can regulate the activity of Nrf2-ARE system in primary human osteoblast (hOB) and in osteoblast-like cell line (SAOS-2). Platelets and PRGF were obtained from healthy human donors. HOB and SAOS-2 osteosarcoma cell line were used. The ARE activity was analysed using a dual luciferase reporter assay system. We used Western blot to detect the nuclear accumulation of Nrf2 and the amount of cytosolic antioxidant Thioredoxin Reductase-1 (TXNRD-1), Heme Oxygenase-1 (HO-1) and NAD(P)H quinine oxidoreductase-1 (NQO1). Gene expression analysis was performed by real-time RT PCR. ELISA was used for the quantification of growth factors. The activity of ARE was increased in the presence of PRGF up to 50%. Western blotting demonstrated enhanced nuclear accumulation of Nrf2. This was followed by an increase in the protein expression of the aforementioned downstream targets of Nrf2. Real-time RT PCR data showed an upregulation in the gene expression of the VEGF after PRGF treatment. This was confirmed by ELISA, where the treatment with PRGF induced the protein level of VEGF in both cells. These results provide a new insight into PRGF's mode of

  3. Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster

    International Nuclear Information System (INIS)

    Vognsen, Tina; Kristensen, Ole

    2012-01-01

    Highlights: ► The crystal structure of the NTF2-like domain of Rasputin protein is presented. ► Differences to known ligand binding sites of nuclear transport factor 2 are discussed. ► A new ligand binding site for the Rasputin and G3BP proteins is proposed. -- Abstract: The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7 Å resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a β-sheet and three α-helices forming a cone-like shape. However, known binding sites for RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site.

  4. Lycopene activates antioxidant enzymes and nuclear transcription factor systems in heat-stressed broilers.

    Science.gov (United States)

    Sahin, K; Orhan, C; Tuzcu, M; Sahin, N; Hayirli, A; Bilgili, S; Kucuk, O

    2016-05-01

    This study was conducted to evaluate the effects of dietary lycopene supplementation on growth performance, antioxidant status, and muscle nuclear transcription factor [Kelch like-ECH-associated protein 1 (Keap1) and (erythroid-derived 2)-like 2 (Nrf2)] expressions in broiler chickens exposed to heat stress (HS). A total of 180 one-day-old male broiler chicks (Ross 308) were assigned randomly to one of 2×3 factorially arranged treatments: two housing temperatures (22°C for 24 h/d; thermoneutral, TN or 34°C for 8 h/d HS) and three dietary lycopene levels (0, 200, or 400 mg/kg). Each treatment consisted of three replicates of 10 birds. Birds were reared to 42 d of age. Heat stress caused reductions in feed intake and weight gain by 12.2 and 20.7% and increased feed efficiency by 10.8% (Plycopene level improved performance in both environments. Birds reared under the HS environment had lower serum and muscle lycopene concentration (0.34 vs. 0.50 μg/mL and 2.80 vs. 2.13 μg/g), activities of superoxide dismutase (151 vs. 126 U/mL and 131 vs. 155 U/mg protein), glutathione peroxidase (184 vs. 154 U/mL and 1.39 vs. 1.74 U/mg protein), and higher malondialdehyde (MDA) concentration (0.53 vs. 0.83 μg/mL and 0.78 vs. 0.45 μg/ mg protein) than birds reared under the TN environment. Changes in levels of lycopene and MDA and activities of enzymes in serum and muscle varied by the environmental temperature as dietary lycopene level increased. Moreover, increasing dietary lycopene level suppressed muscle Keap1 expression and enhanced muscle Nrf2 expression, which had increased by 150% and decreased by 40%, respectively in response to HS. In conclusion, lycopene supplementation alleviates adverse effects of HS on performance through modulating expressions of stress-related nuclear transcription factors. © 2016 Poultry Science Association Inc.

  5. Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Vognsen, Tina, E-mail: tv@farma.ku.dk [Biostructural Research, Department of Drug Design and Pharmacology, Faculty of Health Sciences, University of Copenhagen, Universitetsparken 2, DK-2100 Copenhagen (Denmark); Kristensen, Ole, E-mail: ok@farma.ku.dk [Biostructural Research, Department of Drug Design and Pharmacology, Faculty of Health Sciences, University of Copenhagen, Universitetsparken 2, DK-2100 Copenhagen (Denmark)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer The crystal structure of the NTF2-like domain of Rasputin protein is presented. Black-Right-Pointing-Pointer Differences to known ligand binding sites of nuclear transport factor 2 are discussed. Black-Right-Pointing-Pointer A new ligand binding site for the Rasputin and G3BP proteins is proposed. -- Abstract: The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7 A resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a {beta}-sheet and three {alpha}-helices forming a cone-like shape. However, known binding sites for RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site.

  6. Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster.

    Science.gov (United States)

    Vognsen, Tina; Kristensen, Ole

    2012-03-30

    The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7Å resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a β-sheet and three α-helices forming a cone-like shape. However, known binding sites for RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Autoinducer-2-like activity associated with foods and its interaction with food additives.

    Science.gov (United States)

    Lu, Lingeng; Hume, Michael E; Pillai, Suresh D

    2004-07-01

    The autoinducer-2 (AI-2) molecule produced by bacteria as part of quorum sensing is considered to be a universal inducer signal in bacteria because it reportedly influences gene expression in a variety of both gram-negative and gram-positive bacteria. The objective of this study was to determine whether selected fresh produce and processed foods have AI-2-like activity and whether specific food additives can act as AI-2 mimics and result in AI-2-like activity. The luminescence-based response of the reporter strain Vibrio harveyi BB170 was used as the basis for determining AI-2 activity in the selected foods and food ingredients. Maximum AI-2 activity was seen on the frozen fish sample (203-fold, compared with the negative control) followed by tomato, cantaloupe, carrots, tofu, and milk samples. Interestingly, some samples were capable of inhibiting AI-2 activity. Turkey patties showed the highest inhibition (99.8% compared with the positive control) followed by chicken breast (97.5%), homemade cheeses (93.7%), beef steak (90.6%), and beef patties (84.4%). AI-2 activity was almost totally inhibited by sodium propionate, whereas sodium benzoate caused 93.3% inhibition, compared with 75% inhibition by sodium acetate. Sodium nitrate did not have any appreciable effect, even at 200 ppm. Understanding the relationships that exist between AI-2 activity on foods and the ecology of pathogens and food spoilage bacteria on foods could yield clues about factors controlling food spoilage and pathogen virulence.

  8. PLATINUM SENSITIVE 2 LIKE impacts growth, root morphology, seed set, and stress responses.

    Directory of Open Access Journals (Sweden)

    Amr R A Kataya

    Full Text Available Eukaryotic protein phosphatase 4 (PP4 is a PP2A-type protein phosphatase that is part of a conserved complex with regulatory factors PSY2 and PP4R2. Various lines of Arabidopsis thaliana with mutated PP4 subunit genes were constructed to study the so far completely unknown functions of PP4 in plants. Mutants with knocked out putative functional homolog of the PSY2 LIKE (PSY2L gene were dwarf and bushy, while plants with knocked out PP4R2 LIKE (PP4R2L looked very similar to WT. The psy2l seedlings had short roots with disorganized morphology and impaired meristem. Seedling growth was sensitive to the genotoxin cisplatin. Global transcript analysis (RNA-seq of seedlings and rosette leaves revealed several groups of genes, shared between both types of tissues, strongly influenced by knocked out PSY2L. Receptor kinases, CRINKLY3 and WAG1, important for growth and development, were down-regulated 3-7 times. EUKARYOTIC ELONGATION FACTOR5A1 was down-regulated 4-6 fold. Analysis of hormone sensitive genes indicated that abscisic acid levels were high, while auxin, cytokinin and gibberellic acid levels were low in psy2l. Expression of specific transcription factors involved in regulation of anthocyanin synthesis were strongly elevated, e.g. the master regulator PAP1, and intriguingly TT8, which is otherwise mainly expressed in seeds. The psy2l mutants accumulated anthocyanins under conditions where WT did not, pointing to PSY2L as a possible upstream negative regulator of PAP1 and TT8. Expression of the sugar-phosphate transporter GPT2, important for cellular sugar and phosphate homeostasis, was enhanced 7-8 times. Several DNA damage response genes, including the cell cycle inhibitor gene WEE1, were up-regulated in psy2l. The activation of DNA repair signaling genes, in combination with phenotypic traits showing aberrant root meristem and sensitivity to the genotoxic cisplatin, substantiate the involvement of Arabidopsis PSY2L in maintenance of genome

  9. Crystal structures of the human G3BP1 NTF2-like domain visualize FxFG Nup Repeat Specificity

    DEFF Research Database (Denmark)

    Vognsen, Tina Reinholdt; Möller, Ingvar Rúnar; Kristensen, Ole

    2013-01-01

    Ras GTPase Activating Protein SH3 Domain Binding Protein (G3BP) is a potential anti-cancer drug target implicated in several cellular functions. We have used protein crystallography to solve crystal structures of the human G3BP1 NTF2-like domain both alone and in complex with an FxFG Nup repeat...... peptide. Despite high structural similarity, the FxFG binding site is located between two alpha helices in the G3BP1 NTF2-like domain and not at the dimer interface as observed for nuclear transport factor 2. ITC studies showed specificity towards the FxFG motif but not FG and GLFG motifs. The unliganded...

  10. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Science.gov (United States)

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  11. Cloning, recombinant production, crystallization and preliminary X-ray diffraction analysis of SDF2-like protein from Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Radzimanowski, Jens; Ravaud, Stephanie; Schott, Andrea; Strahl, Sabine; Sinning, Irmgard

    2009-01-01

    Overexpression, purification, crystallization and preliminary X-ray diffraction of the stromal-cell-derived factor 2-like protein of Arabidopsis thaliana are reported. The crystals belonged to the space group P6 1 and diffracted to 1.95 Å resolution. The stromal-cell-derived factor 2-like protein of Arabidopsis thaliana (AtSDL) has been shown to be highly up-regulated in response to unfolded protein response (UPR) inducing reagents, suggesting that it plays a crucial role in the plant UPR pathway. AtSDL has been cloned, overexpressed, purified and crystallized using the vapour-diffusion method. Two crystal forms have been obtained under very similar conditions. The needle-shaped crystals did not diffract X-rays, while the other form diffracted to 1.95 Å resolution using a synchrotron-radiation source and belonged to the hexagonal space group P6 1 , with unit-cell parameters a = b = 96.1, c = 69.3 Å

  12. Molecular basis of the specific subcellular localization of the C2-like domain of 5-lipoxygenase.

    Science.gov (United States)

    Kulkarni, Shilpa; Das, Sudipto; Funk, Colin D; Murray, Diana; Cho, Wonhwa

    2002-04-12

    The activation of 5-lipoxygenase (5-LO) involves its calcium-dependent translocation to the nuclear envelope, where it catalyzes the two-step transformation of arachidonic acid into leukotriene A(4), leading to the synthesis of various leukotrienes. To understand the mechanism by which 5-LO is specifically targeted to the nuclear envelope, we studied the membrane binding properties of the amino-terminal domain of 5-LO, which has been proposed to have a C2 domain-like structure. The model building, electrostatic potential calculation, and in vitro membrane binding studies of the isolated C2-like domain of 5-LO and selected mutants show that this Ca(2+)-dependent domain selectively binds zwitterionic phosphatidylcholine, which is conferred by tryptophan residues (Trp(13), Trp(75), and Trp(102)) located in the putative Ca(2+)-binding loops. The spatiotemporal dynamics of the enhanced green fluorescence protein-tagged C2-like domain of 5-LO and mutants in living cells also show that the phosphatidylcholine selectivity of the C2-like domain accounts for the specific targeting of 5-LO to the nuclear envelope. Together, these results show that the C2-like domain of 5-LO is a genuine Ca(2+)-dependent membrane-targeting domain and that the subcellular localization of the domain is governed in large part by its membrane binding properties.

  13. Aberrant dopamine D2-like receptor function in a rodent model of schizophrenia.

    Science.gov (United States)

    Perez, Stephanie M; Lodge, Daniel J

    2012-11-01

    Based on the observation that antipsychotic medications display antagonist properties at dopamine D2-like receptors, aberrant dopamine signaling has been proposed to underlie psychosis in patients with schizophrenia. Thus, it is not surprising that considerable research has been devoted to understanding the mechanisms involved in the antipsychotic action of these compounds. It is important to note that the majority of these studies have been performed in "normal" experimental animals. Given that these animals do not possess the aberrant neuronal information processing typically associated with schizophrenia, the aim of the current study was to examine the dopamine D2 receptor system in a rodent model of schizophrenia. Here, we demonstrate that methylazoxymethanol acetate (MAM)-treated rats display an enhanced effect of quinpirole on dopamine neuron activity and an aberrant locomotor response to D2-like receptor activation, suggesting changes in postsynaptic D2-like receptor function. To better understand the mechanisms underlying the enhanced response to D2-like ligands in MAM-treated rats, we examined the expression of D2, D3, and dopamine transporter mRNA in the nucleus accumbens and ventral tegmental area by quantitative reverse transcription-polymerase chain reaction. MAM-treated rats displayed a significant increase in dopamine D3 receptor mRNA expression in the nucleus accumbens with no significant changes in the expression of the D2 receptor. Taken together, these data demonstrate robust alterations in dopamine D2-like receptor function in a rodent model of schizophrenia and provide evidence that preclinical studies examining the mechanisms of antipsychotic drug action should be performed in animal models that mirror aspects of the abnormal neuronal transmission thought to underlie symptoms of schizophrenia.

  14. Carbonic anhydrase 2-like and Na⁺-K⁺-ATPase α gene expression in medaka (Oryzias latipes) under carbonate alkalinity stress.

    Science.gov (United States)

    Yao, Zongli; Lai, Qifang; Hao, Zhuoran; Chen, Ling; Lin, Tingting; Zhou, Kai; Wang, Hui

    2015-12-01

    High carbonate alkalinity is one of the major stress factors for living organisms in saline-alkaline water areas. Acute and chronic effects of carbonate alkalinity on expression of two genes, carbonic anhydrase 2-like (CA2-like) and Na(+)-K(+)-ATPase α subunit (NKA-α) mRNA in medaka (Oryzias latipes) were evaluated to better understand the responses important for coping with a carbonate alkalinity stress. In the acute exposure experiment, the expression of CA2-like and NKA-α mRNA in the gill and kidney of medaka were examined from 0 h to 7 days exposed to 30.4 mM carbonate alkalinity water. Exposure to high carbonate alkalinity resulted in a transitory alkalosis, followed by a transient increase in gill and kidney CA2-like and NKA-α mRNA expression. In the chronic exposure experiment, the expression of these two genes was examined in the gill and kidney at 50 days post-exposure to six different carbonate alkalinity concentrations ranging from 1.5 to 30.4 mM. Gill and kidney CA2-like mRNA levels in 30.4 mM were approximately 10 and 30 times higher than that of the control (1.5 mM), respectively. Less differences were found in NKA-α expression in the 50-days exposure. The results indicate that when transferred to high carbonate alkalinity water, a transitory alkalosis may occur in medaka, followed by compensatory acid-base and ion regulatory responses. Thus, CA2-like and NKA-α are at least two of the important factors that contribute to the regulation of alkalinity stress.

  15. Partial separation of platelet and placental adenosine receptors from adenosine A2-like binding protein

    International Nuclear Information System (INIS)

    Zolnierowicz, S.; Work, C.; Hutchison, K.; Fox, I.H.

    1990-01-01

    The ubiquitous adenosine A2-like binding protein obscures the binding properties of adenosine receptors assayed with 5'-N-[ 3 H]ethylcarboxamidoadenosine [( 3 H]NECA). To solve this problem, we developed a rapid and simple method to separate adenosine receptors from the adenosine A2-like binding protein. Human platelet and placental membranes were solubilized with 1% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. The soluble platelet extract was precipitated with polyethylene glycol and the fraction enriched in adenosine receptors was isolated from the precipitate by differential centrifugation. The adenosine A2-like binding protein was removed from the soluble placental extract with hydroxylapatite and adenosine receptors were precipitated with polyethylene glycol. The specificity of the [ 3 H]NECA binding is typical of an adenosine A2 receptor for platelets and an adenosine A1 receptor for placenta. This method leads to enrichment of adenosine A2 receptors for platelets and adenosine A1 receptors for placenta. This provides a useful preparation technique for pharmacologic studies of adenosine receptors

  16. Dopamine D2-Like Receptors and Behavioral Economics of Food Reinforcement

    Science.gov (United States)

    Soto, Paul L; Hiranita, Takato; Xu, Ming; Hursh, Steven R; Grandy, David K; Katz, Jonathan L

    2016-01-01

    Previous studies suggest dopamine (DA) D2-like receptor involvement in the reinforcing effects of food. To determine contributions of the three D2-like receptor subtypes, knockout (KO) mice completely lacking DA D2, D3, or D4 receptors (D2R, D3R, or D4R KO mice) and their wild-type (WT) littermates were exposed to a series of fixed-ratio (FR) food-reinforcement schedules in two contexts: an open economy with additional food provided outside the experimental setting and a closed economy with all food earned within the experimental setting. A behavioral economic model was used to quantify reinforcer effectiveness with food pellets obtained as a function of price (FR schedule value) plotted to assess elasticity of demand. Under both economies, as price increased, food pellets obtained decreased more rapidly (ie, food demand was more elastic) in DA D2R KO mice compared with WT littermates. Extinction of responding was studied in two contexts: by eliminating food deliveries and by delivering food independently of responding. A hyperbolic model quantified rates of extinction. Extinction in DA D2R KO mice occurred less rapidly compared with WT mice in both contexts. Elasticity of food demand was higher in DA D4R KO than WT mice in the open, but not closed, economy. Extinction of responding in DA D4R KO mice was not different from that in WT littermates in either context. No differences in elasticity of food demand or extinction rate were obtained in D3R KO mice and WT littermates. These results indicate that the D2R is the primary DA D2-like receptor subtype mediating the reinforcing effectiveness of food. PMID:26205210

  17. M2-like macrophages are responsible for collagen degradation through a mannose receptor–mediated pathway

    Science.gov (United States)

    Madsen, Daniel H.; Leonard, Daniel; Masedunskas, Andrius; Moyer, Amanda; Jürgensen, Henrik Jessen; Peters, Diane E.; Amornphimoltham, Panomwat; Selvaraj, Arul; Yamada, Susan S.; Brenner, David A.; Burgdorf, Sven; Engelholm, Lars H.; Behrendt, Niels; Holmbeck, Kenn; Weigert, Roberto

    2013-01-01

    Tissue remodeling processes critically depend on the timely removal and remodeling of preexisting collagen scaffolds. Nevertheless, many aspects related to the turnover of this abundant extracellular matrix component in vivo are still incompletely understood. We therefore took advantage of recent advances in optical imaging to develop an assay to visualize collagen turnover in situ and identify cell types and molecules involved in this process. Collagen introduced into the dermis of mice underwent cellular endocytosis in a partially matrix metalloproteinase–dependent manner and was subsequently routed to lysosomes for complete degradation. Collagen uptake was predominantly executed by a quantitatively minor population of M2-like macrophages, whereas more abundant Col1a1-expressing fibroblasts and Cx3cr1-expressing macrophages internalized collagen at lower levels. Genetic ablation of the collagen receptors mannose receptor (Mrc1) and urokinase plasminogen activator receptor–associated protein (Endo180 and Mrc2) impaired this intracellular collagen degradation pathway. This study demonstrates the importance of receptor-mediated cellular uptake to collagen turnover in vivo and identifies a key role of M2-like macrophages in this process. PMID:24019537

  18. Modulation of Nrf2 by Olive Oil and Wine Polyphenols and Neuroprotection

    Directory of Open Access Journals (Sweden)

    Miriam Martínez-Huélamo

    2017-09-01

    Full Text Available Strong adherence to a Mediterranean diet is associated with improved cognitive function and a lower prevalence of mild cognitive impairment. Olive oil and red wine are rich sources of polyphenols which are responsible in part for the beneficial effects on cognitive functioning. Polyphenols induce endogenous antioxidant defense mechanisms by modulating transcription factors such as the nuclear factor (erythroid-derived 2-like 2 (Nrf2. This review discusses the scientific data supporting the modulating effect of olive oil and red wine polyphenols on Nrf2 expression, and the potential health benefits associated with cognitive functioning.

  19. Global transformation of erythrocyte properties via engagement of an SH2-like sequence in band 3.

    Science.gov (United States)

    Puchulu-Campanella, Estela; Turrini, Francesco M; Li, Yen-Hsing; Low, Philip S

    2016-11-29

    Src homology 2 (SH2) domains are composed of weakly conserved sequences of ∼100 aa that bind phosphotyrosines in signaling proteins and thereby mediate intra- and intermolecular protein-protein interactions. In exploring the mechanism whereby tyrosine phosphorylation of the erythrocyte anion transporter, band 3, triggers membrane destabilization, vesiculation, and fragmentation, we discovered a SH2 signature motif positioned between membrane-spanning helices 4 and 5. Evidence that this exposed cytoplasmic sequence contributes to a functional SH2-like domain is provided by observations that: (i) it contains the most conserved sequence of SH2 domains, GSFLVR; (ii) it binds the tyrosine phosphorylated cytoplasmic domain of band 3 (cdb3-PO 4 ) with K d = 14 nM; (iii) binding of cdb3-PO 4 to erythrocyte membranes is inhibited both by antibodies against the SH2 signature sequence and dephosphorylation of cdb3-PO 4 ; (iv) label transfer experiments demonstrate the covalent transfer of photoactivatable biotin from isolated cdb3-PO 4 (but not cdb3) to band 3 in erythrocyte membranes; and (v) phosphorylation-induced binding of cdb3-PO 4 to the membrane-spanning domain of band 3 in intact cells causes global changes in membrane properties, including (i) displacement of a glycolytic enzyme complex from the membrane, (ii) inhibition of anion transport, and (iii) rupture of the band 3-ankyrin bridge connecting the spectrin-based cytoskeleton to the membrane. Because SH2-like motifs are not retrieved by normal homology searches for SH2 domains, but can be found in many tyrosine kinase-regulated transport proteins using modified search programs, we suggest that related cases of membrane transport proteins containing similar motifs are widespread in nature where they participate in regulation of cell properties.

  20. AIM2-Like Receptors Positively and Negatively Regulate the Interferon Response Induced by Cytosolic DNA

    Directory of Open Access Journals (Sweden)

    Yuki Nakaya

    2017-07-01

    Full Text Available Cytosolic DNAs derived from retrotransposons serve as pathogen-associated molecular patterns for pattern recognition receptors (PRRs that stimulate the induction of interferons (IFNs and other cytokines, leading to autoimmune disease. Cyclic GMP-AMP synthase is one PRR that senses retrotransposon DNA, activating type I IFN responses through the stimulator of IFN genes (STING. Absent in melanoma 2 (AIM2-like receptors (ALRs have also been implicated in these pathways. Here we show that the mouse ALR IFI205 senses cytosolic retrotransposon DNA independently of cyclic GMP-AMP production. AIM2 antagonizes IFI205-mediated IFN induction activity by sequestering it from STING. We also found that the complement of genes located in the ALR locus in C57BL/6 and AIM2 knockout mice are different and unique, which has implications for interpretation of the sensing of pathogens in different mouse strains. Our data suggest that members of the ALR family are critical to the host IFN response to endogenous DNA.

  1. Th1 and Th2-like protein balance in human inflammatory radicular cysts and periapical granulomas.

    Science.gov (United States)

    de Carvalho Fraga, Carlos Alberto; Alves, Lucas Rodrigues; de Sousa, Adriana Alkmim; de Jesus, Sabrina Ferreira; Vilela, Daniel Nogueira; Pereira, Camila Santos; Batista Domingos, Patrícia Luciana; Viana, Agostinho Gonçalves; Jham, Bruno Correia; Batista de Paula, Alfredo Maurício; Sena Guimarães, André Luiz

    2013-04-01

    Chronic dental periapical lesions result from chronic inflammation of periapical tissues caused by continuous antigenic stimulation from infected root canals. Recent findings have suggested that T helper (Th) 1 and Th2-like cytokines are important in the pathogenesis of chronic periapical inflammatory diseases. However, the mechanisms regulating these immunoinflammatory pathways have not been fully elucidated. Thus, the aim of this study was to evaluate interleukin (IL)-4, IL-12, and interferon γ (IFN-γ) protein levels in human radicular cysts and periapical granulomas. Archived samples of cysts (n = 52) and granulomas (n = 27) were sectioned and submitted to immunohistochemistry to evaluate the tissue expression of IL-4, IL-12, and IFN-γ. The data were analyzed using the Mann-Whitney U test (P cysts. IL-4 expression was stronger in periapical granulomas than in radicular cysts. IL-12 was not detected in any of the samples. Our study showed that IFN-γ protein levels are increased in radicular cysts, whereas IL-4 expression is stronger in samples of periapical granulomas. Further studies are necessary to elucidate the signaling pathways mediated by these cytokines and to facilitate the development of more effective periapical disease management strategies. Copyright © 2013 American Association of Endodontists. All rights reserved.

  2. Ectopic expression of MPF2-like protein WSA206 leads to arrest in silique and seed development in heterologous host

    International Nuclear Information System (INIS)

    Khan, M.R.

    2016-01-01

    MPF2-like genes belonging to STMADS11 clade of MADS-box transcription factors are mostly involved in calyx inflation, floral reversion and fertility. However their role in fertility remained enigmatic. In this study we transformed WSA206 gene paralog - originated through genome duplication in a Solanaceous plant Withaniasomnifera - ectopically in a heterologous host Arabidopsis thaliana. Interesting phenotypes in floral organs and fruits were observed. Overexpression of WSA206 leads to arrest in silique development. The siliques were compressed and size was drastically reduced from 34mm to 3mm. Along with siliques, the seed development was also suppressed as revealed by shriveling of seeds and reduction in seed number. In extreme cases the siliques were devoid of any seeds. In cases where seeds developed, these were impaired in viability. Besides, the transgenic Arabidopsis also exhibited exorbitant growth of calyx to an extent that it resembled inflated calyx in Solanaceae. The calyx remained persistent and encapsulated the under-developed siliques containing non-viable seeds inside. Thus, fertility and sepal development are tightly coupled traits that are controlled by WSA206 paralog in heterologous system. (author)

  3. AIM2-Like Receptors Positively and Negatively Regulate the Interferon Response Induced by Cytosolic DNA.

    Science.gov (United States)

    Nakaya, Yuki; Lilue, Jingtao; Stavrou, Spyridon; Moran, Eileen A; Ross, Susan R

    2017-07-05

    Cytosolic DNAs derived from retrotransposons serve as pathogen-associated molecular patterns for pattern recognition receptors (PRRs) that stimulate the induction of interferons (IFNs) and other cytokines, leading to autoimmune disease. Cyclic GMP-AMP synthase is one PRR that senses retrotransposon DNA, activating type I IFN responses through the stimulator of IFN genes (STING). Absent in melanoma 2 (AIM2)-like receptors (ALRs) have also been implicated in these pathways. Here we show that the mouse ALR IFI205 senses cytosolic retrotransposon DNA independently of cyclic GMP-AMP production. AIM2 antagonizes IFI205-mediated IFN induction activity by sequestering it from STING. We also found that the complement of genes located in the ALR locus in C57BL/6 and AIM2 knockout mice are different and unique, which has implications for interpretation of the sensing of pathogens in different mouse strains. Our data suggest that members of the ALR family are critical to the host IFN response to endogenous DNA. IMPORTANCE Autoimmune diseases like Aicardi-Goutières syndrome and lupus erythematosus arise when cells of the immune system become activated and attack host cells and tissues. We found that DNA generated by endogenous retroviruses and retroelements in inbred mice and mouse cells is recognized by several host proteins found in macrophages that are members of the ALR family and that these proteins both suppress and activate the pathways leading to the generation of cytokines and IFNs. We also show that there is great genetic diversity between different inbred mouse strains in the ALR genes, which might contribute to differential susceptibility to autoimmunity. Understanding how immune cells become activated is important to the control of disease. Copyright © 2017 Nakaya et al.

  4. M2-like macrophage polarization in high lactic acid-producing head and neck cancer.

    Science.gov (United States)

    Ohashi, Toshimitsu; Aoki, Mitsuhiro; Tomita, Hiroyuki; Akazawa, Takashi; Sato, Katsuya; Kuze, Bunya; Mizuta, Keisuke; Hara, Akira; Nagaoka, Hitoshi; Inoue, Norimitsu; Ito, Yatsuji

    2017-06-01

    Reprogramming of glucose metabolism in tumor cells is referred to as the Warburg effect and results in increased lactic acid secretion into the tumor microenvironment. We have previously shown that lactic acid has important roles as a pro-inflammatory and immunosuppressive mediator and promotes tumor progression. In this study, we examined the relationship between the lactic acid concentration and expression of LDHA and GLUT1, which are related to the Warburg effect, in human head and neck squamous cell carcinoma (HNSCC). Tumors expressing lower levels of LDHA and GLUT1 had a higher concentration of lactic acid than those with higher LDHA and GLUT1 expression. Lactic acid also suppressed the expression of LDHA and GLUT1 in vitro. We previously reported that lactic acid enhances expression of an M2 macrophage marker, ARG1, in murine macrophages. Therefore, we investigated the relationship between the lactic acid concentration and polarization of M2 macrophages in HNSCC by measuring the expression of M2 macrophage markers, CSF1R and CD163, normalized using a pan-macrophage marker, CD68. Tumors with lower levels of CD68 showed a higher concentration of lactic acid, whereas those with higher levels of CSF1R showed a significantly higher concentration of lactic acid. A similar tendency was observed for CD163. These results suggest that tumor-secreted lactic acid is linked to the reduction of macrophages in tumors and promotes induction of M2-like macrophage polarization in human HNSCC. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  5. Extracellular matrix remodeling and matrix metalloproteinases (ajMMP-2 like and ajMMP-16 like) characterization during intestine regeneration of sea cucumber Apostichopus japonicus.

    Science.gov (United States)

    Miao, Ting; Wan, Zixuan; Sun, Lina; Li, Xiaoni; Xing, Lili; Bai, Yucen; Wang, Fang; Yang, Hongsheng

    2017-10-01

    Remodeling of extracellular matrix (ECM) regulated by matrix metalloproteinases (MMPs) is essential for tissue regeneration. In the present study, we used immunohistochemistry (IHC) techniques against ECM components to reveal changes of ECM during intestine regeneration of Apostichopus japonicus. The expression of collagen I and laminin reduced apparently from the eviscerated intestine, while fibronectin exhibited continuous expression in all regeneration stages observed. Meanwhile, we cloned two MMP genes from A. japonicus by RACE PCR. The full-length cDNA of ajMMP-2 like is 2733bp and contains a predicted open reading frame (ORF) of 1716bp encoding 572 amino acids. The full-length cDNA of ajMMP-16 like is 2705bp and contains an ORF of 1452bp encoding 484 amino acids. The predicted protein sequences of each MMP contain two conserved domains, ZnMc_MMP and HX. Homology and phylogenetic analysis revealed that ajMMP-2 like and ajMMP-16 like share high sequence similarity with MMP-2 and MMP-16 from Strongylocentrotus purpuratus, respectively. Then we investigated spatio-temporal expression of ajMMP-2 like and ajMMP-16 like during different regeneration stages by qRT-PCR and IHC. The expression pattern of them showed a roughly opposite trend from that of ECM components. According to our results, a fibronectin-dominate temporary matrix is created in intestine regeneration, and it might provide structural integrity for matrix and promote cell movement. We also hypothesize that ajMMP-2 like and ajMMP-16 like could accelerate cell migration and regulate interaction between ECM components and growth factors. This work provides new evidence of ECM and MMPs involvement in sea cucumber regeneration. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Kinetic properties and adrenergic control of TREK-2-like channels in rat medial prefrontal cortex (mPFC) pyramidal neurons.

    Science.gov (United States)

    Ładno, W; Gawlak, M; Szulczyk, P; Nurowska, E

    2017-06-15

    TREK-2-like channels were identified on the basis of electrophysiological and pharmacological tests performed on freshly isolated and enzymatically/mechanically dispersed pyramidal neurons of the rat medial prefrontal cortex (mPFC). Single-channel currents were recorded in cell-attached configuration and the impact of adrenergic receptors (α 1 , α 2 , β) stimulation on spontaneously appearing TREK-2-like channel activity was tested. The obtained results indicate that noradrenaline decreases the mean open probability of TREK-2-like channel currents by activation of β 1 but not of α 1 - and α 2 -adrenergic receptors. Mean open time and channel conductance were not affected. The system of intracellular signaling pathways depends on the activation of protein kinase A. We also show that adrenergic control of TREK-2-like channel currents by adrenergic receptors was similar in pyramidal neurons isolated from young, adolescent, and adult rats. Immunofluorescent confocal scans of mPFC slices confirmed the presence of the TREK-2 protein, which was abundant in layer V pyramidal neurons. The role of TREK-2-like channel control by adrenergic receptors is discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Th1- and Th2-like subsets of innate lymphoid cells

    NARCIS (Netherlands)

    Bernink, Jochem; Mjösberg, Jenny; Spits, Hergen

    2013-01-01

    Innate lymphoid cells (ILCs) constitute a family of effectors in innate immunity and regulators of tissue remodeling that have a cytokine and transcription factor expression pattern that parallels that of the T-helper (Th) cell family. Here, we discuss how ILCs can be categorized and summarize the

  8. Bardoxolone methyl in type 2 diabetes and stage 4 chronic kidney disease

    DEFF Research Database (Denmark)

    de Zeeuw, Dick; Akizawa, Tadao; Audhya, Paul

    2013-01-01

    Although inhibitors of the renin-angiotensin-aldosterone system can slow the progression of diabetic kidney disease, the residual risk is high. Whether nuclear 1 factor (erythroid-derived 2)-related factor 2 activators further reduce this risk is unknown....

  9. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  10. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  11. VO{sub 2}-like thermo-optical switching effect in one-dimensional nonlinear defective photonic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Juan, E-mail: juanzhang@staff.shu.edu.cn, E-mail: ywang@siom.ac.cn; Zhang, Rongjun [Key Laboratory of Specialty Fiber Optics and Optical Access Networks, School of Communication and Information Engineering, Shanghai University, Shanghai 200072 (China); Wang, Yang, E-mail: juanzhang@staff.shu.edu.cn, E-mail: ywang@siom.ac.cn [Key Laboratory of High Power Laser Materials, Shanghai Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, Shanghai 201800 (China)

    2015-06-07

    A new approach to achieve VO{sub 2}-like thermo-optical switching in a one-dimensional photonic crystal by the combination of thermo-optical and optical Kerr effects was proposed and numerically demonstrated in this study. The switching temperature and the hysteresis width can be tuned in a wide temperature range. Steep transition, high optical contrast, and low pumping power can be achieved at the same time. This kind of one-dimensional photonic crystal-based bistable switch will be low-cost, easy-to-fabricate, and versatile in practical applications compared with traditional VO{sub 2}-type one.

  12. Sheeppox virus SPPV14 encodes a Bcl-2-like cell death inhibitor that counters a distinct set of mammalian proapoptotic proteins.

    Science.gov (United States)

    Okamoto, Toru; Campbell, Stephanie; Mehta, Ninad; Thibault, John; Colman, Peter M; Barry, Michele; Huang, David C S; Kvansakul, Marc

    2012-11-01

    Many viruses express inhibitors of programmed cell death (apoptosis), thereby countering host defenses that would otherwise rapidly clear infected cells. To counter this, viruses such as adenoviruses and herpesviruses express recognizable homologs of the mammalian prosurvival protein Bcl-2. In contrast, the majority of poxviruses lack viral Bcl-2 (vBcl-2) homologs that are readily identified by sequence similarities. One such virus, myxoma virus, which is the causative agent of myxomatosis, expresses a virulence factor that is a potent inhibitor of apoptosis. In spite of the scant sequence similarity to Bcl-2, myxoma virus M11L adopts an almost identical 3-dimensional fold. We used M11L as bait in a sequence similarity search for other Bcl-2-like proteins and identified six putative vBcl-2 proteins from poxviruses. Some are potent inhibitors of apoptosis, in particular sheeppox virus SPPV14, which inhibited cell death induced by multiple agents. Importantly, SPPV14 compensated for the loss of antiapoptotic F1L in vaccinia virus and acts to directly counter the cell death mediators Bax and Bak. SPPV14 also engages a unique subset of the death-promoting BH3-only ligands, including Bim, Puma, Bmf, and Hrk. This suggests that SPPV14 may have been selected for specific biological roles as a virulence factor for sheeppox virus.

  13. An Ime2-like mitogen-activated protein kinase is involved in cellulase expression in the filamentous fungus Trichoderma reesei.

    Science.gov (United States)

    Chen, Fei; Chen, Xiu-Zhen; Su, Xiao-Yun; Qin, Li-Na; Huang, Zhen-Bang; Tao, Yong; Dong, Zhi-Yang

    2015-10-01

    Eukaryotic mitogen-activated protein kinases (MAPKs) play crucial roles in transducing environmental and developmental signals inside the cell and regulating gene expression, however, the roles of MAPKs remain largely unknown in Trichoderma reesei. T. reesei ime2 (TrIme2) encodes an Ime2-like MAPK in T. reesei. The deletion of the TrIme2 gene led to 90% increase in cellulase activity against filter paper during earlier period time of cellulase induction as well as the extracellular protein production. Compared to the parent strain, the transcriptional levels of the three major cellulase genes cbh1,cbh2, egl1 were increased by about 9 times, 4 times, 2 times, respectively, at 8 h after cellulase induction in the ΔTrIme2 mutant. In addition, the disruption of TrIme2 caused over 50% reduction of the transcript levels of cellulase transcriptional regulators cre1 and xyr1. TrIme2 functions in regulation of the expression of cellulase gene in T.reesei, and is a good candidate for genetically engineering of T. reesei for higher cellulase production.

  14. Stress Hormone Cortisol Enhances Bcl2 Like-12 Expression to Inhibit p53 in Hepatocellular Carcinoma Cells.

    Science.gov (United States)

    Wu, Weizhong; Liu, Sanguang; Liang, Yunfei; Zhou, Zegao; Bian, Wei; Liu, Xueqing

    2017-12-01

    The pathogenesis of hepatocellular carcinoma (HC) is unclear. It is suggested that psychological stress associates with the pathogenesis of liver cancer. Bcl2-like protein 12 (Bcl2L12) suppresses p53 protein. This study tests a hypothesis that the major stress hormone, cortisol, inhibits the expression of p53 in HC cells (HCC) via up regulating the expression of Bcl2L12. Peripheral blood samples were collected from patients with HC to be analyzed for the levels of cortisol. HCC were cultured to assess the role of cortisol in the regulation of the expression of Bcl2L12 and p53 in HCC. We observed that the serum cortisol levels were higher in HC patients. Expression of Bcl2L12 in HCC was correlated with serum cortisol. Cortisol enhanced the Bcl2L12 expression in HCC. Bcl2L12 binding to the TP53 promoter was correlated with p53 expression in HCC. Cortisol increased the Bcl2L12 expression in HCC to inhibit p53 expression. Stress hormone cortisol suppresses p53 in HCC via enhancing Bcl2L12 expression in HCC. The results suggest that cortisol may be a therapeutic target for the treatment of HC.

  15. An Impermeant Ganetespib Analog Inhibits Extracellular Hsp90-Mediated Cancer Cell Migration that Involves Lysyl Oxidase 2-like Protein

    Energy Technology Data Exchange (ETDEWEB)

    McCready, Jessica [Department of Natural Sciences, Assumption College, Worcester, MA 01609 (United States); Wong, Daniel S. [Department of Developmental Molecular and Chemical Biology, Tufts University School of Medicine, Boston, MA 02111 (United States); Cell and Molecular Physiology Program, Sackler School of Graduate Biomedical Sciences, Tufts University, Boston, MA 02111 (United States); Burlison, Joseph A.; Ying, Weiwen [Synta Pharmaceuticals, Lexington, MA 02421 (United States); Jay, Daniel G., E-mail: daniel.jay@tufts.edu [Department of Developmental Molecular and Chemical Biology, Tufts University School of Medicine, Boston, MA 02111 (United States); Cell and Molecular Physiology Program, Sackler School of Graduate Biomedical Sciences, Tufts University, Boston, MA 02111 (United States)

    2014-04-30

    Extracellular Hsp90 (eHsp90) activates a number of client proteins outside of cancer cells required for migration and invasion. Therefore, eHsp90 may serve as a novel target for anti-metastatic drugs as its inhibition using impermeant Hsp90 inhibitors would not affect the numerous vital intracellular Hsp90 functions in normal cells. While some eHsp90 clients are known, it is important to establish other proteins that act outside the cell to validate eHsp90 as a drug target to limit cancer spread. Using mass spectrometry we identified two precursor proteins Galectin 3 binding protein (G3BP) and Lysyl oxidase 2-like protein (LOXL2) that associate with eHsp90 in MDA-MB231 breast cancer cell conditioned media and confirmed that LOXL2 binds to eHsp90 in immunoprecipitates. We introduce a novel impermeant Hsp90 inhibitor STA-12-7191 derived from ganetespib and show that it is markedly less toxic to cells and can inhibit cancer cell migration in a dose dependent manner. We used STA-12-7191 to test if LOXL2 and G3BP are potential eHsp90 clients. We showed that while LOXL2 can increase wound healing and compensate for STA-12-7191-mediated inhibition of wound closure, addition of G3BP had no affect on this assay. These findings support of role for LOXL2 in eHsp90 stimulated cancer cell migration and provide preliminary evidence for the use of STA-12-7191 to inhibit eHsp90 to limit cancer invasion.

  16. Dopamine suppresses neuronal activity of Helisoma B5 neurons via a D2-like receptor, activating PLC and K channels.

    Science.gov (United States)

    Zhong, L R; Artinian, L; Rehder, V

    2013-01-03

    Dopamine (DA) plays fundamental roles as a neurotransmitter and neuromodulator in the central nervous system. How DA modulates the electrical excitability of individual neurons to elicit various behaviors is of great interest in many systems. The buccal ganglion of the freshwater pond snail Helisoma trivolvis contains the neuronal circuitry for feeding and DA is known to modulate the feeding motor program in Helisoma. The buccal neuron B5 participates in the control of gut contractile activity and is surrounded by dopaminergic processes, which are expected to release DA. In order to study whether DA modulates the electrical activity of individual B5 neurons, we performed experiments on physically isolated B5 neurons in culture and on B5 neurons within the buccal ganglion in situ. We report that DA application elicited a strong hyperpolarization in both conditions and turned the electrical activity from a spontaneously firing state to an electrically silent state. Using the cell culture system, we demonstrated that the strong hyperpolarization was inhibited by the D2 receptor antagonist sulpiride and the phospholipase C (PLC) inhibitor U73122, indicating that DA affected the membrane potential of B5 neurons through the activation of a D2-like receptor and PLC. Further studies revealed that the DA-induced hyperpolarization was inhibited by the K channel blockers 4-aminopyridine and tetraethylammonium, suggesting that K channels might serve as the ultimate target of DA signaling. Through its modulatory effect on the electrical activity of B5 neurons, the release of DA in vivo may contribute to a neuronal output that results in a variable feeding motor program. Copyright © 2012 IBRO. Published by Elsevier Ltd. All rights reserved.

  17. Th2-like chemokine levels are increased in allergic children and influenced by maternal immunity during pregnancy.

    Science.gov (United States)

    Abelius, Martina S; Lempinen, Esma; Lindblad, Karin; Ernerudh, Jan; Berg, Göran; Matthiesen, Leif; Nilsson, Lennart J; Jenmalm, Maria C

    2014-06-01

    The influence of the intra-uterine environment on the immunity and allergy development in the offspring is unclear. We aimed to investigate (i) whether the pregnancy magnifies the Th2 immunity in allergic and non-allergic women, (ii) whether the maternal chemokine levels during pregnancy influenced the offspring's chemokine levels during childhood and (iii) the relationship between circulating Th1/Th2-associated chemokines and allergy in mothers and children. The Th1-associated chemokines CXCL9, CXCL10, CXCL11, and the Th2-associated chemokines CCL17, CCL18 and CCL22 were quantified by Luminex and ELISA in 20 women with and 36 women without allergic symptoms at gestational week (gw) 10-12, 15-16, 25, 35, 39 and 2 and 12 months post-partum and in their children at birth, 6, 12, 24 months and 6 years of age. Total IgE levels were measured using ImmunoCAP Technology. The levels of the Th2-like chemokines were not magnified by pregnancy. Instead decreased levels were shown during pregnancy (irrespectively of maternal allergy status) as compared to post-partum. In the whole group, the Th1-like chemokine levels were higher at gw 39 than during the first and second trimester and post-partum. Maternal CXCL11, CCL18 and CCL22 levels during and after pregnancy correlated with the corresponding chemokines in the offspring during childhood. Increased CCL22 and decreased CXCL10 levels in the children were associated with sensitisation and increased CCL17 levels with allergic symptoms during childhood. Maternal chemokine levels were not associated with maternal allergic disease. Allergic symptoms and sensitisation were associated with decreased Th1- and increased Th2-associated chemokine levels during childhood, indicating a Th2 shift in the allergic children, possibly influenced by the maternal immunity during pregnancy. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Incorporating Sentinel-2-like remote sensing products in the hydrometeorological modelling over an agricultural area in south west France

    Science.gov (United States)

    Rivalland, Vincent; Gascoin, Simon; Etchanchu, Jordi; Coustau, Mathieu; Cros, Jérôme; Tallec, Tiphaine

    2016-04-01

    The Sentinel-2 mission will enable to monitor the land cover and the vegetation phenology at high-resolution (HR) every 5 days. However, current Land Surface Models (LSM) typically use land cover and vegetation parameters derived from previous low to mid resolution satellite missions. Here we studied the effect of introducing Sentinel-2-like data in the simulation of the land surface energy and water fluxes in a region dominated by cropland. Simulations were performed with the ISBA-SURFEX LSM, which is used in the operational hydrometeorological chain of Meteo-France for hydrological forecasts and drought monitoring. By default, SURFEX vegetation land surface parameters and temporal evolution are from the ECOCLIMAP II European database mostly derived from MODIS products at 1 km resolution. The model was applied to an experimental area of 30 km by 30 km in south west France. In this area the resolution of ECOCLIMAP is coarser than the typical size of a crop field. This means that several crop types can be mixed in a pixel. In addition ECOCLIMAP provides a climatology of the vegetation phenology and thus does not account for the interannual effects of the climate and land management on the crop growth. In this work, we used a series of 26 Formosat-2 images at 8-m resolution acquired in 2006. From this dataset, we derived a land cover map and a leaf area index map (LAI) at each date, which were substituted to the ECOCLIMAP land cover map and the LAI maps. The model output water and energy fluxes were compared to a standard simulation using ECOCLIMAP only and to in situ measurements of soil moisture, latent and sensible heat fluxes. The results show that the introduction of the HR products improved the timing of the evapotranspiration. The impact was the most visible on the crops having a growing season in summer (maize, sunflower), because the growth period is more sensitive to the climate.

  19. An Impermeant Ganetespib Analog Inhibits Extracellular Hsp90-Mediated Cancer Cell Migration that Involves Lysyl Oxidase 2-like Protein

    International Nuclear Information System (INIS)

    McCready, Jessica; Wong, Daniel S.; Burlison, Joseph A.; Ying, Weiwen; Jay, Daniel G.

    2014-01-01

    Extracellular Hsp90 (eHsp90) activates a number of client proteins outside of cancer cells required for migration and invasion. Therefore, eHsp90 may serve as a novel target for anti-metastatic drugs as its inhibition using impermeant Hsp90 inhibitors would not affect the numerous vital intracellular Hsp90 functions in normal cells. While some eHsp90 clients are known, it is important to establish other proteins that act outside the cell to validate eHsp90 as a drug target to limit cancer spread. Using mass spectrometry we identified two precursor proteins Galectin 3 binding protein (G3BP) and Lysyl oxidase 2-like protein (LOXL2) that associate with eHsp90 in MDA-MB231 breast cancer cell conditioned media and confirmed that LOXL2 binds to eHsp90 in immunoprecipitates. We introduce a novel impermeant Hsp90 inhibitor STA-12-7191 derived from ganetespib and show that it is markedly less toxic to cells and can inhibit cancer cell migration in a dose dependent manner. We used STA-12-7191 to test if LOXL2 and G3BP are potential eHsp90 clients. We showed that while LOXL2 can increase wound healing and compensate for STA-12-7191-mediated inhibition of wound closure, addition of G3BP had no affect on this assay. These findings support of role for LOXL2 in eHsp90 stimulated cancer cell migration and provide preliminary evidence for the use of STA-12-7191 to inhibit eHsp90 to limit cancer invasion

  20. Guanine nucleotide-binding protein subunit beta-2-like 1, a new Annexin A7 interacting protein

    International Nuclear Information System (INIS)

    Du, Yue; Meng, Jinyi; Huang, Yuhong; Wu, Jun; Wang, Bo; Ibrahim, Mohammed M.; Tang, Jianwu

    2014-01-01

    Highlights: • RACK1 formed a complex with Annexin A7. • Depletion of RACK1 inhibited the proliferation, migration and invasion. • RACK1 RNAi abolished RACK1-Annexin A7 interaction. • RACK1-Annexin A7 may play a role in regulating the metastatic potentials. - Abstract: We report for the first time that Guanine nucleotide-binding protein subunit beta-2-like 1 (RACK1) formed a complex with Annexin A7. Hca-F and Hca-P are a pair of syngeneic mouse hepatocarcinoma cell lines established and maintained in our laboratory. Our previous study showed that both Annexin A7 and RACK1 were expressed higher in Hca-F (lymph node metastasis >70%) than Hca-P (lymph node metastasis <30%). Suppression of Annexin A7 expression in Hca-F cells induced decreased migration and invasion ability. In this study, knockdown of RACK1 by RNA interference (RNAi) had the same impact on metastasis potential of Hca-F cells as Annexin A7 down-regulation. Furthermore, by co-immunoprecipitation and double immunofluorescence confocal imaging, we found that RACK1 was in complex with Annexin A7 in control cells, but not in the RACK1-down-regulated cells, indicating the abolishment of RACK1-Annexin A7 interaction in Hca-F cells by RACK1 RNAi. Taken together, these results suggest that RACK1-Annexin A7 interaction may be one of the means by which RACK1 and Annexin A7 influence the metastasis potential of mouse hepatocarcinoma cells in vitro

  1. D2-like receptors in the descending dopaminergic pathway are not involved in the decreased postoperative nociceptive threshold induced by plantar incision in adult rats

    Directory of Open Access Journals (Sweden)

    Ohtani N

    2016-10-01

    Full Text Available Norimasa Ohtani, Eiji Masaki Division of Dento-oral Anesthesiology, Tohoku University Graduate School of Dentistry, Sendai, Miyagi, Japan Background: Approximately half of all patients who undergo surgery develop postoperative pain, the mechanisms of which are not well understood by anesthesiologists. D2-like receptors in the descending dopaminergic pathway play an important role in regulation of pain transmission in the spinal cord. Impairment of inhibitory neurons in the spinal cord is suggested as part of the mechanism for neuropathic pain, which is one component of postoperative pain. The purpose of this study was to investigate whether impairment of D2-like receptors in the descending dopaminergic pathway in the spinal cord is involved in the decreased postoperative nociceptive threshold in rats.Methods: Male Sprague-Dawley rats (250–300 g were anesthetized with sevoflurane and an intrathecal (IT catheter was implanted. Six days later, a plantar incision was made. On the following day, saline, a D2-like receptor agonist (quinpirole, or a D2-like receptor antagonist (sulpiride was administered intrathecally. Thermal and mechanical nociceptive responses were assessed by exposure to infrared radiant heat and the von Frey filament test before and after plantar incision.Results: Plantar incision decreased both thermal latency and the mechanical nociceptive threshold. IT administration of quinpirole inhibited the nociceptive responses induced by plantar incision, but sulpiride had no effect.Conclusion: A D2-like receptor agonist had antinociceptive effects on the hypersensitivity response triggered by a surgical incision, but a D2-like receptor antagonist had no effect on this response. These results suggest that impairment and/or modification of D2-like receptors in the descending dopaminergic pathway in the spinal cord is not involved in the postoperative decrease in nociceptive threshold. Keywords: postoperative pain, descending pathway

  2. D2-like receptors in the descending dopaminergic pathway are not involved in the decreased postoperative nociceptive threshold induced by plantar incision in adult rats.

    Science.gov (United States)

    Ohtani, Norimasa; Masaki, Eiji

    2016-01-01

    Approximately half of all patients who undergo surgery develop postoperative pain, the mechanisms of which are not well understood by anesthesiologists. D2-like receptors in the descending dopaminergic pathway play an important role in regulation of pain transmission in the spinal cord. Impairment of inhibitory neurons in the spinal cord is suggested as part of the mechanism for neuropathic pain, which is one component of postoperative pain. The purpose of this study was to investigate whether impairment of D2-like receptors in the descending dopaminergic pathway in the spinal cord is involved in the decreased postoperative nociceptive threshold in rats. Male Sprague-Dawley rats (250-300 g) were anesthetized with sevoflurane and an intrathecal (IT) catheter was implanted. Six days later, a plantar incision was made. On the following day, saline, a D2-like receptor agonist (quinpirole), or a D2-like receptor antagonist (sulpiride) was administered intrathecally. Thermal and mechanical nociceptive responses were assessed by exposure to infrared radiant heat and the von Frey filament test before and after plantar incision. Plantar incision decreased both thermal latency and the mechanical nociceptive threshold. IT administration of quinpirole inhibited the nociceptive responses induced by plantar incision, but sulpiride had no effect. A D2-like receptor agonist had antinociceptive effects on the hypersensitivity response triggered by a surgical incision, but a D2-like receptor antagonist had no effect on this response. These results suggest that impairment and/or modification of D2-like receptors in the descending dopaminergic pathway in the spinal cord is not involved in the postoperative decrease in nociceptive threshold.

  3. The APETALA-2-like transcription factor OsAP2-39 controls key interactions between abscisic acid and gibberellin in rice.

    Science.gov (United States)

    Yaish, Mahmoud W; El-Kereamy, Ashraf; Zhu, Tong; Beatty, Perrin H; Good, Allen G; Bi, Yong-Mei; Rothstein, Steven J

    2010-09-09

    The interaction between phytohormones is an important mechanism which controls growth and developmental processes in plants. Deciphering these interactions is a crucial step in helping to develop crops with enhanced yield and resistance to environmental stresses. Controlling the expression level of OsAP2-39 which includes an APETALA 2 (AP2) domain leads to phenotypic changes in rice. Overexpression of OsAP2-39 leads to a reduction in yield by decreasing the biomass and the number of seeds in the transgenic rice lines. Global transcriptome analysis of the OsAP2-39 overexpression transgenic rice revealed the upregulation of a key abscisic acid (ABA) biosynthetic gene OsNCED-I which codes for 9-cis-epoxycarotenoid dioxygenase and leads to an increase in the endogenous ABA level. In addition to OsNCED-1, the gene expression analysis revealed the upregulation of a gene that codes for the Elongation of Upper most Internode (EUI) protein, an enzyme that catalyzes 16α, 17-epoxidation of non-13-hydroxylated GAs, which has been shown to deactivate gibberellins (GAs) in rice. The exogenous application of GA restores the wild-type phenotype in the transgenic line and ABA application induces the expression of EUI and suppresses the expression of OsAP2-39 in the wild-type line. These observations clarify the antagonistic relationship between ABA and GA and illustrate a mechanism that leads to homeostasis of these hormones. In vivo and in vitro analysis showed that the expression of both OsNCED-1 and EUI are directly controlled by OsAP2-39. Together, these results reveal a novel mechanism for the control of the ABA/GA balance in rice which is regulated by OsAP2-39 that in turn regulates plant growth and seed production.

  4. The APETALA-2-like transcription factor OsAP2-39 controls key interactions between abscisic acid and gibberellin in rice.

    Directory of Open Access Journals (Sweden)

    Mahmoud W Yaish

    2010-09-01

    Full Text Available The interaction between phytohormones is an important mechanism which controls growth and developmental processes in plants. Deciphering these interactions is a crucial step in helping to develop crops with enhanced yield and resistance to environmental stresses. Controlling the expression level of OsAP2-39 which includes an APETALA 2 (AP2 domain leads to phenotypic changes in rice. Overexpression of OsAP2-39 leads to a reduction in yield by decreasing the biomass and the number of seeds in the transgenic rice lines. Global transcriptome analysis of the OsAP2-39 overexpression transgenic rice revealed the upregulation of a key abscisic acid (ABA biosynthetic gene OsNCED-I which codes for 9-cis-epoxycarotenoid dioxygenase and leads to an increase in the endogenous ABA level. In addition to OsNCED-1, the gene expression analysis revealed the upregulation of a gene that codes for the Elongation of Upper most Internode (EUI protein, an enzyme that catalyzes 16α, 17-epoxidation of non-13-hydroxylated GAs, which has been shown to deactivate gibberellins (GAs in rice. The exogenous application of GA restores the wild-type phenotype in the transgenic line and ABA application induces the expression of EUI and suppresses the expression of OsAP2-39 in the wild-type line. These observations clarify the antagonistic relationship between ABA and GA and illustrate a mechanism that leads to homeostasis of these hormones. In vivo and in vitro analysis showed that the expression of both OsNCED-1 and EUI are directly controlled by OsAP2-39. Together, these results reveal a novel mechanism for the control of the ABA/GA balance in rice which is regulated by OsAP2-39 that in turn regulates plant growth and seed production.

  5. Spatial reversal learning in chronically sensitized rats and in undrugged sensitized rats with dopamine D2-like receptor agonist quinpirole

    Czech Academy of Sciences Publication Activity Database

    Hatalová, Hana; Radostová, Dominika; Pištíková, Adéla; Valeš, Karel; Stuchlík, Aleš

    2014-01-01

    Roč. 8, APR 11 (2014), s. 122 ISSN 1662-5153 R&D Projects: GA MZd(CZ) NT13386; GA ČR(CZ) GA14-03627S Institutional support: RVO:67985823 Keywords : flexibility * reversal * rats * quinpirol * obsessive-compulsive disorder Subject RIV: FH - Neurology Impact factor: 3.270, year: 2014

  6. In the Blink of an Eye: Relating Positive-Feedback Sensitivity to Striatal Dopamine D2-Like Receptors through Blink Rate

    Science.gov (United States)

    Groman, Stephanie M.; James, Alex S.; Seu, Emanuele; Tran, Steven; Clark, Taylor A.; Harpster, Sandra N.; Crawford, Maverick; Burtner, Joanna Lee; Feiler, Karen; Roth, Robert H.; Elsworth, John D.; London, Edythe D.

    2014-01-01

    For >30 years, positron emission tomography (PET) has proven to be a powerful approach for measuring aspects of dopaminergic transmission in the living human brain; this technique has revealed important relationships between dopamine D2-like receptors and dimensions of normal behavior, such as human impulsivity, and psychopathology, particularly behavioral addictions. Nevertheless, PET is an indirect estimate that lacks cellular and functional resolution and, in some cases, is not entirely pharmacologically specific. To identify the relationships between PET estimates of D2-like receptor availability and direct in vitro measures of receptor number, affinity, and function, we conducted neuroimaging and behavioral and molecular pharmacological assessments in a group of adult male vervet monkeys. Data gathered from these studies indicate that variation in D2-like receptor PET measurements is related to reversal-learning performance and sensitivity to positive feedback and is associated with in vitro estimates of the density of functional dopamine D2-like receptors. Furthermore, we report that a simple behavioral measure, eyeblink rate, reveals novel and crucial links between neuroimaging assessments and in vitro measures of dopamine D2 receptors. PMID:25339755

  7. Expression, refolding and crystallizations of the Grb2-like (GADS) C-terminal SH3 domain complexed with a SLP-76 motif peptide

    International Nuclear Information System (INIS)

    Faravelli, Alessandro; Dimasi, Nazzareno

    2005-01-01

    Several crystals of the Grb2-like C-terminal SH3 domain in complex with a motif peptide from the SLP-76 protein were obtained and characterized. The Grb2-like adaptor protein GADS is composed of an N-terminal SH3 domain, an SH2 domain, a proline-rich region and a C-terminal SH3 domain. GADS interacts through its C-terminal SH3 domain with the adaptor protein SLP-76, thus recruiting this protein and other associated molecules to the linker for activation of T-cell (LAT) protein. The DNA encoding the C-terminal SH3 domain of GADS (GADS-cSH3) was assembled synthetically using a recursive PCR technique and the protein was overexpressed in Escherichia coli, refolded and purified. Several crystals of this domain in complex with the SLP-76 peptide were obtained and characterized

  8. Thymic irradiation inhibits the rapid recovery of TH1 but not TH2-like functions of CD4+ T cells after total lymphoid irradiation

    International Nuclear Information System (INIS)

    Bass, H.; Adkins, B.; Strober, S.

    1991-01-01

    Four to six weeks after total lymphoid irradiation (TLI), there is a selective deficit in the CD4+ T cells which secrete IL-2, proliferate in the MLR, and induce GVHD (Th1-like functions). A similar deficit in CD4+ T cells which secrete IL-4 and help antibody responses (Th2-like functions) is not observed. In the present study, shielding of the thymus with lead during TLI increased the Th1-like functions of CD4+ cells. Mice without thymus shields showed a marked selective reduction in the medullary stromal cells identified with the monoclonal antibody, MD1, and the severe reduction was prevented with thymus shields. Thus, shielding the thymus prevents the depletion of thymic medullary stromal cells and allows for a rapid recovery of Th1-like functions in the mouse spleen after TLI. Th2-like functions recover rapidly after TLI whether or not the thymus is irradiated

  9. 1-Oleoyl-2-acetylglycerol stimulates 5-lipoxygenase activity via a putative (phospho)lipid binding site within the N-terminal C2-like domain.

    Science.gov (United States)

    Hörnig, Christina; Albert, Dana; Fischer, Lutz; Hörnig, Michael; Rådmark, Olof; Steinhilber, Dieter; Werz, Oliver

    2005-07-22

    5-Lipoxygenase (5-LO) catalysis is positively regulated by Ca2+ ions and phospholipids that both act via the N-terminal C2-like domain of 5-LO. Previously, we have shown that 1-oleoyl-2-acetylglycerol (OAG) functions as an agonist for human polymorphonuclear leukocytes (PMNL) in stimulating 5-LO product formation. Here we have demonstrated that OAG directly stimulates 5-LO catalysis in vitro. In the absence of Ca2+ (chelated using EDTA), OAG strongly and concentration-dependently stimulated crude 5-LO in 100,000 x g supernatants as well as purified 5-LO enzyme from PMNL. Also, the monoglyceride 1-O-oleyl-rac-glycerol and 1,2-dioctanoyl-sn-glycerol were effective, whereas various phospholipids did not stimulate 5-LO. However, in the presence of Ca2+, OAG caused no stimulation of 5-LO. Also, phospholipids or cellular membranes abolished the effects of OAG. As found previously for Ca2+, OAG renders 5-LO activity resistant against inhibition by glutathione peroxidase activity, and this effect of OAG is reversed by phospholipids. Intriguingly, a 5-LO mutant lacking tryptophan residues (Trp-13, -75, and -102) important for the binding of the 5-LO C2-like domain to phospholipids was not stimulated by OAG. We conclude that OAG directly stimulates 5-LO by acting at a phospholipid binding site located within the C2-like domain.

  10. Dopamine D2-like receptors (DRD2 and DRD4) in chickens: Tissue distribution, functional analysis, and their involvement in dopamine inhibition of pituitary prolactin expression.

    Science.gov (United States)

    Lv, Can; Mo, Chunheng; Liu, Haikun; Wu, Chao; Li, Zhengyang; Li, Juan; Wang, Yajun

    2018-04-20

    Dopamine (DA) D2-like (and D1-like) receptors are suggested to mediate the dopamine actions in the anterior pituitary and/or CNS of birds. However, the information regarding the structure, functionality, and expression of avian D2-like receptors have not been fully characterized. In this study, we cloned two D2-like receptors (cDRD2, cDRD4) from chicken brain using RACE PCR. The cloned cDRD4 is a 378-amino acid receptor, which shows 57% amino acid (a.a.) identity with mouse DRD4. As in mammals, two cDRD2 isoforms, cDRD2L (long isoform, 437 a.a.) and cDRD2S (short isoform, 408 a.a.), which differ in their third intracellular loop, were identified in chickens. Using cell-based luciferase reporter assays or Western blot, we demonstrated that cDRD4, cDRD2L and cDRD2S could be activated by dopamine and quinpirole (a D2-like receptor agonist) dose-dependently, and their activation inhibits cAMP signaling pathway and stimulates MAPK/ERK signaling cascade, indicating that they are functional receptors capable of mediating dopamine actions. Quantitative real-time PCR revealed that cDRD2 and cDRD4 are widely expressed in chicken tissues with abundant expression noted in anterior pituitary, and their expressions are likely controlled by their promoters near exon 1, as demonstrated by dual-luciferase reporter assays in DF-1 cells. In accordance with cDRD2/cDRD4 expression in the pituitary, DA or quinpirole could partially inhibit vasoactive intestinal peptide-induced prolactin expression in cultured chick pituitary cells. Together, our data proves the functionality of DRD2 and DRD4 in birds and aids to uncover the conserved roles of DA/D2-like receptor system in vertebrates, such as its action on the pituitary. Copyright © 2018. Published by Elsevier B.V.

  11. Role of D1- and D2-like dopaminergic receptors in the nucleus accumbens in modulation of formalin-induced orofacial pain: Involvement of lateral hypothalamus.

    Science.gov (United States)

    Shafiei, Iman; Vatankhah, Mahsaneh; Zarepour, Leila; Ezzatpanah, Somayeh; Haghparast, Abbas

    2018-05-01

    The role of dopaminergic system in modulation of formalin-induced orofacial nociception has been established. The present study aims to investigate the role of dopaminergic receptors in the nucleus accumbens (NAc) in modulation of nociceptive responses induced by formalin injection in the orofacial region. One hundred and six male Wistar rats were unilaterally implanted with two cannulae into the lateral hypothalamus (LH) and NAc. Intra-LH microinjection of carbachol, a cholinergic receptor agonist, was done 5min after intra-accumbal administration of different doses of SCH23390 (D1-like receptor antagonist) or sulpiride (D2-like receptor antagonist). After 5min, 50μl of 1% formalin was subcutaneously injected into the upper lip for inducing the orofacial pain. Carbachol alone dose-dependently reduced both phases of the formalin-induced orofacial pain. Intra-accumbal administration of SCH23390 (0.25, 1 and 4μg/0.5μl saline) or sulpiride (0.25, 1 and 4μg/0.5μl DMSO) before LH stimulation by carbachol (250nM/0.5μl saline) antagonized the antinociceptive responses during both phases of orofacial formalin test. The effects of D1- and D2-like receptor antagonism on the LH stimulation-induced antinociception were almost similar during the early phase. However, compared to D1-like receptor antagonism, D2-like receptor antagonism was a little more effective but not significant, at blocking the LH stimulation-induced antinociception during the late phase of formalin test. The findings revealed that there is a direct or indirect neural pathway from the LH to the NAc which is at least partially contributed to the modulation of formalin-induced orofacial nociception through recruitment of both dopaminergic receptors in this region. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Novel Au- and Ge-based two-dimensional materials formed through topotactic transitions of AlB2-like structures

    Science.gov (United States)

    Tsetseris, Leonidas

    2016-07-01

    The topotactic reaction of a layered compound, for example CaGe2, with HCl solution is a common and facile method to produce two-dimensional (2D) materials. In this work we demonstrate with first-principles calculations that this technique can potentially lead to a whole new family of 2D materials starting from three-dimensional crystals with AlB2-like structures. As representative cases, we show here that the de-intercalation of Sc and Ca atoms from ScAuGe and Ca2AuGe3 crystals is strongly exothermic and produces the stable 2D monolayers AuGeH and AuGe3H3, respectively. Remarkably, both metals (AuGeH) and semiconductors (AuGe3H3) can be prepared by this method. Based on the broad availability of AlB2-like structures with varying stoichiometries, there are several possibilities to prepare novel functional 2D materials with suitable topotactic transitions.

  13. Validation of the reference tissue model for estimation of dopaminergic D{sub 2}-like receptor binding with [{sup 18}F](N-methyl)benperidol in humans

    Energy Technology Data Exchange (ETDEWEB)

    Antenor-Dorsey, Jo Ann V. [Department of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, MO (United States); Markham, Joanne; Moerlein, Stephen M. [Department of Radiology, Washington University School of Medicine, St. Louis, MO (United States); Videen, Tom O. [Department of Radiology, Washington University School of Medicine, St. Louis, MO (United States); Department of Neurology, Washington University School of Medicine, St. Louis, MO (United States); Perlmutter, Joel S. [Department of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, MO (United States); Department of Radiology, Washington University School of Medicine, St. Louis, MO (United States); Department of Neurology, Washington University School of Medicine, St. Louis, MO (United States); Program in Physical Therapy, Washington University School of Medicine, St. Louis, MO (United States)], E-mail: joel@npg.wustl.edu

    2008-04-15

    Positron emission tomography measurements of dopaminergic D{sub 2}-like receptors may provide important insights into disorders such as Parkinson's disease, schizophrenia, dystonia and Tourette's syndrome. The positron emission tomography (PET) radioligand [{sup 18}F](N-methyl)benperidol ([{sup 18}F]NMB) has high affinity and selectivity for D{sub 2}-like receptors and is not displaced by endogenous dopamine. The goal of this study is to evaluate the use of a graphical method utilizing a reference tissue region for [{sup 18}F]-NMB PET analysis by comparisons to an explicit three-compartment tracer kinetic model and graphical method that use arterial blood measurements. We estimated binding potential (BP) in the caudate and putamen using all three methods in 16 humans and found that the three-compartment tracer kinetic method provided the highest BP estimates while the graphical method using a reference region yielded the lowest estimates (P<.0001 by repeated-measures ANOVA). However, the three methods yielded highly correlated BP estimates for the two regions of interest. We conclude that the graphical method using a reference region still provides a useful estimate of BP comparable to methods using arterial blood sampling, especially since the reference region method is less invasive and computationally more straightforward, thereby simplifying these measurements.

  14. Validation of the reference tissue model for estimation of dopaminergic D2-like receptor binding with [18F](N-methyl)benperidol in humans

    International Nuclear Information System (INIS)

    Antenor-Dorsey, Jo Ann V.; Markham, Joanne; Moerlein, Stephen M.; Videen, Tom O.; Perlmutter, Joel S.

    2008-01-01

    Positron emission tomography measurements of dopaminergic D 2 -like receptors may provide important insights into disorders such as Parkinson's disease, schizophrenia, dystonia and Tourette's syndrome. The positron emission tomography (PET) radioligand [ 18 F](N-methyl)benperidol ([ 18 F]NMB) has high affinity and selectivity for D 2 -like receptors and is not displaced by endogenous dopamine. The goal of this study is to evaluate the use of a graphical method utilizing a reference tissue region for [ 18 F]-NMB PET analysis by comparisons to an explicit three-compartment tracer kinetic model and graphical method that use arterial blood measurements. We estimated binding potential (BP) in the caudate and putamen using all three methods in 16 humans and found that the three-compartment tracer kinetic method provided the highest BP estimates while the graphical method using a reference region yielded the lowest estimates (P<.0001 by repeated-measures ANOVA). However, the three methods yielded highly correlated BP estimates for the two regions of interest. We conclude that the graphical method using a reference region still provides a useful estimate of BP comparable to methods using arterial blood sampling, especially since the reference region method is less invasive and computationally more straightforward, thereby simplifying these measurements

  15. Crystal structure of the G3BP2 NTF2-like domain in complex with a canonical FGDF motif peptide.

    Science.gov (United States)

    Kristensen, Ole

    2015-11-06

    The crystal structure of the NTF2-like domain of the human Ras GTPase SH3 Binding Protein (G3BP), isoform 2, was determined at a resolution of 2.75 Å in complex with a peptide containing a FGDF sequence motif. The overall structure of the protein is highly similar to the homodimeric N-terminal domains of the G3BP1 and Rasputin proteins. Recently, a subset of G3BP interacting proteins was recognized to share a common sequence motif, FGDF. The most studied binding partners, USP10 and viral nsP3, interfere with essential G3BP functions related to assembly of cellular stress granules. Reported molecular modeling suggested that FGDF-motif containing peptides bind in an extended conformation into a hydrophobic groove on the surface of the G3BP NTF2-like domain in a manner similar to the known binding of FxFG nucleoporin repeats. The results in this paper provide evidence for a different binding mode. The FGDF peptide binds and changes conformation of the protruding N-terminal residues by providing hydrophobic interactions to a symmetry related molecule that facilitated crystallization of the G3BP2 isoform. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Evidence for mouse Th1- and Th2-like helper T cells in vivo. Selective reduction of Th1-like cells after total lymphoid irradiation

    International Nuclear Information System (INIS)

    Bass, H.; Mosmann, T.; Strober, S.

    1989-01-01

    Purified CD4+ BALB/c spleen T cells obtained 4-6 wk after total lymphoid irradiation (TLI) helped normal syngeneic B cells to produce a vigorous antibody response to TNP keyhole limpet hemocyanin in adoptive cell transfer experiments. However, the same cells failed to transfer delayed-type hypersensitivity to the adoptive hosts as measured by a foot pad swelling assay. In addition, purified CD4+ cells from TLI-treated mice were unable to induce graft vs. host disease in lethally irradiated allogeneic C57BL/Ka recipient mice. In response to mitogen stimulation, unfractionated spleen cells obtained from TLI mice secreted normal levels of IL-4 and IL-5, but markedly reduced levels of IL-2 and INF-gamma. A total of 229 CD4+ clones from spleen cells of both normal and TLI-treated mice were established, and the cytokine secretion pattern from each clone was analyzed. The results demonstrate that the ratio of Th1- and Th2-like clones in the spleens of normal BALB/c mice is 1:0.6, whereas the ratio in TLI mice is approximately 1:7. These results suggest that Th2-like cells recover rapidly (at approximately 4-6 wk) after TLI treatment and account for the early return of antibody helper activity and secretion of IL-4 and IL-5, but Th1-like cells recover more slowly (in approximately 3 mo) after irradiation, and this accounts for the deficit in cell-mediated immunity and the reduced amount of IL-2 and IFN-gamma secretion

  17. D1- and D2-like dopamine receptors within the nucleus accumbens contribute to stress-induced analgesia in formalin-related pain behaviours in rats.

    Science.gov (United States)

    Faramarzi, G; Zendehdel, M; Haghparast, A

    2016-10-01

    Stressful experiences can produce analgesia, termed stress-induced analgesia (SIA). Meanwhile, it has been widely established that the mesolimbic dopamine pathway and nucleus accumbens (NAc) have a profound role in pain modulation. In this study, we examined the role of accumbal dopamine receptors in antinociception caused by forced swim stress (FSS) in order to understand more about the function of these receptors within the NAc in FSS-induced analgesia. Stereotaxic surgery was unilaterally performed on adult male Wistar rats weighing 230-250 g (some on the left and some on the right side of the midline). Two supergroups were microinjected into the NAc with a D1-like dopamine receptor antagonist, SCH-23390, at doses of 0.25, 1 and 4 μg/0.5 μl saline per rat or Sulpiride as a D2-like dopamine receptor antagonist at the same doses [0.25, 1 and 4 μg/0.5 μl dimethyl sulfoxide (DMSO) per rat]; while their controls just received intra-accumbal saline or DMSO at 0.5 μl, respectively. The formalin test was performed after rats were subjected to FSS (6 min, 25 ± 1 °C) to assess pain-related behaviours. The results demonstrated that intra-accumbal infusions of SCH-23390 and Sulpiride dose-dependently reduced FSS-induced antinociception in both phases of the formalin test. However, the percentage decrease in area under the curve (AUC) values calculated for treatment groups compared to formalin-control group was more significant in the late phase than the early phase. Our findings suggest that D1- and D2-like dopamine receptors in the NAc are involved in stress-induced antinociceptive behaviours in the formalin test as an animal model of persistent inflammatory pain. Forced swim stress (FSS) induces the antinociception in both phases of formalin test. Blockade of accumbal dopamine receptors attenuate the antinociception induced by FSS. Stress-induced analgesia is dose-dependently reduced by dopamine receptor antagonists in both phases, although it is more

  18. The Fanconi Anemia DNA Repair Pathway Is Regulated by an Interaction between Ubiquitin and the E2-like Fold Domain of FANCL.

    Science.gov (United States)

    Miles, Jennifer A; Frost, Mark G; Carroll, Eilis; Rowe, Michelle L; Howard, Mark J; Sidhu, Ateesh; Chaugule, Viduth K; Alpi, Arno F; Walden, Helen

    2015-08-21

    The Fanconi Anemia (FA) DNA repair pathway is essential for the recognition and repair of DNA interstrand crosslinks (ICL). Inefficient repair of these ICL can lead to leukemia and bone marrow failure. A critical step in the pathway is the monoubiquitination of FANCD2 by the RING E3 ligase FANCL. FANCL comprises 3 domains, a RING domain that interacts with E2 conjugating enzymes, a central domain required for substrate interaction, and an N-terminal E2-like fold (ELF) domain. The ELF domain is found in all FANCL homologues, yet the function of the domain remains unknown. We report here that the ELF domain of FANCL is required to mediate a non-covalent interaction between FANCL and ubiquitin. The interaction involves the canonical Ile44 patch on ubiquitin, and a functionally conserved patch on FANCL. We show that the interaction is not necessary for the recognition of the core complex, it does not enhance the interaction between FANCL and Ube2T, and is not required for FANCD2 monoubiquitination in vitro. However, we demonstrate that the ELF domain is required to promote efficient DNA damage-induced FANCD2 monoubiquitination in vertebrate cells, suggesting an important function of ubiquitin binding by FANCL in vivo. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Leishmania donovani-reactive Th1- and Th2-like T-cell clones from individuals who have recovered from visceral leishmaniasis

    DEFF Research Database (Denmark)

    Kemp, M; Kurtzhals, J A; Bendtzen, K

    1993-01-01

    analyzed in a panel of L. donovani-reactive CD4+ human T-cell clones generated from individuals who had recovered from VL after antimonial treatment. Two of the T-cell clones produced large amounts of IL-4 without production of IFN-gamma, seven clones produced both IFN-gamma and IL-4, and eight produced...... by interleukin-4 (IL-4)-producing Th2 cells, or cure may result by Th1 cells secreting gamma interferon (IFN-gamma). The present study examined the potential of human T cells to generate Th1 or Th2 responses to L. donovani. The profiles of IFN-gamma, IL-4, and lymphotoxin secretion after antigen stimulation were...... only IFN-gamma. This is the first report of a Th1- and Th2-type response in human leishmaniasis. These results suggest that in analogy with murine models, there is a dichotomy in the human T-cell response to L. donovani infections. Preferential activation of IL-4-producing Th2-like cells may...

  20. NeptuniumV Retention by Siderite under Anoxic Conditions: Precipitation of NpO2-Like Nanoparticles and of NpIV Pentacarbonate.

    Science.gov (United States)

    Scheinost, Andreas C; Steudtner, Robin; Hübner, René; Weiss, Stephan; Bok, Frank

    2016-10-04

    The Np V retention by siderite, an Fe II carbonate mineral with relevance for the near-field of high-level radioactive waste repositories, was investigated under anoxic conditions. Batch sorption experiments show that siderite has a high affinity for aqueous Np V O 2 + across pH 7 to 13 as expressed by solid-water distribution coefficients, log R d, > 5, similar to the log R d determined for the (solely) tetravalent actinide Th on calcite, suggesting reduction of Np V to Np IV by siderite. Np L 3 -edge X-ray absorption near edge (XANES) spectroscopy conducted in a pH range typical for siderite-containing host rocks (7-8), confirmed the tetravalent Np oxidation state. Extended X-ray absorption fine-structure (EXAFS) spectroscopy revealed a local structure in line with NpO 2 -like nanoparticles with diameter nanoparticles (∼10 -9 M), along with their negligible surface charge at neutral pH conditions which favors particle aggregation, suggest an efficient retention of Np in the near-field of radioactive waste repositories. When Np V was added to ferrous carbonate solution, the subsequent precipitation of siderite did not lead to a structural incorporation of Np IV by siderite, but caused precipitation of a Np IV pentacarbonate phase.

  1. A Rice Gene Homologous to Arabidopsis AGD2-LIKE DEFENSE1 Participates in Disease Resistance Response against Infection with Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Ga Young Jung

    2016-08-01

    Full Text Available ALD1 (ABERRANT GROWTH AND DEATH2 [AGD2]-LIKE DEFENSE1 is one of the key defense regulators in Arabidopsis thaliana and Nicotiana benthamiana. In these model plants, ALD1 is responsible for triggering basal defense response and systemic resistance against bacterial infection. As well ALD1 is involved in the production of pipecolic acid and an unidentified compound(s for systemic resistance and priming syndrome, respectively. These previous studies proposed that ALD1 is a potential candidate for developing genetically modified (GM plants that may be resistant to pathogen infection. Here we introduce a role of ALD1-LIKE gene of Oryza sativa, named as OsALD1, during plant immunity. OsALD1 mRNA was strongly transcribed in the infected leaves of rice plants by Magnaporthe oryzae, the rice blast fungus. OsALD1 proteins predominantly localized at the chloroplast in the plant cells. GM rice plants over-expressing OsALD1 were resistant to the fungal infection. The stable expression of OsALD1 also triggered strong mRNA expression of PATHOGENESIS-RELATED PROTEIN1 genes in the leaves of rice plants during infection. Taken together, we conclude that OsALD1 plays a role in disease resistance response of rice against the infection with rice blast fungus.

  2. The Absent in Melanoma 2-Like Receptor IFN-Inducible Protein 16 as an Inflammasome Regulator in Systemic Lupus Erythematosus: The Dark Side of Sensing Microbes

    Directory of Open Access Journals (Sweden)

    Valeria Caneparo

    2018-05-01

    Full Text Available Absent in melanoma 2 (AIM2-like receptors (ALRs are a newly characterized class of pathogen recognition receptors (PRRs involved in cytosolic and nuclear pathogen DNA recognition. In recent years, two ALR family members, the interferon (IFN-inducible protein 16 (IFI16 and AIM2, have been linked to the pathogenesis of various autoimmune diseases, among which systemic lupus erythematosus (SLE has recently gained increasing attention. SLE patients are indeed often characterized by constitutively high serum IFN levels and increased expression of IFN-stimulated genes due to an abnormal response to pathogens and/or incorrect self-DNA recognition process. Consistently, we and others have shown that IFI16 is overexpressed in a wide range of autoimmune diseases where it triggers production of specific autoantibodies. In addition, evidence from mouse models supports a model whereby ALRs are required for IFN-mediated host response to both exogenous and endogenous DNA. Following interaction with cytoplasmic or nuclear nucleic acids, ALRs can form a functional inflammasome through association with the adaptor ASC [apoptosis-associated speck-like protein containing a caspase recruitment domain (CARD] and with procaspase-1. Importantly, inflammasome-mediated upregulation of IL-1β and IL-18 production positively correlates with SLE disease severity. Therefore, targeting ALR sensors and their downstream pathways represents a promising alternative therapeutic approach for SLE and other systemic autoimmune diseases.

  3. Carbonic anhydrase 2-like in the giant clam, Tridacna squamosa: characterization, localization, response to light, and possible role in the transport of inorganic carbon from the host to its symbionts.

    Science.gov (United States)

    Ip, Yuen K; Koh, Clarissa Z Y; Hiong, Kum C; Choo, Celine Y L; Boo, Mel V; Wong, Wai P; Neo, Mei L; Chew, Shit F

    2017-12-01

    The fluted giant clam, Tridacna squamosa , lives in symbiosis with zooxanthellae which reside extracellularly inside a tubular system. Zooxanthellae fix inorganic carbon (C i ) during insolation and donate photosynthate to the host. Carbonic anhydrases catalyze the interconversion of CO 2 and HCO3-, of which carbonic anhydrase 2 (CA2) is the most ubiquitous and involved in many biological processes. This study aimed to clone a CA2 homolog ( CA2-like ) from the fleshy and colorful outer mantle as well as the thin and whitish inner mantle of T. squamosa , to determine its cellular and subcellular localization, and to examine the effects of light exposure on its gene and protein expression levels. The cDNA coding sequence of CA2-like from T. squamosa comprised 789 bp, encoding 263 amino acids with an estimated molecular mass of 29.6 kDa. A phenogramic analysis of the deduced CA2-like sequence denoted an animal origin. CA2-like was not detectable in the shell-facing epithelium of the inner mantle adjacent to the extrapallial fluid. Hence, CA2-like is unlikely to participate directly in light-enhanced calcification. By contrast, the outer mantle, which contains the highest density of tertiary tubules and zooxanthellae, displayed high level of CA2-like expression, and CA2-like was localized to the tubule epithelial cells. More importantly, exposure to light induced significant increases in the protein abundance of CA2-like in the outer mantle. Hence, CA2-like could probably take part in the increased supply of inorganic carbon (C i ) from the host clam to the symbiotic zooxanthellae when the latter conduct photosynthesis to fix C i during light exposure. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  4. BCL2-like 11 intron 2 deletion polymorphism is not associated with non-small cell lung cancer risk and prognosis.

    Science.gov (United States)

    Cho, Eun Na; Kim, Eun Young; Jung, Ji Ye; Kim, Arum; Oh, In Jae; Kim, Young Chul; Chang, Yoon Soo

    2015-10-01

    BCL2-Like 11(BIM), which encodes a BH3-only protein, is a major pro-apoptotic molecule that facilitates cell death. We hypothesized that a BIM intron 2 deletion polymorphism increases lung cancer risk and predicts poor prognosis in non-small lung cancer (NSCLC) patients. We prospectively recruited 450 lung cancer patients and 1:1 age, sex, and smoking status matched control subjects from February 2013 to April 2014 among patients treated at Severance, Gangnam Severance, and Chonnam Hwasoon Hospital. The presence of a 2903-bp genomic DNA deletion polymorphism of intron 2 of BIM was analyzed by PCR and validated by sequencing. Odds ratios were calculated by chi-square tests and survival analysis with Kaplan-Meier estimation. Sixty-nine out of 450 (15.3%) lung cancer patients carried the BIM deletion polymorphism, while 66 out of 450 (14.7%) control subjects carried the BIM deletion polymorphism, with an odds ratio of for lung cancer of 1.054 (95% CI; 0.731-1.519). We categorized 406 NSCLC patients according to the presence of the polymorphism and found that there were no statistically significant differences in age, sex, histologic type, or stage between subjects with and without the deletion polymorphism. The BIM deletion polymorphism did not influence overall survival (OS) or progression free survival (PFS) in our sample (OS; 37.6 vs 34.4 months (P=0.759), PFS; 49.6 vs 26.0 months (P=0.434)). These findings indicate that the BIM deletion polymorphism is common in Korean NSCLC patients but does not significantly affect the intrinsic biologic function of BH3-only protein. Furthermore, the BIM deletion polymorphism did not predict clinical outcomes in patients with NSCLC. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. FGT-1 is a mammalian GLUT2-like facilitative glucose transporter in Caenorhabditis elegans whose malfunction induces fat accumulation in intestinal cells.

    Directory of Open Access Journals (Sweden)

    Shun Kitaoka

    Full Text Available Caenorhabditis elegans (C. elegans is an attractive animal model for biological and biomedical research because it permits relatively easy genetic dissection of cellular pathways, including insulin/IGF-like signaling (IIS, that are conserved in mammalian cells. To explore C. elegans as a model system to study the regulation of the facilitative glucose transporter (GLUT, we have characterized the GLUT gene homologues in C. elegans: fgt-1, R09B5.11, C35A11.4, F53H8.3, F48E3.2, F13B12.2, Y61A9LA.1, K08F9.1 and Y37A1A.3. The exogenous expression of these gene products in Xenopus oocytes showed transport activity to unmetabolized glucose analogue 2-deoxy-D-glucose only in FGT-1. The FGT-1-mediated transport activity was inhibited by the specific GLUT inhibitor phloretin and exhibited a Michaelis constant (Km of 2.8 mM. Mannose, galactose, and fructose were able to inhibit FGT-1-mediated 2-deoxy-D-glucose uptake (P < 0.01, indicating that FGT-1 is also able to transport these hexose sugars. A GFP fusion protein of FGT-1 was observed only on the basolateral membrane of digestive tract epithelia in C. elegans, but not in other tissues. FGT-1::eGFP expression was observed from early embryonic stages. The knockdown or mutation of fgt-1 resulted in increased fat staining in both wild-type and daf-2 (mammalian insulin receptor homologue mutant animals. Other common phenotypes of IIS mutant animals, including dauer formation and brood size reduction, were not affected by fgt-1 knockdown in wild-type or daf-2 mutants. Our results indicated that in C. elegans, FGT-1 is mainly a mammalian GLUT2-like intestinal glucose transporter and is involved in lipid metabolism.

  6. Arctigenin ameliorates inflammation in vitro and in vivo by inhibiting the PI3K/AKT pathway and polarizing M1 macrophages to M2-like macrophages.

    Science.gov (United States)

    Hyam, Supriya R; Lee, In-Ah; Gu, Wan; Kim, Kyung-Ah; Jeong, Jin-Ju; Jang, Se-Eun; Han, Myung Joo; Kim, Dong-Hyun

    2013-05-15

    Seeds of Arctium lappa, containing arctigenin and its glycoside arctiin as main constituents, have been used as a diuretic, anti-inflammatory and detoxifying agent in Chinese traditional medicine. In our preliminary study, arctigenin inhibited IKKβ and NF-κB activation in peptidoglycan (PGN)- or lipopolysaccharide (LPS)-induced peritoneal macrophages. To understand the anti-inflammatory effect of arctigenin, we investigated its anti-inflammatory effect in LPS-stimulated peritoneal macrophages and on LPS-induced systemic inflammation as well as 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis in mice. Arctigenin inhibited LPS-increased IL-1β, IL-6 and TNF-α expression in LPS-stimulated peritoneal macrophages, but increased LPS-reduced IL-10 and CD204 expression. Arctigenin inhibited LPS-induced PI3K, AKT and IKKβ phosphorylation, but did not suppress LPS-induced IRAK-1 phosphorylation. However, arctigenin did not inhibit NF-κB activation in LPS-stimulated PI3K siRNA-treated peritoneal macrophages. Arctigenin suppressed the binding of p-PI3K antibody and the nucleus translocation of NF-κB p65 in LPS-stimulated peritoneal macrophages. Arctigenin suppressed blood IL-1β and TNF-α level in mice systemically inflamed by intraperitoneal injection of LPS. Arctigenin also inhibited colon shortening, macroscopic scores and myeloperoxidase activity in TNBS-induced colitic mice. Arctigenin inhibited TNBS-induced IL-1β, TNF-α and IL-6 expression, as well as PI3K, AKT and IKKβ phosphorylation and NF-κB activation in mice, but increased IL-10 and CD204 expression. However, it did not affect IRAK-1 phosphorylation. Based on these findings, arctigenin may ameliorate inflammatory diseases, such as colitis, by inhibiting PI3K and polarizing M1 macrophages to M2-like macrophages. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Polarized Th2 like cells, in the absence of Th0 cells, are responsible for lymphocyte produced IL-4 in high IgE-producer schistosomiasis patients

    Directory of Open Access Journals (Sweden)

    Soares-Silveira Alda

    2002-07-01

    Full Text Available Abstract Background Human resistance to re-infection with S. mansoni is correlated with high levels of anti-soluble adult worm antigens (SWAP IgE. Although it has been shown that IL-4 and IL-5 are crucial in establishing IgE responses in vitro, the active in vivo production of these cytokines by T cells, and the degree of polarization of Th2 vs. Th0 in human schistosomiasis is not known. To address this question, we determined the frequency of IL-4 and IFN-γ or IL-5 and IL-2 producing lymphocytes from schistosomiasis patients with high or low levels of IgE anti-SWAP. Results Our analysis showed that high and low IgE-producers responded equally to schistosomiasis antigens as determined by proliferation. Moreover, patients from both groups displayed similar percentages of circulating lymphocytes. However, high IgE-producers had an increased percentage of activated CD4+ T cells as compared to the low IgE-producers. Moreover, intracellular cytokine analysis, after short-term stimulation with anti-CD3/CD28 mAbs, showed that IgE high-producers display an increase in the percentage of T lymphocytes expressing IL-4 and IL-5 as compared to IgE low-responders. A coordinate control of the frequency of IL-4 and IL-5 producing lymphocytes in IgE high, but not IgE low-responders, was observed. Conclusions High IgE phenotype human schistosomiasis patients exhibit a coordinate regulation of IL-4 and IL-5 producing cells and the lymphocyte derived IL-4 comes from true polarized Th2 like cells, in the absence of measurable Th0 cells as measured by co-production of IL-4 and IFN-γ.

  8. SECULAR EVOLUTION OF BINARIES NEAR MASSIVE BLACK HOLES: FORMATION OF COMPACT BINARIES, MERGER/COLLISION PRODUCTS AND G2-LIKE OBJECTS

    International Nuclear Information System (INIS)

    Prodan, Snezana; Antonini, Fabio; Perets, Hagai B.

    2015-01-01

    Here we discuss the evolution of binaries around massive black holes (MBHs) in nuclear stellar clusters. We focus on their secular evolution due to the perturbation by the MBHs, while simplistically accounting for their collisional evolution. Binaries with highly inclined orbits with respect to their orbits around MBHs are strongly affected by secular processes, which periodically change their eccentricities and inclinations (e.g., Kozai-Lidov cycles). During periapsis approach, dissipative processes such as tidal friction may become highly efficient, and may lead to shrinkage of a binary orbit and even to its merger. Binaries in this environment can therefore significantly change their orbital evolution due to the MBH third-body perturbative effects. Such orbital evolution may impinge on their later stellar evolution. Here we follow the secular dynamics of such binaries and its coupling to tidal evolution, as well as the stellar evolution of such binaries on longer timescales. We find that stellar binaries in the central parts of nuclear stellar clusters (NSCs) are highly likely to evolve into eccentric and/or short-period binaries, and become strongly interacting binaries either on the main sequence (at which point they may even merge), or through their later binary stellar evolution. The central parts of NSCs therefore catalyze the formation and evolution of strongly interacting binaries, and lead to the enhanced formation of blue stragglers, X-ray binaries, gravitational wave sources, and possible supernova progenitors. Induced mergers/collisions may also lead to the formation of G2-like cloud-like objects such as the one recently observed in the Galactic center

  9. Synergistic effects of dopamine D2-like receptor antagonist sulpiride and beta-blocker propranolol on learning in the Carousel maze, a dry-land spatial navigation task

    Czech Academy of Sciences Publication Activity Database

    Prokopová, Iva; Bahník, Štěpán; Doulames, Vanessa; Valeš, Karel; Petrásek, Tomáš; Svoboda, Jan; Stuchlík, Aleš

    2012-01-01

    Roč. 102, č. 1 (2012), s. 151-156 ISSN 0091-3057 R&D Projects: GA ČR(CZ) GCP303/10/J032; GA ČR(CZ) GBP304/12/G069; GA MZd(CZ) NT13386 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : learning * behavioral pharmacology * behavior Subject RIV: FH - Neurology Impact factor: 2.608, year: 2012

  10. Morris water maze learning in Long-Evans rats is differentially affected by blockade of D1-like and D2-like dopamine receptors

    Czech Academy of Sciences Publication Activity Database

    Stuchlík, Aleš; Řeháková, Lenka; Telenský, Petr; Valeš, Karel

    2007-01-01

    Roč. 422, č. 3 (2007), s. 169-174 ISSN 0304-3940 R&D Projects: GA MŠk(CZ) 1M0517; GA MŠk(CZ) LC554; GA MZd NR9178; GA ČR GA309/07/0341; GA ČR(CZ) GD206/05/H012; GA ČR(CZ) GA309/06/1231 Institutional research plan: CEZ:AV0Z50110509 Keywords : memory * dopamine * cognition Subject RIV: FH - Neurology Impact factor: 2.085, year: 2007

  11. Type 1- and type 2-like lesional skin-derived Mycobacterium leprae-responsive T cell clones are characterized by coexpression of IFN-gamma/TNF-alpha and IL-4/IL-5/IL-13, respectively

    NARCIS (Netherlands)

    Verhagen, C. E.; van der Pouw Kraan, T. C.; Buffing, A. A.; Chand, M. A.; Faber, W. R.; Aarden, L. A.; Das, P. K.

    1998-01-01

    In an earlier study, we generated a large number of Mycobacterium leprae-responsive and M. leprae-nonresponsive T cell clones (TCC) from the lesional skin of immunologic unstable borderline leprosy patients. In that study, we divided TCC into type 1- and type 2-like on the basis of their IFN-gamma

  12. Association of an SNP in a novel DREB2-like gene SiDREB2 with stress tolerance in foxtail millet [Setaria italica (L.)].

    Science.gov (United States)

    Lata, Charu; Bhutty, Sarita; Bahadur, Ranjit Prasad; Majee, Manoj; Prasad, Manoj

    2011-06-01

    The DREB genes code for important plant transcription factors involved in the abiotic stress response and signal transduction. Characterization of DREB genes and development of functional markers for effective alleles is important for marker-assisted selection in foxtail millet. Here the characterization of a cDNA (SiDREB2) encoding a putative dehydration-responsive element-binding protein 2 from foxtail millet and the development of an allele-specific marker (ASM) for dehydration tolerance is reported. A cDNA clone (GenBank accession no. GT090998) coding for a putative DREB2 protein was isolated as a differentially expressed gene from a 6 h dehydration stress SSH library. A 5' RACE (rapid amplification of cDNA ends) was carried out to obtain the full-length cDNA, and sequence analysis showed that SiDREB2 encoded a polypeptide of 234 amino acids with a predicted mol. wt of 25.72 kDa and a theoretical pI of 5.14. A theoretical model of the tertiary structure shows that it has a highly conserved GCC-box-binding N-terminal domain, and an acidic C-terminus that acts as an activation domain for transcription. Based on its similarity to AP2 domains, SiDREB2 was classified into the A-2 subgroup of the DREB subfamily. Quantitative real-time PCR analysis showed significant up-regulation of SiDREB2 by dehydration (polyethylene glycol) and salinity (NaCl), while its expression was less affected by other stresses. A synonymous single nucleotide polymorphism (SNP) associated with dehydration tolerance was detected at the 558th base pair (an A/G transition) in the SiDREB2 gene in a core set of 45 foxtail millet accessions used. Based on the identified SNP, three primers were designed to develop an ASM for dehydration tolerance. The ASM produced a 261 bp fragment in all the tolerant accessions and produced no amplification in the sensitive accessions. The use of this ASM might be faster, cheaper, and more reproducible than other SNP genotyping methods, and thus will enable

  13. Monitoring irrigation water consumption using high resolution NDVI image time series (Sentinel-2 like). Calibration and validation in the Kairouan plain (Tunisia)

    Science.gov (United States)

    Saadi, Sameh; Simonneaux, Vincent; Boulet, Gilles; Mougenot, Bernard; Zribi, Mehrez; Lili Chabaane, Zohra

    2015-04-01

    Water scarcity is one of the main factors limiting agricultural development in semi-arid areas. It is thus of major importance to design tools allowing a better management of this resource. Remote sensing has long been used for computing evapotranspiration estimates, which is an input for crop water balance monitoring. Up to now, only medium and low resolution data (e.g. MODIS) are available on regular basis to monitor cultivated areas. However, the increasing availability of high resolution high repetitivity VIS-NIR remote sensing, like the forthcoming Sentinel-2 mission to be lunched in 2015, offers unprecedented opportunity to improve this monitoring. In this study, regional crops water consumption was estimated with the SAMIR software (Satellite of Monitoring Irrigation) using the FAO-56 dual crop coefficient water balance model fed with high resolution NDVI image time series providing estimates of both the actual basal crop coefficient (Kcb) and the vegetation fraction cover. The model includes a soil water model, requiring the knowledge of soil water holding capacity, maximum rooting depth, and water inputs. As irrigations are usually not known on large areas, they are simulated based on rules reproducing the farmer practices. The main objective of this work is to assess the operationality and accuracy of SAMIR at plot and perimeter scales, when several land use types (winter cereals, summer vegetables…), irrigation and agricultural practices are intertwined in a given landscape, including complex canopies such as sparse orchards. Meteorological ground stations were used to compute the reference evapotranspiration and get the rainfall depths. Two time series of ten and fourteen high-resolution SPOT5 have been acquired for the 2008-2009 and 2012-2013 hydrological years over an irrigated area in central Tunisia. They span the various successive crop seasons. The images were radiometrically corrected, first, using the SMAC6s Algorithm, second, using invariant

  14. Ce–Fe-modified zeolite-rich tuff to remove Ba{sup 2+}-like {sup 226}Ra{sup 2+} in presence of As(V) and F{sup −} from aqueous media as pollutants of drinking water

    Energy Technology Data Exchange (ETDEWEB)

    Olguín, María Teresa, E-mail: teresa.olguin@inin.gob.mx [Department of Chemical & Materials Engineering, New Mexico State University, P.O. Box 30001, MSC 3805, Las Cruces, NM 88003 (United States); Departamento de Química, Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, Col. Escandón, Delegación Miguel Hidalgo, C.P. 11801, México D.F. (Mexico); Deng, Shuguang [Department of Chemical & Materials Engineering, New Mexico State University, P.O. Box 30001, MSC 3805, Las Cruces, NM 88003 (United States)

    2016-01-25

    Graphical abstract: Ba{sup 2+}-like {sup 226}Ra{sup 2+}, As(V) and F{sup −} simultaneous removal from aqueous media by Ce–Fe-modified natural zeolites. - Highlights: • The metallic species which modified the zeolite change the textural properties. • The pH{sub pzc} is acid for ZUSCeFe and neutral for ZUSNa. • The Linear model describes the Ba{sup 2+}-like {sup 226}Ra{sup 2+} sorption by ZUSNa and ZUSCeFe. • K{sub d} is highest for Ba{sup 2+-} like {sup 226}Ra{sup 2+}-As(V)-F{sup -} solution in contact with ZUSCeFe. • The ZUSCeFe remove simultaneously Ba{sup 2+}-like {sup 226}Ra{sup 2+}, As(V) and F{sup −}. - Abstract: The sorption behavior of the Ba{sup 2+}-like {sup 226}Ra{sup 2+} in the presence of H{sub 2}AsO{sub 4}{sup −}/HAsO{sub 4}{sup 2−} and F{sup −} from aqueous media using Ce–Fe-modified zeolite-rich tuff was investigated in this work. The Na-modified zeolite-rich tuff was also considered for comparison purposes. The zeolite-rich tuff collected from Wyoming (US) was in contact with NaCl and CeCl{sub 3}–FeCl{sub 3} solutions to obtain the Na- and Ce–Fe-modified zeolite-rich tuffs (ZUSNa and ZUSCeFe). These zeolites were characterized by scanning electron microscopy and X-ray diffraction. The BET-specific surface and the points of zero charge were determined as well as the content of Na, Ce and Fe by neutron activation analysis. The textural characteristics and the point of zero charge were changed by the presence of Ce and Fe species in the zeolitic network. A linear model described the Ba{sup 2+}-like {sup 226}Ra{sup 2+} sorption isotherms and the distribution coefficients (K{sub d}) varied with respect to the metallic species present in the zeolitic material. The As(V) oxianionic chemical species and F{sup −} affected this parameter when the Ba{sup 2+}-like {sup 226}Ra{sup 2+}-As(V)-F{sup −} solutions were in contact with ZUSCeFe. The H{sub 2}AsO{sub 4}{sup −}/HAsO{sub 4}{sup 2−} and F{sup −} were adsorbed by ZUSCe

  15. Ce-Fe-modified zeolite-rich tuff to remove Ba(2+)-like (226)Ra(2+) in presence of As(V) and F(-) from aqueous media as pollutants of drinking water.

    Science.gov (United States)

    Olguín, María Teresa; Deng, Shuguang

    2016-01-25

    The sorption behavior of the Ba(2+)-like (226)Ra(2+) in the presence of H2AsO4(-)/HAsO4(2-) and F(-) from aqueous media using Ce-Fe-modified zeolite-rich tuff was investigated in this work. The Na-modified zeolite-rich tuff was also considered for comparison purposes. The zeolite-rich tuff collected from Wyoming (US) was in contact with NaCl and CeCl3-FeCl3 solutions to obtain the Na- and Ce-Fe-modified zeolite-rich tuffs (ZUSNa and ZUSCeFe). These zeolites were characterized by scanning electron microscopy and X-ray diffraction. The BET-specific surface and the points of zero charge were determined as well as the content of Na, Ce and Fe by neutron activation analysis. The textural characteristics and the point of zero charge were changed by the presence of Ce and Fe species in the zeolitic network. A linear model described the Ba(2+)-like (226)Ra(2+) sorption isotherms and the distribution coefficients (Kd) varied with respect to the metallic species present in the zeolitic material. The As(V) oxianionic chemical species and F(-) affected this parameter when the Ba(2+)-like (226)Ra(2+)-As(V)-F(-) solutions were in contact with ZUSCeFe. The H2AsO4(-)/HAsO4(2-) and F(-) were adsorbed by ZUSCeFe in the same amount, independent of the concentration of Ba(2+)-like (226)Ra(2+) in the initial solution. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Astragalus membranaceus Extract Attenuates Inflammation and Oxidative Stress in Intestinal Epithelial Cells via NF-κB Activation and Nrf2 Response

    Directory of Open Access Journals (Sweden)

    Simona Adesso

    2018-03-01

    Full Text Available Astragalus membranaceus, dried root extract, also known as Astragali radix, is used in traditional Chinese medicine as a tonic remedy. Moreover, it has been reported that Astragalus membranaceus could attenuate intestinal inflammation; however, the underlying mechanism for its anti-inflammatory activity in intestinal epithelial cells (IECs remains unclear. In this study, we evaluated Astragalus membranaceus extract (5–100 µg/mL in a model of inflammation and oxidative stress for IECs. We showed that Astragalus membranaceus extract reduced the inflammatory response induced by lipopolysaccharide from E. coli (LPS plus interferon-γ (IFN, decreasing tumor necrosis factor-α (TNF-α release, cycloxygenase-2 (COX-2 and inducible nitric oxide synthase (iNOS expression, nitrotyrosine formation, nuclear factor-κB (NF-κB activation, and reactive oxygen species (ROS release in the non-tumorigenic intestinal epithelial cell line (IEC-6. The antioxidant potential of Astragalus membranaceus extract was also evaluated in a model of hydrogen peroxide (H2O2-induced oxidative stress in IEC-6, indicating that this extract reduced ROS release and increased nuclear factor (erythroid-derived 2-like 2 (Nrf2 activation and the expression of antioxidant cytoprotective factors in these cells. The results contributed to clarify the mechanisms involved in Astragalus membranaceus extract-reduced inflammation and highlighted the potential use of this extract as an anti-inflammatory and antioxidant remedy for intestinal diseases.

  17. The Food Contaminants Nivalenol and Deoxynivalenol Induce Inflammation in Intestinal Epithelial Cells by Regulating Reactive Oxygen Species Release

    Directory of Open Access Journals (Sweden)

    Simona Adesso

    2017-12-01

    Full Text Available Fusarium mycotoxins are fungal metabolites whose ability to affect cereal grains as multi-contaminants is progressively increasing. The trichothecene mycotoxins nivalenol (NIV and deoxynivalenol (DON are often found in almost all agricultural commodities worldwide. They are able to affect animal and human health, including at the intestinal level. In this study, NIV, both alone and in combination with DON, induced inflammation and increased the inflammatory response induced by lipopolysaccharide (LPS plus Interferon-γ (IFN in the non-tumorigenic intestinal epithelial cell line (IEC-6. The inflammatory response induced by NIV and DON involves tumor necrosis factor-α (TNF-α production, inducible nitric oxide synthase (iNOS and cyclooxygenase-2 (COX-2 expression, nitrotyrosine formation, reactive oxygen species (ROS release, Nuclear Factor-κB (NF-κB, Nuclear factor (erythroid-derived 2-like 2 (Nrf2 and inflammasome activation. The pro-inflammatory effect was strongly induced by NIV and by the mycotoxin mixture, when compared to DON alone. Mechanistic studies indicate a pivotal role for ROS in the observed pro-inflammatory effects induced by mycotoxins. In this study, the interactions between NIV and DON point out the importance of their food co-contamination, further highlighting the risk assessment process that is of growing concern.

  18. The Food Contaminants Nivalenol and Deoxynivalenol Induce Inflammation in Intestinal Epithelial Cells by Regulating Reactive Oxygen Species Release.

    Science.gov (United States)

    Adesso, Simona; Autore, Giuseppina; Quaroni, Andrea; Popolo, Ada; Severino, Lorella; Marzocco, Stefania

    2017-12-11

    Fusarium mycotoxins are fungal metabolites whose ability to affect cereal grains as multi-contaminants is progressively increasing. The trichothecene mycotoxins nivalenol (NIV) and deoxynivalenol (DON) are often found in almost all agricultural commodities worldwide. They are able to affect animal and human health, including at the intestinal level. In this study, NIV, both alone and in combination with DON, induced inflammation and increased the inflammatory response induced by lipopolysaccharide (LPS) plus Interferon-γ (IFN) in the non-tumorigenic intestinal epithelial cell line (IEC-6). The inflammatory response induced by NIV and DON involves tumor necrosis factor-α (TNF-α) production, inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) expression, nitrotyrosine formation, reactive oxygen species (ROS) release, Nuclear Factor-κB (NF-κB), Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and inflammasome activation. The pro-inflammatory effect was strongly induced by NIV and by the mycotoxin mixture, when compared to DON alone. Mechanistic studies indicate a pivotal role for ROS in the observed pro-inflammatory effects induced by mycotoxins. In this study, the interactions between NIV and DON point out the importance of their food co-contamination, further highlighting the risk assessment process that is of growing concern.

  19. Inhaled Pollutants: The Molecular Scene behind Respiratory and Systemic Diseases Associated with Ultrafine Particulate Matter

    Directory of Open Access Journals (Sweden)

    Hussein Traboulsi

    2017-01-01

    Full Text Available Air pollution of anthropogenic origin is largely from the combustion of biomass (e.g., wood, fossil fuels (e.g., cars and trucks, incinerators, landfills, agricultural activities and tobacco smoke. Air pollution is a complex mixture that varies in space and time, and contains hundreds of compounds including volatile organic compounds (e.g., benzene, metals, sulphur and nitrogen oxides, ozone and particulate matter (PM. PM0.1 (ultrafine particles (UFP, those particles with a diameter less than 100 nm (includes nanoparticles (NP are considered especially dangerous to human health and may contribute significantly to the development of numerous respiratory and cardiovascular diseases such as chronic obstructive pulmonary disease (COPD and atherosclerosis. Some of the pathogenic mechanisms through which PM0.1 may contribute to chronic disease is their ability to induce inflammation, oxidative stress and cell death by molecular mechanisms that include transcription factors such as nuclear factor κB (NF-κB and nuclear factor (erythroid-derived 2-like 2 (Nrf2. Epigenetic mechanisms including non-coding RNA (ncRNA may also contribute towards the development of chronic disease associated with exposure to PM0.1. This paper highlights emerging molecular concepts associated with inhalational exposure to PM0.1 and their ability to contribute to chronic respiratory and systemic disease.

  20. Dichotomy of the human T cell response to Leishmania antigens. II. Absent or Th2-like response to gp63 and Th1-like response to lipophosphoglycan-associated protein in cells from cured visceral leishmaniasis patients

    DEFF Research Database (Denmark)

    Kurtzhals, J A; Hey, A S; Jardim, A

    1994-01-01

    -gamma) production in PBMC from cured patients, while cells from non-exposed donors gave weak responses. A similar pattern was induced by lipophosphoglycan-associated protein (LPGAP). By contrast, the major surface protease of Leishmania, gp63, induced only a weak proliferative response without IFN-gamma production...... in five of 17 samples from cured patients. Four of the five responding cultures produced IL-4, i.e. the response to this antigen was of the Th2 type. Furthermore, sera from acutely ill visceral leishmaniasis patients contained high levels of IgG antibodies to gp63. The Th2-like response to gp63...

  1. Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway

    Directory of Open Access Journals (Sweden)

    Michelle R. Campbell

    2013-01-01

    Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.

  2. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response.

    Science.gov (United States)

    Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun; Oh, Won Keun

    2017-01-01

    Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata , and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (A β ) 42 -induced microglial activation related to Nrf2 and nuclear factor κ B (NF- κ B)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular A β 42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1 β , prostaglandin (PG)E 2 , and nitric oxide (NO) because of artificial phagocytic A β 42 . It decreased pNF- κ B accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits A β 42 -overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  3. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo

    2017-01-01

    Full Text Available Therapeutic approach of Alzheimer’s disease (AD has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1/nuclear factor (erythroid-derived 2-like 2 (Nrf2-mediated heme oxygenase (HO-1-inducing effects and the inhibitory activity of amyloid beta (Aβ42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL-6, IL-1β, prostaglandin (PGE2, and nitric oxide (NO because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS and cyclooxygenase II (COX-II in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  4. Anti-inflammatory and antioxidant activity of polyphenolic extracts from Lactuca sativa (var. Maravilla de Verano) under different farming methods.

    Science.gov (United States)

    Adesso, Simona; Pepe, Giacomo; Sommella, Eduardo; Manfra, Michele; Scopa, Antonio; Sofo, Adriano; Tenore, Gian Carlo; Russo, Mariateresa; Di Gaudio, Francesca; Autore, Giuseppina; Campiglia, Pietro; Marzocco, Stefania

    2016-09-01

    Besides their nutritional value, vegetables are a source of health-promoting compounds, such as polyphenols, and their content can be influenced by the particular farming method. In this study polyphenolic extracts from Lactuca sativa (var. Maravilla de verano) plants cultivated with different farming methods were chemically characterised and tested in vitro and ex vivo inflammation models. The tested extacts (250-2.5 µg mL(-1) ) were able to reduce both the inflammatory and oxidative stress in LPS-stimulated J774A.1 murine monocyte macrophage cells, by lowering the release of nitric oxide (NO) and reactive oxygen species (ROS) and promoting nuclear translocation of nuclear factor (erythroid-derived 2)-like 2; (Nrf2) and nuclear factor-κB (NF-κB). In this regard, quantitative profiles revealed different amounts of polyphenols, in particular quercetin levels were higher in plants under mineral fertilised treatment. Those extract showed an enhanced anti-inflammatory and antioxidant activity. Our data showed the anti-inflammatory and antioxidant potential of Maravilla de Verano polyphenolic extracts. The effect of farming methods on polyphenolic levels was highlighted. The higher reduction of inflammatory mediators release in extracts from plants cultivated under mineral fertilisation treatment was correlated to the higher amount of quercetin. These results can be useful for both nutraceutical or agronomic purposes. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  5. Synthesis, resolution and radioiodination of S(-)trans-5-hydroxy-2-[N-n-propyl-N-(3'-iodo-2'-propenyl)amino]tet ralin-S(-)trans-5-OH-PIPAT: a new dopamine D2-like receptor ligand

    International Nuclear Information System (INIS)

    Chumpradit, Sumalee; Meiping Kung; Vessotskie, Janet; Kung, H.F.

    1995-01-01

    A new dopamine D2-like receptor ligand, (R,S)trans-5-hydroxy-2-[N-n0propyl-N-(3'-iodo-2'-propeny)amino]tet ralin ((R,S)trans-5-OH-PIPAT,3), based on high affinity dopamine receptor agonist 5-hydroxy-2-[N,N-(di-n-propyl)-2-amino]tetralin (5-OH-DPAT,1), was prepared. The synthesis was achieved by a reductive amination of 5-methoxy-2-tetralone with n-propylamine, followed by N-alkylation, to afford 5-methoxy-N-propyl-N-2'-aminotetralin,7. Reduction of 7 with tributyltin hydride gave the tri-n-butyl tin derivative,8, which was converted to 9 by an iododemetalation reaction. Demethylation of 9 gave the desired compound, (R,S)trans-5-OH-PIPAT,3. The resolved (R) and (S)trans-5-OH-PIPAT,3 were also quantitatively prepared. (author)

  6. Onium ions. XVI. Hydrogen--deuterium exchange accompanying the cleavage of ammonium (tetradeuterioammonium) trifluoroacetate by lithium deuteride (hydride) indicating Sn2 like nucleophilic displacement at quaternary nitrogen through pentacoordinated NH5

    International Nuclear Information System (INIS)

    Olah, G.A.; Donovan, D.J.; Shen, J.; Klopman, G.

    1975-01-01

    The reactions of ammonium trifluoroacetate and lithium hydride, of ammonium trifluoroacetate and lithium deuteride, and of tetradeuteroammonium trifluoroacetate and lithium hydride were studied in an attempt to prove experimentally nucleophilic displacement through the formation of pentacoordinated NH 5 . Significant isotopic scramblings were observed in the reaction products. An analysis of possible side reactions indicated that the most reasonable explanation for the reaction products obtained is the attack of D - on the quarternary hydrogen of NH 4 + in an SN2-like fashion causing exchange to occur via pentacoordinated NH 4 D. The possibility of a real pentacoordinated intermediate was also considered. CNDO/2 calculations show that a nucleophilic attack on hydrogen is favored, but the alternative attack on nitrogen can not be dismissed because of the experimental data. The reaction of NF 4 + SbF 6 - and LiF could indicate the possibility of nucleophilic attack on nitrogen. (U.S.)

  7. Areva at December 31, 2014: Revenue down at Euros 8.336 bn: -8.0% (-7.2% like for like), Backlog at Euros 46.9 bn

    International Nuclear Information System (INIS)

    Repaire, Philippine du

    2015-01-01

    At 46.9 billion euros at December 31, 2014, the group's backlog grew in certain recurring businesses, thanks to long-term contracts with EDF. Nevertheless, the group suffers from the lackluster of markets with short-term sales cycles, as is the case for services to the installed base, and from the postponement of certain customer projects. The group's revenue for 2014, which was down 7.2% like for like, slightly exceeded the group's expectations. The decrease is due to the deterioration of market conditions throughout 2014 and to an unfavorable basis of comparison, with non-recurring contracts in the Mining and Back End businesses having benefited the year of 2013

  8. Sulforaphane Prevents Angiotensin II-Induced Testicular Cell Death via Activation of NRF2

    Directory of Open Access Journals (Sweden)

    Yonggang Wang

    2017-01-01

    Full Text Available Although angiotensin II (Ang II was reported to facilitate sperm motility and intratesticular sperm transport, recent findings shed light on the efficacy of Ang II in stimulating inflammatory events in testicular peritubular cells, effect of which may play a role in male infertility. It is still unknown whether Ang II can induce testicular apoptotic cell death, which may be a more direct action of Ang II in male infertility. Therefore, the present study aims to determine whether Ang II can induce testicular apoptotic cell death and whether this action can be prevented by sulforaphane (SFN via activating nuclear factor (erythroid-derived 2-like 2 (NRF2, the governor of antioxidant-redox signalling. Eight-week-old male C57BL/6J wild type (WT and Nrf2 gene knockout mice were treated with Ang II, in the presence or absence of SFN. In WT mice, SFN activated testicular NRF2 expression and function, along with a marked attenuation in Ang II-induced testicular oxidative stress, inflammation, endoplasmic reticulum stress, and apoptotic cell death. Deletion of the Nrf2 gene led to a complete abolishment of these efficacies of SFN. The present study indicated that Ang II may result in testicular apoptotic cell death, which can be prevented by SFN via the activation of NRF2.

  9. Tetrachloro-p-benzoquinone induces hepatic oxidative damage and inflammatory response, but not apoptosis in mouse: The prevention of curcumin

    International Nuclear Information System (INIS)

    Xu, Demei; Hu, Lihua; Su, Chuanyang; Xia, Xiaomin; Zhang, Pu; Fu, Juanli; Wang, Wenchao; Xu, Duo; Du, Hong; Hu, Qiuling; Song, Erqun; Song, Yang

    2014-01-01

    This study investigated the protective effects of curcumin on tetrachloro-p-benzoquinone (TCBQ)-induced hepatotoxicity in mice. TCBQ-treatment causes significant liver injury (the elevation of serum AST and ALT activities, histopathological changes in liver section including centrilobular necrosis and inflammatory cells), oxidative stress (the elevation of TBAR level and the inhibition of SOD and catalase activities) and inflammation (up-regulation of iNOS, COX-2, IL-1β, IL-6, TNF-α and NF-κB). However, these changes were alleviated upon pretreatment with curcumin. Interestingly, TCBQ has no effect on caspase family genes or B-cell lymphoma 2 (Bcl-2)/Bcl-2 associated X (Bax) protein expressions, which implied that TCBQ-induced hepatotoxicity is independent of apoptosis. Moreover, curcumin was shown to induce phase II detoxifying/antioxidant enzymes HO-1 and NQO1 through the activation of nuclear factor erythroid-derived 2-like 2 (Nrf2). In summary, the protective mechanisms of curcumin against TCBQ-induced hepatoxicity may be related to the attenuation of oxidative stress, along with the inhibition of inflammatory response via the activation of Nrf2 signaling. - Highlights: • TCBQ-intoxication significantly increased AST and ALT activities. • TCBQ-intoxication induced oxidative stress in mice liver. • TCBQ-intoxication induced inflammatory response in mice liver. • TCBQ-intoxication induced hepatotoxicity is independent of apoptosis. • Curcumin relieved TCBQ-induced liver damage remarkably

  10. Beneficial Effect of Jojoba Seed Extracts on Hyperglycemia-Induced Oxidative Stress in RINm5f Beta Cells

    Directory of Open Access Journals (Sweden)

    Sahla Belhadj

    2018-03-01

    Full Text Available Hyperglycemia occurs during diabetes and insulin resistance. It causes oxidative stress by increasing reactive oxygen species (ROS levels, leading to cellular damage. Polyphenols play a central role in defense against oxidative stress. In our study, we investigated the antioxidant properties of simmondsin, a pure molecule present in jojoba seeds, and of the aqueous extract of jojoba seeds on fructose-induced oxidative stress in RINm5f beta cells. The exposure of RINm5f beta cells to fructose triggered the loss of cell viability (−48%, p < 0.001 and disruption of insulin secretion (p < 0.001 associated with of reactive oxygen species (ROS production and a modulation of pro-oxidant and antioxidant signaling pathway. Cell pre-treatments with extracts considerably increased cell viability (+86% p < 0.001 for simmondsin and +74% (p < 0.001 for aqueous extract and insulin secretion. The extracts also markedly decreased ROS (−69% (p < 0.001 for simmondsin and −59% (p < 0.001 for aqueous extract and caspase-3 activation and improved antioxidant defense, inhibiting p22phox and increasing nuclear factor (erythroid-derived 2-like 2 (Nrf2 levels (+70%, p < 0.001 for aqueous extract. Simmondsin had no impact on Nrf2 levels. The richness and diversity of molecules present in jojoba seed extract makes jojoba a powerful agent to prevent the destruction of RINm5f beta cells induced by hyperglycemia.

  11. Spaceflight Activates Autophagy Programs and the Proteasome in Mouse Liver.

    Science.gov (United States)

    Blaber, Elizabeth A; Pecaut, Michael J; Jonscher, Karen R

    2017-09-27

    Increased oxidative stress is an unavoidable consequence of exposure to the space environment. Our previous studies showed that mice exposed to space for 13.5 days had decreased glutathione levels, suggesting impairments in oxidative defense. Here we performed unbiased, unsupervised and integrated multi-'omic analyses of metabolomic and transcriptomic datasets from mice flown aboard the Space Shuttle Atlantis. Enrichment analyses of metabolite and gene sets showed significant changes in osmolyte concentrations and pathways related to glycerophospholipid and sphingolipid metabolism, likely consequences of relative dehydration of the spaceflight mice. However, we also found increased enrichment of aminoacyl-tRNA biosynthesis and purine metabolic pathways, concomitant with enrichment of genes associated with autophagy and the ubiquitin-proteasome. When taken together with a downregulation in nuclear factor (erythroid-derived 2)-like 2-mediated signaling, our analyses suggest that decreased hepatic oxidative defense may lead to aberrant tRNA post-translational processing, induction of degradation programs and senescence-associated mitochondrial dysfunction in response to the spaceflight environment.

  12. Spaceflight Activates Autophagy Programs and the Proteasome in Mouse Liver

    Directory of Open Access Journals (Sweden)

    Elizabeth A. Blaber

    2017-09-01

    Full Text Available Increased oxidative stress is an unavoidable consequence of exposure to the space environment. Our previous studies showed that mice exposed to space for 13.5 days had decreased glutathione levels, suggesting impairments in oxidative defense. Here we performed unbiased, unsupervised and integrated multi-‘omic analyses of metabolomic and transcriptomic datasets from mice flown aboard the Space Shuttle Atlantis. Enrichment analyses of metabolite and gene sets showed significant changes in osmolyte concentrations and pathways related to glycerophospholipid and sphingolipid metabolism, likely consequences of relative dehydration of the spaceflight mice. However, we also found increased enrichment of aminoacyl-tRNA biosynthesis and purine metabolic pathways, concomitant with enrichment of genes associated with autophagy and the ubiquitin-proteasome. When taken together with a downregulation in nuclear factor (erythroid-derived 2-like 2-mediated signaling, our analyses suggest that decreased hepatic oxidative defense may lead to aberrant tRNA post-translational processing, induction of degradation programs and senescence-associated mitochondrial dysfunction in response to the spaceflight environment.

  13. Soybean-Derived Phytoalexins Improve Cognitive Function through Activation of Nrf2/HO-1 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo

    2018-01-01

    Full Text Available As soy-derived glyceollins are known to induce antioxidant enzymes in various types of cells and tissues, we hypothesized that the compounds could protect neurons from damage due to reactive oxygen species (ROS. In order to examine the neuroprotective effect of glyceollins, primary cortical neurons collected from mice and mouse hippocampal HT22 cells were challenged with glutamate. Glyceollins attenuated glutamate-induced cytotoxicity in primary cortical neuron isolated from mice carrying wild-type nuclear factor (erythroid-derived 2-like 2 (Nrf2, but the compounds were ineffective in those isolated from Nrf2 knockout mice, suggesting the involvement of the Nrf2 signaling pathway in glyceollin-mediated neuroprotection. Furthermore, the inhibition of heme oxygenase-1 (HO-1, a major downstream enzyme of Nrf2, abolished the suppressive effect of glyceollins against glutamate-induced ROS production and cytotoxicity, confirming that activation of HO-1 by glyceollins is responsible for the neuroprotection. To examine whether glyceollins also improve cognitive ability, mice pretreated with glyceollins were challenged with scopolamine and subjected to behavioral tests. Glyceollins attenuated scopolamine-induced cognitive impairment of mice, but failed to enhance memory in Nrf2 knockout mice, suggesting that the memory-enhancing effect is also mediated by the Nrf2 signaling pathway. Overall, glyceollins showed neuroprotection against glutamate-induced damage, and attenuated scopolamine-induced memory deficits in an Nrf2-dependent manner.

  14. Neuroprotective and Cognition-Enhancing Effects of Compound K Isolated from Red Ginseng.

    Science.gov (United States)

    Seo, Ji Yeon; Ju, Sung Hee; Oh, Jisun; Lee, Seung Kwon; Kim, Jong-Sang

    2016-04-13

    The present study was aimed at elucidating the effect of compound K derived from red ginseng on memory function in mouse model and glutamate-induced cytotoxicity in mouse hippocampal HT22 cells. Compound K induced antioxidant enzymes in nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated manner, and effectively attenuated cytotoxicity and mitochondrial damage induced by glutamate in HT22 cells. However, the cytoprotective effect by compound K was abolished by heme oxygenase-1 inhibitor, tin protophorphyrin IX, suggesting that neuroprotective effect of compound K was caused by its Nrf2-mediated induction of antioxidant enzymes. Further, memory deficit induced by scopolamine was restored by compound K, which did not inhibit acetylcholine esterase, in C57BL/6 mice but not in Nrf2 knockout mice as assessed by passive avoidance test, Y-maze and water maze tests, suggesting that scopolamine-induced memory impairment was overcome by the induction of Nrf2-mediated antioxidant enzymes by the compound K. Overall, our data indicate that compound K could be useful in prevention and treatment of reactive oxygen species-induced neurological disorders such as Alzheimer's disease.

  15. The berry constituents quercetin, kaempferol, and pterostilbene synergistically attenuate reactive oxygen species: involvement of the Nrf2-ARE signaling pathway.

    Science.gov (United States)

    Saw, Constance Lay Lay; Guo, Yue; Yang, Anne Yuqing; Paredes-Gonzalez, Ximena; Ramirez, Christina; Pung, Douglas; Kong, Ah-Ng Tony

    2014-10-01

    Quercetin, kaempferol, and pterostilbene are abundant in berries. The anti-oxidative properties of these constituents may contribute to cancer chemoprevention. However, their precise mechanisms of action and their combinatorial effects are not completely understood. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates anti-oxidative stress enzymes and Phase II drug metabolizing/detoxifying enzymes by binding to antioxidant response element (ARE). This study aimed to investigate the anti-oxidative stress activities of quercetin, kaempferol, and pterostilbene individually and in combination, as well as the involvement of the Nrf2-ARE signaling pathway. Quercetin, kaempferol, and pterostilbene all exhibited strong free-radical scavenging activity in the DPPH assay. The MTS assay revealed that low concentration combinations we tested were relatively non-toxic to HepG2-C8 cells. The results of the DCFH-DA assay and combination index (CI) indicated that quercetin, kaempferol, and pterostilbene attenuated intracellular reactive oxygen species (ROS) levels when pretreated individually and had synergistic effects when used in combination. In addition, the combination treatment significantly induced ARE and increased the mRNA and protein expression of Nrf2-regulated genes. Collectively, our study demonstrated that the berry constituents quercetin, kaempferol, and pterostilbene activated the Nrf2-ARE signaling pathway and exhibited synergistic anti-oxidative stress activity at appropriate concentrations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. The Biofunctions of Phytochemicals and Their Applications in Farm Animals: The Nrf2/Keap1 System as a Target

    Directory of Open Access Journals (Sweden)

    Si Qin

    2017-10-01

    Full Text Available Reactive oxygen species (ROS can be caused by mechanical, thermal, infectious, and chemical stimuli, and their negative effects on the health of humans and other animals are of considerable concern. The nuclear factor (erythroid-derived 2-like 2/Kelch-like ECH-associated protein 1 (Nrf2/Keap1 system plays a major role in maintaining the balance between the production and elimination of ROS via the regulation of a series of detoxifying and antioxidant enzyme gene expressions by means of the antioxidant response element (ARE. Dietary phytochemicals, which are generally found in vegetables, fruits, grains, and herbs, have been reported to have health benefits and to improve the growth performance and meat quality of farm animals through the regulation of Nrf2-mediated phase II enzymes in a variety of ways. However, the enormous quantity of somewhat chaotic data that is available on the effects of phytochemicals needs to be properly classified according to the functions or mechanisms of phytochemicals. In this review, we first introduce the antioxidant properties of phytochemicals and their relation to the Nrf2/Keap1 system. We then summarize the effects of phytochemicals on the growth performance, meat quality, and intestinal microbiota of farm animals via targeting the Nrf2/Keap1 system. These exhaustive data contribute to better illuminate the underlying biofunctional properties of phytochemicals in farm animals.

  17. Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway

    Directory of Open Access Journals (Sweden)

    W. Rungratanawanich

    2018-01-01

    Full Text Available γ-Oryzanol (ORY is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293. The 24 h ORY exposure significantly prevented hydrogen peroxide- (H2O2- induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD and glutathione peroxidase (GPX. Interestingly, ORY induced the nuclear factor (erythroid-derived 2-like 2 (Nrf2 nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(PH quinone reductase (NQO1, heme oxygenase-1 (HO-1, and glutathione synthetase (GSS at mRNA and protein levels in both basal condition and after H2O2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.

  18. Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway.

    Science.gov (United States)

    Rungratanawanich, W; Abate, G; Serafini, M M; Guarienti, M; Catanzaro, M; Marziano, M; Memo, M; Lanni, C; Uberti, D

    2018-01-01

    γ -Oryzanol (ORY) is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS) scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293). The 24 h ORY exposure significantly prevented hydrogen peroxide- (H 2 O 2 -) induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD) and glutathione peroxidase (GPX). Interestingly, ORY induced the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(P)H quinone reductase (NQO1), heme oxygenase-1 (HO-1), and glutathione synthetase (GSS) at mRNA and protein levels in both basal condition and after H 2 O 2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.

  19. Comparative analysis of transcriptomic responses to repeated-dose exposure to 2-MCPD and 3-MCPD in rat kidney, liver and testis.

    Science.gov (United States)

    Buhrke, Thorsten; Schultrich, Katharina; Braeuning, Albert; Lampen, Alfonso

    2017-08-01

    3-Chloro-1,2-propanediol (3-MCPD) and its isomer 2-chloro-1,3-propanediol (2-MCPD) are heat-induced food contaminants present in oil- and fat-containing foodstuff. Kidney and testes are among the main target organs of 3-MCPD. Almost no data on 2-MCPD toxicity are available. Here, transcriptomic responses following repeated-dose exposure of rats to non-toxic doses of 10 mg/kg body weight per day 2-MCPD or 3-MCPD for 28 days were characterized by microarray analysis of kidney, liver, and testes. 3-MCPD exerted more pronounced effects than 2-MCPD in all organs. The limited overlap between the datasets indicates that 2-MCPD and 3-MCPD do not share the same molecular mechanisms of toxicity. By combining transcriptomic data with datasets on proteomic regulation by 3-MCPD, a comprehensive view on 3-MCPD-induced regulation of glucose utilization and oxidative stress response was developed. Bioinformatic analyses revealed that Nrf2 (nuclear factor (erythroid-derived 2)-like 2) signaling is likely to be involved in mediating the oxidative stress response to 3-MCPD. In summary, this study for the first time presents data on alterations in global gene expression by two important food contaminants, 2-MCPD and 3-MCPD. Data demonstrate profound differences between the effects of the two compounds and substantially broaden our knowledge on molecular details of 3-MCPD-induced disturbance of glucose utilization and redox balance. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Tetrachloro-p-benzoquinone induces hepatic oxidative damage and inflammatory response, but not apoptosis in mouse: The prevention of curcumin

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Demei; Hu, Lihua; Su, Chuanyang; Xia, Xiaomin; Zhang, Pu; Fu, Juanli; Wang, Wenchao; Xu, Duo; Du, Hong; Hu, Qiuling; Song, Erqun; Song, Yang, E-mail: songyangwenrong@hotmail.com

    2014-10-15

    This study investigated the protective effects of curcumin on tetrachloro-p-benzoquinone (TCBQ)-induced hepatotoxicity in mice. TCBQ-treatment causes significant liver injury (the elevation of serum AST and ALT activities, histopathological changes in liver section including centrilobular necrosis and inflammatory cells), oxidative stress (the elevation of TBAR level and the inhibition of SOD and catalase activities) and inflammation (up-regulation of iNOS, COX-2, IL-1β, IL-6, TNF-α and NF-κB). However, these changes were alleviated upon pretreatment with curcumin. Interestingly, TCBQ has no effect on caspase family genes or B-cell lymphoma 2 (Bcl-2)/Bcl-2 associated X (Bax) protein expressions, which implied that TCBQ-induced hepatotoxicity is independent of apoptosis. Moreover, curcumin was shown to induce phase II detoxifying/antioxidant enzymes HO-1 and NQO1 through the activation of nuclear factor erythroid-derived 2-like 2 (Nrf2). In summary, the protective mechanisms of curcumin against TCBQ-induced hepatoxicity may be related to the attenuation of oxidative stress, along with the inhibition of inflammatory response via the activation of Nrf2 signaling. - Highlights: • TCBQ-intoxication significantly increased AST and ALT activities. • TCBQ-intoxication induced oxidative stress in mice liver. • TCBQ-intoxication induced inflammatory response in mice liver. • TCBQ-intoxication induced hepatotoxicity is independent of apoptosis. • Curcumin relieved TCBQ-induced liver damage remarkably.

  1. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  2. SOS2-LIKE PROTEIN KINASE5, an SNF1-RELATED PROTEIN KINASE3-Type Protein Kinase, Is Important for Abscisic Acid Responses in Arabidopsis through Phosphorylation of ABSCISIC ACID-INSENSITIVE51[OPEN

    Science.gov (United States)

    Zhou, Xiaona; Hao, Hongmei; Zhang, Yuguo; Bai, Yili; Zhu, Wenbo; Qin, Yunxia; Yuan, Feifei; Zhao, Feiyi; Wang, Mengyao; Hu, Jingjiang; Xu, Hong; Guo, Aiguang; Zhao, Huixian; Zhao, Yang; Cao, Cuiling; Yang, Yongqing; Schumaker, Karen S.; Guo, Yan; Xie, Chang Gen

    2015-01-01

    Abscisic acid (ABA) plays an essential role in seed germination. In this study, we demonstrate that one SNF1-RELATED PROTEIN KINASE3-type protein kinase, SOS2-LIKE PROTEIN KINASE5 (PKS5), is involved in ABA signal transduction via the phosphorylation of an interacting protein, ABSCISIC ACID-INSENSITIVE5 (ABI5). We found that pks5-3 and pks5-4, two previously identified PKS5 superactive kinase mutants with point mutations in the PKS5 FISL/NAF (a conserved peptide that is necessary for interaction with SOS3 or SOS3-LIKE CALCIUM BINDING PROTEINs) motif and the kinase domain, respectively, are hypersensitive to ABA during seed germination. PKS5 was found to interact with ABI5 in yeast (Saccharomyces cerevisiae), and this interaction was further confirmed in planta using bimolecular fluorescence complementation. Genetic studies revealed that ABI5 is epistatic to PKS5. PKS5 phosphorylates a serine (Ser) residue at position 42 in ABI5 and regulates ABA-responsive gene expression. This phosphorylation was induced by ABA in vivo and transactivated ABI5. Expression of ABI5, in which Ser-42 was mutated to alanine, could not fully rescue the ABA-insensitive phenotypes of the abi5-8 and pks5-4abi5-8 mutants. In contrast, mutating Ser-42 to aspartate rescued the ABA insensitivity of these mutants. These data demonstrate that PKS5-mediated phosphorylation of ABI5 at Ser-42 is critical for the ABA regulation of seed germination and gene expression in Arabidopsis (Arabidopsis thaliana). PMID:25858916

  3. In planta processing and glycosylation of a nematode CLAVATA3/ENDOSPERM SURROUNDING REGION-like effector and its interaction with a host CLAVATA2-like receptor to promote parasitism.

    Science.gov (United States)

    Chen, Shiyan; Lang, Ping; Chronis, Demosthenis; Zhang, Sheng; De Jong, Walter S; Mitchum, Melissa G; Wang, Xiaohong

    2015-01-01

    Like other biotrophic plant pathogens, plant-parasitic nematodes secrete effector proteins into host cells to facilitate infection. Effector proteins that mimic plant CLAVATA3/ENDOSPERM SURROUNDING REGION-related (CLE) proteins have been identified in several cyst nematodes, including the potato cyst nematode (PCN); however, the mechanistic details of this cross-kingdom mimicry are poorly understood. Plant CLEs are posttranslationally modified and proteolytically processed to function as bioactive ligands critical to various aspects of plant development. Using ectopic expression coupled with nanoliquid chromatography-tandem mass spectrometry analysis, we show that the in planta mature form of proGrCLE1, a multidomain CLE effector secreted by PCN during infection, is a 12-amino acid arabinosylated glycopeptide (named GrCLE1-1Hyp4,7g) with striking structural similarity to mature plant CLE peptides. This glycopeptide is more resistant to hydrolytic degradation and binds with higher affinity to a CLAVATA2-like receptor (StCLV2) from potato (Solanum tuberosum) than its nonglycosylated forms. We further show that StCLV2 is highly up-regulated at nematode infection sites and that transgenic potatoes with reduced StCLV2 expression are less susceptible to PCN infection, indicating that interference of the CLV2-mediated signaling pathway confers nematode resistance in crop plants. These results strongly suggest that phytonematodes have evolved to utilize host cellular posttranslational modification and processing machinery for the activation of CLE effectors following secretion into plant cells and highlight the significance of arabinosylation in regulating nematode CLE effector activity. Our finding also provides evidence that multidomain CLEs are modified and processed similarly to single-domain CLEs, adding new insight into CLE maturation in plants. © 2015 American Society of Plant Biologists. All Rights Reserved.

  4. In Planta Processing and Glycosylation of a Nematode CLAVATA3/ENDOSPERM SURROUNDING REGION-Like Effector and Its Interaction with a Host CLAVATA2-Like Receptor to Promote Parasitism1[OPEN

    Science.gov (United States)

    Chen, Shiyan; Lang, Ping; Chronis, Demosthenis; Zhang, Sheng; De Jong, Walter S.; Mitchum, Melissa G.

    2015-01-01

    Like other biotrophic plant pathogens, plant-parasitic nematodes secrete effector proteins into host cells to facilitate infection. Effector proteins that mimic plant CLAVATA3/ENDOSPERM SURROUNDING REGION-related (CLE) proteins have been identified in several cyst nematodes, including the potato cyst nematode (PCN); however, the mechanistic details of this cross-kingdom mimicry are poorly understood. Plant CLEs are posttranslationally modified and proteolytically processed to function as bioactive ligands critical to various aspects of plant development. Using ectopic expression coupled with nanoliquid chromatography-tandem mass spectrometry analysis, we show that the in planta mature form of proGrCLE1, a multidomain CLE effector secreted by PCN during infection, is a 12-amino acid arabinosylated glycopeptide (named GrCLE1-1Hyp4,7g) with striking structural similarity to mature plant CLE peptides. This glycopeptide is more resistant to hydrolytic degradation and binds with higher affinity to a CLAVATA2-like receptor (StCLV2) from potato (Solanum tuberosum) than its nonglycosylated forms. We further show that StCLV2 is highly up-regulated at nematode infection sites and that transgenic potatoes with reduced StCLV2 expression are less susceptible to PCN infection, indicating that interference of the CLV2-mediated signaling pathway confers nematode resistance in crop plants. These results strongly suggest that phytonematodes have evolved to utilize host cellular posttranslational modification and processing machinery for the activation of CLE effectors following secretion into plant cells and highlight the significance of arabinosylation in regulating nematode CLE effector activity. Our finding also provides evidence that multidomain CLEs are modified and processed similarly to single-domain CLEs, adding new insight into CLE maturation in plants. PMID:25416475

  5. Risk Factors

    Science.gov (United States)

    ... cells do not invade nearby tissues or spread. Risk Factors Key Points Factors That are Known to ... chemicals . Factors That are Known to Increase the Risk of Cancer Cigarette Smoking and Tobacco Use Tobacco ...

  6. Cervical Cancer Cell Supernatants Induce a Phenotypic Switch from U937-Derived Macrophage-Activated M1 State into M2-Like Suppressor Phenotype with Change in Toll-Like Receptor Profile

    Directory of Open Access Journals (Sweden)

    Karina Sánchez-Reyes

    2014-01-01

    Full Text Available Cervical cancer (CC is the second most common cancer among women worldwide. Infection with human papillomavirus (HPV is the main risk factor for developing CC. Macrophages are important immune effector cells; they can be differentiated into two phenotypes, identified as M1 (classically activated and M2 (alternatively activated. Macrophage polarization exerts profound effects on the Toll-like receptor (TLR profile. In this study, we evaluated whether the supernatant of human CC cells HeLa, SiHa, and C-33A induces a shift of M1 macrophage toward M2 macrophage in U937-derived macrophages. Results. The results showed that soluble factors secreted by CC cells induce a change in the immunophenotype of macrophages from macrophage M1 into macrophage M2. U937-derived macrophages M1 released proinflammatory cytokines and nitric oxide; however, when these cells were treated with the supernatant of CC cell lines, we observed a turnover of M1 toward M2. These cells increased CD163 and IL-10 expression. The expression of TLR-3, -7, and -9 is increased when the macrophages were treated with the supernatant of CC cells. Conclusions. Our result strongly suggests that CC cells may, through the secretion of soluble factors, induce a change of immunophenotype M1 into M2 macrophages.

  7. Factor XII (Hageman factor) deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000545.htm Factor XII (Hageman factor) deficiency To use the sharing features on this ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  8. RAGE-Specific Inhibitor FPS-ZM1 Attenuates AGEs-Induced Neuroinflammation and Oxidative Stress in Rat Primary Microglia.

    Science.gov (United States)

    Shen, Chao; Ma, Yingjuan; Zeng, Ziling; Yin, Qingqing; Hong, Yan; Hou, Xunyao; Liu, Xueping

    2017-10-01

    Advanced glycation end products (AGEs) enhance microglial activation and intensify the inflammatory response and oxidative stress in the brain. This process may occur due to direct cytotoxicity or interacting with AGEs receptors (RAGE), which are expressed on the surface of microglia. FPS-ZM1 is a high-affinity but nontoxic RAGE-specific inhibitor that has been recently shown to attenuate the Aβ-induced inflammatory response by blocking the ligation of Aβ to RAGE. In this study, we further investigated the effect of FPS-ZM1 on the AGEs/RAGE interaction and downstream elevation of neuroinflammation and oxidative stress in primary microglia cells. The results suggested that FPS-ZM1 significantly suppressed AGEs-induced RAGE overexpression, RAGE-dependent microglial activation, nuclear translocation of nuclear factor kappaB p65 (NF-κB p65), and the expression of downstream inflammatory mediators such as tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), cyclooxygenase 2 (COX-2)/prostaglandin E2 (PGE2) and inducible nitric oxide synthase (iNOS)/nitric oxide (NO). Furthermore, FPS-ZM1 attenuated AGEs-stimulated NADPH oxidase (NOX) activation and reactive oxygen species (ROS) expression. Finally, FPS-ZM1 elevated the levels of transcription factors nuclear-factor (erythroid-derived 2)-like 2 (Nrf2) and heme oxygenase-1 (HO-1), as well as decreased antioxidant capacity and increased production of oxidative species. Our results suggest that FPS-ZM1 may be neuroprotective through attenuating microglial activation, oxidative stress and inflammation by blocking RAGE.

  9. TGF-β and Hypoxia/Reoxygenation Promote Radioresistance of A549 Lung Cancer Cells through Activation of Nrf2 and EGFR

    Directory of Open Access Journals (Sweden)

    Sae-lo-oom Lee

    2016-01-01

    Full Text Available Although many studies have examined the roles of hypoxia and transforming growth factor- (TGF- β separately in the tumor microenvironment, the effects of simultaneous treatment with hypoxia/reoxygenation and TGF-β on tumor malignancy are unclear. Here, we investigated the effects of redox signaling and oncogenes on cell proliferation and radioresistance in A549 human lung cancer cells in the presence of TGF-β under hypoxia/reoxygenation conditions. Combined treatment with TGF-β and hypoxia activated epidermal growth factor receptor (EGFR and nuclear factor (erythroid-derived 2-like 2 (Nrf2, a redox-sensitive transcription factor. Interestingly, Nrf2 knockdown suppressed the effects of combined treatment on EGFR phosphorylation. In addition, blockade of EGFR signaling also suppressed induction of Nrf2 following combined treatment with hypoxia and TGF-β, indicating that the combined treatment induced positive crosstalk between Nrf2 and EGFR. TGF-β and hypoxia/reoxygenation increased the accumulation of reactive oxygen species (ROS, while treatment with N-acetyl-L-cysteine abolished the activation of Nrf2 and EGFR. Treatment with TGF-β under hypoxic conditions increased the proliferation of A549 cells compared with that after vehicle treatment. Moreover, cells treated with the combined treatment exhibited resistance to ionizing radiation (IR, and knockdown of Nrf2 increased IR-induced cell death under these conditions. Thus, taken together, our findings suggested that TGF-β and hypoxia/reoxygenation promoted tumor progression and radioresistance of A549 cells through ROS-mediated activation of Nrf2 and EGFR.

  10. Gemfibrozil pretreatment proved protection against acute restraint stress-induced changes in the male rats' hippocampus.

    Science.gov (United States)

    Khalaj, Leila; Nejad, Sara Chavoshi; Mohammadi, Marzieh; Zadeh, Sadaf Sarraf; Pour, Marieh Hossein; Ahmadiani, Abolhassan; Khodagholi, Fariba; Ashabi, Ghorbangol; Alamdary, Shabnam Zeighamy; Samami, Elham

    2013-08-21

    Stress predisposes the brain to various neuropathological disorders. Fibrates like gemfibrozil, commonly used for hyperlipidemia, have not yet been examined for their protective/deteriorative potential against restraint stress-induced disturbances. Pretreatment of rats with a range of gemfibrozil concentrations showed significant protection against stress consequences at 90 mg/kg of gemfibrozil, as it resulted in the highest level of antioxidant defense system potentiation among other doses. It also reduced plasma corticosterone compared with the stressed animals. Administration of gemfibrozil (90 mg/kg) before stress induction was able to significantly induce the protein levels of some protective factors including hemeoxygenase-1 (HO-1) and NAD(P)H dehydrogenase quinone-1 (NQO-1) in the antioxidant nuclear factor erythroid-derived 2-like 2 (Nrf-2) pathway, as well as mitochondrial pro-survival proteins, including peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) and nuclear respiratory factor 1 (NRF-1). In parallel, the level of cleaved caspase-3 and apoptosis-inducing factor (AIF), two proteins involved in apoptotic cell death, and the number of damaged neurons detected in hematoxylin-eosin (H&E) stained hippocampus sections were suppressed in the presence of gemfibrozil. Herein, although gemfibrozil demonstrated protection against the restraint stress, considering its dose and context-dependent effects reported in the previous studies, as well as its common application in clinic, further investigations are essential to unravel its exact beneficial/deleterious effects in various neuronal contexts. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Robust factorization

    DEFF Research Database (Denmark)

    Aanæs, Henrik; Fisker, Rune; Åström, Kalle

    2002-01-01

    Factorization algorithms for recovering structure and motion from an image stream have many advantages, but they usually require a set of well-tracked features. Such a set is in generally not available in practical applications. There is thus a need for making factorization algorithms deal effect...

  12. Organizational factors

    International Nuclear Information System (INIS)

    Holy, J.

    1999-12-01

    The following organizational factors are considered with respect to the human factor and operating safety of nuclear power plants: external influences; objectives and strategy; positions and ways of management; allocation of resources; working with human resources; operators' training; coordination of work; knowledge of organization and management; proceduralization of the topic; labour organizing culture; self-improvement system; and communication. (P.A.)

  13. El factoring

    Directory of Open Access Journals (Sweden)

    Alberto Rosenthal

    1988-04-01

    Full Text Available RESUMEN El artículo  presenta, una conceptualización general de lo que es el factoring, el origen del mismo, su evolución y hace una clasificación de los distintos tipos de factoring.

  14. Alterations in leukocyte transcriptional control pathway activity associated with major depressive disorder and antidepressant treatment.

    Science.gov (United States)

    Mellon, S H; Wolkowitz, O M; Schonemann, M D; Epel, E S; Rosser, R; Burke, H B; Mahan, L; Reus, V I; Stamatiou, D; Liew, C-C; Cole, S W

    2016-05-24

    Major depressive disorder (MDD) is associated with a significantly elevated risk of developing serious medical illnesses such as cardiovascular disease, immune impairments, infection, dementia and premature death. Previous work has demonstrated immune dysregulation in subjects with MDD. Using genome-wide transcriptional profiling and promoter-based bioinformatic strategies, we assessed leukocyte transcription factor (TF) activity in leukocytes from 20 unmedicated MDD subjects versus 20 age-, sex- and ethnicity-matched healthy controls, before initiation of antidepressant therapy, and in 17 of the MDD subjects after 8 weeks of sertraline treatment. In leukocytes from unmedicated MDD subjects, bioinformatic analysis of transcription control pathway activity indicated an increased transcriptional activity of cAMP response element-binding/activating TF (CREB/ATF) and increased activity of TFs associated with cellular responses to oxidative stress (nuclear factor erythroid-derived 2-like 2, NFE2l2 or NRF2). Eight weeks of antidepressant therapy was associated with significant reductions in Hamilton Depression Rating Scale scores and reduced activity of NRF2, but not in CREB/ATF activity. Several other transcriptional regulation pathways, including the glucocorticoid receptor (GR), nuclear factor kappa-B cells (NF-κB), early growth response proteins 1-4 (EGR1-4) and interferon-responsive TFs, showed either no significant differences as a function of disease or treatment, or activities that were opposite to those previously hypothesized to be involved in the etiology of MDD or effective treatment. Our results suggest that CREB/ATF and NRF2 signaling may contribute to MDD by activating immune cell transcriptome dynamics that ultimately influence central nervous system (CNS) motivational and affective processes via circulating mediators.

  15. Catechins and Their Therapeutic Benefits to Inflammatory Bowel Disease

    Directory of Open Access Journals (Sweden)

    Fei-Yan Fan

    2017-03-01

    Full Text Available Catechins are natural polyphenolic phytochemicals that exist in food and medicinal plants, such as tea, legume and rubiaceae. An increasing number of studies have associated the intake of catechins-rich foods with the prevention and treatment of chronic diseases in humans, such as inflammatory bowel disease (IBD. Some studies have demonstrated that catechins could significantly inhibit the excessive oxidative stress through direct or indirect antioxidant effects and promote the activation of the antioxidative substances such as glutathione peroxidases (GPO and glutathione (GSH, reducing the oxidative damages to the colon. In addition, catechins can also regulate the infiltration and proliferation of immune related-cells, such as neutrophils, colonic epithelial cells, macrophages, and T lymphocytes, helping reduce the inflammatory relations and provide benefits to IBD. Perhaps catechins can further inhibit the deterioration of intestinal lesions through regulating the cell gap junctions. Furthermore, catechins can exert their significant anti-inflammatory properties by regulating the activation or deactivation of inflammation-related oxidative stress-related cell signaling pathways, such as nuclear factor-kappa B (NF-κB, mitogen activated protein kinases (MAPKs, transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2, signal transducer and the activator of transcription 1/3 (STAT1/3 pathways. Finally, catechins can also stabilize the structure of the gastrointestinal micro-ecological environment via promoting the proliferation of beneficial intestinal bacteria and regulating the balance of intestinal flora, so as to relieve the IBD. Furthermore, catechins may regulate the tight junctions (TJ in the epithelium. This paper elaborates the currently known possible molecular mechanisms of catechins in favor of IBD.

  16. Indoxyl Sulfate Affects Glial Function Increasing Oxidative Stress and Neuroinflammation in Chronic Kidney Disease: Interaction between Astrocytes and Microglia

    Directory of Open Access Journals (Sweden)

    Simona Adesso

    2017-06-01

    Full Text Available Indoxyl sulfate (IS is a protein-bound uremic toxin resulting from the metabolism of dietary tryptophan which accumulates in patients with impaired renal function, such as chronic kidney disease (CKD. IS is a well-known nephrovascular toxin but little is known about its effects on central nervous system (CNS cells. Considering the growing interest in the field of CNS comorbidities in CKD, we studied the effect of IS on CNS cells. IS (15–60 μM treatment in C6 astrocyte cells increased reactive oxygen species release and decreased nuclear factor (erythroid-derived 2-like 2 (Nrf2 activation, and heme oxygenase-1 (HO-1 and NAD(PH dehydrogenase quinone 1 expression. Moreover, IS increased Aryl hydrocarbon Receptor (AhR and Nuclear Factor-kB (NF-kB activation in these cells. Similiar observations were made in primary mouse astrocytes and mixed glial cells. Inducible nitric oxide synthase and cyclooxygenase-2 (COX-2 expression, tumor necrosis factor-α and interleukin-6 release and nitrotyrosine formation were increased by IS (15–60 μM in primary mouse astrocytes and mixed glial cells. IS increased AhR and NF-kB nuclear translocation and reduced Nrf2 translocation and HO-1 expression in primary glial cells. In addition, IS induced cell death in neurons in a dose dependent fashion. Injection of IS (800 mg/kg, i.p. into mice induced histological changes and increased COX-2 expression and nitrotyrosine formation in thebrain tissue. Taken together, our results show a significant contribution of IS in generating a neurotoxic enviroment and it could also have a potential role in neurodegeneration. IS could be considered also a potential therapeutical target for CKD-associated neurodegenerative complications.

  17. The flavones apigenin and luteolin induce FOXO1 translocation but inhibit gluconeogenic and lipogenic gene expression in human cells.

    Directory of Open Access Journals (Sweden)

    Christiane Bumke-Vogt

    Full Text Available The flavones apigenin (4',5,7,-trihydroxyflavone and luteolin (3',4',5,7,-tetrahydroxyflavone are plant secondary metabolites with antioxidant, antiinflammatory, and anticancer activities. We evaluated their impact on cell signaling pathways related to insulin-resistance and type 2 diabetes. Apigenin and luteolin were identified in our U-2 OS (human osteosarcoma cell screening assay for micronutrients triggering rapid intracellular translocation of the forkhead box transcription factor O1 (FOXO1, an important mediator of insulin signal transduction. Insulin reversed the translocation of FOXO1 as shown by live cell imaging. The impact on the expression of target genes was evaluated in HepG2 (human hepatoma cells. The mRNA-expression of the gluconeogenic enzymes phosphoenolpyruvate carboxykinase (PEPCK and glucose-6-phosphatase (G6Pc, the lipogenic enzymes fatty-acid synthase (FASN and acetyl-CoA-carboxylase (ACC were down-regulated by both flavones with smaller effective dosages of apigenin than for luteolin. PKB/AKT-, PRAS40-, p70S6K-, and S6-phosphorylation was reduced by apigenin and luteolin but not that of the insulin-like growth factor receptor IGF-1R by apigenin indicating a direct inhibition of the PKB/AKT-signaling pathway distal to the IGF-1 receptor. N-acetyl-L-cysteine did not prevent FOXO1 nuclear translocation induced by apigenin and luteolin, suggesting that these flavones do not act via oxidative stress. The roles of FOXO1, FOXO3a, AKT, sirtuin1 (SIRT1, and nuclear factor (erythroid-derived2-like2 (NRF2, investigated by siRNA knockdown, showed differential patterns of signal pathways involved and a role of NRF2 in the inhibition of gluconeogenic enzyme expression. We conclude that these flavones show an antidiabetic potential due to reduction of gluconeogenic and lipogenic capacity despite inhibition of the PKB/AKT pathway which justifies detailed investigation in vivo.

  18. Catalase inhibition in diabetic rats potentiates DNA damage and apoptotic cell death setting the stage for cardiomyopathy.

    Science.gov (United States)

    Ivanović-Matić, Svetlana; Bogojević, Desanka; Martinović, Vesna; Petrović, Anja; Jovanović-Stojanov, Sofija; Poznanović, Goran; Grigorov, Ilijana

    2014-12-01

    Diabetes is a risk factor for cardiovascular disease that has a multifactorial etiology, with oxidative stress as an important component. Our previous observation of a significant diabetes-related increase in rat cardiac catalase (CAT) activity suggested that CAT could play a major role in delaying the development of diabetic cardiomyopathy. Thus, in the present work, we examined the effects of the daily administration of the CAT inhibitor, 3-amino-1,2,4-triazole (1 mg/g), on the hearts of streptozotocin (STZ)-induced diabetic rats. Administration of CAT inhibitor was started from the 15th day after the last STZ treatment (40 mg/kg/5 days), and maintained until the end of the 4th or 6th weeks of diabetes. Compared to untreated diabetic rats, at the end of the observation period, CAT inhibition lowered the induced level of cardiac CAT activity to the basal level and decreased CAT protein expression, mediated through a decline in the nuclear factor erythroid-derived 2-like 2 /nuclear factor-kappa B p65 (Nrf2/NF-κB p65) subunit ratio. The perturbed antioxidant defenses resulting from CAT inhibition promoted increased H₂O₂production (P < 0.05) and lipid peroxidation (P < 0.05). Generated cytotoxic stimuli increased DNA damage (P < 0.05) and activated pro-apoptotic events, observed as a decrease (P < 0.05) in the ratio of the apoptosis regulator proteins Bcl-2/Bax, increased (P < 0.05) presence of the poly(ADP-ribose) polymerase-1 (PARP-1) 85 kDa apoptotic fragment and cytoplasmic levels of cytochrome C. These findings confirm an important function of CAT in the suppression of events leading to diabetes-promoted cardiac dysfunction and cardiomyopathy.

  19. Synthetic oleanane triterpenoids: multifunctional drugs with a broad range of applications for prevention and treatment of chronic disease.

    Science.gov (United States)

    Liby, Karen T; Sporn, Michael B

    2012-10-01

    We review the rationale for the use of synthetic oleanane triterpenoids (SOs) for prevention and treatment of disease, as well as extensive biological data on this topic resulting from both cell culture and in vivo studies. Emphasis is placed on understanding mechanisms of action. SOs are noncytotoxic drugs with an excellent safety profile. Several hundred SOs have now been synthesized and in vitro have been shown to: 1) suppress inflammation and oxidative stress and therefore be cytoprotective, especially at low nanomolar doses, 2) induce differentiation, and 3) block cell proliferation and induce apoptosis at higher micromolar doses. Animal data on the use of SOs in neurodegenerative diseases and in diseases of the eye, lung, cardiovascular system, liver, gastrointestinal tract, and kidney, as well as in cancer and in metabolic and inflammatory/autoimmune disorders, are reviewed. The importance of the cytoprotective Kelch-like erythroid cell-derived protein with CNC homology-associated protein 1/nuclear factor (erythroid-derived 2)-like 2/antioxidant response element (Keap1/Nrf2/ARE) pathway as a mechanism of action is explained, but interactions with peroxisome proliferator-activated receptor γ (PARPγ), inhibitor of nuclear factor-κB kinase complex (IKK), janus tyrosine kinase/signal transducer and activator of transcription (JAK/STAT), human epidermal growth factor receptor 2 (HER2)/ErbB2/neu, phosphatase and tensin homolog (PTEN), the phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) pathway, mammalian target of rapamycin (mTOR), and the thiol proteome are also described. In these interactions, Michael addition of SOs to reactive cysteine residues in specific molecular targets triggers biological activity. Ultimately, SOs are multifunctional drugs that regulate the activity of entire networks. Recent progress in the earliest clinical trials with 2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oic acid (CDDO) methyl ester (bardoxolone methyl) is also

  20. Linagliptin potentiates the effect of l-dopa on the behavioural, biochemical and immunohistochemical changes in experimentally-induced Parkinsonism: Role of toll-like receptor 4, TGF-β1, NF-κB and glucagon-like peptide 1.

    Science.gov (United States)

    Kabel, Ahmed M; Omar, Mohamed S; Alhadhrami, A; Alharthi, Salman S; Alrobaian, Majed M

    2018-05-01

    Our aim was to assess the effect of different doses of linagliptin with or without l-dopa/Carbidopa on 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced parkinsonism in mice. Eighty Balb/c mice were divided into 8 equal groups: Control; MPTP; MPTP + l-dopa/Carbidopa; MPTP + linagliptin 3 mg/kg/day; MPTP + linagliptin 10 mg/kg/day; MPTP + Carboxymethyl cellulose; MPTP + l-dopa/Carbidopa + linagliptin 3 mg/kg/day and MPTP + l-dopa/Carbidopa + linagliptin 10 mg/kg/day. Striatal dopamine, tumor necrosis factor alpha (TNF-α), interleukin 10 (IL-10), transforming growth factor beta 1 (TGF-β1), toll-like receptor 4 (TLR4), antioxidant enzymes, adenosine triphosphate (ATP), glucagon-like peptide-1 (GLP-1), receptors of advanced glycation end products (RAGE), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), heme oxygenase-1 (HO-1), mitochondrial complex I activity, catalepsy and total swim scores were measured. Also, the substantia nigra was subjected to immunohistochemical examination. The combination of l-dopa/Carbidopa and linagliptin in a dose-dependent manner resulted in significant improvement of the behavioural changes, striatal dopamine, antioxidant parameters, Nrf2/HO-1 content, GLP-1, ATP and mitochondrial complex I activity with significant decrease in striatal RAGE, TGF-β1, TNF-α, IL-10, TLR4 and alleviated the immunohistochemical changes better than the groups that received either l-dopa/Carbidopa or linagliptin alone. The combination of l-dopa/Carbidopa and linagliptin might represent a promising therapeutic modality for management of parkinsonism. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Neuroprotective effects of α-iso-cubebene against glutamate-induced damage in the HT22 hippocampal neuronal cell line.

    Science.gov (United States)

    Park, Sun Young; Jung, Won Jung; Kang, Jum Soon; Kim, Cheol-Min; Park, Geuntae; Choi, Young-Whan

    2015-02-01

    Since oxidative stress is critically involved in excitotoxic damage, we sought to determine whether the activation of the transcription factors, cAMP-responsive element binding protein (CREB) and nuclear factor (erythroid-derived 2)-like 2 (Nrf2, also known as NFE2L2), by α-iso-cubebene is involved in its protective effects against glutamate-induced neuronal cell death. Pre-treatment with α-iso-cubebene significantly attenuated glutamate-induced cytotoxicity in mouse hippocampus-derived neuronal cells. α-iso-cubebene also reduced the glutamate-induced generation of reactive oxygen species and calcium influx, thus preventing apoptotic cell death. α-iso-cubebene inhibited glutamate-induced mitochondrial membrane depolarization and, consequently, inhibited the release of the apoptosis-inducing factor from the mitochondria. Immunoblot anlaysis revealed that the phosphorylation of extracellular signal-regulated kinase (ERK) by glutamate was reduced in the presence of α-iso-cubebene. α-iso-cubebene activated protein kinase A (PKA), CREB and Nrf2, which mediate the expression of the antioxidant enzymes, heme oxygenase-1 (HO-1) and NAD(P)H dehydrogenase [quinone] 1 (NQO1), involved in neuroprotection. In addition, α-iso-cubebene induced the expression of antioxidant responsive element and CRE transcriptional activity, thus conferring neuroprotection against glutamate-induced oxidative injury. α-iso-cubebene also induced the expression of Nrf2-dependent genes encoding HO-1 and NQO1. Furthermore, the knockdown of CREB and Nrf2 by small interfering RNA attenuated the neuroprotective effects of α-iso-cubebene. Taken together, our results indicate that α-iso-cubebene protects HT22 cells from glutamate-induced oxidative damage through the activation of Nrf2/HO-1/NQO-1, as well as through the PKA and CREB signaling pathways.

  2. El factoring

    Directory of Open Access Journals (Sweden)

    Alberto Rosenthal

    2015-04-01

    Full Text Available RESUMEN Se presenta la segunda parte del artículo aparecido en  el número 6 de la revista EAN. Su contenido es complementario a lo expuesto en dicho número, en está aparecen las ventajas del factoring, conveniencias, limitaciones así como la forma  de efectuar un factor en Colombia,  su necesidad, incidencia económica, etc.

  3. Coenzyme Q10 Supplementation Modulates NFκB and Nrf2 Pathways in Exercise Training

    Directory of Open Access Journals (Sweden)

    Ragip Pala, Cemal Orhan, Mehmet Tuzcu, Nurhan Sahin, Shakir Ali, Vedat Cinar, Mustafa Atalay, Kazim Sahin

    2016-03-01

    Full Text Available This study reports the effects of Q10, coenzyme Q10 or ubiquinone, a component of the electron transport chain in mitochondria, on nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB, inhibitors of kappa B (IκB, nuclear factor (erythroid-derived 2-like 2 (Nrf2 and hemeoxygenase 1 (HO-1 in rats after chronic exercise training for 6 weeks. 8-week old male Wistar rats were assigned randomly to one of four treatments planned in a 2 x 2 factorial arrangement of two condition (sedentary vs. exercise training, and two coenzyme Q10 levels (0 and 300 mg/kg per day for 6 weeks. The expression levels of the target proteins were determined in the heart, liver and muscle, and biochemical parameters including creatinine, urea, glucose and lipid profile were investigated in plasma. When compared with sedentary group, significant decreases in heart, liver and muscle NFκB levels by 45%, 26% and 44% were observed in Q10 supplemented rats after exercise training, respectively, while the inhibitory protein IκB increased by 179%, 111% and 127% in heart, liver and muscle tissues. Q10 supplementation caused an increase in Nrf2 (167%, 165% and 90% and HO-1 (107%, 156% and 114% after exercise training in heart, liver and muscle tissues (p < 0.05. No significant change was observed in any of the parameters associated with protein, carbohydrate and lipid metabolism, except that exercise caused a decrease in plasma triglyceride, which was further decreased by Q10. In conclusion, these results suggest that Q10 modulates the expression of NFκB, IκB, Nrf2 and HO-1 in exercise training, indicating an anti-inflammatory effect of Q10 and emphasizes its role in antioxidant defense.

  4. Docosahexaenoic acid (DHA): An essential nutrient and a nutraceutical for brain health and diseases.

    Science.gov (United States)

    Sun, Grace Y; Simonyi, Agnes; Fritsche, Kevin L; Chuang, Dennis Y; Hannink, Mark; Gu, Zezong; Greenlief, C Michael; Yao, Jeffrey K; Lee, James C; Beversdorf, David Q

    2017-03-10

    Docosahexaenoic acid (DHA), a polyunsaturated fatty acid (PUFA) enriched in phospholipids in the brain and retina, is known to play multi-functional roles in brain health and diseases. While arachidonic acid (AA) is released from membrane phospholipids by cytosolic phospholipase A 2 (cPLA 2 ), DHA is linked to action of the Ca 2+ -independent iPLA2. DHA undergoes enzymatic conversion by 15-lipoxygenase (Alox 15) to form oxylipins including resolvins and neuroprotectins, which are powerful lipid mediators. DHA can also undergo non-enzymatic conversion by reacting with oxygen free radicals (ROS), which cause the production of 4-hydoxyhexenal (4-HHE), an aldehyde derivative which can form adducts with DNA, proteins and lipids. In studies with both animal models and humans, there is evidence that inadequate intake of maternal n-3 PUFA may lead to aberrant development and function of the central nervous system (CNS). What is less certain is whether consumption of n-3 PUFA is important in maintaining brain health throughout one's life span. Evidence mostly from non-human studies suggests that DHA intake above normal nutritional requirements might modify the risk/course of a number of diseases of the brain. This concept has fueled much of the present interest in DHA research, in particular, in attempts to delineate mechanisms whereby DHA may serve as a nutraceutical and confer neuroprotective effects. Current studies have revealed ability for the oxylipins to regulation of cell redox homeostasis through the Nuclear factor (erythroid-derived 2)-like 2/Antioxidant response element (Nrf2/ARE) anti-oxidant pathway, and impact signaling pathways associated with neurotransmitters, and modulation of neuronal functions involving brain-derived neurotropic factor (BDNF). This review is aimed at describing recent studies elaborating these mechanisms with special regard to aging and Alzheimer's disease, autism spectrum disorder, schizophrenia, traumatic brain injury, and stroke

  5. Increasing N-acetylaspartate in the Brain during Postnatal Myelination Does Not Cause the CNS Pathologies of Canavan Disease

    Directory of Open Access Journals (Sweden)

    Abhilash P. Appu

    2017-06-01

    Full Text Available Canavan disease is caused by mutations in the gene encoding aspartoacylase (ASPA, a deacetylase that catabolizes N-acetylaspartate (NAA. The precise involvement of elevated NAA in the pathogenesis of Canavan disease is an ongoing debate. In the present study, we tested the effects of elevated NAA in the brain during postnatal development. Mice were administered high doses of the hydrophobic methyl ester of NAA (M-NAA twice daily starting on day 7 after birth. This treatment increased NAA levels in the brain to those observed in the brains of Nur7 mice, an established model of Canavan disease. We evaluated various serological parameters, oxidative stress, inflammatory and neurodegeneration markers and the results showed that there were no pathological alterations in any measure with increased brain NAA levels. We examined oxidative stress markers, malondialdehyde content (indicator of lipid peroxidation, expression of NADPH oxidase and nuclear translocation of the stress-responsive transcription factor nuclear factor (erythroid-derived 2-like 2 (NRF-2 in brain. We also examined additional pathological markers by immunohistochemistry and the expression of activated caspase-3 and interleukin-6 by Western blot. None of the markers were increased in the brains of M-NAA treated mice, and no vacuoles were observed in any brain region. These results show that ASPA expression prevents the pathologies associated with excessive NAA concentrations in the brain during postnatal myelination. We hypothesize that the pathogenesis of Canavan disease involves not only disrupted NAA metabolism, but also excessive NAA related signaling processes in oligodendrocytes that have not been fully determined and we discuss some of the potential mechanisms.

  6. Elevated pressure, a novel cancer therapeutic tool for sensitizing cisplatin-mediated apoptosis in A549

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Sangnam [Cellular and Developmental Biology, Division of Biomedical Science, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Department of Preventive Medicine and Medical Research Center for Environmental Toxico-Genomics and Proteomics, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Kim, Yanghee [Department of Preventive Medicine and Medical Research Center for Environmental Toxico-Genomics and Proteomics, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Kim, Joonhee [Cellular and Developmental Biology, Division of Biomedical Science, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Department of Preventive Medicine and Medical Research Center for Environmental Toxico-Genomics and Proteomics, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Kwon, Daeho [Department of Preventive Medicine and Medical Research Center for Environmental Toxico-Genomics and Proteomics, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Lee, Eunil, E-mail: eunil@korea.ac.kr [Cellular and Developmental Biology, Division of Biomedical Science, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Department of Preventive Medicine and Medical Research Center for Environmental Toxico-Genomics and Proteomics, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of)

    2010-08-13

    Research highlights: {yields} Sensitized apoptosis in cancer cells stimulated by EP precondition with p53 dependence. {yields} EP attenuates several CDDP-resistance mechanisms. {yields} No harmful effect of EP on normal fibroblasts. -- Abstract: Intensive cancer therapy strategies have thus far focused on sensitizing cancer cells to anticancer drug-mediated apoptosis to overcome drug resistance, and this strategy has led to more effective cancer therapeutics. Cisplatin (cis-diamminedichloroplatinum(II), CDDP) is an effective anticancer drug used to treat many types of cancer, including non-small cell lung carcinoma (NSCLC), and can be used in combination with various chemicals to enhance cancer cell apoptosis. Here, we introduce the use of elevated pressure (EP) in combination with CDDP for cancer treatment and explore the effects of EP on CDDP-mediated apoptosis in NSCLC cells. Our findings demonstrate that preconditioning NSCLC cells with EP sensitizes cells for CDDP-induced apoptosis. Enhanced apoptosis was dependent on p53 and HO-1 expression, and was associated with increased DNA damage and down-regulation of genes involved in nucleotide excision repair. The transcriptional levels of transporter proteins indicated that the mechanism by which EP-induced CDDP sensitization was intracellular drug accumulation. The protein levels of some antioxidants, such as hemeoxygenase-1 (HO-1), glutathione (GSH) and glutathione peroxidase (Gpx), were decreased in A549 cells exposed to EP via the down-regulation of the transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf-2). Furthermore, normal human fibroblasts were resistant to EP treatment, with no elevated DNA damage or apoptosis. Collectively, these data show that administration of EP is a potential adjuvant tool for CDDP-based chemosensitivity of lung cancer cells that may reduce drug resistance.

  7. Elevated pressure, a novel cancer therapeutic tool for sensitizing cisplatin-mediated apoptosis in A549

    International Nuclear Information System (INIS)

    Oh, Sangnam; Kim, Yanghee; Kim, Joonhee; Kwon, Daeho; Lee, Eunil

    2010-01-01

    Research highlights: → Sensitized apoptosis in cancer cells stimulated by EP precondition with p53 dependence. → EP attenuates several CDDP-resistance mechanisms. → No harmful effect of EP on normal fibroblasts. -- Abstract: Intensive cancer therapy strategies have thus far focused on sensitizing cancer cells to anticancer drug-mediated apoptosis to overcome drug resistance, and this strategy has led to more effective cancer therapeutics. Cisplatin (cis-diamminedichloroplatinum(II), CDDP) is an effective anticancer drug used to treat many types of cancer, including non-small cell lung carcinoma (NSCLC), and can be used in combination with various chemicals to enhance cancer cell apoptosis. Here, we introduce the use of elevated pressure (EP) in combination with CDDP for cancer treatment and explore the effects of EP on CDDP-mediated apoptosis in NSCLC cells. Our findings demonstrate that preconditioning NSCLC cells with EP sensitizes cells for CDDP-induced apoptosis. Enhanced apoptosis was dependent on p53 and HO-1 expression, and was associated with increased DNA damage and down-regulation of genes involved in nucleotide excision repair. The transcriptional levels of transporter proteins indicated that the mechanism by which EP-induced CDDP sensitization was intracellular drug accumulation. The protein levels of some antioxidants, such as hemeoxygenase-1 (HO-1), glutathione (GSH) and glutathione peroxidase (Gpx), were decreased in A549 cells exposed to EP via the down-regulation of the transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf-2). Furthermore, normal human fibroblasts were resistant to EP treatment, with no elevated DNA damage or apoptosis. Collectively, these data show that administration of EP is a potential adjuvant tool for CDDP-based chemosensitivity of lung cancer cells that may reduce drug resistance.

  8. Ellagic acid ameliorates learning and memory deficits in a rat model of Alzheimer's disease: an exploration of underlying mechanisms.

    Science.gov (United States)

    Kiasalari, Zahra; Heydarifard, Rana; Khalili, Mohsen; Afshin-Majd, Siamak; Baluchnejadmojarad, Tourandokht; Zahedi, Elham; Sanaierad, Ashkan; Roghani, Mehrdad

    2017-06-01

    Alzheimer's disease (AD) is a neurodegenerative disorder with irreversible loss of intellectual abilities. Current therapies for AD are still insufficient. In this study, the effect of ellagic acid on learning and memory deficits was evaluated in intrahippocampal amyloid beta (Aβ 25-35 )-microinjected rats and its modes of action were also explored. AD rat model was induced by bilateral intrahippocampal microinjection of Aβ 25-35 and ellagic acid was daily administered (10, 50, and 100 mg/kg), and learning, recognition memory, and spatial memory were evaluated in addition to histochemical assessment, oxidative stress, cholinesterases activity, and level of nuclear factor-kappaB (NF-κB), Toll-like receptor 4 (TLR4), and nuclear factor (erythroid-derived 2)-like 2 (Nrf2). The amyloid beta-microinjected rats showed a lower discrimination ratio in novel object and alternation score in Y maze tasks and exhibited an impairment of retention and recall capability in passive avoidance paradigm and higher working and reference memory errors in radial arm maze (RAM). In addition, amyloid beta group showed a lower number of Nissl-stained neurons in CA1 area in addition to enhanced oxidative stress, higher activity of cholinesterases, greater level of NF-κB and TLR4, and lower level of nuclear/cytoplasmic ratio for Nrf2 and ellagic acid at a dose of 100 mg/kg significantly prevented most of these abnormal alterations. Ellagic acid pretreatment of intrahippocampal amyloid beta-microinjected rats could dose-dependently improve learning and memory deficits via neuronal protection and at molecular level through mitigation of oxidative stress and acetylcholinesterase (AChE) activity and modulation of NF-κB/Nrf2/TLR4 signaling pathway.

  9. Quality factors

    International Nuclear Information System (INIS)

    Kerr, G.D.

    1986-01-01

    The quality factor, Q, is a dimensionless modifier used in converting absorbed dose, expressed in rads (or grays), to dose equivalent, expressed in rems (or seiverts). The dose equivalent is used in radiation protection to account for the biological effectiveness of different kinds of radiation. The quality factor is related to both the linear energy transfer (LET) and relative biological effectiveness (RBE). The RBE's obtained from biological experiments depend in a complex way on the observed biological effect, the specific test organism, and the experimental conditions. Judgement is involved, therefore, in the choice of the quality factor. Questions regarding the adequacy of current Q values for neutrons were raised first in a 1980 statement by the National Council on Radiation Protection (NCRP) and later in a 1985 statement by the International Commission on Radiological Protection (ICRP). In 1980, the NCRP alerted the technical community to possible future increases between a factor of three and ten in the Q for neutrons, and in 1985, the ICRP suggested an increase by a factor of two in Q for neutrons. Both the ICRP and NRCP are now recommending essentially the same guidance with regard to Q for neutrons: an increase by a factor of two. The Q for neutrons is based on a large, albeit unfocused, body of experimental data. In spite of the lack of focus, the data supporting a change in the neutron quality factor are substantial. However, the proposed doubling of Q for neutrons is clouded by other issues regarding its application. 33 refs., 4 figs., 6 tabs

  10. Biochemical characterization and anti-inflammatory properties of an isothiocyanate-enriched moringa (Moringa oleifera) seed extract.

    Science.gov (United States)

    Jaja-Chimedza, Asha; Graf, Brittany L; Simmler, Charlotte; Kim, Youjin; Kuhn, Peter; Pauli, Guido F; Raskin, Ilya

    2017-01-01

    Moringa oleifera Lam. is a tropical plant, used for centuries as food and traditional medicine. The aim of this study was to develop, validate and biochemically characterize an isothiocyanate-enriched moringa seed extract (MSE), and to compare the anti-inflammatory effects of MSE-containing moringa isothiocyanate-1 (MIC-1) with a curcuminoid-enriched turmeric extract (CTE), and a material further enriched in its primary phytochemical, curcumin (curcumin-enriched material; CEM). MSE was prepared by incubating ground moringa seeds with water to allow myrosinase-catalyzed enzymatic formation of bioactive MIC-1, the predominant isothiocyanate in moringa seeds. Optimization of the extraction process yielded an extract of 38.9% MIC-1. Phytochemical analysis of MSE revealed the presence of acetylated isothiocyanates, phenolic glycosides unique to moringa, flavonoids, fats and fatty acids, proteins and carbohydrates. MSE showed a reduction in the carrageenan-induced rat paw edema (33% at 500 mg/kg MIC-1) comparable to aspirin (27% at 300 mg/kg), whereas CTE did not have any significant effect. In vitro, MIC-1 at 1 μM significantly reduced the production of nitric oxide (NO) and at 5 μM, the gene expression of LPS-inducible nitric oxide synthase (iNOS) and interleukins 1β and 6 (IL-1β and IL-6), whereas CEM did not show any significant activity at all concentrations tested. MIC-1 (10μM) was also more effective at upregulating the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) target genes NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase pi 1 (GSTP1), and heme oxygenase 1 (HO1) than the CEM. Thus, in contrast to CTE and CEM, MSE and its major isothiocyanate MIC-1 displayed strong anti-inflammatory and antioxidant properties in vivo and in vitro, making them promising botanical leads for the mitigation of inflammatory-mediated chronic disorders.

  11. Curcumin Pretreatment Induces Nrf2 and an Antioxidant Response and Prevents Hemin-Induced Toxicity in Primary Cultures of Cerebellar Granule Neurons of Rats

    Directory of Open Access Journals (Sweden)

    Susana González-Reyes

    2013-01-01

    Full Text Available Curcumin is a bifunctional antioxidant derived from Curcuma longa. This study identifies curcumin as a neuroprotectant against hemin-induced damage in primary cultures of cerebellar granule neurons (CGNs of rats. Hemin, the oxidized form of heme, is a highly reactive compound that induces cellular injury. Pretreatment of CGNs with 5–30 μM curcumin effectively increased by 2.3–4.9 fold heme oxygenase-1 (HO-1 expression and by 5.6–14.3-fold glutathione (GSH levels. Moreover, 15 μM curcumin attenuated by 55% the increase in reactive oxygen species (ROS production, by 94% the reduction of GSH/glutathione disulfide (GSSG ratio, and by 49% the cell death induced by hemin. The inhibition of heme oxygenase system or GSH synthesis with tin mesoporphyrin and buthionine sulfoximine, respectively, suppressed the protective effect of curcumin against hemin-induced toxicity. These data strongly suggest that HO-1 and GSH play a major role in the protective effect of curcumin. Furthermore, it was found that 24 h of incubation with curcumin increases by 1.4-, 2.3-, and 5.2-fold the activity of glutathione reductase, glutathione S-transferase and superoxide dismutase, respectively. Additionally, it was found that curcumin was capable of inducing nuclear factor (erythroid-derived 2-like 2 (Nrf2 translocation into the nucleus. These data suggest that the pretreatment with curcumin induces Nrf2 and an antioxidant response that may play an important role in the protective effect of this antioxidant against hemin-induced neuronal death.

  12. UDP-Glucuronosyltransferase Expression in Mouse Liver Is Increased in Obesity- and Fasting-Induced Steatosis

    Science.gov (United States)

    Xu, Jialin; Kulkarni, Supriya R.; Li, Liya

    2012-01-01

    UDP-glucuronosyltransferases (Ugt) catalyze phase II conjugation reactions with glucuronic acid, which enhances chemical polarity and the elimination from the body. Few studies have addressed whether Ugt expression and activity are affected by liver disease, such as steatosis. The purpose of this study was to determine whether steatosis induced by obesity or fasting could affect liver Ugt mRNA expression and activity. Male C57BL/6J and Lepob/ob (ob/ob) mice were fed ad libitum or food was withheld for 24 h. In steatotic livers of ob/ob mice, Ugt1a1, -1a6, -1a9, -2a3, -3a1, and -3a2 mRNA expression increased. Fasting, which also induced steatosis, increased hepatic Ugt1a1, -1a6, -1a7, -1a9, -2b1, -2b5, -2a3, -3a1, and -3a2 mRNA expression in mouse liver. Likewise, acetaminophen glucuronidation increased by 47% in hepatic microsomes from ob/ob mice compared with that in C57BL/6J mice, but not after fasting. In both steatosis models, Ugt induction was accompanied by increased aryl hydrocarbon receptor, constitutive androstane receptor (CAR), peroxisome proliferator-activated receptor (PPAR)-α, pregnane X receptor, nuclear factor (erythroid-derived 2)-like 2 (Nrf2), and peroxisome proliferator-activated receptor-γ coactivator-1α mRNA expression. In addition, fasting increased CAR, PPAR, and Nrf2 binding activity. The work points to hepatic triglyceride concentrations corresponding with nuclear receptor and Ugt expression. The findings indicate that steatosis significantly alters hepatic Ugt expression and activity, which could have a significant impact on determining circulating hormone levels, drug efficacy, and environmental chemical clearance. PMID:22031624

  13. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  14. UDP-glucuronosyltransferase expression in mouse liver is increased in obesity- and fasting-induced steatosis.

    Science.gov (United States)

    Xu, Jialin; Kulkarni, Supriya R; Li, Liya; Slitt, Angela L

    2012-02-01

    UDP-glucuronosyltransferases (Ugt) catalyze phase II conjugation reactions with glucuronic acid, which enhances chemical polarity and the elimination from the body. Few studies have addressed whether Ugt expression and activity are affected by liver disease, such as steatosis. The purpose of this study was to determine whether steatosis induced by obesity or fasting could affect liver Ugt mRNA expression and activity. Male C57BL/6J and Lep(ob/ob) (ob/ob) mice were fed ad libitum or food was withheld for 24 h. In steatotic livers of ob/ob mice, Ugt1a1, -1a6, -1a9, -2a3, -3a1, and -3a2 mRNA expression increased. Fasting, which also induced steatosis, increased hepatic Ugt1a1, -1a6, -1a7, -1a9, -2b1, -2b5, -2a3, -3a1, and -3a2 mRNA expression in mouse liver. Likewise, acetaminophen glucuronidation increased by 47% in hepatic microsomes from ob/ob mice compared with that in C57BL/6J mice, but not after fasting. In both steatosis models, Ugt induction was accompanied by increased aryl hydrocarbon receptor, constitutive androstane receptor (CAR), peroxisome proliferator-activated receptor (PPAR)-α, pregnane X receptor, nuclear factor (erythroid-derived 2)-like 2 (Nrf2), and peroxisome proliferator-activated receptor-γ coactivator-1α mRNA expression. In addition, fasting increased CAR, PPAR, and Nrf2 binding activity. The work points to hepatic triglyceride concentrations corresponding with nuclear receptor and Ugt expression. The findings indicate that steatosis significantly alters hepatic Ugt expression and activity, which could have a significant impact on determining circulating hormone levels, drug efficacy, and environmental chemical clearance.

  15. The role of artichoke leaf tincture (Cynara scolymus) in the suppression of DNA damage and atherosclerosis in rats fed an atherogenic diet.

    Science.gov (United States)

    Bogavac-Stanojevic, Natasa; Kotur Stevuljevic, Jelena; Cerne, Darko; Zupan, Janja; Marc, Janja; Vujic, Zorica; Crevar-Sakac, Milkica; Sopic, Miron; Munjas, Jelena; Radenkovic, Miroslav; Jelic-Ivanovic, Zorana

    2018-12-01

    Polyphenols and flavonoids in artichoke leaf tincture (ALT) protect cells against oxidative damage. We examined ALT effects on deoxyribonucleic acid (DNA) damage and lipid profiles in rat plasma and gene expression in rat aorta [haemeoxygenase-1 (HO1), haemeoxygenase-2 (HO2), NADPH oxidase 4 (NOX-4), monocyte chemoattractant protein-1 (MCP-1) and nuclear factor (erythroid-derived 2)-like 2 (Nrf2)]. Eighteen male Wistar albino rats were divided into three groups (n = 6/group): The control group (CG) was fed with standard pellet chow for 11 weeks; the AD group was fed for a similar period of time with pellet chow supplemented with 2% cholesterol, 3% sunflower oil and 1% sodium cholate. The ADA group was fed with pellet chow (for 1 week), the atherogenic diet (see above) for the following 4 weeks and then with ALT (0.1 mL/kg body weight) and atherogenic diet for 6 weeks. According to HPLC analysis, the isolated main compounds in ALT were chlorogenic acid, caffeic acid, isoquercitrin and rutin. Normalized HO-1 [0.11 (0.04-0.24)] and MCP-1 [0.29 (0.21-0.47)] mRNA levels and DNA scores [12.50 (4.50-36.50)] were significantly lower in the ADA group than in the AD group [0.84 (0.35-2.51)], p = 0.021 for HO-1 [0.85 (0.61-3.45)], p = 0.047 for MCP-1 and [176.5 (66.50-221.25)], p = 0.020 for DNA scores. HO-1 mRNA was lower in the ADA group than in the CG group [0.30 (0.21-0.71), p = 0.049]. Supplementation with ALT limited the effects of the atherogenic diet through reduced MCP-1 expression, thereby preventing oxidative damage.

  16. Peracetylated hydroxytyrosol, a new hydroxytyrosol derivate, attenuates LPS-induced inflammatory response in murine peritoneal macrophages via regulation of non-canonical inflammasome, Nrf2/HO1 and JAK/STAT signaling pathways.

    Science.gov (United States)

    Montoya, Tatiana; Aparicio-Soto, Marina; Castejón, María Luisa; Rosillo, María Ángeles; Sánchez-Hidalgo, Marina; Begines, Paloma; Fernández-Bolaños, José G; Alarcón-de-la-Lastra, Catalina

    2018-03-18

    The present study was designed to investigate the anti-inflammatory effects of a new derivative of hydroxytyrosol (HTy), peracetylated hydroxytyrosol (Per-HTy), compared with its parent, HTy, on lipopolysaccharide (LPS)-stimulated murine macrophages as well as potential signaling pathways involved. In particular, we attempted to characterize the role of the inflammasome underlying Per-HTy possible anti-inflammatory effects. Isolated murine peritoneal macrophages were treated with HTy or its derivative in the presence or absence of LPS (5 μg/ml) for 18 h. Cell viability was determined using sulforhodamine B (SRB) assay. Nitric oxide (NO) production was analyzed by Griess method. Production of pro-inflammatory cytokines was evaluated by enzyme-linked immunosorbent assay (ELISA) and inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2, janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway (STAT3), haem oxigenase 1 (HO1), nuclear factor (erythroid-derived 2)-like 2 (Nrf2) expression and mitogen-activated protein kinases (MAPKs) activation was determined by Western blot. Per-HTy significantly reduced the levels of NO and pro-inflammatory cytokines as well as both COX-2 and iNOS expressions. Furthermore, Per-HTy treatment inhibited STAT3 and increased Nrf2 and HO1 protein levels in murine macrophages exposed to LPS. In addition, Per-HTy anti-inflammatory activity was related with an inhibition of non-canonical nucleotide binding domain (NOD)-like receptor (NLRP3) inflammasome pathways by decreasing pro-inflammatory interleukin (IL)-1β and IL-18 cytokine levels as consequence of regulation of cleaved caspase-11 enzyme. These results support that this new HTy derivative may offer a new promising nutraceutical therapeutic strategy in the management of inflammatory-related pathologies. Copyright © 2018. Published by Elsevier Inc.

  17. Green tea diet decreases PCB 126-induced oxidative stress in mice by up-regulating antioxidant enzymes.

    Science.gov (United States)

    Newsome, Bradley J; Petriello, Michael C; Han, Sung Gu; Murphy, Margaret O; Eske, Katryn E; Sunkara, Manjula; Morris, Andrew J; Hennig, Bernhard

    2014-02-01

    Superfund chemicals such as polychlorinated biphenyls pose a serious human health risk due to their environmental persistence and link to multiple diseases. Selective bioactive food components such as flavonoids have been shown to ameliorate PCB toxicity, but primarily in an in vitro setting. Here, we show that mice fed a green tea-enriched diet and subsequently exposed to environmentally relevant doses of coplanar PCB exhibit decreased overall oxidative stress primarily due to the up-regulation of a battery of antioxidant enzymes. C57BL/6 mice were fed a low-fat diet supplemented with green tea extract (GTE) for 12 weeks and exposed to 5 μmol PCB 126/kg mouse weight (1.63 mg/kg-day) on weeks 10, 11 and 12 (total body burden: 4.9 mg/kg). F2-isoprostane and its metabolites, established markers of in vivo oxidative stress, measured in plasma via HPLC-MS/MS exhibited fivefold decreased levels in mice supplemented with GTE and subsequently exposed to PCB compared to animals on a control diet exposed to PCB. Livers were collected and harvested for both messenger RNA and protein analyses, and it was determined that many genes transcriptionally controlled by aryl hydrocarbon receptor and nuclear factor (erythroid-derived 2)-like 2 proteins were up-regulated in PCB-exposed mice fed the green tea-supplemented diet. An increased induction of genes such as SOD1, GSR, NQO1 and GST, key antioxidant enzymes, in these mice (green tea plus PCB) may explain the observed decrease in overall oxidative stress. A diet supplemented with green tea allows for an efficient antioxidant response in the presence of PCB 126, which supports the emerging paradigm that healthful nutrition may be able to bolster and buffer a physiological system against the toxicities of environmental pollutants. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Reduced mitochondrial mass and function add to age-related susceptibility toward diet-induced fatty liver in C57BL/6J mice.

    Science.gov (United States)

    Lohr, Kerstin; Pachl, Fiona; Moghaddas Gholami, Amin; Geillinger, Kerstin E; Daniel, Hannelore; Kuster, Bernhard; Klingenspor, Martin

    2016-10-01

    Nonalcoholic fatty liver disease (NAFLD) is a major health burden in the aging society with an urging medical need for a better understanding of the underlying mechanisms. Mitochondrial fatty acid oxidation and mitochondrial-derived reactive oxygen species (ROS) are considered critical in the development of hepatic steatosis, the hallmark of NAFLD. Our study addressed in C57BL/6J mice the effect of high fat diet feeding and age on liver mitochondria at an early stage of NAFLD development. We therefore analyzed functional characteristics of hepatic mitochondria and associated alterations in the mitochondrial proteome in response to high fat feeding in adolescent, young adult, and middle-aged mice. Susceptibility to diet-induced obesity increased with age. Young adult and middle-aged mice developed fatty liver, but not adolescent mice. Fat accumulation was negatively correlated with an age-related reduction in mitochondrial mass and aggravated by a reduced capacity of fatty acid oxidation in high fat-fed mice. Irrespective of age, high fat diet increased ROS production in hepatic mitochondria associated with a balanced nuclear factor erythroid-derived 2 like 2 (NFE2L2) dependent antioxidative response, most likely triggered by reduced tethering of NFE2L2 to mitochondrial phosphoglycerate mutase 5. Age indirectly influenced mitochondrial function by reducing mitochondrial mass, thus exacerbating diet-induced fat accumulation. Therefore, consideration of age in metabolic studies must be emphasized. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  19. Biochemical characterization and anti-inflammatory properties of an isothiocyanate-enriched moringa (Moringa oleifera seed extract.

    Directory of Open Access Journals (Sweden)

    Asha Jaja-Chimedza

    Full Text Available Moringa oleifera Lam. is a tropical plant, used for centuries as food and traditional medicine. The aim of this study was to develop, validate and biochemically characterize an isothiocyanate-enriched moringa seed extract (MSE, and to compare the anti-inflammatory effects of MSE-containing moringa isothiocyanate-1 (MIC-1 with a curcuminoid-enriched turmeric extract (CTE, and a material further enriched in its primary phytochemical, curcumin (curcumin-enriched material; CEM. MSE was prepared by incubating ground moringa seeds with water to allow myrosinase-catalyzed enzymatic formation of bioactive MIC-1, the predominant isothiocyanate in moringa seeds. Optimization of the extraction process yielded an extract of 38.9% MIC-1. Phytochemical analysis of MSE revealed the presence of acetylated isothiocyanates, phenolic glycosides unique to moringa, flavonoids, fats and fatty acids, proteins and carbohydrates. MSE showed a reduction in the carrageenan-induced rat paw edema (33% at 500 mg/kg MIC-1 comparable to aspirin (27% at 300 mg/kg, whereas CTE did not have any significant effect. In vitro, MIC-1 at 1 μM significantly reduced the production of nitric oxide (NO and at 5 μM, the gene expression of LPS-inducible nitric oxide synthase (iNOS and interleukins 1β and 6 (IL-1β and IL-6, whereas CEM did not show any significant activity at all concentrations tested. MIC-1 (10μM was also more effective at upregulating the nuclear factor (erythroid-derived 2-like 2 (Nrf2 target genes NAD(PH:quinone oxidoreductase 1 (NQO1, glutathione S-transferase pi 1 (GSTP1, and heme oxygenase 1 (HO1 than the CEM. Thus, in contrast to CTE and CEM, MSE and its major isothiocyanate MIC-1 displayed strong anti-inflammatory and antioxidant properties in vivo and in vitro, making them promising botanical leads for the mitigation of inflammatory-mediated chronic disorders.

  20. Tissue sensitivity of the rat upper and lower extrapulmonary airways to the inhaled electrophilic air pollutants diacetyl and acrolein.

    Science.gov (United States)

    Cichocki, Joseph A; Smith, Gregory J; Morris, John B

    2014-11-01

    The target site for inhaled vapor-induced injury often differs in mouth-breathing humans compared with nose-breathing rats, thus complicating the use of rat inhalation toxicity data for assessment of human risk. We sought to examine sensitivity of respiratory/transitional nasal (RTM) and tracheobronchial (TBM) mucosa to two electrophilic irritant vapors: diacetyl and acrolein. Computational fluid dynamic physiologically based pharmacokinetic modeling was coupled with biomarker assessment to establish delivered dose-response relationships in RTM and TBM in male F344 rats following 6 h exposure to diacetyl or acrolein. Biomarkers included glutathione status, proinflammatory and antioxidant gene mRNA levels, and nuclear translocation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2). Modeling revealed that 0.0094-0.1653 μg acrolein/min-cm(2) and 3.9-21.6 μg diacetyl/min-cm(2) were deposited into RTM/TBM. Results indicate RTM and TBM were generally of similar sensitivity to diacetyl and acrolein. For instance, both tissues displayed induction of antioxidant and proinflammatory genes, and nuclear accumulation of Nrf2 after electrophile exposure. Hierarchical cellular response patterns were similar in RTM and TBM but differed between vapors. Specifically, diacetyl exposure induced proinflammatory and antioxidant genes concomitantly at low exposure levels, whereas acrolein induced antioxidant genes at much lower exposure levels than that required to induce proinflammatory genes. Generally, diacetyl was less potent than acrolein, as measured by maximal induction of transcripts. In conclusion, the upper and lower extrapulmonary airways are of similar sensitivity to inhaled electrophilic vapors. Dosimetrically based extrapolation of nasal responses in nose-breathing rodents may provide an approach to predict risk to the lower airways of humans during mouth-breathing. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All

  1. Curcumin Pretreatment Induces Nrf2 and an Antioxidant Response and Prevents Hemin-Induced Toxicity in Primary Cultures of Cerebellar Granule Neurons of Rats

    Science.gov (United States)

    González-Reyes, Susana; Guzmán-Beltrán, Silvia; Medina-Campos, Omar Noel; Pedraza-Chaverri, José

    2013-01-01

    Curcumin is a bifunctional antioxidant derived from Curcuma longa. This study identifies curcumin as a neuroprotectant against hemin-induced damage in primary cultures of cerebellar granule neurons (CGNs) of rats. Hemin, the oxidized form of heme, is a highly reactive compound that induces cellular injury. Pretreatment of CGNs with 5–30 μM curcumin effectively increased by 2.3–4.9 fold heme oxygenase-1 (HO-1) expression and by 5.6–14.3-fold glutathione (GSH) levels. Moreover, 15 μM curcumin attenuated by 55% the increase in reactive oxygen species (ROS) production, by 94% the reduction of GSH/glutathione disulfide (GSSG) ratio, and by 49% the cell death induced by hemin. The inhibition of heme oxygenase system or GSH synthesis with tin mesoporphyrin and buthionine sulfoximine, respectively, suppressed the protective effect of curcumin against hemin-induced toxicity. These data strongly suggest that HO-1 and GSH play a major role in the protective effect of curcumin. Furthermore, it was found that 24 h of incubation with curcumin increases by 1.4-, 2.3-, and 5.2-fold the activity of glutathione reductase, glutathione S-transferase and superoxide dismutase, respectively. Additionally, it was found that curcumin was capable of inducing nuclear factor (erythroid-derived 2)-like 2 (Nrf2) translocation into the nucleus. These data suggest that the pretreatment with curcumin induces Nrf2 and an antioxidant response that may play an important role in the protective effect of this antioxidant against hemin-induced neuronal death. PMID:24454990

  2. Characterization of docosahexaenoic acid (DHA)-induced heme oxygenase-1 (HO-1) expression in human cancer cells: the importance of enhanced BTB and CNC homology 1 (Bach1) degradation.

    Science.gov (United States)

    Wang, Shuai; Hannafon, Bethany N; Wolf, Roman F; Zhou, Jundong; Avery, Jori E; Wu, Jinchang; Lind, Stuart E; Ding, Wei-Qun

    2014-05-01

    The effect of docosahexaenoic acid (DHA) on heme oxygenase-1 (HO-1) expression in cancer cells has never been characterized. This study examines DHA-induced HO-1 expression in human cancer cell model systems. DHA enhanced HO-1 gene expression in a time- and concentration-dependent manner, with maximal induction at 21 h of treatment. This induction of HO-1 expression was confirmed in vivo using a xenograft nude mouse model fed a fish-oil-enriched diet. The increase in HO-1 gene transcription induced by DHA was significantly attenuated by the antioxidant N-acetyl cysteine, suggesting the involvement of oxidative stress. This was supported by direct measurement of lipid peroxide levels after DHA treatment. Using a human HO-1 gene promoter reporter construct, we identified two antioxidant response elements (AREs) that mediate the DHA-induced increase in HO-1 gene transcription. Knockdown of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) expression compromised the DHA-induced increase in HO-1 gene transcription, indicating the importance of the Nrf2 pathway in this event. However, the nuclear protein levels of Nrf2 remained unchanged upon DHA treatment. Further studies demonstrated that DHA reduces nuclear Bach1 protein expression by promoting its degradation and attenuates Bach1 binding to the AREs in the HO-1 gene promoter. In contrast, DHA enhanced Nrf2 binding to the AREs without affecting nuclear Nrf2 expression levels, indicating a new cellular mechanism that mediates DHA's induction of HO-1 gene transcription. To our knowledge, this is the first characterization of DHA-induced HO-1 expression in human malignant cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Effects of isolated vitamin B6 supplementation on oxidative stress and heart function parameters in experimental hyperhomocysteinemia

    Directory of Open Access Journals (Sweden)

    Roberta Hack Mendes

    2017-07-01

    Full Text Available Introduction: The purpose of this study was to investigate the effects of isolated vitamin B6 (VB6 supplementation on experimental hyperhomocysteinemia (Hhe induced by homocysteine thiolactone (HcyT. Methods: Fifteen male Wistar rats were divided into three groups according to their treatment. Animals received water and food ad libitum and an intragastric probe was used to administer water for 60 days (groups: CB6, HcyT, and HB6. On the 30th day of treatment, two groups were supplemented with VB6 in the drinking water (groups: CB6 and HB6. After 60 days of treatment, homocysteine (Hcy, cysteine, and hydrogen peroxide concentration, nuclear factor (erythroid-derived 2-like 2 (NRF2 and glutathione S-transferase (GST immunocontent, and superoxide dismutase (SOD, catalase (CAT, and GST activities were measured. Results: The HcyT group showed an increase in Hcy concentration (62% in relation to the CB6 group. Additionally, GST immunocontent was enhanced (51% in the HB6 group compared to the HcyT group. Also, SOD activity was lower (17% in the HB6 group compared to the CB6 group, and CAT activity was higher in the HcyT group (53% compared to the CB6 group. Ejection fraction (EF was improved in the HB6 group compared to the HcyT group. E/A ratio was enhanced in the HB6 group compared to the CB6 group. Correlations were found between CAT activity with myocardial performance index (MPI (r = 0.71; P = 0.06 and E/A ratio (r = 0.6; P = 0.01, and between EF and GST activity (r = 0.62; P = 0.02. Conclusions: These findings indicate that isolated VB6 supplementation may lead to the reduction of Hcy concentration and promotes additional benefits to oxidative stress and heart function parameters.   Keywords: Homocysteine; oxidative stress; vitamin B6.

  4. Proteomic analysis of 3-MCPD and 3-MCPD dipalmitate-induced toxicity in rat kidney.

    Science.gov (United States)

    Sawada, Stefanie; Oberemm, Axel; Buhrke, Thorsten; Merschenz, Julia; Braeuning, Albert; Lampen, Alfonso

    2016-06-01

    3-Chloropropane-1,2-diol (3-MCPD) and its fatty acid esters are formed during thermal treatment of fat-containing foodstuff in the presence of salt. Toxicological studies indicate a carcinogenic potential of 3-MCPD, pointing to the kidney as the main target organ. It is assumed that the toxicological property of 3-MCPD esters is constituted by the release of 3-MCPD during digestion. In a repeated-dose 28-day oral toxicity study using Wistar rats, animals were treated with equimolar doses of either 3-MCPD (10 mg/kg body weight) or 3-MCPD dipalmitate (53 mg/kg body weight). A lower dose of 3-MCPD dipalmitate (13.3 mg/kg body weight) was also applied. No histopathologically visible toxicity was observed in the study. To address molecular mechanisms leading to toxicity of 3-MCPD and its esters, kidney samples were analyzed by a comparative, two-dimensional gel electrophoresis/mass spectrometry proteomic approach. After either 3-MCPD or 3-MCPD dipalmitate treatment, alterations in proteins related to various metabolic pathways, including carbohydrate, amino acid, and fatty acid metabolism, were detected. These findings confirm and complement previous data on the inhibition of glucose metabolism by 3-MCPD. Altogether, broad overlap of 3-MCPD- and 3-MCPD dipalmitate-induced proteomic changes was observed. Further analyses revealed that the observed induction of glutathione S-transferase pi 1 (Gstp1) occurred at the transcriptional level and was not related to nuclear factor (erythroid-derived 2)-like 2 activation. Overall, the results indicate common mechanisms of toxicity for 3-MCPD and its dipalmitate ester. Furthermore, data suggest Gstp1 as a sensitive marker for early 3-MCPD-induced effects in rat kidney.

  5. Protection from cyanide-induced brain injury by the Nrf2 transcriptional activator carnosic acid.

    Science.gov (United States)

    Zhang, Dongxian; Lee, Brian; Nutter, Anthony; Song, Paul; Dolatabadi, Nima; Parker, James; Sanz-Blasco, Sara; Newmeyer, Traci; Ambasudhan, Rajesh; McKercher, Scott R; Masliah, Eliezer; Lipton, Stuart A

    2015-06-01

    Cyanide is a life-threatening, bioterrorist agent, preventing cellular respiration by inhibiting cytochrome c oxidase, resulting in cardiopulmonary failure, hypoxic brain injury, and death within minutes. However, even after treatment with various antidotes to protect cytochrome oxidase, cyanide intoxication in humans can induce a delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Additional mechanisms are thought to underlie cyanide-induced neuronal damage, including generation of reactive oxygen species. This may account for the fact that antioxidants prevent some aspects of cyanide-induced neuronal damage. Here, as a potential preemptive countermeasure against a bioterrorist attack with cyanide, we tested the CNS protective effect of carnosic acid (CA), a pro-electrophilic compound found in the herb rosemary. CA crosses the blood-brain barrier to up-regulate endogenous antioxidant enzymes via activation of the Nrf2 transcriptional pathway. We demonstrate that CA exerts neuroprotective effects on cyanide-induced brain damage in cultured rodent and human-induced pluripotent stem cell-derived neurons in vitro, and in vivo in various brain areas of a non-Swiss albino mouse model of cyanide poisoning that simulates damage observed in the human brain. Cyanide, a potential bioterrorist agent, can produce a chronic delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Here, cyanide poisoning treated with the proelectrophillic compound carnosic acid, results in reduced neuronal cell death in both in vitro and in vivo models through activation of the Nrf2/ARE transcriptional pathway. Carnosic acid is therefore a potential treatment for the toxic central nervous system (CNS) effects of cyanide poisoning. ARE, antioxidant responsive element; Nrf2 (NFE2L2, Nuclear factor (erythroid-derived 2)-like 2). © 2015 International Society for Neurochemistry.

  6. Dimerization Controls Marburg Virus VP24-dependent Modulation of Host Antioxidative Stress Responses

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, Britney; Li, Jing; Adhikari, Jagat; Edwards, Megan R.; Zhang, Hao; Schwarz, Toni; Leung, Daisy W.; Basler, Christopher F.; Gross, Michael L.; Amarasinghe, Gaya K.

    2016-08-04

    Marburg virus (MARV), a member of the Filoviridae family that also includes Ebola virus (EBOV), causes lethal hemorrhagic fever with case fatality rates that have exceeded 50% in some outbreaks. Within an infected cell, there are numerous host-viral interactions that contribute to the outcome of infection. Recent studies identified MARV protein 24 (mVP24) as a modulator of the host antioxidative responses, but the molecular mechanism remains unclear. Using a combination of biochemical and mass spectrometry studies, we show that mVP24 is a dimer in solution that directly binds to the Kelch domain of Kelch-like ECH-associated protein 1 (Keap1) to regulate nuclear factor (erythroid-derived 2)-like 2 (Nrf2). This interaction between Keap1 and mVP24 occurs through the Kelch interaction loop (K-Loop) of mVP24 leading to upregulation of antioxidant response element transcription, which is distinct from other Kelch binders that regulate Nrf2 activity. N-terminal truncations disrupt mVP24 dimerization, allowing monomeric mVP24 to bind Kelch with higher affinity and stimulate higher antioxidative stress response element (ARE) reporter activity. Mass spectrometry-based mapping of the interface revealed overlapping binding sites on Kelch for mVP24 and the Nrf2 proteins. Substitution of conserved cysteines, C209 and C210, to alanine in the mVP24 K-Loop abrogates Kelch binding and ARE activation. Our studies identify a shift in the monomer-dimer equilibrium of MARV VP24, driven by its interaction with Keap1 Kelch domain, as a critical determinant that modulates host responses to pathogenic Marburg viral infections.

  7. Phase 1 Study of a Sulforaphane-Containing Broccoli Sprout Homogenate for Sickle Cell Disease.

    Directory of Open Access Journals (Sweden)

    Jennifer F Doss

    Full Text Available Sickle cell disease (SCD is the most common inherited hemoglobinopathy worldwide. Our previous results indicate that the reduced oxidative stress capacity of sickle erythrocytes may be caused by decreased expression of NRF2 (Nuclear factor (erythroid-derived 2-like 2, an oxidative stress regulator. We found that activation of NRF2 with sulforaphane (SFN in erythroid progenitors significantly increased the expression of NRF2 targets HMOX1, NQO1, and HBG1 (subunit of fetal hemoglobin in a dose-dependent manner. Therefore, we hypothesized that NRF2 activation with SFN may offer therapeutic benefits for SCD patients by restoring oxidative capacity and increasing fetal hemoglobin concentration. To test this hypothesis, we performed a Phase 1, open-label, dose-escalation study of SFN, contained in a broccoli sprout homogenate (BSH that naturally contains SFN, in adults with SCD. The primary and secondary study endpoints were safety and physiological response to NRF2 activation, respectively. We found that BSH was well tolerated, and the few adverse events that occurred during the trial were not likely related to BSH consumption. We observed an increase in the mean relative whole blood mRNA levels for the NRF2 target HMOX1 (p = 0.02 on the last day of BSH treatment, compared to pre-treatment. We also observed a trend toward increased mean relative mRNA levels of the NRF2 target HBG1 (p = 0.10 from baseline to end of treatment, but without significant changes in HbF protein. We conclude that BSH, in the provided doses, is safe in stable SCD patients and may induce changes in gene expression levels. We therefore propose investigation of more potent NRF2 inducers, which may elicit more robust physiological changes and offer clinical benefits to SCD patients. Trial registration: ClinicalTrials.gov NCT01715480.

  8. Thrombosis, systemic and cardiac oxidative stress and DNA damage induced by pulmonary exposure to diesel exhaust particles, and the effect of nootkatone thereon.

    Science.gov (United States)

    Nemmar, Abderrahim; Al-Salam, Suhail; Beegam, Sumaya; Yuvaraju, Priya; Ali, Badreldin H

    2018-01-05

    Adverse cardiovascular effects of particulate air pollution persist even at lower concentrations than those of the current air quality limit. Therefore, identification of safe and effective measures against particles-induced cardiovascular toxicity is needed. Nootkatone is a sesquiterpenoid in grapefruit with diverse bioactivities including anti-inflammatory and antioxidant effects. However, its protective effect on the cardiovascular injury induced by diesel exhaust particles (DEP) has not been studied before. We assessed the possible protective effect of nootkatone (90 mg/kg) administered by gavage 1h before intratracheal (i.t.) instillation of DEP (30 μg/mouse). Twenty-four h following the i.t. administration of DEP various thrombotic and cardiac parameters were assessed. Nootkatone inhibited the prothrombotic effect induced by DEP in pial arterioles and venules in vivo and platelet aggregation in whole blood in vitro. Also, nootkatone prevented the shortening of activated partial thromboplastin time and prothrombin time induced by DEP. Nootkatone inhibited the increase of plasma concentration of fibrinogen, plasminogen activator inhibitor-1, interleukin-6 and lipid peroxidation induced by DEP. Immunohistochemically, hearts showed an analogous increase in glutathione and nuclear factor erythroid-derived 2-like 2 (Nrf2) expression by cardiac myocytes and endothelial cells following DEP exposure, and these effects were enhanced in mice treated with nootkatone+DEP. Likewise, heme oxygenase-1 (HO-1) was increased in mice treated with nootkatone+DEP compared with those treated with DEP or nootkatone+saline. The DNA damage caused by DEP was prevented by nootkatoone pretreatment. In conclusion, nootkatoone alleviates DEP-induced thrombogenicity and systemic and cardiac oxidative stress and DNA damage, at least partly, through Nrf2 and HO-1 activation.

  9. Risk factors

    International Nuclear Information System (INIS)

    Dennery, M.; Dupont, M.A.

    2007-01-01

    This article deals with the development of risk management in the gas sector business: why a risk factor legal mention must precede any published financial information? Do gas companies have to face new risks? Is there specific risks bound to gas activities? Why companies want to master their risks? Is it mandatory or just a new habit? Do they expect a real benefit in return? These are the risk management questions that are analyzed in this article which is based on the public communication of 15 gas companies randomly selected over the world. The information comes from their annual reports or from documents available on their web sites. The intention of this document is not to be exhaustive or to make statistics but only to shade light on the risk factors of the gas sector. (J.S.)

  10. Organizational factors

    International Nuclear Information System (INIS)

    Wahlstroem, B.; Kettunen, J.

    2005-01-01

    The goal of this lecture is to give an overview of important concepts connected to organisational factors and to provide an understanding of mechanisms by which they can contribute to safe or unsafe behaviour of people. The lecture gives examples of ways to organise work, organisational deficiencies and good practices applied in safety oriented organisations. The lecture also gives an introduction to international work and Finnish national regulation connected to organisation and management. (orig.)

  11. Factor analysis

    CERN Document Server

    Gorsuch, Richard L

    2013-01-01

    Comprehensive and comprehensible, this classic covers the basic and advanced topics essential for using factor analysis as a scientific tool in psychology, education, sociology, and related areas. Emphasizing the usefulness of the techniques, it presents sufficient mathematical background for understanding and sufficient discussion of applications for effective use. This includes not only theory but also the empirical evaluations of the importance of mathematical distinctions for applied scientific analysis.

  12. Human factors

    International Nuclear Information System (INIS)

    Brown, G.J.

    1991-01-01

    Recent reactor accidents have spurred the major review, described here, of the contribution of operator personnel to safety in Scottish Nuclear Power Stations. The review aims to identify factors leading to the Chernobyl accident and take preventative measures to avoid possible recurrence. Scottish Nuclear power stations aim to remove the operator from a position where failure to take correct action could lead to a safety hazard. Instead operators concentrate on routine and breakdown maintenance and measures are taken to minimize the probability of operator error. The review concluded that most safety procedures were satisfactory but safety analysis supported by good design practices may offer a significant reduction in the risk of operator error. (UK)

  13. Heart disease - risk factors

    Science.gov (United States)

    Heart disease - prevention; CVD - risk factors; Cardiovascular disease - risk factors; Coronary artery disease - risk factors; CAD - risk ... a certain health condition. Some risk factors for heart disease you cannot change, but some you can. ...

  14. Hippocampal Astrocyte Cultures from Adult and Aged Rats Reproduce Changes in Glial Functionality Observed in the Aging Brain.

    Science.gov (United States)

    Bellaver, Bruna; Souza, Débora Guerini; Souza, Diogo Onofre; Quincozes-Santos, André

    2017-05-01

    Astrocytes are dynamic cells that maintain brain homeostasis, regulate neurotransmitter systems, and process synaptic information, energy metabolism, antioxidant defenses, and inflammatory response. Aging is a biological process that is closely associated with hippocampal astrocyte dysfunction. In this sense, we demonstrated that hippocampal astrocytes from adult and aged Wistar rats reproduce the glial functionality alterations observed in aging by evaluating several senescence, glutamatergic, oxidative and inflammatory parameters commonly associated with the aging process. Here, we show that the p21 senescence-associated gene and classical astrocyte markers, such as glial fibrillary acidic protein (GFAP), vimentin, and actin, changed their expressions in adult and aged astrocytes. Age-dependent changes were also observed in glutamate transporters (glutamate aspartate transporter (GLAST) and glutamate transporter-1 (GLT-1)) and glutamine synthetase immunolabeling and activity. Additionally, according to in vivo aging, astrocytes from adult and aged rats showed an increase in oxidative/nitrosative stress with mitochondrial dysfunction, an increase in RNA oxidation, NADPH oxidase (NOX) activity, superoxide levels, and inducible nitric oxide synthase (iNOS) expression levels. Changes in antioxidant defenses were also observed. Hippocampal astrocytes also displayed age-dependent inflammatory response with augmentation of proinflammatory cytokine levels, such as TNF-α, IL-1β, IL-6, IL-18, and messenger RNA (mRNA) levels of cyclo-oxygenase 2 (COX-2). Furthermore, these cells secrete neurotrophic factors, including glia-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF), S100 calcium-binding protein B (S100B) protein, and transforming growth factor-β (TGF-β), which changed in an age-dependent manner. Classical signaling pathways associated with aging, such as nuclear factor erythroid-derived 2-like 2 (Nrf2), nuclear factor kappa B (NFκ

  15. Electroweak form factors

    International Nuclear Information System (INIS)

    Singh, S.K.

    2002-01-01

    The present status of electroweak nucleon form factors and the N - Δ transition form factors is reviewed. Particularly the determination of dipole mass M A in the axial vector form factor is discussed

  16. Risk Factors for Scleroderma

    Science.gov (United States)

    ... You are here: Home For Patients Risk Factors Risk Factors for Scleroderma The cause of scleroderma is ... what biological factors contribute to scleroderma pathogenesis. Genetic Risk Scleroderma does not tend to run in families ...

  17. Risk Factors and Prevention

    Science.gov (United States)

    ... Resources Risk Factors & Prevention Back to Patient Resources Risk Factors & Prevention Even people who look healthy and ... Blood Pressure , high cholesterol, diabetes, and thyroid disease. Risk Factors For Arrhythmias and Heart Disease The following ...

  18. Factors and factorizations of graphs proof techniques in factor theory

    CERN Document Server

    Akiyama, Jin

    2011-01-01

    This book chronicles the development of graph factors and factorizations. It pursues a comprehensive approach, addressing most of the important results from hundreds of findings over the last century. One of the main themes is the observation that many theorems can be proved using only a few standard proof techniques. This stands in marked contrast to the seemingly countless, complex proof techniques offered by the extant body of papers and books. In addition to covering the history and development of this area, the book offers conjectures and discusses open problems. It also includes numerous explanatory figures that enable readers to progressively and intuitively understand the most important notions and proofs in the area of factors and factorization.

  19. Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.

    Directory of Open Access Journals (Sweden)

    Monica M Horvath

    2007-07-01

    Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This

  20. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and

  1. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2010-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can

  2. Foundations of factor analysis

    CERN Document Server

    Mulaik, Stanley A

    2009-01-01

    Introduction Factor Analysis and Structural Theories Brief History of Factor Analysis as a Linear Model Example of Factor AnalysisMathematical Foundations for Factor Analysis Introduction Scalar AlgebraVectorsMatrix AlgebraDeterminants Treatment of Variables as Vectors Maxima and Minima of FunctionsComposite Variables and Linear Transformations Introduction Composite Variables Unweighted Composite VariablesDifferentially Weighted Composites Matrix EquationsMulti

  3. Blood coagulation factor VIII

    Indian Academy of Sciences (India)

    Factor VIII (FVIII) functions as a co-factor in the blood coagulation cascade for the proteolytic activation of factor X by factor IXa. Deficiency of FVIII causes hemophilia A, the most commonly inherited bleeding disorder. This review highlights current knowledge on selected aspects of FVIII in which both the scientist and the ...

  4. Constructivism, Factoring, and Beliefs.

    Science.gov (United States)

    Rauff, James V.

    1994-01-01

    Discusses errors made by remedial intermediate algebra students in factoring polynomials in light of student definitions of factoring. Found certain beliefs about factoring to logically imply many of the errors made. Suggests that belief-based teaching can be successful in teaching factoring. (16 references) (Author/MKR)

  5. Factors affecting construction performance: exploratory factor analysis

    Science.gov (United States)

    Soewin, E.; Chinda, T.

    2018-04-01

    The present work attempts to develop a multidimensional performance evaluation framework for a construction company by considering all relevant measures of performance. Based on the previous studies, this study hypothesizes nine key factors, with a total of 57 associated items. The hypothesized factors, with their associated items, are then used to develop questionnaire survey to gather data. The exploratory factor analysis (EFA) was applied to the collected data which gave rise 10 factors with 57 items affecting construction performance. The findings further reveal that the items constituting ten key performance factors (KPIs) namely; 1) Time, 2) Cost, 3) Quality, 4) Safety & Health, 5) Internal Stakeholder, 6) External Stakeholder, 7) Client Satisfaction, 8) Financial Performance, 9) Environment, and 10) Information, Technology & Innovation. The analysis helps to develop multi-dimensional performance evaluation framework for an effective measurement of the construction performance. The 10 key performance factors can be broadly categorized into economic aspect, social aspect, environmental aspect, and technology aspects. It is important to understand a multi-dimension performance evaluation framework by including all key factors affecting the construction performance of a company, so that the management level can effectively plan to implement an effective performance development plan to match with the mission and vision of the company.

  6. Low concentrations of silver nanoparticles have a beneficial effect on wound healing in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Ambrožová, Nikola [Palacký University, Department of Medical Chemistry and Biochemistry, Faculty of Medicine and Dentistry (Czech Republic); Zálešák, Bohumil [University Hospital Olomouc, Department of Plastic and Aesthetic Surgery (Czech Republic); Ulrichová, Jitka [Palacký University, Department of Medical Chemistry and Biochemistry, Faculty of Medicine and Dentistry (Czech Republic); Čížková, Kateřina [Palacký University, Department of Histology and Embryology, Faculty of Medicine and Dentistry (Czech Republic); Galandáková, Adéla, E-mail: galandakova.a@seznam.cz [Palacký University, Department of Medical Chemistry and Biochemistry, Faculty of Medicine and Dentistry (Czech Republic)

    2017-03-15

    Silver has been used in medical application for its antibacterial, antifungal, and anti-inflammatory effects. Silver nanoparticles (AgNPs) are currently in the spotlight. It was shown that their application can be useful in the management of wounds. Our study was conducted to determine whether AgNPs (average size 10.43 ± 4.74 nm) and ionic silver (Ag-I) could affect the wound healing in the in vitro model of normal human dermal fibroblasts (NHDF). We evaluated their effect on reactive oxygen species (ROS) generation and the expression of key transcription factors that coordinate the cellular response to oxidative stress [nuclear factor (erythroid-derived 2)-like 2 (Nrf2)] and inflammation [nuclear factor-κB (NF-κB)], expression of heme oxygenase-1 (HO-1), and interleukin-6 (IL-6) level. Isolated primary NHDF were scratched, heated (1 h; 42 °C), and cultured with AgNPs (0.25, 2.5, and 25 μg/ml) and Ag-I (0.025, 0.1, and 0.25 μg/ml) for 8 or 24 h. The ROS generation, Nrf2, NF-κB, and HO-1 protein expression and IL-6 protein level were then evaluated by standard methods. Non-cytotoxic concentrations of AgNPs (0.25 and 2.5 μg/ml) did not affect the ROS generation but activated the Nrf2/HO-1 pathway and decreased the NF-κB expression and IL-6 level in the in vitro wound healing model. AgNPs at concentrations of 0.25 and 2.5 μg/ml seem to be suitable for the intended application as a topical agent for wound healing, although the gene silencing technique, chemical inhibitors, and detailed time- and concentration-dependent experiments are needed for a comprehensive study of signaling pathway regulation. Further investigation is also necessary to exclude any possible adverse effects.

  7. Low concentrations of silver nanoparticles have a beneficial effect on wound healing in vitro

    International Nuclear Information System (INIS)

    Ambrožová, Nikola; Zálešák, Bohumil; Ulrichová, Jitka; Čížková, Kateřina; Galandáková, Adéla

    2017-01-01

    Silver has been used in medical application for its antibacterial, antifungal, and anti-inflammatory effects. Silver nanoparticles (AgNPs) are currently in the spotlight. It was shown that their application can be useful in the management of wounds. Our study was conducted to determine whether AgNPs (average size 10.43 ± 4.74 nm) and ionic silver (Ag-I) could affect the wound healing in the in vitro model of normal human dermal fibroblasts (NHDF). We evaluated their effect on reactive oxygen species (ROS) generation and the expression of key transcription factors that coordinate the cellular response to oxidative stress [nuclear factor (erythroid-derived 2)-like 2 (Nrf2)] and inflammation [nuclear factor-κB (NF-κB)], expression of heme oxygenase-1 (HO-1), and interleukin-6 (IL-6) level. Isolated primary NHDF were scratched, heated (1 h; 42 °C), and cultured with AgNPs (0.25, 2.5, and 25 μg/ml) and Ag-I (0.025, 0.1, and 0.25 μg/ml) for 8 or 24 h. The ROS generation, Nrf2, NF-κB, and HO-1 protein expression and IL-6 protein level were then evaluated by standard methods. Non-cytotoxic concentrations of AgNPs (0.25 and 2.5 μg/ml) did not affect the ROS generation but activated the Nrf2/HO-1 pathway and decreased the NF-κB expression and IL-6 level in the in vitro wound healing model. AgNPs at concentrations of 0.25 and 2.5 μg/ml seem to be suitable for the intended application as a topical agent for wound healing, although the gene silencing technique, chemical inhibitors, and detailed time- and concentration-dependent experiments are needed for a comprehensive study of signaling pathway regulation. Further investigation is also necessary to exclude any possible adverse effects.

  8. Differential Action between Schisandrin A and Schisandrin B in Eliciting an Anti-Inflammatory Action: The Depletion of Reduced Glutathione and the Induction of an Antioxidant Response.

    Directory of Open Access Journals (Sweden)

    Pou Kuan Leong

    Full Text Available Schisandrin A (Sch A and schisandrin B (Sch B are active components of Schisandrae Fructus. We compared the biochemical mechanism underlying the anti-inflammatory action of Sch A and Sch B, using cultured lipopolysaccharide (LPS-stimulated RAW264.7 macrophages and concanavalin (ConA-stimulated mouse splenocytes. Pre-incubation with Sch A or Sch B produced an anti-inflammatory action in LPS-stimulated RAW264.7 cells, as evidenced by the inhibition of the pro-inflammatory c-Jun N-terminal kinases/p38 kinase/nuclear factor-κB signaling pathway as well as the suppression of various pro-inflammatory cytokines and effectors, with the extent of inhibition by Sch A being more pronounced. The greater activity of Sch A in anti-inflammatory response was associated with a greater decrease in cellular reduced glutathione (GSH level and a greater increase in glutathione S-transferase activity than corresponding changes produced by Sch B. However, upon incubation, only Sch B resulted in the activation of the nuclear factor (erythroid-derived 2-like factor 2 and the induction of a significant increase in the expression of thioredoxin (TRX in RAW264.7 cells. The Sch B-induced increase in TRX expression was associated with the suppression of pro-inflammatory cytokines and effectors in LPS-stimulated macrophages. Studies in a mouse model of inflammation (carrageenan-induced paw edema indicated that while long-term treatment with either Sch A or Sch B suppressed the extent of paw edema, only acute treatment with Sch A produced a significant degree of inhibition on the inflammatory response. Although only Sch A decreased the cellular GSH level and suppressed the release of pro-inflammatory cytokines and cell proliferation in ConA-simulated splenocytes in vitro, both Sch A and Sch B treatments, while not altering cellular GSH levels, suppressed ConA-stimulated splenocyte proliferation ex vivo. These results suggest that Sch A and Sch B may act differentially on

  9. Fenretinide causes emphysema, which is prevented by sphingosine 1-phoshate.

    Directory of Open Access Journals (Sweden)

    Masanori Yasuo

    Full Text Available Sphingolipids play a role in the development of emphysema and ceramide levels are increased in experimental models of emphysema; however, the mechanisms of ceramide-related pulmonary emphysema are not fully understood. Here we examine mechanisms of ceramide-induced pulmonary emphysema. Male Sprague-Dawley rats were treated with fenretinide (20 mg/kg BW, a synthetic derivative of retinoic acid that causes the formation of ceramide, and we postulated that the effects of fenretinide could be offset by administering sphingosine 1-phosphate (S1P (100 µg/kg BW. Lung tissues were analyzed and mean alveolar airspace area, total length of the alveolar perimeter and the number of caspase-3 positive cells were measured. Hypoxia-inducible factor alpha (HIF-1α, vascular endothelial growth factor (VEGF and other related proteins were analyzed by Western blot analysis. Immunohistochemical analysis of HIF-1α was also performed. Ceramide, dihydroceramide, S1P, and dihydro-S1P were measured by mass spectrometer. Chronic intraperitoneal injection of fenretinide increased the alveolar airspace surface area and increased the number of caspase-3 positive cells in rat lungs. Fenretinide also suppressed HIF-1α and VEGF protein expression in rat lungs. Concomitant injection of S1P prevented the decrease in the expression of HIF-1α, VEGF, histone deacetylase 2 (HDAC2, and nuclear factor (erythroid-derived 2-like 2 (Nrf2 protein expression in the lungs. S1P injection also increased phosphorylated sphingosine kinase 1. Dihydroceramide was significantly increased by fenretinide injection and S1P treatment prevented the increase in dihydroceramide levels in rat lungs. These data support the concept that increased de novo ceramide production causes alveolar septal cell apoptosis and causes emphysema via suppressing HIF-1α. Concomitant treatment with S1P normalizes the ceramide-S1P balance in the rat lungs and increases HIF-1α protein expression via activation of

  10. The joy of factoring

    CERN Document Server

    Wagstaff, Samuel S

    2013-01-01

    This book is about the theory and practice of integer factorization presented in a historic perspective. It describes about twenty algorithms for factoring and a dozen other number theory algorithms that support the factoring algorithms. Most algorithms are described both in words and in pseudocode to satisfy both number theorists and computer scientists. Each of the ten chapters begins with a concise summary of its contents. The book starts with a general explanation of why factoring integers is important. The next two chapters present number theory results that are relevant to factoring. Further on there is a chapter discussing, in particular, mechanical and electronic devices for factoring, as well as factoring using quantum physics and DNA molecules. Another chapter applies factoring to breaking certain cryptographic algorithms. Yet another chapter is devoted to practical vs. theoretical aspects of factoring. The book contains more than 100 examples illustrating various algorithms and theorems. It also co...

  11. Factor VII deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000548.htm Factor VII deficiency To use the sharing features on this page, please enable JavaScript. Factor VII (seven) deficiency is a disorder caused by a ...

  12. Annual Adjustment Factors

    Data.gov (United States)

    Department of Housing and Urban Development — The Department of Housing and Urban Development establishes the rent adjustment factors - called Annual Adjustment Factors (AAFs) - on the basis of Consumer Price...

  13. Stroke - risk factors

    Science.gov (United States)

    ... oxygen. Brain cells can die, causing lasting damage. Risk factors are things that increase your chance of ... a disease or condition. This article discusses the risk factors for stroke and things you can do ...

  14. Human factors in training

    International Nuclear Information System (INIS)

    Dutton, J.W.; Brown, W.R.

    1981-01-01

    The Human Factors concept is a focused effort directed at those activities which require human involvement. Training is, by its nature, an activity totally dependent on the Human Factor. This paper identifies several concerns significant to training situations and discusses how Human Factor awareness can increase the quality of learning. Psychology in the training arena is applied Human Factors. Training is a method of communication represented by sender, medium, and receiver. Two-thirds of this communications model involves the human element directly

  15. Neutron electromagnetic form factors

    International Nuclear Information System (INIS)

    Finn, J.M.; Madey, R.; Eden, T.; Markowitz, P.; Rutt, P.M.; Beard, K.; Anderson, B.D.; Baldwin, A.R.; Keane, D.; Manley, D.M.; Watson, J.W.; Zhang, W.M.; Kowalski, S.; Bertozzi, W.; Dodson, G.; Farkhondeh, M.; Dow, K.; Korsch, W.; Tieger, D.; Turchinetz, W.; Weinstein, L.; Gross, F.; Mougey, J.; Ulmer, P.; Whitney, R.; Reichelt, T.; Chang, C.C.; Kelly, J.J.; Payerle, T.; Cameron, J.; Ni, B.; Spraker, M.; Barkhuff, D.; Lourie, R.; Verst, S.V.; Hyde-Wright, C.; Jiang, W.-D.; Flanders, B.; Pella, P.; Arenhoevel, H.

    1992-01-01

    Nucleon form factors provide fundamental input for nuclear structure and quark models. Current knowledge of neutron form factors, particularly the electric form factor of the neutron, is insufficient to meet these needs. Developments of high-duty-factor accelerators and polarization-transfer techniques permit new experiments that promise results with small sensitivities to nuclear models. We review the current status of the field, our own work at the MIT/Bates linear accelerator, and future experimental efforts

  16. Effect of pregabalin on contextual memory deficits and inflammatory state-related protein expression in streptozotocin-induced diabetic mice.

    Science.gov (United States)

    Sałat, Kinga; Gdula-Argasińska, Joanna; Malikowska, Natalia; Podkowa, Adrian; Lipkowska, Anna; Librowski, Tadeusz

    2016-06-01

    Diabetes mellitus is a metabolic disease characterized by hyperglycemia due to defects in insulin secretion or its action. Complications from long-term diabetes consist of numerous biochemical, molecular, and functional tissue alterations, including inflammation, oxidative stress, and neuropathic pain. There is also a link between diabetes mellitus and vascular dementia or Alzheimer's disease. Hence, it is important to treat diabetic complications using drugs which do not aggravate symptoms induced by the disease itself. Pregabalin is widely used for the treatment of diabetic neuropathic pain, but little is known about its impact on cognition or inflammation-related proteins in diabetic patients. Thus, this study aimed to evaluate the effect of intraperitoneal (ip) pregabalin on contextual memory and the expression of inflammatory state-related proteins in the brains of diabetic, streptozotocin (STZ)-treated mice. STZ (200 mg/kg, ip) was used to induce diabetes mellitus. To assess the impact of pregabalin (10 mg/kg) on contextual memory, a passive avoidance task was applied. Locomotor and exploratory activities in pregabalin-treated diabetic mice were assessed by using activity cages. Using Western blot analysis, the expression of cyclooxygenase-2 (COX-2), cytosolic prostaglandin E synthase (cPGES), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), nuclear factor-ĸB (NF-ĸB) p50 and p65, aryl hydrocarbon receptor (AhR), as well as glucose transporter type-4 (GLUT4) was assessed in mouse brains after pregabalin treatment. Pregabalin did not aggravate STZ-induced learning deficits in vivo or influence animals' locomotor activity. We observed significantly lower expression of COX-2, cPGES, and NF-κB p50 subunit, and higher expression of AhR and Nrf2 in the brains of pregabalin-treated mice in comparison to STZ-treated controls, which suggested immunomodulatory and anti-inflammatory effects of pregabalin. Antioxidant properties of pregabalin in the brains of

  17. Nrf2-inducing anti-oxidation stress response in the rat liver--new beneficial effect of lansoprazole.

    Science.gov (United States)

    Yamashita, Yasunobu; Ueyama, Takashi; Nishi, Toshio; Yamamoto, Yuta; Kawakoshi, Akatsuki; Sunami, Shogo; Iguchi, Mikitaka; Tamai, Hideyuki; Ueda, Kazuki; Ito, Takao; Tsuruo, Yoshihiro; Ichinose, Masao

    2014-01-01

    Lansoprazole is a potent anti-gastric ulcer drug that inhibits gastric proton pump activity. We identified a novel function for lansoprazole, as an inducer of anti-oxidative stress responses in the liver. Gastric administration of lansoprazole (10-100 mg/kg) to male Wistar rats produced a dose-dependent increase in hepatic mRNA levels of nuclear factor, erythroid-derived 2, -like 2 (Nrf2), a redox-sensitive transcription factor, at 3 h and Nrf2 immunoreactivity (IR) in whole hepatic lysates at 6 h. Conversely, the levels of Kelch-like ECH-associated protein (Keap1), which sequesters Nrf2 in the cytoplasm under un-stimulated conditions, were unchanged. Translocation of Nrf2 into the nuclei of hepatocytes was observed using western blotting and immunohistochemistry. Expression of mRNAs for Nrf2-dependent antioxidant and phase II enzymes, such as heme oxygenase 1 (HO-1), NAD (P) H dehydrogenase, quinone 1 (Nqo1), glutathione S-transferase A2 (Gsta2), UDP glucuronosyltransferase 1 family polypeptide A6 (Ugt1a6), were dose-dependently up-regulated at 3 h. Furthermore, the levels of HO-1 IR were dose-dependently increased in hepatocytes at 6 h. Subcutaneous administration of lansoprazole (30 mg/kg/day) for 7 successive days resulted in up-regulation and nuclear translocation of Nrf2 IR in hepatocytes and up-regulation of HO-1 IR in the liver. Pretreatment with lansoprazole attenuated thioacetamide (500 mg/kg)-induced acute hepatic damage via both HO-1-dependent and -independent pathways. Up-stream networks related to Nrf2 expression were investigated using microarray analysis, followed by data mining with Ingenuity Pathway Analysis. Up-regulation of the aryl hydrocarbon receptor (AhR)-cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1) pathway was associated with up-regulation of Nrf2 mRNA. In conclusion, lansoprazole might have an alternative indication in the prevention and treatment of oxidative hepatic damage through the induction of both phase I and phase

  18. Nrf2-Inducing Anti-Oxidation Stress Response in the Rat Liver - New Beneficial Effect of Lansoprazole

    Science.gov (United States)

    Yamashita, Yasunobu; Ueyama, Takashi; Nishi, Toshio; Yamamoto, Yuta; Kawakoshi, Akatsuki; Sunami, Shogo; Iguchi, Mikitaka; Tamai, Hideyuki; Ueda, Kazuki; Ito, Takao; Tsuruo, Yoshihiro; Ichinose, Masao

    2014-01-01

    Lansoprazole is a potent anti-gastric ulcer drug that inhibits gastric proton pump activity. We identified a novel function for lansoprazole, as an inducer of anti-oxidative stress responses in the liver. Gastric administration of lansoprazole (10–100 mg/kg) to male Wistar rats produced a dose-dependent increase in hepatic mRNA levels of nuclear factor, erythroid-derived 2, -like 2 (Nrf2), a redox-sensitive transcription factor, at 3 h and Nrf2 immunoreactivity (IR) in whole hepatic lysates at 6 h. Conversely, the levels of Kelch-like ECH-associated protein (Keap1), which sequesters Nrf2 in the cytoplasm under un-stimulated conditions, were unchanged. Translocation of Nrf2 into the nuclei of hepatocytes was observed using western blotting and immunohistochemistry. Expression of mRNAs for Nrf2-dependent antioxidant and phase II enzymes, such as heme oxygenase 1 (HO-1), NAD (P) H dehydrogenase, quinone 1 (Nqo1), glutathione S-transferase A2 (Gsta2), UDP glucuronosyltransferase 1 family polypeptide A6 (Ugt1a6), were dose-dependently up-regulated at 3 h. Furthermore, the levels of HO-1 IR were dose-dependently increased in hepatocytes at 6 h. Subcutaneous administration of lansoprazole (30 mg/kg/day) for 7 successive days resulted in up-regulation and nuclear translocation of Nrf2 IR in hepatocytes and up-regulation of HO-1 IR in the liver. Pretreatment with lansoprazole attenuated thioacetamide (500 mg/kg)-induced acute hepatic damage via both HO-1-dependent and -independent pathways. Up-stream networks related to Nrf2 expression were investigated using microarray analysis, followed by data mining with Ingenuity Pathway Analysis. Up-regulation of the aryl hydrocarbon receptor (AhR)-cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1) pathway was associated with up-regulation of Nrf2 mRNA. In conclusion, lansoprazole might have an alternative indication in the prevention and treatment of oxidative hepatic damage through the induction of both phase I and

  19. Alteration of Nrf2 and Glutamate Cysteine Ligase expression contribute to lesions growth and fibrogenesis in ectopic endometriosis.

    Science.gov (United States)

    Marcellin, L; Santulli, P; Chouzenoux, S; Cerles, O; Nicco, C; Dousset, B; Pallardy, M; Kerdine-Römer, S; Just, P A; Chapron, C; Batteux, F

    2017-09-01

    The redox-sensitive nuclear factor erythroid-derived 2-like 2 (NRF2) controls endogenous antioxidant enzymes' transcription and protects against oxidative damage which is triggered by inflammation and known to favor progression of endometriosis. Glutamate Cysteine Ligase (GCL), a target gene of NRF2, is the first enzyme in the synthesis cascade of glutathione, an important endogenous antioxidant. Sixty-one patients, with thorough surgical examination of the abdominopelvic cavity, were recruited for the study: 31 with histologically-proven endometriosis and 30 disease-free women taken as controls. Expressions of NRF2 and GCL were investigated by quantitative RT-PCR and immunohistochemistry in eutopic and ectopic endometria from endometriosis-affected women and in endometrium of disease-free women. Ex vivo stromal and epithelial cells were extracted and purified from endometrial and endometriotic biopsies to explore expression of NRF2 and GCL in both stromal and epithelial compartments by western blot. Finally, in order to strengthen the role of NRF2 in endometriosis pathogenesis, we evaluated the drop of NRF2 expression in a mouse model of endometriosis using NRF2 knockout (NRF2 -/- ) mice. The mRNA levels of NRF2 and GCL were significantly lower in ectopic endometria of endometriosis-affected women compared to eutopic endometria of disease-free women. The immunohistochemical analysis confirmed the decreased expression of both NRF2 and GCL in ectopic endometriotic tissues compared to eutopic endometria of endometriosis-affected and disease-free women. Immunoblotting revealed a significant decreased of NRF2 and GCL expression in epithelial and stroma cells from ectopic lesions of endometriosis-affected women compared to eutopic endometria from controls. Using a murine model of endometriosis, NRF2 -/- implants were more fibrotic compared to wild-type with an increased weight and volume. These findings indicate that expression of the transcription factor NRF2 and its

  20. Disconnected electromagnetic form factors

    International Nuclear Information System (INIS)

    Wilcox, Walter

    2001-01-01

    Preliminary results of a calculation of disconnected nucleon electromagnetic factors factors on the lattice are presented. The implementation of the numerical subtraction scheme is outlined. A comparison of results for electric and magnetic disconnected form factors on two lattice sizes with those of the Kentucky group is presented. Unlike previous results, the results found in this calculation are consistent with zero in these sectors

  1. Mesonic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Frederic D. R. Bonnet; Robert G. Edwards; George T. Fleming; Randal Lewis; David Richards

    2003-07-22

    We have started a program to compute the electromagnetic form factors of mesons. We discuss the techniques used to compute the pion form factor and present preliminary results computed with domain wall valence fermions on MILC asqtad lattices, as well as Wilson fermions on quenched lattices. These methods can easily be extended to rho-to-gamma-pi transition form factors.

  2. demographic factors associated factors associated with malaria

    African Journals Online (AJOL)

    userpc

    .8%) than those in other nce of 35.4% which was actors can predispose alence of malaria in a study were significantly eveloping guidelines and more effective disease endemic areas (Bashar et therefore attempts to rmation on possible demographic factors d out in four selected geria; Major Ibrahim B. Hospital Zaria, Hajiya.

  3. Aspects of QCD factorization

    International Nuclear Information System (INIS)

    Neubert, Matthias

    2001-01-01

    The QCD factorization approach provides the theoretical basis for a systematic analysis of nonleptonic decay amplitudes of B mesons in the heavy-quark limit. After recalling the basic ideas underlying this formalism, several tests of QCD factorization in the decays B→D (*) L, B→K * γ, and B→πK, ππ are discussed. It is then illustrated how factorization can be used to obtain new constraints on the parameters of the unitarity triangle

  4. Oversimplifying quantum factoring.

    Science.gov (United States)

    Smolin, John A; Smith, Graeme; Vargo, Alexander

    2013-07-11

    Shor's quantum factoring algorithm exponentially outperforms known classical methods. Previous experimental implementations have used simplifications dependent on knowing the factors in advance. However, as we show here, all composite numbers admit simplification of the algorithm to a circuit equivalent to flipping coins. The difficulty of a particular experiment therefore depends on the level of simplification chosen, not the size of the number factored. Valid implementations should not make use of the answer sought.

  5. Organic Solute Transporter α-β Protects Ileal Enterocytes From Bile Acid–Induced InjurySummary

    Directory of Open Access Journals (Sweden)

    Courtney B. Ferrebee

    , Reactive Oxygen Species, Nuclear Factor Erythroid-Derived 2-Like 2, Neonate, Drosophila

  6. Preconditioning with Gua Lou Gui Zhi decoction enhances H2O2-induced Nrf2/HO-1 activation in PC12 cells

    Science.gov (United States)

    MAO, JINGJIE; LI, ZUANFANG; LIN, RUHUI; ZHU, XIAOQIN; LIN, JIUMAO; PENG, JUN; CHEN, LIDIAN

    2015-01-01

    Spasticity is common in various central neurological conditions, including after a stroke. Such spasticity may cause additional problems, and often becomes a primary concern for afflicted individuals. A number of studies have identified nuclear factor (erythroid-derived 2)-like 2 (Nrf2) as a key regulator in the adaptive survival response to oxidative stress. Elevated expression of Nrf2, combined with heme oxygenase 1 (HO-1) resistance, in the central nervous system is known to elicit key internal and external oxidation protection. Gua Lou Gui Zhi decoction (GLGZD) is a popular traditional Chinese formula with a long history of clinical use in China for the treatment of muscular spasticity following a stroke, epilepsy or a spinal cord injury. However, the mechanism underlying the efficacy of the medicine remains unclear. In the present study, the antioxidative effects of GLGZD were evaluated and the underlying molecular mechanisms were investigated, using hydrogen peroxide (H2O2)-induced rat pheochromocytoma cells (PC12 cells) as an in vitro oxidative stress model of neural cells. Upon application of different concentrations of GLGZD, a 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay and ATP measurement were conducted to assess the impact on PC12 cell proliferation. In addition, inverted microscopy observations, and the MTT and ATP assessments, revealed that GLGZD attenuated H2O2-induced oxidative damage and signaling repression in PC12 cells. Furthermore, the mRNA and protein expression levels of Nrf2 and HO-1, which are associated with oxidative stress, were analyzed using reverse transcription quantitative polymerase chain reaction (PCR) and confocal microscopy. Confocal microscopy observations, as well as the quantitative PCR assay, revealed that GLGZD exerted a neuroprotective function against H2O2-induced oxidative damage in PC12 cells. Therefore, the results demonstrated that GLGZD protected PC12 cells injured by H2O2, which may be

  7. Analysis of changes in hepatic gene expression in a murine model of tolerance to acetaminophen hepatotoxicity (autoprotection)

    International Nuclear Information System (INIS)

    O'Connor, Meeghan A.; Koza-Taylor, Petra; Campion, Sarah N.; Aleksunes, Lauren M.; Gu, Xinsheng; Enayetallah, Ahmed E.; Lawton, Michael P.; Manautou, José E.

    2014-01-01

    Pretreatment of mice with a low hepatotoxic dose of acetaminophen (APAP) results in resistance to a subsequent, higher dose of APAP. This mouse model, termed APAP autoprotection was used here to identify differentially expressed genes and cellular pathways that could contribute to this development of resistance to hepatotoxicity. Male C57BL/6J mice were pretreated with APAP (400 mg/kg) and then challenged 48 h later with 600 mg APAP/kg. Livers were obtained 4 or 24 h later and total hepatic RNA was isolated and hybridized to Affymetrix Mouse Genome MU430 2 GeneChip. Statistically significant genes were determined and gene expression changes were also interrogated using the Causal Reasoning Engine (CRE). Extensive literature review narrowed our focus to methionine adenosyl transferase-1 alpha (MAT1A), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), flavin-containing monooxygenase 3 (Fmo3) and galectin-3 (Lgals3). Down-regulation of MAT1A could lead to decreases in S-adenosylmethionine (SAMe), which is known to protect against APAP toxicity. Nrf2 activation is expected to play a role in protective adaptation. Up-regulation of Lgals3, one of the genes supporting the Nrf2 hypothesis, can lead to suppression of apoptosis and reduced mitochondrial dysfunction. Fmo3 induction suggests the involvement of an enzyme not known to metabolize APAP in the development of tolerance to APAP toxicity. Subsequent quantitative RT-PCR and immunochemical analysis confirmed the differential expression of some of these genes in the APAP autoprotection model. In conclusion, our genomics strategy identified cellular pathways that might further explain the molecular basis for APAP autoprotection. - Highlights: • Differential expression of genes in mice resistant to acetaminophen hepatotoxicity. • Increased gene expression of Flavin-containing monooxygenase 3 and Galectin-3. • Decrease in MAT1A expression and compensatory hepatocellular regeneration. • Two distinct gene expression

  8. Edaravone attenuates hippocampal damage in an infant mouse model of pneumococcal meningitis by reducing HMGB1 and iNOS expression via the Nrf2/HO-1 pathway.

    Science.gov (United States)

    Li, Zheng; Ma, Qian-Qian; Yan, Yan; Xu, Feng-Dan; Zhang, Xiao-Ying; Zhou, Wei-Qin; Feng, Zhi-Chun

    2016-09-01

    Edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) is a free radical scavenger that has shown potent antioxidant, anti-inflammatory and neuroprotective effects in variety of disease models. In this study, we investigated whether edaravone produced neuroprotective actions in an infant mouse model of pneumococcal meningitis. C57BL/6 mice were infected on postnatal d 11 by intracisternal injection of a certain inoculum of Streptococcus pneumoniae. The mice received intracisternal injection of 10 μL of saline containing edaravone (3 mg/kg) once a day for 7 d. The severity of pneumococcal meningitis was assessed with a clinical score. In mice with severe meningitis, the survival rate from the time of infection to d 8 after infection was analyzed using Kaplan-Meier curves. In mice with mild meningitis, the CSF inflammation and cytokine levels in the hippocampus were analyzed d 7 after infection, and the clinical neurological deficit score was evaluated using a neurological scoring system d 14 after infection. The nuclear factor (erythroid-derived 2)-like 2 knockout (Nrf2 KO) mice and heme oxygenase-1 knockout (HO-1 KO) mice were used to confirm the involvement of Nrf2/HO-1 pathway in the neuroprotective actions of edaravone. In mice with severe meningitis, edaravone treatment significantly increased the survival rate (76.4%) compared with the meningitis model group (32.2%). In mice with mild meningitis, edaravone treatment significantly decreased the number of leukocytes and TNF- levels in CSF, as well as the neuronal apoptosis and protein levels of HMGB1 and iNOS in the hippocampus, but did not affect the high levels of IL-10 and IL-6 in the hippocampus. Moreover, edaravone treatment significantly improved the neurological function of mice with mild meningitis. In Nrf2 KO or HO-1 KO mice with the meningitis, edaravone treatment was no longer effective in improving the survival rate of the mice with severe meningitis (20.2% and 53.6%, respectively), nor it affected the

  9. Role of Nrf2 antioxidant defense in mitigating cadmium-induced oxidative stress in the olfactory system of zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lu; Gallagher, Evan P., E-mail: evang3@uw.edu

    2013-01-15

    Exposure to trace metals can disrupt olfactory function in fish leading to a loss of behaviors critical to survival. Cadmium (Cd) is an olfactory toxicant that elicits cellular oxidative stress as a mechanism of toxicity while also inducing protective cellular antioxidant genes via activation of the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathway. However, the molecular mechanisms of Cd-induced olfactory injury have not been characterized. In the present study, we investigated the role of the Nrf2-mediated antioxidant defense pathway in protecting against Cd-induced olfactory injury in zebrafish. A dose-dependent induction of Nrf2-regulated antioxidant genes associated with cellular responses to oxidative stress was observed in the olfactory system of adult zebrafish following 24 h Cd exposure. Zebrafish larvae exposed to Cd for 3 h showed increased glutathione S-transferase pi (gst pi), glutamate–cysteine ligase catalytic subunit (gclc), heme oxygenase 1 (hmox1) and peroxiredoxin 1 (prdx1) mRNA levels indicative of Nrf2 activation, and which were blocked by morpholino-mediated Nrf2 knockdown. The inhibition of antioxidant gene induction in Cd-exposed Nrf2 morphants was associated with disruption of olfactory driven behaviors, increased cell death and loss of olfactory sensory neurons (OSNs). Nrf2 morphants also exhibited a downregulation of OSN-specific genes after Cd exposure. Pre-incubation of embryos with sulforaphane (SFN) partially protected against Cd-induced olfactory tissue damage. Collectively, our results indicate that oxidative stress is an important mechanism of Cd-mediated injury in the zebrafish olfactory system. Moreover, the Nrf2 pathway plays a protective role against cellular oxidative damage and is important in maintaining zebrafish olfactory function. -- Highlights: ► Oxidative stress is an important mechanism of Cd-mediated olfactory injury. ► Cd induces antioxidant gene expression in the zebrafish olfactory system. ► The

  10. Analysis of changes in hepatic gene expression in a murine model of tolerance to acetaminophen hepatotoxicity (autoprotection)

    Energy Technology Data Exchange (ETDEWEB)

    O' Connor, Meeghan A., E-mail: meeghan.oconnor@boehringer-ingelheim.com [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States); Boehringer Ingelheim Pharmaceuticals Inc., 900 Ridgebury Road, Ridgefield, CT 06877-0368 (United States); Koza-Taylor, Petra, E-mail: petra.h.koza-taylor@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Campion, Sarah N., E-mail: sarah.campion@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Aleksunes, Lauren M., E-mail: aleksunes@eohsi.rutgers.edu [Rutgers University, Department of Pharmacology and Toxicology, Environmental and Occupational Health Sciences Institute, Piscataway, NJ 08854 (United States); Gu, Xinsheng, E-mail: xinsheng.gu@uconn.edu [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States); Enayetallah, Ahmed E., E-mail: ahmed.enayetallah@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Lawton, Michael P., E-mail: michael.lawton@pfizer.com [Pfizer Inc., Groton, CT 06340 (United States); Manautou, José E., E-mail: jose.manautou@uconn.edu [Department of Pharmaceutical Sciences, University of Connecticut, Storrs, CT 06269-3092 (United States)

    2014-01-01

    Pretreatment of mice with a low hepatotoxic dose of acetaminophen (APAP) results in resistance to a subsequent, higher dose of APAP. This mouse model, termed APAP autoprotection was used here to identify differentially expressed genes and cellular pathways that could contribute to this development of resistance to hepatotoxicity. Male C57BL/6J mice were pretreated with APAP (400 mg/kg) and then challenged 48 h later with 600 mg APAP/kg. Livers were obtained 4 or 24 h later and total hepatic RNA was isolated and hybridized to Affymetrix Mouse Genome MU430{sub 2} GeneChip. Statistically significant genes were determined and gene expression changes were also interrogated using the Causal Reasoning Engine (CRE). Extensive literature review narrowed our focus to methionine adenosyl transferase-1 alpha (MAT1A), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), flavin-containing monooxygenase 3 (Fmo3) and galectin-3 (Lgals3). Down-regulation of MAT1A could lead to decreases in S-adenosylmethionine (SAMe), which is known to protect against APAP toxicity. Nrf2 activation is expected to play a role in protective adaptation. Up-regulation of Lgals3, one of the genes supporting the Nrf2 hypothesis, can lead to suppression of apoptosis and reduced mitochondrial dysfunction. Fmo3 induction suggests the involvement of an enzyme not known to metabolize APAP in the development of tolerance to APAP toxicity. Subsequent quantitative RT-PCR and immunochemical analysis confirmed the differential expression of some of these genes in the APAP autoprotection model. In conclusion, our genomics strategy identified cellular pathways that might further explain the molecular basis for APAP autoprotection. - Highlights: • Differential expression of genes in mice resistant to acetaminophen hepatotoxicity. • Increased gene expression of Flavin-containing monooxygenase 3 and Galectin-3. • Decrease in MAT1A expression and compensatory hepatocellular regeneration. • Two distinct gene

  11. PFOS induces adipogenesis and glucose uptake in association with activation of Nrf2 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Jialin [Institute of Biochemistry and Molecular Biology, College of Life and Health Sciences, Northeastern University, Shenyang 110819 (China); Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Shimpi, Prajakta; Armstrong, Laura; Salter, Deanna [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Slitt, Angela L., E-mail: aslitt@uri.edu [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States)

    2016-01-01

    PFOS is a chemical of nearly ubiquitous exposure in humans. Recent studies have associated PFOS exposure to adipose tissue-related effects. The present study was to determine whether PFOS alters the process of adipogenesis and regulates insulin-stimulated glucose uptake in mouse and human preadipocytes. In murine-derived 3T3-L1 preadipocytes, PFOS enhanced hormone-induced differentiation to adipocytes and adipogenic gene expression, increased insulin-stimulated glucose uptake at concentrations ranging from 10 to 100 μM, and enhanced Glucose transporter type 4 and Insulin receptor substrate-1 expression. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2), NAD(P)H dehydrogenase, quinone 1 and Glutamate-cysteine ligase, catalytic subunit were significantly induced in 3T3-L1 cells treated with PFOS, along with a robust induction of Antioxidant Response Element (ARE) reporter in mouse embryonic fibroblasts isolated from ARE-hPAP transgenic mice by PFOS treatment. Chromatin immunoprecipitation assays further illustrated that PFOS increased Nrf2 binding to ARE sites in mouse Nqo1 promoter, suggesting that PFOS activated Nrf2 signaling in murine-derived preadipocytes. Additionally, PFOS administration in mice (100 μg/kg/day) induced adipogenic gene expression and activated Nrf2 signaling in epididymal white adipose tissue. Moreover, the treatment on human visceral preadipocytes illustrated that PFOS (5 and 50 μM) promoted adipogenesis and increased cellular lipid accumulation. It was observed that PFOS increased Nrf2 binding to ARE sites in association with Nrf2 signaling activation, induction of Peroxisome proliferator-activated receptor γ and CCAAT/enhancer-binding protein α expression, and increased adipogenesis. This study points to a potential role of PFOS in dysregulation of adipose tissue expandability, and warrants further investigations on the adverse effects of persistent pollutants on human health. - Highlights: • PFOS induces adipogenesis in association

  12. Serotonin Signaling Through the 5-HT1B Receptor and NADPH Oxidase 1 in Pulmonary Arterial Hypertension.

    Science.gov (United States)

    Hood, Katie Y; Mair, Kirsty M; Harvey, Adam P; Montezano, Augusto C; Touyz, Rhian M; MacLean, Margaret R

    2017-07-01

    Serotonin can induce human pulmonary artery smooth muscle cell (hPASMC) proliferation through reactive oxygen species (ROS), influencing the development of pulmonary arterial hypertension (PAH). We hypothesize that in PASMCs, serotonin induces oxidative stress through NADPH-oxidase-derived ROS generation and reduced Nrf-2 (nuclear factor [erythroid-derived 2]-like 2) antioxidant systems, promoting vascular injury. HPASMCs from controls and PAH patients, and PASMCs from Nox1 -/- mice, were stimulated with serotonin in the absence/presence of inhibitors of Src kinase, the 5-HT 1B receptor, and NADPH oxidase 1 (Nox1). Markers of fibrosis were also determined. The pathophysiological significance of our findings was examined in vivo in serotonin transporter overexpressing female mice, a model of pulmonary hypertension. We confirmed thatserotonin increased superoxide and hydrogen peroxide production in these cells. For the first time, we show that serotonin increased oxidized protein tyrosine phosphatases and hyperoxidized peroxiredoxin and decreased Nrf-2 and catalase activity in hPASMCs. ROS generation was exaggerated and dependent on cellular Src-related kinase, 5-HT 1B receptor, and the serotonin transporter in human pulmonary artery smooth muscle cells from PAH subjects. Proliferation and extracellular matrix remodeling were exaggerated in human pulmonary artery smooth muscle cells from PAH subjects and dependent on 5-HT 1B receptor signaling and Nox1, confirmed in PASMCs from Nox1 -/- mice. In serotonin transporter overexpressing mice, SB216641, a 5-HT 1B receptor antagonist, prevented development of pulmonary hypertension in a ROS-dependent manner. Serotonin can induce cellular Src-related kinase-regulated Nox1-induced ROS and Nrf-2 dysregulation, contributing to increased post-translational oxidative modification of proteins and activation of redox-sensitive signaling pathways in hPASMCs, associated with mitogenic responses. 5-HT 1B receptors contribute to

  13. PCB 126 toxicity is modulated by cross-talk between caveolae and Nrf2 signaling

    Energy Technology Data Exchange (ETDEWEB)

    Petriello, Michael C. [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY 40536 (United States); University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Han, Sung Gu [University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Food Science and Biotechnology of Animal Resources, College of Animal Bioscience and Technology, Konkuk University, Seoul 143-701 (Korea, Republic of); Newsome, Bradley J. [University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Chemistry, College of Arts and Sciences, University of Kentucky, Lexington, KY 40506 (United States); Hennig, Bernhard [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY 40536 (United States); University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Animal and Food Sciences, College of Agriculture, Food and Environment, University of Kentucky, KY 40506 (United States)

    2014-06-01

    Environmental toxicants such as polychlorinated biphenyls (PCBs) have been implicated in the promotion of multiple inflammatory disorders including cardiovascular disease, but information regarding mechanisms of toxicity and cross-talk between relevant cell signaling pathways is lacking. To examine the hypothesis that cross-talk between membrane domains called caveolae and nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathways alters PCB-induced inflammation, caveolin-1 was silenced in vascular endothelial cells, resulting in a decreased PCB-induced inflammatory response. Cav-1 silencing (siRNA treatment) also increased levels of Nrf2-ARE transcriptional binding, resulting in higher mRNA levels of the antioxidant genes glutathione s-transferase and NADPH dehydrogenase quinone-1 in both vehicle and PCB-treated systems. Along with this upregulated antioxidant response, Cav-1 siRNA treated cells exhibited decreased mRNA levels of the Nrf2 inhibitory protein Keap1 in both vehicle and PCB-treated samples. Silencing Cav-1 also decreased protein levels of Nrf2 inhibitory proteins Keap1 and Fyn kinase, especially in PCB-treated cells. Further, endothelial cells from wildtype and Cav-1 −/− mice were isolated and treated with PCB to better elucidate the role of functional caveolae in PCB-induced endothelial inflammation. Cav-1 −/− endothelial cells were protected from PCB-induced cellular dysfunction as evidenced by decreased vascular cell adhesion molecule (VCAM-1) protein induction. Compared to wildtype cells, Cav-1 −/− endothelial cells also allowed for a more effective antioxidant response, as observed by higher levels of the antioxidant genes. These data demonstrate novel cross-talk mechanisms between Cav-1 and Nrf2 and implicate the reduction of Cav-1 as a protective mechanism for PCB-induced cellular dysfunction and inflammation. - Highlights: • Reduction of caveolin-1 protein protects against polychlorinated biphenyl toxicity. • Decreasing

  14. Radioimmunoassay of human Hageman factor (factor XII)

    International Nuclear Information System (INIS)

    Saito, H.; Ratnoff, O.D.; Pensky, J.

    1976-01-01

    A specific, sensitive, and reproducible radioimmunoassay for human Hageman factor (HF, factor XII) has been developed with purified human HF and monospecific rabbit antibody. Precise measurements of HF antigen were possible for concentrations as low as 0.1 percent of that in normal pooled plasma. A good correlation (correlation coefficient = 0.82) existed between the titers of HF measured by clot-promoting assays and radioimmunoassays among 42 normal adults. Confirming earlier studies, HF antigen was absent in Hageman trait plasma, but other congenital deficient plasmas, including those of individuals with Fletcher trait and Fitzgerald trait, contained normal amounts of HF antigen. HF antigen was reduced in the plasmas of patients with disseminated intravascular coagulation or advanced liver cirrhosis, but it was normal in those of patients with chronic renal failure or patients under treatment with warfarin. HF antigen was detected by this assay in plasmas of primates, but not detectable in plasmas of 11 nonprimate mammalian and one avian species

  15. What Are Rare Clotting Factor Deficiencies?

    Science.gov (United States)

    ... Deficiency Factor V Deficiency Combined FV & FVIII Deficiencies Factor VII Deficiency Factor X Deficiency Factor XI Deficiency Factor ... Deficiency Factor V Deficiency Combined FV & FVIII Deficiencies Factor VII Deficiency Factor X Deficiency Factor XI Deficiency Factor ...

  16. PAYMENT CAPACITY SENSITIVITY FACTORS

    Directory of Open Access Journals (Sweden)

    Daniel BRÎNDESCU – OLARIU

    2014-11-01

    The results of the study facilitate the determination and classification of the main sensitivity factors for the payment capacity at sample level, the establishment of general benchmarks for the payment capacity (as no such benchmarks currently exist in the Romanian literature and the identification of the mechanisms through which the variation of different factors impacts the payment capacity.

  17. Respirator field performance factors

    International Nuclear Information System (INIS)

    Skaggs, B.J.; DeField, J.D.; Strandberg, S.W.; Sutcliffe, C.R.

    1985-01-01

    The Industrial Hygiene Group assisted OSHA and the NRC in measurements of respirator performance under field conditions. They reviewed problems associated with sampling aerosols within the respirator in order to determine fit factors (FFs) or field performance factor (FPF). In addition, they designed an environmental chamber study to determine the effects of temperature and humidity on a respirator wearer

  18. Factors affecting nuclear development

    International Nuclear Information System (INIS)

    Stevens, G.H.; Girouard, P.

    1995-01-01

    Among the factors affecting nuclear development, some depend more or less on public authorities, but many are out of public authorities control (foreign policies, market and deregulation, socials and environmental impacts, public opinion). As far as possible, the following study tries to identify those factors. (D.L.). 2 photos

  19. Soil Forming Factors

    Science.gov (United States)

    It! What is Soil? Chip Off the Old Block Soil Forming Factors Matters of Life and Death Underneath It All Wise Choices A World of Soils Soil Forming Factors 2 A Top to Bottom Guide 3 Making a Soil Monolith 4 Soil Orders 5 State Soil Monoliths 6 Where in the Soil World Are You? >> A Top to

  20. Two-factor authentication

    CERN Document Server

    Stanislav, Mark

    2015-01-01

    During the book, readers will learn about the various technical methods by which two-factor authentication is implemented, security concerns with each type of implementation, and contextual details to frame why and when these technologies should be used. Readers will also be provided with insight about the reasons that two-factor authentication is a critical security control, events in history that have been important to prove why organization and individual would want to use two factor, and core milestones in the progress of growing the market.

  1. Business Intelligence Success Factors

    DEFF Research Database (Denmark)

    Gaardboe, Rikke; Jonasen, Tanja Svarre

    2018-01-01

    Business intelligence (BI) is a strategically important practice in many organizations. Several studies have investigated the factors that contribute to BI success; however, an overview of the critical success factors (CSFs) involved is lacking in the extant literature. We have integrated...... 34 CSFs related to BI success. The distinct CSFs identified in the extant literature relate to project management skills (13 papers), management support (20 papers), and user involvement (11 papers). In the articles with operationalized BI success, we found several distinct factors: system quality...

  2. Human factor reliability program

    International Nuclear Information System (INIS)

    Knoblochova, L.

    2017-01-01

    The human factor's reliability program was at Slovenske elektrarne, a.s. (SE) nuclear power plants. introduced as one of the components Initiatives of Excellent Performance in 2011. The initiative's goal was to increase the reliability of both people and facilities, in response to 3 major areas of improvement - Need for improvement of the results, Troubleshooting support, Supporting the achievement of the company's goals. The human agent's reliability program is in practice included: - Tools to prevent human error; - Managerial observation and coaching; - Human factor analysis; -Quick information about the event with a human agent; -Human reliability timeline and performance indicators; - Basic, periodic and extraordinary training in human factor reliability(authors)

  3. [Human factors in medicine].

    Science.gov (United States)

    Lazarovici, M; Trentzsch, H; Prückner, S

    2017-01-01

    The concept of human factors is commonly used in the context of patient safety and medical errors, all too often ambiguously. In actual fact, the term comprises a wide range of meanings from human-machine interfaces through human performance and limitations up to the point of working process design; however, human factors prevail as a substantial cause of error in complex systems. This article presents the full range of the term human factors from the (emergency) medical perspective. Based on the so-called Swiss cheese model by Reason, we explain the different types of error, what promotes their emergence and on which level of the model error prevention can be initiated.

  4. Shell Buckling Knockdown Factors

    Data.gov (United States)

    National Aeronautics and Space Administration — The Shell Buckling Knockdown Factor (SBKF) Project, NASA Engineering and Safety Center (NESC) Assessment #: 07-010-E, was established in March of 2007 by the NESC in...

  5. Risk factors for neoplasms

    International Nuclear Information System (INIS)

    Brachner, A.; Grosche, B.

    1991-06-01

    A broad survey is given of risk factors for neoplasms. The main carcinogenic substances (including also ionizing radiation and air pollution) are listed, and are correlated with the risk factors for various cancers most frequently explained and discussed in the literature. The study is intended to serve as a basis for a general assessment of the incidence of neoplasms in children, and of cancer mortality in the entire population of Bavaria in the years 1983-1989, or 1979-1988, respectively, with the principal idea of drawing up an environment-related health survey. The study therefore takes into account not only ionizing radiation as a main risk factor, but also other risk factors detectable within the ecologic context, as e.g. industrial installations and their effects, refuse incineration plants or waste dumps, or the social status. (orig./MG) [de

  6. Factor IX assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003679.htm Factor IX assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  7. Factor VIII assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003678.htm Factor VIII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  8. Factor II assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003674.htm Factor II assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  9. Factor V deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000550.htm Factor V deficiency To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  10. Rheumatoid factor (RF)

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003548.htm Rheumatoid factor (RF) To use the sharing features on this ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  11. Factor II deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000549.htm Factor II deficiency To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  12. Factor VII assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003676.htm Factor VII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  13. Factor X deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000553.htm Factor X deficiency To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  14. New microbial growth factor

    Science.gov (United States)

    Bok, S. H.; Casida, L. E., Jr.

    1977-01-01

    A screening procedure was used to isolate from soil a Penicillium sp., two bacterial isolates, and a Streptomyces sp. that produced a previously unknown microbial growth factor. This factor was an absolute growth requirement for three soil bacteria. The Penicillium sp. and one of the bacteria requiring the factor, an Arthrobacter sp., were selected for more extensive study concerning the production and characteristics of the growth factor. It did not seem to be related to the siderochromes. It was not present in soil extract, rumen fluid, or any other medium component tested. It appears to be a glycoprotein of high molecular weight and has high specific activity. When added to the diets for a meadow-vole mammalian test system, it caused an increased consumption of diet without a concurrent increase in rate of weight gain.

  15. Human factors in aviation

    National Research Council Canada - National Science Library

    Salas, Eduardo; Maurino, Daniel E

    2010-01-01

    .... HFA offers a comprehensive overview of the topic, taking readers from the general to the specific, first covering broad issues, then the more specific topics of pilot performance, human factors...

  16. [Risk factors of schizophrenia].

    Science.gov (United States)

    Suvisaari, Jaana

    2010-01-01

    Schizophrenia is a multifactorial, neurodevelopmental disorder caused by a combination of genetic and environmental risk factors. Disturbances of brain development begin prenatally, while different environmental insults further affect postnatal brain maturation during childhood and adolescence. Genome-wide association studies (GWAS) have succeeded in identifying hundreds of new risk variants for common, multifactorial diseases. In schizophrenia research, GWAS have found several rare copy number variants that considerably increase the risk of schizophrenia, and have shown an association between schizophrenia and the major histocompatibility complex. Research on environmental risk factors in recent years has provided new information particularly on risk factors related to pregnancy and childhood rearing environment. Gene-environment interactions have become a central research topic. There is evidence that genetically susceptible children are more vulnerable to the effects of unstable childhood rearing environment and other environmental risk factors.

  17. Human Factors Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — Purpose: The purpose of the Human Factors Laboratory is to further the understanding of highway user needs so that those needs can be incorporated in roadway design,...

  18. Factors Affecting Wound Healing

    Science.gov (United States)

    Guo, S.; DiPietro, L.A.

    2010-01-01

    Wound healing, as a normal biological process in the human body, is achieved through four precisely and highly programmed phases: hemostasis, inflammation, proliferation, and remodeling. For a wound to heal successfully, all four phases must occur in the proper sequence and time frame. Many factors can interfere with one or more phases of this process, thus causing improper or impaired wound healing. This article reviews the recent literature on the most significant factors that affect cutaneous wound healing and the potential cellular and/or molecular mechanisms involved. The factors discussed include oxygenation, infection, age and sex hormones, stress, diabetes, obesity, medications, alcoholism, smoking, and nutrition. A better understanding of the influence of these factors on repair may lead to therapeutics that improve wound healing and resolve impaired wounds. PMID:20139336

  19. The stem factor challenge

    International Nuclear Information System (INIS)

    Russell, M.J.; Steele, R. Jr.; DeWall, K.G.; Watkins, J.C.; Bramwell, D.

    1994-01-01

    One of the most important challenges that still needs to be met in the effort to understand the operation of motor-operated, rising-stem valves is the ability to determine stem factor throughout the valve's load range. The stem factor represents the conversion of operator torque to stem thrust. Determining the stem factor is important because some motor-operated valves (MOVs) cannot be tested in the plant at design basis conditions. The ability of these valves to perform their design basis function (typically, to operate against specified flow and pressure loads) must be ensured by analytical methods or by extrapolating from the results of tests conducted at lower loads. Because the stem factor tends to vary in response to friction and lubrication phenomena that occur during loading and wedging, analytical methods and extrapolation methods have been difficult to develop and implement. Early investigations into variability in the stem factor tended to look only at the tip of the iceberg; they focused on what was happening at torque switch trip, which usually occurs at full wedging. In most stems, the stem factor is better (lower) in the wedging transient than before wedging, so working with torque switch trip data alone led many early researchers to false conclusions about the relationship between stem factor and load. However, research at the Idaho National Engineering Laboratory (INEL) has taken a closer look at what happens during the running portion of the closing stroke along with the wedging portion. This shift in focus is important, because functional failure of a valve typically consists of a failure to isolate flow, not a failure to achieve full wedging. Thus, the stem factor that must be determined for a valve's design basis closing requirements is the one that corresponds with the running load before wedging

  20. Factors Affecting Wound Healing

    OpenAIRE

    Guo, S.; DiPietro, L.A.

    2010-01-01

    Wound healing, as a normal biological process in the human body, is achieved through four precisely and highly programmed phases: hemostasis, inflammation, proliferation, and remodeling. For a wound to heal successfully, all four phases must occur in the proper sequence and time frame. Many factors can interfere with one or more phases of this process, thus causing improper or impaired wound healing. This article reviews the recent literature on the most significant factors that affect cutane...

  1. Los factores de riesgo

    Directory of Open Access Journals (Sweden)

    Justo Senado Dumoy

    1999-01-01

    Full Text Available Sobre el fundamento filosófico de los conceptos de la Dialéctica Materialista, se presenta un análisis en relación con el concepto e interpretación de los Factores de Riesgo.A analysis on the concept and interpretation of risk factors is presented based on the philosophical foundation of the concepts of materialist dialectics.

  2. Brain derived neurotrophic factor

    DEFF Research Database (Denmark)

    Mitchelmore, Cathy; Gede, Lene

    2014-01-01

    Brain Derived Neurotrophic Factor (BDNF) is a neurotrophin with important functions in neuronal development and neuroplasticity. Accumulating evidence suggests that alterations in BDNF expression levels underlie a variety of psychiatric and neurological disorders. Indeed, BDNF therapies are curre......Brain Derived Neurotrophic Factor (BDNF) is a neurotrophin with important functions in neuronal development and neuroplasticity. Accumulating evidence suggests that alterations in BDNF expression levels underlie a variety of psychiatric and neurological disorders. Indeed, BDNF therapies...

  3. Factors Impacting Knowledge Sharing

    DEFF Research Database (Denmark)

    Schulzmann, David; Slepniov, Dmitrij

    The purpose of this paper is to examine various factors affecting knowledge sharing at the R&D center of a Western MNE in China. The paper employs qualitative methodology and is based on the action research and case study research techniques. The findings of the paper advance our understanding...... about factors that affect knowledge sharing. The main emphasis is given to the discussion on how to improve knowledge sharing in global R&D organizations....

  4. FGF growth factor analogs

    Science.gov (United States)

    Zamora, Paul O [Gaithersburg, MD; Pena, Louis A [Poquott, NY; Lin, Xinhua [Plainview, NY; Takahashi, Kazuyuki [Germantown, MD

    2012-07-24

    The present invention provides a fibroblast growth factor heparin-binding analog of the formula: ##STR00001## where R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, X, Y and Z are as defined, pharmaceutical compositions, coating compositions and medical devices including the fibroblast growth factor heparin-binding analog of the foregoing formula, and methods and uses thereof.

  5. Factorization and pion form factor in QCD

    International Nuclear Information System (INIS)

    Efremov, A.V.; Radyushkin, A.V.

    1979-01-01

    The behaviour of the pion electromagnetic form factor (EMFF) in the framework of quantum chromodynamics (QCD) is discussed. Pion is considered to be a quark-antiquark bound state. It is proposed to use an OPE description of the bound state structure by matrix elements of certain local gauge-invariant operators. Short-distance quark interactions is proved using a direct analysis of perturbation theory in the α-parametric representation of the Feynman diagrams. It is shown that the short-distance parton picture privides a self-consistent description of the large Q 2 momentum behaviour of the pion EMFF in QCD. Pion EMFF asymptotics is expressed in terms of fu fundamental constants of the theory

  6. [Pathological gambling: risk factors].

    Science.gov (United States)

    Bouju, G; Grall-Bronnec, M; Landreat-Guillou, M; Venisse, J-L

    2011-09-01

    In France, consumption of gambling games increased by 148% between 1960 and 2005. In 2004, gamblers lost approximately 0.9% of household income, compared to 0.4% in 1960. This represents approximately 134 Euros per year and per head. In spite of this important increase, the level remains lower than the European average (1%). However, gambling practices may continue to escalate in France in the next few years, particularly with the recent announce of the legalisation of online games and sports betting. With the spread of legalised gambling, pathological gambling rates may increase in France in the next years, in response to more widely available and more attractive gambling opportunities. In this context, there is a need for better understanding of the risk factors that are implicated in the development and maintenance of pathological gambling. This paper briefly describes the major risk factors for pathological gambling by examining the recent published literature available during the first quarter of 2008. This documentary basis was collected by Inserm for the collective expert report procedure on Gambling (contexts and addictions). Seventy-two articles focusing on risk factors for pathological gambling were considered in this review. Only 47 of them were taken into account for analysis. The selection of these 47 publications was based on the guide on literature analysis established by the French National Agency for Accreditation and Assessment in Health (ANAES, 2000). Some publications from more recent literature have also been added, mostly about Internet gambling. We identify three major types of risk factors implicated in gambling problems: some of them are related to the subject (individual factors), others are related to the object of the addiction, here the gambling activity by itself (structural factors), and the last are related to environment (contextual or situational factors). Thus, the development and maintenance of pathological gambling seems to be

  7. Generalised Batho correction factor

    International Nuclear Information System (INIS)

    Siddon, R.L.

    1984-01-01

    There are various approximate algorithms available to calculate the radiation dose in the presence of a heterogeneous medium. The Webb and Fox product over layers formulation of the generalised Batho correction factor requires determination of the number of layers and the layer densities for each ray path. It has been shown that the Webb and Fox expression is inefficient for the heterogeneous medium which is expressed as regions of inhomogeneity rather than layers. The inefficiency of the layer formulation is identified as the repeated problem of determining for each ray path which inhomogeneity region corresponds to a particular layer. It has been shown that the formulation of the Batho correction factor as a product over inhomogeneity regions avoids that topological problem entirely. The formulation in terms of a product over regions simplifies the computer code and reduces the time required to calculate the Batho correction factor for the general heterogeneous medium. (U.K.)

  8. factores psicosociales asociados

    Directory of Open Access Journals (Sweden)

    María Teresa Varela Arévalo

    2007-01-01

    Full Text Available El objetivo de este trabajo fue describir el consumo de sustancias psicoactivas [SPA] ilegales en jóvenes y los factores psicosociales de riesgo y de protección asociados. Participaron 763 estudiantes (46,5% hombres y 52,4% mujeres de una universidad privada de Cali, quienes diligenciaron el cuestionario de factores de riesgo y protección para el consumo de drogas. Los resultados muestran que la marihuana fue la droga de mayor consumo; y que existe una fuerte asociación entre el consumo de las cuatro SPA ilegales (marihuana, opiáceos, cocaína y éxtasis y los factores psicosociales de riesgo y/o protección, principalmente, las habilidades de autocontrol, los preconceptos y valoración de las SPA, la relación con personas consumidoras y los comportamientos perturbadores.

  9. Multi-factor authentication

    Science.gov (United States)

    Hamlet, Jason R; Pierson, Lyndon G

    2014-10-21

    Detection and deterrence of spoofing of user authentication may be achieved by including a cryptographic fingerprint unit within a hardware device for authenticating a user of the hardware device. The cryptographic fingerprint unit includes an internal physically unclonable function ("PUF") circuit disposed in or on the hardware device, which generates a PUF value. Combining logic is coupled to receive the PUF value, combines the PUF value with one or more other authentication factors to generate a multi-factor authentication value. A key generator is coupled to generate a private key and a public key based on the multi-factor authentication value while a decryptor is coupled to receive an authentication challenge posed to the hardware device and encrypted with the public key and coupled to output a response to the authentication challenge decrypted with the private key.

  10. Human factors guides

    International Nuclear Information System (INIS)

    Penington, J.

    1995-10-01

    This document presents human factors guides, which have been developed in order to provide licensees of the AECB with advice as to how to address human factors issues within the design and assessment process. This documents presents the results of a three part study undertaken to develop three guides which are enclosed in this document as Parts B, C and D. As part of the study human factors standards, guidelines, handbooks and other texts were researched, to define those which would be most useful to the users of the guides and for the production of the guides themselves. Detailed specifications were then produced to outline the proposed contents and format of the three guides. (author). 100 refs., 3 tabs., 11 figs

  11. Human factors guides

    Energy Technology Data Exchange (ETDEWEB)

    Penington, J [PHF Services Inc., (Canada)

    1995-10-01

    This document presents human factors guides, which have been developed in order to provide licensees of the AECB with advice as to how to address human factors issues within the design and assessment process. This documents presents the results of a three part study undertaken to develop three guides which are enclosed in this document as Parts B, C and D. As part of the study human factors standards, guidelines, handbooks and other texts were researched, to define those which would be most useful to the users of the guides and for the production of the guides themselves. Detailed specifications were then produced to outline the proposed contents and format of the three guides. (author). 100 refs., 3 tabs., 11 figs.

  12. The focus factor

    DEFF Research Database (Denmark)

    Nicolaisen, Jeppe; Frandsen, Tove Faber

    2015-01-01

    Introduction. We present a new bibliometric indicator to measure journal specialisation over time, named the focus factor. This new indicator is based on bibliographic coupling and counts the percentage of re-citations given in subsequent years. Method. The applicability of the new indicator....... To validate re-citations as caused by specialisation, other possible causes were measured and correlated (obsolescence, journal self-citations and number of references). Results. The results indicate that the focus factor is capable of distinguishing between general and specialised journals and thus...... effectively measures the intended phenomenon (i.e., journal specialisation). Only weak correlations were found between journal re-citations and obsolescence, journal self-citations, and number of references. Conclusions. The focus factor successfully measures journal specialisation over time. Measures based...

  13. WRKY transcription factors

    Science.gov (United States)

    Bakshi, Madhunita; Oelmüller, Ralf

    2014-01-01

    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  14. On braid monodromy factorizations

    International Nuclear Information System (INIS)

    Kharlamov, V M; Kulikov, Vik S

    2003-01-01

    We introduce and develop a language of semigroups over the braid groups to study the braid monodromy factorizations (bmf's) of plane algebraic curves and other related objects. As an application, we give a new proof of Orevkov's theorem on the realization of bmf's over a disc by algebraic curves and show that the complexity of such a realization cannot be bounded in terms of the types of factors of the bmf. We also prove that the type of a bmf distinguishes Hurwitz curves with singularities of inseparable type up to H-isotopy and J-holomorphic cuspidal curves in CP 2 up to symplectic isotopy

  15. Dose conversion factors

    International Nuclear Information System (INIS)

    Kocher, D.C.; Eckerman, K.F.

    1992-01-01

    The following is discussed in this report: concepts and quantities used in calculating radiation dose from internal and external exposure. Tabulations of dose conversion factor for internal and external exposure to radionuclides. Dose conversion factors give dose per unit intake (internal) or dose per unit concentration in environment (external). Intakes of radionuclides for internal exposure and concentrations of radionuclides in environment for external exposure are assumed to be known. Intakes and concentrations are obtained, e.g., from analyses of environmental transport and exposure pathways. differences between dosimetry methods for radionuclides and hazardous chemicals are highlighted

  16. Factors stimulating content marketing

    Directory of Open Access Journals (Sweden)

    Naser Azad

    2016-02-01

    Full Text Available This paper presents an empirical investigation to determine factors influencing on content marketing in banking industry. The study designs a questionnaire consists of 40 questions in Likert scale and distributes it among 550 randomly selected regular customers of Bank Mellat in city of Tehran, Iran and 400 properly filled questionnaires are collected. Cronbach alphas for all components of the survey are well above desirable level. Using principle component analysis with Varimax rotation, the study has determined six factors influencing the most on content marketing including organization, details, having new ideas, quality, sensitivity and power while the last component contains only two subcomponents and is removed from the study.

  17. STEREOTYPICAL FACTORS IN TOURISM

    Directory of Open Access Journals (Sweden)

    Cristina-Elena ALBU

    2013-06-01

    Full Text Available International tourism has grown rapidly nowdays, contributing to the growth of the global economy. The purpose of this essay is to identify and analyze stereotypical factors in the development of strategies concerning the offer for the tourism industry: the image of a tourist destination, brand, country of origin and customer behaviour. Documentary study was the research method used: representative articles were analysed, as recent as possible, to determine the factors mentioned above. Professionals in the industry of tourism need to understand cultural differences between tourists, as well as those of the host country, to be able to create tourist reception offers that live up to the standards expected by clients.

  18. Factor analysis and scintigraphy

    International Nuclear Information System (INIS)

    Di Paola, R.; Penel, C.; Bazin, J.P.; Berche, C.

    1976-01-01

    The goal of factor analysis is usually to achieve reduction of a large set of data, extracting essential features without previous hypothesis. Due to the development of computerized systems, the use of largest sampling, the possibility of sequential data acquisition and the increase of dynamic studies, the problem of data compression can be encountered now in routine. Thus, results obtained for compression of scintigraphic images were first presented. Then possibilities given by factor analysis for scan processing were discussed. At last, use of this analysis for multidimensional studies and specially dynamic studies were considered for compression and processing [fr

  19. The Transcription Factor Encyclopedia

    DEFF Research Database (Denmark)

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I

    2012-01-01

    mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written......ABSTRACT: Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130...

  20. Factorizations and physical representations

    International Nuclear Information System (INIS)

    Revzen, M; Khanna, F C; Mann, A; Zak, J

    2006-01-01

    A Hilbert space in M dimensions is shown explicitly to accommodate representations that reflect the decomposition of M into prime numbers. Representations that exhibit the factorization of M into two relatively prime numbers: the kq representation (Zak J 1970 Phys. Today 23 51), and related representations termed q 1 q 2 representations (together with their conjugates) are analysed, as well as a representation that exhibits the complete factorization of M. In this latter representation each quantum number varies in a subspace that is associated with one of the prime numbers that make up M

  1. Model Correction Factor Method

    DEFF Research Database (Denmark)

    Christensen, Claus; Randrup-Thomsen, Søren; Morsing Johannesen, Johannes

    1997-01-01

    The model correction factor method is proposed as an alternative to traditional polynomial based response surface techniques in structural reliability considering a computationally time consuming limit state procedure as a 'black box'. The class of polynomial functions is replaced by a limit...... of the model correction factor method, is that in simpler form not using gradient information on the original limit state function or only using this information once, a drastic reduction of the number of limit state evaluation is obtained together with good approximations on the reliability. Methods...

  2. [Natural factors influencing sleep].

    Science.gov (United States)

    Jurkowski, Marek K; Bobek-Billewicz, Barbara

    2007-01-01

    Sleep is a universal phenomenon of human and animal lives, although the importance of sleep for homeo-stasis is still unknown. Sleep disturbances influence many behavioral and physiologic processes, leading to health complications including death. On the other hand, sleep improvement can beneficially influence the course of healing of many disorders and can be a prognostic of health recovery. The factors influencing sleep have different biological and chemical origins. They are classical hormones, hypothalamic releasing and inhibitory hormones, neuropeptides, peptides and others as cytokines, prostaglandins, oleamid, adenosine, nitric oxide. These factors regulate most physiologic processes and are likely elements integrating sleep with physiology and physiology with sleep in health and disorders.

  3. Environmental factors and leukaemia

    Energy Technology Data Exchange (ETDEWEB)

    Brandt, L

    1985-01-01

    Investigations on the association between environmental hazards and the development of various types of leukaemia are reviewed. Regarding acute non-lymphocytic leukaemia (ANLL) exposure to ionizing radiation is a well-documented risk factor. According to several recent studies exposure to strong electromagnetic fields may be suspected to be of etiologic importance for ANLL. There is evidence that occupational handling of benzene is a risk factor and other organic solvents may also be leukaemogenic. Occupational exposure to petrol products has been proposed to be a risk factor although the hazardous substances have not yet been defined. Results of cytogenetic studies in ANLL suggest that exposure to certain environmental agents may be associated with relatively specific clonal chromosome aberrations. Exposure in utero to ionizing radiation has been proposed to be a risk factor for acute lymphocytic leukaemia (ALL) in children. Unlike ANLL there seems at present to be little evidence that ALL is related to exposure to some chemicals. Chronic myeloid leukaemia (CML) may follow exposure to high doses of ionizing radiation whereas such exposure seems to be of insignificant importance for the development of chronic lymphocytic leukaemia (CLL). According to some studies an abnormally high incidence of CLL may be found among farmers in the USA. These results have not been confirmed in Scandinavian studies. There seems to be little evidence that CML or CLL are related to occupational handling of some chemicals. 35 references.

  4. Hyperglycemia: a prothrombotic factor?

    NARCIS (Netherlands)

    Lemkes, B. A.; Hermanides, J.; DeVries, J. H.; Holleman, F.; Meijers, J. C. M.; Hoekstra, J. B. L.

    2010-01-01

    Diabetes mellitus is characterized by a high risk of atherothrombotic events. What is more, venous thrombosis has also been found to occur more frequently in this patient group. This prothrombotic condition in diabetes is underpinned by laboratory findings of elevated coagulation factors and

  5. Thermal disadvantage factor

    International Nuclear Information System (INIS)

    Abdullah, K.M.S.; Loyalka, S.K.

    1990-01-01

    A method is described where reactor cell flux and the disadvantage factor are calculated by using diffusion theory in the moderator and integral transport in the fuel. The method is efficient (noniterative) and provides results that agree well with Monte Carlo, P 5 and ABH results

  6. Threshold factorization redux

    Science.gov (United States)

    Chay, Junegone; Kim, Chul

    2018-05-01

    We reanalyze the factorization theorems for the Drell-Yan process and for deep inelastic scattering near threshold, as constructed in the framework of the soft-collinear effective theory (SCET), from a new, consistent perspective. In order to formulate the factorization near threshold in SCET, we should include an additional degree of freedom with small energy, collinear to the beam direction. The corresponding collinear-soft mode is included to describe the parton distribution function (PDF) near threshold. The soft function is modified by subtracting the contribution of the collinear-soft modes in order to avoid double counting on the overlap region. As a result, the proper soft function becomes infrared finite, and all the factorized parts are free of rapidity divergence. Furthermore, the separation of the relevant scales in each factorized part becomes manifest. We apply the same idea to the dihadron production in e+e- annihilation near threshold, and show that the resultant soft function is also free of infrared and rapidity divergences.

  7. Fibroblast growth factor 23

    African Journals Online (AJOL)

    Dr Olaleye

    Systemic phosphate homeostasis is maintained through several hormonal mechanisms which involve fibroblast growth factor 23 (FGF-23), α-klotho, vitamin D and parathyroid hormone. FGF-23 is known to be the major regulator of phosphate balance (Mirams et al., 2004). FGF-23 is a phosphaturic hormone, which is.

  8. Human factors information system

    International Nuclear Information System (INIS)

    Goodman, P.C.; DiPalo, C.A.

    1991-01-01

    Nuclear power plant safety is dependent upon human performance related to plant operations. To provide improvements in human performance, data collection and assessment play key roles. This paper reports on the Human factors Information System (HFIS) which is designed to meet the needs of the human factors specialists of the United States Nuclear Regulatory Commission. These specialists identify personnel errors and provide guidance designed to prevent such errors. HFIS is a simple and modular system designed for use on a personal computer. It is designed to contain four separate modules that provide information indicative of program or function effectiveness as well as safety-related human performance based on programmatic and performance data. These modules include the Human Factors Status module; the Regulatory Programs module; the Licensee Event Report module; and the Operator Requalification Performance module. Information form these modules can either be used separately or can be combined due to the integrated nature of the system. HFIS has the capability, therefore, to provide insights into those areas of human factors that can reduce the probability of events caused by personnel error at nuclear power plants and promote the health and safety of the public. This information system concept can be applied to other industries as well as the nuclear industry

  9. PATTERNS AND FACTORS INVOLVED

    African Journals Online (AJOL)

    Between 1*' of July 1996 and 30'h of June 2000 a total of 3583 patients were registered at the accident and emergency unit of Nnamdi. Azikiwe ... The case files of these were reviewed with a view to ascertaining the causes and factors involved in the deaths of these patients. The .... H.I.V/AIDS related complications 23 6.8.

  10. Introduction to human factors

    International Nuclear Information System (INIS)

    Winters, J.M.

    1988-03-01

    Some background is given on the field of human factors. The nature of problems with current human/computer interfaces is discussed, some costs are identified, ideal attributes of graceful system interfaces are outlined, and some reasons are indicated why it's not easy to fix the problems

  11. Prognostic factors in oligodendrogliomas

    DEFF Research Database (Denmark)

    Westergaard, L; Gjerris, F; Klinken, L

    1997-01-01

    An outcome analysis was performed on 96 patients with pure cerebral oligodendrogliomas operated in the 30-year period 1962 to 1991. The most important predictive prognostic factors were youth and no neurological deficit, demonstrated as a median survival for the group younger than 20 years of 17...

  12. Factors affecting mining costs

    International Nuclear Information System (INIS)

    Lowell, A.F.

    1977-01-01

    The subject is discussed under the following headings: investment decision-making, unit cost factors (declining ore grade, low-price contracts, ore grade/output relationship, above average cost increases). Economic, environmental, sociological and political aspects are considered. (U.K.)

  13. Human factors in network security

    OpenAIRE

    Jones, Francis B.

    1991-01-01

    Human factors, such as ethics and education, are important factors in network information security. This thesis determines which human factors have significant influence on network security. Those factors are examined in relation to current security devices and procedures. Methods are introduced to evaluate security effectiveness by incorporating the appropriate human factors into network security controls

  14. Electromagnetic form factors

    International Nuclear Information System (INIS)

    Desplanques, B.

    1987-01-01

    Electromagnetic form factors, in first approximation, are sensitive to spatial distribution of nucleons and to their current. In second approximation, more precise effects are concerned, whose role is increasing with momentum transfer and participating essentially of short range nuclei description. They concern of course the nucleon-nucleon interaction while approaching each other and keeping their free-state identity, but also mutually polarizing one the other. In this last effect, radial and orbital excitations of nucleon, the nucleon mesonic cloud modification and the nucleon antinucleon pair excitation are included. In this paper, these contributions are discussed while trying to find the important elements for a good description of form factors. Current questions are also discussed. Light nuclei are essentially concerned [fr

  15. Researching organizational factors

    International Nuclear Information System (INIS)

    Coffman, F.

    1991-01-01

    This paper discusses feedback and insights from experience (both successful and unsuccessful) with the past and the ongoing organizational factors research. That experience suggests a leading set of ingredients that appear proper for performing regulatory research on organizational processes. By keeping focused upon these proper ingredients, the research will contribute to the regulatory assessments of utility management through the use of improved methods and measures in investigations, inspections, diagnostics, performance indicators, and PRA insights. This paper is organized into (1) an introductory description of what the agency is doing to assess organizational effectiveness, (2) some insights from past and ongoing research, (3) an opinion on a leading set of ingredients to properly research organizational factors, and (4) a summary

  16. On braid monodromy factorizations

    Energy Technology Data Exchange (ETDEWEB)

    Kharlamov, V M [Institut de Recherche Matematique Avanee Universite Louis Pasteur et CNRS 7 rue Rene Descartes (France); Kulikov, Vik S [Steklov Mathematical Institute, Russian Academy of Sciences (Russian Federation)

    2003-06-30

    We introduce and develop a language of semigroups over the braid groups to study the braid monodromy factorizations (bmf's) of plane algebraic curves and other related objects. As an application, we give a new proof of Orevkov's theorem on the realization of bmf's over a disc by algebraic curves and show that the complexity of such a realization cannot be bounded in terms of the types of factors of the bmf. We also prove that the type of a bmf distinguishes Hurwitz curves with singularities of inseparable type up to H-isotopy and J-holomorphic cuspidal curves in CP{sup 2} up to symplectic isotopy.

  17. Factors in Agile Methods Adoption

    Directory of Open Access Journals (Sweden)

    Samia Abdalhamid

    2017-05-01

    Full Text Available There are many factors that can affect the process of adopting Agile methods during software developing. This paper illustrates the critical factors in Agile methods adoption in software organizations. To present the success and failure factors, an exploratory study is carried out among the critical factors of success and failure from existing studies. Dimensions and Factors are introduced utilizing success and failure dimensions. The mind map was used to clarify these factors.

  18. Factors of academic procrastination

    OpenAIRE

    Kranjec, Eva; Košir, Katja; Komidar, Luka

    2017-01-01

    This study investigated dimensions of perfectionism, anxiety, and depression as factors of academic procrastination. Our main research interest was to examine the role of specific dimensions of perfectionism as moderators in the relationship between anxiety and depression and academic procrastination. Four scales were administered on the sample of 403 students: perfectionism scale FMPS, academic procrastination scale APS-SI, depression scale CESD and anxiety scale STAI-X2. The results showed ...

  19. Concentration factors for fish

    International Nuclear Information System (INIS)

    Feldt, W.; Lauer, R.; Melzer, M.; Siebert, W.

    1978-01-01

    Concentration factors are defined as operators allowing to calculate the specific activity of fish meat from a given concentration of an element in the water. This parameter depends among others from the content of stable isotopes and homologues in the different waters. If this parameter is reasonably to be used for model calculations it must be referred to water with all of its content substances, these calculations also being based on this type of 'water'. (orig.) [de

  20. Prognostic factors for medulloblastoma

    International Nuclear Information System (INIS)

    Jenkin, Derek; Al Shabanah, Mohamed; Al Shail, Essam; Gray, Alan; Hassounah, Maher; Khafaga, Yasser; Kofide, Amani; Mustafa, Mahmoud; Schultz, Henrik

    2000-01-01

    Purpose: To evaluate prognostic factors for medulloblastoma. Methods and Materials: One hundred and seventy-three consecutive patients with medulloblastoma, treated at King Faisal Specialist Hospital (KFSH) from 1988-1997, were reviewed. Eighty-four percent were children less than 15 years old. From 1988-1994, treatment was at the discretion of the investigator. From 1994-1998, patients entered a single-arm best practice protocol in which, in staged patients, the surgical intent was total resection, standard radiation treatment was defined, and adjuvant chemotherapy was given to a 'high-risk' subset. Results: For 150 patients who completed surgical and radiation treatment, the 5-year survival rate was 58%, compared with 0% for 16 patients who were unable to start or complete radiation treatment. For staged patients, the 5-year survival was M0 + M1, 78% and M2 + M3, 21% (p 14 years and gross cystic/necrotic features in the primary tumor. The size of the primary tumor, the degree of hydrocephalus at diagnosis, the presence of residual tumor in the post-operative CT/MRI, and the functional status of the patient prior to radiation treatment were not significant factors. Conclusions: Stage M0 + M1 was the most powerful favorable prognostic factor. In Saudi Arabia more patients present with advanced disseminated disease, 41% M2 + M3, than in the West, and this impacts adversely on overall survival. Total resection and standard radiation treatment were not sensitive prognostic factors in a treatment environment in which 78% of patients underwent at least 90% tumor resection and 60% received standard radiation treatment. In order to improve the proportion of patients able to complete radiation treatment, consideration should be given to limiting resection when the attainment of total resection is likely to be morbid, and to delaying rather than omitting radiation treatment in the patient severely compromised postoperatively

  1. Risk factors for cancer

    International Nuclear Information System (INIS)

    Lyman, G.H.

    1992-01-01

    It is no longer reasonable to divide cancers into those that are genetic in origin and those that are environmental in origin. With rare exception, carcinogenesis involves environmental factors that directly or indirectly exert a change in the cell's genome. Virtually all causes of cancer are multifactorial, sometimes involving an inherited predisposition to the carcinogenic effects of environmental factors, which include chemicals, ionizing radiation, and oncogenic virus. Carcinogenesis is a multistep process including induction, promotion, and progression. Initiation requires an irreversible change in the cellular genome, whereas promotion is commonly associated with prolonged and reversible exposure. Tumor progression results in genotypic and phenotypic changes associated with tumor growth, invasion, and metastasis. Most information on human cancer risk is based on epidemiologic studies involving both exposed and unexposed individuals. The quality of such studies depends on their ability to assess the strength of any association of exposure and disease and careful attention to any potential bias. Few cancers are inherited in a Mendelian fashion. Several preneoplastic conditions, however, are clearly inherited and several malignancies demonstrate weak familial patterns. Environmental factors may exert their effect on DNA in a random fashion, but certain consistent changes, including specific translocations of genetic information, are often found. Currently, there is great interest in the close proximity of certain oncogenes governing growth control to the consistent chromosomal changes observed. Such changes may represent a final common pathway of action for environmental carcinogens. Sufficient laboratory and epidemiologic evidence exists to establish a causal association of several chemical agents with cancer

  2. Human factoring administrative procedures

    International Nuclear Information System (INIS)

    Grider, D.A.; Sturdivant, M.H.

    1991-01-01

    In nonnuclear business, administrative procedures bring to mind such mundane topics as filing correspondence and scheduling vacation time. In the nuclear industry, on the other hand, administrative procedures play a vital role in assuring the safe operation of a facility. For some time now, industry focus has been on improving technical procedures. Significant efforts are under way to produce technical procedure requires that a validated technical, regulatory, and administrative basis be developed and that the technical process be established for each procedure. Producing usable technical procedures requires that procedure presentation be engineered to the same human factors principles used in control room design. The vital safety role of administrative procedures requires that they be just as sound, just a rigorously formulated, and documented as technical procedures. Procedure programs at the Tennessee Valley Authority and at Boston Edison's Pilgrim Station demonstrate that human factors engineering techniques can be applied effectively to technical procedures. With a few modifications, those same techniques can be used to produce more effective administrative procedures. Efforts are under way at the US Department of Energy Nuclear Weapons Complex and at some utilities (Boston Edison, for instance) to apply human factors engineering to administrative procedures: The techniques being adapted include the following

  3. Human Factors Review Plan

    International Nuclear Information System (INIS)

    Paramore, B.; Peterson, L.R.

    1985-12-01

    ''Human Factors'' is concerned with the incorporation of human user considerations into a system in order to maximize human reliability and reduce errors. This Review Plan is intended to assist in the assessment of human factors conditions in existing DOE facilities. In addition to specifying assessment methodologies, the plan describes techniques for improving conditions which are found to not adequately support reliable human performance. The following topics are addressed: (1) selection of areas for review describes techniques for needs assessment to assist in selecting and prioritizing areas for review; (2) human factors engineering review is concerned with optimizing the interfaces between people and equipment and people and their work environment; (3) procedures review evaluates completeness and accuracy of procedures, as well as their usability and management; (4) organizational interface review is concerned with communication and coordination between all levels of an organization; and (5) training review evaluates training program criteria such as those involving: trainee selection, qualification of training staff, content and conduct of training, requalification training, and program management

  4. Human Factors Review Plan

    Energy Technology Data Exchange (ETDEWEB)

    Paramore, B.; Peterson, L.R. (eds.)

    1985-12-01

    ''Human Factors'' is concerned with the incorporation of human user considerations into a system in order to maximize human reliability and reduce errors. This Review Plan is intended to assist in the assessment of human factors conditions in existing DOE facilities. In addition to specifying assessment methodologies, the plan describes techniques for improving conditions which are found to not adequately support reliable human performance. The following topics are addressed: (1) selection of areas for review describes techniques for needs assessment to assist in selecting and prioritizing areas for review; (2) human factors engineering review is concerned with optimizing the interfaces between people and equipment and people and their work environment; (3) procedures review evaluates completeness and accuracy of procedures, as well as their usability and management; (4) organizational interface review is concerned with communication and coordination between all levels of an organization; and (5) training review evaluates training program criteria such as those involving: trainee selection, qualification of training staff, content and conduct of training, requalification training, and program management.

  5. Human and Organizational Factors

    International Nuclear Information System (INIS)

    Eshiett, P.B.S.

    2016-01-01

    The Human and Organizational Factors Approach to Industrial Safety (HOFS) consists of identifying and putting in place conditions which encourage a positive contribution from operators (individually and in a team) with regards to industrial safety. The knowledge offered by the HOFS approach makes it possible better to understand what conditions human activity and to act on the design of occupational situations and the organization, in the aim of creating the conditions for safe work. Efforts made in this area can also lead to an improvement in results in terms of the quality of production or occupational safety (incidence and seriousness rates) (Daniellou, F., et al., 2011). Research on industrial accidents shows that they rarely happen as a result of a single event, but rather emerge from the accumulation of several, often seemingly trivial, malfunctions, misunderstandings, incorrect assumptions and other issues. The nuclear community has established rigorous international safety standards and concepts to ensure the protection of people and the environment from harmful effects of ionizing radiation (IAEA, 2014). A review of major human induced disasters in a number of countries and in different industries yields insights into several of the human and organizational factors involved in their occurrence. Some of these factors relate to failures in: • Design or technology; • Training; • Decision making; • Communication; • Preparation for the unexpected; • Understanding of organizational interdependencies

  6. Molecular factors in migraine

    Science.gov (United States)

    Kowalska, Marta; Prendecki, Michał; Kozubski, Wojciech; Lianeri, Margarita; Dorszewska, Jolanta

    2016-01-01

    Migraine is a common neurological disorder that affects 11% of adults worldwide. This disease most likely has a neurovascular origin. Migraine with aura (MA) and more common form - migraine without aura (MO) – are the two main clinical subtypes of disease. The exact pathomechanism of migraine is still unknown, but it is thought that both genetic and environmental factors are involved in this pathological process. The first genetic studies of migraine were focused on the rare subtype of MA: familial hemiplegic migraine (FHM). The genes analysed in familial and sporadic migraine are: MTHFR, KCNK18, HCRTR1, SLC6A4, STX1A, GRIA1 and GRIA3. It is possible that migraine is a multifactorial disease with polygenic influence. Recent studies have shown that the pathomechanisms of migraine involves both factors responsible for immune response and oxidative stress such as: cytokines, tyrosine metabolism, homocysteine; and factors associated with pain transmission and emotions e.g.: serotonin, hypocretin-1, calcitonin gene-related peptide, glutamate. The correlations between genetic variants of the HCRTR1 gene, the polymorphism 5-HTTLPR and hypocretin-1, and serotonin were observed. It is known that serotonin inhibits the activity of hypocretin neurons and may affect the appearance of the aura during migraine attack. The understanding of the molecular mechanisms of migraine, including genotype-phenotype correlations, may contribute to finding markers important for the diagnosis and treatment of this disease. PMID:27191890

  7. Structuring factoring business: accounting aspects

    Directory of Open Access Journals (Sweden)

    I.M. Vygivska

    2017-08-01

    Full Text Available The article theoretically substantiates the fact that factoring belongs to the main operational activity of a factoring company, and this allowed structuring the factoring business by types of activity. The lack of a unified approach to the classification of factoring (factoring services made it possible to systematize and refine their classification as a basis for developing accounting and analytical support for risk management of factoring business. The authors single out such classification signs as: the right of the reverse claim (reverse, irretrievable, a territorial feature (international, internal, the subject of the factoring contract (real, consensual, the availability of notification of the debtor (conventional, confidential. The structuring of factoring business contributes to the identification of the risks of the economic activities of a factoring company depending on the type of factoring, the development of methodological support for the bookkeeping of factoring transactions in a risk environment, the search for risk management practices and the determination of management effectiveness in general.

  8. Milestones and Impact Factors

    Directory of Open Access Journals (Sweden)

    Grandjean Philippe

    2010-07-01

    Full Text Available Abstract Environmental Health has just received its first Impact Factor by Thomson ISI. At a level of 2.48, this achievement is quite satisfactory and places Environmental Health in the top 25% of environmental science journals. When the journal was launched in 2002, it was still unclear whether the Open Access publishing model could be made into a viable commercial enterprise within the biomedical field. During the past eight years, Open Access journals have become widely available, although still covering only about 15% of journal titles. Major funding agencies and institutions, including prominent US universities, now require that researchers publish in Open Access journals. Because of the profound role of scientific journals for the sharing of results and communication between researchers, the advent of Open Access may be of as much significance as the transition from handwriting to printing via moveable type. As Environmental Health is an electronic Open Access journal, the numbers of downloads at the journal website can be retrieved. The top-20 list of articles most frequently accessed shows that all of them have been downloaded over 10,000 times. Back in 2002, the first article published was accessed only 49 times during the following month. A year later, the server had over 1,000 downloads per month, and now the total number of monthly downloads approaches 50,000. These statistics complement the Impact Factor and confirm the viability of Open Access in our field of research. The advent of digital media and its decentralized mode of distribution - the internet - have dramatically changed the control and financing of scientific information dissemination, while facilitating peer review, accelerating editorial handling, and supporting much needed transparency. Both the meaning and means of "having an impact" are therefore changing, as will the degree and way in which scientific journals remain "factors" in that impact.

  9. Factor 4 planning

    International Nuclear Information System (INIS)

    Bariol-Mathais, Brigitte; Lavoillotte, Philippine; Gall-Sorrentino, Florence; Malez, Marianne; Sanna, Daniela; Marsauche, Maud; Marquet, Sarah; Debergue, Sophie; Aminu, Olufunmi; Bernard, Helene; Marchand, Jean-Michel; Blin, Frederic; Grange, Jerome; Caillierez, Sophie; Muller, Dania; Clement, Bob; Desire, Jean-Charles; Metais, Benedicte; Lannuzel, Philippe; Pezet-Kuhn, Murielle; Pons, Anne; Rivoire-Meley, Benedicte; Tissot, Heloise

    2015-07-01

    Factor 4 is the goal of cutting our greenhouse gas emissions by 75% by 2050. Achieving this objective will necessitate radical changes in our practices, in particular concerning transport and housing; the measures currently implemented, such as positive-energy buildings, low-impact mobility and eco-neighbourhoods, will not be enough to meet this goal. These measures must be conceived in the framework of broad territorial planning that integrates environmental and energy objectives far upstream. To this end, the French Environment and Energy Management Agency (ADEME) and the French network of Urban Planning Agencies (FNAU), pursuing their missions in their respective areas of competence, have joined forces to make infrastructure and land use planning an integral part of the environmental and energy transition process. In 2013, the two organisations signed a partnership agreement and compiled an inventory of practices that are relevant to Factor 4 planning. This work was led by Epures, Saint-etienne urban planning agency, along with FNAU, drawing upon the expertise of a dozen urban planning agencies in precursor territories. This inventory describes the stakes, resources and strengths for each territory, which have led to cross-sectoral territorial planning exercises with ambitious environmental and energy objectives; the importance of evaluation in attaining these goals is emphasised. Current experience, questions and available methodological tools are summarised in this document, to encourage territories and help them design their planning policies along a trajectory to achieve Factor 4 goals. The compilation also aims to be a contribution to the COP21 climate conference

  10. Accidents and human factors

    International Nuclear Information System (INIS)

    Nishiwaki, Y.; Kawai, H.; Morishima, H.; Terano, T.; Sugeno, M.

    1984-01-01

    When the TMI accident occurred it was 4 a.m., an hour when the error potential of the operators would have been very high. The frequency of car and train accidents in Japan is also highest between 4 a.m. and 6 a.m. The error potential may be classified into five phases corresponding to the electroencephalogramic pattern (EEG). At phase 0, when the delta wave appears, a person is unconscious and in deep sleep; at phase I, when the theta wave appears, he is very tired, sleepy and subnormal; at phase II, when the alpha wave appears, he is normal, relaxed and passive; at phase III, when the beta wave appears, he is normal, clear-minded and active; at phase IV, when the strong beta or epileptic wave appears, he is hypernormal, excited and incapable of normal judgement. Should an accident occur at phase II, the brain condition may jump to phase IV. At this phase the error or accident potential is maximum. The response of the human brain to different types of noises and signals may vary somewhat for different individuals and for different groups of people. Therefore, the possibility that such differences in brain functions may influence the mental structure would be worthy of consideration in human factors and in the design of man-machine systems. Human reliability and performance would be affected by many factors: medical, physiological and psychological, etc. The uncertainty involved in human factors may not necessarily be probabilistic, but fuzzy. Therefore, it would be important to develop a theory by which both non-probabilistic uncertainties, or fuzziness, of human factors and the probabilistic properties of machines can be treated consistently. From the mathematical point of view, probabilistic measure is considered a special case of fuzzy measure. Therefore, fuzzy set theory seems to be an effective tool for analysing man-machine systems. To minimize human error and the possibility of accidents, new safety systems should not only back up man and make up for his

  11. Speeding Fermat's factoring method

    Science.gov (United States)

    McKee, James

    A factoring method is presented which, heuristically, splits composite n in O(n^{1/4+epsilon}) steps. There are two ideas: an integer approximation to sqrt(q/p) provides an O(n^{1/2+epsilon}) algorithm in which n is represented as the difference of two rational squares; observing that if a prime m divides a square, then m^2 divides that square, a heuristic speed-up to O(n^{1/4+epsilon}) steps is achieved. The method is well-suited for use with small computers: the storage required is negligible, and one never needs to work with numbers larger than n itself.

  12. Improved Balanced Incomplete Factorization

    Czech Academy of Sciences Publication Activity Database

    Bru, R.; Marín, J.; Mas, J.; Tůma, Miroslav

    2010-01-01

    Roč. 31, č. 5 (2010), s. 2431-2452 ISSN 0895-4798 R&D Projects: GA AV ČR IAA100300802 Grant - others:GA AV ČR(CZ) M100300902 Institutional research plan: CEZ:AV0Z10300504 Source of funding: I - inštitucionálna podpora na rozvoj VO Keywords : preconditioned iterative methods * sparse matrices * incomplete decompositions * approximate inverses * Sherman-Morrison formula * nonsymmetric matrices Subject RIV: BA - General Mathematics Impact factor: 1.725, year: 2010

  13. Sleep-inducing factors.

    Science.gov (United States)

    García-García, Fabio; Acosta-Peña, Eva; Venebra-Muñoz, Arturo; Murillo-Rodríguez, Eric

    2009-08-01

    Kuniomi Ishimori and Henri Piéron were the first researchers to introduce the concept and experimental evidence for a chemical factor that would presumably accumulate in the brain during waking and eventually induce sleep. This substance was named hypnotoxin. Currently, the variety of substances which have been shown to alter sleep includes peptides, cytokines, neurotransmitters and some substances of lipidic nature, many of which are well known for their involvement in other biological activities. In this chapter, we describe the sleep-inducing properties of the vasoactive intestinal peptide, prolactin, adenosine and anandamide.

  14. "Factor Analysis Using ""R"""

    Directory of Open Access Journals (Sweden)

    A. Alexander Beaujean

    2013-02-01

    Full Text Available R (R Development Core Team, 2011 is a very powerful tool to analyze data, that is gaining in popularity due to its costs (its free and flexibility (its open-source. This article gives a general introduction to using R (i.e., loading the program, using functions, importing data. Then, using data from Canivez, Konold, Collins, and Wilson (2009, this article walks the user through how to use the program to conduct factor analysis, from both an exploratory and confirmatory approach.

  15. Perinatal risk factors for strabismus

    DEFF Research Database (Denmark)

    Torp-Pedersen, Tobias; Boyd, Heather A; Poulsen, Gry

    2010-01-01

    Little is known about the aetiological factors underlying strabismus. We undertook a large cohort study to investigate perinatal risk factors for strabismus, overall and by subtype.......Little is known about the aetiological factors underlying strabismus. We undertook a large cohort study to investigate perinatal risk factors for strabismus, overall and by subtype....

  16. Activation of human factor V by factor Xa and thrombin

    International Nuclear Information System (INIS)

    Monkovic, D.D.; Tracy, P.B.

    1990-01-01

    The activation of human factor V by factor Xa and thrombin was studied by functional assessment of cofactor activity and sodium dodecyl sulfate-polycarylamide gel electrophoresis followed by either autoradiography of 125 I-labeled factor V activation products or Western blot analyses of unlabeled factor V activation products. Cofactor activity was measured by the ability of the factor V/Va peptides to support the activation of prothrombin. The factor Xa catalyzed cleavage of factor V was observed to be time, phospholipid, and calcium ion dependent, yielding a cofactor with activity equal to that of thrombin-activated factor V (factor Va). The cleavage pattern differed markedly from the one observed in the bovine system. The factor Xa activated factor V subunits expressing cofactor activity were isolated and found to consist of peptides of M r 220,000 and 105,000. Although thrombin cleaved the M r 220,000 peptide to yield peptides previously shown to be products of thrombin activation, cofactor activity did not increase. N-Terminal sequence analysis confirmed that both factor Xa and thrombin cleave factor V at the same bond to generate the M r 220,000 peptide. The factor Xa dependent functional assessment of 125 I-labeled factor V coupled with densitometric analyses of the cleavage products indicated that the cofactor activity of factor Xa activated factor V closely paralleled the appearance of the M r 220,000 peptide. The data indicate that factor Xa is as efficient an enzyme toward factor V as thrombin

  17. Organizational factors in Korean NPPs

    International Nuclear Information System (INIS)

    Jang, D. J.; Kim, Y. I.; Jeong, C. H.; Kim, J. W.

    2003-01-01

    Organizational factors are referred to as the factors that influence the achievement of a goal of an organization. Latent problems of an organization could contribute to causing human errors in such stages as design, operation and maintenance, and furthermore, leading to an severe accident. In order to evaluate an organization from the safety viewpoint, it is necessary to identify the organizational factors in a systematic fashion. In this paper, some efforts to identify the organizational factors in Korean NPPs are presented. The study was performed in the following steps: 1) Reviewing the definitions and range of the organizational factors used by the previous 13 researches, 2) Structuring the organizational factors by screening and collating factors, 3) Analysing the organizational factors that is considered to have contributed to the trip events based on the trip report of Korean NPPs, 4) Suggesting a more reliable taxonomy of organizational factors for event analysis by applying the Onion Structure Model to the selected factors

  18. Risk Factors in Pemphigus

    Directory of Open Access Journals (Sweden)

    Gülşen Tükenmez Demirc

    2011-09-01

    Full Text Available Background and Design: There have been reports suggesting the involvement of environmental factors in the disease process of pemphigus. In this study, we aimed to find out the risk factors which could play role in the etiopathogenesis in our pemphigus patients.Material and method: A total of 42 patients (15 male and 27 female who were diagnosed as pemphigus with histopathological and direct immunoflurosence examinations in our clinic between the years 1998-2004, were interviewed for assessment of regarding with the subjects of the demographic properties, occupational groups, educational level, the number of pregnancies, stressfull life events, diet habits, smoking and alcohol consumption before the onset of the disease and the results were compared to 42 age and gender-matched controls with similar socioeconomic circumstances. Results: Working in agriculture and livestock, multi-parity, absence of smoking and stressfull life events were found to be statistically significant in pemphigus patients than in controls. Conclusion: Working in agriculture and livestock, multi-parity, absence of smoking and stressfull life events were assumed to play role in the etiopathogenesis and course of pemphigus.

  19. Systemic blockade of D2-like dopamine receptors facilitates extinction of conditioned fear in mice

    OpenAIRE

    Ponnusamy, Ravikumar; Nissim, Helen A.; Barad, Mark

    2005-01-01

    Extinction of conditioned fear in animals is the explicit model of behavior therapy for human anxiety disorders, including panic disorder, obsessive-compulsive disorder, and post-traumatic stress disorder. Based on previous data indicating that fear extinction in rats is blocked by quinpirole, an agonist of dopamine D2 receptors, we hypothesized that blockade of D2 receptors might facilitate extinction in mice, while agonists should block extinction, as they do in rats. One day after fear con...

  20. A retroviral oncogene, akt, encoding a serine-threonine kinase containing an SH2-like region.

    Science.gov (United States)

    Bellacosa, A; Testa, J R; Staal, S P; Tsichlis, P N

    1991-10-11

    The v-akt oncogene codes for a 105-kilodalton fusion phosphoprotein containing Gag sequences at its amino terminus. Sequence analysis of v-akt and biochemical characterization of its product revealed that it codes for a protein kinase C-related serine-threonine kinase whose cellular homolog is expressed in most tissues, with the highest amount found in thymus. Although Akt is a serine-threonine kinase, part of its regulatory region is similar to the Src homology-2 domain, a structural motif characteristic of cytoplasmic tyrosine kinases that functions in protein-protein interactions. This suggests that Akt may form a functional link between tyrosine and serine-threonine phosphorylation pathways.

  1. S2 like Star Orbits near the Galactic Center in Rn and Yukawa Gravity

    Science.gov (United States)

    Borka, Dusko; Jovanović, Predrag; Jovanović Vesna Borka; Zakharov, Alexander F.

    2015-01-01

    In this chapter we investigate the possibility to provide theoretical explanation for the observed deviations of S2 star orbit around the Galactic Center using gravitational potentials derived from extended gravity models, but in absence of dark matter. Extended Theories of Gravity are alternative theories of gravitational interaction developed from the exact starting points investigated first by Einstein and Hilbert and aimed from one side to extend the positive results of General Relativity and, on the other hand, to cure its shortcomings. One of the aims of these theories is to explain galactic and extragalactic dynamics without introduction of dark matter. They are based on straightforward generalizations of the Einstein theory where the gravitational action (the Hilbert-Einstein action) is assumed to be linear in the Ricci curvature scalar R. The f(R) gravity is a type of modified gravity which generalizes Einstein's General Relativity, i.e. the simplest case is just the General Relativity. It is actually a family of models, each one defined by a different function of the Ricci scalar. Here, we consider Rn (power-law fourth-order theories of gravity) and Yukawa-like modified gravities in the weak field limit and discuss the constrains on these theories. For that purpose we simulate the orbit of S2 star around the Galactic Center in Rn and Yukawa-like gravity potentials and compare it with New Technology Telescope/Very Large Telescope (NTT/VLT) as well as by Keck telescope observations. Our simulations result in strong constraints on the range of gravity interaction and showed that both Rn and Yukawa gravity could satisfactorily explain the observed orbits of S2 star. However, we concluded that parameters of Rn and Yukawa gravity theories must be very close to those corresponding to the Newtonian limit of the theory. Besides, in contrast to Newtonian gravity, these two modified theories induce orbital precession, even in the case of point-like central mass. The approach we are proposing seems to be sufficiently reliable to constrain the modified gravity models from stellar orbits around Galactic Center.

  2. Does exposure to UV radiation induce a shift to a Th-2-like immune reaction?

    International Nuclear Information System (INIS)

    Ullrich, S.E.

    1996-01-01

    In addition to being the primary cause of skin cancer, UV radiation is immune suppressive and there appears to be a link between the ability of UV to suppress the immune response and induce skin cancer. Cytokines made by UV-irradiated keratinocytes play an essential role in activating immune suppression. In particular, we have found that keratinocyte-derived interleukin (IL)-10 is responsible for the systemic impairment of antigen presenting cell function and the UV-induced suppression of delayed-type hypersenstivity (DTH). Antigen presentation by splenic adherent cells isolated from UV-irradiated mice to T helper-1 type T (Th1) cells is suppressed, whereas antigen presentation to T helper-2 type T (Th2) cells is enhanced. The enhanced antigen presentation to Th2 cells and the impaired presentation to Th1 cells can be reversed in vivo by injecting the UV-irradiated mice with monoclonal anti-IL-10 antibody. Furthermore, immune suppression can be transferred from UV-irradiated mice to normal recipients by adoptive transfer of T cells. Injecting the recipient mice with anti-IL-4 or anti-IL-10 prevents the transfer of immune suppression, suggesting the suppressor cells are Th2 cells. In addition, injecting UV-irradiated mice with IL-12, a cytokine that has been shown to be the primary inducer of Th1 cells, and one that prevents the differentiation of Th2 cells in vivo, reverses UV-induced immune suppression. These findings support the hypothesis that UV exposure activates IL-10 secretion, which depresses the function of Th1 cells, while enhancing the activity of Th2 cells. (Author)

  3. NEDD 4 binding protein 2-like 1 promotes cancer cell invasion in oral squamous cell carcinoma.

    Science.gov (United States)

    Sasahira, Tomonori; Kurihara, Miyako; Nishiguchi, Yukiko; Fujiwara, Rina; Kirita, Tadaaki; Kuniyasu, Hiroki

    2016-08-01

    Head and neck cancer, including oral squamous cell carcinoma, is the sixth most common cancer worldwide. Although cancer cell invasion and metastasis are crucial for tumor progression, detailed molecular mechanisms underlying the invasion and metastasis of oral squamous cell carcinoma are unclear. Comparison of transcriptional profiles using a cDNA microarray demonstrated that N4BP2L1, a novel oncogene expressed by neural precursor cells, is involved in oral squamous cell carcinoma. Expression of N4BP2L1 in oral squamous cell carcinoma is regulated by activation of miR-448 and is higher than in normal oral mucosa. Knockdown of N4BP2L1 and upregulation of miR-448 significantly reduced the invasive potential of oral squamous cell carcinoma cells. We studied N4BP2L1 expression in 187 cases of oral squamous cell carcinoma and found its overexpression to be significantly associated with nodal metastasis (P = 0.0155) and poor prognosis (P = 0.0136). Expression of miR-448 was found to be inversely associated with that of N4BP2L1 (P = 0.0019). Cox proportional hazards analysis identified N4BP2L1 expression as an independent predictor of disease-free survival (P = 0.0349). Our results suggest that N4BP2L1 plays an important role in tumor cell invasion in oral squamous cell carcinoma. Further studies on expression of N4BP2L1 may provide new insight into its function and clarify its potential as biomarker in human oral cancer.

  4. Indomethacin causes prostaglandin D(2)-like and eotaxin-like selective responses in eosinophils and basophils.

    Science.gov (United States)

    Stubbs, Victoria E L; Schratl, Petra; Hartnell, Adele; Williams, Timothy J; Peskar, Bernhard A; Heinemann, Akos; Sabroe, Ian

    2002-07-19

    We investigated the actions of a panel of nonsteroidal anti-inflammatory drugs on eosinophils, basophils, neutrophils, and monocytes. Indomethacin alone was a potent and selective inducer of eosinophil and basophil shape change. In eosinophils, indomethacin induced chemotaxis, CD11b up-regulation, respiratory burst, and L-selectin shedding but did not cause up-regulation of CD63 expression. Pretreatment of eosinophils with indomethacin also enhanced subsequent eosinophil shape change induced by eotaxin, although treatment with higher concentrations of indomethacin resulted in a decrease in the expression of the major eosinophil chemokine receptor, CCR3. Indomethacin activities and cell selectivity closely resembled those of prostaglandin D(2) (PGD(2)). Eosinophil shape change in response to eotaxin was inhibited by pertussis toxin, but indomethacin- and PGD(2)-induced shape change responses were not. Treatment of eosinophils with specific inhibitors of phospholipase C (U-73122), phosphatidylinositol 3-kinase (LY-294002), and p38 mitogen-activated protein kinase (SB-202190) revealed roles for these pathways in indomethacin signaling. Indomethacin and its analogues may therefore provide a structural basis from which selective PGD(2) receptor small molecule antagonists may be designed and which may have utility in the treatment of allergic inflammatory disease.

  5. Activation of 125I-Factor IX and 125I-Factor X: Effect of tissue factor and Factor VII, Factor Xsub(a) and thrombin

    International Nuclear Information System (INIS)

    Oesterud, B.; Rapaport, S.I.

    Activation of Factor IX and Factor X was studied by adding 125 I-Factor IX or 125 I-Factor X to reaction mixtures and quantitating cleavage products by reduced sodium dodecylsulfate gel electrophoresis. Thrombin failed to activate Factors IX or X; Factor Xsub(a) produced insignificant amounts of cleavage products of both factors. In contrast, the reaction product of tissue factor and Factor VII cleaved large amounts of both Factor IX and Factor X in purified systems and in plasma. In incubation mixtures of plasma containing added 125 I-Factor IX or 125 I-Factor X, tissue factor and Ca 2+ ions, the percentage of total radioactivity in the heavy chain peak of 125 I-IXsub(a) and the heavy chain of 125 I-Xsub(a) increased at a similar rate. When the tissue factor was diluted, similar curves were obtained for percent cleavage of 125 I-Factor IX and percent cleavage of 125 I-Factor X plotted against tissue factor concentration. These findings support the hypothesis that activation of Factor IX by the tissue factor-Factor VII reaction product represents a physiologically significant step in normal haemostasis. (author)

  6. Psychosomatic factors in pruritus.

    Science.gov (United States)

    Tey, Hong Liang; Wallengren, Joanna; Yosipovitch, Gil

    2013-01-01

    Pruritus and psyche are intricately and reciprocally related, with psychophysiological evidence and psychopathological explanations helping us to understand their complex association. Their interaction may be conceptualized and classified into 3 groups: pruritic diseases with psychiatric sequelae, pruritic diseases aggravated by psychosocial factors, and psychiatric disorders causing pruritus. Management of chronic pruritus is directed at treating the underlying causes and adopting a multidisciplinary approach to address the dermatologic, somatosensory, cognitive, and emotional aspects. Pharmcotherapeutic agents that are useful for chronic pruritus with comorbid depression and/or anxiety comprise selective serotonin reuptake inhibitors, mirtazapine, tricyclic antidepressants (amitriptyline and doxepin), and anticonvulsants (gabapentin, pregabalin); the role of neurokinin receptor-1 antagonists awaits verification. Antipsychotics are required for treating itch and formication associated with schizophrenia and delusion of parasitosis (including Morgellons disease). Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Factorization of Observables

    Science.gov (United States)

    Eliaš, Peter; Frič, Roman

    2017-12-01

    Categorical approach to probability leads to better understanding of basic notions and constructions in generalized (fuzzy, operational, quantum) probability, where observables—dual notions to generalized random variables (statistical maps)—play a major role. First, to avoid inconsistencies, we introduce three categories L, S, and P, the objects and morphisms of which correspond to basic notions of fuzzy probability theory and operational probability theory, and describe their relationships. To illustrate the advantages of categorical approach, we show that two categorical constructions involving observables (related to the representation of generalized random variables via products, or smearing of sharp observables, respectively) can be described as factorizing a morphism into composition of two morphisms having desired properties. We close with a remark concerning products.

  8. Functional Maximum Autocorrelation Factors

    DEFF Research Database (Denmark)

    Larsen, Rasmus; Nielsen, Allan Aasbjerg

    2005-01-01

    MAF outperforms the functional PCA in concentrating the interesting' spectra/shape variation in one end of the eigenvalue spectrum and allows for easier interpretation of effects. Conclusions. Functional MAF analysis is a useful methods for extracting low dimensional models of temporally or spatially......Purpose. We aim at data where samples of an underlying function are observed in a spatial or temporal layout. Examples of underlying functions are reflectance spectra and biological shapes. We apply functional models based on smoothing splines and generalize the functional PCA in......\\verb+~+\\$\\backslash\\$cite{ramsay97} to functional maximum autocorrelation factors (MAF)\\verb+~+\\$\\backslash\\$cite{switzer85,larsen2001d}. We apply the method to biological shapes as well as reflectance spectra. {\\$\\backslash\\$bf Methods}. MAF seeks linear combination of the original variables that maximize autocorrelation between...

  9. Pion form factor

    Energy Technology Data Exchange (ETDEWEB)

    Ryong Ji, C.; Pang, A.; Szczepaniak, A. [North Carolina State Univ., Raleigh, NC (United States)

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  10. Eukaryotic transcription factors

    DEFF Research Database (Denmark)

    Staby, Lasse; O'Shea, Charlotte; Willemoës, Martin

    2017-01-01

    Gene-specific transcription factors (TFs) are key regulatory components of signaling pathways, controlling, for example, cell growth, development, and stress responses. Their biological functions are determined by their molecular structures, as exemplified by their structured DNA-binding domains...... regions with function-related, short sequence motifs and molecular recognition features with structural propensities. This review focuses on molecular aspects of TFs, which represent paradigms of ID-related features. Through specific examples, we review how the ID-associated flexibility of TFs enables....... It is furthermore emphasized how classic biochemical concepts like allostery, conformational selection, induced fit, and feedback regulation are undergoing a revival with the appreciation of ID. The review also describes the most recent advances based on computational simulations of ID-based interaction mechanisms...

  11. Nucleon Electromagnetic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi

    2007-10-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  12. Wave friction factor rediscovered

    Science.gov (United States)

    Le Roux, J. P.

    2012-02-01

    The wave friction factor is commonly expressed as a function of the horizontal water particle semi-excursion ( A wb) at the top of the boundary layer. A wb, in turn, is normally derived from linear wave theory by {{U_{{wb}}/T_{{w}}}}{{2π }} , where U wb is the maximum water particle velocity measured at the top of the boundary layer and T w is the wave period. However, it is shown here that A wb determined in this way deviates drastically from its real value under both linear and non-linear waves. Three equations for smooth, transitional and rough boundary conditions, respectively, are proposed to solve this problem, all three being a function of U wb, T w, and δ, the thickness of the boundary layer. Because these variables can be determined theoretically for any bottom slope and water depth using the deepwater wave conditions, there is no need to physically measure them. Although differing substantially from many modern attempts to define the wave friction factor, the results coincide with equations proposed in the 1960s for either smooth or rough boundary conditions. The findings also confirm that the long-held notion of circular water particle motion down to the bottom in deepwater conditions is erroneous, the motion in fact being circular at the surface and elliptical at depth in both deep and shallow water conditions, with only horizontal motion at the top of the boundary layer. The new equations are incorporated in an updated version (WAVECALC II) of the Excel program published earlier in this journal by Le Roux et al. Geo-Mar Lett 30(5): 549-560, (2010).

  13. [The Steel factor].

    Science.gov (United States)

    Cáceres-Cortés, J R

    1997-01-01

    Mice bearing mutations at either of two loci, dominant White spotting(W) or Steel(Sl), exhibit development defects in hematopoietic, melanocytic and germ cells. Genetics studies have shown that the SI locus encodes the Steel factor (SF), which is the ligand for the tyrosine kinase receptor c-kit, the product of the W locus. SF is synthesized in membrane-bound form and can be processed to produce a soluble form. Cell-cell interaction is important in the production of normal blood cells in vivo and in vitro and in the cellular expansion of leukemic cells. We discuss here how SF decreases the requirements in cell interaction for blast colony formation in acute myeloblastic leukemia (AML) and the presence of membrane-bound SF possibly contributes to the density-dependent growth of the AML blasts. We explain that SF is mainly a survival factor for hematopoietic cells, of little proliferative effect, which maintains CD34+ hematopoietic cells in an undifferentiated state. These properties would potentially allow the maintenance of hematopoietic cells in culture for the purpose of marrow purging or gene therapy. The activation of the c-kit signal transduction pathway may play a significant role in the development of many types of non-hematological malignancies by disrupting normal cell-cell interactions and allowing the growth of cancer cell populations. In summary, the properties of the SF indicate it has a role for survival signals during the process of normal differentiation, AML proliferation and in the maintenance of many c-kit+ tumors.

  14. Neutron quality factor

    International Nuclear Information System (INIS)

    1995-06-01

    Both the International Commission on Radiological Protection (ICRP) and the National Council on Radiation Protection and Measurements (NCRP) have recommended that the radiation quality weighting factor for neutrons (Q n , or the corresponding new modifying factor, w R ) be increased by a value of two for most radiation protection practices. This means an increase in the recommended value for Q n from a nominal value of 10 to a nominal value of 20. This increase may be interpreted to mean that the biological effectiveness of neutrons is two times greater than previously thought. A decision to increase the value of Q n will have a major impact on the regulations and radiation protection programs of Federal agencies responsible for the protection of radiation workers. Therefore, the purposes of this report are: (1) to examine the general concept of open-quotes quality factorclose quotes (Q) in radiation protection and the rationale for the selection of specific values of Q n ; and (2) to make such recommendations to the Federal agencies, as appropriate. This report is not intended to be an exhaustive review of the scientific literature on the biological effects of neutrons, with the aim of defending a particular value for Q n . Rather, the working group examined the technical issues surrounding the current recommendations of scientific advisory bodies on this matter, with the aim of determining if these recommendations should be adopted by the Federal agencies. Ultimately, the group concluded that there was no compelling basis for a change in Q n . The report was prepared by Federal scientists working under the auspices of the Science Panel of the Committee on Interagency Radiation Research and Policy Coordination (CIRRPC)

  15. Factorization and non-factorization in diffractive hard scattering

    International Nuclear Information System (INIS)

    Berera, Arjun

    1997-01-01

    Factorization, in the sense defined for inclusive hard scattering, is discussed for diffractive hard scattering. A factorization theorem similar to its inclusive counterpart is presented for diffractive DIS. For hadron-hadron diffractive hard scattering, in contrast to its inclusive counterpart, the expected breakdown of factorization is discussed. Cross section estimates are given from a simple field theory model for non-factorizing double-pomeron-exchange (DPE) dijet production with and without account for Sudakov suppression

  16. Robust and Sparse Factor Modelling

    DEFF Research Database (Denmark)

    Croux, Christophe; Exterkate, Peter

    Factor construction methods are widely used to summarize a large panel of variables by means of a relatively small number of representative factors. We propose a novel factor construction procedure that enjoys the properties of robustness to outliers and of sparsity; that is, having relatively few...... nonzero factor loadings. Compared to the traditional factor construction method, we find that this procedure leads to a favorable forecasting performance in the presence of outliers and to better interpretable factors. We investigate the performance of the method in a Monte Carlo experiment...

  17. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  18. External Factors, Internal Factors and Self-Directed Learning Readiness

    Science.gov (United States)

    Ramli, Nurjannah; Muljono, Pudji; Afendi, Farit M.

    2018-01-01

    There are many factors which affect the level of self-directed learning readiness. This study aims to investigate the relationship between external factors, internal factors and self-directed learning readiness. This study was carried out by using a census method for fourth year students of medical program of Tadulako University. Data were…

  19. Electromagnetic Hadronic Form-Factors

    International Nuclear Information System (INIS)

    Edwards, Robert G.

    2005-01-01

    We present a calculation of the nucleon electromagnetic form-factors as well as the pion and rho to pion transition form-factors in a hybrid calculation with domain wall valence quarks and improved staggered (Asqtad) sea quarks

  20. R-Factor for Alaska

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The rainfall-runoff erosivity factor (R-Factor) quantifies the effects of raindrop impacts and reflects the amount and rate of runoff associated with the rain. The...

  1. Air Emissions Factors and Quantification

    Science.gov (United States)

    Emissions factors are used in developing air emissions inventories for air quality management decisions and in developing emissions control strategies. This area provides technical information on and support for the use of emissions factors.

  2. Integrated Factors Correlating Undergraduate Academic ...

    African Journals Online (AJOL)

    Integrated Factors Correlating Undergraduate Academic Achievement in Bayelsa State, Nigeria. ... AFRREV IJAH: An International Journal of Arts and Humanities ... Thus, it is study investigated the integrated factors determining academic performance of students in public secondary schools in Bayelsa State, Nigeria.

  3. Human Factors in Training

    Science.gov (United States)

    Barshi, Immanuel; Byrne, Vicky; Arsintescu, Lucia; Connell, Erin

    2010-01-01

    Future space missions will be significantly longer than current shuttle missions and new systems will be more complex than current systems. Increasing communication delays between crews and Earth-based support means that astronauts need to be prepared to handle the unexpected on their own. As crews become more autonomous, their potential span of control and required expertise must grow to match their autonomy. It is not possible to train for every eventuality ahead of time on the ground, or to maintain trained skills across long intervals of disuse. To adequately prepare NASA personnel for these challenges, new training approaches, methodologies, and tools are required. This research project aims at developing these training capabilities. By researching established training principles, examining future needs, and by using current practices in space flight training as test beds, both in Flight Controller and Crew Medical domains, this research project is mitigating program risks and generating templates and requirements to meet future training needs. Training efforts in Fiscal Year 09 (FY09) strongly focused on crew medical training, but also began exploring how Space Flight Resource Management training for Mission Operations Directorate (MOD) Flight Controllers could be integrated with systems training for optimal Mission Control Center (MCC) operations. The Training Task addresses Program risks that lie at the intersection of the following three risks identified by the Project: 1) Risk associated with poor task design; 2) Risk of error due to inadequate information; and 3) Risk associated with reduced safety and efficiency due to poor human factors design.

  4. Self-shielding factors

    International Nuclear Information System (INIS)

    Kaul, D.C.

    1982-01-01

    Throughout the last two decades many efforts have been made to estimate the effect of body self-shielding on organ doses from externally incident neutrons and gamma rays. These began with the use of simple geometry phantoms and have culminated in the use of detailed anthropomorphic phantoms. In a recent effort, adjoint Monte Carlo analysis techniques have been used to determine dose and dose equivalent to the active marrow as a function of energy and angle of neutron fluence externally incident on an anthropomorphic phantom. When combined with fluences from actual nuclear devices, these dose-to-fluence factors result in marrow dose values that demonstrate great sensitivity to variations in device type, range, and body orientation. Under a state-of-the-art radiation transport analysis demonstration program for the Japanese cities, sponsored by the Defense Nuclear Agency at the request of the National Council on Radiation Protection and Measurements, the marrow dose study referred to above is being repeated to obtain spectral distributions within the marrow for externally incident neutrons and gamma rays of arbitrary energy and angle. This is intended to allow radiobiologists and epidemiologists to select and to modify numbers of merit for correlation with health effects and to permit a greater understanding of the relationship between human and laboratory subject dosimetry

  5. Research organizational factors

    International Nuclear Information System (INIS)

    Coffman, F.D. Jr.

    1990-01-01

    Organizational processes at nuclear power plants should be sufficient to prevent accidents and to protect public health and safety upon the occurrence of an accident. The role of regulatory research is to confirm that agency assessments of organization processes are on a firm technical basis and provide for improvements in the NRC [Nuclear Regulatory Commission] programs. A firm technical basis is achieved by reducing uncertainties associated with methods and measures used to assess organization processes. The general objective for regulatory research is to confirm that the agency has a coherent understanding of the organizational processes that are individually necessary and are collectively sufficient for safe operations, methods are available to reliably characterize organizational processes, and measures exist to monitor changes in the key organizational processes. The first specific objective was to develop a method to translate organizational processes into PRAs. The discussion provides feedback and insights from experience with the past and the ongoing organizational factors research. That experience suggests a set of ingredients that appear proper for performing regulatory research on organizational processes. By keeping focused upon these proper ingredients, the research will contribute to the regulatory assessments of utility management through the use of improved methods and measures in investigations, inspections, diagnostics, performance indicators, and PRA insights

  6. BASIC FACTORS OF MARKET CONCENTRATION

    OpenAIRE

    V. Fyliuk

    2013-01-01

    The paper systemizes factors which reinforce trends towards market concentration in all economic systems. These factors include factors related to the general changes in economic environment such as globalization of the world economy, state structural and taxation policies, cycle of economic development and changes in consumer demand. They also include factors related to competition (intensification of competition, companies’ desire to monopolize market and present market structure) and scien...

  7. Human Factors in Marine Casualties

    Directory of Open Access Journals (Sweden)

    Jelenko Švetak

    2002-05-01

    Full Text Available Human factors play an important role in the origin of accidents,and it is commonly claimed that between seventy andninety-five percent of industrial and transport accidents involvehuman factors, see Figure 1.Some authorities, however, claim that ultimately, all accidentsinvolve human factors.

  8. Risks factoring business: accounting measurement

    Directory of Open Access Journals (Sweden)

    Z.V. Gutsaylyuk

    2015-06-01

    Full Text Available The paper carried out the identification of risk factors for the development of possible accounting software management. Studied theoretical and methodological aspects of the risk classification of factoring operations in the part of the risk assessment factors. It is proposed to consider the risks factors as the risk that is acceptable controlled by accounting instruments and the risks that can not be taken into account in the accounting records. To minimize the risk factor, accounting-driven tools, a method of self-insurance, which is a factor in the creation of provision for factoring transactions designed to cover unexpected expenses and losses. Provision for factoring factor will establish more stable conditions of financial activity and avoid the fluctuations of profit factor in relation to the writing off of losses on factoring operatsіyam.Developed proposals allow for further research to improve the organizational and methodological basis of accounting and analysis of information as a basis for providing risk management factor, particularly in terms of improving the evaluation questions such risks and their qualitative and quantitative analysis.

  9. Investing in systematic factor premiums

    NARCIS (Netherlands)

    Koedijk, Kees G.; Slager, Alfred M. H.; Stork, P.A.

    In this paper we investigate and evaluate factor investing in the US and Europe for equities and bonds. We show that factor-based portfolios generally produce comparable or better portfolios than market indices. We expand the analysis to other asset classes and factors, work with other optimisation

  10. Sparse and Robust Factor Modelling

    NARCIS (Netherlands)

    C. Croux (Christophe); P. Exterkate (Peter)

    2011-01-01

    textabstractFactor construction methods are widely used to summarize a large panel of variables by means of a relatively small number of representative factors. We propose a novel factor construction procedure that enjoys the properties of robustness to outliers and of sparsity; that is, having

  11. Risk Factor Assessment Branch (RFAB)

    Science.gov (United States)

    The Risk Factor Assessment Branch (RFAB) focuses on the development, evaluation, and dissemination of high-quality risk factor metrics, methods, tools, technologies, and resources for use across the cancer research continuum, and the assessment of cancer-related risk factors in the population.

  12. Geriatic Disability Related Factors

    Directory of Open Access Journals (Sweden)

    Mohsen Adib Hajbagheri

    2008-07-01

    Full Text Available Objectives: Reports are indicating of increasing trend of aging and disability in the developing countries while such disabilities are decreasing within the developed countries. This study designed to evaluate the disability and some of its related factors among the elderly population (65 and older in Kashan, Iran. Methods & Materials: A cross-sectional analytical study was conducted on a multi-stage random sample of 350 elderly people (65 year and older in Kashan. The WHO-DAS-II was used as the generic disability measure. The questionnair had 48 questions. The range of score could be between 0-144. Chi-square, t-test analysis and ANOVA were utilized to check significant differences between subgroups. Results: 61% were men and 12% were living lonely. One fourth had some type of addiction, the majority were ilitrate and two thired had not regular phisycal activity.Twenty percent of the old people had a modereate disability and 4.3% were extremely disabled. A significant relationship was found between the disability and variables such as sex, age, living style, needing help, marriage status, living location, addiction, job, level of physical activity, education, and having multiple diseases. Conclusion: In conclusion, geriatric population in Iran, has a lower levels of disability in compare to those of other developed countries. Need of geriatric cares must be be increasing, since the populationpattern of elderly people is increasing in Iran. Female and ilitrate elders were sufering of more disability. These findings indicated the nessesity to more attention to these voulnarable subgroups of population.

  13. Gut transfer factors

    International Nuclear Information System (INIS)

    1990-01-01

    A Nuclear Energy Agency (NEA) Expert Group has proposed values for the absorbed fractions (f 1 values) of radionuclides ingested in food and drinking water by members of the public. The f 1 values for adults, which are also taken to apply to children from 1 year of age, are increased from those given in ICRP Publication 30 for occupationally exposed adults for 7 elements out of the 31 considered. Since the publication of the NEA report, further information has become available that is relevant to the choice of f 1 values for polonium and thorium. These data suggest that for the present the f 1 value for polonium currently recommended by ICRP (0.1) should be retained, and that for thorium a reasonable f 1 value is 0.0005. With these exceptions, the NRPB endorses the revisions in f 1 values proposed by the NEA Expert Group for adults and children from 1 year of age. Higher f 1 values are proposed by the NEA expert Group for absorption in the first year of life. For adult values of between 0.01 and 0.5, an increase by a factor of two is assumed, and for adult values of 0.001 or less, absorption by infants is taken to be ten times greater. This approach is consistent with, and extends, that applied to the actinides in ICRP Publication 48 and represents a reasonable interpretation of current evidence. The NRPB therefore endorses the approach proposed by the NEA Expert Group for the calculation of doses to infants. (author)

  14. Factors Affecting Medical Service Quality.

    Science.gov (United States)

    Mosadeghrad, Ali Mohammad

    2014-02-01

    A better understanding of factors influencing quality of medical service can pinpoint better strategies for quality assurance in medical services. This study aimed to identify factors affecting the quality of medical services provided by Iranian physicians. Exploratory in-depth individual interviews were conducted with sixty-four physicians working in various medical institutions in Iran. Individual, organizational and environmental factors enhance or inhibit the quality of medical services. Quality of medical services depends on the personal factors of the physician and patient, and factors pertaining to the healthcare setting and the broader environment. Differences in internal and external factors such as availability of resources, patient cooperation and collaboration among providers affect the quality of medical services and patient outcomes. Supportive leadership, proper planning, education and training and effective management of resources and processes improve the quality of medical services. This article contributes to healthcare theory and practice by developing a conceptual framework for understanding factors that influence medical services quality.

  15. Prognostic factors of breast cancer

    International Nuclear Information System (INIS)

    Gonzalez Ortega, Jose Maria; Morales Wong, Mario Miguel; Lopez Cuevas, Zoraida; Diaz Valdez, Marilin

    2011-01-01

    The prognostic factors must to be differentiated of the predictive ones. A prognostic factor is any measurement used at moment of the surgery correlated with the free interval of disease or global survival in the absence of the systemic adjuvant treatment and as result is able to correlate with the natural history of the disease. In contrast, a predictive factor is any measurement associated with the response to a given treatment. Among the prognostic factors of the breast cancer are included the clinical, histological, biological, genetic and psychosocial factors. In present review of psychosocial prognostic factors has been demonstrated that the stress and the depression are negative prognostic factors in patients presenting with breast cancer. It is essential to remember that the assessment of just one prognostic parameter is a help but it is not useful to clinical and therapeutic management of the patient.(author)

  16. The population factor.

    Science.gov (United States)

    Kats, G

    1983-01-01

    Reducing population growth is essentil to Egypt's broader efforts to improve facilities, services, and the phsycial quality of life. Although a family planning program has existed since the mid-1950s, the 2.7% annual rate of population growth has not changed in 30 years. Nasser and the other "free officers" who seized power in 1952 became concerned about the adverse effects of the rapidly growing population, but perhaps out of concern with a possible religious backlash, they confined themselves to launching studies and subsidizing several dozen private family planning clinics. From 1962-72, the number of private clinics grew from 28 to 480, and family planning was introduced in government healthclinics in 1965. Such clinics are mainly located in rural areas and are staffed by doctors and other personnel who are not members of the local community and are not very effective at promoting family planning. Local girls and women called Rayadet were recruited to promote the idea to birth control in local communities. By 1970, 12.6% of Egyptians were using reliable contraception. A national survey 12 years later found 34% using contraception, buth the figure seems high. Approximately 60-65% of eligible couples would need to practice birth control for Egypt to reach a less than 1% annuel increase. The Egyptian government hopes to slow population growth to 1% by the year 2000, but major problems of motivation remain especially among the rural poor. Several factors may lead to success of the family planning effort: 1) financial and technical support from international family planning sources has grown rapidley and is likely to remain high; 2) the mortality rate has dropped from 17.8/1000 in 1952 to about half that level, while the rate of natural increase is about the same, suggesting that future reductions in the birth rate will translate to a reduced rate of natural increase, and that parents will be less reluctant to practice faimly planning if there is a greater chance

  17. A factor analysis to detect factors influencing building national brand

    Directory of Open Access Journals (Sweden)

    Naser Azad

    Full Text Available Developing a national brand is one of the most important issues for development of a brand. In this study, we present factor analysis to detect the most important factors in building a national brand. The proposed study uses factor analysis to extract the most influencing factors and the sample size has been chosen from two major auto makers in Iran called Iran Khodro and Saipa. The questionnaire was designed in Likert scale and distributed among 235 experts. Cronbach alpha is calculated as 84%, which is well above the minimum desirable limit of 0.70. The implementation of factor analysis provides six factors including “cultural image of customers”, “exciting characteristics”, “competitive pricing strategies”, “perception image” and “previous perceptions”.

  18. Risk factors for stress fractures.

    Science.gov (United States)

    Bennell, K; Matheson, G; Meeuwisse, W; Brukner, P

    1999-08-01

    Preventing stress fractures requires knowledge of the risk factors that predispose to this injury. The aetiology of stress fractures is multifactorial, but methodological limitations and expediency often lead to research study designs that evaluate individual risk factors. Intrinsic risk factors include mechanical factors such as bone density, skeletal alignment and body size and composition, physiological factors such as bone turnover rate, flexibility, and muscular strength and endurance, as well as hormonal and nutritional factors. Extrinsic risk factors include mechanical factors such as surface, footwear and external loading as well as physical training parameters. Psychological traits may also play a role in increasing stress fracture risk. Equally important to these types of analyses of individual risk factors is the integration of information to produce a composite picture of risk. The purpose of this paper is to critically appraise the existing literature by evaluating study design and quality, in order to provide a current synopsis of the known scientific information related to stress fracture risk factors. The literature is not fully complete with well conducted studies on this topic, but a great deal of information has accumulated over the past 20 years. Although stress fractures result from repeated loading, the exact contribution of training factors (volume, intensity, surface) has not been clearly established. From what we do know, menstrual disturbances, caloric restriction, lower bone density, muscle weakness and leg length differences are risk factors for stress fracture. Other time-honoured risk factors such as lower extremity alignment have not been shown to be causative even though anecdotal evidence indicates they are likely to play an important role in stress fracture pathogenesis.

  19. Human factor H-related protein 2 (CFHR2 regulates complement activation.

    Directory of Open Access Journals (Sweden)

    Hannes U Eberhardt

    Full Text Available Mutations and deletions within the human CFHR gene cluster on chromosome 1 are associated with diseases, such as dense deposit disease, CFHR nephropathy or age-related macular degeneration. Resulting mutant CFHR proteins can affect complement regulation. Here we identify human CFHR2 as a novel alternative pathway complement regulator that inhibits the C3 alternative pathway convertase and terminal pathway assembly. CFHR2 is composed of four short consensus repeat domains (SCRs. Two CFHR2 molecules form a dimer through their N-terminal SCRs, and each of the two C-terminal ends can bind C3b. C3b bound CFHR2 still allows C3 convertase formation but the CFHR2 bound convertases do not cleave the substrate C3. Interestingly CFHR2 hardly competes off factor H from C3b. Thus CFHR2 likely acts in concert with factor H, as CFHR2 inhibits convertases while simultaneously allowing factor H assisted degradation by factor I.

  20. [Predictive factors of anxiety disorders].

    Science.gov (United States)

    Domschke, K

    2014-10-01

    Anxiety disorders are among the most frequent mental disorders in Europe (12-month prevalence 14%) and impose a high socioeconomic burden. The pathogenesis of anxiety disorders is complex with an interaction of biological, environmental and psychosocial factors contributing to the overall disease risk (diathesis-stress model). In this article, risk factors for anxiety disorders will be presented on several levels, e.g. genetic factors, environmental factors, gene-environment interactions, epigenetic mechanisms, neuronal networks ("brain fear circuit"), psychophysiological factors (e.g. startle response and CO2 sensitivity) and dimensional/subclinical phenotypes of anxiety (e.g. anxiety sensitivity and behavioral inhibition), and critically discussed regarding their potential predictive value. The identification of factors predictive of anxiety disorders will possibly allow for effective preventive measures or early treatment interventions, respectively, and reduce the individual patient's suffering as well as the overall socioeconomic burden of anxiety disorders.

  1. Factor of originality in advertising

    OpenAIRE

    Ešner, Rudolf

    2009-01-01

    The bachelor thesis deals with exploitation of original attitudes in advertising. The thesis solves answers, what role plays the factor of originality in advertising, when and why firms use that factor, how creators work with it, how consumers perceive the factor and what other elements it generally contains. The bachelor thesis qualifies relationship of advertising and originality, describes and probes practical situations, when originality in advertising can be used as a serious competitive...

  2. Risk factors in school shootings.

    Science.gov (United States)

    Verlinden, S; Hersen, M; Thomas, J

    2000-01-01

    Nine incidents of multiple-victim homicide in American secondary schools are examined and common risk factors are identified. The literature dealing with individual, family, social, societal, and situational risk factors for youth violence and aggression is reviewed along with existing risk assessment methods. Checklists of risk factors for serious youth violence and school violence are used in reviewing each school shooting case. Commonalties among the cases and implications for psychologists practicing in clinical and school settings are discussed.

  3. First course in factor analysis

    CERN Document Server

    Comrey, Andrew L

    2013-01-01

    The goal of this book is to foster a basic understanding of factor analytic techniques so that readers can use them in their own research and critically evaluate their use by other researchers. Both the underlying theory and correct application are emphasized. The theory is presented through the mathematical basis of the most common factor analytic models and several methods used in factor analysis. On the application side, considerable attention is given to the extraction problem, the rotation problem, and the interpretation of factor analytic results. Hence, readers are given a background of

  4. Summable series and convergence factors

    CERN Document Server

    Moore, Charles N

    1938-01-01

    Fairly early in the development of the theory of summability of divergent series, the concept of convergence factors was recognized as of fundamental importance in the subject. One of the pioneers in this field was C. N. Moore, the author of the book under review.... Moore classifies convergence factors into two types. In type I he places the factors which have only the property that they preserve convergence for a convergent series or produce convergence for a summable series. In type II he places the factors which not only maintain or produce convergence but have the additional property that

  5. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  6. Factorization method of quadratic template

    Science.gov (United States)

    Kotyrba, Martin

    2017-07-01

    Multiplication of two numbers is a one-way function in mathematics. Any attempt to distribute the outcome to its roots is called factorization. There are many methods such as Fermat's factorization, Dixońs method or quadratic sieve and GNFS, which use sophisticated techniques fast factorization. All the above methods use the same basic formula differing only in its use. This article discusses a newly designed factorization method. Effective implementation of this method in programs is not important, it only represents and clearly defines its properties.

  7. Social networks and factor markets

    DEFF Research Database (Denmark)

    Abay, Kibrom Araya; Kahsay, Goytom Abraha; Berhane, Guush

    In the absence of well-established factor markets, the role of indigenous institutions and social networks can be substantial for mobilizing factors for agricultural production. We investigate the role of an indigenous social network in Ethiopia, the iddir, in facilitating factor market...... transactions among smallholder farmers. Using detailed longitudinal household survey data and employing a difference-in-differences approach, we find that iddir membership improves households’ access to factor markets. Specifically, we find that joining an iddir network improves households’ access to land...

  8. FACTORING- CREDIT OPPORTUNITIES IN ROMANIA

    Directory of Open Access Journals (Sweden)

    ADELA IONESCU

    2013-05-01

    Full Text Available Capital is the main factor of production, business development becomes virtually impossible without taking into account the financial market and the resources it provides to businesses. Any business, regardless of its degree of development, is involving direct contact with financial markets, namely the institutions that mediate mobilization of capital and the services they provide. Understanding the functioning of the financial system, the specific financial mechanisms through which savings are allocated to support capital investments and the costs and risks involved is essential for the development of a solid base for business. In this context, factoring operations can support economic agents, allowing a transfer of commercial receivables from their holder to a factor who commits to their recovery and guarantee such operations even if temporary or permanent insolvency of the debtor . Thus, factoring is a complex technique in at least two aspects, of the debt and the transfer of credit. . Factoring is a means of financing business, especially export-import transactions, less known in Romania. Maybe because of poor business environment popularize the term is as little known as it was a few years ago the leasing. Present in Romanian legislation since 2002, factoring appears as a contract between one party (called adherent, providing goods or service and a banking company or a financial institution specialized (called factor, which the last one shall finance debts pursuing and preservation against credit risks and adherent gives factor by way of sale, debts arising from the sale of goods or services to third parties. The article is divided into three parts. In the first part we defined the concept of factoring and international factoring, then I presented the advantages and development of factoring in Romania, and the last part conclusions.

  9. Activation of factor VII bound to tissue factor: a key early step in the tissue factor pathway of blood coagulation.

    OpenAIRE

    Rao, L V; Rapaport, S I

    1988-01-01

    Whether the factor VII/tissue factor complex that forms in tissue factor-dependent blood coagulation must be activated to factor VIIa/tissue factor before it can activate its substrates, factor X and factor IX, has been a difficult question to answer because the substrates, once activated, back-activate factor VII. Our earlier studies suggested that human factor VII/tissue factor cannot activate factor IX. Studies have now been extended to the activation of factor X. Reaction mixtures were ma...

  10. Activation of factor VII bound to tissue factor: A key early step in the tissue factor pathway of blood coagulation

    International Nuclear Information System (INIS)

    Rao, L.V.M.; Rapaport, S.I.

    1988-01-01

    Whether the factor VII/tissue factor complex that forms in tissue factor-dependent blood coagulation must be activated to factor VIIa/tissue factor before it can activate its substrates, factor X and IX, has been a difficult question to answer because the substrates, once activated, back-activate factor VII. The earlier studies suggested that human factor VII/tissue factor cannot activate factor IX. Studies have now been extended to the activation of factor X. Reaction mixtures were made with purified factor VII, X, and tissue factor; in some experiments antithrombin III and heparin were added to prevent back-activation of factor VII. Factor X was activated at similar rates in reaction mixtures containing either VII or factor VIIa after an initial 30-sec lag with factor VII. In reaction mixtures with factor VII a linear activation of factor X was established several minutes before cleavage of 125 I-labeled factor VII to the two-chain activated molecule was demonstrable on gel profiles. These data suggest that factor VII/tissue factor cannot activate measurable amounts of factor X over several minutes. Overall, the results support the hypothesis that a rapid preferential activation of factor VII bound to tissue factor by trace amounts of factor Xa is a key early step in tissue factor-dependent blood coagulation

  11. Factors of trade in Europe

    Czech Academy of Sciences Publication Activity Database

    Hanousek, Jan; Kočenda, Evžen

    2014-01-01

    Roč. 38, č. 4 (2014), s. 518-535 ISSN 0939-3625 R&D Projects: GA ČR(CZ) GAP403/12/0080 Grant - others:UK(CZ) UNCE 204005/2012 Institutional support: PRVOUK-P23 Keywords : bilateral trade * factors of trade * panel data Subject RIV: AH - Economics Impact factor: 0.649, year: 2014

  12. Quadratic prediction of factor scores

    NARCIS (Netherlands)

    Wansbeek, T

    1999-01-01

    Factor scores are naturally predicted by means of their conditional expectation given the indicators y. Under normality this expectation is linear in y but in general it is an unknown function of y. II is discussed that under nonnormality factor scores can be more precisely predicted by a quadratic

  13. Hidden Risk Factors for Women

    Science.gov (United States)

    ... A.S.T. Quiz Hidden Stroke Risk Factors for Women Updated:Nov 22,2016 Excerpted from "What Women Need To Know About The Hidden Risk Factors ... 2012) This year, more than 100,000 U.S. women under 65 will have a stroke. Stroke is ...

  14. Factor analysis of multivariate data

    Digital Repository Service at National Institute of Oceanography (India)

    Fernandes, A.A.; Mahadevan, R.

    A brief introduction to factor analysis is presented. A FORTRAN program, which can perform the Q-mode and R-mode factor analysis and the singular value decomposition of a given data matrix is presented in Appendix B. This computer program, uses...

  15. Pineal factors other than melatonin

    NARCIS (Netherlands)

    Ebels, I.

    Some sheep pineal factors other than melatonin are described. A “nonmelatonin” antigonadotropic activity has been detected by application of the inhibition of compensatory ovarian hypertrophy (COH) in unilaterally ovariectomized adult Charles River CD-1 mice. The factor has been extracted from

  16. Stroke Risk Factors and Symptoms

    Science.gov (United States)

    ... » [ pdf, 433 kb ] Order Materials » Stroke Risk Factors and Symptoms Risk Factors for a Stroke Stroke prevention is still ... it. Treatment can delay complications that increase the risk of stroke. Transient ischemic attacks (TIAs). Seek help. ...

  17. Electromagnetic form factors of hadrons

    International Nuclear Information System (INIS)

    Zidell, V.S.

    1976-01-01

    A vector meson dominance model of the electromagnetic form factors of hadrons is developed which is based on the use of unstable particle propagators. Least-square fits are made to the proton, neutron, pion and kaon form factor data in both the space and time-like regions. A good fit to the low-energy nucleon form factor data is obtained using only rho, ω, and phi dominance, and leads to a determination of the vector meson resonance parameters in good agreement with experiment. The nucleon-vector meson coupling constants obey simple sum rules indicating that there exists no hard core contribution to the form factors within theoretical uncertainties. The prediction for the electromagnetic radii of the proton is in reasonable agreement with recent experiments. The pion and kaon charge form factors as deduced from the nucleon form factors assuming vector meson universality are compared to the data. The pion form factor agrees with the data in both the space and time-like regions. The pion charge radius is in agreement with the recent Dubna result, but the isovector P-wave pion-pion phase shift calculated from the theory disagrees with experiment. A possible contribution to the form factors from a heavy rho meson is also evaluated

  18. Shell model and spectroscopic factors

    International Nuclear Information System (INIS)

    Poves, P.

    2007-01-01

    In these lectures, I introduce the notion of spectroscopic factor in the shell model context. A brief review is given of the present status of the large scale applications of the Interacting Shell Model. The spectroscopic factors and the spectroscopic strength are discussed for nuclei in the vicinity of magic closures and for deformed nuclei. (author)

  19. EAMJ Risk Factors 10.indd

    African Journals Online (AJOL)

    2010-02-02

    Feb 2, 2010 ... Several factors have been suggested as independent risk factors for their development. Identification of these ... with age, gender or haematological test. ... A meta-analysis of prospective studies on ..... The marked difference may be because monthly .... and dyslipidemia among patients taking first-line,.

  20. Factors That Shape Design Thinking

    Science.gov (United States)

    Gray, Colin M.

    2013-01-01

    A wide range of design literature discusses the role of the studio and its related pedagogy in the development of design thinking. Scholars in a variety of design disciplines pose a number of factors that potentially affect this development process, but a full understanding of these factors as experienced from a critical pedagogy or student…

  1. Kadison-Kastler stable factors

    DEFF Research Database (Denmark)

    Cameron, Jan; Christensen, Erik; Sinclair, Allan M.

    2014-01-01

    It is proven that a pair of continuous finite von Neumann algebra factors are unitarily equivalent if sufficiently close and one satisfies a certain cohomological condition.......It is proven that a pair of continuous finite von Neumann algebra factors are unitarily equivalent if sufficiently close and one satisfies a certain cohomological condition....

  2. Human factors influencing decision making

    OpenAIRE

    Jacobs, Patricia A.

    1998-01-01

    This report supplies references and comments on literature that identifies human factors influencing decision making, particularly military decision making. The literature has been classified as follows (the classes are not mutually exclusive): features of human information processing; decision making models which are not mathematical models but rather are descriptive; non- personality factors influencing decision making; national characteristics influencing decision makin...

  3. Factoring in Factor VIII With Acute Ischemic Stroke.

    Science.gov (United States)

    Siegler, James E; Samai, Alyana; Albright, Karen C; Boehme, Amelia K; Martin-Schild, Sheryl

    2015-10-01

    There is growing research interest into the etiologies of cryptogenic stroke, in particular as it relates to hypercoagulable states. An elevation in serum levels of the procoagulant factor VIII is recognized as one such culprit of occult cerebral infarctions. It is the objective of the present review to summarize the molecular role of factor VIII in thrombogenesis and its clinical use in the diagnosis and prognosis of acute ischemic stroke. We also discuss the utility of screening for serum factor VIII levels among patients at risk for, or those who have experienced, ischemic stroke. © The Author(s) 2015.

  4. Using Bayes factors for multi-factor, biometric authentication

    Science.gov (United States)

    Giffin, A.; Skufca, J. D.; Lao, P. A.

    2015-01-01

    Multi-factor/multi-modal authentication systems are becoming the de facto industry standard. Traditional methods typically use rates that are point estimates and lack a good measure of uncertainty. Additionally, multiple factors are typically fused together in an ad hoc manner. To be consistent, as well as to establish and make proper use of uncertainties, we use a Bayesian method that will update our estimates and uncertainties as new information presents itself. Our algorithm compares competing classes (such as genuine vs. imposter) using Bayes Factors (BF). The importance of this approach is that we not only accept or reject one model (class), but compare it to others to make a decision. We show using a Receiver Operating Characteristic (ROC) curve that using BF for determining class will always perform at least as well as the traditional combining of factors, such as a voting algorithm. As the uncertainty decreases, the BF result continues to exceed the traditional methods result.

  5. What factors influence mitigative capacity?

    International Nuclear Information System (INIS)

    Winkler, Harald; Baumert, Kevin; Blanchard, Odile; Burch, Sarah; Robinson, John

    2007-01-01

    This article builds on Yohe's seminal piece on mitigative capacity, which elaborates 'determinants' of mitigative capacity, also reflected in the IPCC's third assessment report. We propose a revised definition, where mitigative capacity is a country's ability to reduce anthropogenic greenhouse gas emissions or enhance natural sinks. By 'ability' we mean skills, competencies, fitness, and proficiencies that a country has attained which can contribute to GHG emissions mitigation. A conceptual framework is proposed, linking mitigative capacity to a country's sustainable development path, and grouping the factors influencing mitigative capacity into three main sets: economic factors, institutional ones, and technology. Both quantitative and qualitative analysis of factors is presented, showing how these factors vary across countries. We suggest that it is the interplay between the three economic factors-income, abatement cost and opportunity cost-that shape mitigative capacity. We find that income is an important economic factor influencing mitigative capacity, while abatement cost is important in turning mitigative capacity into actual mitigation. Technology is a critical mitigative capacity, including the ability to absorb existing climate-friendly technologies or to develop innovative ones. Institutional factors that promote mitigative capacity include the effectiveness of government regulation, clear market rules, a skilled work force and public awareness. We briefly investigate such as high abatement cost or lack of political willingness that prevent mitigative capacity from being translated into mitigation

  6. Corrosion effects on friction factors

    International Nuclear Information System (INIS)

    Magleby, H.L.; Shaffer, S.J.

    1996-01-01

    This paper presents the results of NRC-sponsored material specimen tests that were performed to determine if corrosion increases the friction factors of sliding surfaces of motor-operated gate valves, which could require higher forces to close and open safety-related valves when subjected to their design basis differential pressures. Friction tests were performed with uncorroded specimens and specimens subjected to accelerated corrosion. Preliminary tests at ambient conditions showed that corrosion increased the friction factors, indicating the need for additional tests duplicating valve operating parameters at hot conditions. The additional tests showed friction factors of corroded specimens were 0.1 to 0.2 higher than for uncorroded specimens, and that the friction factors of the corroded specimens were not very dependent on contact stress or corrosion film thickness. The measured values of friction factors for the three corrosion films tested (simulating three operating times) were in the range of 0.3 to 0.4. The friction factor for even the shortest simulated operating time was essentially the same as the others, indicating that the friction factors appear to reach a plateau and that the plateau is reached quickly

  7. Conversion factors and oil statistics

    International Nuclear Information System (INIS)

    Karbuz, Sohbet

    2004-01-01

    World oil statistics, in scope and accuracy, are often far from perfect. They can easily lead to misguided conclusions regarding the state of market fundamentals. Without proper attention directed at statistic caveats, the ensuing interpretation of oil market data opens the door to unnecessary volatility, and can distort perception of market fundamentals. Among the numerous caveats associated with the compilation of oil statistics, conversion factors, used to produce aggregated data, play a significant role. Interestingly enough, little attention is paid to conversion factors, i.e. to the relation between different units of measurement for oil. Additionally, the underlying information regarding the choice of a specific factor when trying to produce measurements of aggregated data remains scant. The aim of this paper is to shed some light on the impact of conversion factors for two commonly encountered issues, mass to volume equivalencies (barrels to tonnes) and for broad energy measures encountered in world oil statistics. This paper will seek to demonstrate how inappropriate and misused conversion factors can yield wildly varying results and ultimately distort oil statistics. Examples will show that while discrepancies in commonly used conversion factors may seem trivial, their impact on the assessment of a world oil balance is far from negligible. A unified and harmonised convention for conversion factors is necessary to achieve accurate comparisons and aggregate oil statistics for the benefit of both end-users and policy makers

  8. Factors Influencing of Social Conflict

    Directory of Open Access Journals (Sweden)

    Suwandi Sumartias

    2013-07-01

    Full Text Available Social conflicts that occur in several areas in Indonesia lately, one of them is caused by the weakness of law certainty. This is feared to threaten the integration of the Republic of Indonesia. This study aims to determine the factors that affect social conflict in Manis Lor village in Kuningan district. The method used the explanatory quantitative methods, the statistical test Path Analysis. The study population was a formal and informal community leaders (village chief, clergy, and youth, and the people who involved in a conflict in Manis Lor village Kuningan regency. The result shows a There is no significant influence between social identity factors with social conflict anarchist. b There is significant influence between socio-economic factors with social conflict anarchists. c There is no significant influence between the credibility factor anarchist leaders with social conflict. d There is no significant influence between the motive factor with anarchist social conflict. e There is significant influence between personality factors/beliefs with anarchist social conflict. f There is significant influence of behavioral factors anarchist communication with social conflict.

  9. Factor concentrates for the treatment of factor XIII deficiency.

    Science.gov (United States)

    Gootenberg, J E

    1998-11-01

    Factor XIII deficiency is a severe autosomal recessive bleeding disorder associated with a characteristic pattern of neonatal hemorrhage and a lifelong bleeding diathesis. Even relatively minor trauma can be followed by prolonged and recurrent bleeding. Intracranial hemorrhage is a frequent complication. With the development of safe and effective factor XIII concentrates, reliable prophylactic treatment is possible. Two plasma-derived, virus-inactivated factor XIII concentrates are currently in production. The first, Fibrogammin P, (Centeon LLC, King of Prussia, PA, USA; and Centeon Pharma GmbH, Marburg, Germany) is marketed in Europe, South America, South Africa, and Japan. It is distributed in the United States under a Food and Drug Administration Investigational New Drug Application. A second factor XIII concentrate (Bio Products Laboratory, Elstree, UK) is available for use only on a "named patient" compassionate basis in the United Kingdom. Patients with factor XIII deficiency who receive appropriately timed periodic infusions of such factor XIII concentrates are able to live normal lives, free from catastrophic bleeding episodes.

  10. Sequence Factorization with Multiple References.

    Directory of Open Access Journals (Sweden)

    Sebastian Wandelt

    Full Text Available The success of high-throughput sequencing has lead to an increasing number of projects which sequence large populations of a species. Storage and analysis of sequence data is a key challenge in these projects, because of the sheer size of the datasets. Compression is one simple technology to deal with this challenge. Referential factorization and compression schemes, which store only the differences between input sequence and a reference sequence, gained lots of interest in this field. Highly-similar sequences, e.g., Human genomes, can be compressed with a compression ratio of 1,000:1 and more, up to two orders of magnitude better than with standard compression techniques. Recently, it was shown that the compression against multiple references from the same species can boost the compression ratio up to 4,000:1. However, a detailed analysis of using multiple references is lacking, e.g., for main memory consumption and optimality. In this paper, we describe one key technique for the referential compression against multiple references: The factorization of sequences. Based on the notion of an optimal factorization, we propose optimization heuristics and identify parameter settings which greatly influence 1 the size of the factorization, 2 the time for factorization, and 3 the required amount of main memory. We evaluate a total of 30 setups with a varying number of references on data from three different species. Our results show a wide range of factorization sizes (optimal to an overhead of up to 300%, factorization speed (0.01 MB/s to more than 600 MB/s, and main memory usage (few dozen MB to dozens of GB. Based on our evaluation, we identify the best configurations for common use cases. Our evaluation shows that multi-reference factorization is much better than single-reference factorization.

  11. Cardiovascular risk factors and dementia.

    Science.gov (United States)

    Fillit, Howard; Nash, David T; Rundek, Tatjana; Zuckerman, Andrea

    2008-06-01

    Dementias, such as Alzheimer's disease (AD) and vascular dementia, are disorders of aging populations and represent a significant economic burden. Evidence is accumulating to suggest that cardiovascular disease (CVD) risk factors may be instrumental in the development of dementia. The goal of this review was to discuss the relationship between specific CVD risk factors and dementia and how current treatment strategies for dementia should focus on reducing CVD risks. We conducted a review of the literature for the simultaneous presence of 2 major topics, cardiovascular risk factors and dementia (eg, AD). Special emphasis was placed on clinical outcome studies examining the effects of treatments of pharmacologically modifiable CVD risk factors on dementia and cognitive impairment. Lifestyle risk factors for CVD, such as obesity, lack of exercise, smoking, and certain psychosocial factors, have been associated with an increased risk of cognitive decline and dementia. Some evidence suggests that effectively managing these factors may prevent cognitive decline/dementia. Randomized, placebo-controlled trials of antihypertensive medications have found that such therapy may reduce the risk of cognitive decline, and limited data suggest a benefit for patients with AD. Some small open-label and randomized clinical trials of statins have observed positive effects on cognitive function; larger studies of statins in patients with AD are ongoing. Although more research is needed, current evidence indicates an association between CVD risk factors--such as hypertension, dyslipidemia, and diabetes mellitus--and cognitive decline/dementia. From a clinical perspective, these data further support the rationale for physicians to provide effective management of CVD risk factors and for patients to be compliant with such recommendations to possibly prevent cognitive decline/dementia.

  12. Improved multivariate polynomial factoring algorithm

    International Nuclear Information System (INIS)

    Wang, P.S.

    1978-01-01

    A new algorithm for factoring multivariate polynomials over the integers based on an algorithm by Wang and Rothschild is described. The new algorithm has improved strategies for dealing with the known problems of the original algorithm, namely, the leading coefficient problem, the bad-zero problem and the occurrence of extraneous factors. It has an algorithm for correctly predetermining leading coefficients of the factors. A new and efficient p-adic algorithm named EEZ is described. Bascially it is a linearly convergent variable-by-variable parallel construction. The improved algorithm is generally faster and requires less store then the original algorithm. Machine examples with comparative timing are included

  13. Quality factors for monoenergetic neutrons

    International Nuclear Information System (INIS)

    Cross, W.G.; Ing, H.

    1984-01-01

    Mean quality factors anti Q(E/sub n/), for the dose resulting from first interactons of monoenergetic neutrons in tissue, have been calculated at energies from thermal to 14.7 MeV. Knowledge of these values, along with kerma factors, allows the calculation of the heavy-particle dose equivalent for any known neutron spectrum in tissue. The partial quality factors for the dose delivered by C, N, and O elastic and inelastic recoils are found to be virtually independent of the scattering angular distributions and are given by simple expressions

  14. Novel genetic factors involved in resistance to Bacillus thuringiensis in Plutella xylostella.

    Science.gov (United States)

    Ayra-Pardo, C; Raymond, B; Gulzar, A; Rodríguez-Cabrera, L; Morán-Bertot, I; Crickmore, N; Wright, D J

    2015-12-01

    The widespread and sustainable exploitation of the entomopathogen Bacillus thuringiensis (Bt) in pest control is threatened by the evolution of resistance. Although resistance is often associated with loss of binding of the Bt toxins to the insect midgut cells, other factors have been implicated. Here we used suppressive subtractive hybridization and gene expression suppression to identify additional molecular components involved in Bt-resistance in Plutella xylostella. We isolated transcripts from genes that were differentially expressed in the midgut of larvae from a resistant population, following ingestion of a Bt kurstaki HD1 strain-based commercial formulation (DiPel), and compared with a genetically similar susceptible population. Quantitative real-time polymerase-chain reaction (RT-PCR) analysis confirmed the differential basal expression of a subset of these genes. Gene expression suppression of three of these genes (P. xylostella cyclin-dependent kinase 5 regulatory subunit associated protein 1-like 1, stromal cell-derived factor 2-like 1 and hatching enzyme-like 1) significantly increased the pathogenicity of HD1 to the resistant population. In an attempt to link the multitude of factors reportedly influencing resistance to Bt with the well-characterized loss of toxin binding, we also considered Bt-resistance models in P. xylostella and other insects. © 2015 The Royal Entomological Society.

  15. Nucleocytoplasmic shuttling of transcription factors

    DEFF Research Database (Denmark)

    Cartwright, P; Helin, K

    2000-01-01

    To elicit the transcriptional response following intra- or extracellular stimuli, the signals need to be transmitted to their site of action within the nucleus. The nucleocytoplasmic shuttling of transcription factors is a mechanism mediating this process. The activation and inactivation...... of the transcriptional response is essential for cells to progress through the cell cycle in a normal manner. The involvement of cytoplasmic and nuclear accessory molecules, and the general nuclear membrane transport components, are essential for this process. Although nuclear import and export for different...... transcription factor families are regulated by similar mechanisms, there are several differences that allow for the specific activation of each transcription factor. This review discusses the general import and export pathways found to be common amongst many different transcription factors, and highlights...

  16. Secreted factors as synaptic organizers.

    Science.gov (United States)

    Johnson-Venkatesh, Erin M; Umemori, Hisashi

    2010-07-01

    A critical step in synaptic development is the differentiation of presynaptic and postsynaptic compartments. This complex process is regulated by a variety of secreted factors that serve as synaptic organizers. Specifically, fibroblast growth factors, Wnts, neurotrophic factors and various other intercellular signaling molecules are proposed to regulate presynaptic and/or postsynaptic differentiation. Many of these factors appear to function at both the neuromuscular junction and in the central nervous system, although the specific function of the molecules differs between the two. Here we review secreted molecules that organize the synaptic compartments and discuss how these molecules shape synaptic development, focusing on mammalian in vivo systems. Their critical role in shaping a functional neural circuit is underscored by their possible link to a wide range of neurological and psychiatric disorders both in animal models and by mutations identified in human patients. © The Authors (2010). Journal Compilation © Federation of European Neuroscience Societies and Blackwell Publishing Ltd.

  17. Disadvantage factor for anisotropic scattering

    International Nuclear Information System (INIS)

    Saad, E.A.; Abdel Krim, M.S.; EL-Dimerdash, A.A.

    1990-01-01

    The invariant embedding method is used to solve the problem for a two region reactor with anisotropic scattering and to compute the disadvantage factor necessary for calculating some reactor parameters

  18. Calculation of pion form factor

    International Nuclear Information System (INIS)

    Vahedi, N.; Amirarjomand, S.

    1975-09-01

    The pion form factor is calculated using the structure function Wsub(2), which incorporates kinematical constraints, threshold behaviour and scaling. The Bloom-Gilman sum rule is used and only the two leading Regge trajectories are taken into account

  19. EAMJ Factors Aug.indd

    African Journals Online (AJOL)

    2009-08-01

    Aug 1, 2009 ... Objective: To bridge the existing gaps by examining the factors associated with attrition. Design: ... Results: In this cohort study, 1353 women were enrolled at delivery and 1188 (88%) ... wage earners with poor social support.

  20. HIV: Social and Environmental Factors

    Centers for Disease Control (CDC) Podcasts

    Dr. Kevin Fenton, Director of CDC’s National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention, discusses how social and environmental factors may put African Americans at greater risk for HIV.

  1. Lithuanian Population Aging Factors Analysis

    Directory of Open Access Journals (Sweden)

    Agnė Garlauskaitė

    2015-05-01

    Full Text Available The aim of this article is to identify the factors that determine aging of Lithuania’s population and to assess the influence of these factors. The article shows Lithuanian population aging factors analysis, which consists of two main parts: the first describes the aging of the population and its characteristics in theoretical terms. Second part is dedicated to the assessment of trends that influence the aging population and demographic factors and also to analyse the determinants of the aging of the population of Lithuania. After analysis it is concluded in the article that the decline in the birth rate and increase in the number of emigrants compared to immigrants have the greatest impact on aging of the population, so in order to show the aging of the population, a lot of attention should be paid to management of these demographic processes.

  2. Environmental risk factors and pressures

    International Nuclear Information System (INIS)

    Klinda, J.; Lieskovska, Z.

    1998-01-01

    In this chapter the physical risk factors (as radiation [air contamination, contamination of the environment components and food contamination], radon and its radioactive decay products, radioactive wastes, noise), chemical risk factors [chemical substances, xenobiotics in the food chain the ozone depletion], wastes (waste generation, waste management, municipal waste management, import, export and transit of waste) and natural an technological hazards (water quality deterioration as a result of various accidents and fire risk) in the Slovak Republic in 1997 are reviewed

  3. Factorization-algebraization-path integration

    International Nuclear Information System (INIS)

    Inomata, A.; Wilson, R.

    1986-01-01

    The authors review the method of factorization proposed by Schroedinger of a quantum mechanical second-order linear differential equation into a product of two first-order differential operators, often referred to as ladder operators, as well as the modifications made to Schroedinger's method by Infeld and Hull. They then review the group theoretical treatments proposed by Miller of the Schroedinger-Infeld-Hull factorizations and go on to demonstrate the application of dynamical symmetry to path integral calculations. 30 references

  4. Factors determining UK album success

    OpenAIRE

    Elliott, Caroline; Simmons, Robert

    2011-01-01

    This article uses a recently compiled dataset on the UK album sales to determine which factors contribute to best-selling album sales success. We control for factors including length of time since release, nationality of artist, artist type and album type, testing the increasing returns to information hypothesis. Information on general public online review scores for the albums in the dataset allows for a strong test of the accuracy of online reviews in predicting music sales, as online revie...

  5. Virulence Factors of Streptococcus mutans.

    Science.gov (United States)

    1986-08-01

    763512/715242 Final Report U VIRULENCE FACTORS OF STREPTOCOCCUS MUTANS U Samuel Rosen Department of Oral Biology For the Period April 1, 1983 - June 30...00 FINAL REPORT VIRULENCE FACTORS OF STREPTOCOCCUS MUTANS Sam Rosen, Irving Shklair, E. X. Beck and F. M. Beck Ohio State University Columbus,Oh and...206-212. Johnson CP, Gorss S, Hillman JD (1978). Cariogenic properties of LDH deficient mutants of streptococcus mutans . J Dent Res 57, Special Issue

  6. Power peaking nuclear reliability factors

    International Nuclear Information System (INIS)

    Hassan, H.A.; Pegram, J.W.; Mays, C.W.; Romano, J.J.; Woods, J.J.; Warren, H.D.

    1977-11-01

    The Calculational Nuclear Reliability Factor (CNRF) assigned to the limiting power density calculated in reactor design has been determined. The CNRF is presented as a function of the relative power density of the fuel assembly and its radial local. In addition, the Measurement Nuclear Reliability Factor (MNRF) for the measured peak hot pellet power in the core has been evaluated. This MNRF is also presented as a function of the relative power density and radial local within the fuel assembly

  7. FACTORS INFLUENCING SECOND LANGUAGE ACQUISITION

    Directory of Open Access Journals (Sweden)

    Siti Khasinah

    2014-05-01

    Full Text Available Motivation, attitude, age, intelligence, aptitude, cognitive style, and personality are considered as factors that greatly influence someone in the process of his or her second language acquisition. Experts state that those factors give a more dominant contribution in SLA to learners variedly, depend on who the learners are, their age, how they behave toward the language, their cognitive ability, and also the way they learn.

  8. Clinical Application of Wedge Factor

    International Nuclear Information System (INIS)

    Choi, Dong Rak; Ahn, Yong Chan; Huh, Sueng Jae

    1995-01-01

    Purpose : In general. The wedge factors which are used clinical practices are ignored of dependency on field sizes and depths. In this present, we investigated systematically the depth and field size dependency to determine the absorbed dose more accurately. Methods : The wedge factors for each wedge filter were measured at various depth (depth of Dmax, 5cm, 10cm, and 15cm) and field sizes (5 X 5cm, 10 X 10cm, 15 X 15cm, 20 X 20 cm) by using 4-,6-, and 10-MV X rays. By convention, wedge factors are determined by taking the ratio of the central axis ionization readings when the wedge filter is in place to those of the open field in same field size and measurement depth. In this present work, we determined the wedge factors for 4-, 6-, and 10-MV X rays from Clinac 600C and 2100C linear accelerators (manufactured by Varian Associates, Inc., Palo Alto, CA). To confirm that the wedge was centered., measurements were done with the two possible wedge position and various collimator orientations. Results : The standard deviations of measured values are within 0.3% and the depth dependence of wedge factor is greater for the lower energies. Especially, the variation of wedge factor is no less than 5% for 4- and 6- MV X rays with more than 45 .deg. wedge filter. But there seems to be a small dependence on field size. Conclusion : The results of this study show a dependence on the point of measurement. There also seems to be a small dependence on field size. And so, we should consider the depth and field size dependence in determining the wedge factors. If one wedge factor were to be used for each wedge filter, it seems that the measurement for a 10cm X 10cm field size at a depth of 10cm would be a reasonable choice

  9. Demand, Energy, and Power Factor

    Science.gov (United States)

    1994-08-01

    POWER FACTOR DEFINITION I Basically , power factor (pf) is a measure of how effectively the plant uses the electricity it purchases from the utility. It...not be made available by the plant. U 24 This video is relatively short, less than fifteen-minutes, and covers the basics on demand, block extenders... ratemaking methodology and test period as used in determining the NC-RS rates. Pending final decision by the FERC, the Federal Government would pay a rate as

  10. Environmental Factors and Cardiovascular Diseases

    Directory of Open Access Journals (Sweden)

    Omer Faruk Tekbas

    2008-10-01

    Full Text Available Epidemiological and clinical observations have led to the hypothesis that the risk of developing cardiovascular diseases is influenced not only by genetic, lifestyle and major risk factors, but also by environmental factors. Environmental factors are considered key determinants of cardiovascular diseases. Although lifestyle choices such as smoking, diet, and exercise are viewed as major environmental influences, the contribution of pollutants and environmental chemicals is less clear. Accumulating evidence suggests that exposure to physically and chemical pollutants could elevate the risk of cardiovascular diseases. Many epidemiological studies report that exposure to physically, biologically and socio-cultural environmental factors are associated with an increase in cardiovascular mortality. Relationships between environmental factors and coronary arter disease, arhythmias, and cardiomyopathies have been reported. Exposures to arsenic, lead, cadmium, pollutant gases, solvents, and pesticides have also been linked to increased incidence of cardiovascular disease. In this paper, I review that relationships between exposure to physically, chemical, biologically and socio-cultural environmental factors and cardiovascular diseases. [TAF Prev Med Bull 2008; 7(5.000: 435-444

  11. Human factors in resuscitation teaching.

    Science.gov (United States)

    Norris, Elizabeth M; Lockey, Andrew S

    2012-04-01

    There is an increasing interest in human factors within the healthcare environment reflecting the understanding of their impact on safety. The aim of this paper is to explore how human factors might be taught on resuscitation courses, and improve course outcomes in terms of improved mortality and morbidity for patients. The delivery of human factors training is important and this review explores the work that has been delivered already and areas for future research and teaching. Medline was searched using MESH terms Resuscitation as a Major concept and Patient or Leadership as core terms. The abstracts were read and 25 full length articles reviewed. Critical incident reporting has shown four recurring problems: lack of organisation at an arrest, lack of equipment, non functioning equipment, and obstructions preventing good care. Of these, the first relates directly to the concept of human factors. Team dynamics for both team membership and leadership, management of stress, conflict and the role of debriefing are highlighted. Possible strategies for teaching them are discussed. Four strategies for improving human factors training are discussed: team dynamics (including team membership and leadership behaviour), the influence of stress, debriefing, and conflict within teams. This review illustrates how human factor training might be integrated further into life support training without jeopardising the core content and lengthening the courses. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  12. Growth factors and new periodontology

    Directory of Open Access Journals (Sweden)

    Paknejad M

    1999-06-01

    Full Text Available Growth factors are biological mediators that have a key roll in proliferation, chemotaxy and"ndifferentiation by acting on specific receptors on the surface of cells and regulating events in wound"nhealing.They can be considered hormones that are not released in to the blood stream but have one a"nlocal action. Some of these factors can regulate premature change in GO to Gl phase in cell devesion"ncycle and even may stimulate synthesis of DNA in suitable cells, Growth substances, primarily secreted"nby fibroblasts, endothelia! cells, macrophages and platelet, include platelet derived growth factor"n(PDGF, insulin like growth factor (IGF transforming growth factor (TGFa and (3 and bone"nmorphogenetic proteins BMPs that approximately are the most important of them. (BMPs could be"nused to control events during periodontal, craniofacial and implant wound healing through favoring bone"nformation"nAccording toLynch, combination of PGDF and IGF1 would be effective in promoting growth of all the"ncomponents of the periodontium."nThe aim of this study was to characterize growth factor and review the literature to determine the"nmechanism of their function, classification and application in implant and periodontal treatment.

  13. Sexual harassment: identifying risk factors.

    Science.gov (United States)

    O'Hare, E A; O'Donohue, W

    1998-12-01

    A new model of the etiology of sexual harassment, the four-factor model, is presented and compared with several models of sexual harassment including the biological model, the organizational model, the sociocultural model, and the sex role spillover model. A number of risk factors associated with sexually harassing behavior are examined within the framework of the four-factor model of sexual harassment. These include characteristics of the work environment (e.g., sexist attitudes among co-workers, unprofessional work environment, skewed sex ratios in the workplace, knowledge of grievance procedures for sexual harassment incidents) as well as personal characteristics of the subject (e.g., physical attractiveness, job status, sex-role). Subjects were 266 university female faculty, staff, and students who completed the Sexual Experience Questionnaire to assess the experience of sexual harassment and a questionnaire designed to assess the risk factors stated above. Results indicated that the four-factor model is a better predictor of sexual harassment than the alternative models. The risk factors most strongly associated with sexual harassment were an unprofessional environment in the workplace, sexist atmosphere, and lack of knowledge about the organization's formal grievance procedures.

  14. Modifying factors for metabolic parameters

    International Nuclear Information System (INIS)

    Inaba, Jiro

    1990-01-01

    Studies on factors which influence the metabolic parameter for calculation of radiation doses from intakes of radionuclides are very important for estimation of the doses for the general public, because the present procedures recommended by the International Commission on Radiological Protection is for occupationally exposed workers and the underlying metabolic and dosimetric models have been developed from studies on adult man and experiments on adult animals and from observations on radionuclides in physico-chemically simple form. Many factors have been reported to influence the metabolic parameters. Among them, the food-chain involvement of radionuclides and the age-dependence in humans and animals are most significant as environmental and physiological factor, respectively. In connection with the age-dependence of dose calculation, the ICRP started a new programme. They organized a Task Group on Age-Dependent Dose-Factors where relevant information on metabolic and biokinetic parameters are presently being reviewed for development of a set of dose factors for the following age-groups: infant, 1-year-old, 5-year-old, 10-year-old, 15-year-old, and ICRP Reference Man. The first stage of the work is for age-dependent integrated organ and effective dose factors for radioisotopes of the following elements: hydrogen, carbon, iodine, cesium, strontium, plutonium and americium. (author)

  15. Multi-factor authentication using quantum communication

    Science.gov (United States)

    Hughes, Richard John; Peterson, Charles Glen; Thrasher, James T.; Nordholt, Jane E.; Yard, Jon T.; Newell, Raymond Thorson; Somma, Rolando D.

    2018-02-06

    Multi-factor authentication using quantum communication ("QC") includes stages for enrollment and identification. For example, a user enrolls for multi-factor authentication that uses QC with a trusted authority. The trusted authority transmits device factor information associated with a user device (such as a hash function) and user factor information associated with the user (such as an encrypted version of a user password). The user device receives and stores the device factor information and user factor information. For multi-factor authentication that uses QC, the user device retrieves its stored device factor information and user factor information, then transmits the user factor information to the trusted authority, which also retrieves its stored device factor information. The user device and trusted authority use the device factor information and user factor information (more specifically, information such as a user password that is the basis of the user factor information) in multi-factor authentication that uses QC.

  16. Rare coagulation disorders: fibrinogen, factor VII and factor XIII.

    Science.gov (United States)

    de Moerloose, P; Schved, J-F; Nugent, D

    2016-07-01

    Rare coagulation disorders (RCDs) include the inherited deficiencies of fibrinogen, factor (F) II, FV, combined FV and VIII, FVII, FX, combined FVII and X, FXI, FXIII and combined congenital deficiency of vitamin K-dependent factors (VKCFDs). Despite their rarity, a deep comprehension of all these disorders is essential to really understand haemostasis. Indeed, even if they share some common features each RCD has some particularity which makes it unique. In this review, we focus on three disorders: fibrinogen, FVII and FXIII. © 2016 John Wiley & Sons Ltd.

  17. Self-similar factor approximants

    International Nuclear Information System (INIS)

    Gluzman, S.; Yukalov, V.I.; Sornette, D.

    2003-01-01

    The problem of reconstructing functions from their asymptotic expansions in powers of a small variable is addressed by deriving an improved type of approximants. The derivation is based on the self-similar approximation theory, which presents the passage from one approximant to another as the motion realized by a dynamical system with the property of group self-similarity. The derived approximants, because of their form, are called self-similar factor approximants. These complement the obtained earlier self-similar exponential approximants and self-similar root approximants. The specific feature of self-similar factor approximants is that their control functions, providing convergence of the computational algorithm, are completely defined from the accuracy-through-order conditions. These approximants contain the Pade approximants as a particular case, and in some limit they can be reduced to the self-similar exponential approximants previously introduced by two of us. It is proved that the self-similar factor approximants are able to reproduce exactly a wide class of functions, which include a variety of nonalgebraic functions. For other functions, not pertaining to this exactly reproducible class, the factor approximants provide very accurate approximations, whose accuracy surpasses significantly that of the most accurate Pade approximants. This is illustrated by a number of examples showing the generality and accuracy of the factor approximants even when conventional techniques meet serious difficulties

  18. Factors Influencing Healthcare Service Quality

    Directory of Open Access Journals (Sweden)

    Ali Mohammad Mosadeghrad

    2014-07-01

    Full Text Available Background The main purpose of this study was to identify factors that influence healthcare quality in the Iranian context. Methods Exploratory in-depth individual and focus group interviews were conducted with 222 healthcare stakeholders including healthcare providers, managers, policy-makers, and payers to identify factors affecting the quality of healthcare services provided in Iranian healthcare organisations. Results Quality in healthcare is a production of cooperation between the patient and the healthcare provider in a supportive environment. Personal factors of the provider and the patient, and factors pertaining to the healthcare organisation, healthcare system, and the broader environment affect healthcare service quality. Healthcare quality can be improved by supportive visionary leadership, proper planning, education and training, availability of resources, effective management of resources, employees and processes, and collaboration and cooperation among providers. Conclusion This article contributes to healthcare theory and practice by developing a conceptual framework that provides policy-makers and managers a practical understanding of factors that affect healthcare service quality.

  19. TRASYS form factor matrix normalization

    Science.gov (United States)

    Tsuyuki, Glenn T.

    1992-01-01

    A method has been developed for adjusting a TRASYS enclosure form factor matrix to unity. This approach is not limited to closed geometries, and in fact, it is primarily intended for use with open geometries. The purpose of this approach is to prevent optimistic form factors to space. In this method, nodal form factor sums are calculated within 0.05 of unity using TRASYS, although deviations as large as 0.10 may be acceptable, and then, a process is employed to distribute the difference amongst the nodes. A specific example has been analyzed with this method, and a comparison was performed with a standard approach for calculating radiation conductors. In this comparison, hot and cold case temperatures were determined. Exterior nodes exhibited temperature differences as large as 7 C and 3 C for the hot and cold cases, respectively when compared with the standard approach, while interior nodes demonstrated temperature differences from 0 C to 5 C. These results indicate that temperature predictions can be artificially biased if the form factor computation error is lumped into the individual form factors to space.

  20. Peaking-factor of PWR

    International Nuclear Information System (INIS)

    Morioka, Noboru; Kato, Yasuji; Yokoi, M.

    1975-01-01

    Output peaking factor often plays an important role in the safety and operation of nuclear reactors. The meaning of the peaking factor of PWRs is categorized into two features or the peaking factor in core (FQ-core) and the peaking factor on the basis of accident analysis (or FQ-limit). FQ-core is the actual peaking factor realized in nuclear core at the time of normal operation, and FQ-limit should be evaluated from loss of coolant accident and other abnormal conditions. If FQ-core is lower than FQ-limit, the reactor may be operated at full load, but if FQ-core is larger than FQ-limit, reactor output should be controlled lower than FQ-limit. FQ-core has two kinds of values, or the one on the basis of nuclear design, and the other actually measured in reactor operation. The first FQ-core should be named as FQ-core-design and the latter as FQ-core-measured. The numerical evaluation of FQ-core-design is as follows; FQ-core-design of three-dimensions is synthesized with FQ-core horizontal value (X-Y) and FQ-core vertical value, the former one is calculated with ASSY-CORE code, and the latter one with one dimensional diffusion code. For the evaluation of FQ-core-measured, on-site data observation from nuclear reactor instrumentation or off-site data observation is used. (Iwase, T.)

  1. [Risk factors of necrotizing enterocolitis].

    Science.gov (United States)

    Tapia-Rombo, C A; Velasco-Lavín, M R; Nieto-Caldelas, A

    1993-09-01

    The purpose of the present study is to compare risk factors of necrotizing enterocolitis (NEC) between two group: group A, newborns with the disease and group B, newborns with other diseases different from NEC, in order to know if these risk factors are more frequent or not in the first group. We assessed the clinical records of all the patients hospitalized in the Neonatal Intensive Care Unit and Neonatology Service of the La Raza General Hospital between 1987 and 1991 with the diagnosis of NEC. They were compared with 65 clinical records chosen at random of patients hospitalized in the same Unit with other diagnosis at the same time, and who were discharged by improvement or deceased. In all of them were look for known risk factors for NEC generally accepted such as: prematurity, neonatal asphyxia, poliglobulia, cyanotic congenital heart disease, patent ductus arteriosus, respiratory distress syndrome, catheterization of umbilical vessels, early feeding of elevated formula increases, exchange exchange transfusion, hypoxic ischemic encephalopathy, infection, etc. Just 25 records of the possible 50 with the diagnosis of NEC full filled inclusion criteria. There were no statistically significant difference in weight, sex, mortality and known risk factors of NEC between both groups. Were concluded that NEC is a disease of unknown etiology that should be studied more thoroughly. The known risk factors must be avoided because the patient susceptibility probably play an important role.

  2. Epistaxis: Prevailing Factors and Treatment

    Directory of Open Access Journals (Sweden)

    Secchi, Myrian Marajó Dal

    2009-12-01

    Full Text Available Introduction: The epistaxis is one the most frequent otorhinolaryngologic emergencies in the medical practice. It is a benign affection, but the refractory cases require hospital admission. Objective: To evaluate prevailing factors in patients with epistaxis and treatment. Form of study: Retrospective study. Method: 60 patients with diagnosis of epistaxis were evaluated and they needed hospital admission between 2005 and 2006. Results: The main prevailing factors were: Systemic arterial hypertension 36% (n= 22, trauma 16% (n=10 and coagulopathy 5% (n=3. The treatment was the use of nasal splint: anterior 58% (n=35 and antero-posterior 27% (n=16, the electrocauterization of the identified bloody point 7% (n=4, endoscopic arterial bandage 8% (n=5 in severe epistaxis. For the patients with antero-posterior splint with recurrence of bleeding in the first 24 hours (five patients, after clinical stabilization, an arterial bandage was indicated by endoscopic means; four patients had systemic arterial hypertension and in one patient no prevailing factor was identified. Conclusion: The main associated prevailing factors were systemic arterial hypertension, trauma and coagulopathy. The treatment depends on the type, severity and cause of bleeding, initially the anterior and antero-posterior splint for bleeding control. The early endoscopic arterial bandage is indicated in patients with severe epistaxis and prevailing factors, and prolonged admission and morbidities associated with nasal splint should be avoided.

  3. Security Gaps In Authentication Factor Credentials

    Directory of Open Access Journals (Sweden)

    Neeraj A. Sharma

    2015-08-01

    Full Text Available Authentication factors refer to user login credentials that a user supplies to an authentication process for it to decide whether to grant or deny access. While two-factor and three-factor authentication generally provides better security than one-factor authentication the aim of this paper is to review security in individual authentication factor credentials that are in use nowadays. These credentials will be discussed in factor categories knowledge factor possession factor and inherence factor. The paper details current security gaps and some novel approaches to diminish the gaps in these authentication factors. We believe that our recommendations will inspire development of better authentication credentials and systems.

  4. Success factors in technology development

    Science.gov (United States)

    Preston, John T.

    1995-01-01

    Universities in the U.S. have a significant impact on business through the transfer of technology. This paper describes goals and philosophy of the Technology Licensing Office at the Massachusetts Institute of Technology. This paper also relates the critical factors for susscessful technology transfer, particularly relating to new business formation. These critical factors include the quality of the technology, the quality of the management, the quality of the investor, the passion for success, and the image of the company. Descriptions of three different levels of investment are also given and the most successful level of investment for starting a new company is reviewed. Licensing to large companies is also briefly reviewed, as this type of licensing requires some different strategies than that of licensing to start-up companies. High quality critical factors and intelligent investment create rewards for the parties and successful ventures.

  5. Critical factors for EIA implementation

    DEFF Research Database (Denmark)

    Zhang, Jasmine; Kørnøv, Lone; Christensen, Per

    2013-01-01

    After decades of development, the gap between expectations of Environment Impact Assessments (EIA) and their practical performance remains significant. Research has been done to identify the critical factors for an effective implementation of EIA. However, this research, to a large extent, has...... not been cumulated and analysed comprehensively according to the stages of the EIA process. This paper contributes to the critical review of the literature on EIA implementation and effectiveness by cumulating mainly empirical findings in an implementation theoretical perspective. It focuses on the links...... between different critical factors and how they relate to different stages in the EIA and thus influence the decision making process. After reviewing 33 refereed journal articles published between 1999 and 2011, we identified 203 notions of critical factors. Of these, 102 related to different stages...

  6. Factors Driving Business Intelligence Culture

    Directory of Open Access Journals (Sweden)

    Rimvydas Skyrius

    2016-05-01

    Full Text Available The field of business intelligence (BI, despite rapid technology advances, continues to feature inadequate levels of adoption. The attention of researchers is shifting towards hu-man factors of BI adoption. The wide set of human factors influencing BI adoption con-tains elements of what we call BI culture – an overarching concept covering key managerial issues that come up in BI implementation. Research sources provide different sets of features pertaining to BI culture or related concepts – decision-making culture, analytical culture and others. The goal of this paper is to perform the review of research and practical sources to examine driving forces of BI – data-driven approaches, BI agility, maturity and acceptance – to point out culture-related issues that support BI adoption and to suggest an emerging set of factors influencing BI culture.

  7. Factors controlling metal fuel lifetime

    International Nuclear Information System (INIS)

    Porter, D.L.; Hofman, G.L.; Seidel, B.R.; Walters, L.C.

    1986-01-01

    The reliability of metal fuel elements is determined by a fuel burnup at which a statistically predicted number of fuel breaches would occur, the number of breaches determined by the amount of free fission gas which a particular reactor design can tolerate. The reliability is therefore measured using experimentally determined breach statistics, or by modelling fuel element behavior and those factors which contribute to cladding breach. The factors are fuel/cladding mechanical and chemical interactions, fission gas pressure, fuel phase transformations involving volume changes, and fission product effects on cladding integrity. Experimental data for EBR-II fuel elements has shown that the primary, and perhaps the only significant factor affecting metal fuel reliability, is the pressure-induced stresses caused by fission gas release. Other metal fuel/cladding systems may perform similarly

  8. Perinatal risk factors including malformation

    International Nuclear Information System (INIS)

    Brachner, A.; Grosche, B.

    1991-10-01

    The study gives a survey of the factors most frequently mentioned in the literature as factors likely to adversely affect a pregnancy. One essential aspect is the discussion of those factors that can be counted among the causes of malformations, as among others, prenatal radiation exposure. The study prepared within the framework of the research project 'Radiobiological environmental monitoring in Bavaria' is intended to serve as a basis for a retrospective and prospective evaluation of infant mortality, perinatal conditions and occurrence of malformations in Bavaria, with the principal idea of drawing up an environment - related health survey. The study therefore, in addition to ionizing radiation also takes into account other detectable risks within the ecologic context, as e.g. industrial installations, refuse incineration plants or waste dumps, or urbanity. (orig./MG) [de

  9. Self-government’s factoring

    Directory of Open Access Journals (Sweden)

    Maciej Tokarski

    2011-12-01

    Full Text Available Local self-governments are reliable business partners. Such belief, confirmed by long-term experience, results in eager collaboration between financial institutions and these entities. Contrary to its name, local self-governments do not constitute the main beneficiaries of the self-government’s factoring. The enterprises which perform investments commissioned by a local commune, district or province are the principal recipients. Such firms may utilise it independently if they have signed contracts with the proper authority and conduct sale with deferred payment, or they may be forced to utilise factoring when they submit their bids in self-government’s tenders within which a refinance guarantee is required. The main aim of the article is to present the mechanism and features of the self-government’s factoring, as well as the benefits which the entities involved enjoy.

  10. Organizational Factors and Intrapreneurial Competences

    Directory of Open Access Journals (Sweden)

    Suzete Antonieta Lizote

    2013-12-01

    Full Text Available This study analyzes the relationship between organizational factors and entrepreneurial competencies of coordinators of undergraduate courses in two community universities in Santa Catarina, Brazil. The organizational factors studied were: management support, freedom at work, rewards, and time available and organizational limitations. Eight entrepreneurial competencies were considered; five included in an achievement set, and three in a planning set. The method was quantitative and descriptive, adopting a structured questionnaire as the data collection tool. Factor analysis, canonical analysis, and multiple regression analysis were performed. The results revealed a positive relationship between the constructs. The most relevant competencies were organizational limitations or uncertainty about tasks, and freedom at work, which indicates the importance having clarity about rules and decisions that should exist both at the level of performance expected of the coordinator, and the freedom that they must feel in their work.

  11. Prognostic factors in Acanthamoeba keratitis.

    Science.gov (United States)

    Kaiserman, Igor; Bahar, Irit; McAllum, Penny; Srinivasan, Sathish; Elbaz, Uri; Slomovic, Allan R; Rootman, David S

    2012-06-01

    To assess the prognostic factors influencing visual prognosis and length of treatment after acanthamoeba keratitis (AK). Forty-two AK eyes of 41 patients treated between 1999 and 2006 were included. A diagnosis of AK was made on the basis of culture results with a corresponding clinical presentation. We calculated the prognostic effect of the various factors on final visual acuity and the length of treatment. Multivariate regression analysis was used to adjust for the simultaneous effects of the various prognostic factors. Mean follow-up was 19.7 ± 21.0 months. Sixty-four percent of cases had > 1 identified risk factor for AK, the most common risk factor being contact lens wear (92.9% of eyes). At presentation, median best spectacle corrected visual acuity (BCVA) was 20/200 (20/30 to Hand Motion [HM]) that improved after treatment to 20/50 (20/20 to Counting Fingers [CF]). Infection acquired by swimming or related to contact lenses had significantly better final BCVA (p = 0.03 and p = 0.007, respectively). Neuritis and pseudodendrites were also associated with better final BCVA (p = 0.04 and p = 0.05, respectively). Having had an epithelial defect on presentation and having been treated with topical steroid were associated with worse final best spectacle corrected visual acuity (BSCVA) (p = 0.0006 and p = 0.04). Multivariate regression analysis found a good initial visual acuity (p = 0.002), infections related to swimming (p = 0.01), the absence of an epithelial defect (p = 0.03), having been treated with chlorhexidine (p = 0.05), and not having receive steroids (p = 0.003) to significantly forecast a good final BCVA. We identified several prognostic factors that can help clinicians evaluate the expected visual damage of the AK infection and thus tailor treatment accordingly. Copyright © 2012 Canadian Ophthalmological Society. All rights reserved.

  12. The selection of occupancy factors

    International Nuclear Information System (INIS)

    Lakey, J.R.A.

    1977-01-01

    An estimate of the proportion of time that an area is occupied by radiation workers is often used in radiological protection to permit relaxation of exposure rate limits above those for continuous occupation. This proportion is known as an occupancy factor and is used most frequently in X-ray facilities. The strategy for controlling the external exposure of radiation workers must be decided before occupancy factors are selected for the design of the radiation protection facilities. When shielding has to be designed the occupancy factor effects the design objectives and permits increased exposure rates at the shield surface. It is useful to note that the selection of occupancy factors with due regard to the expected spatial variation of the exposure rate can help to reduce the range of the worker's radiation exposure because field gradients are usually steeper close to the shield. When other hazards, such as internal exposure, and other constraints, such as cost of the space consumed, are added, the selection of the optimum set of occupancy factors is more difficult. Two zone occupancy factors are discussed in this paper and proposals are made for a strategy to be used when there is more than one hazard and the designer has to meet constraints imposed by limitations of the facilities available. An important feature of the strategy is the avoidance of high radiation exposure to small groups of workers. The errors involved in assessment of the actual dose received by the radiation worker must be taken into account and in particular the selection of the higher exposure rate limits must be made with attention to the accident potential

  13. Theoretical difference between impact factor and influence factor

    Directory of Open Access Journals (Sweden)

    Đilda Pečarić

    2010-06-01

    Full Text Available Bibliometric constructions of "knowledge maps" and "cognitive structures of science" do not differentiate between impact and influence factors. The difference can be constructedaccording to different meaning and interpretation of the terms reference and citation. Reference is "acknowledgment which one author gives to another", whereas citation is "acknowledgment which one document receives from another". Development of Information Science according to period and subject area is analyzed on the corpus of citation literature retrieved from doctoral dissertations in Information Science from 1978 to 2007 at Croatian universities. The research aim is to indicate the difference between document impact factor and author's influence factor (i.e. reference ability to produce effects on actions, behavior, and opinions of authors of doctoral theses. The influence factor serves to distinguish the key role of cited authors in time and according to the duration of the influence (the average age for cited papers of dominant authors in different periods is between eight and ten years. The difference between linear and interactive communication seems vital for the interpretation of cited half-life, i.e. the attitude of one science community towards used information resources and cognitive heritage. The analyzed corpus of 22,210 citations can be divided into three communication phases according to influence factor criteria: in the phase of dialogue and interactive communication 25% of bibliographic units are cited in the first four years; in the second phase another 25% of units are cited from the fifth to the ninth year; after ten years, in the dominant linear communication phase, approximately 30% of units are cited.

  14. Absorption factor for cylindrical samples

    International Nuclear Information System (INIS)

    Sears, V.F.

    1984-01-01

    The absorption factor for the scattering of X-rays or neutrons in cylindrical samples is calculated by numerical integration for the case in which the absorption coefficients of the incident and scattered beams are not equal. An extensive table of values having an absolute accuracy of 10 -4 is given in a companion report [Sears (1983). Atomic Energy of Canada Limited, Report No. AECL-8176]. In the present paper an asymptotic expression is derived for the absorption factor which can be used with an error of less than 10 -3 for most cases of interest in both neutron inelastic scattering and neutron diffraction in crystals. (Auth.)

  15. General introduction and recovery factors

    Science.gov (United States)

    Verma, Mahendra K.

    2017-07-17

    IntroductionThe U.S. Geological Survey (USGS) compared methods for estimating an incremental recovery factor (RF) for the carbon dioxide enhanced oil recovery (CO2-EOR) process involving the injection of CO2 into oil reservoirs. This chapter first provides some basic information on the RF, including its dependence on various reservoir and operational parameters, and then discusses the three development phases of oil recovery—primary, second­ary, and tertiary (EOR). It ends with a brief discussion of the three approaches for estimating recovery factors, which are detailed in subsequent chapters.

  16. Cardiovascular risk factors in men

    DEFF Research Database (Denmark)

    Gyllenborg, J; Rasmussen, S L; Borch-Johnsen, Knut

    2001-01-01

    Males have higher risk of cardiovascular disease (CVD) than premenopausal females. Gonadal steroids are probably involved in the gender difference in CVD, but previous results have been conflicting. We investigated the associations between CVD risk factors and sex hormones in a cross-sectional de......Males have higher risk of cardiovascular disease (CVD) than premenopausal females. Gonadal steroids are probably involved in the gender difference in CVD, but previous results have been conflicting. We investigated the associations between CVD risk factors and sex hormones in a cross...

  17. Efficiency factors in Mie scattering

    International Nuclear Information System (INIS)

    Nussenzveig, H.M.

    1980-04-01

    Asymptotic approximation to the Mie efficiency factors for extinction, absorption and radiation pressure, derived from complex angular momentum theory and averaged over Δβ approximately π (β = size parameter), are given and compared with the exact results. For complex refractive indices N = n + i kappa with 1.1 -2 - 10 -3 % between β = 10 and β = 1000, and computing time is reduced by a factor of order β, so that the Mie formulae can advantageously by replaced by the asymptotic ones in most applications. (Author) [pt

  18. Output factors and scatter ratios

    Energy Technology Data Exchange (ETDEWEB)

    Shrivastava, P N; Summers, R E; Samulski, T V; Baird, L C [Allegheny General Hospital, Pittsburgh, PA (USA); Ahuja, A S; Dubuque, G L; Hendee, W R; Chhabra, A S

    1979-07-01

    Reference is made to a previous publication on output factors and scatter ratios for radiotherapy units in which it was suggested that the output factor should be included in the definitions of scatter-air ratio and tissue-maximum ratio. In the present correspondence from other authors and from the authors of the previous publication, the original definitions and the proposed changes are discussed. Radiation scatter from source and collimator degradation of beam energy and calculation of dose in tissue are considered in relation to the objective of accurate dosimetry.

  19. Effectiveness of human factors simulator

    International Nuclear Information System (INIS)

    Moragas, F.

    2015-01-01

    En 2011, ANAV started the exploitation of the Human Factors Simulator installed in TECNATOM Training Center located in L'Hospital de L'Infant Tarragona. AVAN's Strategic Plan includes the Action Plan for the improvement of human behavior. The plan includes improving the efficiency of the efficiency of the human factors simulator. It is proposed to improve the efficiency into two different terms: winning effectiveness in modeling behaviors, and interweaving the activities in the simulator with the actual strategy of promoting Safety culture and human behaviour. (Author)

  20. The gamma contamination food factor

    International Nuclear Information System (INIS)

    Kukoc, A.H.; Anicin, I.V.; Adzic, P.R.

    1992-01-01

    We suggest that radioactive food contamination, as determined solely by a quantitative gamma-ray spectroscopic measurement, may, apart from the total activity per unit mass, be for quick reference conveniently characterized by another single figure which we call the ''Gamma Contamination Food Factor'' (GCFF). This factor may be defined as the ratio of the total specific activity of gamma-ray-emitting radionuclides in the food sample (except that of 40 K) to the specific activity of 40 K either in the sample itself or in an ''average man''. We discuss briefly the meaning and advantages of these definitions. (author)

  1. Age factors in biometric processing

    CERN Document Server

    Fairhurst, Michael

    2013-01-01

    As biometrics-based identification and identity authentication become increasingly widespread in their deployment, it becomes correspondingly important to consider more carefully issues relating to reliability, usability and inclusion. One factor which is particularly important in this context is that of the relationship between the nature of the measurements extracted from a particular biometric modality and the age of the sample donor, and the effect which age has on physiological and behavioural characteristics invoked in a biometric transaction. In Age Factors in Biometric Processing an in

  2. Social networks and factor markets

    DEFF Research Database (Denmark)

    Abay, Kibrom Araya; Kahsay, Goytom Abraha; Berhane, Guush

    2018-01-01

    We investigate the role of an indigenous social network in Ethiopia, the iddir, in facilitating factor market transactions among smallholder farmers. We use a detailed longitudinal household survey data and employ a fixed effects estimation to identify the effect of iddir membership on factor...... market transactions among farmers. We find that joining an iddir network improves households’ access to land, labour and credit transactions. Our findings also hint that iddir networks may crowd-out borrowing from local moneylenders (locally referred as ‘Arata Abedari’), a relatively expensive credit...

  3. Risk factor for febrile seizures

    Directory of Open Access Journals (Sweden)

    Odalović Dragica

    2014-01-01

    Full Text Available Febrile seizures are the most frequent neurological disorder in the childhood. According to American Academy of Pediatrics (AAP, they have been defined as seizures provoked by high temperature in children aged between 6 months and 5 years, without previous history of afebrile seizures, intracranial infections and other possible causes of seizures. Seizures can be typical and atypical, according to the characteristics. Pathogenesis of this disorder has not been clarified yet, and it is believed to be a combination of genetic factors, high body temperature and brain maturation. The risk factors for recurrence of febrile seizures are: age in which seizures appeared for the first time, epilepsy in the first degree relative, febrile seizures in the first degree relative, frequent diseases with fever and low body temperature on the beginning of seizures. The frequency of recurrent seizures The risk for occurrence of epilepsy in children with simple seizures is about 1-1.5%, which is slightly higher compared to general population, while it increases to 4-15% in patients with complex seizures. However, there is no evidence that therapy prevents occurrence of epilepsy. When the prevention of recurrent seizures is considered, it is necessary to separate simple from complex seizures. The aim of this paper was to analyze the most important risk factors for febrile seizures, and to evaluate their impact on occurrence of recurrent seizures. Our study included 125 children with febrile seizures, aged from 6 months to 5 years. The presence of febrile seizures and epilepsy in the first degree relative has been noted in 22% of children. Typical febrile seizures were observed in 76% of cases, and atypical in 24%. Most patients had only one seizure (73.6%. Children, who had seizure earlier in life, had more frequent recurrences. Both risk factors were present in 25% of patients, while 68% of patients had only one risk factor. For the children with febrile disease

  4. Factores de risco em implantologia

    OpenAIRE

    Sousa, Inês Silveira e Luz Nunes de

    2015-01-01

    A Implantologia tem ganho popularidade na medicina dentária pelos resultados previsíveis em reabilitações de áreas edêntulas, permitindo minimizar as consequências funcionais, fonéticas e estéticas que advém da perda de dentes através de uma solução fixa que satizfaz os pacientes. Esta é uma revisão da literatura existente sobre factores de risco, fracassos e complicações inerentes ao tratamento com implantes dentários. Categorizam-se os factores de risco em implantologia co...

  5. Tissue factor-dependent activation of tritium-labeled factor IX and factor X in human plasma

    International Nuclear Information System (INIS)

    Morrison, S.A.; Jesty, J.

    1984-01-01

    A comparism was made of the tissue factor-dependent activation of tritium-labeled factor IX and factor X in a human plasma system and a study was made of the role of proteases known to stimulate factor VII activity. Plasma was defibrinated by heating and depleted of its factors IX and X by passing it through antibody columns. Addition of human brain thromboplastin, Ca2+, and purified 3H-labeled factor X to the plasma resulted, after a short lag, in burst-like activation of the factor X, measured as the release of radiolabeled activation peptide. The progress of activation was slowed by both heparin and a specific inhibitor of factor Xa but factor X activation could not be completely abolished by such inhibitors. In the case of 3H-factor IX activation, the rate also increased for approximately 3 min after addition of thromboplastin, but was not subsequently curtailed. A survey of proteases implicated as activators of factor VII in other settings showed that both factor Xa and factor IXa could accelerate the activation of factor IX. However, factor Xa was unique in obliterating activation when present at concentrations greater than approximately 1 nM. Heparin inhibited the tissue factor-dependent activation of factor IX almost completely, apparently through the effect of antithrombin on the feedback reactions of factors Xa and IXa on factor VII. These results suggest that a very tight, biphasic control of factor VII activity exists in human plasma, which is modulated mainly by factor Xa. At saturation of factor VIIa/tissue factor, factor IX activation was significantly more rapid than was previously found in bovine plasma under similar conditions. The activation of factor X at saturation was slightly more rapid than in bovine plasma, despite the presence of heparin

  6. HUMAN PROSTATE CANCER RISK FACTORS

    Science.gov (United States)

    Prostate cancer has the highest prevalence of any non-skin cancer in the human body, with similar likelihood of neoplastic foci found within the prostates of men around the world regardless of diet, occupation, lifestyle, or other factors. Essentially all men with circulating an...

  7. Risk factors for undescended testis.

    NARCIS (Netherlands)

    Brouwers, M.M.; Bruijne, L.M. de; Gier, R.P.E. de; Zielhuis, G.A.; Feitz, W.F.J.; Roeleveld, N.

    2012-01-01

    OBJECTIVE: To contribute to the understanding of the etiology of undescended testis (UDT), by exploring a wide range of potential risk factors in a case-referent study. PATIENTS AND METHODS: Cases and referents were recruited at five hospitals and included 200 boys with surgically corrected UDT and

  8. Factor VII-activating protease

    DEFF Research Database (Denmark)

    Ramanathan, Ramshanker; Gram, Jørgen B; Sand, Niels Peter R

    2017-01-01

    : Factor VII-activating protease (FSAP) may regulate development of cardiovascular disease (CVD). We evaluated sex differences in FSAP measures and examined the association between FSAP and coronary artery calcification (CAC) in a middle-aged population. Participants were randomly selected citizens...

  9. An innovation resistance factor model

    Directory of Open Access Journals (Sweden)

    Siti Salwa Mohd Ishak

    2016-09-01

    Full Text Available The process and implementation strategy of information technology in construction is generally considered through the limiting prism of theoretical contexts generated from innovation diffusion and acceptance. This research argues that more attention should be given to understanding the positive effects of resistance. The study develops a theoretical framing for the Integrated Resistance Factor Model (IRFM. The framing uses a combination of diffusion of innovation theory, technology acceptance model and social network perspective. The model is tested to identify the most significant resistance factors using Partial Least Square (PLS technique. All constructs proposed in the model are found to be significant, valid and consistent with the theoretical framework. IRFM is shown to be an effective and appropriate model of user resistance factors. The most critical factors to influence technology resistance in the online project information management system (OPIMS context are: support from leaders and peers, complexity of the technology, compatibility with key work practices; and pre-trial of the technology before it is actually deployed. The study provides a new model for further research in technology innovation specific to the construction industry.

  10. Seasonality of cardiovascular risk factors

    DEFF Research Database (Denmark)

    Marti-Soler, Helena; Gubelmann, Cédric; Aeschbacher, Stefanie

    2014-01-01

    OBJECTIVE: To assess the seasonality of cardiovascular risk factors (CVRF) in a large set of population-based studies. METHODS: Cross-sectional data from 24 population-based studies from 15 countries, with a total sample size of 237 979 subjects. CVRFs included Body Mass Index (BMI) and waist...

  11. Psychological Risk Factors in Headache

    Science.gov (United States)

    Nicholson, Robert A.; Houle, Timothy T.; Rhudy, Jamie L.; Norton, Peter J.

    2008-01-01

    Headache is a chronic disease that occurs with varying frequency and results in varying levels of disability. To date, the majority of research and clinical focus has been on the role of biological factors in headache and headache-related disability. However, reliance on a purely biomedical model of headache does not account for all aspects of headache and associated disability. Using a biopsychosocial framework, the current manuscript expands the view of what factors influence headache by considering the role psychological (i.e., cognitive and affective) factors have in the development, course, and consequences of headache. The manuscript initially reviews evidence showing that neural circuits responsible for cognitive–affective phenomena are highly interconnected with the circuitry responsible for headache pain. The manuscript then reviews the influence cognitions (locus of control and self-efficacy) and negative affect (depression, anxiety, and anger) have on the development of headache attacks, perception of headache pain, adherence to prescribed treatment, headache treatment outcome, and headache-related disability. The manuscript concludes with a discussion of the clinical implications of considering psychological factors when treating headache. PMID:17371358

  12. Field factors for asymmetric collimators

    International Nuclear Information System (INIS)

    Turner, J.R.; Butler, A.P.H.

    1996-01-01

    In recent years manufacturers have been supplying linear accelerators with either a single pair or a dual pair of collimators. The use of a model to relate off-axis field factors to on-axis field factors obviates the need for repeat measurements whenever the asymmetric collimators are employed. We have investigated the variation of collimator scatter Sc, with distance of the central ray x from the central axis for a variety of non square field sizes. Collimator scatter was measured by in-air measurements with a build-up cap. The Primaty-Off-Centre-Ratio (POCR) was measured in-air by scanning orthogonally across the beam with an ionization chamber. The result of the investigation is the useful prediction of off-axis field factors for a range of rectangular asymmetric fields using the simple product of the on-axis field factor and the POCR in air. The effect of asymmetry on the quality of the beam and hence the percent depth dose will be discussed. (author)

  13. [Risk factors associated to preclampsia].

    Science.gov (United States)

    López-Carbajal, Mario Joaquín; Manríquez-Moreno, María Esther; Gálvez-Camargo, Daniela; Ramírez-Jiménez, Evelia

    2012-01-01

    preeclampsia constitutes one of the main causes of maternal and perinatal morbidity and mortality. The aim was to identify the risk factors associated to the developmental of preeclampsia mild-moderate and severe, as well as the force of association of these factors in a hospital of second-level medical care. study of cases and controls, a relation 1:1, in women withdrawn of the Service of Gynecology and Obstetrics during 2004 to 2007. Pregnant women with more than 20 weeks gestation were included. In the cases group we included patients with diagnosis of preeclampsia mild-moderate or severe (corroborated clinical and laboratory). In the controls group that had a normal childbirth without pathology during the pregnancy. 42 cases and 42 controls. The average age was of 27 years. The associated risk factors were overweight, obesity, irregular prenatal control, short or long intergenesic period, history of caesarean or preeclampsia in previous pregnancies. the knowledge of the risk factors will allow the accomplishment of preventive measures and decrease the fetal and maternal morbidity and mortality due to preeclampsia.

  14. Elevated plasma factor VIII enhances venous thrombus formation in rabbits: contribution of factor XI, von Willebrand factor and tissue factor.

    Science.gov (United States)

    Sugita, Chihiro; Yamashita, Atsushi; Matsuura, Yunosuke; Iwakiri, Takashi; Okuyama, Nozomi; Matsuda, Shuntaro; Matsumoto, Tomoko; Inoue, Osamu; Harada, Aya; Kitazawa, Takehisa; Hattori, Kunihiro; Shima, Midori; Asada, Yujiro

    2013-07-01

    Elevated plasma levels of factor VIII (FVIII) are associated with increased risk of deep venous thrombosis. The aim of this study is to elucidate how elevated FVIII levels affect venous thrombus formation and propagation in vivo. We examined rabbit plasma FVIII activity, plasma thrombin generation, whole blood coagulation, platelet aggregation and venous wall thrombogenicity before and one hour after an intravenous infusion of recombinant human FVIII (rFVIII). Venous thrombus induced by the endothelial denudation of rabbit jugular veins was histologically assessed. Thrombus propagation was evaluated as indocyanine green fluorescence intensity. Argatroban, a thrombin inhibitor, and neutralised antibodies for tissue factor (TF), factor XI (FXI), and von Willebrand factor (VWF) were infused before or after thrombus induction to investigate their effects on venous thrombus formation or propagation. Recombinant FVIII (100 IU/kg) increased rabbit plasma FVIII activity two-fold and significantly enhanced whole blood coagulation and total plasma thrombin generation, but did not affect initial thrombin generation time, platelet aggregation and venous wall thrombogenicity. The rFVIII infusion also increased the size of venous thrombus 1 hour after thrombus induction. Argatroban and the antibodies for TF, FXI or VWF inhibited such enhanced thrombus formation and all except TF suppressed thrombus propagation. In conclusion, elevated plasma FVIII levels enhance venous thrombus formation and propagation. Excess thrombin generation by FXI and VWF-mediated FVIII recruitment appear to contribute to the growth of FVIII-driven venous thrombus.

  15. 2011 Critical Success Factors Report

    Science.gov (United States)

    North Carolina Community College System (NJ1), 2011

    2011-01-01

    The Critical Success Factors Report is the North Carolina Community College System's major accountability document. This annual performance report serves to inform colleges and the public on the performance of North Carolina's 58 community colleges. In 1993, the State Board of Community Colleges began monitoring performance data on specific…

  16. 2012 Critical Success Factors Report

    Science.gov (United States)

    North Carolina Community College System (NJ1), 2012

    2012-01-01

    The Critical Success Factors Report is the North Carolina Community College System's major accountability document. This annual performance report is based on data compiled from the previous year and serves to inform colleges and the public on the performance of North Carolina's 58 community colleges. In 1993, the State Board of Community Colleges…

  17. The factorization method and supersymmetry

    International Nuclear Information System (INIS)

    Alves, N.A.; Drigo Filho, E.

    1988-01-01

    Applying the factorization method, we generalize the harmonic - oscillator and the Coulomb potentials, both in arbitrary dimensions. We also show that this method allows the determination of the superpotentials and the supersymmetric partners associated with each of those systems. (author) [pt

  18. Human Leptospirosis and risk factors.

    Directory of Open Access Journals (Sweden)

    Yanelis Emilia Tabío Henry

    2010-09-01

    Full Text Available The human leptospirosis is a zoonosis of world distribution, were risk factors exist that have favored the wild and domestic animal propagation and so man. A descpitive investigation was made with the objective of determining the behavior of risk factors in outpatients by human leptospirosis in “Camilo Cienfuegos“ University General Hospital from Sncti Spíritus In the comprised time period betwen december 1 st and 3 st , 2008.The sample of this study was conformed by 54 risk persons that keep inclusion criteria. Some variables were used:age, sex, risk factors and number of ill persons, according to the month. Some patients of masculine sex prevailed (61,9%, group of ages between 15-29 and 45-59 years (27,7%, patients treated since october to december (53,7%, the direct and indirect contact with animals (46,2 %. The risk factors cassually associated to human leptospirosis turned to be: the masculine sex, the contac with animals, the occupational exposition and the inmersion on sources of sweet water.

  19. Introduction to human factors engineering

    International Nuclear Information System (INIS)

    Derfuss, Ch.

    2010-01-01

    Some of the main aspects of human factors engineering are discussed. The following topics are considered: Integration into the design process; Identification and application of human-centered design requirements; Design of error-tolerant systems; Iterative process consisting of evaluations and feedback loops; Participation of operators/users; Utilization of an interdisciplinary design/ evaluation team; Documentation of the complete HFE-process: traceability

  20. Factors influencing bone scan quality

    International Nuclear Information System (INIS)

    Adams, F.G.; Shirley, A.W.

    1983-01-01

    A reliable subjective method of assessing bone scan quality is described. A large number of variables which theoretically could influence scan quality were submitted to regression and factor analysis. Obesity, age, sex and abnormality of scan were found to be significant but weak variables. (orig.)

  1. Five Describing Factors of Dyslexia

    Science.gov (United States)

    Tamboer, Peter; Vorst, Harrie C. M.; Oort, Frans J.

    2016-01-01

    Two subtypes of dyslexia (phonological, visual) have been under debate in various studies. However, the number of symptoms of dyslexia described in the literature exceeds the number of subtypes, and underlying relations remain unclear. We investigated underlying cognitive features of dyslexia with exploratory and confirmatory factor analyses. A…

  2. Analysis of Bernstein's factorization circuit

    NARCIS (Netherlands)

    Lenstra, A.K.; Shamir, A.; Tomlinson, J.; Tromer, E.; Zheng, Y.

    2002-01-01

    In [1], Bernstein proposed a circuit-based implementation of the matrix step of the number field sieve factorization algorithm. These circuits offer an asymptotic cost reduction under the measure "construction cost x run time". We evaluate the cost of these circuits, in agreement with [1], but argue

  3. Vandalism: Environmental and Social Factors

    Science.gov (United States)

    Brown, Gregory; Devlin, Ann Sloan

    2003-01-01

    To explore the relationship between vandalism, college residence hall size, and a number of social factors, 688 college students completed the Core Alcohol and Drug Survey (Presley, Meilman, & Lyerla, 1994), the University Residence Environment Scale (Moos, 1988), and answered questions about their television habits and athletic participation.…

  4. Factor Analysis for Clustered Observations.

    Science.gov (United States)

    Longford, N. T.; Muthen, B. O.

    1992-01-01

    A two-level model for factor analysis is defined, and formulas for a scoring algorithm for this model are derived. A simple noniterative method based on decomposition of total sums of the squares and cross-products is discussed and illustrated with simulated data and data from the Second International Mathematics Study. (SLD)

  5. Efficient networks for quantum factoring

    International Nuclear Information System (INIS)

    Beckman, D.; Chari, A.N.; Devabhaktuni, S.; Preskill, J.

    1996-01-01

    We consider how to optimize memory use and computation time in operating a quantum computer. In particular, we estimate the number of memory quantum bits (qubits) and the number of operations required to perform factorization, using the algorithm suggested by Shor [in Proceedings of the 35th Annual Symposium on Foundations of Computer Science, edited by S. Goldwasser (IEEE Computer Society, Los Alamitos, CA, 1994), p. 124]. A K-bit number can be factored in time of order K 3 using a machine capable of storing 5K+1 qubits. Evaluation of the modular exponential function (the bottleneck of Shor close-quote s algorithm) could be achieved with about 72K 3 elementary quantum gates; implementation using a linear ion trap would require about 396K 3 laser pulses. A proof-of-principle demonstration of quantum factoring (factorization of 15) could be performed with only 6 trapped ions and 38 laser pulses. Though the ion trap may never be a useful computer, it will be a powerful device for exploring experimentally the properties of entangled quantum states. copyright 1996 The American Physical Society

  6. Temporal factors in resource dilemmas

    NARCIS (Netherlands)

    Hendrickx, L; Poortinga, W; van der Kooij, R

    The conflict between present and future consumption lies at the heart of resource dilemmas (RDs), yet the role of time has received little attention in this research area. Emphasis was on factors related to the social rather than the temporal conflict inherent in an RD. We propose a model that deals

  7. Landscape genetics and limiting factors

    Science.gov (United States)

    Samuel A. Cushman; Andrew J. Shirk; Erin L. Landguth

    2013-01-01

    Population connectivity is mediated by the movement of organisms or propagules through landscapes. However, little is known about how variation in the pattern of landscape mosaics affects the detectability of landscape genetic relationships. The goal of this paper is to explore the impacts of limiting factors on landscape genetic processes using simulation...

  8. Logistical Factors in Teachers' Motivation

    Science.gov (United States)

    Daniels, Erika

    2016-01-01

    Research in education and psychology contributes to an understanding of how educators create contexts for learning that encourage intrinsic motivation and increase academic achievement. In this article, the researcher investigated how teachers themselves define effectiveness and identified what factors influence their motivation, both positively…

  9. Accentuated Factors of Handheld Computing

    DEFF Research Database (Denmark)

    Andersson, Bo; Henningsson, Stefan

    2013-01-01

    and the mobile technology. In this chapter, we deductively, from previous research on aspects on mobility, synthesize a tentative analytical framework capturing factors accentuated in mobile IS design. We evaluate the framework based on criteria of completeness, distinctiveness and simplicity. Eventually...

  10. Time dependent view factor methods

    International Nuclear Information System (INIS)

    Kirkpatrick, R.C.

    1998-03-01

    View factors have been used for treating radiation transport between opaque surfaces bounding a transparent medium for several decades. However, in recent years they have been applied to problems involving intense bursts of radiation in enclosed volumes such as in the laser fusion hohlraums. In these problems, several aspects require treatment of time dependence

  11. Transcription factor-based biosensor

    Science.gov (United States)

    Dietrich, Jeffrey A; Keasling, Jay D

    2013-10-08

    The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

  12. Transforming Rubrics Using Factor Analysis

    Science.gov (United States)

    Baryla, Ed; Shelley, Gary; Trainor, William

    2012-01-01

    Student learning and program effectiveness is often assessed using rubrics. While much time and effort may go into their creation, it is equally important to assess how effective and efficient the rubrics actually are in terms of measuring competencies over a number of criteria. This study demonstrates the use of common factor analysis to identify…

  13. Human Factor in Therapeutic Relationship

    Directory of Open Access Journals (Sweden)

    Ramazan Akdogan

    2011-03-01

    Full Text Available herapeutic relationship is a professional relationship that has been structured based on theoretical props. This relationship is a complicated, wide and unique relationship which develops between two people, where both sides' personality and attitudes inevitably interfere. Therapist-client relationship experienced through transference and counter transference, especially in psychodynamic approaches, is accepted as the main aspect of therapeutic process. However, the approaches without dynamic/deterministic tendency also take therapist-client relationship into account seriously and stress uniqueness of interaction between two people. Being a person and a human naturally sometimes may negatively influence the relationship between the therapist and client and result in a relationship going out of the theoretical frame at times. As effective components of a therapeutic process, the factors that stem from being human include the unique personalities of the therapist and the client, their values and their attitude either made consciously or subconsciously. Literature has shown that the human-related factors are too effective to be denied in therapeutic relationship process. Ethical and theoretical knowledge can be inefficient to prevent the negative effects of these factors in therapeutic process at which point a deep insight and supervision would have a critical role in continuing an acceptable therapeutic relationship. This review is focused on the reflection of some therapeutic factors resulting from being human and development of counter transference onto the therapeutic process.

  14. Shot-noise Fano factor

    Czech Academy of Sciences Publication Activity Database

    Rajdl, K.; Lánský, Petr

    2015-01-01

    Roč. 92, č. 5 (2015), č. článku 052135. ISSN 2470-0045 Institutional support: RVO:67985823 Keywords : response functions * limit-theorems * spike trains * variability Subject RIV: BD - Theory of Information Impact factor: 2.252, year: 2015

  15. Factors in Dubbing Television Comedy.

    Science.gov (United States)

    Zabalbeascoa, Patrick

    1994-01-01

    Advocates a greater awareness of the factors involved with dubbing television comedies. Considers the translation of jokes and provides an outline of the various kinds of jokes in television shows. Calls for more research on comedy dubbing and television translation in general. (HB)

  16. The risk factor of thyroid

    International Nuclear Information System (INIS)

    Kusama, Tomoko

    1979-01-01

    For the purposes of radiation protection, the noteworthy risk of thyroid is carcinogenesis. The risk factor which ICRP presented in the publication-26 is 5 x 10 - 6 rem - 1 . This numerical value is based upon the estimated likelihood of inducing fatal thyroid cancer. On the other hand, the risk factor presented by the BEIR report is 4 x 10 - 6 yr - 1 . This value was decided after consideration of the risks of both fatal and non-fatal cancer of thyroid. The following features distinguished thyroid cancer from malignancy of other tissue from medical point of view. 1) A large difference between incidence and mortality in case of thyroid cancer is recognized, because the thyroid cancer could be successfully treated by surgical or radiological treatment. 2) The high prevalence of clinically silent tumor in thyroid gland has been reported. The incidence of thyroid cancer, therefore, is very dependent on methods of medical inspection. The prevalence of radiation induced thyroid cancer is modified by various factors such as age, sex, latency, dose and dose rate. The latent period is very important factors such as ave, sex, latency, dose and dose rate. The latent period is a very important factor in the estimation of accumulated total risk of thyroid malignancy. What is included in the risk caused by thyroid irradiation must be investigated. The risk of non-fatal cancer should be considered in the same way as that of fatal cancer. The dose-equivalent limit of thyroid in non-uniform irradiation caused by radioactive iodine is decided by the limit for non-stochastic effects. Therefore the further consideration of non-stochastic effects of thyroid is necessary. (author)

  17. Organizational factors in nuclear safety

    International Nuclear Information System (INIS)

    Wilpert, Bernhard

    2000-01-01

    The overall picture of factors which contributed to the event presents a panorama of a NPP where organizational and managerial characteristics were intricately intertwined and emerged as crucial for a general deterioration of the plant's capabilities to continually correct its deficiencies and optimize its operations. In the following author shall attempt to first cover various important efforts to modeling organizational factors relevant to safety. The second part of my presentation will offer an attempt towards an integrative model. The third part concludes with an agenda for research and practice. Most of the twelve different approaches above attempt to consider safety relevant organizational factors by way of pragmatic classifications. Together with their sub-categories we can count close to 160 different factors on various levels of abstraction. This is tantamount to say that most approaches lack systematic theoretical underpinnings. Thus then arises the question whether we need to develop a generic model, which promises to encompass these three major approaches altogether. Practical issues emerge particularly in the domain of organizational development, i.e. the goal oriented efforts to change the structures and the functioning of nuclear operations in such a way that the desired outputs in terms safety and reliability result in a sustained fashion. Again, these practical concerns are intimately related to developments and advances in theory and methodology. Only a close cooperation among scientists from various disciplines and of practitioners holds the promise of adequately understanding and use of organizational factors in future improving the safety record of nuclear industry worldwide. (S.Y.)

  18. Causal Indicators Can Help to Interpret Factors

    Science.gov (United States)

    Bentler, Peter M.

    2016-01-01

    The latent factor in a causal indicator model is no more than the latent factor of the factor part of the model. However, if the causal indicator variables are well-understood and help to improve the prediction of individuals' factor scores, they can help to interpret the meaning of the latent factor. Aguirre-Urreta, Rönkkö, and Marakas (2016)…

  19. Factoring SözleşmesiFactoring Contracts

    OpenAIRE

    DEMİR,  REMZİ

    2013-01-01

    man tekniğidir. Bir başka ifadeyle, factoring, firmaların satışlarından doğan vadeli alacaklarını factore peşin bedel ile satmaları işlemidir4. Hukuki anlamda mal satımı ve/veya hizmet arzı ile uğraşan firma- ların bu satışları sonucu doğan veya doğacak alacaklarını devralarak tahsilini üstlenen, bu alacaklara karşı peşin ödemelerde bulunarak finansman sağlayan, aynı anda firmalara idari, ticari ve mali konu- larda verilen hizmetler karşılığı faiz, komisyon ve ücrete hak kaza- nan kişi ve...

  20. Eigenstates of coupling factor and loss factor of piezoelectric ceramics

    International Nuclear Information System (INIS)

    Smits, J.G.

    1978-01-01

    A short history of piezoelectricity is given and its occurence in nature described. The physical background of piezoelectric loss is discussed together with how material coefficients like susceptibilities can be used to describe the relation between canonical variables and to determine the dissipation of energy. The piezoelectric coupling factor, the applications of the eigencoupling state, elastic and piezoelectric digenstates are dealt with. The composition of the measurement system is described and experimental values of ceramics given. (C.F.)

  1. Food Ingestion Factors of the Korean Exposure Factors Handbook

    Directory of Open Access Journals (Sweden)

    Jae-Yeon Jang

    2014-01-01

    Full Text Available The purpose of this study was to establish food ingestion factors needed to assess exposure to contaminants through food ingestion. The study reclassified the raw data of the Korean National Health and Nutrition Examination Survey in 2001 into 12 subcategories including grain products, meat products, fish and shellfish, and vegetables for international comparability of exposure evaluation. The criteria for food intake calculation were unified according to the characteristics of food groups, and recommended values for food ingestion factors were calculated through moisture correction and recategorization of cooked, processed, and mixed foods for each group. The average intake rate for grain and grain products was 6.25 g/kg-d per capita and the men's intake rate was approximately 8% higher than that of the women. The average intake rate of meat and meat products was 1.62 g/kg-d per capita and the men's intake rate was 30% higher than that of the women, on average. The average intake rate of fish and shellfish was 1.53 g/kg-d per capita, and the age groups of 1 to 2 and 3 to 6 recorded higher capita intake rates than other age groups, 2.62 g/kg-d and 2.25 g/kg-d, respectively. The average intake rate of vegetables was 6.47 g/kg-d per capita, with the age group of 1 to 2 recording the highest per capita intake rate of 9.79 g/kg-d and that of 13 to 19 recording the lowest mean. The study also offers recommended values for food ingestion factors of other food groups by gender, age, and region. The food ingestion exposure factors will need future updates in consideration of ongoing changes in food consumption behavior.

  2. Activated human neutrophils release hepatocyte growth factor/scatter factor.

    LENUS (Irish Health Repository)

    McCourt, M

    2012-02-03

    BACKGROUND: Hepatocyte growth factor or scatter factor (HGF\\/SF) is a pleiotropic cytokine that has potent angiogenic properties. We have previously demonstrated that neutrophils (PMN) are directly angiogenic by releasing vascular endothelial growth factor (VEGF). We hypothesized that the acute inflammatory response can stimulate PMN to release HGF. AIMS: To examine the effects of inflammatory mediators on PMN HGF release and the effect of recombinant human HGF (rhHGF) on PMN adhesion receptor expression and PMN VEGF release. METHODS: In the first experiment, PMN were isolated from healthy volunteers and stimulated with tumour necrosis factor-alpha (TNF-alpha), lipopolysaccharide (LPS), interleukin-8 (IL-8), and formyl methionyl-leucyl-phenylalanine (fMLP). Culture supernatants were assayed for HGF using ELISA. In the second experiment, PMN were lysed to measure total HGF release and HGF expression in the PMN was detected by Western immunoblotting. Finally, PMN were stimulated with rhHGF. PMN CD 11a, CD 11b, and CD 18 receptor expression and VEGF release was measured using flow cytometry and ELISA respectively. RESULTS: TNF-alpha, LPS and fMLP stimulation resulted in significantly increased release of PMN HGF (755+\\/-216, 484+\\/-221 and 565+\\/-278 pg\\/ml, respectively) compared to controls (118+\\/-42 pg\\/ml). IL-8 had no effect. Total HGF release following cell lysis and Western blot suggests that HGF is released from intracellular stores. Recombinant human HGF did not alter PMN adhesion receptor expression and had no effect on PMN VEGF release. CONCLUSIONS: This study demonstrates that pro-inflammatory mediators can stimulate HGF release from a PMN intracellular store and that activated PMN in addition to secreting VEGF have further angiogenic potential by releasing HGF.

  3. Food ingestion factors of the Korean exposure factors handbook.

    Science.gov (United States)

    Jang, Jae-Yeon; Jo, Soo-Nam; Kim, Sun-Ja; Myung, Hyung-Nam; Kim, Cho-Il

    2014-01-01

    The purpose of this study was to establish food ingestion factors needed to assess exposure to contaminants through food ingestion. The study reclassified the raw data of the Korean National Health and Nutrition Examination Survey in 2001 into 12 subcategories including grain products, meat products, fish and shellfish, and vegetables for international comparability of exposure evaluation. The criteria for food intake calculation were unified according to the characteristics of food groups, and recommended values for food ingestion factors were calculated through moisture correction and recategorization of cooked, processed, and mixed foods for each group. The average intake rate for grain and grain products was 6.25 g/kg-d per capita and the men's intake rate was approximately 8% higher than that of the women. The average intake rate of meat and meat products was 1.62 g/kg-d per capita and the men's intake rate was 30% higher than that of the women, on average. The average intake rate of fish and shellfish was 1.53 g/kg-d per capita, and the age groups of 1 to 2 and 3 to 6 recorded higher capita intake rates than other age groups, 2.62 g/kg-d and 2.25 g/kg-d, respectively. The average intake rate of vegetables was 6.47 g/kg-d per capita, with the age group of 1 to 2 recording the highest per capita intake rate of 9.79 g/kg-d and that of 13 to 19 recording the lowest mean. The study also offers recommended values for food ingestion factors of other food groups by gender, age, and region. The food ingestion exposure factors will need future updates in consideration of ongoing changes in food consumption behavior.

  4. Pion transition form factor in k{sub T} factorization

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hsiang-nan [Academica Sinica, Taipei, Taiwan (China). Inst. of Physics; Tsing-Hua Univ., Hsinchu, Taiwan (China). Dept. of Phyiscs; National Cheng-Kung Univ., Tainan, Taiwan (China). Dept. of Physics; National Cheng-Chi Univ, Taipei, Taiwan (China). Inst. of Applied Physics; Mishima, Satoshi [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2009-07-15

    It has been pointed out that the recent BaBar data on the {pi}{gamma}{sup *} {yields} {gamma} transition form factor F{sub {pi}}{sub {gamma}}(Q{sup 2}) at low (high) momentum transfer squared Q{sup 2} indicate an asymptotic (flat) pion distribution amplitude. These seemingly contradictory observations can be reconciled in the k{sub T} factorization theorem: the increase of the measured Q{sup 2}FF{sub {pi}}{sub {gamma}}(Q{sup 2}) for Q{sup 2} > 10 GeV{sup 2} is explained by convoluting a k{sub T} dependent hard kernel with a flat pion distribution amplitude, k{sub T} being a parton transverse momentum. The low Q{sup 2} data are accommodated by including the resummation of {alpha}{sub s} ln{sup 2}x, x being a parton momentum fraction, which provides a stronger suppression at the endpoints of x. The next-to-leading-order correction to the pion transition form factor is found to be less than 20% in the considered range of Q{sup 2}. (orig.)

  5. Hepatocellular hypoxia-induced vascular endothelial growth factor expression and angiogenesis in experimental biliary cirrhosis.

    Science.gov (United States)

    Rosmorduc, O; Wendum, D; Corpechot, C; Galy, B; Sebbagh, N; Raleigh, J; Housset, C; Poupon, R

    1999-10-01

    We tested the potential role of vascular endothelial growth factor (VEGF) and of fibroblast growth factor-2 (FGF-2) in the angiogenesis associated with experimental liver fibrogenesis induced by common bile duct ligation in Sprague-Dawley rats. In normal rats, VEGF and FGF-2 immunoreactivities were restricted to less than 3% of hepatocytes. One week after bile duct ligation, hypoxia was demonstrated by the immunodetection of pimonidazole adducts unevenly distributed throughout the lobule. After 2 weeks, hypoxia and VEGF expression were detected in >95% of hepatocytes and coexisted with an increase in periportal vascular endothelial cell proliferation, as ascertained by Ki67 immunolabeling. Subsequently, at 3 weeks the density of von Willebrand-labeled vascular section in fibrotic areas significantly increased. Semiquantitative reverse transcription polymerase chain reaction showed that VEGF(120) and VEGF(164) transcripts, that correspond to secreted isoforms, increased within 2 weeks, while VEGF(188) transcripts remained unchanged. FGF-2 mainly consisting of a 22-kd isoform, according to Western blot, was identified by immunohistochemistry in 49% and 100% of hepatocytes at 3 and 7 weeks, respectively. Our data provide evidence that in biliary-type liver fibrogenesis, angiogenesis is stimulated primarily by VEGF in response to hepatocellular hypoxia while FGF-2 likely contributes to the maintenance of angiogenesis at later stages.

  6. Factors secreted from dental pulp stem cells show multifaceted benefits for treating acute lung injury in mice.

    Science.gov (United States)

    Wakayama, Hirotaka; Hashimoto, Naozumi; Matsushita, Yoshihiro; Matsubara, Kohki; Yamamoto, Noriyuki; Hasegawa, Yoshinori; Ueda, Minoru; Yamamoto, Akihito

    2015-08-01

    Acute respiratory distress syndrome (ARDS) is a severe inflammatory disorder characterized by acute respiratory failure, resulting from severe, destructive lung inflammation and irreversible lung fibrosis. We evaluated the use of stem cells derived from human exfoliated deciduous teeth (SHEDs) or SHED-derived serum-free conditioned medium (SHED-CM) as treatments for bleomycin (BLM)-induced mice acute lung injury (ALI), exhibiting several pathogenic features associated with the human disease ARDS. Mice with BLM-induced ALI with or without SHED or SHED-CM treatment were examined for weight loss and survival. The lung tissue was characterized by histological and real-time quantitative polymerase chain reaction analysis. The effects of SHED-CM on macrophage differentiation in vitro were also assessed. A single intravenous administration of either SHEDs or SHED-CM attenuated the lung injury and weight loss in BLM-treated mice and improved their survival rate. Similar recovery levels were seen in the SHEDs and SHED-CM treatment groups, suggesting that SHED improves ALI by paracrine mechanisms. SHED-CM contained multiple therapeutic factors involved in lung-regenerative mechanisms. Importantly, SHED-CM attenuated the BLM-induced pro-inflammatory response and generated an anti-inflammatory/tissue-regenerating environment, accompanied by the induction of anti-inflammatory M2-like lung macrophages. Furthermore, SHED-CM promoted the in vitro differentiation of bone marrow-derived macrophages into M2-like cells, which expressed high levels of Arginase1, CD206 and Ym-1. Our results suggest that SHED-secreted factors provide multifaceted therapeutic effects, including a strong M2-inducing activity, for treating BLM-induced ALI. This work may open new avenues for research on stem cell-based ARDS therapies. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  7. Genetics Home Reference: factor VII deficiency

    Science.gov (United States)

    ... Facebook Twitter Home Health Conditions Factor VII deficiency Factor VII deficiency Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Factor VII deficiency is a rare bleeding disorder that varies ...

  8. [Factor XIII deficiency in burns].

    Science.gov (United States)

    Burkhardt, H; Zellner, P R; Möller, I

    1977-08-01

    In 34 patients with severe burn injuries platelets, fibrinogen, prothrombin time, partial thromboplastin time, thrombin time and factor XIII were measured daily. Half of the patients were administered 15 000 IE of heparin per 24 hours. In the first 4 days there was a rapid fall of factor XIII to a value of approximately 30%. Values remained very low during the whole observation period of up to 20 days. However, in patients treated with heparin, values tended to be 10--15% higher. After an initial decline on the tenth day, the platelets had risen to the lowest normal level. Platelets were identical in both groups. The causes for the changes in these haemostasis parameters, their significance, and possible consequences of therapy are discussed.

  9. Borderline Personality Disorder: Therapeutic Factors.

    Science.gov (United States)

    Stone, Michael H

    2016-01-01

    Proponents of the now half-dozen major psychotherapeutic approaches tend to claim the superiority of their different approaches-known widely by their acronyms: CBT for Cognitive Behavioral Therapy, DBT for Dialectic Behavioral Therapy, MBT for Mentalization-Based Therapy, TFP for Transference- Focused Psychotherapy, and so on. The data thus far support the utility of each method, but do not show clear-cut superiority of any one method. A large percentage of BPD patients eventually improve or even recover, but these favorable results appear to derive from a multiplicity of factors. These include the personality traits of both patient and therapist, the unpredictable life events over time, the socioeconomic and cultural background of the patient, and the placebo effect of simply being in treatment. These latter factors constitute the contextual model, which operates alongside the medical model, each playing a role in eventual outcome. The contextual model will be discussed extensively in a separate article.

  10. Determining Factors of Subsidiary Development

    DEFF Research Database (Denmark)

    Pedersen, Torben

    (the depth of activities) and level of integration in the internal MNC-network. Birkinshaw and Hood (1998a) have in their seminal paper proposed a model where subsidiary development is determined by three factors: Headquarter assignment, dynamism of local business environment and subsidiary initiatives......Subsidiary development is a multi-dimensional construct that cannot be captured just by looking at subsidiary roles, activities, etc. Three distinct dimensions of subsidiary development are identified and these are: scope of subsidiary (the breadth of activities), level of subsidiary competence....... This paper is the first to conduct a statistical test of this model on a large-sample data set including data of more than 2.100 subsidiaries located in seven different countries in Europe. The effect of the three determining factors on subsidiary development is tested simultaneously in a LISREL model....

  11. Factors contributing to adolescent obesity.

    Science.gov (United States)

    Al-Kloub, Manal I; Froelicher, Erika S

    2009-06-01

    Obesity in children is a significant public health concern. The prevalence of overweight and obesity in Jordanian children, and adolescents has increased in the last decade. The consequences of obesity to health in childhood and adulthood have both medical, and economic cost to individuals and society. This paper reviews the factors that contribute to adolescent obesity and emphasizes behavioral and environmental factors. An individual's behaviors such as increased consumption of high caloric foods, increased sedentary activity while decreasing physical activity has been identified as key issues in the development of obesity. Additionally, the current environment in homes, schools, and neighborhoods tend to discourage a healthy lifestyle. A comprehensive approach that involves the whole community is the best strategy for preventing adolescent obesity. Nurses are in a unique position to provide leadership in developing programs for healthier lifestyle choices for adolescents' and adoption of these goals into their daily lives.

  12. Human Factors and Medical Devices

    International Nuclear Information System (INIS)

    Dick Sawyer

    1998-01-01

    Medical device hardware- and software-driven user interfaces should be designed to minimize the likelihood of use-related errors and their consequences. The role of design-induced errors in medical device incidents is attracting widespread attention. The U.S. Food and Drug Administration (FDA) is fully cognizant that human factors engineering is critical to the design of safe medical devices, and user interface design is receiving substantial attention by the agency. Companies are paying more attention to the impact of device design, including user instructions, upon the performance of those health professionals and lay users who operate medical devices. Concurrently, the FDA is monitoring human factors issues in its site inspections, premarket device approvals, and postmarket incident evaluations. Overall, the outlook for improved designs and safer device operation is bright

  13. Significance evaluation in factor graphs

    DEFF Research Database (Denmark)

    Madsen, Tobias; Hobolth, Asger; Jensen, Jens Ledet

    2017-01-01

    in genomics and the multiple-testing issues accompanying them, accurate significance evaluation is of great importance. We here address the problem of evaluating statistical significance of observations from factor graph models. Results Two novel numerical approximations for evaluation of statistical...... significance are presented. First a method using importance sampling. Second a saddlepoint approximation based method. We develop algorithms to efficiently compute the approximations and compare them to naive sampling and the normal approximation. The individual merits of the methods are analysed both from....... Conclusions The applicability of saddlepoint approximation and importance sampling is demonstrated on known models in the factor graph framework. Using the two methods we can substantially improve computational cost without compromising accuracy. This contribution allows analyses of large datasets...

  14. Strange mesonic transition form factor

    International Nuclear Information System (INIS)

    Goity, J.L.; Musolf, M.J.

    1996-01-01

    The strange-quark vector current ρ-to-π meson transition form factor is computed at one-loop order using strange meson intermediate states. A comparison is made with a φ-meson dominance model estimate. We find that one-loop contributions are comparable in magnitude to those predicted by φ-meson dominance. It is possible that the one-loop contribution can make the matrix element as large as those of the electromagnetic current mediating vector meson radiative decays. However, due to the quadratic dependence of the one-loop results on the hadronic form factor cutoff mass, a large uncertainty in the estimate of the loops is unavoidable. These results indicate that non-nucleonic strange quarks could contribute appreciable in moderate-parallel Q 2 parallel parity-violating electron-nucleus scattering measurements aimed at probing the strange-quark content of the nucleon. copyright 1996 The American Physical Society

  15. Geological factors of deposit formation

    International Nuclear Information System (INIS)

    Grushevoj, G.V.

    1980-01-01

    Geologic factors of hydrogenic uranium deposit formation are considered. Structural, formation and lithological-facies factors of deposit formation, connected with zones of stratal oxidation, are characterized. Peculiarities of deposit localization, connected with orogenic structures of Mesozoic and lenozoic age, are described. It is noted that deposits of anagenous group are widely spread in Paleozoic formations, infiltration uranium deposits are localized mainly in Cenozoic sediments, while uranium mineralization both anagenous and infiltration groups are widely developed in Mesozoic sediments. Anagenous deposits were formed in non-oxygen situation, their age varies from 200 to 55 mln years. Infiltration deposit formation is determined by asymmetric oxidation zonation, their age varies from 10 - 40 mln years to dozens of thousand years [ru

  16. Critical factors to bioenergy implementation

    International Nuclear Information System (INIS)

    Roos, A.; Hektor, B.; Rakos, C.

    1999-01-01

    Barriers to bioenergy technology implementation have received increased attention in recent years. This paper contributes to the identification and analysis of barriers and drivers behind bioenergy market growth, here labelled c ritical factors . It presents a framework for the analysis of both existing and projected bioenergy market potential, using economic concepts and models from transaction cost theory and industrial organization. The framework can be used for assessments of the potential for market growth of different bioenergy systems by decision makers in administration and industry. The following critical factors are identified: Integration with other economic activity, Scale effects on bioenergy markets, Competition in bioenergy markets, Competition with other business, National policy, Local policy and local opinion. The framework is demonstrated with five cases of real bioenergy markets: Pellet residential heating in USA, bioenergy power in USA, pellet residential heating in Sweden, biomass district heating in Sweden, and biomass district heating in Austria. Different applications of the framework are discussed

  17. Automatic Power Factor Correction Using Capacitive Bank

    OpenAIRE

    Mr.Anant Kumar Tiwari,; Mrs. Durga Sharma

    2014-01-01

    The power factor correction of electrical loads is a problem common to all industrial companies. Earlier the power factor correction was done by adjusting the capacitive bank manually [1]. The automated power factor corrector (APFC) using capacitive load bank is helpful in providing the power factor correction. Proposed automated project involves measuring the power factor value from the load using microcontroller. The design of this auto-adjustable power factor correction is ...

  18. Theoretical Fundamentals of Human Factor

    OpenAIRE

    Nicoleta Maria Ienciu

    2012-01-01

    The purpose of this paper is to identify the theoretical approaches presented by the literature on the human factor. In order to achieve such objective we have performed a qualitative research by analyzing the content of several papers published in internationally renowned journals, classified according to the list of journals' ranking provided by the Association of Business Schools (UK), in relation to the theories that have been approached within it. Our findings suggest that from all ident...

  19. Human factors in waste management

    International Nuclear Information System (INIS)

    Moray, N.

    1994-01-01

    This article examines the role of human factors in radioactive waste management. Although few problems and ergonomics are special to radioactive waste management, some problems are unique especially with long term storage. The entire sociotechnical system must be looked at in order to see where improvement can take place because operator errors, as seen in Chernobyl and Bhopal, are ultimately the result of management errors

  20. Human Factors in Space Exploration

    Science.gov (United States)

    Jones, Patricia M.; Fiedler, Edna

    2010-01-01

    The exploration of space is one of the most fascinating domains to study from a human factors perspective. Like other complex work domains such as aviation (Pritchett and Kim, 2008), air traffic management (Durso and Manning, 2008), health care (Morrow, North, and Wickens, 2006), homeland security (Cooke and Winner, 2008), and vehicle control (Lee, 2006), space exploration is a large-scale sociotechnical work domain characterized by complexity, dynamism, uncertainty, and risk in real-time operational contexts (Perrow, 1999; Woods et ai, 1994). Nearly the entire gamut of human factors issues - for example, human-automation interaction (Sheridan and Parasuraman, 2006), telerobotics, display and control design (Smith, Bennett, and Stone, 2006), usability, anthropometry (Chaffin, 2008), biomechanics (Marras and Radwin, 2006), safety engineering, emergency operations, maintenance human factors, situation awareness (Tenney and Pew, 2006), crew resource management (Salas et aI., 2006), methods for cognitive work analysis (Bisantz and Roth, 2008) and the like -- are applicable to astronauts, mission control, operational medicine, Space Shuttle manufacturing and assembly operations, and space suit designers as they are in other work domains (e.g., Bloomberg, 2003; Bos et al, 2006; Brooks and Ince, 1992; Casler and Cook, 1999; Jones, 1994; McCurdy et ai, 2006; Neerincx et aI., 2006; Olofinboba and Dorneich, 2005; Patterson, Watts-Perotti and Woods, 1999; Patterson and Woods, 2001; Seagull et ai, 2007; Sierhuis, Clancey and Sims, 2002). The human exploration of space also has unique challenges of particular interest to human factors research and practice. This chapter provides an overview of those issues and reports on sorne of the latest research results as well as the latest challenges still facing the field.

  1. Calibration factor or calibration coefficient?

    International Nuclear Information System (INIS)

    Meghzifene, A.; Shortt, K.R.

    2002-01-01

    Full text: The IAEA/WHO network of SSDLs was set up in order to establish links between SSDL members and the international measurement system. At the end of 2001, there were 73 network members in 63 Member States. The SSDL network members provide calibration services to end-users at the national or regional level. The results of the calibrations are summarized in a document called calibration report or calibration certificate. The IAEA has been using the term calibration certificate and will continue using the same terminology. The most important information in a calibration certificate is a list of calibration factors and their related uncertainties that apply to the calibrated instrument for the well-defined irradiation and ambient conditions. The IAEA has recently decided to change the term calibration factor to calibration coefficient, to be fully in line with ISO [ISO 31-0], which recommends the use of the term coefficient when it links two quantities A and B (equation 1) that have different dimensions. The term factor should only be used for k when it is used to link the terms A and B that have the same dimensions A=k.B. However, in a typical calibration, an ion chamber is calibrated in terms of a physical quantity such as air kerma, dose to water, ambient dose equivalent, etc. If the chamber is calibrated together with its electrometer, then the calibration refers to the physical quantity to be measured per electrometer unit reading. In this case, the terms referred have different dimensions. The adoption by the Agency of the term coefficient to express the results of calibrations is consistent with the 'International vocabulary of basic and general terms in metrology' prepared jointly by the BIPM, IEC, ISO, OIML and other organizations. The BIPM has changed from factor to coefficient. The authors believe that this is more than just a matter of semantics and recommend that the SSDL network members adopt this change in terminology. (author)

  2. Islamic factor in contemporary Russia

    OpenAIRE

    N. M. Shalenna

    2014-01-01

    Russian Federation, a Eurasian multinational state, has a significant number of indigenous Muslim population (about 10%) that continues to increase not only due to natural growth and conversion of non-Muslims to Islam, but also as a result of intensive immigration from the Central Asian countries and Azerbaijan. Islamic factor significantly predetermined policy of Russia during its historical development. The importance of Islam in contemporary political life has been underlined by many gover...

  3. Contingent factors affecting network learning

    OpenAIRE

    Peters, Linda D.; Pressey, Andrew D.; Johnston, Wesley J.

    2016-01-01

    To increase understanding of the impact of individuals on organizational learning processes, this paper explores the impact of individual cognition and action on the absorptive capacity process of the wider network. In particular this study shows how contingent factors such as social integration mechanisms and power relationships influence how network members engage in, and benefit from, learning. The use of cognitive consistency and sensemaking theory enables examination of how these conting...

  4. HIV: Social and Environmental Factors

    Centers for Disease Control (CDC) Podcasts

    2012-02-01

    Dr. Kevin Fenton, Director of CDC’s National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention, discusses how social and environmental factors may put African Americans at greater risk for HIV.  Created: 2/1/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 2/1/2012.

  5. Insomnia: prevalence and associated factors

    OpenAIRE

    Lopes, Cátia; Lopes, Daniela; Ferreira, Sofia; Correia, Teresa; Pinto, Isabel C.

    2014-01-01

    Nowadays sleep disorders are very common and affect most of the population, the most common may be insomnia. Insomnia is defined as the difficulty of initiating or maintaining sleep it, may also be reflected in an early wake up and by the presence of a non-restful sleep and it is associated with impairment in social and occupational functioning of the individual. Knowing the prevalence and the associated factors of insomnia. This is a cross-sectional epidemiological study. The pop...

  6. Psychological factors affecting equine performance

    OpenAIRE

    McBride, Sebastian D; Mills, Daniel S

    2012-01-01

    Abstract For optimal individual performance within any equestrian discipline horses must be in peak physical condition and have the correct psychological state. This review discusses the psychological factors that affect the performance of the horse and, in turn, identifies areas within the competition horse industry where current behavioral research and established behavioral modification techniques could be applied to further enhance the performance of animals. In particular, the role of af...

  7. Asma bronquial: factores de riesgo de las crisis y factores preventivos Bronchial asthma: risk factors of crises and preventive factors

    Directory of Open Access Journals (Sweden)

    Anselmo Abdo Rodríguez

    2007-09-01

    Full Text Available En los últimos años, y con motivo de los avances que se realizan en el campo de la investigación del asma bronquial, los conceptos en su prevención han ido cambiando entre los especialistas que lo tratan. Este trabajo tiene como objetivo llevar el conocimiento básico necesario a los profesionales de la medicina, para que a cada paciente asmático, atendido por primera vez, se le determinen los alergenos desencadenantes, los factores agravantes y socioculturales que le rodean y que pueden estar afectándolo. Se aborda la sensibilización a alergenos desde la etapa embrionaria y lactancia en el niño atópico, cuándo debemos considerar a un niño con alto riesgo alérgico, los factores de riesgo más importantes, con experiencias prácticas en el Hospital Universitario “Calixto García”, y las recomendaciones para la prevención de las enfermedades alérgicas en lactantes e infantes de alto riesgo alérgico.En recent years and advances in research field of bronchial asthma, features in its prevention has been changing among specialists treating it. Aim of this paper is to transmit the basic and necessary knowledge to medicine professionals for that in each asthmatic patient treated for the first time, the triggering allergens, aggravating factors, and the surrounded sociocultural ones, affecting him be determined. Authors approach sensitivity to allergens from embryonic stage and the lactation in atopic child, when we must to consider the case of an allergic and in high risk child, the more significant risk factors, with practical experiences in “Calixto García” University Hospital, and recommendations for preventions of allergic diseases in infants and breast-fed child in high risk of allergy.

  8. Mutagenic effect of clastogenic factors

    International Nuclear Information System (INIS)

    Blagov, P.S.; Morozik, M.S.; Morozik, V.M.

    2007-01-01

    Clastogenic factors (CF) were first described in the plasma of persons who had been irradiated accidentally or therapeutically. In present study, the effect of CF from blood serum samples from Chernobyl liquidators on HPV-G (human keratinocyte cells immortalized with HPV virus) cells using micronuclei test has been studied. The analysis has shown that CF from liquidators' serum samples induce significantly higher level of micronuclei compared to control. (authors)

  9. College factors that influence drinking.

    Science.gov (United States)

    Presley, Cheryl A; Meilman, Philip W; Leichliter, Jami S

    2002-03-01

    The purpose of this article is to examine the aspects of collegiate environments, rather than student characteristics, that influence drinking. Unfortunately, the existing literature is scant on this topic. A literature review of articles primarily published within the last 10 years, along with some earlier "landmark" studies of collegiate drinking in the United States, was conducted to determine institutional factors that influence the consumption of alcohol. In addition, a demonstration analysis of Core Alcohol and Drug Survey research findings was conducted to further elucidate the issues. Several factors have been shown to relate to drinking: (1) organizational property variables of campuses, including affiliations (historically black institutions, women's institutions), presence of a Greek system, athletics and 2- or 4-year designation; (2) physical and behavioral property variables of campuses, including type of residence, institution size, location and quantity of heavy episodic drinking; and (3) campus community property variables, including pricing and availability and outlet density. Studies, however, tend to look at individual variables one at a time rather than in combination (multivariate analyses). Some new analyses, using Core Alcohol and Drug Survey data sets, are presented as examples of promising approaches to future research. Given the complexities of campus environments, it continues to be a challenge to the field to firmly establish the most compelling institutional and environmental factors relating to high-risk collegiate drinking.

  10. Column: Factors Affecting Data Decay

    Directory of Open Access Journals (Sweden)

    Kevin Fairbanks

    2012-06-01

    Full Text Available In nuclear physics, the phrase decay rate is used to denote the rate that atoms and other particles spontaneously decompose. Uranium-235 famously decays into a variety of daughter isotopes including Thorium and Neptunium, which themselves decay to others. Decay rates are widely observed and wildly different depending on many factors, both internal and external. U-235 has a half-life of 703,800,000 years, for example, while free neutrons have a half-life of 611 seconds and neutrons in an atomic nucleus are stable.We posit that data in computer systems also experiences some kind of statistical decay process and thus also has a discernible decay rate. Like atomic decay, data decay fluctuates wildly. But unlike atomic decay, data decay rates are the result of so many different interplaying processes that we currently do not understand them well enough to come up with quantifiable numbers. Nevertheless, we believe that it is useful to discuss some of the factors that impact the data decay rate, for these factors frequently determine whether useful data about a subject can be recovered by forensic investigation.(see PDF for full column

  11. Factorizing the time evolution operator

    International Nuclear Information System (INIS)

    Garcia Quijas, P C; Arevalo Aguilar, L M

    2007-01-01

    There is a widespread belief in the quantum physical community, and textbooks used to teach quantum mechanics, that it is a difficult task to apply the time evolution operator e itH-hat/h on an initial wavefunction. Because the Hamiltonian operator is, generally, the sum of two operators, then it is not possible to apply the time evolution operator on an initial wavefunction ψ(x, 0), for it implies using terms like (a-hat + b-hat). A possible solution is to factorize the time evolution operator and then apply successively the individual exponential operator on the initial wavefunction. However, the exponential operator does not directly factorize, i.e. e a-hat+b-hat ≠ e a-hat e b-hat . In this study we present a useful procedure for factorizing the time evolution operator when the argument of the exponential is a sum of two operators, which obey specific commutation relations. Then, we apply the exponential operator as an evolution operator for the case of elementary unidimensional potentials, like a particle subject to a constant force and a harmonic oscillator. Also, we discuss an apparent paradox concerning the time evolution operator and non-spreading wave packets addressed previously in the literature

  12. Factors Influencing Learner Permit Duration

    Directory of Open Access Journals (Sweden)

    Johnathon P. Ehsani

    2016-12-01

    Full Text Available An increasing number of countries are requiring an extended learner permit prior to independent driving. The question of when drivers begin the learner permit period, and how long they hold the permit before advancing to independent licensure has received little research attention. Licensure timing is likely to be related to “push” and “pull” factors which may encourage or inhibit the process. To examine this question, we recruited a sample of 90 novice drivers (49 females and 41 males, average age of 15.6 years soon after they obtained a learner permit and instrumented their vehicles to collect a range of driving data. Participants completed a series of surveys at recruitment related to factors that may influence licensure timing. Two distinct findings emerged from the time-to-event analysis that tested these push and pull factors in relation to licensure timing. The first can be conceptualized as teens’ motivation to drive (push, reflected in a younger age when obtaining a learner permit and extensive pre-permit driving experience. The second finding was teens’ perceptions of their parents’ knowledge of their activities (pull; a proxy for a parents’ attentiveness to their teens’ lives. Teens who reported higher levels of their parents’ knowledge of their activities took longer to advance to independent driving. These findings suggest time-to-licensure may be related to teens’ internal motivation to drive, and the ability of parents to facilitate or impede early licensure.

  13. Human Factors in Financial Trading

    Science.gov (United States)

    Leaver, Meghan; Reader, Tom W.

    2016-01-01

    Objective This study tests the reliability of a system (FINANS) to collect and analyze incident reports in the financial trading domain and is guided by a human factors taxonomy used to describe error in the trading domain. Background Research indicates the utility of applying human factors theory to understand error in finance, yet empirical research is lacking. We report on the development of the first system for capturing and analyzing human factors–related issues in operational trading incidents. Method In the first study, 20 incidents are analyzed by an expert user group against a referent standard to establish the reliability of FINANS. In the second study, 750 incidents are analyzed using distribution, mean, pathway, and associative analysis to describe the data. Results Kappa scores indicate that categories within FINANS can be reliably used to identify and extract data on human factors–related problems underlying trading incidents. Approximately 1% of trades (n = 750) lead to an incident. Slip/lapse (61%), situation awareness (51%), and teamwork (40%) were found to be the most common problems underlying incidents. For the most serious incidents, problems in situation awareness and teamwork were most common. Conclusion We show that (a) experts in the trading domain can reliably and accurately code human factors in incidents, (b) 1% of trades incur error, and (c) poor teamwork skills and situation awareness underpin the most critical incidents. Application This research provides data crucial for ameliorating risk within financial trading organizations, with implications for regulation and policy. PMID:27142394

  14. Human factors in RBNK plants

    International Nuclear Information System (INIS)

    Demitrack, T.

    1995-01-01

    The Safety of RBMK nuclear power plants in the Russian Federation, The Ukraine and Lithuanian is a topic of concern to the European Union and other Western European countries. The European Commission, Sweden, Finland and Canada financed the project Safety Design Solutions and Operation of NPP with RBMK Reactors. The project examined nine issues and recommended safety improvements which will form the basis of future European Commission spending on these power plants. During its year of work, the project examined these issues: 1. Systems Engineering and progression of accidents 2. Protection System 3. Core Physics 4. External Events 5. Engineering Quality 6. Operating Experience 7. Human Factors 8. Regulatory Interface 9. Probabilistic Safety analysis Empresarios Agrupados, in collaboration with other western European firms, the Russian Federation and Lithuanian took part in two of these groups, Human Factors and Probabilistic Safety Analysis. This presentation gives a brief description of the most important aspects of human factors in RBMK plants, focusing on operations organization, training and education

  15. Schisandra chinensis regulates drug metabolizing enzymes and drug transporters via activation of Nrf2-mediated signaling pathway

    Directory of Open Access Journals (Sweden)

    He JL

    2014-12-01

    Full Text Available Jin-Lian He,1 Zhi-Wei Zhou,2,3 Juan-Juan Yin,2 Chang-Qiang He,1 Shu-Feng Zhou,2,3 Yang Yu1 1College of Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong, People’s Republic of China; 2Department of Pharmaceutical Sciences, College of Pharmacy, University of South Florida, Tampa, FL, USA; 3Guizhou Provincial Key Laboratory for Regenerative Medicine, Stem Cell and Tissue Engineering Research Center and Sino-US Joint Laboratory for Medical Sciences, Guiyang Medical University, Guiyang, Guizhou, People’s Republic of China Abstract: Drug metabolizing enzymes (DMEs and drug transporters are regulated via epigenetic, transcriptional, posttranscriptional, and translational and posttranslational modifications. Phase I and II DMEs and drug transporters play an important role in the disposition and detoxification of a large number of endogenous and exogenous compounds. The nuclear factor (erythroid-derived 2-like 2 (Nrf2 is a critical regulator of a variety of important cytoprotective genes that are involved in disposition and detoxification of xenobiotics. Schisandra chinensis (SC is a commonly used traditional Chinese herbal medicine that has been primarily used to protect the liver because of its potent antioxidative and anti-inflammatory activities. SC can modulate some DMEs and drug transporters, but the underlying mechanisms are unclear. In this study, we aimed to explore the role of Nrf2 in the regulatory effect of SC extract (SCE on selected DMEs and drug transporters in human hepatocellular liver carcinoma cell line (HepG2 cells. The results showed that SCE, schisandrin A, and schisandrin B significantly increased the expression of NAD(PH: Nicotinamide Adenine Dinucleotide Phosphate-oxidase or:quinone oxidoreductase 1, heme oxygenase-1, glutamate–cysteine ligase, and glutathione S-transferase A4 at both transcriptional and posttranscriptional levels. Incubation of HepG2 cells with SCE resulted in a significant

  16. Model of a ternary complex between activated factor VII, tissue factor and factor IX.

    Science.gov (United States)

    Chen, Shu-wen W; Pellequer, Jean-Luc; Schved, Jean-François; Giansily-Blaizot, Muriel

    2002-07-01

    Upon binding to tissue factor, FVIIa triggers coagulation by activating vitamin K-dependent zymogens, factor IX (FIX) and factor X (FX). To understand recognition mechanisms in the initiation step of the coagulation cascade, we present a three-dimensional model of the ternary complex between FVIIa:TF:FIX. This model was built using a full-space search algorithm in combination with computational graphics. With the known crystallographic complex FVIIa:TF kept fixed, the FIX docking was performed first with FIX Gla-EGF1 domains, followed by the FIX protease/EGF2 domains. Because the FIXa crystal structure lacks electron density for the Gla domain, we constructed a chimeric FIX molecule that contains the Gla-EGF1 domains of FVIIa and the EGF2-protease domains of FIXa. The FVIIa:TF:FIX complex has been extensively challenged against experimental data including site-directed mutagenesis, inhibitory peptide data, haemophilia B database mutations, inhibitor antibodies and a novel exosite binding inhibitor peptide. This FVIIa:TF:FIX complex provides a powerful tool to study the regulation of FVIIa production and presents new avenues for developing therapeutic inhibitory compounds of FVIIa:TF:substrate complex.

  17. Factors affecting dental service quality.

    Science.gov (United States)

    Bahadori, Mohammadkarim; Raadabadi, Mehdi; Ravangard, Ramin; Baldacchino, Donia

    2015-01-01

    Measuring dental clinic service quality is the first and most important factor in improving care. The quality provided plays an important role in patient satisfaction. The purpose of this paper is to identify factors affecting dental service quality from the patients' viewpoint. This cross-sectional, descriptive-analytical study was conducted in a dental clinic in Tehran between January and June 2014. A sample of 385 patients was selected from two work shifts using stratified sampling proportional to size and simple random sampling methods. The data were collected, a self-administered questionnaire designed for the purpose of the study, based on the Parasuraman and Zeithaml's model of service quality which consisted of two parts: the patients' demographic characteristics and a 30-item questionnaire to measure the five dimensions of the service quality. The collected data were analysed using SPSS 21.0 and Amos 18.0 through some descriptive statistics such as mean, standard deviation, as well as analytical methods, including confirmatory factor. Results showed that the correlation coefficients for all dimensions were higher than 0.5. In this model, assurance (regression weight=0.99) and tangibility (regression weight=0.86) had, respectively, the highest and lowest effects on dental service quality. The Parasuraman and Zeithaml's model is suitable to measure quality in dental services. The variables related to dental services quality have been made according to the model. This is a pioneering study that uses Parasuraman and Zeithaml's model and CFA in a dental setting. This study provides useful insights and guidance for dental service quality assurance.

  18. Time factors in radiation carcinogenesis

    International Nuclear Information System (INIS)

    Sasaki, Shunsaku

    1995-01-01

    Results of experiments using B6C3F 1 female mice were made subject of analysis on the time factors in radiation carcinogenesis. In the experiment for examination of influence of age at irradiation on the lifetime risk and on distribution of ages at death, mice were irradiated at day 12, 14 or 17 of the prenatal period, or day 0, 7, 35, 105, 240 or 365 of the postnatal period with doses ranging from 0.48 to 5.7 Gy gamma-rays from 137 Cs. In the experiment to examine the reduction factor for carcinogenic effect by multiple fractionation of gamma-rays dose 1.9 or 3.8 Gy was divided into 10 fractions, which were delivered once a week during period from 5 to 15 weeks of age. All mice were allowed to live out their life spans under a specific pathogen free condition. The cumulative relative risk for mortality from all causes except lymphoma and leukemia was shown to decrease with age when mice were irradiated at the fetal, neonatal, suckling, adolescent or young adult period, whereas, the decrease in the cumulative relative risk was very little when gamma-rays were given at the intermediate adult period. The lifetime risk for the increase in mortality and for the induction of solid tumors was highest in mice irradiated during neonatal, suckling or adolescent period. Age-dependence of susceptibility to radiation carcinogenesis was different for each type of neoplasm. However, the most susceptible period for induction of each type of neoplasm concentrated in the age from neonatal to adolescent period. Radiation-induced late effects were apparently reduced by multiple fractionation of radiation dose, but the reduction factor for the increase in the long-term mortality did not exceed 2.0. (author)

  19. Risk factor management: antiatherogenic therapies.

    Science.gov (United States)

    Gielen, Stephan; Sandri, Marcus; Schuler, Gerhard; Teupser, Daniel

    2009-08-01

    Despite the advances in interventional techniques, the management of stable atherosclerosis remains the domain of optimal guideline-oriented therapy. Recent studies on the effects of aggressive lipid lowering on atheroma volume changes using intravascular ultrasound indicate that it is possible to achieve atherosclerosis regression by reaching low-density lipoprotein (LDL) levels less than 75 mg/dl. The pleiotropic anti-inflammatory effects of statins contribute to the reduction of cardiovascular (CV) event observed with aggressive lipid lowering. As a second important strategy to prevent disease progression, lifestyle changes with regular physical exercise are capable of halting the atherosclerotic process and reducing angina symptoms and CV events. Optimal medical therapy, a healthy lifestyle with regular physical exercise, and coronary interventions are not mutually exclusive treatment strategies. Over the last few decades, both have proved to be effective in significantly reducing the CV mortality in the Western world. However, risk factor modification contributed to at least half the effect in the reduction of CV mortality. This figure provides an estimate of what could be achieved if we were to take risk factor modification more seriously - especially in the acute care setting. The knowledge is there: today we have a better understanding on how to stop progression and even induce regression of atherosclerosis. Much research still needs to be done and will be done. In the meantime, however, our primary focus should lie in implementing what is already known. In addition, it is essential not just to treat CV risk factors, but also to treat them to achieve the target values as set by the guidelines of European Society of Cardiology.

  20. Oil: economic and political factors

    International Nuclear Information System (INIS)

    Ayoub, A.

    1994-01-01

    This article deals with the evolution of the international petroleum sector since 1973 with a special view to interdependence between the economic and political factors that influence it. Two issues are focused upon: (1) the effects of the nationalization of oil companies on the sharing of oil rents and on changes in the structure of the oil market; and (2) the determination of oil prices. The latter involves a discussion of, on the one hand, the political and economic behaviour of the United States and Saudi Arabia and, on the other, the combination of cooperation and conflict that has tended to characterize relations among OPEC countries. (author). 30 refs