Threats to the Internal Validity of Experimental and Quasi-Experimental Research in Healthcare.

Science.gov (United States)

Flannelly, Kevin J; Flannelly, Laura T; Jankowski, Katherine R B

2018-01-24

The article defines, describes, and discusses the seven threats to the internal validity of experiments discussed by Donald T. Campbell in his classic 1957 article: history, maturation, testing, instrument decay, statistical regression, selection, and mortality. These concepts are said to be threats to the internal validity of experiments because they pose alternate explanations for the apparent causal relationship between the independent variable and dependent variable of an experiment if they are not adequately controlled. A series of simple diagrams illustrate three pre-experimental designs and three true experimental designs discussed by Campbell in 1957 and several quasi-experimental designs described in his book written with Julian C. Stanley in 1966. The current article explains why each design controls for or fails to control for these seven threats to internal validity.

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

Science.gov (United States)

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

Science.gov (United States)

Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

2017-08-01

The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

A new set of validated SSR primers for application in mulberry ...

Indian Academy of Sciences (India)

user

2018-01-11

Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

Lucas, D.S.

2004-10-03

This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

DEFF Research Database (Denmark)

Busk, Peter Kamp

2014-01-01

of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

Science.gov (United States)

Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

2017-02-01

There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

Experimental validation of the HARMONIE code

International Nuclear Information System (INIS)

Bernard, A.; Dorsselaere, J.P. van

1984-01-01

An experimental program of deformation, in air, of different groups of subassemblies (7 to 41 subassemblies), was performed on a scale 1 mock-up in the SPX1 geometry, in order to achieve a first experimental validation of the code HARMONIE. The agreement between tests and calculations was suitable, qualitatively for all the groups and quantitatively for regular groups of 19 subassemblies at most. The differences come mainly from friction between pads, and secondly from the foot gaps. (author)

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

Science.gov (United States)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

Directory of Open Access Journals (Sweden)

Andrea Fuso

Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

Polyacid macromolecule primers

Science.gov (United States)

Sugama, Toshifumi.

1989-12-26

Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

Fission Product Experimental Program: Validation and Computational Analysis

Energy Technology Data Exchange (ETDEWEB)

Leclaire, N.; Ivanova, T.; Letang, E. [Inst Radioprotect and Surete Nucl, F-92262 Fontenay Aux Roses (France); Girault, E. [CEA Valduc, Serv Rech Neutron and Critcite, 21 - Is-sur-Tille (France); Thro, J. F. [AREVA NC, F-78000 Versailles (France)

2009-02-15

From 1998 to 2004, a series of critical experiments referred to as the fission product (FP) experimental program was performed at the Commissariat a l'Energie Atomique Valduc research facility. The experiments were designed by Institut de Radioprotection et de Surete Nucleaire (IRSN) and funded by AREVA NC and IRSN within the French program supporting development of a technical basis for burnup credit validation. The experiments were performed with the following six key fission products encountered in solution either individually or as mixtures: {sup 103}Rh, {sup 133}Cs, {sup nat}Nd, {sup 149}Sm, {sup 152}Sm, and {sup 155}Gd. The program aimed at compensating for the lack of information on critical experiments involving FPs and at establishing a basis for FPs credit validation. One hundred forty-five critical experiments were performed, evaluated, and analyzed with the French CRISTAL criticality safety package and the American SCALE5. 1 code system employing different cross-section libraries. The aim of the paper is to show the experimental data potential to improve the ability to perform validation of full burnup credit calculation. The paper describes three Phases of the experimental program; the results of preliminary evaluation, the calculation, and the sensitivity/uncertainty study of the FP experiments used to validate the APOLLO2-MORET 4 route in the CRISTAL criticality package for burnup credit applications. (authors)

PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

DEFF Research Database (Denmark)

Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

2011-01-01

containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

Science.gov (United States)

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

Contact Modelling in Resistance Welding, Part II: Experimental Validation

DEFF Research Database (Denmark)

Song, Quanfeng; Zhang, Wenqi; Bay, Niels

2006-01-01

Contact algorithms in resistance welding presented in the previous paper are experimentally validated in the present paper. In order to verify the mechanical contact algorithm, two types of experiments, i.e. sandwich upsetting of circular, cylindrical specimens and compression tests of discs...... with a solid ring projection towards a flat ring, are carried out at room temperature. The complete algorithm, involving not only the mechanical model but also the thermal and electrical models, is validated by projection welding experiments. The experimental results are in satisfactory agreement...

GST-PRIME: an algorithm for genome-wide primer design.

Science.gov (United States)

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

Science.gov (United States)

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

Directory of Open Access Journals (Sweden)

Puntipar Sonthiphand

Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

Criticality calculations with MCNP trademark: A primer

International Nuclear Information System (INIS)

Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

1994-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

Low-copy nuclear primers and ycf1 primers in Cactaceae.

Science.gov (United States)

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

Experimental validation of optimum resistance moment of concrete ...

African Journals Online (AJOL)

Experimental validation of optimum resistance moment of concrete slabs reinforced ... other solutions to combat corrosion problems in steel reinforced concrete. ... Eight specimens of two-way spanning slabs reinforced with CFRP bars were ...

Solar-Diesel Hybrid Power System Optimization and Experimental Validation

Science.gov (United States)

Jacobus, Headley Stewart

As of 2008 1.46 billion people, or 22 percent of the World's population, were without electricity. Many of these people live in remote areas where decentralized generation is the only method of electrification. Most mini-grids are powered by diesel generators, but new hybrid power systems are becoming a reliable method to incorporate renewable energy while also reducing total system cost. This thesis quantifies the measurable Operational Costs for an experimental hybrid power system in Sierra Leone. Two software programs, Hybrid2 and HOMER, are used during the system design and subsequent analysis. Experimental data from the installed system is used to validate the two programs and to quantify the savings created by each component within the hybrid system. This thesis bridges the gap between design optimization studies that frequently lack subsequent validation and experimental hybrid system performance studies.

PEMFC modeling and experimental validation

Energy Technology Data Exchange (ETDEWEB)

Vargas, J.V.C. [Federal University of Parana (UFPR), Curitiba, PR (Brazil). Dept. of Mechanical Engineering], E-mail: jvargas@demec.ufpr.br; Ordonez, J.C.; Martins, L.S. [Florida State University, Tallahassee, FL (United States). Center for Advanced Power Systems], Emails: ordonez@caps.fsu.edu, martins@caps.fsu.edu

2009-07-01

In this paper, a simplified and comprehensive PEMFC mathematical model introduced in previous studies is experimentally validated. Numerical results are obtained for an existing set of commercial unit PEM fuel cells. The model accounts for pressure drops in the gas channels, and for temperature gradients with respect to space in the flow direction, that are investigated by direct infrared imaging, showing that even at low current operation such gradients are present in fuel cell operation, and therefore should be considered by a PEMFC model, since large coolant flow rates are limited due to induced high pressure drops in the cooling channels. The computed polarization and power curves are directly compared to the experimentally measured ones with good qualitative and quantitative agreement. The combination of accuracy and low computational time allow for the future utilization of the model as a reliable tool for PEMFC simulation, control, design and optimization purposes. (author)

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

Do we need primer for orthodontic bonding? A randomized controlled trial.

Science.gov (United States)

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

Experimental validation of a topology optimized acoustic cavity

DEFF Research Database (Denmark)

Christiansen, Rasmus Ellebæk; Sigmund, Ole; Fernandez Grande, Efren

2015-01-01

This paper presents the experimental validation of an acoustic cavity designed using topology optimization with the goal of minimizing the sound pressure locally for monochromatic excitation. The presented results show good agreement between simulations and measurements. The effect of damping...

Experimental Validation of a Permeability Model for Enrichment Membranes

International Nuclear Information System (INIS)

Orellano, Pablo; Brasnarof, Daniel; Florido Pablo

2003-01-01

An experimental loop with a real scale diffuser, in a single enrichment-stage configuration, was operated with air at different process conditions, in order to characterize the membrane permeability.Using these experimental data, an analytical geometric-and-morphologic-based model was validated.It is conclude that a new set of independent measurements, i.e. enrichment, is necessary in order to fully characterize diffusers, because of its internal parameters are not univocally determinated with permeability experimental data only

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

Science.gov (United States)

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Development of a quality-assessment tool for experimental bruxism studies: reliability and validity.

Science.gov (United States)

Dawson, Andreas; Raphael, Karen G; Glaros, Alan; Axelsson, Susanna; Arima, Taro; Ernberg, Malin; Farella, Mauro; Lobbezoo, Frank; Manfredini, Daniele; Michelotti, Ambra; Svensson, Peter; List, Thomas

2013-01-01

To combine empirical evidence and expert opinion in a formal consensus method in order to develop a quality-assessment tool for experimental bruxism studies in systematic reviews. Tool development comprised five steps: (1) preliminary decisions, (2) item generation, (3) face-validity assessment, (4) reliability and discriminitive validity assessment, and (5) instrument refinement. The kappa value and phi-coefficient were calculated to assess inter-observer reliability and discriminative ability, respectively. Following preliminary decisions and a literature review, a list of 52 items to be considered for inclusion in the tool was compiled. Eleven experts were invited to join a Delphi panel and 10 accepted. Four Delphi rounds reduced the preliminary tool-Quality-Assessment Tool for Experimental Bruxism Studies (Qu-ATEBS)- to 8 items: study aim, study sample, control condition or group, study design, experimental bruxism task, statistics, interpretation of results, and conflict of interest statement. Consensus among the Delphi panelists yielded good face validity. Inter-observer reliability was acceptable (k = 0.77). Discriminative validity was excellent (phi coefficient 1.0; P reviews of experimental bruxism studies, exhibits face validity, excellent discriminative validity, and acceptable inter-observer reliability. Development of quality assessment tools for many other topics in the orofacial pain literature is needed and may follow the described procedure.

HTC Experimental Program: Validation and Calculational Analysis

Energy Technology Data Exchange (ETDEWEB)

Fernex, F.; Ivanova, T.; Bernard, F.; Letang, E. [Inst Radioprotect and Surete Nucl, F-92262 Fontenay Aux Roses (France); Fouillaud, P. [CEA Valduc, Serv Rech Neutron and Critcite, 21 - Is-sur-Tille (France); Thro, J. F. [AREVA NC, F-78000 Versailles (France)

2009-05-15

In the 1980's a series of the Haut Taux de Combustion (HTC) critical experiments with fuel pins in a water-moderated lattice was conducted at the Apparatus B experimental facility in Valduc (Commissariat a I'Energie Atomique, France) with the support of the Institut de Radioprotection et de Surete Nucleaire and AREVA NC. Four series of experiments were designed to assess profit associated with actinide-only burnup credit in the criticality safety evaluation for fuel handling, pool storage, and spent-fuel cask conditions. The HTC rods, specifically fabricated for the experiments, simulated typical pressurized water reactor uranium oxide spent fuel that had an initial enrichment of 4. 5 wt% {sup 235}U and was burned to 37.5 GWd/tonne U. The configurations have been modeled with the CRISTAL criticality package and SCALE 5.1 code system. Sensitivity/uncertainty analysis has been employed to evaluate the HTC experiments and to study their applicability for validation of burnup credit calculations. This paper presents the experimental program, the principal results of the experiment evaluation, and modeling. The HTC data applicability to burnup credit validation is demonstrated with an example of spent-fuel storage models. (authors)

Experimental validation of an ultrasonic flowmeter for unsteady flows

Science.gov (United States)

Leontidis, V.; Cuvier, C.; Caignaert, G.; Dupont, P.; Roussette, O.; Fammery, S.; Nivet, P.; Dazin, A.

2018-04-01

An ultrasonic flowmeter was developed for further applications in cryogenic conditions and for measuring flow rate fluctuations in the range of 0 to 70 Hz. The prototype was installed in a flow test rig, and was validated experimentally both in steady and unsteady water flow conditions. A Coriolis flowmeter was used for the calibration under steady state conditions, whereas in the unsteady case the validation was done simultaneously against two methods: particle image velocimetry (PIV), and with pressure transducers installed flush on the wall of the pipe. The results show that the developed flowmeter and the proposed methodology can accurately measure the frequency and amplitude of unsteady fluctuations in the experimental range of 0-9 l s-1 of the mean main flow rate and 0-70 Hz of the imposed disturbances.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

30 CFR 56.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

International Nuclear Information System (INIS)

Bowman, Stephen M.

2008-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

Experimental validation of a new heterogeneous mechanical test design

Science.gov (United States)

Aquino, J.; Campos, A. Andrade; Souto, N.; Thuillier, S.

2018-05-01

Standard material parameters identification strategies generally use an extensive number of classical tests for collecting the required experimental data. However, a great effort has been made recently by the scientific and industrial communities to support this experimental database on heterogeneous tests. These tests can provide richer information on the material behavior allowing the identification of a more complete set of material parameters. This is a result of the recent development of full-field measurements techniques, like digital image correlation (DIC), that can capture the heterogeneous deformation fields on the specimen surface during the test. Recently, new specimen geometries were designed to enhance the richness of the strain field and capture supplementary strain states. The butterfly specimen is an example of these new geometries, designed through a numerical optimization procedure where an indicator capable of evaluating the heterogeneity and the richness of strain information. However, no experimental validation was yet performed. The aim of this work is to experimentally validate the heterogeneous butterfly mechanical test in the parameter identification framework. For this aim, DIC technique and a Finite Element Model Up-date inverse strategy are used together for the parameter identification of a DC04 steel, as well as the calculation of the indicator. The experimental tests are carried out in a universal testing machine with the ARAMIS measuring system to provide the strain states on the specimen surface. The identification strategy is accomplished with the data obtained from the experimental tests and the results are compared to a reference numerical solution.

INL Experimental Program Roadmap for Thermal Hydraulic Code Validation

Energy Technology Data Exchange (ETDEWEB)

Glenn McCreery; Hugh McIlroy

2007-09-01

Advanced computer modeling and simulation tools and protocols will be heavily relied on for a wide variety of system studies, engineering design activities, and other aspects of the Next Generation Nuclear Power (NGNP) Very High Temperature Reactor (VHTR), the DOE Global Nuclear Energy Partnership (GNEP), and light-water reactors. The goal is for all modeling and simulation tools to be demonstrated accurate and reliable through a formal Verification and Validation (V&V) process, especially where such tools are to be used to establish safety margins and support regulatory compliance, or to design a system in a manner that reduces the role of expensive mockups and prototypes. Recent literature identifies specific experimental principles that must be followed in order to insure that experimental data meet the standards required for a “benchmark” database. Even for well conducted experiments, missing experimental details, such as geometrical definition, data reduction procedures, and manufacturing tolerances have led to poor Benchmark calculations. The INL has a long and deep history of research in thermal hydraulics, especially in the 1960s through 1980s when many programs such as LOFT and Semiscle were devoted to light-water reactor safety research, the EBRII fast reactor was in operation, and a strong geothermal energy program was established. The past can serve as a partial guide for reinvigorating thermal hydraulic research at the laboratory. However, new research programs need to fully incorporate modern experimental methods such as measurement techniques using the latest instrumentation, computerized data reduction, and scaling methodology. The path forward for establishing experimental research for code model validation will require benchmark experiments conducted in suitable facilities located at the INL. This document describes thermal hydraulic facility requirements and candidate buildings and presents examples of suitable validation experiments related

Experimental validation of the containment codes ASTARTE and SEURBNUK

International Nuclear Information System (INIS)

Kendall, K.C.; Arnold, L.A.; Broadhouse, B.J.; Jones, A.; Yerkess, A.; Benuzzi, A.

1979-10-01

The fast reactor containment codes ASTARTE and SEURBNUK are being validated against data from the COVA series of small scale experiments being performed jointly by the UKAEA and JRC Ispra. The experimental programme is nearly complete, and data are given. (U.K.)

Experimental validation of calculated atomic charges in ionic liquids

Science.gov (United States)

Fogarty, Richard M.; Matthews, Richard P.; Ashworth, Claire R.; Brandt-Talbot, Agnieszka; Palgrave, Robert G.; Bourne, Richard A.; Vander Hoogerstraete, Tom; Hunt, Patricia A.; Lovelock, Kevin R. J.

2018-05-01

A combination of X-ray photoelectron spectroscopy and near edge X-ray absorption fine structure spectroscopy has been used to provide an experimental measure of nitrogen atomic charges in nine ionic liquids (ILs). These experimental results are used to validate charges calculated with three computational methods: charges from electrostatic potentials using a grid-based method (ChelpG), natural bond orbital population analysis, and the atoms in molecules approach. By combining these results with those from a previous study on sulfur, we find that ChelpG charges provide the best description of the charge distribution in ILs. However, we find that ChelpG charges can lead to significant conformational dependence and therefore advise that small differences in ChelpG charges (<0.3 e) should be interpreted with care. We use these validated charges to provide physical insight into nitrogen atomic charges for the ILs probed.

DMFC performance and methanol cross-over: Experimental analysis and model validation

Energy Technology Data Exchange (ETDEWEB)

Casalegno, A.; Marchesi, R. [Dipartimento di Energia, Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy)

2008-10-15

A combined experimental and modelling approach is proposed to analyze methanol cross-over and its effect on DMFC performance. The experimental analysis is performed in order to allow an accurate investigation of methanol cross-over influence on DMFC performance, hence measurements were characterized in terms of uncertainty and reproducibility. The findings suggest that methanol cross-over is mainly determined by diffusion transport and affects cell performance partly via methanol electro-oxidation at the cathode. The modelling analysis is carried out to further investigate methanol cross-over phenomenon. A simple model evaluates the effectiveness of two proposed interpretations regarding methanol cross-over and its effects. The model is validated using the experimental data gathered. Both the experimental analysis and the proposed and validated model allow a substantial step forward in the understanding of the main phenomena associated with methanol cross-over. The findings confirm the possibility to reduce methanol cross-over by optimizing anode feeding. (author)

The Los Alamos primer

CERN Document Server

Serber, Robert

2018-01-01

Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

Criteria of the validation of experimental and evaluated covariance data

International Nuclear Information System (INIS)

Badikov, S.

2008-01-01

The criteria of the validation of experimental and evaluated covariance data are reviewed. In particular: a) the criterion of the positive definiteness for covariance matrices, b) the relationship between the 'integral' experimental and estimated uncertainties, c) the validity of the statistical invariants, d) the restrictions imposed to correlations between experimental errors, are described. Applying these criteria in nuclear data evaluation was considered and 4 particular points have been examined. First preserving positive definiteness of covariance matrices in case of arbitrary transformation of a random vector was considered, properties of the covariance matrices in operations widely used in neutron and reactor physics (splitting and collapsing energy groups, averaging the physical values over energy groups, estimation parameters on the basis of measurements by means of generalized least squares method) were studied. Secondly, an algorithm for comparison of experimental and estimated 'integral' uncertainties was developed, square root of determinant of a covariance matrix is recommended for use in nuclear data evaluation as a measure of 'integral' uncertainty for vectors of experimental and estimated values. Thirdly, a set of statistical invariants-values which are preserved in statistical processing was presented. And fourthly, the inequality that signals a correlation between experimental errors that leads to unphysical values is given. An application is given concerning the cross-section of the (n,t) reaction on Li 6 with a neutron incident energy comprised between 1 and 100 keV

Experimental validation of a mathematical model for seabed liquefaction in waves

DEFF Research Database (Denmark)

Sumer, B. Mutlu; Kirca, Özgür; Fredsøe, Jørgen

2011-01-01

This paper summarizes the results of an experimental study directed towards the validation of a mathematical model for the buildup of pore water pressure and resulting liquefaction of marine soils under progressive waves. Experiments were conducted under controlled conditions with silt ( d50 = 0.......070 mm) in a wave flume with a soil pit. Waves with wave heights in the range 7.7-18 cm with the water depth 55 cm and the wave period 1.6 s enabled us to study both the liquefaction and no-liquefaction regime pore water pressure buildup. The experimental data was used to validate the model. A numerical...

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M; Lovmand, J

1997-01-01

, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

Nanotechnology: A Policy Primer

Science.gov (United States)

2013-06-24

savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

Validation of experimental molecular crystal structures with dispersion-corrected density functional theory calculations

International Nuclear Information System (INIS)

Streek, Jacco van de; Neumann, Marcus A.

2010-01-01

The accuracy of a dispersion-corrected density functional theory method is validated against 241 experimental organic crystal structures from Acta Cryst. Section E. This paper describes the validation of a dispersion-corrected density functional theory (d-DFT) method for the purpose of assessing the correctness of experimental organic crystal structures and enhancing the information content of purely experimental data. 241 experimental organic crystal structures from the August 2008 issue of Acta Cryst. Section E were energy-minimized in full, including unit-cell parameters. The differences between the experimental and the minimized crystal structures were subjected to statistical analysis. The r.m.s. Cartesian displacement excluding H atoms upon energy minimization with flexible unit-cell parameters is selected as a pertinent indicator of the correctness of a crystal structure. All 241 experimental crystal structures are reproduced very well: the average r.m.s. Cartesian displacement for the 241 crystal structures, including 16 disordered structures, is only 0.095 Å (0.084 Å for the 225 ordered structures). R.m.s. Cartesian displacements above 0.25 Å either indicate incorrect experimental crystal structures or reveal interesting structural features such as exceptionally large temperature effects, incorrectly modelled disorder or symmetry breaking H atoms. After validation, the method is applied to nine examples that are known to be ambiguous or subtly incorrect

A project manager's primer on data validation

International Nuclear Information System (INIS)

Ramos, S.J.

1991-01-01

While carrying out their central responsibility of conducting an environmental investigation in a high- quality, timely, and cost-effective manner, project managers also face a significant challenge due to the many inherent uncertainties associated with characterizing and remediating sites. From all aspects and considerations (health and financial risks; and technical, professional, and legal defensibility/credibility), the project manager must minimize the uncertainty associated with making decisions based on environmental data. A key objective for every project manager is to produce sufficient data of known and acceptable quality. In simple terms, the level of confidence in the gathered data directly relates to: (1) the upfront determination of the types and uses of the data needed (which drives the required quality of the data); (2) the ongoing verification that the prescribed methods by which the data are to be obtained and analyzed are being followed; and (3) the validation of the verified data to determine whether the preestablished data quality objectives have been met, therefore making the data adequate for their intended use(s). This paper focuses on the third clement of the equation for data quality, therefore implying that the first two elements (planning and verification) have been accomplished. The open-quotes Who,close quotes open-quotes What,close quotes open-quotes Why,close quotes open-quotes Whenclose quotes and open-quotes Howclose quotes of data validation are discussed in general terms

Validation of NEPTUNE-CFD two-phase flow models using experimental data

International Nuclear Information System (INIS)

Perez-Manes, Jorge; Sanchez Espinoza, Victor Hugo; Bottcher, Michael; Stieglitz, Robert; Sergio Chiva Vicent

2014-01-01

This paper deals with the validation of the two-phase flow models of the CFD code NEPTUNE-CFD using experimental data provided by the OECD BWR BFBT and PSBT Benchmark. Since the two-phase models of CFD codes are extensively being improved, the validation is a key step for the acceptability of such codes. The validation work is performed in the frame of the European NURISP Project and it was focused on the steady state and transient void fraction tests. The influence of different NEPTUNE-CFD model parameters on the void fraction prediction is investigated and discussed in detail. Due to the coupling of heat conduction solver SYRTHES with NEPTUNE-CFD, the description of the coupled fluid dynamics and heat transfer between the fuel rod and the fluid is improved significantly. The averaged void fraction predicted by NEPTUNE-CFD for selected PSBT and BFBT tests is in good agreement with the experimental data. Finally, areas for future improvements of the NEPTUNE-CFD code were identified, too. (authors)

Predictive maintenance primer

International Nuclear Information System (INIS)

Flude, J.W.; Nicholas, J.R.

1991-04-01

This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

China Energy Primer

Energy Technology Data Exchange (ETDEWEB)

Ni, Chun Chun

2009-11-16

Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

Topology Optimization for Wave Propagation Problems with Experimental Validation

DEFF Research Database (Denmark)

Christiansen, Rasmus Ellebæk

designed using the proposed method is provided. A novel approach for designing meta material slabs with selectively tuned negative refractive behavior is outlined. Numerical examples demonstrating the behavior of a slab under different conditions is provided. Results from an experimental studydemonstrating...... agreement with numerical predictions are presented. Finally an approach for designing acoustic wave shaping devices is treated. Three examples of applications are presented, a directional sound emission device, a wave splitting device and a flat focusing lens. Experimental results for the first two devices......This Thesis treats the development and experimental validation of density-based topology optimization methods for wave propagation problems. Problems in the frequency regime where design dimensions are between approximately one fourth and ten wavelengths are considered. All examples treat problems...

Computational design and experimental validation of new thermal barrier systems

Energy Technology Data Exchange (ETDEWEB)

Guo, Shengmin [Louisiana State Univ., Baton Rouge, LA (United States)

2015-03-31

The focus of this project is on the development of a reliable and efficient ab initio based computational high temperature material design method which can be used to assist the Thermal Barrier Coating (TBC) bond-coat and top-coat design. Experimental evaluations on the new TBCs are conducted to confirm the new TBCs’ properties. Southern University is the subcontractor on this project with a focus on the computational simulation method development. We have performed ab initio density functional theory (DFT) method and molecular dynamics simulation on screening the top coats and bond coats for gas turbine thermal barrier coating design and validation applications. For experimental validations, our focus is on the hot corrosion performance of different TBC systems. For example, for one of the top coatings studied, we examined the thermal stability of TaZr_2.75O₈ and confirmed it’s hot corrosion performance.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

Directory of Open Access Journals (Sweden)

Kitchen James L

2012-11-01

Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

Science.gov (United States)

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

Modeling of surge in free-spool centrifugal compressors : experimental validation

NARCIS (Netherlands)

Gravdahl, J.T.; Willems, F.P.T.; Jager, de A.G.; Egeland, O.

2004-01-01

The derivation of a compressor characteristic, and the experimental validation of a dynamic model for a variable speed centrifugal compressor using this characteristic, are presented. The dynamic compressor model of Fink et al. is used, and a variable speed compressor characteristic is derived by

High-speed measurement of firearm primer blast waves

OpenAIRE

Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

2012-01-01

This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

Experimental validation of wireless communication with chaos

International Nuclear Information System (INIS)

Ren, Hai-Peng; Bai, Chao; Liu, Jian; Baptista, Murilo S.; Grebogi, Celso

2016-01-01

The constraints of a wireless physical media, such as multi-path propagation and complex ambient noises, prevent information from being communicated at low bit error rate. Surprisingly, it has only recently been shown that, from a theoretical perspective, chaotic signals are optimal for communication. It maximises the receiver signal-to-noise performance, consequently minimizing the bit error rate. This work demonstrates numerically and experimentally that chaotic systems can in fact be used to create a reliable and efficient wireless communication system. Toward this goal, we propose an impulsive control method to generate chaotic wave signals that encode arbitrary binary information signals and an integration logic together with the match filter capable of decreasing the noise effect over a wireless channel. The experimental validation is conducted by inputting the signals generated by an electronic transmitting circuit to an electronic circuit that emulates a wireless channel, where the signals travel along three different paths. The output signal is decoded by an electronic receiver, after passing through a match filter.

Experimental validation of wireless communication with chaos

Energy Technology Data Exchange (ETDEWEB)

Ren, Hai-Peng; Bai, Chao; Liu, Jian [Shaanxi Key Laboratory of Complex System Control and Intelligent Information Processing, Xian University of Technology, Xian 710048 (China); Baptista, Murilo S.; Grebogi, Celso [Institute for Complex System and Mathematical Biology, SUPA, University of Aberdeen, Aberdeen AB24 3UE (United Kingdom)

2016-08-15

The constraints of a wireless physical media, such as multi-path propagation and complex ambient noises, prevent information from being communicated at low bit error rate. Surprisingly, it has only recently been shown that, from a theoretical perspective, chaotic signals are optimal for communication. It maximises the receiver signal-to-noise performance, consequently minimizing the bit error rate. This work demonstrates numerically and experimentally that chaotic systems can in fact be used to create a reliable and efficient wireless communication system. Toward this goal, we propose an impulsive control method to generate chaotic wave signals that encode arbitrary binary information signals and an integration logic together with the match filter capable of decreasing the noise effect over a wireless channel. The experimental validation is conducted by inputting the signals generated by an electronic transmitting circuit to an electronic circuit that emulates a wireless channel, where the signals travel along three different paths. The output signal is decoded by an electronic receiver, after passing through a match filter.

Experimental validation of wireless communication with chaos.

Science.gov (United States)

Ren, Hai-Peng; Bai, Chao; Liu, Jian; Baptista, Murilo S; Grebogi, Celso

2016-08-01

The constraints of a wireless physical media, such as multi-path propagation and complex ambient noises, prevent information from being communicated at low bit error rate. Surprisingly, it has only recently been shown that, from a theoretical perspective, chaotic signals are optimal for communication. It maximises the receiver signal-to-noise performance, consequently minimizing the bit error rate. This work demonstrates numerically and experimentally that chaotic systems can in fact be used to create a reliable and efficient wireless communication system. Toward this goal, we propose an impulsive control method to generate chaotic wave signals that encode arbitrary binary information signals and an integration logic together with the match filter capable of decreasing the noise effect over a wireless channel. The experimental validation is conducted by inputting the signals generated by an electronic transmitting circuit to an electronic circuit that emulates a wireless channel, where the signals travel along three different paths. The output signal is decoded by an electronic receiver, after passing through a match filter.

Validation of Experimental whole-body SAR Assessment Method in a Complex Indoor Environment

DEFF Research Database (Denmark)

Bamba, Aliou; Joseph, Wout; Vermeeren, Gunter

2012-01-01

Assessing experimentally the whole-body specific absorption rate (SARwb) in a complex indoor environment is very challenging. An experimental method based on room electromagnetics theory (accounting only the Line-Of-Sight as specular path) to assess the whole-body SAR is validated by numerical...... of the proposed method is that it allows discarding the computation burden because it does not use any discretizations. Results show good agreement between measurement and computation at 2.8 GHz, as long as the plane wave assumption is valid, i.e., for high distances from the transmitter. Relative deviations 0...

Physics of subcritical multiplying regions and experimental validation

International Nuclear Information System (INIS)

Salvatores, M.

1996-01-01

The coupling of a particle accelerator with a spallation target and with a subcritical multiplying region has been proposed in the fifties and is called here a hybrid system. This article gives some ideas about the energetic balance of such a system. The possibilities of experimental validation of some properties of a subcritical multiplying region by using MASURCA facility at CEA-Cadarache are examined. The results of a preliminary experiment called MUSE are presented. (A.C.)

Experimental Validation of a Wave Energy Converter Array Hydrodynamics Tool

DEFF Research Database (Denmark)

Ruiz, Pau Mercadé; Ferri, Francesco; Kofoed, Jens Peter

2017-01-01

This paper uses experimental data to validate a wave energy converter (WEC) array hydrodynamics tool developed within the context of linearized potential flow theory. To this end, wave forces and power absorption by an array of five-point absorber WECs in monochromatic and panchromatic waves were...

Hexavalent Chromium IV-Free Primer Development

Science.gov (United States)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

Validation of a Wave-Body Interaction Model by Experimental Tests

DEFF Research Database (Denmark)

Ferri, Francesco; Kramer, Morten; Pecher, Arthur

2013-01-01

Within the wave energy field, numerical simulation has recently acquired a worldwide consent as being a useful tool, besides physical model testing. The main goal of this work is the validation of a numerical model by experimental results. The numerical model is based on a linear wave-body intera...

Multiphysics modelling and experimental validation of high concentration photovoltaic modules

International Nuclear Information System (INIS)

Theristis, Marios; Fernández, Eduardo F.; Sumner, Mike; O'Donovan, Tadhg S.

2017-01-01

Highlights: • A multiphysics modelling approach for concentrating photovoltaics was developed. • An experimental campaign was conducted to validate the models. • The experimental results were in good agreement with the models. • The multiphysics modelling allows the concentrator’s optimisation. - Abstract: High concentration photovoltaics, equipped with high efficiency multijunction solar cells, have great potential in achieving cost-effective and clean electricity generation at utility scale. Such systems are more complex compared to conventional photovoltaics because of the multiphysics effect that is present. Modelling the power output of such systems is therefore crucial for their further market penetration. Following this line, a multiphysics modelling procedure for high concentration photovoltaics is presented in this work. It combines an open source spectral model, a single diode electrical model and a three-dimensional finite element thermal model. In order to validate the models and the multiphysics modelling procedure against actual data, an outdoor experimental campaign was conducted in Albuquerque, New Mexico using a high concentration photovoltaic monomodule that is thoroughly described in terms of its geometry and materials. The experimental results were in good agreement (within 2.7%) with the predicted maximum power point. This multiphysics approach is relatively more complex when compared to empirical models, but besides the overall performance prediction it can also provide better understanding of the physics involved in the conversion of solar irradiance into electricity. It can therefore be used for the design and optimisation of high concentration photovoltaic modules.

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Experimental Validation of a Dynamic Model for Lightweight Robots

Directory of Open Access Journals (Sweden)

Alessandro Gasparetto

2013-03-01

Full Text Available Nowadays, one of the main topics in robotics research is dynamic performance improvement by means of a lightening of the overall system structure. The effective motion and control of these lightweight robotic systems occurs with the use of suitable motion planning and control process. In order to do so, model-based approaches can be adopted by exploiting accurate dynamic models that take into account the inertial and elastic terms that are usually neglected in a heavy rigid link configuration. In this paper, an effective method for modelling spatial lightweight industrial robots based on an Equivalent Rigid Link System approach is considered from an experimental validation perspective. A dynamic simulator implementing the formulation is used and an experimental test-bench is set-up. Experimental tests are carried out with a benchmark L-shape mechanism.

Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

International Nuclear Information System (INIS)

Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

2013-01-01

To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

International Nuclear Information System (INIS)

Busch, R.D.

2003-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

Directory of Open Access Journals (Sweden)

Cheng-Hong Yang

Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

Dynamic modeling and experimental validation for direct contact membrane distillation (DCMD) process

KAUST Repository

Eleiwi, Fadi

2016-02-01

This work proposes a mathematical dynamic model for the direct contact membrane distillation (DCMD) process. The model is based on a 2D Advection–Diffusion Equation (ADE), which describes the heat and mass transfer mechanisms that take place inside the DCMD module. The model studies the behavior of the process in the time varying and the steady state phases, contributing to understanding the process performance, especially when it is driven by intermittent energy supply, such as the solar energy. The model is experimentally validated in the steady state phase, where the permeate flux is measured for different feed inlet temperatures and the maximum absolute error recorded is 2.78 °C. Moreover, experimental validation includes the time variation phase, where the feed inlet temperature ranges from 30 °C to 75 °C with 0.1 °C increment every 2min. The validation marks relative error to be less than 5%, which leads to a strong correlation between the model predictions and the experiments.

Dynamic modeling and experimental validation for direct contact membrane distillation (DCMD) process

KAUST Repository

Eleiwi, Fadi; Ghaffour, NorEddine; Alsaadi, Ahmad Salem; Francis, Lijo; Laleg-Kirati, Taous-Meriem

2016-01-01

This work proposes a mathematical dynamic model for the direct contact membrane distillation (DCMD) process. The model is based on a 2D Advection–Diffusion Equation (ADE), which describes the heat and mass transfer mechanisms that take place inside the DCMD module. The model studies the behavior of the process in the time varying and the steady state phases, contributing to understanding the process performance, especially when it is driven by intermittent energy supply, such as the solar energy. The model is experimentally validated in the steady state phase, where the permeate flux is measured for different feed inlet temperatures and the maximum absolute error recorded is 2.78 °C. Moreover, experimental validation includes the time variation phase, where the feed inlet temperature ranges from 30 °C to 75 °C with 0.1 °C increment every 2min. The validation marks relative error to be less than 5%, which leads to a strong correlation between the model predictions and the experiments.

Primer on spontaneous heating and pyrophoricity

Energy Technology Data Exchange (ETDEWEB)

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

30 CFR 57.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

Experimental validation of solid rocket motor damping models

Science.gov (United States)

Riso, Cristina; Fransen, Sebastiaan; Mastroddi, Franco; Coppotelli, Giuliano; Trequattrini, Francesco; De Vivo, Alessio

2017-12-01

In design and certification of spacecraft, payload/launcher coupled load analyses are performed to simulate the satellite dynamic environment. To obtain accurate predictions, the system damping properties must be properly taken into account in the finite element model used for coupled load analysis. This is typically done using a structural damping characterization in the frequency domain, which is not applicable in the time domain. Therefore, the structural damping matrix of the system must be converted into an equivalent viscous damping matrix when a transient coupled load analysis is performed. This paper focuses on the validation of equivalent viscous damping methods for dynamically condensed finite element models via correlation with experimental data for a realistic structure representative of a slender launch vehicle with solid rocket motors. A second scope of the paper is to investigate how to conveniently choose a single combination of Young's modulus and structural damping coefficient—complex Young's modulus—to approximate the viscoelastic behavior of a solid propellant material in the frequency band of interest for coupled load analysis. A scaled-down test article inspired to the Z9-ignition Vega launcher configuration is designed, manufactured, and experimentally tested to obtain data for validation of the equivalent viscous damping methods. The Z9-like component of the test article is filled with a viscoelastic material representative of the Z9 solid propellant that is also preliminarily tested to investigate the dependency of the complex Young's modulus on the excitation frequency and provide data for the test article finite element model. Experimental results from seismic and shock tests performed on the test configuration are correlated with numerical results from frequency and time domain analyses carried out on its dynamically condensed finite element model to assess the applicability of different equivalent viscous damping methods to describe

Experimental validation of solid rocket motor damping models

Science.gov (United States)

Riso, Cristina; Fransen, Sebastiaan; Mastroddi, Franco; Coppotelli, Giuliano; Trequattrini, Francesco; De Vivo, Alessio

2018-06-01

In design and certification of spacecraft, payload/launcher coupled load analyses are performed to simulate the satellite dynamic environment. To obtain accurate predictions, the system damping properties must be properly taken into account in the finite element model used for coupled load analysis. This is typically done using a structural damping characterization in the frequency domain, which is not applicable in the time domain. Therefore, the structural damping matrix of the system must be converted into an equivalent viscous damping matrix when a transient coupled load analysis is performed. This paper focuses on the validation of equivalent viscous damping methods for dynamically condensed finite element models via correlation with experimental data for a realistic structure representative of a slender launch vehicle with solid rocket motors. A second scope of the paper is to investigate how to conveniently choose a single combination of Young's modulus and structural damping coefficient—complex Young's modulus—to approximate the viscoelastic behavior of a solid propellant material in the frequency band of interest for coupled load analysis. A scaled-down test article inspired to the Z9-ignition Vega launcher configuration is designed, manufactured, and experimentally tested to obtain data for validation of the equivalent viscous damping methods. The Z9-like component of the test article is filled with a viscoelastic material representative of the Z9 solid propellant that is also preliminarily tested to investigate the dependency of the complex Young's modulus on the excitation frequency and provide data for the test article finite element model. Experimental results from seismic and shock tests performed on the test configuration are correlated with numerical results from frequency and time domain analyses carried out on its dynamically condensed finite element model to assess the applicability of different equivalent viscous damping methods to describe

Validation of experimental molecular crystal structures with dispersion-corrected density functional theory calculations.

Science.gov (United States)

van de Streek, Jacco; Neumann, Marcus A

2010-10-01

This paper describes the validation of a dispersion-corrected density functional theory (d-DFT) method for the purpose of assessing the correctness of experimental organic crystal structures and enhancing the information content of purely experimental data. 241 experimental organic crystal structures from the August 2008 issue of Acta Cryst. Section E were energy-minimized in full, including unit-cell parameters. The differences between the experimental and the minimized crystal structures were subjected to statistical analysis. The r.m.s. Cartesian displacement excluding H atoms upon energy minimization with flexible unit-cell parameters is selected as a pertinent indicator of the correctness of a crystal structure. All 241 experimental crystal structures are reproduced very well: the average r.m.s. Cartesian displacement for the 241 crystal structures, including 16 disordered structures, is only 0.095 Å (0.084 Å for the 225 ordered structures). R.m.s. Cartesian displacements above 0.25 A either indicate incorrect experimental crystal structures or reveal interesting structural features such as exceptionally large temperature effects, incorrectly modelled disorder or symmetry breaking H atoms. After validation, the method is applied to nine examples that are known to be ambiguous or subtly incorrect.

A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

Directory of Open Access Journals (Sweden)

Andrés Alvarado

Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

Rust transformation/rust compatible primers

Science.gov (United States)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

Preliminary Validation of the MATRA-LMR Code Using Existing Sodium-Cooled Experimental Data

International Nuclear Information System (INIS)

Choi, Sun Rock; Kim, Sangji

2014-01-01

The main objective of the SFR prototype plant is to verify TRU metal fuel performance, reactor operation, and transmutation ability of high-level wastes. The core thermal-hydraulic design is used to ensure the safe fuel performance during the whole plant operation. The fuel design limit is highly dependent on both the maximum cladding temperature and the uncertainties of the design parameters. Therefore, an accurate temperature calculation in each subassembly is highly important to assure a safe and reliable operation of the reactor systems. The current core thermalhydraulic design is mainly performed using the SLTHEN (Steady-State LMR Thermal-Hydraulic Analysis Code Based on ENERGY Model) code, which has been already validated using the existing sodium-cooled experimental data. In addition to the SLTHEN code, a detailed analysis is performed using the MATRA-LMR (Multichannel Analyzer for Transient and steady-state in Rod Array-Liquid Metal Reactor) code. In this work, the MATRA-LMR code is validated for a single subassembly evaluation using the previous experimental data. The MATRA-LMR code has been validated using existing sodium-cooled experimental data. The results demonstrate that the design code appropriately predicts the temperature distributions compared with the experimental values. Major differences are observed in the experiments with the large pin number due to the radial-wise mixing difference

Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

International Nuclear Information System (INIS)

Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

1991-01-01

In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

Dislocation-mediated strain hardening in tungsten: Thermo-mechanical plasticity theory and experimental validation

Science.gov (United States)

Terentyev, Dmitry; Xiao, Xiazi; Dubinko, A.; Bakaeva, A.; Duan, Huiling

2015-12-01

A self-consistent thermo-mechanical model to study the strain-hardening behavior of polycrystalline tungsten was developed and validated by a dedicated experimental route. Dislocation-dislocation multiplication and storage, as well dislocation-grain boundary (GB) pinning were the major mechanisms underlying the evolution of plastic deformation, thus providing a link between the strain hardening behavior and material's microstructure. The microstructure of the polycrystalline tungsten samples has been thoroughly investigated by scanning and electron microscopy. The model was applied to compute stress-strain loading curves of commercial tungsten grades, in the as-received and as-annealed states, in the temperature range of 500-1000 °C. Fitting the model to the independent experimental results obtained using a single crystal and as-received polycrystalline tungsten, the model demonstrated its capability to predict the deformation behavior of as-annealed samples in a wide temperature range and applied strain. The relevance of the dislocation-mediated plasticity mechanisms used in the model have been validated using transmission electron microscopy examination of the samples deformed up to different amounts of strain. On the basis of the experimental validation, the limitations of the model are determined and discussed.

The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

Science.gov (United States)

Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

2013-11-01

To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

Summary: Experimental validation of real-time fault-tolerant systems

Science.gov (United States)

Iyer, R. K.; Choi, G. S.

1992-01-01

Testing and validation of real-time systems is always difficult to perform since neither the error generation process nor the fault propagation problem is easy to comprehend. There is no better substitute to results based on actual measurements and experimentation. Such results are essential for developing a rational basis for evaluation and validation of real-time systems. However, with physical experimentation, controllability and observability are limited to external instrumentation that can be hooked-up to the system under test. And this process is quite a difficult, if not impossible, task for a complex system. Also, to set up such experiments for measurements, physical hardware must exist. On the other hand, a simulation approach allows flexibility that is unequaled by any other existing method for system evaluation. A simulation methodology for system evaluation was successfully developed and implemented and the environment was demonstrated using existing real-time avionic systems. The research was oriented toward evaluating the impact of permanent and transient faults in aircraft control computers. Results were obtained for the Bendix BDX 930 system and Hamilton Standard EEC131 jet engine controller. The studies showed that simulated fault injection is valuable, in the design stage, to evaluate the susceptibility of computing sytems to different types of failures.

A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

Directory of Open Access Journals (Sweden)

Dunn Sade N

2008-06-01

Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

A method for automatically extracting infectious disease-related primers and probes from the literature

Directory of Open Access Journals (Sweden)

Pérez-Rey David

2010-08-01

Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

An Experimental Validated Control Strategy of Maglev Vehicle-Bridge Self-Excited Vibration

Directory of Open Access Journals (Sweden)

Lianchun Wang

2017-01-01

Full Text Available This study discusses an experimentally validated control strategy of maglev vehicle-bridge vibration, which degrades the stability of the suspension control, deteriorates the ride comfort, and limits the cost of the magnetic levitation system. First, a comparison between the current-loop and magnetic flux feedback is carried out and a minimum model including flexible bridge and electromagnetic levitation system is proposed. Then, advantages and disadvantages of the traditional feedback architecture with the displacement feedback of electromagnet yE and bridge yB in pairs are explored. The results indicate that removing the feedback of the bridge’s displacement yB from the pairs (yE − yB measured by the eddy-current sensor is beneficial for the passivity of the levitation system and the control of the self-excited vibration. In this situation, the signal acquisition of the electromagnet’s displacement yE is discussed for the engineering application. Finally, to validate the effectiveness of the aforementioned control strategy, numerical validations are carried out and the experimental data are provided and analyzed.

Experimental Validation of a Differential Variational Inequality-Based Approach for Handling Friction and Contact in Vehicle

Science.gov (United States)

2015-11-20

terrain modeled using the discrete element method (DEM). Experimental Validation of a Differential Variational Inequality -Based Approach for Handling...COVERED 00-00-2015 to 00-00-2015 4. TITLE AND SUBTITLE Experimental Validation of a Differential Variational Inequality -Based Approach for...sinkage, and single wheel tests. 1.1. Modeling Frictional Contact Via Differential Variational Inequalities Consider a three dimensional (3D) system of

Bioinformatic tools and guideline for PCR primer design | Abd ...

African Journals Online (AJOL)

Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

Science.gov (United States)

Elkins, Kelly M.; Kadunc, Raelynn E.

2012-01-01

In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

Development and validation of genic-SSR markers in sesame by RNA-seq.

Science.gov (United States)

Zhang, Haiyang; Wei, Libin; Miao, Hongmei; Zhang, Tide; Wang, Cuiying

2012-07-16

Sesame (Sesamum indicum L.) is one of the most important oil crops; however, a lack of useful molecular markers hinders current genetic research. We performed transcriptome sequencing of samples from different sesame growth and developmental stages, and mining of genic-SSR markers to identify valuable markers for sesame molecular genetics research. In this study, 75 bp and 100 bp paired-end RNA-seq was used to sequence 24 cDNA libraries, and 42,566 uni-transcripts were assembled from more than 260 million filtered reads. The total length of uni-transcript sequences was 47.99 Mb, and 7,324 SSRs (SSRs ≥15 bp) and 4,440 SSRs (SSRs ≥18 bp) were identified. On average, there was one genic-SSR per 6.55 kb (SSRs ≥15 bp) or 10.81 kb (SSRs ≥18 bp). Among perfect SSRs (≥18 bp), di-nucleotide motifs (48.01%) were the most abundant, followed by tri- (20.96%), hexa- (25.37%), penta- (2.97%), tetra- (2.12%), and mono-nucleotides (0.57%). The top four motif repeats were (AG/CT)n [1,268 (34.51%)], (CA/TG)n [281 (7.65%)], (AT/AT)n [215 (5.85%)], and (GAA/TTC)n [131 (3.57%)]. A total of 2,164 SSR primer pairs were identified in the 4,440 SSR-containing sequences (≥18 bp), and 300 SSR primer pairs were randomly chosen for validation. These SSR markers were amplified and validated in 25 sesame accessions (24 cultivated accessions, one wild species). 276 (92.0%) primer pairs yielded PCR amplification products in 24 cultivars. Thirty two primer pairs (11.59%) exhibited polymorphisms. Moreover, 203 primer pairs (67.67%) yielded PCR amplicons in the wild accession and 167 (60.51%) were polymorphic between species. A UPGMA dendrogram based on genetic similarity coefficients showed that the correlation between genotype and geographical source was low and that the genetic basis of sesame in China is narrow, as previously reported. The 32 polymorphic primer pairs were validated using an F2 mapping population; 18 primer pairs exhibited polymorphisms between the parents, and 14

Numerical simulation and experimental validation of coiled adiabatic capillary tubes

Energy Technology Data Exchange (ETDEWEB)

Garcia-Valladares, O. [Centro de Investigacion en Energia, Universidad Nacional Autonoma de Mexico (UNAM), Apdo. Postal 34, 62580 Temixco, Morelos (Mexico)

2007-04-15

The objective of this study is to extend and validate the model developed and presented in previous works [O. Garcia-Valladares, C.D. Perez-Segarra, A. Oliva, Numerical simulation of capillary tube expansion devices behaviour with pure and mixed refrigerants considering metastable region. Part I: mathematical formulation and numerical model, Applied Thermal Engineering 22 (2) (2002) 173-182; O. Garcia-Valladares, C.D. Perez-Segarra, A. Oliva, Numerical simulation of capillary tube expansion devices behaviour with pure and mixed refrigerants considering metastable region. Part II: experimental validation and parametric studies, Applied Thermal Engineering 22 (4) (2002) 379-391] to coiled adiabatic capillary tube expansion devices working with pure and mixed refrigerants. The discretized governing equations are coupled using an implicit step by step method. A special treatment has been implemented in order to consider transitions (subcooled liquid region, metastable liquid region, metastable two-phase region and equilibrium two-phase region). All the flow variables (enthalpies, temperatures, pressures, vapor qualities, velocities, heat fluxes, etc.) together with the thermophysical properties are evaluated at each point of the grid in which the domain is discretized. The numerical model allows analysis of aspects such as geometry, type of fluid (pure substances and mixtures), critical or non-critical flow conditions, metastable regions, and transient aspects. Comparison of the numerical simulation with a wide range of experimental data presented in the technical literature will be shown in the present article in order to validate the model developed. (author)

Medium Caliber Lead-Free Electric Primer. Version 2

Science.gov (United States)

2012-09-01

2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

Science.gov (United States)

Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

2006-01-01

A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the

Experimental validation of lead cross sections for scale and MCNP

International Nuclear Information System (INIS)

Henrikson, D.J.

1995-01-01

Moving spent nuclear fuel between facilities often requires the use of lead-shielded casks. Criticality safety that is based upon calculations requires experimental validation of the fuel matrix and lead cross section libraries. A series of critical experiments using a high-enriched uranium-aluminum fuel element with a variety of reflectors, including lead, has been identified. Twenty-one configurations were evaluated in this study. The fuel element was modelled for KENO V.a and MCNP 4a using various cross section sets. The experiments addressed in this report can be used to validate lead-reflected calculations. Factors influencing calculated k eff which require further study include diameters of styrofoam inserts and homogenization

Simple sequence repeat marker loci discovery using SSR primer.

Science.gov (United States)

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Value for money assessment for public-private partnerships : a primer.

Science.gov (United States)

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

The turbulent viscosity models and their experimental validation; Les modeles de viscosite turbulente et leur validation experimentale

Energy Technology Data Exchange (ETDEWEB)

NONE

1997-12-31

This workshop on turbulent viscosity models and on their experimental validation was organized by the `convection` section of the French society of thermal engineers. From the 9 papers presented during this workshop, 8 deal with the modeling of turbulent flows inside combustion chambers, turbo-machineries or in other energy-related applications, and have been selected for ETDE. (J.S.)

76 FR 81991 - National Spectrum Sharing Research Experimentation, Validation, Verification, Demonstration and...

Science.gov (United States)

2011-12-29

... NATIONAL SCIENCE FOUNDATION National Spectrum Sharing Research Experimentation, Validation... requirements of national level spectrum research, development, demonstration, and field trial facilities... to determine the optimal way to manage and use the radio spectrum. During Workshop I held at Boulder...

Economics : pricing, demand, and economic efficiency : a primer.

Science.gov (United States)

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Semantic Web Primer

NARCIS (Netherlands)

Antoniou, Grigoris; Harmelen, Frank van

2004-01-01

The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

Validation of the newborn larynx modeling with aerodynamical experimental data.

Science.gov (United States)

Nicollas, R; Giordano, J; Garrel, R; Medale, M; Caminat, P; Giovanni, A; Ouaknine, M; Triglia, J M

2009-06-01

Many authors have studied adult's larynx modelization, but the mechanisms of newborn's voice production have very rarely been investigated. After validating a numerical model with acoustic data, studies were performed on larynges of human fetuses in order to validate this model with aerodynamical experiments. Anatomical measurements were performed and a simplified numerical model was built using Fluent((R)) with the vocal folds in phonatory position. The results obtained are in good agreement with those obtained by laser Doppler velocimetry (LDV) and high-frame rate particle image velocimetry (HFR-PIV), on an experimental bench with excised human fetus larynges. It appears that computing with first cry physiological parameters leads to a model which is close to those obtained in experiments with real organs.

Numerical modeling and experimental validation of thermoplastic composites induction welding

Science.gov (United States)

Palmieri, Barbara; Nele, Luigi; Galise, Francesco

2018-05-01

In this work, a numerical simulation and experimental test of the induction welding of continuous fibre-reinforced thermoplastic composites (CFRTPCs) was provided. The thermoplastic Polyamide 66 (PA66) with carbon fiber fabric was used. Using a dedicated software (JMag Designer), the influence of the fundamental process parameters such as temperature, current and holding time was investigated. In order to validate the results of the simulations, and therefore the numerical model used, experimental tests were carried out, and the temperature values measured during the tests were compared with the aid of an optical pyrometer, with those provided by the numerical simulation. The mechanical properties of the welded joints were evaluated by single lap shear tests.

Electromagnetic scattering problems -Numerical issues and new experimental approaches of validation

Energy Technology Data Exchange (ETDEWEB)

Geise, Robert; Neubauer, Bjoern; Zimmer, Georg [University of Braunschweig, Institute for Electromagnetic Compatibility, Schleinitzstrasse 23, 38106 Braunschweig (Germany)

2015-03-10

Electromagnetic scattering problems, thus the question how radiated energy spreads when impinging on an object, are an essential part of wave propagation. Though the Maxwell’s differential equations as starting point, are actually quite simple,the integral formulation of an object’s boundary conditions, respectively the solution for unknown induced currents can only be solved numerically in most cases.As a timely topic of practical importance the scattering of rotating wind turbines is discussed, the numerical description of which is still based on rigorous approximations with yet unspecified accuracy. In this context the issue of validating numerical solutions is addressed, both with reference simulations but in particular with the experimental approach of scaled measurements. For the latter the idea of an incremental validation is proposed allowing a step by step validation of required new mathematical models in scattering theory.

Experimental validation for calcul methods of structures having shock non-linearity

International Nuclear Information System (INIS)

Brochard, D.; Buland, P.

1987-01-01

For the seismic analysis of non-linear structures, numerical methods have been developed which need to be validated on experimental results. The aim of this paper is to present the design method of a test program which results will be used for this purpose. Some applications to nuclear components will illustrate this presentation [fr

Three-dimensional shape optimization of a cemented hip stem and experimental validations.

Science.gov (United States)

Higa, Masaru; Tanino, Hiromasa; Nishimura, Ikuya; Mitamura, Yoshinori; Matsuno, Takeo; Ito, Hiroshi

2015-03-01

This study proposes novel optimized stem geometry with low stress values in the cement using a finite element (FE) analysis combined with an optimization procedure and experimental measurements of cement stress in vitro. We first optimized an existing stem geometry using a three-dimensional FE analysis combined with a shape optimization technique. One of the most important factors in the cemented stem design is to reduce stress in the cement. Hence, in the optimization study, we minimized the largest tensile principal stress in the cement mantle under a physiological loading condition by changing the stem geometry. As the next step, the optimized stem and the existing stem were manufactured to validate the usefulness of the numerical models and the results of the optimization in vitro. In the experimental study, strain gauges were embedded in the cement mantle to measure the strain in the cement mantle adjacent to the stems. The overall trend of the experimental study was in good agreement with the results of the numerical study, and we were able to reduce the largest stress by more than 50% in both shape optimization and strain gauge measurements. Thus, we could validate the usefulness of the numerical models and the results of the optimization using the experimental models. The optimization employed in this study is a useful approach for developing new stem designs.

Coal Bed Methane Primer

Energy Technology Data Exchange (ETDEWEB)

Dan Arthur; Bruce Langhus; Jon Seekins

2005-05-25

During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

Physical validation issue of the NEPTUNE two-phase modelling: validation plan to be adopted, experimental programs to be set up and associated instrumentation techniques developed

International Nuclear Information System (INIS)

Pierre Peturaud; Eric Hervieu

2005-01-01

Full text of publication follows: A long-term joint development program for the next generation of nuclear reactors simulation tools has been launched in 2001 by EDF (Electricite de France) and CEA (Commissariat a l'Energie Atomique). The NEPTUNE Project constitutes the Thermal-Hydraulics part of this comprehensive program. Along with the underway development of this new two-phase flow software platform, the physical validation of the involved modelling is a crucial issue, whatever the modelling scale is, and the present paper deals with this issue. After a brief recall about the NEPTUNE platform, the general validation strategy to be adopted is first of all clarified by means of three major features: (i) physical validation in close connection with the concerned industrial applications, (ii) involving (as far as possible) a two-step process successively focusing on dominant separate models and assessing the whole modelling capability, (iii) thanks to the use of relevant data with respect to the validation aims. Based on this general validation process, a four-step generic work approach has been defined; it includes: (i) a thorough analysis of the concerned industrial applications to identify the key physical phenomena involved and associated dominant basic models, (ii) an assessment of these models against the available validation pieces of information, to specify the additional validation needs and define dedicated validation plans, (iii) an inventory and assessment of existing validation data (with respect to the requirements specified in the previous task) to identify the actual needs for new validation data, (iv) the specification of the new experimental programs to be set up to provide the needed new data. This work approach has been applied to the NEPTUNE software, focusing on 8 high priority industrial applications, and it has resulted in the definition of (i) the validation plan and experimental programs to be set up for the open medium 3D modelling

Quick spacecraft charging primer

International Nuclear Information System (INIS)

Larsen, Brian Arthur

2014-01-01

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

Primer design for a prokaryotic differential display RT-PCR.

Science.gov (United States)

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

CFD Code Validation against Stratified Air-Water Flow Experimental Data

International Nuclear Information System (INIS)

Terzuoli, F.; Galassi, M.C.; Mazzini, D.; D'Auria, F.

2008-01-01

Pressurized thermal shock (PTS) modelling has been identified as one of the most important industrial needs related to nuclear reactor safety. A severe PTS scenario limiting the reactor pressure vessel (RPV) lifetime is the cold water emergency core cooling (ECC) injection into the cold leg during a loss of coolant accident (LOCA). Since it represents a big challenge for numerical simulations, this scenario was selected within the European Platform for Nuclear Reactor Simulations (NURESIM) Integrated Project as a reference two-phase problem for computational fluid dynamics (CFDs) code validation. This paper presents a CFD analysis of a stratified air-water flow experimental investigation performed at the Institut de Mecanique des Fluides de Toulouse in 1985, which shares some common physical features with the ECC injection in PWR cold leg. Numerical simulations have been carried out with two commercial codes (Fluent and Ansys CFX), and a research code (NEPTUNE CFD). The aim of this work, carried out at the University of Pisa within the NURESIM IP, is to validate the free surface flow model implemented in the codes against experimental data, and to perform code-to-code benchmarking. Obtained results suggest the relevance of three-dimensional effects and stress the importance of a suitable interface drag modelling

CFD Code Validation against Stratified Air-Water Flow Experimental Data

Directory of Open Access Journals (Sweden)

F. Terzuoli

2008-01-01

Full Text Available Pressurized thermal shock (PTS modelling has been identified as one of the most important industrial needs related to nuclear reactor safety. A severe PTS scenario limiting the reactor pressure vessel (RPV lifetime is the cold water emergency core cooling (ECC injection into the cold leg during a loss of coolant accident (LOCA. Since it represents a big challenge for numerical simulations, this scenario was selected within the European Platform for Nuclear Reactor Simulations (NURESIM Integrated Project as a reference two-phase problem for computational fluid dynamics (CFDs code validation. This paper presents a CFD analysis of a stratified air-water flow experimental investigation performed at the Institut de Mécanique des Fluides de Toulouse in 1985, which shares some common physical features with the ECC injection in PWR cold leg. Numerical simulations have been carried out with two commercial codes (Fluent and Ansys CFX, and a research code (NEPTUNE CFD. The aim of this work, carried out at the University of Pisa within the NURESIM IP, is to validate the free surface flow model implemented in the codes against experimental data, and to perform code-to-code benchmarking. Obtained results suggest the relevance of three-dimensional effects and stress the importance of a suitable interface drag modelling.

Computational Fluid Dynamics Modeling of the Human Pulmonary Arteries with Experimental Validation.

Science.gov (United States)

Bordones, Alifer D; Leroux, Matthew; Kheyfets, Vitaly O; Wu, Yu-An; Chen, Chia-Yuan; Finol, Ender A

2018-05-21

Pulmonary hypertension (PH) is a chronic progressive disease characterized by elevated pulmonary arterial pressure, caused by an increase in pulmonary arterial impedance. Computational fluid dynamics (CFD) can be used to identify metrics representative of the stage of PH disease. However, experimental validation of CFD models is often not pursued due to the geometric complexity of the model or uncertainties in the reproduction of the required flow conditions. The goal of this work is to validate experimentally a CFD model of a pulmonary artery phantom using a particle image velocimetry (PIV) technique. Rapid prototyping was used for the construction of the patient-specific pulmonary geometry, derived from chest computed tomography angiography images. CFD simulations were performed with the pulmonary model with a Reynolds number matching those of the experiments. Flow rates, the velocity field, and shear stress distributions obtained with the CFD simulations were compared to their counterparts from the PIV flow visualization experiments. Computationally predicted flow rates were within 1% of the experimental measurements for three of the four branches of the CFD model. The mean velocities in four transversal planes of study were within 5.9 to 13.1% of the experimental mean velocities. Shear stresses were qualitatively similar between the two methods with some discrepancies in the regions of high velocity gradients. The fluid flow differences between the CFD model and the PIV phantom are attributed to experimental inaccuracies and the relative compliance of the phantom. This comparative analysis yielded valuable information on the accuracy of CFD predicted hemodynamics in pulmonary circulation models.

Climate Change, Health, and Communication: A Primer.

Science.gov (United States)

Chadwick, Amy E

2016-01-01

Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental results showed that the detection limit of the assay was 0.2 pg {mu}L{sup -1} of rotavirus. The ECL intensity was linearly with the concentration from 0.2 pg {mu}L{sup -1} to 400 pg {mu}L{sup -1}. What's more, the specificity of this method was confirmed by detecting other fecal specimens of patients with nonrotavirus-associated gastroenteritis. We anticipate that the proposed magnetic primer based RT-PCR with ECL detection strategy will find numerous applications in food safety field and clinical diagnosis.

Marketing Information Products and Services : A Primer for ...

International Development Research Centre (IDRC) Digital Library (Canada)

Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

Validation of the CATHARE2 code against experimental data from Brayton-cycle plants

International Nuclear Information System (INIS)

Bentivoglio, Fabrice; Tauveron, Nicolas; Geffraye, Genevieve; Gentner, Herve

2008-01-01

In recent years the Commissariat a l'Energie Atomique (CEA) has commissioned a wide range of feasibility studies of future-advanced nuclear reactors, in particular gas-cooled reactors (GCR). The thermohydraulic behaviour of these systems is a key issue for, among other things, the design of the core, the assessment of thermal stresses, and the design of decay heat removal systems. These studies therefore require efficient and reliable simulation tools capable of modelling the whole reactor, including the core, the core vessel, piping, heat exchangers and turbo-machinery. CATHARE2 is a thermal-hydraulic 1D reference safety code developed and extensively validated for the French pressurized water reactors. It has been recently adapted to deal also with gas-cooled reactor applications. In order to validate CATHARE2 for these new applications, CEA has initiated an ambitious long-term experimental program. The foreseen experimental facilities range from small-scale loops for physical correlations, to component technology and system demonstration loops. In the short-term perspective, CATHARE2 is being validated against existing experimental data. And in particular from the German power plants Oberhausen I and II. These facilities have both been operated by the German utility Energie Versorgung Oberhausen (E.V.O.) and their power conversion systems resemble to the high-temperature reactor concepts: Oberhausen I is a 13.75-MWe Brayton-cycle air turbine plant, and Oberhausen II is a 50-MWe Brayton-cycle helium turbine plant. The paper presents these two plants, the adopted CATHARE2 modelling and a comparison between experimental data and code results for both steady state and transient cases

Primer for criticality calculations with DANTSYS

International Nuclear Information System (INIS)

Busch, R.D.

1996-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

CFD Modeling and Experimental Validation of a Solar Still

Directory of Open Access Journals (Sweden)

Mahmood Tahir

2017-01-01

Full Text Available Earth is the densest planet of the solar system with total area of 510.072 million square Km. Over 71.68% of this area is covered with water leaving a scant area of 28.32% for human to inhabit. The fresh water accounts for only 2.5% of the total volume and the rest is the brackish water. Presently, the world is facing chief problem of lack of potable water. This issue can be addressed by converting brackish water into potable through a solar distillation process and solar still is specially assigned for this purpose. Efficiency of a solar still explicitly depends on its design parameters, such as wall material, chamber depth, width and slope of the zcondensing surface. This study was aimed at investigating the solar still parameters using CFD modeling and experimental validation. The simulation data of ANSYS-FLUENT was compared with actual experimental data. A close agreement among the simulated and experimental results was seen in the presented work. It reveals that ANSYS-FLUENT is a potent tool to analyse the efficiency of the new designs of the solar distillation systems.

An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

Energy Technology Data Exchange (ETDEWEB)

Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

2011-01-15

Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Relationship of otolith strontium-to-calcium ratios and salinity: Experimental validation for juvenile salmonids

Science.gov (United States)

Zimmerman, C.E.

2005-01-01

Analysis of otolith strontium (Sr) or strontium-to-calcium (Sr:Ca) ratios provides a powerful tool to reconstruct the chronology of migration among salinity environments for diadromous salmonids. Although use of this method has been validated by examination of known individuals and translocation experiments, it has never been validated under controlled experimental conditions. In this study, incorporation of otolith Sr was tested across a range of salinities and resulting levels of ambient Sr and Ca concentrations in juvenile chinook salmon (Oncorhynchus tshawytscha), coho salmon (Oncorhynchus kisutch), sockeye salmon (Oncorhynchus nerka), rainbow trout (Oncorhynchus rnykiss), and Arctic char (Salvelinus alpinus). Experimental water was mixed, using stream water and seawater as end members, to create experimental salinities of 0.1, 6.3, 12.7, 18.6, 25.5, and 33.0 psu. Otolith Sr and Sr:Ca ratios were significantly related to salinity for all species (r2 range: 0.80-0.91) but provide only enough predictive resolution to discriminate among fresh water, brackish water, and saltwater residency. These results validate the use of otolith Sr:Ca ratios to broadly discriminate salinity histories encountered by salmonids but highlight the need for further research concerning the influence of osmoregulation and physiological changes associated with smoking on otolith microchemistry.

Experimental Testing Procedures and Dynamic Model Validation for Vanadium Redox Flow Battery Storage System

DEFF Research Database (Denmark)

Baccino, Francesco; Marinelli, Mattia; Nørgård, Per Bromand

2013-01-01

The paper aims at characterizing the electrochemical and thermal parameters of a 15 kW/320 kWh vanadium redox flow battery (VRB) installed in the SYSLAB test facility of the DTU Risø Campus and experimentally validating the proposed dynamic model realized in Matlab-Simulink. The adopted testing...... efficiency of the battery system. The test procedure has general validity and could also be used for other storage technologies. The storage model proposed and described is suitable for electrical studies and can represent a general model in terms of validity. Finally, the model simulation outputs...

Impact-friction vibrations of tubular systems. Numerical simulation and experimental validation

International Nuclear Information System (INIS)

Jacquart, G.

1993-05-01

This note presents a summary on the numerical developments made to simulate impact-friction vibrations of tubular systems, detailing the algorithms used and the expression of impact and friction forces. A synthesis of the experimental results obtained on MASSIF workbench is also presented, as well as their comparison with numerical computations in order to validate the numerical approach. (author). 5 refs

Experimental validation of models for Plasma Focus devices

International Nuclear Information System (INIS)

Rodriguez Palomino, Luis; Gonzalez, Jose; Clausse, Alejandro

2003-01-01

Plasma Focus(PF) Devices are thermonuclear pulsators that produce short pulsed radiation (X-ray, charged particles and neutrons). Since Filippov and Mather, investigations have been used to study plasma properties. Nowadays the interest about PF is focused in technology applications, related to the use of these devices as pulsed neutron sources. In the numerical calculus the Inter institutional PLADEMA (PLAsmas DEnsos MAgnetizados) network is developing three models. Each one is useful in different engineering stages of the Plasma Focus design. One of the main objectives in this work is a comparative study on the influence of the different parameters involved in each models. To validate these results, several experimental measurements under different geometry and initial conditions were performed. (author)

A physicists guide to The Los Alamos Primer

International Nuclear Information System (INIS)

Reed, B Cameron

2016-01-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

Experimental validation of the buildings energy performance (PEC assessment methods with reference to occupied spaces heating

Directory of Open Access Journals (Sweden)

Cristian PETCU

2010-01-01

Full Text Available This paper is part of the series of pre-standardization research aimed to analyze the existing methods of calculating the Buildings Energy Performance (PEC in view of their correction of completing. The entire research activity aims to experimentally validate the PEC Calculation Algorithm as well as the comparative application, on the support of several case studies focused on representative buildings of the stock of buildings in Romania, of the PEC calculation methodology for buildings equipped with occupied spaces heating systems. The targets of the report are the experimental testing of the calculation models so far known (NP 048-2000, Mc 001-2006, SR EN 13790:2009, on the support provided by the CE INCERC Bucharest experimental building, together with the complex calculation algorithms specific to the dynamic modeling, for the evaluation of the occupied spaces heat demand in the cold season, specific to the traditional buildings and to modern buildings equipped with solar radiation passive systems, of the ventilated solar space type. The schedule of the measurements performed in the 2008-2009 cold season is presented as well as the primary processing of the measured data and the experimental validation of the heat demand monthly calculation methods, on the support of CE INCERC Bucharest. The calculation error per heating season (153 days of measurements between the measured heat demand and the calculated one was of 0.61%, an exceptional value confirming the phenomenological nature of the INCERC method, NP 048-2006. The mathematical model specific to the hourly thermal balance is recurrent – decisional with alternating paces. The experimental validation of the theoretical model is based on the measurements performed on the CE INCERC Bucharest building, within a time lag of 57 days (06.01-04.03.2009. The measurements performed on the CE INCERC Bucharest building confirm the accuracy of the hourly calculation model by comparison to the values

An Experimental Simulation to Validate FEM to Predict Transverse Young’s Modulus of FRP Composites

Directory of Open Access Journals (Sweden)

V. S. Sai

2013-01-01

Full Text Available Finite element method finds application in the analysis of FRP composites due to its versatility in getting the solution for complex cases which are not possible by exact classical analytical approaches. The finite element result is questionable unless it is obtained from converged mesh and properly validated. In the present work specimens are prepared with metallic materials so that the arrangement of fibers is close to hexagonal packing in a matrix as similar arrangement in case of FRP is complex due to the size of fibers. Transverse Young’s moduli of these specimens are determined experimentally. Equivalent FE models are designed and corresponding transverse Young’s moduli are compared with the experimental results. It is observed that the FE values are in good agreement with the experimental results, thus validating FEM for predicting transverse modulus of FRP composites.

Modeling and Experimental Validation for 3D mm-wave Radar Imaging

Science.gov (United States)

Ghazi, Galia

As the problem of identifying suicide bombers wearing explosives concealed under clothing becomes increasingly important, it becomes essential to detect suspicious individuals at a distance. Systems which employ multiple sensors to determine the presence of explosives on people are being developed. Their functions include observing and following individuals with intelligent video, identifying explosives residues or heat signatures on the outer surface of their clothing, and characterizing explosives using penetrating X-rays, terahertz waves, neutron analysis, or nuclear quadrupole resonance. At present, mm-wave radar is the only modality that can both penetrate and sense beneath clothing at a distance of 2 to 50 meters without causing physical harm. Unfortunately, current mm-wave radar systems capable of performing high-resolution, real-time imaging require using arrays with a large number of transmitting and receiving modules; therefore, these systems present undesired large size, weight and power consumption, as well as extremely complex hardware architecture. The overarching goal of this thesis is the development and experimental validation of a next generation inexpensive, high-resolution radar system that can distinguish security threats hidden on individuals located at 2-10 meters range. In pursuit of this goal, this thesis proposes the following contributions: (1) Development and experimental validation of a new current-based, high-frequency computational method to model large scattering problems (hundreds of wavelengths) involving lossy, penetrable and multi-layered dielectric and conductive structures, which is needed for an accurate characterization of the wave-matter interaction and EM scattering in the target region; (2) Development of combined Norm-1, Norm-2 regularized imaging algorithms, which are needed for enhancing the resolution of the images while using a minimum number of transmitting and receiving antennas; (3) Implementation and experimental

Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

OpenAIRE

Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

2001-01-01

Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

Development of a quality-assessment tool for experimental bruxism studies: reliability and validity

NARCIS (Netherlands)

Dawson, A.; Raphael, K.G.; Glaros, A.; Axelsson, S.; Arima, T.; Ernberg, M.; Farella, M.; Lobbezoo, F.; Manfredini, D.; Michelotti, A.; Svensson, P.; List, T.

2013-01-01

AIMS: To combine empirical evidence and expert opinion in a formal consensus method in order to develop a quality-assessment tool for experimental bruxism studies in systematic reviews. METHODS: Tool development comprised five steps: (1) preliminary decisions, (2) item generation, (3) face-validity

Validation of Code ASTEC with LIVE-L1 Experimental Results

International Nuclear Information System (INIS)

Bachrata, Andrea

2008-01-01

The severe accidents with core melting are considered at the design stage of project at Generation 3+ of Nuclear Power Plants (NPP). Moreover, there is an effort to apply the severe accident management to the operated NPP. The one of main goals of severe accidents mitigation is corium localization and stabilization. The two strategies that fulfil this requirement are: the in-vessel retention (e.g. AP-600, AP- 1000) and the ex-vessel retention (e.g. EPR). To study the scenario of in-vessel retention, a large experimental program and the integrated codes have been developed. The LIVE-L1 experimental facility studied the formation of melt pools and the melt accumulation in the lower head using different cooling conditions. Nowadays, a new European computer code ASTEC is being developed jointly in France and Germany. One of the important steps in ASTEC development in the area of in-vessel retention of corium is its validation with LIVE-L1 experimental results. Details of the experiment are reported. Results of the ASTEC (module DIVA) application to the analysis of the test are presented. (author)

Primer on consumer marketing research : procedures, methods, and tools

Science.gov (United States)

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Numerical calibration and experimental validation of a PCM-Air heat exchanger model

International Nuclear Information System (INIS)

Stathopoulos, N.; El Mankibi, M.; Santamouris, Mattheos

2017-01-01

Highlights: • Development of a PCM-Air heat exchanger experimental unit and its numerical model. • Differential Scanning Calorimetry for PCM properties. • Ineptitude of DSC obtained heat capacity curves. • Creation of adequate heat capacity curves depending on heat transfer rates. • Confrontation of numerical and experimental results and validation of the model. - Abstract: Ambitious goals have been set at international, European and French level for energy consumption and greenhouse gas emissions decrease of the building sector. Achieving them requires renewable energy integration, a technology that presents however an important drawback: intermittent energy production. In response, thermal energy storage (TES) technology applications have been developed in order to correlate energy production and consumption of the building. Phase Change Materials (PCMs) have been widely used in TES applications as they offer a high storage density and adequate phase change temperature range. It is important to accurately know the thermophysical properties of the PCM, both for experimental (system design) and numerical (correct prediction) purposes. In this paper, the fabrication of a PCM – Air experimental prototype is presented at first, along with the development of a numerical model simulating the downstream temperature evolution of the heat exchanger. Particular focus is given to the calibration method and the validation of the model using experimental characterization results. Differential scanning calorimetry (DSC) is used to define the thermal properties of the PCM. Initial numerical results are underestimated compared to experimental ones. Various factors were investigated, pointing to the ineptitude of the heat capacity parameter, as DSC results depend on heating/cooling rates. Adequate heat capacity curves were empirically determined, depending on heat transfer rates and based on DSC results and experimental observations. The results of the proposed model

MCNPTM criticality primer and training experiences

International Nuclear Information System (INIS)

Briesmeister, J.; Forster, R.A.; Busch, R.

1995-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

Recent Advances in Simulation of Eddy Current Testing of Tubes and Experimental Validations

Science.gov (United States)

Reboud, C.; Prémel, D.; Lesselier, D.; Bisiaux, B.

2007-03-01

Eddy current testing (ECT) is widely used in iron and steel industry for the inspection of tubes during manufacturing. A collaboration between CEA and the Vallourec Research Center led to the development of new numerical functionalities dedicated to the simulation of ECT of non-magnetic tubes by external probes. The achievement of experimental validations led us to the integration of these models into the CIVA platform. Modeling approach and validation results are discussed here. A new numerical scheme is also proposed in order to improve the accuracy of the model.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Experimental validation of the twins prediction program for rolling noise. Pt.2: results

NARCIS (Netherlands)

Thompson, D.J.; Fodiman, P.; Mahé, H.

1996-01-01

Two extensive measurement campaigns have been carried out to validate the TWINS prediction program for rolling noise, as described in part 1 of this paper. This second part presents the experimental results of vibration and noise during train pass-bys and compares them with predictions from the

Modeling and experimental validation of a Hybridized Energy Storage System for automotive applications

Science.gov (United States)

Fiorenti, Simone; Guanetti, Jacopo; Guezennec, Yann; Onori, Simona

2013-11-01

This paper presents the development and experimental validation of a dynamic model of a Hybridized Energy Storage System (HESS) consisting of a parallel connection of a lead acid (PbA) battery and double layer capacitors (DLCs), for automotive applications. The dynamic modeling of both the PbA battery and the DLC has been tackled via the equivalent electric circuit based approach. Experimental tests are designed for identification purposes. Parameters of the PbA battery model are identified as a function of state of charge and current direction, whereas parameters of the DLC model are identified for different temperatures. A physical HESS has been assembled at the Center for Automotive Research The Ohio State University and used as a test-bench to validate the model against a typical current profile generated for Start&Stop applications. The HESS model is then integrated into a vehicle simulator to assess the effects of the battery hybridization on the vehicle fuel economy and mitigation of the battery stress.

Experimental validation of prototype high voltage bushing

Science.gov (United States)

Shah, Sejal; Tyagi, H.; Sharma, D.; Parmar, D.; M. N., Vishnudev; Joshi, K.; Patel, K.; Yadav, A.; Patel, R.; Bandyopadhyay, M.; Rotti, C.; Chakraborty, A.

2017-08-01

Prototype High voltage bushing (PHVB) is a scaled down configuration of DNB High Voltage Bushing (HVB) of ITER. It is designed for operation at 50 kV DC to ensure operational performance and thereby confirming the design configuration of DNB HVB. Two concentric insulators viz. Ceramic and Fiber reinforced polymer (FRP) rings are used as double layered vacuum boundary for 50 kV isolation between grounded and high voltage flanges. Stress shields are designed for smooth electric field distribution. During ceramic to Kovar brazing, spilling cannot be controlled which may lead to high localized electrostatic stress. To understand spilling phenomenon and precise stress calculation, quantitative analysis was performed using Scanning Electron Microscopy (SEM) of brazed sample and similar configuration modeled while performing the Finite Element (FE) analysis. FE analysis of PHVB is performed to find out electrical stresses on different areas of PHVB and are maintained similar to DNB HV Bushing. With this configuration, the experiment is performed considering ITER like vacuum and electrical parameters. Initial HV test is performed by temporary vacuum sealing arrangements using gaskets/O-rings at both ends in order to achieve desired vacuum and keep the system maintainable. During validation test, 50 kV voltage withstand is performed for one hour. Voltage withstand test for 60 kV DC (20% higher rated voltage) have also been performed without any breakdown. Successful operation of PHVB confirms the design of DNB HV Bushing. In this paper, configuration of PHVB with experimental validation data is presented.

Experimental validation of error in temperature measurements in thin walled ductile iron castings

DEFF Research Database (Denmark)

Pedersen, Karl Martin; Tiedje, Niels Skat

2007-01-01

An experimental analysis has been performed to validate the measurement error of cooling curves measured in thin walled ductile cast iron. Specially designed thermocouples with Ø0.2 mm thermocouple wire in Ø1.6 mm ceramic tube was used for the experiments. Temperatures were measured in plates...

Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

DEFF Research Database (Denmark)

Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

2014-01-01

, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

Experimental validation of a thermodynamic boiler model under steady state and dynamic conditions

International Nuclear Information System (INIS)

Carlon, Elisa; Verma, Vijay Kumar; Schwarz, Markus; Golicza, Laszlo; Prada, Alessandro; Baratieri, Marco; Haslinger, Walter; Schmidl, Christoph

2015-01-01

Highlights: • Laboratory tests on two commercially available pellet boilers. • Steady state and a dynamic load cycle tests. • Pellet boiler model calibration based on data registered in stationary operation. • Boiler model validation with reference to both stationary and dynamic operation. • Validated model suitable for coupled simulation of building and heating system. - Abstract: Nowadays dynamic building simulation is an essential tool for the design of heating systems for residential buildings. The simulation of buildings heated by biomass systems, first of all needs detailed boiler models, capable of simulating the boiler both as a stand-alone appliance and as a system component. This paper presents the calibration and validation of a boiler model by means of laboratory tests. The chosen model, i.e. TRNSYS “Type 869”, has been validated for two commercially available pellet boilers of 6 and 12 kW nominal capacities. Two test methods have been applied: the first is a steady state test at nominal load and the second is a load cycle test including stationary operation at different loads as well as transient operation. The load cycle test is representative of the boiler operation in the field and characterises the boiler’s stationary and dynamic behaviour. The model had been calibrated based on laboratory data registered during stationary operation at different loads and afterwards it was validated by simulating both the stationary and the dynamic tests. Selected parameters for the validation were the heat transfer rates to water and the water temperature profiles inside the boiler and at the boiler outlet. Modelling results showed better agreement with experimental data during stationary operation rather than during dynamic operation. Heat transfer rates to water were predicted with a maximum deviation of 10% during the stationary operation, and a maximum deviation of 30% during the dynamic load cycle. However, for both operational regimes the

A database of PCR primers for the chloroplast genomes of higher plants

Science.gov (United States)

Heinze, Berthold

2007-01-01

Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

A database of PCR primers for the chloroplast genomes of higher plants

Directory of Open Access Journals (Sweden)

Heinze Berthold

2007-02-01

Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

Advanced Reactors-Intermediate Heat Exchanger (IHX) Coupling: Theoretical Modeling and Experimental Validation

Energy Technology Data Exchange (ETDEWEB)

Utgikar, Vivek [Univ. of Idaho, Moscow, ID (United States); Sun, Xiaodong [The Ohio State Univ., Columbus, OH (United States); Christensen, Richard [The Ohio State Univ., Columbus, OH (United States); Sabharwall, Piyush [Idaho National Lab. (INL), Idaho Falls, ID (United States)

2016-12-29

The overall goal of the research project was to model the behavior of the advanced reactorintermediate heat exchange system and to develop advanced control techniques for off-normal conditions. The specific objectives defined for the project were: 1. To develop the steady-state thermal hydraulic design of the intermediate heat exchanger (IHX); 2. To develop mathematical models to describe the advanced nuclear reactor-IHX-chemical process/power generation coupling during normal and off-normal operations, and to simulate models using multiphysics software; 3. To develop control strategies using genetic algorithm or neural network techniques and couple these techniques with the multiphysics software; 4. To validate the models experimentally The project objectives were accomplished by defining and executing four different tasks corresponding to these specific objectives. The first task involved selection of IHX candidates and developing steady state designs for those. The second task involved modeling of the transient and offnormal operation of the reactor-IHX system. The subsequent task dealt with the development of control strategies and involved algorithm development and simulation. The last task involved experimental validation of the thermal hydraulic performances of the two prototype heat exchangers designed and fabricated for the project at steady state and transient conditions to simulate the coupling of the reactor- IHX-process plant system. The experimental work utilized the two test facilities at The Ohio State University (OSU) including one existing High-Temperature Helium Test Facility (HTHF) and the newly developed high-temperature molten salt facility.

The ability of T2/B4 primers to detect Leishmania infantum among ...

African Journals Online (AJOL)

SERVER

2008-04-03

Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

Science.gov (United States)

Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

2013-09-01

New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Method for Determining Volumetric Efficiency and Its Experimental Validation

Directory of Open Access Journals (Sweden)

Ambrozik Andrzej

2017-12-01

Full Text Available Modern means of transport are basically powered by piston internal combustion engines. Increasingly rigorous demands are placed on IC engines in order to minimise the detrimental impact they have on the natural environment. That stimulates the development of research on piston internal combustion engines. The research involves experimental and theoretical investigations carried out using computer technologies. While being filled, the cylinder is considered to be an open thermodynamic system, in which non-stationary processes occur. To make calculations of thermodynamic parameters of the engine operating cycle, based on the comparison of cycles, it is necessary to know the mean constant value of cylinder pressure throughout this process. Because of the character of in-cylinder pressure pattern and difficulties in pressure experimental determination, in the present paper, a novel method for the determination of this quantity was presented. In the new approach, the iteration method was used. In the method developed for determining the volumetric efficiency, the following equations were employed: the law of conservation of the amount of substance, the first law of thermodynamics for open system, dependences for changes in the cylinder volume vs. the crankshaft rotation angle, and the state equation. The results of calculations performed with this method were validated by means of experimental investigations carried out for a selected engine at the engine test bench. A satisfactory congruence of computational and experimental results as regards determining the volumetric efficiency was obtained. The method for determining the volumetric efficiency presented in the paper can be used to investigate the processes taking place in the cylinder of an IC engine.

Computational Design and Experimental Validation of New Thermal Barrier Systems

Energy Technology Data Exchange (ETDEWEB)

Guo, Shengmin; Yang, Shizhong; Khosravi, Ebrahim

2011-12-31

This project (10/01/2010-9/30/2013), “Computational Design and Experimental Validation of New Thermal Barrier Systems”, originates from Louisiana State University (LSU) Mechanical Engineering Department and Southern University (SU) Department of Computer Science. This proposal will directly support the technical goals specified in DE-FOA-0000248, Topic Area 3: Turbine Materials, by addressing key technologies needed to enable the development of advanced turbines and turbine-based systems that will operate safely and efficiently using coal-derived synthesis gases. We will develop novel molecular dynamics method to improve the efficiency of simulation on novel TBC materials; we will perform high performance computing (HPC) on complex TBC structures to screen the most promising TBC compositions; we will perform material characterizations and oxidation/corrosion tests; and we will demonstrate our new Thermal barrier coating (TBC) systems experimentally under Integrated gasification combined cycle (IGCC) environments. The durability of the coating will be examined using the proposed High Temperature/High Pressure Durability Test Rig under real syngas product compositions.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Experimental validation of a rate-based model for CO2 capture using an AMP solution

DEFF Research Database (Denmark)

Gabrielsen, Jostein; Svendsen, H. F.; Michelsen, Michael Locht

2007-01-01

Detailed experimental data, including temperature profiles over the absorber, for a carbon dioxide (CO"2) absorber with structured packing in an integrated laboratory pilot plant using an aqueous 2-amino-2-methyl-1-propanol (AMP) solution are presented. The experimental gas-liquid material balance...... was within an average of 3.5% for the experimental conditions presented. A predictive rate-based steady-state model for CO"2 absorption into an AMP solution, using an implicit expression for the enhancement factor, has been validated against the presented pilot plant data. Furthermore, a parameter...

Analytical and Experimental Study for Validation of the Device to Confine BN Reactor Melted Fuel

International Nuclear Information System (INIS)

Rogozhkin, S.; Osipov, S.; Sobolev, V.; Shepelev, S.; Kozhaev, A.; Mavrin, M.; Ryabov, A.

2013-01-01

To validate the design and confirm the design characteristics of the special retaining device (core catcher) used for protection of BN reactor vessel in the case of a severe beyond-design basis accident with core melting, computational and experimental studies were carried out. The Tray test facility that uses water as coolant was developed and fabricated by OKBM; experimental studies were performed. To verify the methodical approach used for the computational study, experimental results obtained in the Tray test facility were compared with numerical simulation results obtained by the STAR-CCM+ CFD code

Experimental validation of the fluid–structure interaction simulation of a bioprosthetic aortic heart valve

International Nuclear Information System (INIS)

Kemp, I.; Dellimore, K.; Rodriguez, R.; Scheffer, C.; Blaine, D.; Weich, H.; Doubell, A.

2013-01-01

Experiments performed on a 19 mm diameter bioprosthetic valve were used to successfully validate the fluid–structure interaction (FSI) simulation of an aortic valve at 72 bpm. The FSI simulation was initialized via a novel approach utilizing a Doppler sonogram of the experimentally tested valve. Using this approach very close quantitative agreement (≤12.5 %) between the numerical predictions and experimental values for several key valve performance parameters, including the peak systolic transvalvular pressure gradient, rapid valve opening time and rapid valve closing time, was obtained. The predicted valve leaflet kinematics during opening and closing were also in good agreement with the experimental measurements.

Design of a Percussion and Electric Primer Gun Firing Power Supply

Science.gov (United States)

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

Science.gov (United States)

Duina, Andrea A; Miller, Mary E; Keeney, Jill B

2014-05-01

The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

Science.gov (United States)

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Computational Modelling of Patella Femoral Kinematics During Gait Cycle and Experimental Validation

Science.gov (United States)

Maiti, Raman

2016-06-01

The effect of loading and boundary conditions on patellar mechanics is significant due to the complications arising in patella femoral joints during total knee replacements. To understand the patellar mechanics with respect to loading and motion, a computational model representing the patella femoral joint was developed and validated against experimental results. The computational model was created in IDEAS NX and simulated in MSC ADAMS/VIEW software. The results obtained in the form of internal external rotations and anterior posterior displacements for a new and experimentally simulated specimen for patella femoral joint under standard gait condition were compared with experimental measurements performed on the Leeds ProSim knee simulator. A good overall agreement between the computational prediction and the experimental data was obtained for patella femoral kinematics. Good agreement between the model and the past studies was observed when the ligament load was removed and the medial lateral displacement was constrained. The model is sensitive to ±5 % change in kinematics, frictional, force and stiffness coefficients and insensitive to time step.

Parametric model of servo-hydraulic actuator coupled with a nonlinear system: Experimental validation

Science.gov (United States)

Maghareh, Amin; Silva, Christian E.; Dyke, Shirley J.

2018-05-01

Hydraulic actuators play a key role in experimental structural dynamics. In a previous study, a physics-based model for a servo-hydraulic actuator coupled with a nonlinear physical system was developed. Later, this dynamical model was transformed into controllable canonical form for position tracking control purposes. For this study, a nonlinear device is designed and fabricated to exhibit various nonlinear force-displacement profiles depending on the initial condition and the type of materials used as replaceable coupons. Using this nonlinear system, the controllable canonical dynamical model is experimentally validated for a servo-hydraulic actuator coupled with a nonlinear physical system.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

Directory of Open Access Journals (Sweden)

Alexandre R. Zuntini

2013-08-01

Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Experimental validation of TASS/SMR-S critical flow model for the integral reactor SMART

Energy Technology Data Exchange (ETDEWEB)

Seo, Si Won; Ra, In Sik; Kim, Kun Yeup [ACT Co., Daejeon (Korea, Republic of); Chung, Young Jong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2011-05-15

An advanced integral PWR, SMART (System- Integrated Modular Advanced ReacTor) is being developed in KAERI. It has a compact size and a relatively small power rating (330MWt) compared to a conventional reactor. Because new concepts are applied to SMART, an experimental and analytical validation is necessary for the safety evaluation of SMART. The analytical safety validation is being accomplished by a safety analysis code for an integral reactor, TASS/SMR-S developed by KAERI. TASS/SMR-S uses a lumped parameter one dimensional node and path modeling for the thermal hydraulic calculation and it uses point kinetics for the reactor power calculation. It has models for a general usage such as a core heat transfer model, a wall heat structure model, a critical flow model, component models, and it also has many SMART specific models such as an once through helical coiled steam generator model, and a condensate heat transfer model. To ensure that the TASS/SMR-S code has the calculation capability for the safety evaluation of SMART, the code should be validated for the specific models with the separate effect test experimental results. In this study, TASS/SMR-S critical flow model is evaluated as compared with SMD (Super Moby Dick) experiment

A Hearing Aid Primer 1

Science.gov (United States)

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

A classical primer for QCD

International Nuclear Information System (INIS)

Moriyasu, K.

1981-01-01

A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

Experimental validation of UTDefect

Energy Technology Data Exchange (ETDEWEB)

Eriksson, A.S. [ABB Tekniska Roentgencentralen AB, Taeby (Sweden); Bostroem, A.; Wirdelius, H. [Chalmers Univ. of Technology, Goeteborg (Sweden). Div. of Mechanics

1997-01-01

This study reports on conducted experiments and computer simulations of ultrasonic nondestructive testing (NDT). Experiments and simulations are compared with the purpose of validating the simulation program UTDefect. UTDefect simulates ultrasonic NDT of cracks and some other defects in isotropic and homogeneous materials. Simulations for the detection of surface breaking cracks are compared with experiments in pulse-echo mode on surface breaking cracks in carbon steel plates. The echo dynamics are plotted and compared with the simulations. The experiments are performed on a plate with thickness 36 mm and the crack depths are 7.2 mm and 18 mm. L- and T-probes with frequency 1, 2 and 4 MHz and angels 45, 60 and 70 deg are used. In most cases the probe and the crack is on opposite sides of the plate, but in some cases they are on the same side. Several cracks are scanned from two directions. In total 53 experiments are reported for 33 different combinations. Generally the simulations agree well with the experiments and UTDefect is shown to be able to, within certain limits, perform simulations that are close to experiments. It may be concluded that: For corner echoes the eight 45 deg cases and the eight 60 deg cases show good agreement between experiments and UTDefect, especially for the 7.2 mm crack. The amplitudes differ more for some cases where the defect is close to the probe and for the corner of the 18 mm crack. For the two 70 deg cases there are too few experimental values to compare the curve shapes, but the amplitudes do not differ too much. The tip diffraction echoes also agree well in general. For some cases, where the defect is close to the probe, the amplitudes differ more than 10-15 dB, but for all but two cases the difference in amplitude is less than 7 dB. 6 refs.

Tools for Ultraspecific Probe/Primer Design

National Research Council Canada - National Science Library

Fofanov, Yurly

2006-01-01

.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

Diversity of internal structures in inhibited epoxy primers

Directory of Open Access Journals (Sweden)

Anthony E. Hughes

2015-10-01

Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

Macroscopic Dynamic Modeling of Sequential Batch Cultures of Hybridoma Cells: An Experimental Validation

Directory of Open Access Journals (Sweden)

Laurent Dewasme

2017-02-01

Full Text Available Hybridoma cells are commonly grown for the production of monoclonal antibodies (MAb. For monitoring and control purposes of the bioreactors, dynamic models of the cultures are required. However these models are difficult to infer from the usually limited amount of available experimental data and do not focus on target protein production optimization. This paper explores an experimental case study where hybridoma cells are grown in a sequential batch reactor. The simplest macroscopic reaction scheme translating the data is first derived using a maximum likelihood principal component analysis. Subsequently, nonlinear least-squares estimation is used to determine the kinetic laws. The resulting dynamic model reproduces quite satisfactorily the experimental data, as evidenced in direct and cross-validation tests. Furthermore, model predictions can also be used to predict optimal medium renewal time and composition.

Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

Directory of Open Access Journals (Sweden)

El-Sayed Negim

2016-01-01

Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

Validation of the revised Mystical Experience Questionnaire in experimental sessions with psilocybin.

Science.gov (United States)

Barrett, Frederick S; Johnson, Matthew W; Griffiths, Roland R

2015-11-01

The 30-item revised Mystical Experience Questionnaire (MEQ30) was previously developed within an online survey of mystical-type experiences occasioned by psilocybin-containing mushrooms. The rated experiences occurred on average eight years before completion of the questionnaire. The current paper validates the MEQ30 using data from experimental studies with controlled doses of psilocybin. Data were pooled and analyzed from five laboratory experiments in which participants (n=184) received a moderate to high oral dose of psilocybin (at least 20 mg/70 kg). Results of confirmatory factor analysis demonstrate the reliability and internal validity of the MEQ30. Structural equation models demonstrate the external and convergent validity of the MEQ30 by showing that latent variable scores on the MEQ30 positively predict persisting change in attitudes, behavior, and well-being attributed to experiences with psilocybin while controlling for the contribution of the participant-rated intensity of drug effects. These findings support the use of the MEQ30 as an efficient measure of individual mystical experiences. A method to score a "complete mystical experience" that was used in previous versions of the mystical experience questionnaire is validated in the MEQ30, and a stand-alone version of the MEQ30 is provided for use in future research. © The Author(s) 2015.

Bond strength of compomers to dentin using acidic primers.

Science.gov (United States)

Tate, W H; You, C; Powers, J M

1999-10-01

To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

Experimental validation of sound field control with a circular double-layer array of loudspeakers

DEFF Research Database (Denmark)

Chang, Jiho; Jacobsen, Finn

2013-01-01

This paper is concerned with experimental validation of a recently proposed method of controlling sound fields with a circular double-layer array of loudspeakers [Chang and Jacobsen, J. Acoust. Soc. Am. 131(6), 4518-4525 (2012)]. The double-layer of loudspeakers is realized with 20 pairs of closed...

Numerical Simulation and Experimental Validation of the Inflation Test of Latex Balloons

OpenAIRE

Bustos, Claudio; Herrera, Claudio García; Celentano, Diego; Chen, Daming; Cruchaga, Marcela

2016-01-01

Abstract Experiments and modeling aimed at assessing the mechanical response of latex balloons in the inflation test are presented. To this end, the hyperelastic Yeoh material model is firstly characterized via tensile test and, then, used to numerically simulate via finite elements the stress-strain evolution during the inflation test. The numerical pressure-displacement curves are validated with those obtained experimentally. Moreover, this analysis is extended to a biomedical problem of an...

Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

OpenAIRE

Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

2014-01-01

Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

Directory of Open Access Journals (Sweden)

Francesco Dal Grande

2013-03-01

Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

40 CFR 63.745 - Standards: Primer and topcoat application operations.

Science.gov (United States)

2010-07-01

... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

Experimental validation of field cooling simulations for linear superconducting magnetic bearings

Energy Technology Data Exchange (ETDEWEB)

Dias, D H N; Motta, E S; Sotelo, G G; De Andrade Jr, R, E-mail: ddias@coe.ufrj.b [Laboratorio de aplicacao de Supercondutores (LASUP), Universidade Federal do Rio de Janeiro, Rio de Janeiro (Brazil)

2010-07-15

For practical stability of a superconducting magnetic bearing the refrigeration process must occur with the superconductor in the presence of the magnetic field (a field cooling (FC) process). This paper presents an experimental validation of a method for simulating this system in the FC case. Measured and simulated results for a vertical force between a high temperature superconductor and a permanent magnet rail are compared. The main purpose of this work is to consolidate a simulation tool that can help in future projects on superconducting magnetic bearings for MagLev vehicles.

Design of passive directional acoustic devices using Topology Optimization - from method to experimental validation

DEFF Research Database (Denmark)

Christiansen, Rasmus Ellebæk; Fernandez Grande, Efren

2016-01-01

emission in two dimensions and is experimentally validated using three dimensional prints of the optimized designs. The emitted fields exhibit a level difference of at least 15 dB on axis relative to the off-axis directions, over frequency bands of approximately an octave. It is demonstrated to be possible...

Neuroinflammatory targets and treatments for epilepsy validated in experimental models.

Science.gov (United States)

Aronica, Eleonora; Bauer, Sebastian; Bozzi, Yuri; Caleo, Matteo; Dingledine, Raymond; Gorter, Jan A; Henshall, David C; Kaufer, Daniela; Koh, Sookyong; Löscher, Wolfgang; Louboutin, Jean-Pierre; Mishto, Michele; Norwood, Braxton A; Palma, Eleonora; Poulter, Michael O; Terrone, Gaetano; Vezzani, Annamaria; Kaminski, Rafal M

2017-07-01

A large body of evidence that has accumulated over the past decade strongly supports the role of inflammation in the pathophysiology of human epilepsy. Specific inflammatory molecules and pathways have been identified that influence various pathologic outcomes in different experimental models of epilepsy. Most importantly, the same inflammatory pathways have also been found in surgically resected brain tissue from patients with treatment-resistant epilepsy. New antiseizure therapies may be derived from these novel potential targets. An essential and crucial question is whether targeting these molecules and pathways may result in anti-ictogenesis, antiepileptogenesis, and/or disease-modification effects. Therefore, preclinical testing in models mimicking relevant aspects of epileptogenesis is needed to guide integrated experimental and clinical trial designs. We discuss the most recent preclinical proof-of-concept studies validating a number of therapeutic approaches against inflammatory mechanisms in animal models that could represent novel avenues for drug development in epilepsy. Finally, we suggest future directions to accelerate preclinical to clinical translation of these recent discoveries. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

Science.gov (United States)

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Numerical Simulation and Experimental Validation of the Inflation Test of Latex Balloons

Directory of Open Access Journals (Sweden)

Claudio Bustos

Full Text Available Abstract Experiments and modeling aimed at assessing the mechanical response of latex balloons in the inflation test are presented. To this end, the hyperelastic Yeoh material model is firstly characterized via tensile test and, then, used to numerically simulate via finite elements the stress-strain evolution during the inflation test. The numerical pressure-displacement curves are validated with those obtained experimentally. Moreover, this analysis is extended to a biomedical problem of an eyeball under glaucoma conditions.

Integral Reactor Containment Condensation Model and Experimental Validation

Energy Technology Data Exchange (ETDEWEB)

Wu, Qiao [Oregon State Univ., Corvallis, OR (United States); Corradini, Michael [Univ. of Wisconsin, Madison, WI (United States)

2016-05-02

This NEUP funded project, NEUP 12-3630, is for experimental, numerical and analytical studies on high-pressure steam condensation phenomena in a steel containment vessel connected to a water cooling tank, carried out at Oregon State University (OrSU) and the University of Wisconsin at Madison (UW-Madison). In the three years of investigation duration, following the original proposal, the planned tasks have been completed: (1) Performed a scaling study for the full pressure test facility applicable to the reference design for the condensation heat transfer process during design basis accidents (DBAs), modified the existing test facility to route the steady-state secondary steam flow into the high pressure containment for controllable condensation tests, and extended the operations at negative gage pressure conditions (OrSU). (2) Conducted a series of DBA and quasi-steady experiments using the full pressure test facility to provide a reliable high pressure condensation database (OrSU). (3) Analyzed experimental data and evaluated condensation model for the experimental conditions, and predicted the prototypic containment performance under accidental conditions (UW-Madison). A film flow model was developed for the scaling analysis, and the results suggest that the 1/3 scaled test facility covers large portion of laminar film flow, leading to a lower average heat transfer coefficient comparing to the prototypic value. Although it is conservative in reactor safety analysis, the significant reduction of heat transfer coefficient (50%) could under estimate the prototypic condensation heat transfer rate, resulting in inaccurate prediction of the decay heat removal capability. Further investigation is thus needed to quantify the scaling distortion for safety analysis code validation. Experimental investigations were performed in the existing MASLWR test facility at OrST with minor modifications. A total of 13 containment condensation tests were conducted for pressure

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

Science.gov (United States)

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

Tyre tread-block friction: modelling, simulation and experimental validation

Science.gov (United States)

Wallaschek, Jörg; Wies, Burkard

2013-07-01

Pneumatic tyres are used in vehicles since the beginning of the last century. They generate braking and steering forces for bicycles, motor cycles, cars, busses, trucks, agricultural vehicles and aircraft. These forces are generated in the usually very small contact area between tyre and road and their performance characteristics are of eminent importance for safety and comfort. Much research has been addressed to optimise tyre design with respect to footprint pressure and friction. In this context, the development of virtual tyre prototypes, that is, simulation models for the tyre, has grown to a science in its own. While the modelling of the structural dynamics of the tyre has reached a very advanced level, which allows to take into account effects like the rate-independent inelasticity of filled elastomers or the transient 3D deformations of the ply-reinforced tread, shoulder and sidewalls, little is known about the friction between tread-block elements and road. This is particularly obvious in the case when snow, ice, water or a third-body layer are present in the tyre-road contact. In the present paper, we give a survey on the present state of knowledge in the modelling, simulation and experimental validation of tyre tread-block friction processes. We concentrate on experimental techniques.

Targeted reduction of highly abundant transcripts using pseudo-random primers.

Science.gov (United States)

Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

2016-04-01

Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

Experimental Validation and Model Verification for a Novel Geometry ICPC Solar Collector

DEFF Research Database (Denmark)

Perers, Bengt; Duff, William S.; Daosukho, Jirachote

A novel geometry ICPC solar collector was developed at the University of Chicago and Colorado State University. A ray tracing model has been designed to investigate the optical performance of both the horizontal and vertical fin versions of this collector. Solar radiation is modeled as discrete...... to the desired incident angle of the sun’s rays, performance of the novel ICPC solar collector at various specified angles along the transverse and longitudinal evacuated tube directions were experimentally determined. To validate the ray tracing model, transverse and longitudinal performance predictions...... at the corresponding specified incident angles are compared to the Sandia results. A 100 m2 336 Novel ICPC evacuated tube solar collector array has been in continuous operation at a demonstration project in Sacramento California since 1998. Data from the initial operation of the array are used to further validate...

Defense Primer: DOD Contractors

Science.gov (United States)

2017-02-10

functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

Directory of Open Access Journals (Sweden)

Li Kelvin

2012-11-01

Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

Freshwater Wetlands: A Citizen's Primer.

Science.gov (United States)

Catskill Center for Conservation and Development, Inc., Hobart, NY.

The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

Experimental Validation of Mathematical Framework for Fast Switching Valves used in Digital Hydraulic Machines

DEFF Research Database (Denmark)

Nørgård, Christian; Roemer, Daniel Beck; Bech, Michael Møller

2015-01-01

of 10 kW during switching (mean of approximately 250 W) and a pressure loss below 0.5 bar at 600 l/min. The main goal of this article is validate parts of the mathematical framework based on a series of experiments. Furthermore, this article aims to document the experience gained from the experimental...

Quantitative Microbial Risk Assessment Tutorial - Primer

Science.gov (United States)

This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

Experimental and simulation validation of ABHE for disinfection of Legionella in hot water systems

International Nuclear Information System (INIS)

Altorkmany, Lobna; Kharseh, Mohamad; Ljung, Anna-Lena; Staffan Lundström, T.

2017-01-01

Highlights: • ABHE system can supply a continues thermal treatment of water with saving energy. • Mathematical and experimental validation of ABHE performance are presented. • EES-based model is developed to simulate ABHE system. • Energy saving by ABHE is proved for different initial working parameters. - Abstract: The work refers to an innovative system inspired by nature that mimics the thermoregulation system that exists in animals. This method, which is called Anti Bacteria Heat Exchanger (ABHE), is proposed to achieve continuous thermal disinfection of bacteria in hot water systems with high energy efficiency. In particular, this study aims to demonstrate the opportunity to gain energy by means of recovering heat over a plate heat exchanger. Firstly, the thermodynamics of the ABHE is clarified to define the ABHE specification. Secondly, a first prototype of an ABHE is built with a specific configuration based on simplicity regarding design and construction. Thirdly, an experimental test is carried out. Finally, a computer model is built to simulate the ABHE system and the experimental data is used to validate the model. The experimental results indicate that the performance of the ABHE system is strongly dependent on the flow rate, while the supplied temperature has less effect. Experimental and simulation data show a large potential for saving energy of this thermal disinfection method by recovering heat. To exemplify, when supplying water at a flow rate of 5 kg/min and at a temperature of 50 °C, the heat recovery is about 1.5 kW while the required pumping power is 1 W. This means that the pressure drop is very small compared to the energy recovered and consequently high saving in total cost is promising.

Experimental validation of a heat transfer model for concentrating photovoltaic system

International Nuclear Information System (INIS)

Sendhil Kumar, Natarajan; Matty, Katz; Rita, Ebner; Simon, Weingaertner; Ortrun, Aßländer; Alex, Cole; Roland, Wertz; Tim, Giesen; Tapas Kumar, Mallick

2012-01-01

In this paper, a three dimensional heat transfer model is presented for a novel concentrating photovoltaic design for Active Solar Panel Initiative System (ASPIS). The concentration ratio of two systems (early and integrated prototype) are 5× and 10× respectively, designed for roof-top integrated Photovoltaic systems. ANSYS 12.1, CFX package was effectively used to predict the temperatures of the components of the both ASPIS systems at various boundary conditions. The predicted component temperatures of an early prototype were compared with experimental results of ASPIS, which were carried out in Solecta – Israel and at the Austrian Institute of Technology (AIT) – Austria. It was observed that the solar cell and lens temperature prediction shows good agreement with Solecta measurements. The minimum and maximum deviation of 3.8% and 17.9% were observed between numerical and Solecta measurements and the maximum deviations of 16.9% were observed between modeling and AIT measurements. Thus, the developed validated thermal model enables to predict the component temperatures for concentrating photovoltaic systems. - Highlights: ► Experimentally validated heat transfer model for concentrating Photovoltaic system developed. ► Predictions of solar cell temperatures for parallactic tracking CPV system for roof integration. ► The ASPIS module contains 2 mm wide 216 solar cells manufactured based on SATURN technology. ► A solar cell temperature of 44 °C was predicted for solar radiation intensity was 1000 W/m 2 and ambient temperature was 20 °C. ► Average deviation was 6% and enabled to predict temperature of any CPV system.

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Sensory reception of the primer pheromone ethyl oleate

Science.gov (United States)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

PSpice Modeling Platform for SiC Power MOSFET Modules with Extensive Experimental Validation

DEFF Research Database (Denmark)

Ceccarelli, Lorenzo; Iannuzzo, Francesco; Nawaz, Muhammad

2016-01-01

to simulate the performance of high current rating (above 100 A), multi-chip SiC MOSFET modules both for static and switching behavior. Therefore, the simulation results have been validated experimentally in a wide range of operating conditions, including high temperatures, gate resistance and stray elements....... The whole process has been repeated for three different modules with voltage rating of 1.2 kV and 1.7 kV, manufactured by three different companies. Lastly, a parallel connection of two modules of the same type has been performed in order to observe the unbalancing and mismatches experimentally......The aim of this work is to present a PSpice implementation for a well-established and compact physics-based SiC MOSFET model, including a fast, experimental-based parameter extraction procedure in a MATLAB GUI environment. The model, originally meant for single-die devices, has been used...

Targeted resequencing and variant validation using pxlence PCR assays

Directory of Open Access Journals (Sweden)

Frauke Coppieters

2016-01-01

Full Text Available The advent of next-generation sequencing technologies had a profound impact on molecular diagnostics. PCR is a popular method for target enrichment of disease gene panels. Using our proprietary primer-design pipeline, primerXL, we have created almost one million assays covering over 98% of the human exome. Here we describe the assay specification and both in silico and wet-lab validation of a selected set of 2294 assays using both next-generation sequencing and Sanger sequencing. Using a universal PCR protocol without optimization, these assays result in high coverage uniformity and limited non-specific coverage. In addition, data indicates a positive correlation between the predictive in silico specificity score and the amount of assay non-specific coverage.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

Science.gov (United States)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

Development and Validation of a Rubric for Diagnosing Students’ Experimental Design Knowledge and Difficulties

Science.gov (United States)

Dasgupta, Annwesa P.; Anderson, Trevor R.

2014-01-01

It is essential to teach students about experimental design, as this facilitates their deeper understanding of how most biological knowledge was generated and gives them tools to perform their own investigations. Despite the importance of this area, surprisingly little is known about what students actually learn from designing biological experiments. In this paper, we describe a rubric for experimental design (RED) that can be used to measure knowledge of and diagnose difficulties with experimental design. The development and validation of the RED was informed by a literature review and empirical analysis of undergraduate biology students’ responses to three published assessments. Five areas of difficulty with experimental design were identified: the variable properties of an experimental subject; the manipulated variables; measurement of outcomes; accounting for variability; and the scope of inference appropriate for experimental findings. Our findings revealed that some difficulties, documented some 50 yr ago, still exist among our undergraduate students, while others remain poorly investigated. The RED shows great promise for diagnosing students’ experimental design knowledge in lecture settings, laboratory courses, research internships, and course-based undergraduate research experiences. It also shows potential for guiding the development and selection of assessment and instructional activities that foster experimental design. PMID:26086658

Visual Servoing Tracking Control of a Ball and Plate System: Design, Implementation and Experimental Validation

Directory of Open Access Journals (Sweden)

Ming-Tzu Ho

2013-07-01

Full Text Available This paper presents the design, implementation and validation of real-time visual servoing tracking control for a ball and plate system. The position of the ball is measured with a machine vision system. The image processing algorithms of the machine vision system are pipelined and implemented on a field programmable gate array (FPGA device to meet real-time constraints. A detailed dynamic model of the system is derived for the simulation study. By neglecting the high-order coupling terms, the ball and plate system model is simplified into two decoupled ball and beam systems, and an approximate input-output feedback linearization approach is then used to design the controller for trajectory tracking. The designed control law is implemented on a digital signal processor (DSP. The validity of the performance of the developed control system is investigated through simulation and experimental studies. Experimental results show that the designed system functions well with reasonable agreement with simulations.

Collider physics within the standard model a primer

CERN Document Server

Altarelli, Guido

2017-01-01

With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

Science.gov (United States)

Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

2015-01-01

Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities* #

Science.gov (United States)

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-01-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20–23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community. PMID:25367789

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities.

Science.gov (United States)

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-11-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20-23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community.

Texas Panhandle soil-crop-beef food chain for uranium: a dynamic model validated by experimental data

International Nuclear Information System (INIS)

Wenzel, W.J.; Wallwork-Barber, K.M.; Rodgers, J.C.; Gallegos, A.F.

1982-01-01

Long-term simulations of uranium transport in the soil-crop-beef food chain were performed using the BIOTRAN model. Experimental data means from an extensive Pantex beef cattle study are presented. Experimental data were used to validate the computer model. Measurements of uranium in air, soil, water, range grasses, feed, and cattle tissues are compared to simulated uranium output values in these matrices when the BIOTRAN model was set at the measured soil and air values. The simulations agreed well with experimental data even though metabolic details for ruminants and uranium chemical form in the environment remain to be studied

Chemical looping reforming in packed-bed reactors : modelling, experimental validation and large-scale reactor design

NARCIS (Netherlands)

Spallina, V.; Marinello, B.; Gallucci, F.; Romano, M.C.; van Sint Annaland, M.

This paper addresses the experimental demonstration and model validation of chemical looping reforming in dynamically operated packed-bed reactors for the production of H2 or CH3OH with integrated CO2 capture. This process is a combination of auto-thermal and steam methane reforming and is carried

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

Science.gov (United States)

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

The R primer

CERN Document Server

Ekstrom, Claus Thorn

2011-01-01

Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

Simulation, experimental validation and kinematic optimization of a Stirling engine using air and helium

International Nuclear Information System (INIS)

Bert, Juliette; Chrenko, Daniela; Sophy, Tonino; Le Moyne, Luis; Sirot, Frédéric

2014-01-01

A Stirling engine with nominal output power of 1 kW is tested using air and helium as working gases. The influence of working pressure, engine speed and temperature of the hot source is studied, analyzing instantaneous gas pressure as well as instantaneous and stationary temperature at different positions to derive the effective power. A zero dimensional finite-time thermodynamic, three zones model of a generic Stirling engine is developed and successfully validated against experimental gas temperature and pressure in each zone, providing the effective power. This validation underlines the interest of different working gases as well as different geometric configurations for different applications. Furthermore, the validated model allows parametric studies of the engine, with regard to geometry, working gas and engine kinematics. It is used in order to optimize the kinematic of a Stirling engine for different working points and gases. - Highlights: • A Stirling engine of 1 kW is tested using air and helium as working gas. • Effects of working pressure, speed and temperature on power are studied. • A zero dimensional finite-time thermodynamic, three zones model of it is validated. • The validated model is used for parametric studies and optimization of the engine

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

Directory of Open Access Journals (Sweden)

Prima Ditahardiyani

2008-01-01

Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

Experimental validation of thermal design of top shield for a pool type SFR

International Nuclear Information System (INIS)

Aithal, Sriramachandra; Babu, V. Rajan; Balasubramaniyan, V.; Velusamy, K.; Chellapandi, P.

2016-01-01

Highlights: • Overall thermal design of top shield in a SFR is experimentally verified. • Air jet cooling is effective in ensuring the temperatures limits for top shield. • Convection patterns in narrow annulus are in line with published CFD results. • Wire mesh insulation ensures gradual thermal gradient at top portion of main vessel. • Under loss of cooling scenario, sufficient time is available for corrective action. - Abstract: An Integrated Top Shield Test Facility towards validation of thermal design of top shield for a pool type SFR has been conceived, constructed & commissioned. Detailed experiments were performed in this experimental facility having full-scale features. Steady state temperature distribution within the facility is measured for various heater plate temperatures in addition to simulating different operating states of the reactor. Following are the important observations (i) jet cooling system is effective in regulating the roof slab bottom plate temperature and thermal gradient across roof slab simulating normal operation of reactor, (ii) wire mesh insulation provided in roof slab-main vessel annulus is effective in obtaining gradual thermal gradient along main vessel top portion and inhibiting the setting up of cellular convection within annulus and (iii) cellular convection with four distinct convective cells sets in the annular gap between roof slab and small rotatable plug measuring ∼ϕ4 m in diameter & gap width varying from 16 mm to 30 mm. Repeatability of results is also ensured during all the above tests. The results presented in this paper is expected to provide reference data for validation of thermal hydraulic models in addition to serving as design validation of jet cooling system for pool type SFR.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

Science.gov (United States)

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

OpenAIRE

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

De novo peptide design and experimental validation of histone methyltransferase inhibitors.

Directory of Open Access Journals (Sweden)

James Smadbeck

Full Text Available Histones are small proteins critical to the efficient packaging of DNA in the nucleus. DNA–protein complexes, known as nucleosomes, are formed when the DNA winds itself around the surface of the histones. The methylation of histone residues by enhancer of zeste homolog 2 (EZH2 maintains gene repression over successive cell generations. Overexpression of EZH2 can silence important tumor suppressor genes leading to increased invasiveness of many types of cancers. This makes the inhibition of EZH2 an important target in the development of cancer therapeutics. We employed a three-stage computational de novo peptide design method to design inhibitory peptides of EZH2. The method consists of a sequence selection stage and two validation stages for fold specificity and approximate binding affinity. The sequence selection stage consists of an integer linear optimization model that was solved to produce a rank-ordered list of amino acid sequences with increased stability in the bound peptide-EZH2 structure. These sequences were validated through the calculation of the fold specificity and approximate binding affinity of the designed peptides. Here we report the discovery of novel EZH2 inhibitory peptides using the de novo peptide design method. The computationally discovered peptides were experimentally validated in vitro using dose titrations and mechanism of action enzymatic assays. The peptide with the highest in vitro response, SQ037, was validated in nucleo using quantitative mass spectrometry-based proteomics. This peptide had an IC50 of 13.5 mM, demonstrated greater potency as an inhibitor when compared to the native and K27A mutant control peptides, and demonstrated competitive inhibition versus the peptide substrate. Additionally, this peptide demonstrated high specificity to the EZH2 target in comparison to other histone methyltransferases. The validated peptides are the first computationally designed peptides that directly inhibit EZH2

De novo peptide design and experimental validation of histone methyltransferase inhibitors.

Directory of Open Access Journals (Sweden)

James Smadbeck

Full Text Available Histones are small proteins critical to the efficient packaging of DNA in the nucleus. DNA-protein complexes, known as nucleosomes, are formed when the DNA winds itself around the surface of the histones. The methylation of histone residues by enhancer of zeste homolog 2 (EZH2 maintains gene repression over successive cell generations. Overexpression of EZH2 can silence important tumor suppressor genes leading to increased invasiveness of many types of cancers. This makes the inhibition of EZH2 an important target in the development of cancer therapeutics. We employed a three-stage computational de novo peptide design method to design inhibitory peptides of EZH2. The method consists of a sequence selection stage and two validation stages for fold specificity and approximate binding affinity. The sequence selection stage consists of an integer linear optimization model that was solved to produce a rank-ordered list of amino acid sequences with increased stability in the bound peptide-EZH2 structure. These sequences were validated through the calculation of the fold specificity and approximate binding affinity of the designed peptides. Here we report the discovery of novel EZH2 inhibitory peptides using the de novo peptide design method. The computationally discovered peptides were experimentally validated in vitro using dose titrations and mechanism of action enzymatic assays. The peptide with the highest in vitro response, SQ037, was validated in nucleo using quantitative mass spectrometry-based proteomics. This peptide had an IC50 of 13.5 [Formula: see text]M, demonstrated greater potency as an inhibitor when compared to the native and K27A mutant control peptides, and demonstrated competitive inhibition versus the peptide substrate. Additionally, this peptide demonstrated high specificity to the EZH2 target in comparison to other histone methyltransferases. The validated peptides are the first computationally designed peptides that directly

Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

Directory of Open Access Journals (Sweden)

Tatyana V Matveeva

2008-09-01

Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

Site characterization and validation - Head variations during the entire experimental period

International Nuclear Information System (INIS)

Haigh, D.; Brightman, M.; Black, J.; Parry, S.

1992-01-01

The site characterization and validation project lasted for five years from 1986 to 1991. It consisted of a number of experiments within the region known as the SCV site. During this period of experimentation a monitoring system was established within the mine for the purpose of measuring the variation of head at a number of locations within and around the site. The system installed was based around a set of equipment known as a Piezomac TM system. In this system there is one central pressure transducer and each borehole interval is connected to it in turn. It can measure up to 55 separate points during each measurement 'cycle'. Monitoring points were either complete boreholes or sections of boreholes isolated by packers. In order to produce reasonable file size, data sets were screened. The results show that the SCV site was always responding to some form of hydrogeological disturbance. Many key tests were performed against changing background trends. This was particularly so of the simulated drift experiment and the large scale crosshole tests. However, some estimates of long term equilibrium heads before and after excavation of the validation drift have been made. Contoured plots of heads before and after show significant reduction of steady state heads as a result of drift excavation. Furthermore contouring the estimated long term drawdowns responding to the simulated drift experiment shows the specific influence of the H zone and the A/B zone. Overall the results of the monitoring show that the mine was a very active hydrogeological environment during the experimentation. Additionally it was often very difficult to clearly identify the causes of such disturbances. (au)

Dynamic model with experimental validation of a biogas-fed SOFC plant

International Nuclear Information System (INIS)

D'Andrea, G.; Gandiglio, M.; Lanzini, A.; Santarelli, M.

2017-01-01

Highlights: • 60% of DIR into the SOFC anode reduces the air blower parasitic losses by 14%. • PID-controlled cathode airflow enables fast thermal regulation of the SOFC. • Stack overheating occurs due to unexpected reductions in the cathode airflow. • Current ramp rates higher than +0.30 A/min lead to an excessive stack overheating. - Abstract: The dynamic model of a poly-generation system based on a biogas-fed solid oxide fuel cell (SOFC) plant is presented in this paper. The poly-generation plant was developed in the framework of the FP7 EU-funded project SOFCOM ( (www.sofcom.eu)), which consists of a fuel-cell based polygeneration plant with CO_2 capture and re-use. CO_2 is recovered from the anode exhaust of the SOFC (after oxy-combustion, cooling and water condensation) and the Carbon is fixed in the form of micro-algae in a tubular photobioreactor. This work focuses on the dynamic operation of the SOFC module running on steam-reformed biogas. Both steady state and dynamic operation of the fuel cell stack and the related Balance-of-Plant (BoP) has been modeled in order to simulate the thermal behavior and performance of the system. The model was validated against experimental data gathered during the operation of the SOFCOM proof-of-concept showing good agreement with the experimental data. The validated model has been used to investigate further on the harsh off-design operation of the proof-of-concept. Simulation results provide guidelines for an improved design of the control system of the plant, highlighting the feasible operating region under safe conditions and means to maximize the overall system efficiency.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

Science.gov (United States)

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

Directory of Open Access Journals (Sweden)

Veronika Lancíková

2014-02-01

Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

El primer virreinato americano

Directory of Open Access Journals (Sweden)

Cassá, Roberto

2006-12-01

Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

Experimental validation of a theoretical model for a direct-expansion solar-assisted heat pump applied to heating

International Nuclear Information System (INIS)

Moreno-Rodriguez, A.; Garcia-Hernando, N.; González-Gil, A.; Izquierdo, M.

2013-01-01

This paper discusses the experimental validation of a theoretical model that determines the operating parameters of a DXSAHP (direct-expansion solar-assisted heat pump) applied to heating. For this application, the model took into account the variable condensing temperature, and it was developed from the following environmental variables: outdoor temperature, solar radiation and wind. The experimental data were obtained from a prototype installed at the University Carlos III, which is located south of Madrid. The prototype uses a solar collector with a total area of 5.6 m 2 , a compressor with a rated capacity of 1100 W, a thermostatic expansion valve and fan-coil units as indoor terminals. The monitoring results were analyzed for several typical days in the climatic zone where the machine was located to understand the equipment's seasonal behavior. The experimental coefficient of the performance varies between 1.9 and 2.7, and the equipment behavior in extreme outdoor conditions has also been known to determine the thermal demand that can be compensated for. - Highlights: • The study aims to present an experimental validation of a theoretical model. • The experimental COP can vary between 1.9 and 2.7 (max. condensation temperature 59 °C). • A “dragging term” relates condensation and evaporation temperature. • The operating parameters respond to the solar radiation. The COP may increase up to 25%

The Dynamic Similitude Design Method of Thin Walled Structures and Experimental Validation

Directory of Open Access Journals (Sweden)

Zhong Luo

2016-01-01

Full Text Available For the applicability of dynamic similitude models of thin walled structures, such as engine blades, turbine discs, and cylindrical shells, the dynamic similitude design of typical thin walled structures is investigated. The governing equation of typical thin walled structures is firstly unified, which guides to establishing dynamic scaling laws of typical thin walled structures. Based on the governing equation, geometrically complete scaling law of the typical thin walled structure is derived. In order to determine accurate distorted scaling laws of typical thin walled structures, three principles are proposed and theoretically proved by combining the sensitivity analysis and governing equation. Taking the thin walled annular plate as an example, geometrically complete and distorted scaling laws can be obtained based on the principles of determining dynamic scaling laws. Furthermore, the previous five orders’ accurate distorted scaling laws of thin walled annular plates are presented and numerically validated. Finally, the effectiveness of the similitude design method is validated by experimental annular plates.

Modelling of PEM Fuel Cell Performance: Steady-State and Dynamic Experimental Validation

Directory of Open Access Journals (Sweden)

Idoia San Martín

2014-02-01

Full Text Available This paper reports on the modelling of a commercial 1.2 kW proton exchange membrane fuel cell (PEMFC, based on interrelated electrical and thermal models. The electrical model proposed is based on the integration of the thermodynamic and electrochemical phenomena taking place in the FC whilst the thermal model is established from the FC thermal energy balance. The combination of both models makes it possible to predict the FC voltage, based on the current demanded and the ambient temperature. Furthermore, an experimental characterization is conducted and the parameters for the models associated with the FC electrical and thermal performance are obtained. The models are implemented in Matlab Simulink and validated in a number of operating environments, for steady-state and dynamic modes alike. In turn, the FC models are validated in an actual microgrid operating environment, through the series connection of 4 PEMFC. The simulations of the models precisely and accurately reproduce the FC electrical and thermal performance.

Experimental validation of thermo-chemical algorithm for a simulation of pultrusion processes

Science.gov (United States)

Barkanov, E.; Akishin, P.; Miazza, N. L.; Galvez, S.; Pantelelis, N.

2018-04-01

To provide better understanding of the pultrusion processes without or with temperature control and to support the pultrusion tooling design, an algorithm based on the mixed time integration scheme and nodal control volumes method has been developed. At present study its experimental validation is carried out by the developed cure sensors measuring the electrical resistivity and temperature on the profile surface. By this verification process the set of initial data used for a simulation of the pultrusion process with rod profile has been successfully corrected and finally defined.

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Science.gov (United States)

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Environmental dose rate heterogeneity of beta radiation and its implications for luminescence dating: Monte Carlo modelling and experimental validation

DEFF Research Database (Denmark)

Nathan, R.P.; Thomas, P.J.; Jain, M.

2003-01-01

and identify the likely size of these effects on D-e distributions. The study employs the MCNP 4C Monte Carlo electron/photon transport model, supported by an experimental validation of the code in several case studies. We find good agreement between the experimental measurements and the Monte Carlo...

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

Directory of Open Access Journals (Sweden)

Andrew L. Krohn

2013-07-01

Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

Science.gov (United States)

Jarausch, W; Saillard, C; Dosba, F; Bové, J M

1994-01-01

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

In vivo effect of a self-etching primer on dentin.

Science.gov (United States)

Milia, E; Lallai, M R; García-Godoy, F

1999-08-01

To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

Characteristics of the population employed in primer sector in Turkey

Directory of Open Access Journals (Sweden)

Bayar Rüya

2006-01-01

Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

Science.gov (United States)

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Primer Vector Optimization: Survey of Theory, new Analysis and Applications

Science.gov (United States)

Guzman

This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

Menopause 101: A Primer for the Perimenopausal

Science.gov (United States)

... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Science.gov (United States)

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Simulation and experimental validation of the performance of a absorption refrigerator

International Nuclear Information System (INIS)

Olbricht, Michael; Luke, Andrea

2015-01-01

The two biggest obstacles to a stronger market penetration of absorption refrigerators are their high cost and the size of the apparatus, which are due to the inaccurate methods for plant design. In order to contribute to an improved design a thermodynamic model is presented to describe the performance of a absorption refrigerator with the working fluid water/lithium. In this model, the processes are displayed in the single apparatus and coupled to each other in the systemic context. Thereby the interactions between the apparatus can specifically investigated and thus the process limiting component can be identified under the respective conditions. A validation of the simulation model and the boundary conditions used is done based on experimental data operating a self-developed absorption refrigerator. In the simulation, the heat transfer surfaces in accordance with the real system can be specified. The heat transport is taken into account based on typical values for the heat transfer in the individual apparatuses. Simulation results show good agreement with the experimental data. The physical relationships and influences externally defined operating parameters are correctly reproduced. Due to the chosen low heat transfer coefficient, the calculated cooling capacities by the model are below the experimentally measured. Finally, the possibilities and limitations are discussed by using the model and further improvement possibilities are suggested. [de

Verification and validation of the PLTEMP/ANL code for thermal hydraulic analysis of experimental and test reactors

International Nuclear Information System (INIS)

Kalimullah, M.; Olson, A.O.; Feldman, E.E.; Hanan, N.; Dionne, B.

2012-01-01

The document compiles in a single volume several verification and validation works done for the PLTEMP/ANL code during the years of its development and improvement. Some works that are available in the open literature are simply referenced at the outset, and are not included in the document. PLTEMP has been used in conversion safety analysis reports of several US and foreign research reactors that have been licensed and converted. A list of such reactors is given. Each chapter of the document deals with the verification or validation of a specific model. The model verification is usually done by comparing the code with hand calculation, Microsoft spreadsheet calculation, or Mathematica calculation. The model validation is done by comparing the code with experimental data or a more validated code like the RELAP5 code.

Verification and Validation of the PLTEMP/ANL Code for Thermal-Hydraulic Analysis of Experimental and Test Reactors

Energy Technology Data Exchange (ETDEWEB)

Kalimullah, M. [Argonne National Lab. (ANL), Argonne, IL (United States); Olson, Arne P. [Argonne National Lab. (ANL), Argonne, IL (United States); Feldman, E. E. [Argonne National Lab. (ANL), Argonne, IL (United States); Hanan, N. [Argonne National Lab. (ANL), Argonne, IL (United States); Dionne, B. [Argonne National Lab. (ANL), Argonne, IL (United States)

2015-04-07

The document compiles in a single volume several verification and validation works done for the PLTEMP/ANL code during the years of its development and improvement. Some works that are available in the open literature are simply referenced at the outset, and are not included in the document. PLTEMP has been used in conversion safety analysis reports of several US and foreign research reactors that have been licensed and converted. A list of such reactors is given. Each chapter of the document deals with the verification or validation of a specific model. The model verification is usually done by comparing the code with hand calculation, Microsoft spreadsheet calculation, or Mathematica calculation. The model validation is done by comparing the code with experimental data or a more validated code like the RELAP5 code.

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

Science.gov (United States)

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Experimental validation of additively manufactured optimized shapes for passive cooling

DEFF Research Database (Denmark)

Lazarov, Boyan S.; Sigmund, Ole; Meyer, Knud E.

2018-01-01

This article confirms the superior performance of topology optimized heat sinks compared to lattice designs and suggests simpler manufacturable pin-fin design interpretations. The development is driven by the wide adoption of light-emitting-diode (LED) lamps for industrial and residential lighting....... The presented heat sink solutions are generated by topology optimization, a computational morphogenesis approach with ultimate design freedom, relying on high-performance computing and simulation. Optimized devices exhibit complex and organic-looking topologies which are realized with the help of additive...... manufacturing. To reduce manufacturing cost, a simplified interpretation of the optimized design is produced and validated as well. Numerical and experimental results agree well and indicate that the obtained designs outperform lattice geometries by more than 21%, resulting in a doubling of life expectancy and...

Experimental Validation of the LHC Helium Relief System Flow Modeling

CERN Document Server

Fydrych, J; Riddone, G

2006-01-01

In case of simultaneous resistive transitions in a whole sector of magnets in the Large Hadron Collider, the helium would be vented from the cold masses to a dedicated recovery system. During the discharge the cold helium will eventually enter a pipe at room temperature. During the first period of the flow the helium will be heated intensely due to the pipe heat capacity. To study the changes of the helium thermodynamic and flow parameters we have simulated numerically the most critical flow cases. To verify and validate numerical results, a dedicated laboratory test rig representing the helium relief system has been designed and commissioned. Both numerical and experimental results allow us to determine the distributions of the helium parameters along the pipes as well as mechanical strains and stresses.

Math primer for engineers

CERN Document Server

Cryer, CW

2014-01-01

Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

A Quantum Groups Primer

Science.gov (United States)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

IVIM: modeling, experimental validation and application to animal models

International Nuclear Information System (INIS)

Fournet, Gabrielle

2016-01-01

This PhD thesis is centered on the study of the IVIM ('Intravoxel Incoherent Motion') MRI sequence. This sequence allows for the study of the blood microvasculature such as the capillaries, arterioles and venules. To be sensitive only to moving groups of spins, diffusion gradients are added before and after the 180 degrees pulse of a spin echo (SE) sequence. The signal component corresponding to spins diffusing in the tissue can be separated from the one related to spins travelling in the blood vessels which is called the IVIM signal. These two components are weighted by f IVIM which represents the volume fraction of blood inside the tissue. The IVIM signal is usually modelled by a mono-exponential (ME) function and characterized by a pseudo-diffusion coefficient, D*. We propose instead a bi-exponential IVIM model consisting of a slow pool, characterized by F slow and D* slow corresponding to the capillaries as in the ME model, and a fast pool, characterized by F fast and D* fast, related to larger vessels such as medium-size arterioles and venules. This model was validated experimentally and more information was retrieved by comparing the experimental signals to a dictionary of simulated IVIM signals. The influence of the pulse sequence, the repetition time and the diffusion encoding time was also studied. Finally, the IVIM sequence was applied to the study of an animal model of Alzheimer's disease. (author) [fr

The impact of crowd noise on officiating in Muay Thai: achieving external validity in an experimental setting

Directory of Open Access Journals (Sweden)

Tony D Myers

2012-09-01

Full Text Available Numerous factors have been proposed to explain the home advantage in sport. Several authors have suggested that a partisan home crowd enhances home advantage and that this is at least in part a consequence of their influence on officiating. However, while experimental studies examining this phenomenon have high levels of internal validity (since only the ‘crowd noise’ intervention is allowed to vary, they suffer from a lack of external validity, with decision-making in a laboratory setting typically bearing little resemblance to decision-making in live sports settings. Conversely, observational and quasi-experimental studies with high levels of external validity suffer from low levels of internal validity as countless factors besides crowd noise vary. The present study provides a unique opportunity to address these criticisms, by conducting a controlled experiment on the impact of crowd noise on officiating in a live tournament setting. Seventeen qualified judges officiated on thirty Thai boxing bouts in a live international tournament setting featuring ‘home’ and ‘away’ boxers. In each bout, judges were randomised into a ‘noise’ (live sound or ‘no crowd noise’ (noise cancelling headphones and white noise condition, resulting in 59 judgements in the ‘no crowd noise’ and 61 in the ‘crowd noise’ condition. The results provide the first experimental evidence of the impact of live crowd noise on officials in sport. A cross-classified statistical model indicated that crowd noise had a statistically significant impact, equating to just over half a point per bout (in the context of five round bouts with the ‘ten point must’ scoring system shared with professional boxing. The practical significance of the findings, their implications for officiating and for the future conduct of crowd noise studies are discussed.

The impact of crowd noise on officiating in muay thai: achieving external validity in an experimental setting.

Science.gov (United States)

Myers, Tony; Balmer, Nigel

2012-01-01

Numerous factors have been proposed to explain the home advantage in sport. Several authors have suggested that a partisan home crowd enhances home advantage and that this is at least in part a consequence of their influence on officiating. However, while experimental studies examining this phenomenon have high levels of internal validity (since only the "crowd noise" intervention is allowed to vary), they suffer from a lack of external validity, with decision-making in a laboratory setting typically bearing little resemblance to decision-making in live sports settings. Conversely, observational and quasi-experimental studies with high levels of external validity suffer from low levels of internal validity as countless factors besides crowd noise vary. The present study provides a unique opportunity to address these criticisms, by conducting a controlled experiment on the impact of crowd noise on officiating in a live tournament setting. Seventeen qualified judges officiated on thirty Thai boxing bouts in a live international tournament setting featuring "home" and "away" boxers. In each bout, judges were randomized into a "noise" (live sound) or "no crowd noise" (noise-canceling headphones and white noise) condition, resulting in 59 judgments in the "no crowd noise" and 61 in the "crowd noise" condition. The results provide the first experimental evidence of the impact of live crowd noise on officials in sport. A cross-classified statistical model indicated that crowd noise had a statistically significant impact, equating to just over half a point per bout (in the context of five round bouts with the "10-point must" scoring system shared with professional boxing). The practical significance of the findings, their implications for officiating and for the future conduct of crowd noise studies are discussed.

Design of JT-60SA magnets and associated experimental validations

International Nuclear Information System (INIS)

Zani, L.; Barabaschi, P.; Peyrot, M.; Meunier, L.; Tomarchio, V.; Duglue, D.; Decool, P.; Torre, A.; Marechal, J.L.; Della Corte, A.; Di Zenobio, A.; Muzzi, L.; Cucchiaro, A.; Turtu, S.; Ishida, S.; Yoshida, K.; Tsuchiya, K.; Kizu, K.; Murakami, H.

2011-01-01

In the framework of the JT-60SA project, aiming at upgrading the present JT-60U tokamak toward a fully superconducting configuration, the detailed design phase led to adopt for the three main magnet systems a brand new design. Europe (EU) is expected to provide to Japan (JA) the totality of the toroidal field (TF) magnet system, while JA will provide both Equilibrium field (EF) and Central Solenoid (CS) systems. All magnet designs were optimized trough the past years and entered in parallel into extensive experimentally-based phases of concept validation, which came to maturation in the years 2009 and 2010. For this, all magnet systems were investigated by mean of dedicated samples, e.g. conductor and joint samples designed, manufactured and tested at full scale in ad hoc facilities either in EU or in JA. The present paper, after an overall description of magnet systems layouts, presents in a general approach the different experimental campaigns dedicated to qualification design and manufacture processes of either coils, conductors and electrical joints. The main results with the associated analyses are shown and the main conclusions presented, especially regarding their contribution to consolidate the triggering of magnet mass production. The status of respective manufacturing stages in EU and in JA are also evoked. (authors)

Validating Animal Models

Directory of Open Access Journals (Sweden)

Nina Atanasova

2015-06-01

Full Text Available In this paper, I respond to the challenge raised against contemporary experimental neurobiology according to which the field is in a state of crisis because of the multiple experimental protocols employed in different laboratories and strengthening their reliability that presumably preclude the validity of neurobiological knowledge. I provide an alternative account of experimentation in neurobiology which makes sense of its experimental practices. I argue that maintaining a multiplicity of experimental protocols and strengthening their reliability are well justified and they foster rather than preclude the validity of neurobiological knowledge. Thus, their presence indicates thriving rather than crisis of experimental neurobiology.

Experimental validation of neutron activation simulation of a varian medical linear accelerator.

Science.gov (United States)

Morato, S; Juste, B; Miro, R; Verdu, G; Diez, S

2016-08-01

This work presents a Monte Carlo simulation using the last version of MCNP, v. 6.1.1, of a Varian CLinAc emitting a 15MeV photon beam. The main objective of the work is to estimate the photoneutron production and activated products inside the medical linear accelerator head. To that, the Varian LinAc head was modelled in detail using the manufacturer information, and the model was generated with a CAD software and exported as a mesh to be included in the particle transport simulation. The model includes the transport of photoneutrons generated by primary photons and the (n, γ) reactions which can result in activation products. The validation of this study was done using experimental measures. Activation products have been identified by in situ gamma spectroscopy placed at the jaws exit of the LinAc shortly after termination of a high energy photon beam irradiation. Comparison between experimental and simulation results shows good agreement.

Scrimer: designing primers from transcriptome data

Czech Academy of Sciences Publication Activity Database

Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

2015-01-01

Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

Science.gov (United States)

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Profitability primer: a guide to profitability analysis in the electric power industry

International Nuclear Information System (INIS)

Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

1996-06-01

As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

Effect of saliva contamination and artificial aging on different primer/cement systems bonded to zirconia.

Science.gov (United States)

Pitta, João; Branco, Teresa C; Portugal, Jaime

2018-05-01

Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermocycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (Pcontamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (Pcontamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Temas de Física para Ingeniería: Primer principio de la termodinámica

OpenAIRE

Beléndez Vázquez, Augusto

1992-01-01

Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

A primer on motor vehicle air pollution.

Science.gov (United States)

1973-01-01

This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

Methodology for experimental validation of a CFD model for predicting noise generation in centrifugal compressors

International Nuclear Information System (INIS)

Broatch, A.; Galindo, J.; Navarro, R.; García-Tíscar, J.

2014-01-01

Highlights: • A DES of a turbocharger compressor working at peak pressure point is performed. • In-duct pressure signals are measured in a steady flow rig with 3-sensor arrays. • Pressure spectra comparison is performed as a validation for the numerical model. • A suitable comparison methodology is developed, relying on pressure decomposition. • Whoosh noise at outlet duct is detected in experimental and numerical spectra. - Abstract: Centrifugal compressors working in the surge side of the map generate a broadband noise in the range of 1–3 kHz, named as whoosh noise. This noise is perceived at strongly downsized engines operating at particular conditions (full load, tip-in and tip-out maneuvers). A 3-dimensional CFD model of a centrifugal compressor is built to analyze fluid phenomena related to whoosh noise. A detached eddy simulation is performed with the compressor operating at the peak pressure point of 160 krpm. A steady flow rig mounted on an anechoic chamber is used to obtain experimental measurements as a means of validation for the numerical model. In-duct pressure signals are obtained in addition to standard averaged global variables. The numerical simulation provides global variables showing excellent agreement with experimental measurements. Pressure spectra comparison is performed to assess noise prediction capability of numerical model. The influence of the type and position of the virtual pressure probes is evaluated. Pressure decomposition is required by the simulations to obtain meaningful spectra. Different techniques for obtaining pressure components are analyzed. At the simulated conditions, a broadband noise in 1–3 kHz frequency band is detected in the experimental measurements. This whoosh noise is also captured by the numerical model

Genomic validation of PB 260 clone of rubber (Hevea brasiliensis) at Cikumpay Plantation by SSR marker

Science.gov (United States)

Royani, J. I.; Safarrida, A.; Rachmawati, I.; Khairiyah, H.; Mustika, I. P.; Suyono, A.; Rudiyana, Y.; Kubil; Nurjaya; Arianto, A.

2017-05-01

Rubber from Hevea brasiliensis is the only commercial natural rubber in the world. Propagation of rubber trees usually done by grafting and seed germination. BPPT had been producing rubber tree by in vitro technique with embryo somatic methods. Validation of mother plant for in vitro propagation is important to compare between mother plant and propagated plants. The aim for this research was to validation of PB 260 clone that planted at Cikumpay Plantation by SSR marker. Sampling of 10 rubber leaves were done at Cikumpay Plantation based on GPS position from the area of PB 260 clone. Rubber leaves were isolated with CTAB modification method to obtained DNA. Four of SSR primers from rubber, i.e.: hmac 4, hmac 5, hmct 1, and hmct 5, were used as primers to amplification of rubber DNA. The result showed that no band that different from 10 rubber of PB 260 clone at Cikumpay Plantation. This research will continue to compare genomic validation between mother plant and propagated plants that had been produced from BPPT.

Primer on CDM programme of activities

Energy Technology Data Exchange (ETDEWEB)

Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

2009-07-01

As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

Experimental Testing and Model Validation of a Decoupled-Phase On-Load Tap Changer Transformer in an Active Network

DEFF Research Database (Denmark)

Zecchino, Antonio; Hu, Junjie; Coppo, Massimiliano

2016-01-01

Due to the increasing penetration of single-phase small generation units and electric vehicles connected to distribution grids, system operators are facing challenges related to local unbalanced voltage rise or drop issues, which may lead to a violation of the allowed voltage band. To address...... this problem, distribution transformers with on-load tapping capability are under development. This paper presents model and experimental validation of a 35 kVA three-phase power distribution transformer with independent on-load tap changer control capability on each phase. With the purpose of investigating...... to reproduce the main feature of an unbalanced grid. The experimental activities are recreated in by carrying out dynamics simulation studies, aiming at validating the implemented models of both the transformer as well as the other grid components. Phase-neutral voltages’ deviations are limited, proving...

Black liquor devolatilization and swelling - a detailed droplet model and experimental validation

International Nuclear Information System (INIS)

Jaervinen, M.; Zevenhoven, R.; Vakkilainen, E.; Forssen, M.

2003-01-01

In this paper, we present results from a new detailed physical model for single black liquor droplet pyrolysis and swelling, and validate them against experimental data from a non-oxidizing environment using two different reactor configurations. In the detailed model, we solve for the heat transfer and gas phase mass transfer in the droplet and thereby, the intra-particle gas-char and gas-gas interactions during drying and devolatilization can be studied. In the experimental part, the mass change, the swelling behaviour, and the volume fraction of larger voids, i.e. cenospheres in the droplets were determined in a non-oxidizing environment. The model gave a good correlation with experimental swelling and mass loss data. Calculations suggest that a considerable amount of the char can be consumed before the entire droplet has experienced the devolatilization and drying stages of combustion. Char formed at the droplet surface layer is generally consumed by gasification with H 2 O flowing outwards from the droplet interior. The extent of char conversion during devolatilization and the rate of devolatilization are greatly affected by swelling and the formation of larger voids in the particle. The more the particle swells and the more homogeneous the particle structure is, the larger is the conversion of char at the end of devolatilization

Development and Validation of a Rubric for Diagnosing Students' Experimental Design Knowledge and Difficulties.

Science.gov (United States)

Dasgupta, Annwesa P; Anderson, Trevor R; Pelaez, Nancy

2014-01-01

It is essential to teach students about experimental design, as this facilitates their deeper understanding of how most biological knowledge was generated and gives them tools to perform their own investigations. Despite the importance of this area, surprisingly little is known about what students actually learn from designing biological experiments. In this paper, we describe a rubric for experimental design (RED) that can be used to measure knowledge of and diagnose difficulties with experimental design. The development and validation of the RED was informed by a literature review and empirical analysis of undergraduate biology students' responses to three published assessments. Five areas of difficulty with experimental design were identified: the variable properties of an experimental subject; the manipulated variables; measurement of outcomes; accounting for variability; and the scope of inference appropriate for experimental findings. Our findings revealed that some difficulties, documented some 50 yr ago, still exist among our undergraduate students, while others remain poorly investigated. The RED shows great promise for diagnosing students' experimental design knowledge in lecture settings, laboratory courses, research internships, and course-based undergraduate research experiences. It also shows potential for guiding the development and selection of assessment and instructional activities that foster experimental design. © 2014 A. P. Dasgupta et al. CBE—Life Sciences Education © 2014 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Forest Interpreter's Primer on Fire Management.

Science.gov (United States)

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

Designing for transportation management and operations : a primer.

Science.gov (United States)

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

Evaluation of genetic diversity in open pollinated guava by iPBS primers

International Nuclear Information System (INIS)

Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

2013-01-01

DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

The UVM primer a step-by-step introduction to the universal verification methodology

CERN Document Server

Salemi, Ray

2013-01-01

The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

Experimental validation of tape springs to be used as thin-walled space structures

Science.gov (United States)

Oberst, S.; Tuttle, S. L.; Griffin, D.; Lambert, A.; Boyce, R. R.

2018-04-01

With the advent of standardised launch geometries and off-the-shelf payloads, space programs utilising nano-satellite platforms are growing worldwide. Thin-walled, flexible and self-deployable structures are commonly used for antennae, instrument booms or solar panels owing to their lightweight, ideal packaging characteristics and near zero energy consumption. However their behaviour in space, in particular in Low Earth Orbits with continually changing environmental conditions, raises many questions. Accurate numerical models, which are often not available due to the difficulty of experimental testing under 1g-conditions, are needed to answer these questions. In this study, we present on-earth experimental validations, as a starting point to study the response of a tape spring as a representative of thin-walled flexible structures under static and vibrational loading. Material parameters of tape springs in a singly (straight, open cylinder) and a doubly curved design, are compared to each other by combining finite element calculations, with experimental laser vibrometry within a single and multi-stage model updating approach. While the determination of the Young's modulus is unproblematic, the damping is found to be inversely proportional to deployment length. With updated material properties the buckling instability margin is calculated using different slenderness ratios. Results indicate a high sensitivity of thin-walled structures to miniscule perturbations, which makes proper experimental testing a key requirement for stability prediction on thin-elastic space structures. The doubly curved tape spring provides closer agreement with experimental results than a straight tape spring design.

First experimental validation on the core equilibrium code: HARMONIE

International Nuclear Information System (INIS)

Van Dorsselaere, J.; Cozzani, M.; Gnuffi, M.

1981-08-01

The code HARMONIE calculates the mechanical equilibrium of a fast reactor. An experimental program of deformation, in air, of groups of subassemblies, was performed on a mock-up, in the Super Phenix 1- geometry. This program included three kinds of tests, all performed without and then with grease: on groups of 2 or 3 rings of subassemblies, subjected to a force acting upon flats or angles; on groups of 35 and 41 subassemblies, subjected to a force acting on the first row, then with 1 or 2 empty cells; and on groups with 1 or 2 bowed subassemblies or 1 enlarged one over flats. A preliminary test on the friction coefficient in air between two pads showed some dependance upon the pad surface condition with a scattering factor of 8. Two basic code hypotheses were validated: the rotation of the subassemblies around their axis was negligible after deformation of the group, and the choice of a mean Maxwell coefficient, between those of 1st and 2nd slope, led to very similar results to experimental. The agreement between tests and HARMONIE calculations was suitable, qualitatively for all the groups and quantitatively for regular groups of 3 rings at most. But the difference increased for larger groups of 35 or 41 subassemblies: friction between pads, neglected by HARMONIE, seems to be the main reason. Other reasons for these differences are: the influence of the loading order on the mock-up, and the initial contacts issued from the gap between foot and diagrid-insert, and from manufacture bowings

Assessment of the energy performance of the solar space system attached to the CE – INCERC Bucharest experimental house – experimental validation

Directory of Open Access Journals (Sweden)

Dan CONSTANTINESCU

2010-01-01

Full Text Available The INCERC Bucharest experimental house is equipped on the Southern façade with a ventilated solar space. The solar space ensures the ventilation of the entire building at a constant rate of 0.60 exchanges / h during the cold season, by inletting the pre-heated space in the greenhouse space. In the hot season the system ensures the building reversible ventilation by providing the fresh air rate by air suction in the building Northern zone, a consequence of the natural draught effect ensured by the solar space. This report presents the experiments performed in the season 2008-2009 and the experimental validation of the mathematical model used in assessing the solar space energy performance in the heating season.

Servo-hydraulic actuator in controllable canonical form: Identification and experimental validation

Science.gov (United States)

Maghareh, Amin; Silva, Christian E.; Dyke, Shirley J.

2018-02-01

Hydraulic actuators have been widely used to experimentally examine structural behavior at multiple scales. Real-time hybrid simulation (RTHS) is one innovative testing method that largely relies on such servo-hydraulic actuators. In RTHS, interface conditions must be enforced in real time, and controllers are often used to achieve tracking of the desired displacements. Thus, neglecting the dynamics of hydraulic transfer system may result either in system instability or sub-optimal performance. Herein, we propose a nonlinear dynamical model for a servo-hydraulic actuator (a.k.a. hydraulic transfer system) coupled with a nonlinear physical specimen. The nonlinear dynamical model is transformed into controllable canonical form for further tracking control design purposes. Through a number of experiments, the controllable canonical model is validated.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

Energy Technology Data Exchange (ETDEWEB)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

Science.gov (United States)

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Virtual Reality for Enhanced Ecological Validity and Experimental Control in the Clinical, Affective and Social Neurosciences

Science.gov (United States)

Parsons, Thomas D.

2015-01-01

An essential tension can be found between researchers interested in ecological validity and those concerned with maintaining experimental control. Research in the human neurosciences often involves the use of simple and static stimuli lacking many of the potentially important aspects of real world activities and interactions. While this research is valuable, there is a growing interest in the human neurosciences to use cues about target states in the real world via multimodal scenarios that involve visual, semantic, and prosodic information. These scenarios should include dynamic stimuli presented concurrently or serially in a manner that allows researchers to assess the integrative processes carried out by perceivers over time. Furthermore, there is growing interest in contextually embedded stimuli that can constrain participant interpretations of cues about a target’s internal states. Virtual reality environments proffer assessment paradigms that combine the experimental control of laboratory measures with emotionally engaging background narratives to enhance affective experience and social interactions. The present review highlights the potential of virtual reality environments for enhanced ecological validity in the clinical, affective, and social neurosciences. PMID:26696869

Numerical and experimental validation of a particle Galerkin method for metal grinding simulation

Science.gov (United States)

Wu, C. T.; Bui, Tinh Quoc; Wu, Youcai; Luo, Tzui-Liang; Wang, Morris; Liao, Chien-Chih; Chen, Pei-Yin; Lai, Yu-Sheng

2018-03-01

In this paper, a numerical approach with an experimental validation is introduced for modelling high-speed metal grinding processes in 6061-T6 aluminum alloys. The derivation of the present numerical method starts with an establishment of a stabilized particle Galerkin approximation. A non-residual penalty term from strain smoothing is introduced as a means of stabilizing the particle Galerkin method. Additionally, second-order strain gradients are introduced to the penalized functional for the regularization of damage-induced strain localization problem. To handle the severe deformation in metal grinding simulation, an adaptive anisotropic Lagrangian kernel is employed. Finally, the formulation incorporates a bond-based failure criterion to bypass the prospective spurious damage growth issues in material failure and cutting debris simulation. A three-dimensional metal grinding problem is analyzed and compared with the experimental results to demonstrate the effectiveness and accuracy of the proposed numerical approach.

Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

OpenAIRE

Castillo Canales, Braulio

2017-01-01

En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

Móvil remisión de V. cinta del primer móvil.

OpenAIRE

2011-01-01

[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

Preliminary experimentally-validated forced and mixed convection computational simulations of the Rotatable Buoyancy Tunnel

International Nuclear Information System (INIS)

Clifford, Corey E.; Kimber, Mark L.

2015-01-01

Although computational fluid dynamics (CFD) has not been directly utilized to perform safety analyses of nuclear reactors in the United States, several vendors are considering adopting commercial numerical packages for current and future projects. To ensure the accuracy of these computational models, it is imperative to validate the assumptions and approximations built into commercial CFD codes against physical data from flows analogous to those in modern nuclear reactors. To this end, researchers at Utah State University (USU) have constructed the Rotatable Buoyancy Tunnel (RoBuT) test facility, which is designed to provide flow and thermal validation data for CFD simulations of forced and mixed convection scenarios. In order to evaluate the ability of current CFD codes to capture the complex physics associated with these types of flows, a computational model of the RoBuT test facility is created using the ANSYS Fluent commercial CFD code. The numerical RoBuT model is analyzed at identical conditions to several experimental trials undertaken at USU. Each experiment is reconstructed numerically and evaluated with the second-order Reynolds stress model (RSM). Two different thermal boundary conditions at the heated surface of the RoBuT test section are investigated: constant temperature (isothermal) and constant surface heat flux (isoflux). Additionally, the fluid velocity at the inlet of the test section is varied in an effort to modify the relative importance of natural convection heat transfer from the heated wall of the RoBuT. Mean velocity, both in the streamwise and transverse directions, as well as components of the Reynolds stress tensor at three points downstream of the RoBuT test section inlet are compared to results obtained from experimental trials. Early computational results obtained from this research initiative are in good agreement with experimental data obtained from the RoBuT facility and both the experimental data and numerical method can be used

A comparative study of soft sensor design for lipid estimation of microalgal photobioreactor system with experimental validation.

Science.gov (United States)

Yoo, Sung Jin; Jung, Dong Hwi; Kim, Jung Hun; Lee, Jong Min

2015-03-01

This study examines the applicability of various nonlinear estimators for online estimation of the lipid concentration in microalgae cultivation system. Lipid is a useful bio-product that has many applications including biofuels and bioactives. However, the improvement of lipid productivity using real-time monitoring and control with experimental validation is limited because measurement of lipid in microalgae is a difficult and time-consuming task. In this study, estimation of lipid concentration from other measurable sources such as biomass or glucose sensor was studied. Extended Kalman filter (EKF), unscented Kalman filter (UKF), and particle filter (PF) were compared in various cases for their applicability to photobioreactor systems. Furthermore, simulation studies to identify appropriate types of sensors for estimating lipid were also performed. Based on the case studies, the most effective case was validated with experimental data and found that UKF and PF with time-varying system noise covariance is effective for microalgal photobioreactor system. Copyright © 2014 Elsevier Ltd. All rights reserved.

A primer on water

Science.gov (United States)

Leopold, Luna Bergere; Langbein, Walter Basil

1960-01-01

When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

Experimental validation for combustion analysis of GOTHIC code in 2-dimensional combustion chamber

International Nuclear Information System (INIS)

Lee, J. W.; Yang, S. Y.; Park, K. C.; Jung, S. H.

2002-01-01

In this study, the prediction capability of GOTHIC code for hydrogen combustion phenomena was validated with the results of two-dimensional premixed hydrogen combustion experiment executed by Seoul National University. The experimental chamber has about 24 liter free volume (1x0.024x1 m 3 ) and 2-dimensional rectangular shape. The test were preformed with 10% hydrogen/air gas mixture and conducted with combination of two igniter positions (top center, top corner) and two boundary conditions (bottom full open, bottom right half open). Using the lumped parameter and mechanistic combustion model in GOTHIC code, the SNU experiments were simulated under the same conditions. The GOTHIC code prediction of the hydrogen combustion phenomena did not compare well with the experimental results. In case of lumped parameter simulation, the combustion time was predicted appropriately. But any other local information related combustion phenomena could not be obtained. In case of mechanistic combustion analysis, the physical combustion phenomena of gas mixture were not matched experimental ones. In boundary open cases, the GOTHIC predicted very long combustion time and the flame front propagation could not simulate appropriately. Though GOTHIC showed flame propagation phenomenon in adiabatic calculation, the induction time of combustion was still very long compare with experimental results. Also, it was found that the combustion model of GOTHIC code had some weak points in low concentration of hydrogen combustion simulation

Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

2015-04-01

A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

NUMERICAL MODELLING AND EXPERIMENTAL INFLATION VALIDATION OF A BIAS TWO-WHEEL TIRE

Directory of Open Access Journals (Sweden)

CHUNG KET THEIN

2016-02-01

Full Text Available This paper presents a parametric study on the development of a computational model for bias two-wheel tire through finite element analysis (FEA. An 80/90- 17 bias two-wheel tire was adopted which made up of four major layers of rubber compound with different material properties to strengthen the structure. Mooney-Rivlin hyperelastic model was applied to represent the behaviour of incompressible rubber compound. A 3D tire model was built for structural static finite element analysis. The result was validated from the inflation analysis. Structural static finite element analysis method is suitable for evaluation of the tire design and improvement of the tire behaviour to desired performance. Experimental tire was inflated at various pressures and the geometry between numerical and experimental tire were compared. There are good agreements between numerical simulation model and the experiment results. This indicates that the simulation model can be applied to the bias two-wheel tire design in order to predict the tire behaviour and improve its mechanical characteristics.

The International Experimental Thermal Hydraulic Systems database – TIETHYS: A new NEA validation tool

Energy Technology Data Exchange (ETDEWEB)

Rohatgi, Upendra S.

2018-07-22

Nuclear reactor codes require validation with appropriate data representing the plant for specific scenarios. The thermal-hydraulic data is scattered in different locations and in different formats. Some of the data is in danger of being lost. A relational database is being developed to organize the international thermal hydraulic test data for various reactor concepts and different scenarios. At the reactor system level, that data is organized to include separate effect tests and integral effect tests for specific scenarios and corresponding phenomena. The database relies on the phenomena identification sections of expert developed PIRTs. The database will provide a summary of appropriate data, review of facility information, test description, instrumentation, references for the experimental data and some examples of application of the data for validation. The current database platform includes scenarios for PWR, BWR, VVER, and specific benchmarks for CFD modelling data and is to be expanded to include references for molten salt reactors. There are place holders for high temperature gas cooled reactors, CANDU and liquid metal reactors. This relational database is called The International Experimental Thermal Hydraulic Systems (TIETHYS) database and currently resides at Nuclear Energy Agency (NEA) of the OECD and is freely open to public access. Going forward the database will be extended to include additional links and data as they become available. https://www.oecd-nea.org/tiethysweb/

Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

Directory of Open Access Journals (Sweden)

Christopher Ryan Penton

2013-09-01

Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

Directory of Open Access Journals (Sweden)

Aleksić Jelena M.

2016-01-01

Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

Science.gov (United States)

D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

2018-02-01

Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

Energy Technology Data Exchange (ETDEWEB)

Lech, L.M. [DuPont, Parkersburg, WV (United States)

1999-11-01

Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

V&V of MCNP 6.1.1 Beta Against Intermediate and High-Energy Experimental Data

Energy Technology Data Exchange (ETDEWEB)

Mashnik, Stepan G [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2014-09-08

This report presents a set of validation and verification (V&V) MCNP 6.1.1 beta results calculated in parallel, with MPI, obtained using its event generators at intermediate and high-energies compared against various experimental data. It also contains several examples of results using the models at energies below 150 MeV, down to 10 MeV, where data libraries are normally used. This report can be considered as the forth part of a set of MCNP6 Testing Primers, after its first, LA-UR-11-05129, and second, LA-UR-11-05627, and third, LA-UR-26944, publications, but is devoted to V&V with the latest, 1.1 beta version of MCNP6. The MCNP6 test-problems discussed here are presented in the /VALIDATION_CEM/and/VALIDATION_LAQGSM/subdirectories in the MCNP6/Testing/directory. README files that contain short descriptions of every input file, the experiment, the quantity of interest that the experiment measures and its description in the MCNP6 output files, and the publication reference of that experiment are presented for every test problem. Templates for plotting the corresponding results with xmgrace as well as pdf files with figures representing the final results of our V&V efforts are presented. Several technical “bugs” in MCNP 6.1.1 beta were discovered during our current V&V of MCNP6 while running it in parallel with MPI using its event generators. These “bugs” are to be fixed in the following version of MCNP6. Our results show that MCNP 6.1.1 beta using its CEM03.03, LAQGSM03.03, Bertini, and INCL+ABLA, event generators describes, as a rule, reasonably well different intermediate- and high-energy measured data. This primer isn’t meant to be read from cover to cover. Readers may skip some sections and go directly to any test problem in which they are interested.

A Primer to Slow Light

OpenAIRE

Leonhardt, U.

2001-01-01

Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

Validation of a numerical 3-D fluid-structure interaction model for a prosthetic valve based on experimental PIV measurements.

Science.gov (United States)

Guivier-Curien, Carine; Deplano, Valérie; Bertrand, Eric

2009-10-01

A numerical 3-D fluid-structure interaction (FSI) model of a prosthetic aortic valve was developed, based on a commercial computational fluid dynamics (CFD) software program using an Arbitrary Eulerian Lagrangian (ALE) formulation. To make sure of the validity of this numerical model, an equivalent experimental model accounting for both the geometrical features and the hydrodynamic conditions was also developed. The leaflet and the flow behaviours around the bileaflet valve were investigated numerically and experimentally by performing particle image velocimetry (PIV) measurements. Through quantitative and qualitative comparisons, it was shown that the leaflet behaviour and the velocity fields were similar in both models. The present study allows the validation of a fully coupled 3-D FSI numerical model. The promising numerical tool could be therefore used to investigate clinical issues involving the aortic valve.

Sliding spool design for reducing the actuation forces in direct operated proportional directional valves: Experimental validation

International Nuclear Information System (INIS)

Amirante, Riccardo; Distaso, Elia; Tamburrano, Paolo

2016-01-01

Highlights: • An innovative procedure to design a commercial proportional directional valve is shown. • Experimental tests are performed to demonstrate the flow force reduction. • The design is improved by means of a previously made optimization procedure. • Great reduction in the flow forces without reducing the flow rate is demonstrated. - Abstract: This paper presents the experimental validation of a new methodology for the design of the spool surfaces of four way three position direct operated proportional directional valves. The proposed methodology is based on the re-design of both the compensation profile (the central conical surface of the spool) and the lateral surfaces of the spool, in order to reduce the flow forces acting on the spool and hence the actuation forces. The aim of this work is to extend the application range of these valves to higher values of pressure and flow rate, thus avoiding the employment of more expensive two stage configurations in the case of high-pressure conditions and/or flow rate. The paper first presents a theoretical approach and a general strategy for the sliding spool design to be applied to any four way three position direct operated proportional directional valve. Then, the proposed approach is experimentally validated on a commercially available valve using a hydraulic circuit capable of measuring the flow rate as well as the actuation force over the entire spool stroke. The experimental results, performed using both the electronic driver provided by the manufacturer and a manual actuation system, show that the novel spool surface requires remarkably lower actuation forces compared to the commercial configuration, while maintaining the same flow rate trend as a function of the spool position.

Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

DEFF Research Database (Denmark)

Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

2011-01-01

BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

Energy Technology Data Exchange (ETDEWEB)

Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

2011-01-15

Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

International Nuclear Information System (INIS)

Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

2011-01-01

Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

Metabolomics: A Primer.

Science.gov (United States)

Liu, Xiaojing; Locasale, Jason W

2017-04-01

Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Experimental design technique applied to the validation of an instrumental Neutron Activation Analysis procedure

International Nuclear Information System (INIS)

Santos, Uanda Paula de M. dos; Moreira, Edson Gonçalves

2017-01-01

In this study optimization of procedures and standardization of Instrumental Neutron Activation Analysis (INAA) method were carried out for the determination of the elements bromine, chlorine, magnesium, manganese, potassium, sodium and vanadium in biological matrix materials using short irradiations at a pneumatic system. 2 k experimental designs were applied for evaluation of the individual contribution of selected variables of the analytical procedure in the final mass fraction result. The chosen experimental designs were the 2 3 and the 2 4 , depending on the radionuclide half life. Different certified reference materials and multi-element comparators were analyzed considering the following variables: sample decay time, irradiation time, counting time and sample distance to detector. Comparator concentration, sample mass and irradiation time were maintained constant in this procedure. By means of the statistical analysis and theoretical and experimental considerations, it was determined the optimized experimental conditions for the analytical methods that will be adopted for the validation procedure of INAA methods in the Neutron Activation Analysis Laboratory (LAN) of the Research Reactor Center (CRPq) at the Nuclear and Energy Research Institute (IPEN /CNEN-SP). Optimized conditions were estimated based on the results of z-score tests, main effect, interaction effects and better irradiation conditions. (author)

Experimental design technique applied to the validation of an instrumental Neutron Activation Analysis procedure

Energy Technology Data Exchange (ETDEWEB)

Santos, Uanda Paula de M. dos; Moreira, Edson Gonçalves, E-mail: uandapaula@gmail.com, E-mail: emoreira@ipen.br [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil)

2017-07-01

In this study optimization of procedures and standardization of Instrumental Neutron Activation Analysis (INAA) method were carried out for the determination of the elements bromine, chlorine, magnesium, manganese, potassium, sodium and vanadium in biological matrix materials using short irradiations at a pneumatic system. 2{sup k} experimental designs were applied for evaluation of the individual contribution of selected variables of the analytical procedure in the final mass fraction result. The chosen experimental designs were the 2{sup 3} and the 2{sup 4}, depending on the radionuclide half life. Different certified reference materials and multi-element comparators were analyzed considering the following variables: sample decay time, irradiation time, counting time and sample distance to detector. Comparator concentration, sample mass and irradiation time were maintained constant in this procedure. By means of the statistical analysis and theoretical and experimental considerations, it was determined the optimized experimental conditions for the analytical methods that will be adopted for the validation procedure of INAA methods in the Neutron Activation Analysis Laboratory (LAN) of the Research Reactor Center (CRPq) at the Nuclear and Energy Research Institute (IPEN /CNEN-SP). Optimized conditions were estimated based on the results of z-score tests, main effect, interaction effects and better irradiation conditions. (author)

Neurociencia y bilingüismo: efecto del primer idioma

Directory of Open Access Journals (Sweden)

Germary Díaz-Sánchez

2013-08-01

Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

Phantom-based experimental validation of computational fluid dynamics simulations on cerebral aneurysms

Energy Technology Data Exchange (ETDEWEB)

Sun Qi; Groth, Alexandra; Bertram, Matthias; Waechter, Irina; Bruijns, Tom; Hermans, Roel; Aach, Til [Philips Research Europe, Weisshausstrasse 2, 52066 Aachen (Germany) and Institute of Imaging and Computer Vision, RWTH Aachen University, Sommerfeldstrasse 24, 52074 Aachen (Germany); Philips Research Europe, Weisshausstrasse 2, 52066 Aachen (Germany); Philips Healthcare, X-Ray Pre-Development, Veenpluis 4-6, 5684PC Best (Netherlands); Institute of Imaging and Computer Vision, RWTH Aachen University, Sommerfeldstrasse 24, 52074 Aachen (Germany)

2010-09-15

Purpose: Recently, image-based computational fluid dynamics (CFD) simulation has been applied to investigate the hemodynamics inside human cerebral aneurysms. The knowledge of the computed three-dimensional flow fields is used for clinical risk assessment and treatment decision making. However, the reliability of the application specific CFD results has not been thoroughly validated yet. Methods: In this work, by exploiting a phantom aneurysm model, the authors therefore aim to prove the reliability of the CFD results obtained from simulations with sufficiently accurate input boundary conditions. To confirm the correlation between the CFD results and the reality, virtual angiograms are generated by the simulation pipeline and are quantitatively compared to the experimentally acquired angiograms. In addition, a parametric study has been carried out to systematically investigate the influence of the input parameters associated with the current measuring techniques on the flow patterns. Results: Qualitative and quantitative evaluations demonstrate good agreement between the simulated and the real flow dynamics. Discrepancies of less than 15% are found for the relative root mean square errors of time intensity curve comparisons from each selected characteristic position. The investigated input parameters show different influences on the simulation results, indicating the desired accuracy in the measurements. Conclusions: This study provides a comprehensive validation method of CFD simulation for reproducing the real flow field in the cerebral aneurysm phantom under well controlled conditions. The reliability of the CFD is well confirmed. Through the parametric study, it is possible to assess the degree of validity of the associated CFD model based on the parameter values and their estimated accuracy range.

Phantom-based experimental validation of computational fluid dynamics simulations on cerebral aneurysms

International Nuclear Information System (INIS)

Sun Qi; Groth, Alexandra; Bertram, Matthias; Waechter, Irina; Bruijns, Tom; Hermans, Roel; Aach, Til

2010-01-01

Purpose: Recently, image-based computational fluid dynamics (CFD) simulation has been applied to investigate the hemodynamics inside human cerebral aneurysms. The knowledge of the computed three-dimensional flow fields is used for clinical risk assessment and treatment decision making. However, the reliability of the application specific CFD results has not been thoroughly validated yet. Methods: In this work, by exploiting a phantom aneurysm model, the authors therefore aim to prove the reliability of the CFD results obtained from simulations with sufficiently accurate input boundary conditions. To confirm the correlation between the CFD results and the reality, virtual angiograms are generated by the simulation pipeline and are quantitatively compared to the experimentally acquired angiograms. In addition, a parametric study has been carried out to systematically investigate the influence of the input parameters associated with the current measuring techniques on the flow patterns. Results: Qualitative and quantitative evaluations demonstrate good agreement between the simulated and the real flow dynamics. Discrepancies of less than 15% are found for the relative root mean square errors of time intensity curve comparisons from each selected characteristic position. The investigated input parameters show different influences on the simulation results, indicating the desired accuracy in the measurements. Conclusions: This study provides a comprehensive validation method of CFD simulation for reproducing the real flow field in the cerebral aneurysm phantom under well controlled conditions. The reliability of the CFD is well confirmed. Through the parametric study, it is possible to assess the degree of validity of the associated CFD model based on the parameter values and their estimated accuracy range.

Primer on Health Surveys

Directory of Open Access Journals (Sweden)

David L Nordstrom

2012-06-01

Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

Directory of Open Access Journals (Sweden)

Diana Sari

2015-05-01

Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

Experimental validation of calculation schemes connected with PWR absorbers and burnable poisons; Validation experimentale des schemas de calcul relatifs aux absorbants et poisons consommables dans les REP

Energy Technology Data Exchange (ETDEWEB)

Klenov, P.

1995-10-01

In France 80% of electricity is produced by PWR reactors. For a better exploitation of these reactors a modular computer code Apollo-II has been developed. his code compute the flux transport by discrete ordinate method or by probabilistic collisions on extended configurations such as reactor cells, assemblies or little cores. For validation of this code on mixed oxide fuel lattices with absorbers an experimental program Epicure in the reactor Eole was induced. This thesis is devoted to the validation of the Apollo code according to the results of the Epicure program. 43 refs., 65 figs., 1 append.

Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

Science.gov (United States)

2011-08-17

system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Single primer amplification reaction methods reveal exotic and ...

Indian Academy of Sciences (India)

Unknown

mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

Experimental validation of Monte Carlo calculations for organ dose

International Nuclear Information System (INIS)

Yalcintas, M.G.; Eckerman, K.F.; Warner, G.G.

1980-01-01

The problem of validating estimates of absorbed dose due to photon energy deposition is examined. The computational approaches used for the estimation of the photon energy deposition is examined. The limited data for validation of these approaches is discussed and suggestions made as to how better validation information might be obtained

Experimental results and validation of a method to reconstruct forces on the ITER test blanket modules

International Nuclear Information System (INIS)

Zeile, Christian; Maione, Ivan A.

2015-01-01

Highlights: • An in operation force measurement system for the ITER EU HCPB TBM has been developed. • The force reconstruction methods are based on strain measurements on the attachment system. • An experimental setup and a corresponding mock-up have been built. • A set of test cases representing ITER relevant excitations has been used for validation. • The influence of modeling errors on the force reconstruction has been investigated. - Abstract: In order to reconstruct forces on the test blanket modules in ITER, two force reconstruction methods, the augmented Kalman filter and a model predictive controller, have been selected and developed to estimate the forces based on strain measurements on the attachment system. A dedicated experimental setup with a corresponding mock-up has been designed and built to validate these methods. A set of test cases has been defined to represent possible excitation of the system. It has been shown that the errors in the estimated forces mainly depend on the accuracy of the identified model used by the algorithms. Furthermore, it has been found that a minimum of 10 strain gauges is necessary to allow for a low error in the reconstructed forces.

Out-of-plane buckling of pantographic fabrics in displacement-controlled shear tests: experimental results and model validation

Science.gov (United States)

Barchiesi, Emilio; Ganzosch, Gregor; Liebold, Christian; Placidi, Luca; Grygoruk, Roman; Müller, Wolfgang H.

2018-01-01

Due to the latest advancements in 3D printing technology and rapid prototyping techniques, the production of materials with complex geometries has become more affordable than ever. Pantographic structures, because of their attractive features, both in dynamics and statics and both in elastic and inelastic deformation regimes, deserve to be thoroughly investigated with experimental and theoretical tools. Herein, experimental results relative to displacement-controlled large deformation shear loading tests of pantographic structures are reported. In particular, five differently sized samples are analyzed up to first rupture. Results show that the deformation behavior is strongly nonlinear, and the structures are capable of undergoing large elastic deformations without reaching complete failure. Finally, a cutting edge model is validated by means of these experimental results.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-09-27

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

1998-12-10

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Summary of the primer on tumor immunology and the biological therapy of cancer

Directory of Open Access Journals (Sweden)

Margolin Kim

2009-01-01

Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

Science.gov (United States)

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

An experimentally validated simulation model for a four-stage spray dryer

DEFF Research Database (Denmark)

Petersen, Lars Norbert; Poulsen, Niels Kjølstad; Niemann, Hans Henrik

2017-01-01

mathematical model is an index-1 differential algebraic equation (DAE) model with 12 states, 9 inputs, 8 disturbances, and 30 parameters. The parameters in the model are identified from well-excited experimental data obtained from the industrialtype spray dryer. The simulated outputs ofthe model are validated...... is divided into four consecutive stages: a primary spray drying stage, two heated fluid bed stages, and a cooling fluid bed stage. Each of these stages in the model is assumed ideally mixed and the dynamics are described by mass- and energy balances. These balance equations are coupled with constitutive...... equations such as a thermodynamic model, the water evaporation rate, the heat transfer rates, and an equation for the stickiness of the powder (glass transition temperature). Laboratory data is used to model the equilibrium moisture content and the glass transition temperature of the powder. The resulting...

MRI Primer

International Nuclear Information System (INIS)

Oldendorf, W.; Oldendorf, W. Jr.

1991-01-01

Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

Relativistic Astrophysics and Cosmology: A Primer

International Nuclear Information System (INIS)

Abramowicz, Marek A

2007-01-01

'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

A primer of multivariate statistics

CERN Document Server

Harris, Richard J

2014-01-01

Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

A Primer on Basic Effect Size Concepts.

Science.gov (United States)

Elmore, Patricia B.; Rotou, Ourania

The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

Modeling and experimental validation of water mass balance in a PEM fuel cell stack

DEFF Research Database (Denmark)

Liso, Vincenzo; Araya, Samuel Simon; Olesen, Anders Christian

2016-01-01

Polymer electrolyte membrane (PEM) fuel cells require good hydration in order to deliver high performance and ensure long life operation. Water is essential for proton conductivity in the membrane which increases by nearly six orders of magnitude from dry to fully hydrated. Adequate water...... management in PEM fuel cell is crucial in order to avoid an imbalance between water production and water removal from the fuel cell. In the present study, a novel mathematical zero-dimensional model has been formulated for the water mass balance and hydration of a polymer electrolyte membrane. This model...... is validated against experimental data. In the results it is shown that the fuel cell water balance calculated by this model shows better fit with experimental data-points compared with model where only steady state operation were considered. We conclude that this discrepancy is due a different rate of water...

Theoretical model and experimental validation of a direct-expansion solar assisted heat pump for domestic hot water applications

International Nuclear Information System (INIS)

Moreno-Rodríguez, A.; González-Gil, A.; Izquierdo, M.; Garcia-Hernando, N.

2012-01-01

This paper has shown the development of a theoretical model to determine the operating parameters and consumption of a domestic hot water (DHW) installation, which uses a direct-expansion solar assisted heat pump (DXSAHP) with refrigerant R-134a, a compressor with a rated capacity of 1.1 kW and collectors with a total area of 5.6 m 2 . The model results have been compared and validated the experimental results obtained with the equipment installed at the University Carlos III, South of Madrid. The analysis was conducted over the course of a year, and the results have been represented depending on the meteorological and process variables of several representative days. Taking into account the thermal losses of the installation and the dependency on the operating conditions, the acquired experimental coefficient of performance is between 1.7 and 2.9, while the DHW tank temperature over the course of the study is 51 °C. -- Highlights: ► The study aims to present a new theoretical model and an experimental validation. ► The experimental COP vary between 1.7 and 2.9 (max. condensation temperature 57 °C). ► The operating parameters respond to the solar radiation. The COP may increase up to 50%. ► The useful surface area varies between 50% and 85% of the total surface. ► The system stops if conditions exceed the maximum value of the absorbed heat.

Experimental validation of a simple, low-cost, T-junction droplet generator fabricated through 3D printing

Science.gov (United States)

Donvito, Lidia; Galluccio, Laura; Lombardo, Alfio; Morabito, Giacomo; Nicolosi, Alfio; Reno, Marco

2015-03-01

Three-dimensional printing has been recently proposed and assessed for continuous flow microfluidic devices. In this paper the focus is on a new application of this rapid and low cost method for microfluidic device prototyping: droplets production through a T-junction generator. The feasibility of this new methodology is assessed by means of an experimental study in which the statistical parameters which characterize the production of droplets are analyzed. Furthermore, this study assesses the validity of previous theoretical and experimental results, obtained for a PDMS T-junction droplet generator, also in the case of a 3D printed Acrylonitrile microfluidic chip. Finally, the feasibility of producing monodisperse droplets by analyzing the polydispersity index of the prepared droplets is demonstrated.

The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

DEFF Research Database (Denmark)

Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

2011-01-01

. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

A Brief Taxometrics Primer

Science.gov (United States)

Beauchaine, Theodore P.

2009-01-01

Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

Directory of Open Access Journals (Sweden)

Michael D. Blanton

2012-09-01

Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

Science.gov (United States)

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

Science.gov (United States)

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

A mathematical model for hydrogen evolution in an electrochemical cell and experimental validation

International Nuclear Information System (INIS)

Mahmut D Mat; Yuksel Kaplan; Beycan Ibrahimoglu; Nejat Veziroglu; Rafig Alibeyli; Sadiq Kuliyev

2006-01-01

Electrochemical reaction is largely employed in various industrial areas such as hydrogen production, chlorate process, electroplating, metal purification etc. Most of these processes often take place with gas evaluation on the electrodes. Presence of gas phase in the liquid phase makes the problem two-phase flow which is much knowledge available from heat transfer and fluid mechanics studies. The motivation of this study is to investigate hydrogen release in an electrolysis processes from two-phase flow point of view and investigate effect of gas release on the electrolysis process. Hydrogen evolution, flow field and current density distribution in an electrochemical cell are investigated with a two-phase flow model. The mathematical model involves solutions of transport equations for the variables of each phase with allowance for inter phase transfer of mass and momentum. An experimental set-up is established to collect data to validate and improve the mathematical model. Void fraction is determined from measurement of resistivity changes in the system due to the presence of bubbles. A good agreement is obtained between numerical results and experimental data. (authors)

Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

Directory of Open Access Journals (Sweden)

Nigel C. Brissett

2013-11-01

Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

Electrocatalysis of borohydride oxidation: a review of density functional theory approach combined with experimental validation

International Nuclear Information System (INIS)

Sison Escaño, Mary Clare; Arevalo, Ryan Lacdao; Kasai, Hideaki; Gyenge, Elod

2014-01-01

The electrocatalysis of borohydride oxidation is a complex, up-to-eight-electron transfer process, which is essential for development of efficient direct borohydride fuel cells. Here we review the progress achieved by density functional theory (DFT) calculations in explaining the adsorption of BH 4 − on various catalyst surfaces, with implications for electrocatalyst screening and selection. Wherever possible, we correlate the theoretical predictions with experimental findings, in order to validate the proposed models and to identify potential directions for further advancements. (topical review)

Electrocatalysis of borohydride oxidation: a review of density functional theory approach combined with experimental validation

Science.gov (United States)

Sison Escaño, Mary Clare; Lacdao Arevalo, Ryan; Gyenge, Elod; Kasai, Hideaki

2014-09-01

The electrocatalysis of borohydride oxidation is a complex, up-to-eight-electron transfer process, which is essential for development of efficient direct borohydride fuel cells. Here we review the progress achieved by density functional theory (DFT) calculations in explaining the adsorption of BH4- on various catalyst surfaces, with implications for electrocatalyst screening and selection. Wherever possible, we correlate the theoretical predictions with experimental findings, in order to validate the proposed models and to identify potential directions for further advancements.

Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

DEFF Research Database (Denmark)

Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

2005-01-01

A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

The astrobiology primer: an outline of general knowledge--version 1, 2006.

Science.gov (United States)

Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

2006-10-01

The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

Validation of an experimental polyurethane model for biomechanical studies on implant supported prosthesis - tension tests

Directory of Open Access Journals (Sweden)

Mariane Miyashiro

2011-06-01

Full Text Available OBJECTIVES: The complexity and heterogeneity of human bone, as well as ethical issues, frequently hinder the development of clinical trials. The purpose of this in vitro study was to determine the modulus of elasticity of a polyurethane isotropic experimental model via tension tests, comparing the results to those reported in the literature for mandibular bone, in order to validate the use of such a model in lieu of mandibular bone in biomechanical studies. MATERIAL AND METHODS: Forty-five polyurethane test specimens were divided into 3 groups of 15 specimens each, according to the ratio (A/B of polyurethane reagents (PU-1: 1/0.5, PU-2: 1/1, PU-3: 1/1.5. RESULTS: Tension tests were performed in each experimental group and the modulus of elasticity values found were 192.98 MPa (SD=57.20 for PU-1, 347.90 MPa (SD=109.54 for PU-2 and 304.64 MPa (SD=25.48 for PU-3. CONCLUSION: The concentration of choice for building the experimental model was 1/1.

Experimental Definition and Validation of Protein Coding Transcripts in Chlamydomonas reinhardtii

Energy Technology Data Exchange (ETDEWEB)

Kourosh Salehi-Ashtiani; Jason A. Papin

2012-01-13

Algal fuel sources promise unsurpassed yields in a carbon neutral manner that minimizes resource competition between agriculture and fuel crops. Many challenges must be addressed before algal biofuels can be accepted as a component of the fossil fuel replacement strategy. One significant challenge is that the cost of algal fuel production must become competitive with existing fuel alternatives. Algal biofuel production presents the opportunity to fine-tune microbial metabolic machinery for an optimal blend of biomass constituents and desired fuel molecules. Genome-scale model-driven algal metabolic design promises to facilitate both goals by directing the utilization of metabolites in the complex, interconnected metabolic networks to optimize production of the compounds of interest. Using Chlamydomonas reinhardtii as a model, we developed a systems-level methodology bridging metabolic network reconstruction with annotation and experimental verification of enzyme encoding open reading frames. We reconstructed a genome-scale metabolic network for this alga and devised a novel light-modeling approach that enables quantitative growth prediction for a given light source, resolving wavelength and photon flux. We experimentally verified transcripts accounted for in the network and physiologically validated model function through simulation and generation of new experimental growth data, providing high confidence in network contents and predictive applications. The network offers insight into algal metabolism and potential for genetic engineering and efficient light source design, a pioneering resource for studying light-driven metabolism and quantitative systems biology. Our approach to generate a predictive metabolic model integrated with cloned open reading frames, provides a cost-effective platform to generate metabolic engineering resources. While the generated resources are specific to algal systems, the approach that we have developed is not specific to algae and

Multimicrophone Speech Dereverberation: Experimental Validation

Directory of Open Access Journals (Sweden)

Marc Moonen

2007-05-01

Full Text Available Dereverberation is required in various speech processing applications such as handsfree telephony and voice-controlled systems, especially when signals are applied that are recorded in a moderately or highly reverberant environment. In this paper, we compare a number of classical and more recently developed multimicrophone dereverberation algorithms, and validate the different algorithmic settings by means of two performance indices and a speech recognition system. It is found that some of the classical solutions obtain a moderate signal enhancement. More advanced subspace-based dereverberation techniques, on the other hand, fail to enhance the signals despite their high-computational load.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

Science.gov (United States)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Promotion primer. Foerderfibel

Energy Technology Data Exchange (ETDEWEB)

1981-01-01

This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

DEFF Research Database (Denmark)

Li, H; Shi, B; Li, X

2013-01-01

The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Experimental Peptide Identification Repository (EPIR): an integrated peptide-centric platform for validation and mining of tandem mass spectrometry data

DEFF Research Database (Denmark)

Kristensen, Dan Bach; Brønd, Jan Christian; Nielsen, Peter Aagaard

2004-01-01

LC MS/MS has become an established technology in proteomic studies, and with the maturation of the technology the bottleneck has shifted from data generation to data validation and mining. To address this bottleneck we developed Experimental Peptide Identification Repository (EPIR), which...... is an integrated software platform for storage, validation, and mining of LC MS/MS-derived peptide evidence. EPIR is a cumulative data repository where precursor ions are linked to peptide assignments and protein associations returned by a search engine (e.g. Mascot, Sequest, or PepSea). Any number of datasets can...

Effect of oligonucleotide primers in determining viral variability within hosts

Directory of Open Access Journals (Sweden)

Moya Andrés

2004-12-01

Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Effect of oligonucleotide primers in determining viral variability within hosts.

Science.gov (United States)

Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

2004-12-09

Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Alteration of 'R7T7' type nuclear glasses: statistical approach, experimental validation, local evolution model

International Nuclear Information System (INIS)

Thierry, F.

2003-02-01

The aim of this work is to propose an evolution of nuclear (R7T7-type) glass alteration modeling. The first part of this thesis is about development and validation of the 'r(t)' model. This model which predicts the decrease of alteration rates in confined conditions is based upon a coupling between a first-order dissolution law and a diffusion barrier effect of the alteration gel layer. The values and the uncertainties regarding the main adjustable parameters of the model (α, Dg and C*) have been determined from a systematic study of the available experimental data. A program called INVERSION has been written for this purpose. This work lead to characterize the validity domain of the 'r(t)' model and to parametrize it. Validation experiments have been undertaken, confirming the validity of the parametrization over 200 days. A new model is proposed in the second part of this thesis. It is based on an inhibition of glass dissolution reaction by silicon coupled with a local description of silicon retention in the alteration gel layer. This model predicts the evolutions of boron and silicon concentrations in solution as well as the concentrations and retention profiles in the gel layer. These predictions have been compared to measurements of retention profiles by the secondary ion mass spectrometry (SIMS) method. The model has been validated on fractions of gel layer which reactivity present low or moderate disparities. (author)

Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

Science.gov (United States)

This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

FullSSR: Microsatellite Finder and Primer Designer

Directory of Open Access Journals (Sweden)

Sebastián Metz

2016-01-01

Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

Experimental validation of a simple, low-cost, T-junction droplet generator fabricated through 3D printing

International Nuclear Information System (INIS)

Donvito, Lidia; Galluccio, Laura; Lombardo, Alfio; Morabito, Giacomo; Nicolosi, Alfio; Reno, Marco

2015-01-01

Three-dimensional printing has been recently proposed and assessed for continuous flow microfluidic devices. In this paper the focus is on a new application of this rapid and low cost method for microfluidic device prototyping: droplets production through a T-junction generator. The feasibility of this new methodology is assessed by means of an experimental study in which the statistical parameters which characterize the production of droplets are analyzed. Furthermore, this study assesses the validity of previous theoretical and experimental results, obtained for a PDMS T-junction droplet generator, also in the case of a 3D printed Acrylonitrile microfluidic chip. Finally, the feasibility of producing monodisperse droplets by analyzing the polydispersity index of the prepared droplets is demonstrated. (paper)

Three-dimensional deformation response of a NiTi shape memory helical-coil actuator during thermomechanical cycling: experimentally validated numerical model

Science.gov (United States)

Dhakal, B.; Nicholson, D. E.; Saleeb, A. F.; Padula, S. A., II; Vaidyanathan, R.

2016-09-01

Shape memory alloy (SMA) actuators often operate under a complex state of stress for an extended number of thermomechanical cycles in many aerospace and engineering applications. Hence, it becomes important to account for multi-axial stress states and deformation characteristics (which evolve with thermomechanical cycling) when calibrating any SMA model for implementation in large-scale simulation of actuators. To this end, the present work is focused on the experimental validation of an SMA model calibrated for the transient and cyclic evolutionary behavior of shape memory Ni49.9Ti50.1, for the actuation of axially loaded helical-coil springs. The approach requires both experimental and computational aspects to appropriately assess the thermomechanical response of these multi-dimensional structures. As such, an instrumented and controlled experimental setup was assembled to obtain temperature, torque, degree of twist and extension, while controlling end constraints during heating and cooling of an SMA spring under a constant externally applied axial load. The computational component assesses the capabilities of a general, multi-axial, SMA material-modeling framework, calibrated for Ni49.9Ti50.1 with regard to its usefulness in the simulation of SMA helical-coil spring actuators. Axial extension, being the primary response, was examined on an axially-loaded spring with multiple active coils. Two different conditions of end boundary constraint were investigated in both the numerical simulations as well as the validation experiments: Case (1) where the loading end is restrained against twist (and the resulting torque measured as the secondary response) and Case (2) where the loading end is free to twist (and the degree of twist measured as the secondary response). The present study focuses on the transient and evolutionary response associated with the initial isothermal loading and the subsequent thermal cycles under applied constant axial load. The experimental

Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2011-01-01

Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

Experimental validation of Villain's conjecture about magnetic ordering in quasi-1D helimagnets

International Nuclear Information System (INIS)

Cinti, F.; Rettori, A.; Pini, M.G.; Mariani, M.; Micotti, E.; Lascialfari, A.; Papinutto, N.; Amato, A.; Caneschi, A.; Gatteschi, D.; Affronte, M.

2010-01-01

Low-temperature magnetic susceptibility, zero-field muon spin resonance and specific heat measurements have been performed in the quasi-one-dimensional (1D) molecular helimagnetic compound Gd(hfac) 3 NITEt. The specific heat presents two anomalies at T 0 =2.19(2)K and T N =1.88(2)K, while susceptibility and zero-field muon spin resonance show anomalies only at T N =1.88(2)K. The results suggest an experimental validation of Villain's conjecture of a two-step magnetic ordering in quasi-1D XY helimagnets: the paramagnetic phase and the helical spin solid phases are separated by a chiral spin liquid, where translational invariance is broken without violation of rotational invariance.

A Simulation Study of Threats to Validity in Quasi-Experimental Designs: Interrelationship between Design, Measurement, and Analysis.

Science.gov (United States)

Holgado-Tello, Fco P; Chacón-Moscoso, Salvador; Sanduvete-Chaves, Susana; Pérez-Gil, José A

2016-01-01

The Campbellian tradition provides a conceptual framework to assess threats to validity. On the other hand, different models of causal analysis have been developed to control estimation biases in different research designs. However, the link between design features, measurement issues, and concrete impact estimation analyses is weak. In order to provide an empirical solution to this problem, we use Structural Equation Modeling (SEM) as a first approximation to operationalize the analytical implications of threats to validity in quasi-experimental designs. Based on the analogies established between the Classical Test Theory (CTT) and causal analysis, we describe an empirical study based on SEM in which range restriction and statistical power have been simulated in two different models: (1) A multistate model in the control condition (pre-test); and (2) A single-trait-multistate model in the control condition (post-test), adding a new mediator latent exogenous (independent) variable that represents a threat to validity. Results show, empirically, how the differences between both the models could be partially or totally attributed to these threats. Therefore, SEM provides a useful tool to analyze the influence of potential threats to validity.

Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

Science.gov (United States)

Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

2015-06-01

Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

Planning your first wind power project. A primer for utilities: Everything you need to know to bring your first wind power plant on-line

International Nuclear Information System (INIS)

Conover, K.; Davis, E.

1994-12-01

This primer has been prepared to help utility personnel become familiar with some or the details relative to wind power technology and project development. It is written as a series of relatively independent chapters to address specific topics or phases of wind power evaluation and development as they might occur within a utility. The topics include: wind prospecting and the first pass analysis, resource validation, project feasibility, resource planning and evaluation, resource acquisition, project development, equipment selection, project design and construction, and plant operation and maintenance

Experimental Validation of an FSW Model with an Enhanced Friction Law: Application to a Threaded Cylindrical Pin Tool

Directory of Open Access Journals (Sweden)

Narges Dialami

2017-11-01

Full Text Available This work adopts a fast and accurate two-stage computational strategy for the analysis of FSW (Friction stir welding processes using threaded cylindrical pin tools. The coupled thermo-mechanical problem is equipped with an enhanced friction model to include the effect of non-uniform pressure distribution under the pin shoulder. The overall numerical strategy is successfully validated by the experimental measurements provided by the industrial partner (Sapa. The verification of the numerical model using the experimental evidence is not only accomplished in terms of temperature evolution but also in terms of torque, longitudinal, transversal and vertical forces.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

Science.gov (United States)

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

Experimental validation of GADRAS's coupled neutron-photon inverse radiation transport solver

International Nuclear Information System (INIS)

Mattingly, John K.; Mitchell, Dean James; Harding, Lee T.

2010-01-01

Sandia National Laboratories has developed an inverse radiation transport solver that applies nonlinear regression to coupled neutron-photon deterministic transport models. The inverse solver uses nonlinear regression to fit a radiation transport model to gamma spectrometry and neutron multiplicity counting measurements. The subject of this paper is the experimental validation of that solver. This paper describes a series of experiments conducted with a 4.5 kg sphere of α-phase, weapons-grade plutonium. The source was measured bare and reflected by high-density polyethylene (HDPE) spherical shells with total thicknesses between 1.27 and 15.24 cm. Neutron and photon emissions from the source were measured using three instruments: a gross neutron counter, a portable neutron multiplicity counter, and a high-resolution gamma spectrometer. These measurements were used as input to the inverse radiation transport solver to evaluate the solver's ability to correctly infer the configuration of the source from its measured radiation signatures.

Experimental and computational validation of BDTPS using a heterogeneous boron phantom

CERN Document Server

Daquino, G G; Mazzini, M; Moss, R L; Muzi, L

2004-01-01

The idea to couple the treatment planning system (TPS) to the information on the real boron distribution in the patient acquired by positron emission tomography (PET) is the main added value of the new methodology set-up at DIMNP (Dipartimento di Ingegneria Meccanica, Nucleare e della Produzione) of University of Pisa, in collaboration with the JRC (Joint Research Centre) at Petten (NL). This methodology has been implemented in a new TPS, called Boron Distribution Treatment Planning System (BDTPS), which takes into account the actual boron distribution in the patient's organ, as opposed to other TPSs used in BNCT that assume an ideal uniform boron distribution. BDTPS is based on the Monte Carlo technique and has been experimentally validated comparing the computed main parameters (thermal neutron flux, boron dose, etc.) to those measured during the irradiation of an ad hoc designed phantom (HEterogeneous BOron phanto M, HEBOM). The results are also in good agreement with those obtained by the standard TPS SER...

PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

Science.gov (United States)

Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

2013-01-01

Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

International Nuclear Information System (INIS)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-01-01

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

Zero-G experimental validation of a robotics-based inertia identification algorithm

Science.gov (United States)

Bruggemann, Jeremy J.; Ferrel, Ivann; Martinez, Gerardo; Xie, Pu; Ma, Ou

2010-04-01

The need to efficiently identify the changing inertial properties of on-orbit spacecraft is becoming more critical as satellite on-orbit services, such as refueling and repairing, become increasingly aggressive and complex. This need stems from the fact that a spacecraft's control system relies on the knowledge of the spacecraft's inertia parameters. However, the inertia parameters may change during flight for reasons such as fuel usage, payload deployment or retrieval, and docking/capturing operations. New Mexico State University's Dynamics, Controls, and Robotics Research Group has proposed a robotics-based method of identifying unknown spacecraft inertia properties1. Previous methods require firing known thrusts then measuring the thrust, and the velocity and acceleration changes. The new method utilizes the concept of momentum conservation, while employing a robotic device powered by renewable energy to excite the state of the satellite. Thus, it requires no fuel usage or force and acceleration measurements. The method has been well studied in theory and demonstrated by simulation. However its experimental validation is challenging because a 6- degree-of-freedom motion in a zero-gravity condition is required. This paper presents an on-going effort to test the inertia identification method onboard the NASA zero-G aircraft. The design and capability of the test unit will be discussed in addition to the flight data. This paper also introduces the design and development of an airbearing based test used to partially validate the method, in addition to the approach used to obtain reference value for the test system's inertia parameters that can be used for comparison with the algorithm results.

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

Science.gov (United States)

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

Science.gov (United States)

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Experimental validation for combustion analysis of GOTHIC 6.1b code in 2-dimensional premixed combustion experiments

International Nuclear Information System (INIS)

Lee, J. Y.; Lee, J. J.; Park, K. C.

2003-01-01

In this study, the prediction capability of GOTHIC code for hydrogen combustion phenomena was validated with the results of two-dimensional premixed hydrogen combustion experiment executed by Seoul National University. In the experimental results, we could confirm the propagation characteristics of hydrogen flame such as buoyancy effect, flame front shape etc.. The combustion time of the tests was about 0.1 sec.. In the GOTHIC analyses results, the GOTHIC code could predict the overall hydrogen flame propagation characteristics but the buoyancy effect and flame shape did not compare well with the experimental results. Especially, in case of the flame propagate to the dead-end, GOTHIC predicted the flame did not affected by the flow and this cause quite different results in flame propagation from experimental results. Moreover the combustion time of the analyses was about 1 sec. which is ten times longer than the experimental result. To obtain more reasonable analysis results, it is necessary that combustion model parameters in GOTHIC code apply appropriately and hydrogen flame characteristics be reflected in solving governing equations

Neutronics experimental validation of the Jules Horowitz reactor fuel by interpretation of the VALMONT experimental program-transposition of the uncertainties on the reactivity of JHR with JEF2.2 and JEFF3.1.1

International Nuclear Information System (INIS)

Leray, O.; Hudelot, J.P.; Doederlein, C.; Vaglio-Gaudard, C.; Antony, M.; Santamarina, A.; Bernard, D.

2012-01-01

The new European material testing Jules Horowitz Reactor (JHR), currently under construction in Cadarache center (CEA France), will use LEU (20% enrichment in 235 U) fuels (U 3 Si 2 for the start up and UMoAl in the future) which are quite different from the industrial oxide fuel, for which an extensive neutronics experimental validation database has been established. The HORUS3D/N neutronics calculation scheme, used for the design and safety studies of the JHR, is being developed within the framework of a rigorous verification-numerical validation-experimental validation methodology. In this framework, the experimental VALMONT (Validation of Aluminium Molybdenum uranium fuel for Neutronics) program has been performed in the MINERVE facility of CEA Cadarache (France), in order to qualify the capability of HORUS3D/N to accurately calculate the reactivity of the JHR reactor. The MINERVE facility using the oscillation technique provides accurate measurements of reactivity effect of samples. The VALMONT program includes oscillations of samples of UAl ∞ /Al and UMo/Al with enrichments ranging from 0.2% to 20% and Uranium densities from 2.2 to 8 g/cm 3 . The geometry of the samples and the pitch of the experimental lattice ensure maximum representativeness with the neutron spectrum expected for JHR. By comparing the effect of the sample with the one of a known fuel specimen, the reactivity effect can be measured in absolute terms and be compared to computational results. Special attention was paid to the rigorous determination and reduction of the experimental uncertainties. The calculational analysis of the VALMONT results was performed with the French deterministic code APOLLO2. A comparison of the impact of the different calculation methods, data libraries and energy meshes that were tested is presented. The interpretation of the VALMONT experimental program allowed the experimental validation of JHR fuel UMoAl8 (with an enrichment of 19.75% 235 U) by the Minerve

Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

Science.gov (United States)

Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

2015-01-01

Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

Computational Prediction and Rationalization, and Experimental Validation of Handedness Induction in Helical Aromatic Oligoamide Foldamers.

Science.gov (United States)

Liu, Zhiwei; Hu, Xiaobo; Abramyan, Ara M; Mészáros, Ádám; Csékei, Márton; Kotschy, András; Huc, Ivan; Pophristic, Vojislava

2017-03-13

Metadynamics simulations were used to describe the conformational energy landscapes of several helically folded aromatic quinoline carboxamide oligomers bearing a single chiral group at either the C or N terminus. The calculations allowed the prediction of whether a helix handedness bias occurs under the influence of the chiral group and gave insight into the interactions (sterics, electrostatics, hydrogen bonds) responsible for a particular helix sense preference. In the case of camphanyl-based and morpholine-based chiral groups, experimental data confirming the validity of the calculations were already available. New chiral groups with a proline residue were also investigated and were predicted to induce handedness. This prediction was verified experimentally through the synthesis of proline-containing monomers, their incorporation into an oligoamide sequence by solid phase synthesis and the investigation of handedness induction by NMR spectroscopy and circular dichroism. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Signals and systems primer with Matlab

CERN Document Server

Poularikas, Alexander D

2006-01-01

Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

Experimental study of cathodic protection of concrete from a 30 year old bridge

NARCIS (Netherlands)

Polder, R.B.; Nerland, O.C.

1998-01-01

An experimental study of cathodic protection (CP) was carried out with a conductive primer anode applied to specimens from a concrete bridge. The bridge was demolished after 30 years of service due to severe delaminations and reinforcement corrosion. Four specimens of approximately 1 m2 each were

Experimental Validation of UTDefect: Scattering in Anisotropic Media and Near-field Behavior

International Nuclear Information System (INIS)

Pecorari, Claudio

2002-11-01

Theoretical models that simulate measurements of ultrasonic waves undergoing scattering by material defects have been developed by Prof. Bostroem and co-workers at Chalmers Univ. of Tech. for a variety of experimental configurations and defects. A software program named UTDefect has been developed at the same time, which gathers the theoretical results obtained so far in a single package. A discussion of the motivations behind such an effort and details concerning UTDefect can be found in articles by Bostroem. Following an initial effort to validate some of the theoretical predictions available at the time, the present project has been conceived as a support to the on-going theoretical work. In fact, the goal of the project described in this report has been the experimental validation of two aspects of the above theory that have not yet been tested: the scattering of a finite ultrasonic beam by a surface-breaking crack in an anisotropic medium, and an improved model of the behaviour of a finite ultrasonic beam in the near-field region of the source. In the last case, the supporting medium is supposed to be isotropic. To carry out the first task, a single crystal, silicon sample was employed. A surface-breaking notch with a depth of approximately 1.8 mm was introduced by means of a wire-cutting saw to simulate a scattering defect. Two kinds of measurements were performed of this sample. The first one considered the signal amplitude as a function of the transducer position. To this end, three wedges generating beams propagating in different directions were used. The second series of measurements concerned the frequency content of the backscattered signals at the position where the amplitude was maximum. All three wedges mentioned above were used also in this part of the work. The experimental results were compared to the values of the physical quantities of interest as predicted by UTDefect, with the only difference that UTDefect was run for a sub-surface rectangular

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

Science.gov (United States)

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Histological evaluation of direct pulp capping of rat pulp with experimentally developed low-viscosity adhesives containing reparative dentin-promoting agents.

Science.gov (United States)

Suzuki, Masaya; Taira, Yoshihisa; Kato, Chikage; Shinkai, Koichi; Katoh, Yoshiroh

2016-01-01

This study examines the wound healing process in exposed rat pulp when capped with experimental adhesive resin systems. Experimental adhesive resin system for direct pulp capping was composed of primer-I (PI), -II (PII), and -III (PIII) and an experimental bonding agent (EBA). PI was Clearfil(®) SE Bond(®)/Primer (CSP) containing 5.0 wt% CaCl2, PII was PI containing 10 wt% nanofiller (Aerosil(®) 380), and PIII was CSP containing 5.0 wt% of compounds of equal moles of synthetic peptides (pA and pB) derived from dentin matrix protein 1. EBA was Clearfil(®) SE Bond(®)/Bond (CSB) containing 10 wt% hydroxyapatite powders. Three experimental groups were designed. PI was assigned to experimental Groups 1 and 3. PII was assigned to experimental Groups 2 and 3. PIII and EBA were assigned to all experimental adhesive groups. Control teeth were capped with calcium hydroxide preparation (Dycal(®)), and CSP and CSB were applied to the cavity. The rats were sacrificed after each observation period (14, 28, 56, and 112 days). The following parameters were evaluated: pulp tissue disorganization, inflammatory cell infiltration, reparative dentin formation (RDF), and bacterial penetration. There were no significant differences among all the groups for all parameters and all observation periods (p>0.05, Kruskal-Wallis test). All groups showed initial RDF at 14 days postoperatively and extensive RDF until 112 days postoperatively. Groups 2 and 3 demonstrated higher quantity of mineralized dentin bridge formation compared with Group 1. Addition of nanofillers to the primer was effective in promoting high-density RDF. Experimentally developed adhesive resin systems induce the exposed pulp to produce almost the same quantity of reparative dentin as calcium hydroxide. However, we need further studies to elucidate whether the same results could be obtained in humans. Copyright © 2015 Elsevier Ltd. All rights reserved.

Experimental Study of the Twin Turbulent Water Jets Using Laser Doppler Anemometry for Validating Numerical Models

International Nuclear Information System (INIS)

Wang Huhu; Lee Saya; Hassan, Yassin A.; Ruggles, Arthur E.

2014-01-01

The design of next generation (Gen. IV) high-temperature nuclear reactors including gas-cooled and sodium-cooled ones involves massive numerical works especially the Computational Fluid Dynamics (CFD) simulations. The high cost of large-scale experiments and the inherent uncertainties existing in the turbulent models and wall functions of any CFD codes solving Reynolds-averaged Navier-Stokes (RANS) equations necessitate the high-spacial experimental data sets for benchmarking the simulation results. In Gen. IV conceptual reactors, the high- temperature flows mix in the upper plenum before entering the secondary cooling system. The mixing condition should be accurately estimated and fully understood as it is related to the thermal stresses induced in the upper plenum and the magnitudes of output power oscillations due to any changes of primary coolant temperature. The purpose of this study is to use Laser Doppler Anemometry (LDA) technique to measure the flow field of two submerged parallel jets issuing from two rectangular channels. The LDA data sets can be used to validate the corresponding simulation results. The jets studied in this work were at room temperature. The turbulent characteristics including the distributions of mean velocities, turbulence intensities, Reynolds stresses were studied. Uncertainty analysis was also performed to study the errors involved in this experiment. The experimental results in this work are valid for benchmarking any steady-state numerical simulations using turbulence models to solve RANS equations. (author)

Thermodynamic properties of 1-naphthol: Mutual validation of experimental and computational results

International Nuclear Information System (INIS)

Chirico, Robert D.; Steele, William V.; Kazakov, Andrei F.

2015-01-01

Highlights: • Heat capacities were measured for the temperature range 5 K to 445 K. • Vapor pressures were measured for the temperature range 370 K to 570 K. • Computed and derived properties for ideal gas entropies are in excellent accord. • The enthalpy of combustion was measured and shown to be consistent with reliable literature values. • Thermodynamic consistency analysis revealed anomalous literature data. - Abstract: Thermodynamic properties for 1-naphthol (Chemical Abstracts registry number [90-15-3]) in the ideal-gas state are reported based on both experimental and computational methods. Measured properties included the triple-point temperature, enthalpy of fusion, and heat capacities for the crystal and liquid phases by adiabatic calorimetry; vapor pressures by inclined-piston manometry and comparative ebulliometry; and the enthalpy of combustion of the crystal phase by oxygen bomb calorimetry. Critical properties were estimated. Entropies for the ideal-gas state were derived from the experimental studies for the temperature range 298.15 ⩽ T/K ⩽ 600, and independent statistical calculations were performed based on molecular geometry optimization and vibrational frequencies calculated at the B3LYP/6-31+G(d,p) level of theory. The mutual validation of the independent experimental and computed results is achieved with a scaling factor of 0.975 applied to the calculated vibrational frequencies. This same scaling factor was successfully applied in the analysis of results for other polycyclic molecules, as described in a series of recent articles by this research group. This article reports the first extension of this approach to a hydroxy-aromatic compound. All experimental results are compared with property values reported in the literature. Thermodynamic consistency between properties is used to show that several studies in the literature are erroneous. The enthalpy of combustion for 1-naphthol was also measured in this research, and excellent

Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

DEFF Research Database (Denmark)

Hansen, A C; Grunwald, T; Lund, Anders Henrik

2001-01-01

could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

Energy Technology Data Exchange (ETDEWEB)

Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

2012-08-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

Science.gov (United States)

Glennon, Kelsey L; Cron, Glynis V

2016-05-01

Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

Science.gov (United States)

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

Science.gov (United States)

Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

2016-06-01

Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

Science.gov (United States)

Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

2015-07-28

Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

Blood Donation and Transfusion: A Primer for Health Educators.

Science.gov (United States)

Felts, W. Michael; Glascoff, Mary A.

1991-01-01

Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

Small Commercial Building Re-tuning: A Primer

Energy Technology Data Exchange (ETDEWEB)

Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

2013-09-30

To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

Directory of Open Access Journals (Sweden)

Warren B. Chatwin

2014-10-01

Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

Numerical simulation and experimental validation of internal heat exchanger influence on CO{sub 2} trans-critical cycle performance

Energy Technology Data Exchange (ETDEWEB)

Rigola, Joaquim; Ablanque, Nicolas; Perez-Segarra, Carlos D.; Oliva, Assensi [Centre Tecnologic de Transferencia de Calor (CTTC), Universitat Politecnica de Catalunya (UPC), ETSEIAT, C. Colom 11, 08222 Terrassa (Barcelona) (Spain)

2010-06-15

The present paper is a numerical and experimental comparative study of the whole vapour compression refrigerating cycle in general, and reciprocating compressors in particular, with the aim of showing the possibilities that CO{sub 2} offers for commercial refrigeration, considering a single-stage trans-critical cycle using semi-hermetic reciprocating compressors under small cooling capacity systems. The present work is focussed on the influence of using an internal heat exchanger (IHX) in order to improve the cycle performance under real working conditions. In order to validate the numerical results, an experimental unit specially designed and built to analyze trans-critical refrigerating equipments considering IHX has been built. Both numerical results and experimental data show reasonable good agreement, while the comparative global values conclude the improvement of cooling capacity and COP when IHX is considered in the CO{sub 2} trans-critical cycle. (author)

Experimental Validation of Stratified Flow Phenomena, Graphite Oxidation, and Mitigation Strategies of Air Ingress Accidents

Energy Technology Data Exchange (ETDEWEB)

Chang Ho Oh; Eung Soo Kim; Hee Cheon No; Nam Zin Cho

2008-12-01

The US Department of Energy is performing research and development (R&D) that focuses on key phenomena that are important during challenging scenarios that may occur in the Next Generation Nuclear Plant (NGNP) Program / GEN-IV Very High Temperature Reactor (VHTR). Phenomena identification and ranking studies (PIRT) to date have identified the air ingress event, following on the heels of a VHTR depressurization, as very important (Schultz et al., 2006). Consequently, the development of advanced air ingress-related models and verification and validation (V&V) are very high priority for the NGNP program. Following a loss of coolant and system depressurization, air will enter the core through the break. Air ingress leads to oxidation of the in-core graphite structure and fuel. The oxidation will accelerate heat-up of the bottom reflector and the reactor core and will cause the release of fission products eventually. The potential collapse of the bottom reflector because of burn-off and the release of CO lead to serious safety problems. For estimation of the proper safety margin we need experimental data and tools, including accurate multi-dimensional thermal-hydraulic and reactor physics models, a burn-off model, and a fracture model. We also need to develop effective strategies to mitigate the effects of oxidation. The results from this research will provide crucial inputs to the INL NGNP/VHTR Methods R&D project. This project is focused on (a) analytical and experimental study of air ingress caused by density-driven, stratified, countercurrent flow, (b) advanced graphite oxidation experiments, (c) experimental study of burn-off in the bottom reflector, (d) structural tests of the burnt-off bottom reflector, (e) implementation of advanced models developed during the previous tasks into the GAMMA code, (f) full air ingress and oxidation mitigation analyses, (g) development of core neutronic models, (h) coupling of the core neutronic and thermal hydraulic models, and (i

Numerical Validation of a Vortex Model against ExperimentalData on a Straight-Bladed Vertical Axis Wind Turbine

Directory of Open Access Journals (Sweden)

Eduard Dyachuk

2015-10-01

Full Text Available Cyclic blade motion during operation of vertical axis wind turbines (VAWTs imposes challenges on the simulations models of the aerodynamics of VAWTs. A two-dimensional vortex model is validated against the new experimental data on a 12-kW straight-bladed VAWT, which is operated at an open site. The results on the normal force on one blade are analyzed. The model is assessed against the measured data in the wide range of tip speed ratios: from 1.8 to 4.6. The predicted results within one revolution have a similar shape and magnitude as the measured data, though the model does not reproduce every detail of the experimental data. The present model can be used when dimensioning the turbine for maximum loads.

Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

OpenAIRE

Johnston, Nessa

2012-01-01

Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

Final Design and Experimental Validation of the Thermal Performance of the LHC Lattice Cryostats

International Nuclear Information System (INIS)

Bourcey, N.; Capatina, O.; Parma, V.; Poncet, A.; Rohmig, P.; Serio, L.; Skoczen, B.; Tock, J.-P.; Williams, L. R.

2004-01-01

The recent commissioning and operation of the LHC String 2 have given a first experimental validation of the global thermal performance of the LHC lattice cryostat at nominal cryogenic conditions. The cryostat designed to minimize the heat inleak from ambient temperature, houses under vacuum and thermally protects the cold mass, which contains the LHC twin-aperture superconducting magnets operating at 1.9 K in superfluid helium. Mechanical components linking the cold mass to the vacuum vessel, such as support posts and insulation vacuum barriers are designed with efficient thermalisations for heat interception to minimise heat conduction. Heat inleak by radiation is reduced by employing multilayer insulation (MLI) wrapped around the cold mass and around an aluminium thermal shield cooled to about 60 K.Measurements of the total helium vaporization rate in String 2 gives, after substraction of supplementary heat loads and end effects, an estimate of the total thermal load to a standard LHC cell (107 m) including two Short Straight Sections and six dipole cryomagnets. Temperature sensors installed at critical locations provide a temperature mapping which allows validation of the calculated and estimated thermal performance of the cryostat components, including efficiency of the heat interceptions

Final Design and Experimental Validation of the Thermal Performance of the LHC Lattice Cryostats

Science.gov (United States)

Bourcey, N.; Capatina, O.; Parma, V.; Poncet, A.; Rohmig, P.; Serio, L.; Skoczen, B.; Tock, J.-P.; Williams, L. R.

2004-06-01

The recent commissioning and operation of the LHC String 2 have given a first experimental validation of the global thermal performance of the LHC lattice cryostat at nominal cryogenic conditions. The cryostat designed to minimize the heat inleak from ambient temperature, houses under vacuum and thermally protects the cold mass, which contains the LHC twin-aperture superconducting magnets operating at 1.9 K in superfluid helium. Mechanical components linking the cold mass to the vacuum vessel, such as support posts and insulation vacuum barriers are designed with efficient thermalisations for heat interception to minimise heat conduction. Heat inleak by radiation is reduced by employing multilayer insulation (MLI) wrapped around the cold mass and around an aluminium thermal shield cooled to about 60 K. Measurements of the total helium vaporization rate in String 2 gives, after substraction of supplementary heat loads and end effects, an estimate of the total thermal load to a standard LHC cell (107 m) including two Short Straight Sections and six dipole cryomagnets. Temperature sensors installed at critical locations provide a temperature mapping which allows validation of the calculated and estimated thermal performance of the cryostat components, including efficiency of the heat interceptions.

Absorber and regenerator models for liquid desiccant air conditioning systems. Validation and comparison using experimental data

Energy Technology Data Exchange (ETDEWEB)

Krause, M.; Heinzen, R.; Jordan, U.; Vajen, K. [Kassel Univ., Inst. of Thermal Engineering, Kassel (Germany); Saman, W.; Halawa, E. [Sustainable Energy Centre, Univ. of South Australia, Mawson Lakes, Adelaide (Australia)

2008-07-01

Solar assisted air conditioning systems using liquid desiccants represent a promising option to decrease high summer energy demand caused by electrically driven vapor compression machines. The main components of liquid desiccant systems are absorbers for dehumidifying and cooling of supply air and regenerators for concentrating the desiccant. However, high efficient and validated reliable components are required and the design and operation have to be adjusted to each respective building design, location, and user demand. Simulation tools can help to optimize component and system design. The present paper presents new developed numerical models for absorbers and regenerators, as well as experimental data of a regenerator prototype. The models have been compared with a finite-difference method model as well as experimental data. The data are gained from the regenerator prototype presented and an absorber presented in the literature. (orig.)

Development of robust flexible OLED encapsulations using simulated estimations and experimental validations

International Nuclear Information System (INIS)

Lee, Chang-Chun; Shih, Yan-Shin; Wu, Chih-Sheng; Tsai, Chia-Hao; Yeh, Shu-Tang; Peng, Yi-Hao; Chen, Kuang-Jung

2012-01-01

This work analyses the overall stress/strain characteristic of flexible encapsulations with organic light-emitting diode (OLED) devices. A robust methodology composed of a mechanical model of multi-thin film under bending loads and related stress simulations based on nonlinear finite element analysis (FEA) is proposed, and validated to be more reliable compared with related experimental data. With various geometrical combinations of cover plate, stacked thin films and plastic substrate, the position of the neutral axis (NA) plate, which is regarded as a key design parameter to minimize stress impact for the concerned OLED devices, is acquired using the present methodology. The results point out that both the thickness and mechanical properties of the cover plate help in determining the NA location. In addition, several concave and convex radii are applied to examine the reliable mechanical tolerance and to provide an insight into the estimated reliability of foldable OLED encapsulations. (paper)

Experimentally Manipulating Items Informs on the (Limited Construct and Criterion Validity of the Humor Styles Questionnaire

Directory of Open Access Journals (Sweden)

Willibald Ruch

2017-04-01

Full Text Available How strongly does humor (i.e., the construct-relevant content in the Humor Styles Questionnaire (HSQ; Martin et al., 2003 determine the responses to this measure (i.e., construct validity? Also, how much does humor influence the relationships of the four HSQ scales, namely affiliative, self-enhancing, aggressive, and self-defeating, with personality traits and subjective well-being (i.e., criterion validity? The present paper answers these two questions by experimentally manipulating the 32 items of the HSQ to only (or mostly contain humor (i.e., construct-relevant content or to substitute the humor content with non-humorous alternatives (i.e., only assessing construct-irrelevant context. Study 1 (N = 187 showed that the HSQ affiliative scale was mainly determined by humor, self-enhancing and aggressive were determined by both humor and non-humorous context, and self-defeating was primarily determined by the context. This suggests that humor is not the primary source of the variance in three of the HQS scales, thereby limiting their construct validity. Study 2 (N = 261 showed that the relationships of the HSQ scales to the Big Five personality traits and subjective well-being (positive affect, negative affect, and life satisfaction were consistently reduced (personality or vanished (subjective well-being when the non-humorous contexts in the HSQ items were controlled for. For the HSQ self-defeating scale, the pattern of relationships to personality was also altered, supporting an positive rather than a negative view of the humor in this humor style. The present findings thus call for a reevaluation of the role that humor plays in the HSQ (construct validity and in the relationships to personality and well-being (criterion validity.

Experimentally Manipulating Items Informs on the (Limited) Construct and Criterion Validity of the Humor Styles Questionnaire.

Science.gov (United States)

Ruch, Willibald; Heintz, Sonja

2017-01-01

How strongly does humor (i.e., the construct-relevant content) in the Humor Styles Questionnaire (HSQ; Martin et al., 2003) determine the responses to this measure (i.e., construct validity)? Also, how much does humor influence the relationships of the four HSQ scales, namely affiliative, self-enhancing, aggressive, and self-defeating, with personality traits and subjective well-being (i.e., criterion validity)? The present paper answers these two questions by experimentally manipulating the 32 items of the HSQ to only (or mostly) contain humor (i.e., construct-relevant content) or to substitute the humor content with non-humorous alternatives (i.e., only assessing construct-irrelevant context). Study 1 ( N = 187) showed that the HSQ affiliative scale was mainly determined by humor, self-enhancing and aggressive were determined by both humor and non-humorous context, and self-defeating was primarily determined by the context. This suggests that humor is not the primary source of the variance in three of the HQS scales, thereby limiting their construct validity. Study 2 ( N = 261) showed that the relationships of the HSQ scales to the Big Five personality traits and subjective well-being (positive affect, negative affect, and life satisfaction) were consistently reduced (personality) or vanished (subjective well-being) when the non-humorous contexts in the HSQ items were controlled for. For the HSQ self-defeating scale, the pattern of relationships to personality was also altered, supporting an positive rather than a negative view of the humor in this humor style. The present findings thus call for a reevaluation of the role that humor plays in the HSQ (construct validity) and in the relationships to personality and well-being (criterion validity).

Primers As Socializing Agents in American and Finnish Schools.

Science.gov (United States)

Hyona, Jukka; And Others

1995-01-01

Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

D. S. Lucas

2004-10-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

Experimental Equipment Validation for Methane (CH4) and Carbon Dioxide (CO2) Hydrates

Science.gov (United States)

Saad Khan, Muhammad; Yaqub, Sana; Manner, Naathiya; Ani Karthwathi, Nur; Qasim, Ali; Mellon, Nurhayati Binti; Lal, Bhajan

2018-04-01

Clathrate hydrates are eminent structures regard as a threat to the gas and oil industry in light of their irritating propensity to subsea pipelines. For natural gas transmission and processing, the formation of gas hydrate is one of the main flow assurance delinquent has led researchers toward conducting fresh and meticulous studies on various aspects of gas hydrates. This paper highlighted the thermodynamic analysis on pure CH4 and CO2 gas hydrates on the custom fabricated equipment (Sapphire cell hydrate reactor) for experimental validation. CO2 gas hydrate formed at lower pressure (41 bar) as compared to CH4 gas hydrate (70 bar) while comparison of thermodynamic properties between CH4 and CO2 also presented in this study. This preliminary study could provide pathways for the quest of potent hydrate inhibitors.

Experimental Validation of Surrogate Models for Predicting the Draping of Physical Interpolating Surfaces

DEFF Research Database (Denmark)

Christensen, Esben Toke; Lund, Erik; Lindgaard, Esben

2018-01-01

This paper concerns the experimental validation of two surrogate models through a benchmark study involving two different variable shape mould prototype systems. The surrogate models in question are different methods based on kriging and proper orthogonal decomposition (POD), which were developed...... to the performance of the studied surrogate models. By comparing surrogate model performance for the two variable shape mould systems, and through a numerical study involving simple finite element models, the underlying cause of this effect is explained. It is concluded that for a variable shape mould prototype...... hypercube approach. This sampling method allows for generating a space filling and high-quality sample plan that respects mechanical constraints of the variable shape mould systems. Through the benchmark study, it is found that mechanical freeplay in the modeled system is severely detrimental...

Elasto-dynamic analysis of a gear pump-Part III: Experimental validation procedure and model extension to helical gears

Science.gov (United States)

Mucchi, E.; Dalpiaz, G.

2015-01-01

This work concerns external gear pumps for automotive applications, which operate at high speed and low pressure. In previous works of the authors (Part I and II, [1,2]), a non-linear lumped-parameter kineto-elastodynamic model for the prediction of the dynamic behaviour of external gear pumps was presented. It takes into account the most important phenomena involved in the operation of this kind of machine. The two main sources of noise and vibration are considered: pressure pulsation and gear meshing. The model has been used in order to foresee the influence of working conditions and design modifications on vibration generation. The model's experimental validation is a difficult task. Thus, Part III proposes a novel methodology for the validation carried out by the comparison of simulations and experimental results concerning forces and moments: it deals with the external and inertial components acting on the gears, estimated by the model, and the reactions and inertial components on the pump casing and the test plate, obtained by measurements. The validation is carried out comparing the level of the time synchronous average in the time domain and the waterfall maps in the frequency domain, with particular attention to identify system resonances. The validation results are satisfactory globally, but discrepancies are still present. Moreover, the assessed model has been properly modified for the application to a new virtual pump prototype with helical gears in order to foresee gear accelerations and dynamic forces. Part IV is focused on improvements in the modelling and analysis of the phenomena bound to the pressure evolution around the gears in order to achieve results closer to the measured values. As a matter of fact, the simulation results have shown that a variable meshing stiffness has a notable contribution on the dynamic behaviour of the pump but this is not as important as the pressure phenomena. As a consequence, the original model was modified with the

Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

NARCIS (Netherlands)

RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

1990-01-01

We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

The corrosion mechanisms for primer coated 2219-T87 aluminum

Science.gov (United States)

Danford, Merlin D.; Knockemus, Ward W.

1987-01-01

To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

Science.gov (United States)

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Experimental validation of the TOPAS Monte Carlo system for passive scattering proton therapy

International Nuclear Information System (INIS)

Testa, M.; Schümann, J.; Lu, H.-M.; Paganetti, H.; Shin, J.; Faddegon, B.; Perl, J.

2013-01-01

Purpose: TOPAS (TOol for PArticle Simulation) is a particle simulation code recently developed with the specific aim of making Monte Carlo simulations user-friendly for research and clinical physicists in the particle therapy community. The authors present a thorough and extensive experimental validation of Monte Carlo simulations performed with TOPAS in a variety of setups relevant for proton therapy applications. The set of validation measurements performed in this work represents an overall end-to-end testing strategy recommended for all clinical centers planning to rely on TOPAS for quality assurance or patient dose calculation and, more generally, for all the institutions using passive-scattering proton therapy systems. Methods: The authors systematically compared TOPAS simulations with measurements that are performed routinely within the quality assurance (QA) program in our institution as well as experiments specifically designed for this validation study. First, the authors compared TOPAS simulations with measurements of depth-dose curves for spread-out Bragg peak (SOBP) fields. Second, absolute dosimetry simulations were benchmarked against measured machine output factors (OFs). Third, the authors simulated and measured 2D dose profiles and analyzed the differences in terms of field flatness and symmetry and usable field size. Fourth, the authors designed a simple experiment using a half-beam shifter to assess the effects of multiple Coulomb scattering, beam divergence, and inverse square attenuation on lateral and longitudinal dose profiles measured and simulated in a water phantom. Fifth, TOPAS’ capabilities to simulate time dependent beam delivery was benchmarked against dose rate functions (i.e., dose per unit time vs time) measured at different depths inside an SOBP field. Sixth, simulations of the charge deposited by protons fully stopping in two different types of multilayer Faraday cups (MLFCs) were compared with measurements to benchmark the

Effect of a metal primer on the bond strength of the resin-metal interface Efeito de um primer para metais sobre a força de união da interface metal-resina

Directory of Open Access Journals (Sweden)

Anderson Pinheiro de Freitas

2004-06-01

Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do

Primer: Fracture mechanics in the nuclear power industry

International Nuclear Information System (INIS)

Wessel, E.T.; Server, W.L.; Kennedy, E.L.

1990-01-01

This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

Optimization of instrumental neutron activation analysis method by means of 2k experimental design technique aiming the validation of analytical procedures

International Nuclear Information System (INIS)

Petroni, Robson; Moreira, Edson G.

2013-01-01

In this study optimization of procedures and standardization of Instrumental Neutron Activation Analysis (INAA) methods were carried out for the determination of the elements arsenic, chromium, cobalt, iron, rubidium, scandium, selenium and zinc in biological materials. The aim is to validate the analytical methods for future accreditation at the National Institute of Metrology, Quality and Technology (INMETRO). The 2 k experimental design was applied for evaluation of the individual contribution of selected variables of the analytical procedure in the final mass fraction result. Samples of Mussel Tissue Certified Reference Material and multi-element standards were analyzed considering the following variables: sample decay time, counting time and sample distance to detector. The standard multi-element concentration (comparator standard), mass of the sample and irradiation time were maintained constant in this procedure. By means of the statistical analysis and theoretical and experimental considerations it was determined the optimized experimental conditions for the analytical methods that will be adopted for the validation procedure of INAA methods in the Neutron Activation Analysis Laboratory (LAN) of the Research Reactor Center (CRPq) at the Nuclear and Energy Research Institute (IPEN - CNEN/SP). Optimized conditions were estimated based on the results of z-score tests, main effect and interaction effects. The results obtained with the different experimental configurations were evaluated for accuracy (precision and trueness) for each measurement. (author)

Colagem ortodôntica em esmalte com presença ou ausência de contaminação salivar: é necessário o uso de adesivo auto-condicionante ou de adesivo hidrofílico? Orthodontic bonding in dry and saliva contaminated enamel: is a self-etching primer or a moisture-insensitive primer necessary?

Directory of Open Access Journals (Sweden)

Cristiane Becher Rosa

2008-06-01

Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a

ENGINEERING DESIGN OPTIMIZATION OF HEEL TESTING EQUIPMENT IN THE EXPERIMENTAL VALIDATION OF SAFE WALKING

Directory of Open Access Journals (Sweden)

Cristiano Fragassa

2017-06-01

Full Text Available Experimental test methods for the evaluation of the resistance of heels of ladies' shoes in the case of impact loads are fully defined by International Organization for Standardization (ISO procedures that indicate all the conditions of experiment. A first Standard (ISO 19553 specifies the test method for determining the strength of the heels in the case of single impact. The result offers a valuation of the liability to fail under the sporadic heavy blows. A second Standard (ISO 19556 details a method for testing the capability of heels of women' shoes to survive to the repetition of small impacts provoked by normal walking. These Standards strictly define the features for two different testing devices (with specific materials, geometries, weights, etc. and all the experimental procedures to be followed during tests. On the contrary, this paper describes the technical solutions adopted to design one single experimental device able to perform impact testing of heels in both conditions. Joining the accuracy of mechanic movements with the speed of an electronic control system, a new and flexible equipment for the complete characterization of heels respect to (single or fatigue impacts was developed. Moreover a new level of performances in experimental validation of heel resistance was introduced by the versatility of the user-defined software control programs, able to encode every complex time-depending cycle of impact loads. Dynamic simulations permitted to investigate the impacts on heel in different conditions of testing, optimizing the machine design. The complexity of real stresses on shoes during an ordinary walk and in other common situations (as going up and downstairs was considered for a proper dimensioning.

Primer on molecular genetics. DOE Human Genome Program

Energy Technology Data Exchange (ETDEWEB)

1992-04-01

This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

Analysis of progressive distorsion. Validation of the method based on effective primary stress. Discussion of Anderson's experimental data

International Nuclear Information System (INIS)

Moulin, Didier.

1981-02-01

An empirical rule usable for design by analysis against progressive distorsion has been set up from experiments conducted in C.E.N. Saclay. This rule is checked with experimental data obtained by W.F. ANDERSON, this experiment is sufficiently different from the Saclay one to evaluate the merits of the rule. The satisfactory results achieved, are another validation of the efficiency diagram on which the method is based [fr

Validation of a buffet meal design in an experimental restaurant.

Science.gov (United States)

Allirot, Xavier; Saulais, Laure; Disse, Emmanuel; Roth, Hubert; Cazal, Camille; Laville, Martine

2012-06-01

We assessed the reproducibility of intakes and meal mechanics parameters (cumulative energy intake (CEI), number of bites, bite rate, mean energy content per bite) during a buffet meal designed in a natural setting, and their sensitivity to food deprivation. Fourteen men were invited to three lunch sessions in an experimental restaurant. Subjects ate their regular breakfast before sessions A and B. They skipped breakfast before session FAST. The same ad libitum buffet was offered each time. Energy intakes and meal mechanics were assessed by foods weighing and video recording. Intrasubject reproducibility was evaluated by determining intraclass correlation coefficients (ICC). Mixed-models were used to assess the effects of the sessions on CEI. We found a good reproducibility between A and B for total energy (ICC=0.82), carbohydrate (ICC=0.83), lipid (ICC=0.81) and protein intake (ICC=0.79) and for meal mechanics parameters. Total energy, lipid and carbohydrate intake were higher in FAST than in A and B. CEI were found sensitive to differences in hunger level while the other meal mechanics parameters were stable between sessions. In conclusion, a buffet meal in a normal eating environment is a valid tool for assessing the effects of interventions on intakes. Copyright © 2012 Elsevier Ltd. All rights reserved.

CFD simulation of a burner for syngas characterization and experimental validation

Energy Technology Data Exchange (ETDEWEB)

Fantozzi, Francesco; Desideri, Umberto [University of Perugia (Italy). Dept. of Industrial Engineering], Emails: fanto@unipg.it, umberto.desideri@unipg.it; D' Amico, Michele [University of Perugia (Italy). Dept. of Energetic Engineering], E-mail: damico@crbnet.it

2009-07-01

Biomass and waste are distributed and renewable energy sources that may contribute effectively to sustainability if used on a small and micro scale. This requires the transformation through efficient technologies (gasification, pyrolysis and anaerobic digestion) into a suitable gaseous fuel to use in small internal combustion engines and gas turbines. The characterization of biomass derived syngas during combustion is therefore a key issue to improve the performance of small scale integrated plants because synthesis gas show significant differences with respect to Natural Gas (mixture of gases, low calorific value, hydrogen content, tar and particulate content) that may turn into ignition problems, combustion instabilities, difficulties in emission control and fouling. To this aim a burner for syngas combustion and LHV measurement through mass and energy balance was realized and connected to the rotary-kiln laboratory scale pyrolyzer at the Department of Industrial Engineering of the University of Perugia. A computational fluid dynamics (CFD) simulation of the burner was carried out considering the combustion of propane to investigate temperature and pressure distribution, heat transmission and distribution of the combustion products and by products. The simulation was carried out using the CFD program Star-CD. Before the simulation a geometrical model of the burner was built and the volume of model was subdivided in cells. A sensibility analysis of cells was carried out to estimate the approximation degree of the model. Experimental data about combustion emission were carried out with the propane combustion in the burner, the comparison between numerical results and experimental data was studied to validate the simulation for future works involved with the combustion of treated or raw (syngas with tar) syngas obtained from pyrolysis process. (author)

An Experimentally Validated Numerical Modeling Technique for Perforated Plate Heat Exchangers.

Science.gov (United States)

White, M J; Nellis, G F; Kelin, S A; Zhu, W; Gianchandani, Y

2010-11-01

Cryogenic and high-temperature systems often require compact heat exchangers with a high resistance to axial conduction in order to control the heat transfer induced by axial temperature differences. One attractive design for such applications is a perforated plate heat exchanger that utilizes high conductivity perforated plates to provide the stream-to-stream heat transfer and low conductivity spacers to prevent axial conduction between the perforated plates. This paper presents a numerical model of a perforated plate heat exchanger that accounts for axial conduction, external parasitic heat loads, variable fluid and material properties, and conduction to and from the ends of the heat exchanger. The numerical model is validated by experimentally testing several perforated plate heat exchangers that are fabricated using microelectromechanical systems based manufacturing methods. This type of heat exchanger was investigated for potential use in a cryosurgical probe. One of these heat exchangers included perforated plates with integrated platinum resistance thermometers. These plates provided in situ measurements of the internal temperature distribution in addition to the temperature, pressure, and flow rate measured at the inlet and exit ports of the device. The platinum wires were deposited between the fluid passages on the perforated plate and are used to measure the temperature at the interface between the wall material and the flowing fluid. The experimental testing demonstrates the ability of the numerical model to accurately predict both the overall performance and the internal temperature distribution of perforated plate heat exchangers over a range of geometry and operating conditions. The parameters that were varied include the axial length, temperature range, mass flow rate, and working fluid.

Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

Science.gov (United States)

Leggat, Robert Benton, III

Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

Retrieval of Droplet size Density Distribution from Multiple field of view Cross polarized Lidar Signals: Theory and Experimental Validation

Science.gov (United States)

2016-06-02

Retrieval of droplet-size density distribution from multiple-field-of-view cross-polarized lidar signals: theory and experimental validation...Gilles Roy, Luc Bissonnette, Christian Bastille, and Gilles Vallee Multiple-field-of-view (MFOV) secondary-polarization lidar signals are used to...use secondary polarization. A mathematical relation among the PSD, the lidar fields of view, the scattering angles, and the angular depolarization

An experimentally validated model for geometrically nonlinear plucking-based frequency up-conversion in energy harvesting

Science.gov (United States)

Kathpalia, B.; Tan, D.; Stern, I.; Erturk, A.

2018-01-01

It is well known that plucking-based frequency up-conversion can enhance the power output in piezoelectric energy harvesting by enabling cyclic free vibration at the fundamental bending mode of the harvester even for very low excitation frequencies. In this work, we present a geometrically nonlinear plucking-based framework for frequency up-conversion in piezoelectric energy harvesting under quasistatic excitations associated with low-frequency stimuli such as walking and similar rigid body motions. Axial shortening of the plectrum is essential to enable plucking excitation, which requires a nonlinear framework relating the plectrum parameters (e.g. overlap length between the plectrum and harvester) to the overall electrical power output. Von Kármán-type geometrically nonlinear deformation of the flexible plectrum cantilever is employed to relate the overlap length between the flexible (nonlinear) plectrum and the stiff (linear) harvester to the transverse quasistatic tip displacement of the plectrum, and thereby the tip load on the linear harvester in each plucking cycle. By combining the nonlinear plectrum mechanics and linear harvester dynamics with two-way electromechanical coupling, the electrical power output is obtained directly in terms of the overlap length. Experimental case studies and validations are presented for various overlap lengths and a set of electrical load resistance values. Further analysis results are reported regarding the combined effects of plectrum thickness and overlap length on the plucking force and harvested power output. The experimentally validated nonlinear plectrum-linear harvester framework proposed herein can be employed to design and optimize frequency up-conversion by properly choosing the plectrum parameters (geometry, material, overlap length, etc) as well as the harvester parameters.

A Primer on Concepts and Applications of Proteomics in Neuroscience

DEFF Research Database (Denmark)

Hosp, Fabian; Mann, Matthias

2017-01-01

The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.

Science.gov (United States)

Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K

1996-07-01

To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.

Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

Science.gov (United States)

2018-01-18

This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

Experimental Validation of the Electrokinetic Theory and Development of Seismoelectric Interferometry by Cross-Correlation

Directory of Open Access Journals (Sweden)

F. C. Schoemaker

2012-01-01

Full Text Available We experimentally validate a relatively recent electrokinetic formulation of the streaming potential (SP coefficient as developed by Pride (1994. The start of our investigation focuses on the streaming potential coefficient, which gives rise to the coupling of mechanical and electromagnetic fields. It is found that the theoretical amplitude values of this dynamic SP coefficient are in good agreement with the normalized experimental results over a wide frequency range, assuming no frequency dependence of the bulk conductivity. By adopting the full set of electrokinetic equations, a full-waveform wave propagation model is formulated. We compare the model predictions, neglecting the interface response and modeling only the coseismic fields, with laboratory measurements of a seismic wave of frequency 500 kHz that generates electromagnetic signals. Agreement is observed between measurement and electrokinetic theory regarding the coseismic electric field. The governing equations are subsequently adopted to study the applicability of seismoelectric interferometry. It is shown that seismic sources at a single boundary location are sufficient to retrieve the 1D seismoelectric responses, both for the coseismic and interface components, in a layered model.

Experimental and Numerical Investigations on Feasibility and Validity of Prismatic Rock Specimen in SHPB

Directory of Open Access Journals (Sweden)

Xibing Li

2016-01-01

Full Text Available The paper presents experimental and numerical studies on the feasibility and validity of using prismatic rock specimens in split Hopkinson pressure bar (SHPB test. Firstly, the experimental tests are conducted to evaluate the stress and strain uniformity in the prismatic specimens during impact loading. The stress analysis at the ends of the specimen shows that stress equilibrium can be achieved after about three wave reflections in the specimen, and the balance can be well maintained for a certain time after peak stress. The strain analysis reveals that the prismatic specimen deforms uniformly during the dynamic loading period. Secondly, numerical simulation is performed to further verify the stress and strain uniformity in the prismatic specimen in SHPB test. It indicates that the stress equilibrium can be achieved in prismatic specimen despite a certain degree of stress concentration at the corners. The comparative experiments demonstrate that the change of specimen shape has no significant effect on dynamic responses and failure patterns of the specimen. Finally, a dynamic crack propagation test is presented to show the application of the present work in studying fracturing mechanisms under dynamic loading.

Experimental Validation of Flow Force Models for Fast Switching Valves

DEFF Research Database (Denmark)

Bender, Niels Christian; Pedersen, Henrik Clemmensen; Nørgård, Christian

2017-01-01

This paper comprises a detailed study of the forces acting on a Fast Switching Valve (FSV) plunger. The objective is to investigate to what extend different models are valid to be used for design purposes. These models depend on the geometry of the moving plunger and the properties of the surroun......This paper comprises a detailed study of the forces acting on a Fast Switching Valve (FSV) plunger. The objective is to investigate to what extend different models are valid to be used for design purposes. These models depend on the geometry of the moving plunger and the properties...... to compare and validate different models, where an effort is directed towards capturing the fluid squeeze effect just before material on material contact. The test data is compared with simulation data relying solely on analytic formulations. The general dynamics of the plunger is validated...

Note: Primer Amysat 001; Fragment size is 211bp

Indian Academy of Sciences (India)

Renuka

Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

DEFF Research Database (Denmark)

Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

2014-01-01

Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

Directory of Open Access Journals (Sweden)

S Hamid Raji

2011-01-01

Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

On-line experimental validation of a model-based diagnostic algorithm dedicated to a solid oxide fuel cell system

Science.gov (United States)

Polverino, Pierpaolo; Esposito, Angelo; Pianese, Cesare; Ludwig, Bastian; Iwanschitz, Boris; Mai, Andreas

2016-02-01

In the current energetic scenario, Solid Oxide Fuel Cells (SOFCs) exhibit appealing features which make them suitable for environmental-friendly power production, especially for stationary applications. An example is represented by micro-combined heat and power (μ-CHP) generation units based on SOFC stacks, which are able to produce electric and thermal power with high efficiency and low pollutant and greenhouse gases emissions. However, the main limitations to their diffusion into the mass market consist in high maintenance and production costs and short lifetime. To improve these aspects, the current research activity focuses on the development of robust and generalizable diagnostic techniques, aimed at detecting and isolating faults within the entire system (i.e. SOFC stack and balance of plant). Coupled with appropriate recovery strategies, diagnosis can prevent undesired system shutdowns during faulty conditions, with consequent lifetime increase and maintenance costs reduction. This paper deals with the on-line experimental validation of a model-based diagnostic algorithm applied to a pre-commercial SOFC system. The proposed algorithm exploits a Fault Signature Matrix based on a Fault Tree Analysis and improved through fault simulations. The algorithm is characterized on the considered system and it is validated by means of experimental induction of faulty states in controlled conditions.

Experimental validation of a kinetic multi-component mechanism in a wide HCCI engine operating range for mixtures of n-heptane, iso-octane and toluene: Influence of EGR parameters

International Nuclear Information System (INIS)

Machrafi, Hatim

2008-01-01

The parameters that are present in exhaust gas recirculation (EGR) are believed to provide an important contribution to control the auto-ignition process of the homogeneous charge compression ignition (HCCI) in an engine. For the investigation of the behaviour of the auto-ignition process, a kinetic multi-component mechanism has been developed in former work, containing 62 reactions and 49 species for mixtures of n-heptane, iso-octane and toluene. This paper presents an experimental validation of this mechanism, comparing the calculated pressure, heat release, ignition delays and CO 2 emissions with experimental data performed on a HCCI engine. The validation is performed in a broad range of EGR parameters by varying the dilution by N 2 and CO 2 from 0 to 46 vol.%, changing the EGR temperature from 30 to 120 deg. C, altering the addition of CO and NO from 0 to 170 ppmv and varying the addition of CH 2 O from 0 to 1400 ppmv. These validations were performed respecting the HCCI conditions for the inlet temperature and the equivalence ratio. The results showed that the mechanism is validated experimentally in dilution ranges going up to 21-30 vol.%, depending on the species of dilution and over the whole range of the EGR temperature. The mechanism is validated over the whole range of CO and CH 2 O addition. As for the addition of NO, the mechanism is validated quantitatively up to 50 ppmv and qualitatively up to 170 ppmv

An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

Science.gov (United States)

Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

2013-01-01

Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

Development, Implementation and Experimental Validations of Activation Products Models for Water Pool Reactors

International Nuclear Information System (INIS)

Petriw, S.N.

2001-01-01

Some parameters were obtained both calculations and experiments in order to determined the source of the meaning activation products in water pool reactors. In this case, the study was done in RA-6 reactor (Centro Atomico Bariloche - Argentina).In normal operation, neutron flux on core activates aluminium plates.The activity on coolant water came from its impurities activation and meanly from some quantity of aluminium that, once activated, leave the cladding and is transported by water cooling system.This quantity depends of the 'recoil range' of each activation reaction.The 'staying time' on pool (the time that nuclides are circulating on the reactor pool) is another characteristic parameter of the system.Stationary state activity of some nuclides depends of this time.Also, several theoretical models of activation on coolant water system are showed, and their experimental validations

EFEKTIVITAS PEMBERIAN TERAPI MUSIK (MOZART DAN BACK EXERCISE TERHADAP PENURUNAN NYERI DYSMENORRHEA PRIMER

Directory of Open Access Journals (Sweden)

reni heryani

2017-12-01

Full Text Available Dysmenorrhea / nyeri haid adalah nyeri menjelang atau selama haid, yang kadang menyebabkan gangguan aktivitas dan memerlukan istirahat. Nyeri menstruasi atau dysmenorrhea adalah kekakuan atau kejang di bagian bawah perut akibat menstruasi dan produksi zat prostaglandin yang terjadi pada waktu menjelang atau selama menstruasi Dismenorea primer didefinisikan sebagai nyeri haid yang tidak berhubungan dengan kondisi patologis pelvis. Nyeri yang biasanya dirasakan adalah kram yang timbul-hilang atau nyeri yang terus menerus biasanya pada perut bagian bawah yang menjalar sampai ke punggung bagian bawah. Salah satu exercise yang dapat diberikan untuk nyeri dysmenorrhea  ini adalah dengan pemberian terapi musik dan back exercise.Tujuan penelitian ini adalah untuk mengetahui efektivitas pemberian terapi musik dan back exercise terhadap penurunan nyeri dysmenorrhea. Penelitian ini merupakan penelitian Quasi experimental pre and post test with control group design. Populasi pada penelitian ini adalah remaja putri yang sedang mengalami  menstruasi dengan  nyeri dysmenorrhea dengan jumlah responden sebanyak 50 orang yang dibagi menjadi 2 kelompok. Kelompok 1 sebagai kelompok eksperimen, diberikan perlakukan terapi musik (mozart dan back exercise  dan kelompok 2 sebagai kelompok kontrol yang tidak diberikan terapi musik (mozart dan back exercise. Pada penelitian ini menggunakan uji hipotesis Paired Sample T- test untuk mengetahui pengaruh pemberian terapi musik dan back exercice terhadap dysmenorrhea primer. Kemudian untuk uji beda pengaruh antara kelompok kontrol dan kelompok perlakuan digunakan uji Independent Sample T-test.Tingkat nyeri dismenorhoea sebelum diberikan perlakuan adalah nyeri tingkat sedang (rata-rata : 2,08 dan setelah diberikan perlakuan adalah adalah nyeri tingkat ringan (rata rata = 0,88. Uji efektifitas menggunakan Paired Sample T-Test pada kelompok eksperimen menunjukkan hasil p= 0,00 dan pada kelompok kontrol p= 0,00. Dengan

Development of a microsatellite primer set to investigate the genetic ...

Indian Academy of Sciences (India)

Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

Development of specific primers for genus Fusarium and F. solani ...

African Journals Online (AJOL)

Yomi

2012-01-05

Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

CPV cells cooling system based on submerged jet impingement: CFD modeling and experimental validation

Science.gov (United States)

Montorfano, Davide; Gaetano, Antonio; Barbato, Maurizio C.; Ambrosetti, Gianluca; Pedretti, Andrea

2014-09-01

Concentrating photovoltaic (CPV) cells offer higher efficiencies with regard to the PV ones and allow to strongly reduce the overall solar cell area. However, to operate correctly and exploit their advantages, their temperature has to be kept low and as uniform as possible and the cooling circuit pressure drops need to be limited. In this work an impingement water jet cooling system specifically designed for an industrial HCPV receiver is studied. Through the literature and by means of accurate computational fluid dynamics (CFD) simulations, the nozzle to plate distance, the number of jets and the nozzle pitch, i.e. the distance between adjacent jets, were optimized. Afterwards, extensive experimental tests were performed to validate pressure drops and cooling power simulation results.

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

Science.gov (United States)

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

A Validation Approach for Quasistatic Numerical/Experimental Indentation Analysis in Soft Materials Using 3D Digital Image Correlation.

Science.gov (United States)

Felipe-Sesé, Luis; López-Alba, Elías; Hannemann, Benedikt; Schmeer, Sebastian; Diaz, Francisco A

2017-06-28

A quasistatic indentation numerical analysis in a round section specimen made of soft material has been performed and validated with a full field experimental technique, i.e., Digital Image Correlation 3D. The contact experiment specifically consisted of loading a 25 mm diameter rubber cylinder of up to a 5 mm indentation and then unloading. Experimental strains fields measured at the surface of the specimen during the experiment were compared with those obtained by performing two numerical analyses employing two different hyperplastic material models. The comparison was performed using an Image Decomposition new methodology that makes a direct comparison of full-field data independently of their scale or orientation possible. Numerical results show a good level of agreement with those measured during the experiments. However, since image decomposition allows for the differences to be quantified, it was observed that one of the adopted material models reproduces lower differences compared to experimental results.

Sealing properties of a self-etching primer system to normal caries-affected and caries-infected dentin.

Science.gov (United States)

Lee, Kwang-Won; Son, H-H; Yoshiyama, Masatoshi; Tay, Franklin R; Carvalho, Ricardo M; Pashley, David H

2003-09-01

To compare the ability of an experimental antibacterial self-etching primer adhesive system to seal exposure sites in normal, caries-affected and caries-infected human dentin. 30 extracted human third molars were used within 1 month of extraction. 10 intact normal teeth comprised the normal group. 20 teeth with occlusal caries that radiographically extended halfway to the pulp were excavated using caries-detector solution (CDS) and a #4 round carbide bur in a slowspeed handpiece. Half of those teeth were fully excavated free of CDS-stained material without exposing the pulp, and were designated as the caries-affected dentin group. The remaining 10 teeth were excavated as close to the pulp as possible without obtaining an exposure, but whose dentin continued to stain red with CDS; this group was designated as the caries-infected dentin group. The remaining dentin thickness in all of the specimens in the other two groups was then reduced to the same extent as the caries-infected group. Direct exposures of the pulp chamber were made with a 1/4 round bur in the normal dentin or a 25 gauge needle in the other two groups. After measuring the fluid flow through the exposure, the sites were then sealed with an experimental antibacterial fluoride-containing self-etching primer adhesive systems (ABF). Fluid conductance was remeasured every week for 16 weeks. The fluid conductance through the exposure fell 99% in all groups following resin sealing. The seals of normal and caries-affected dentin remained relatively stable over the 16 weeks, while the seals of caries-infected dentin gradually deteriorated, reaching significance at 8 weeks. TEM examination revealed very thin (ca. 0.5 mm) hybrid layers in normal dentin, 3-4 microm thick hybrid layers in caries-affected dentin and 40 microm thick hybrid layers in caries-infected dentin. The tubules of caries-infected dentin were enlarged and filled with bacteria. Resin tags passed around these bacteria in the top 20-40 microm

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

Science.gov (United States)

Glennon, Kelsey L.; Cron, Glynis V.

2016-01-01

Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

FACTORES AMBIENTALES Y GENÉTICOS QUE INFLUYEN SOBRE LA EDAD AL PRIMER PARTO EN HEMBRAS DE LA RAZA ROMOSINUANO