Regulation of p53 tetramerization and nuclear export by ARC.
Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N
2007-12-26
Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great
Evaluation of nuclear unrest and p53 immunostaining in Wilms' tumor.
Salama, Asmaa; Kamel, Ahmad
2011-03-01
Nuclear unrest is a term applied to Wilms' tumors (WT) that show nuclear abnormalities close to anaplasia but without abnormal mitoses. p53 is claimed to be associated with anaplasia and poor prognosis. This study was undertaken to evaluate the clinical significance of nuclear unrest and p53 immunostaining in Wilms' tumor. This is a retrospective study of 63 patients who presented at NCI with Wilms' tumors, and underwent preoperative chemotherapy followed by nephrectomy. Histopathologic assessment and p53 immunohistochemistry were done. WT with nuclear unrest grade III closely resembled anaplastic tumors and both of them (group 1) constituted 19% of cases. Group 1 constituted 29% of cases showing blastema dominant morphology compared to 9.4% of cases without blastema dominant morphology with significant statistical difference (p=0.047). Almost 83% of cases that achieved 1st complete remission were stages I, II and III, while 17% were stages IV and V with significant statistical difference (p<0.001). Stage affected the 3-year relapse-free-survival (RFS) significantly (p=0.014) as it was more in stages I, II and III than in stages IV and V (75.4% versus 50%). Blastema dominant morphology and high risk state significantly lowered the 3-year overall survival (OS) into 54.8% in comparison to 80.9% for cases with non-blastema dominant morphology (p=0.042). Regarding p53 immunohistochemistry, group 1 tumors showed positive p53 more than group 2 with significant statistical difference (p=0.014). p53 Positive immunostaining was significantly associated with high risk nephroblastoma (p=0.004). Tumor stage and blastema dominant morphology are potent prognostic factors. p53 is linked to blastema dominant morphology. WT with nuclear unrest grade III closely resembles anaplastic WT. It may be appropriate to group tumors with nuclear unrest grade III with anaplastic histology regarding treatment stratification. Copyright © 2011. Published by Elsevier B.V.
Evaluation of nuclear unrest and p53 immunostaining in Wilms' tumor
International Nuclear Information System (INIS)
Salama, A.; Kamel, A.
2011-01-01
Nuclear unrest is a term applied to Wilms' tumors (WT) that show nuclear abnormalities close to anaplasia but without abnormal mitoses. p53 is claimed to be associated with anaplasia and poor prognosis. This study was undertaken to evaluate the clinical significance of nuclear unrest and p53 immunostaining in Wilms' tumor. Material and methods: This is a retrospective study of 63 patients who presented at NCI with Wilms' tumors, and underwent preoperative chemotherapy followed by nephrectomy. Histopathologic assessment and p53 immunohistochemistry were done. Results: WT with nuclear unrest grade III closely resembled anaplastic tumors and both of them (group 1) constituted 19% of cases. Group 1 constituted 29% of cases showing blastema dominant morphology compared to 9.4% of cases without blastema dominant morphology with significant statistical difference (p = 0.047). Almost 83% of cases that achieved 1st complete remission were stages I, II and III, while 17% were stages IV and V with significant statistical difference (p < 0.001). Stage affected the 3-year relapse-free-survival (RFS) significantly (p = 0.014) as it was more in stages I, II and III than in stages IV and V (75.4% versus 50%). Blastema dominant morphology and high risk state significantly lowered the 3-year overall survival (OS) into 54.8% in comparison to 80.9% for cases with non-blastema dominant morphology (p = 0.042). Regarding p53 immunohistochemistry, group 1 tumors showed positive p53 more than group 2 with significant statistical difference (p = 0.014). p53 Positive immunostaining was significantly associated with high risk nephroblastoma (p = 0.004). Conclusion: Tumor stage and blastema dominant morphology are potent prognostic factors. p53 is linked to blastema dominant morphology. WT with nuclear unrest grade III closely resembles anaplastic WT. It may be appropriate to group tumors with nuclear unrest grade III with anaplastic histology regarding treatment stratification
Directory of Open Access Journals (Sweden)
Jeyran eShahbazi
2013-05-01
Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Sajeevan, Thara Purath; Saraswathi, Tillai Rajasekaran; Ranganathan, Kannan; Joshua, Elizabeth; Rao, Uma Devi K
2014-07-01
p53 protein is a product of p53 gene, which is now classified as a tumor suppressor gene. The gene is a frequent target for mutation, being seen as a common step in the pathogenesis of many human cancers. Proliferating cell nuclear antigen (PCNA) is an auxiliary protein of DNA polymerase delta and plays a critical role in initiation of cell proliferation. The aim of this study is to assess and compare the expression of p53 and PCNA in lining epithelium of odontogenic keratocyst (OKC) and periapical cyst (PA). A total of 20 cases comprising 10 OKC and 10 PA were included in retrospective study. Three paraffin section of 4 μm were cut, one was used for routine hematoxylin and eosin stain, while the other two were used for immunohistochemistry. Statistical analysis was performed using Chi-square test. The level of staining and intensity were assessed in all these cases. OKC showed PCNA expression in all cases (100%), whereas in perapical cyst only 60% of cases exhibited PCNA staining. (1) OKC showed p53 expression in 6 cases (60%) whereas in PA only 10% of the cases exhibited p53 staining. Chi-square test showed PCNA staining intensity was more significant than p53 in OKC. (2) The staining intensity of PA using p53, PCNA revealed that PCNA stating intensity was more significant than p53. OKC shows significant proliferative activity than PA using PCNA and p53. PCNA staining was more intense when compared with p53 in both OKC and PA.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage
Directory of Open Access Journals (Sweden)
Rolletschek Alexandra
2009-06-01
Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53
International Nuclear Information System (INIS)
O'Hagan, Heather M.; Ljungman, Mats
2004-01-01
It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation
Directory of Open Access Journals (Sweden)
Thara Purath Sajeevan
2014-01-01
Full Text Available Introduction: p53 protein is a product of p53 gene, which is now classified as a tumor suppressor gene. The gene is a frequent target for mutation, being seen as a common step in the pathogenesis of many human cancers. Proliferating cell nuclear antigen (PCNA is an auxiliary protein of DNA polymerase delta and plays a critical role in initiation of cell proliferation. Aim: The aim of this study is to assess and compare the expression of p53 and PCNA in lining epithelium of odontogenic keratocyst (OKC and periapical cyst (PA. Materials and Methods: A total of 20 cases comprising 10 OKC and 10 PA were included in retrospective study. Three paraffin section of 4 μm were cut, one was used for routine hematoxylin and eosin stain, while the other two were used for immunohistochemistry. Statistical analysis was performed using Chi-square test. Results: The level of staining and intensity were assessed in all these cases. OKC showed PCNA expression in all cases (100%, whereas in perapical cyst only 60% of cases exhibited PCNA staining. (1 OKC showed p53 expression in 6 cases (60% whereas in PA only 10% of the cases exhibited p53 staining. Chi-square test showed PCNA staining intensity was more significant than p53 in OKC. (2 The staining intensity of PA using p53, PCNA revealed that PCNA stating intensity was more significant than p53. Conclusion: OKC shows significant proliferative activity than PA using PCNA and p53. PCNA staining was more intense when compared with p53 in both OKC and PA.
Nuclear localization signal of ING4 plays a key role in its binding to p53
International Nuclear Information System (INIS)
Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang
2005-01-01
ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53
Energy Technology Data Exchange (ETDEWEB)
Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila; Hayman, Ian; Brown, Celeste J.; Fortunato, Elizabeth A., E-mail: lfort@uidaho.edu
2016-10-15
Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, with a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.
Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.
Directory of Open Access Journals (Sweden)
Monica M Horvath
2007-07-01
Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This
Expression of p53 in oligodendrogliomas
J.M. Kros (Johan); J.J.C.J. Godschalk (J. J C J); K.K. Krishnadath (Kausilia); C.G. van Eden (C.)
1993-01-01
textabstractThe expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and
Expression of p53 in oligodendrogliomas
Kros, J. M.; Godschalk, J. J.; Krishnadath, K. K.; van Eden, C. G.
1993-01-01
The expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and survival.
Epstein-Barr virus nuclear antigen 3C stabilizes Gemin3 to block p53-mediated apoptosis.
Directory of Open Access Journals (Sweden)
Qiliang Cai
2011-12-01
Full Text Available The Epstein-Barr nuclear antigen 3C (EBNA3C, one of the essential latent antigens for Epstein-Barr virus (EBV-induced immortalization of primary human B lymphocytes in vitro, has been implicated in regulating cell proliferation and anti-apoptosis via interaction with several cellular and viral factors. Gemin3 (also named DDX20 or DP103 is a member of DEAD RNA helicase family which exhibits diverse cellular functions including DNA transcription, recombination and repair, and RNA metabolism. Gemin3 was initially identified as a binding partner to EBNA2 and EBNA3C. However, the mechanism by which EBNA3C regulates Gemin3 function remains unclear. Here, we report that EBNA3C directly interacts with Gemin3 through its C-terminal domains. This interaction results in increased stability of Gemin3 and its accumulation in both B lymphoma cells and EBV transformed lymphoblastoid cell lines (LCLs. Moreover, EBNA3C promotes formation of a complex with p53 and Gemin3 which blocks the DNA-binding affinity of p53. Small hairpin RNA based knockdown of Gemin3 in B lymphoma or LCL cells remarkably attenuates the ability of EBNA3C to inhibit the transcription activity of p53 on its downstream genes p21 and Bax, as well as apoptosis. These findings provide the first evidence that Gemin3 may be a common target of oncogenic viruses for driving cell proliferation and anti-apoptotic activities.
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
p53 downregulates the Fanconi anaemia DNA repair pathway.
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-04-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.
Regulation of autophagy by cytoplasmic p53.
Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2008-06-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.
Human NTH1 physically interacts with p53 and proliferating cell nuclear antigen
International Nuclear Information System (INIS)
Oyama, Masaki; Wakasugi, Mitsuo; Hama, Takashi; Hashidume, Hatsuho; Iwakami, Yasutaka; Imai, Rika; Hoshino, Sanae; Morioka, Hiroshi; Ishigaki, Yasuhito; Nikaido, Osamu; Matsunaga, Tsukasa
2004-01-01
Thymine glycol (Tg) is one of predominant oxidative DNA lesions caused by ionizing radiation and other oxidative stresses. Human NTH1 is a bifunctional enzyme with DNA glycosylase and AP lyase activities and removes Tg as the first step of base excision repair (BER). We have searched for the factors interacting with NTH1 by using a pull-down assay and found that GST-NTH1 fusion protein precipitates proliferating cell nuclear antigen (PCNA) and p53 as well as XPG from human cell-free extracts. GST-NTH1 also bound to recombinant FLAG-tagged XPG, PCNA, and (His) 6 -tagged p53 proteins, indicating direct protein-protein interaction between those proteins. Furthermore, His-p53 and FLAG-XPG, but not PCNA, stimulated the Tg DNA glycosylase/AP lyase activity of GST-NTH1 or NTH1. These results provide an insight into the positive regulation of BER reaction and also suggest a possible linkage between BER of Tg and other cellular mechanisms
An N-terminal Region of Mot-2 Binds to p53 In Vitro
Directory of Open Access Journals (Sweden)
Sunil C. Kaul
2001-01-01
Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.
Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.
Directory of Open Access Journals (Sweden)
Simon Leuchs
Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.
Directory of Open Access Journals (Sweden)
Katrin Friedrich
1997-01-01
Full Text Available The study was aimed to detect differences in nuclear morphology between nuclear populations as well as between tumours with different p53 expression in breast cancers with different clinicopathological features, which also reflect the stage of tumour progression. The p53 immunohistochemistry was performed on paraffin sections from 88 tumour samples. After the cells had been localised by means of an image cytometry workstation and their immunostaining had been categorised visually, the sections were destained and stained by the Feulgen protocol. The nuclei were relocated and measured cytometrically by the workstation.
Directory of Open Access Journals (Sweden)
Youfeng Shen
2017-11-01
Full Text Available Abstract Background Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Methods Transcription activator-like effector nucleases (TALENs were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. Results The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19 were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean
Buglioni, S; D'Agnano, I; Vasselli, S; Perrone Donnorso, R; D'Angelo, C; Brenna, A; Benevolo, M; Cosimelli, M; Zupi, G; Mottolese, M
2001-09-01
To identify the prognostically highest risk patients, DNA content and p53 nuclear or cytoplasmic accumulation, evaluated by monoclonal antibody DO7 and polyclonal antibody CM1, were determined in 94 surgically resected stage II (Dukes B2) colorectal cancers, treated or not with adjuvant 5-fluorouracil-based chemotherapy. Sixty-one (65%) of the tumors were aneuploid, 16 (17%) of which had a multiploid DNA content; 50 (53%) displayed DO7 nuclear p53 accumulation, and 44 (47%) showed cytoplasmic CM1 positivity. In multivariate analysis, only multiploidy and p53 nuclear positivity emerged as independent prognostic indicators of a poorer outcome. Positivity for p53 was associated with shorter survival in 5-fluorouracil-treated and untreated patients. Therefore, in patients with Dukes B2 colorectal cancer, a biologic profile based on the combined evaluation of DNA multiploidy and p53 status can provide valuable prognostic information, identifying patients to be enrolled in alternative, more aggressive therapeutic trials.
Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L
2018-05-31
The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53.
Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei
2013-07-01
Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.
Comparison of p53 levels in lymphocytes and in blood plasma of nuclear power plant workers
International Nuclear Information System (INIS)
Roessner, Pavel; Chvatalova, Irena; Schmuczerova, Jana; Milcova, Alena; Roessner, Pavel; Sram, Radim J.
2004-01-01
p53 levels were assessed in lymphocytes and in blood plasma of workers from two Czech nuclear power plants (NPP): 114 subjects working in Temelin and 108 subjects working in Dukovany. Ionizing radiation (IR) exposure data were available for 64 and 59 subjects working in the monitored zones from the NPP in Temelin and Dukovany, respectively. The short-term doses of IR for these subjects were 0.01 and 0.12 mSv, and the long-term doses were 0.46 and 5.68 mSv, in the Temelin and Dukovany NPP, respectively. As a control group, 46 subjects living in Ceske Budejovice, a city nearby the Temelin NPP, were analyzed. The concentration of p53 in lymphocytes was significantly higher in workers from the monitored zone in the Dukovany NPP (median value 6.4 pg/μg protein, P < 0.001) than in workers from the Temelin NPP (3.2 pg/μg) as well as in the control group (3.5 pg/μg). In contrast, plasma levels of p53 were comparable in the control group (median value 116 pg/ml plasma) and workers from the monitored zone of Dukovany NPP (102 pg/ml), but lower in workers from Temelin NPP (5 pg/ml). Other factors affecting p53 levels were studied. Smoking resulted in increased p53 lymphocyte levels. The effect of polymorphisms in metabolic and DNA repair genes on p53 levels was analyzed. The correlation was found between p53 levels in lymphocytes and p53 codon 72 polymorphism in subjects working in NPPs, but not in the control group. The results of measurement p53 levels in lymphocytes suggest that this biomarker could reflect the short-term as well as long-term effects of low doses IR. Its impact on human health should be further explored
OTUD5 regulates p53 stability by deubiquitinating p53.
Directory of Open Access Journals (Sweden)
Judong Luo
Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.
Around and beyond 53BP1 Nuclear Bodies.
Fernandez-Vidal, Anne; Vignard, Julien; Mirey, Gladys
2017-12-05
Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction.
Around and beyond 53BP1 Nuclear Bodies
Directory of Open Access Journals (Sweden)
Anne Fernandez-Vidal
2017-12-01
Full Text Available Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1, a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction.
The expression of p53 protein in patients with multiple myeloma
Directory of Open Access Journals (Sweden)
Marković Olivera
2007-01-01
Full Text Available Introduction: Although mutations of p53 are one of the most often acquired genetic changes in malignant tumors, these mutations are rare events in patients with newly diagnosed multiple myeloma (MM. Moreover, there are a few literature data about clinical significance of p53 overexpression in multiple myeloma. Objective The aim of our study was to evaluate the clinical significance of p53 immunoexpression in multiple myeloma. Method A total of 58 patients with newly diagnosed MM (26 females and 32 males, mean age 62 years were enrolled in the study. The diagnosis of MM was made according to criteria of Chronic Leukemia-Myeloma Task Force. Clinical staging was done according to Durie and Salmon classification (4 patients had disease stage I, 15 patients stage II and 39 patients stage III. The histological grade and histological stage were determined according to predominant plasma cell morphology and volume of myeloma infiltration, respectively. Standard immunohistochemical analysis with p53 antibody in B5-fixed and paraffin- embedded bone marrow specimens was used to evaluate the expression of p53 in myeloma cells. The specimens were considered positive when ≥5% of plasma cells exhibited clear nuclear positivity. Results Out of 58 patients, p53 expression was detected in 9 (15.52%. No significant correlation was found between p53 expression and clinical stage (I+II vs. III, Я2-microglobulin level (≤6 mg/L vs. >6mg/L, histological grade (I vs. II+III, histological stage (<20% vs. 21-50% vs. >50% and the extent of osteolytic lesions (≤3 vs. >3 lesions. Median survival of patients with p53 immunoreactivity in =>5% of plasma cells was 10 months, whilst median survival of patients with p53 immunoreactivity in <5% of plasma cells was 36 months. However, such difference was not significant (p=0.2. Conclusion The frequency of p53 immunoexpression in our group of newly diagnosed MM was relatively low. Although p53 immunoexpression was not
The Transcriptional Landscape of p53 Signalling Pathway
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2017-06-01
Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.
Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes
Simeonova, I.; Jaber, S.; Draskovic, I.; Bardot, B.; Fang, M.; Bouarich-Bourimi, R.; Lejour, V.; Charbonnier, L.; Soudais, C.; Bourdon, J.C.; Huerre, M.; Londono-Vallejo, A.; Toledo, F.
2013-01-01
Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53(Delta31), a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis,
International Nuclear Information System (INIS)
Zhuang Yiping; Shen Zongli; Zhang Jin; Kang Zheng; Zhu Yueqing; Feng Yong; Shen Wenrong; Wang Yaping
2004-01-01
Objective: To evaluate relations between lung cancer and the expressions of P53 protein together with proliferating cell nuclear antigen (PCNA) in specimens of lung lesions by needle biopsy. Methods: CT-guidance percutaneous biopsy of lung lesions were performed in 66 patients with the determination of expressions of p53 protein and PCNA by flow cytometer (FCM). Results: 1. The sensitivity of CT-guidance percutaneous biopsy was 94.3% in 53 cases of lung cancer with the diagnostic accuracy of 90.9% totally. The complication rate of pneumothorax was 4.6%. 2. The expression of P53 protein was (29.9 ± 2.7)% in lung cancer (53 cases), while (17.9 ± 2.8)% in benign lesions (13 cases) (t=2.0, P 2 =6.10, P 2 =9.71, P 0.05). Conclusions: FCM plays and valuable role in determining the expression of P53 protein and PCNA in the specimen of lung cancer by CT-guided percutaneous biopsy. The expression of p53 and PCNA may be useful in the diagnosis of lung cancer by providing the relation between imaging of lung cancer and the molecular mechanism, and furthermore revealing the characteristics of molecular biology of lung cancer at protein level. (authors)
Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.
Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald
2017-06-01
p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.
Mutant p53 protein localized in the cytoplasm inhibits autophagy.
Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido
2008-10-01
The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.
Stress-specific response of the p53-Mdm2 feedback loop
Directory of Open Access Journals (Sweden)
Jensen Mogens H
2010-07-01
Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.
Expression of Androgen Receptor Is Negatively Regulated By p53
Directory of Open Access Journals (Sweden)
Fatouma Alimirah
2007-12-01
Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.
40 Years of Research Put p53 in Translation
Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques
2018-01-01
Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.
Alterations in the K-ras and p53 genes in rat lung tumors
Energy Technology Data Exchange (ETDEWEB)
Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others
1997-06-01
Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma
International Nuclear Information System (INIS)
Frey, L. M.; Houben, R.; Brocker, E. B.
2011-01-01
Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.
2003-01-01
Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy
International Nuclear Information System (INIS)
Deocaris, Custer C.
2004-01-01
Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death
The role of p53 in the response to mitotic spindle damage
International Nuclear Information System (INIS)
Meek, D.W.
2000-01-01
The p53 tumour suppressor protein has defined roles in G1/S and G2/M cell cycle checkpoint in response to a range of cellular stresses including DNA damage, dominant oncogene expression, hypoxia, metabolic changes and viral infection. In addition to these responses, p53 can also be activated when damage occurs to the mitotic spindle. Initially, spindle damage activates a p53-independent checkpoint which functions at the metaphase-anaphase transition and prevents cells from progressing through mitosis until the completion of spindle formation. Cells eventually escape from this block (a process termed 'mitotic slippage'), and an aberrant mitosis ensues in which sister chromatids fail to segregate properly. After a delay period, p53 responds to this mitotic failure by instituting a G1-like growth arrest, with an intact nucleus containing 4N DNA, but without the cells undergoing division. Cells lacking wild-type p53 are still able to arrest transiently at mitosis, and also fail to undergo division, underscoring that the delay in mitosis is p53-independent. However, these cells are not prevented from re-entering the cell cycle and can reduplicate their DNA unchecked, leading to polyploidy. Additionally, p53-null cells which experience spindle failure often show the appearance of micronuclei arising from poorly segregated chromosomes which have de-condensed and been enclosed in a nuclear envelope. The ability of p53 to prevent their formation suggests an additional G2 involvement which prevents nuclear breakdown prior to mitosis. The molecular mechanism by which p53 is able to sense mitotic failure is still unknown, but may be linked to the ability of p53 to regulate duplication of the centrosome, the organelle which nucleates spindle formation. (authors)
p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.
Cox, Darren P
2012-01-01
Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
Molecular mechanism of X-ray-induced p53-dependent apoptosis
Energy Technology Data Exchange (ETDEWEB)
Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)
1999-03-01
Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.
Attallah, A M; El-Far, M; Abdelrazek, M A; Omran, M M; Attallah, A A; Elkhouly, A A; Elkenawy, H M; Farid, K
2017-10-01
Hepatocellular carcinoma (HCC) is a multistage process resulting from various genetic changes. We aimed to determine nuclear phosphoprotein c-Myc and cellular phosphoprotein p53 expression and to evaluate their importance in HCC diagnosis. One hundred and twenty chronic hepatitis C (CHC) patients (60 non-HCC CHC patients and 60 HCC patients who had a single small (c-Myc and p53 were identified in liver tissues and serum samples using immunostaining, western blot and ELISA. Immunohistochemical detection of c-Myc and p53 with monospecific antibodies revealed intense and diffuse cytoplasmic staining patterns. Accumulated mutant proteins, released from tumour cells into the extracellular serum, were detected at 62 KDa, for c-Myc, and 53 KDa, for p53, using western blotting. In contrast to alpha feto-protein, there was a significant increase (p c-Myc (86.7% vs. 6.7%) and p53 (78.3% vs. 8.3%) in the malignant vs. non-malignant patients. The parallel combination of c-Myc and p53 reach the absolute sensitivity (100%), for more accurate and reliable HCC detection (specificity was 87%). c-Myc and p53 are potential HCC diagnostic biomarkers, and convenient combinations of them could improve diagnostic accuracy of HCC.
Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function
Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.
2011-01-01
The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107
Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes
Directory of Open Access Journals (Sweden)
Iva Simeonova
2013-06-01
Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.
Directory of Open Access Journals (Sweden)
Yitao Wang
2017-03-01
Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.
DEFF Research Database (Denmark)
Hermann, G G; Horn, T; Steven, K
1998-01-01
PURPOSE: We assessed the influence of the level of lamina propria invasion and the prevalence of p53 nuclear immunoreactivity on the survival of patients with stage T1 transitional cell bladder cancer. MATERIALS AND METHODS: All patients presenting with stage T1 bladder cancer were prospectively...... and routinely grouped according to the level of lamina propria invasion. Invasion of the tumor stalk was defined as stage T1a, invasion of the lamina propria proper superficial to the level of muscularis mucosa as stage T1b and into or deeper than the muscularis mucosa as stage T1c. The p53 nuclear...... related to age, level of lamina propria invasion and presence of p53 nuclear accumulation. For this subpopulation overall survival was 67%, and 79% for stage T1a, 70% for stage T1b and 57% for stage T1c (p
Immunohistochemical Expression of p53 in Pleomorphic Adenoma and Carcinoma Ex Pleomorphic Adenoma
International Nuclear Information System (INIS)
Tarakji, B.; Kujan, O.; Nassani, M. Z.
2010-01-01
Context. Immunohistochemical stains for p53 are used as a diagnostic marker associated with malignancy in several histologic types of salivary gland tumors. This marker may be useful in differentiating pleomorphic adenoma (PA) from carcinoma ex pleomorphic adenoma (CPA), as these tumors are often difficult to distinguish on the basis of morphology alone. Objective. to evaluate whatever inactivation of tumor suppressor gene (p53) increases with the tumor progression from normal salivary tissue to PA and eventually CPA. Design. Paraffin blocks of 29 cases of PA, which were surrounded by normal parotid gland, and 27 cases of carcinoma ex pleomorphic adenoma were retrieved and validated. In all cases of carcinoma ex pleomorphic adenoma, a PA “ghost” was identified, and the malignant element was either undifferentiated carcinoma or adenocarcinoma. Results. The results showed negative nuclear expression of P53 in normal parotid gland. Nuclear P53 was expressed strongly in 6/29 (20.7%) pleomorphic salivary adenoma and 10/27 (37%) carcinoma ex pleomorphic adenoma. Conclusion. Our data suggest that inactivation of p53 may play an important role in the evolution of pleomorphic salivary adenoma and carcinoma ex pleomorphic adenoma.
p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.
Directory of Open Access Journals (Sweden)
Karolyn J Forget
Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.
Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53
International Nuclear Information System (INIS)
Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi
2001-01-01
Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)
p53 Acetylation: Regulation and Consequences
International Nuclear Information System (INIS)
Reed, Sara M.; Quelle, Dawn E.
2014-01-01
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer
p53 Acetylation: Regulation and Consequences
Energy Technology Data Exchange (ETDEWEB)
Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)
2014-12-23
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.
International Nuclear Information System (INIS)
Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio
2010-01-01
The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)
Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer
Directory of Open Access Journals (Sweden)
Villiard Éric
2007-09-01
Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.
Immunohistochemical positive stained p53 protein in bladder transitional cell carcinoma
Directory of Open Access Journals (Sweden)
Halimi Monireh
2009-04-01
Full Text Available Background: Molecular genetics and immunopathologic analysis of bladder cancer have shown some abnormalities in a number of genes and proteins that have been implicated in the development and progression of such tumors, mainly in the p53 pathway. Aims: To investigate the rate of positively stained p53 protein in patients with urothelial papillary carcinoma of the bladder (UCB by immunohistochemistry and its relationship with tumor grade, gender and age of the patients. Settings and Design: During the present cross-sectional study, 100 paraffin-embedded specimens of UCB, which were provided from biopsies of the bladder by transurethral access, were immunohistochemically stained and studied for p53 protein from May 2006 to May 2007 in our referral center pathology laboratory. Materials and Methods: First, 4 µm slices of paraffin sections were provided and then stained by the avidin-biotin peroxidase method. The rate of positively stained p53 protein (defined as positive nuclear staining in over 10% of the cells was assessed. This rate was also estimated and compared between grades, genders and age-related groups (< 70 years, ≥70 years. Statistical Analysis: The χ2 , Fisher′s exact test and Mann-Whitney U test were used for comparing. Results: The overall rate of positively stained specimens was 11% for nuclear p53 protein. This rate was significantly higher in females (10/29 vs. 1/71; P < 0.001; odds ratio [OR]: 0.23; 95% confidence interval [CI]: 4.43-306.08, patients with 70 or older than 70 years (8/42 vs. 3/58; P = 0.04; OR: 0.55; 95% CI: 1.07-17.39 and in high-grade tumors (10/58 vs. 1/42; P = 0.02; OR: 0.59; 95% CI: 0.01-0.95. Conclusions: The rate of positively stained p53 protein for UCB was lower in our population. This rate was also higher in females, patients with 70 or older than 70 years and high grade of UCB.
International Nuclear Information System (INIS)
An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min; Kim, Chul-Hong; Kang, Eun-Jin; Choi, Kyung-Hee
2011-01-01
Highlights: → The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. → GSN interacts with transactivation- and DNA binding domains of p53. → GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. → GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate that GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.
International Nuclear Information System (INIS)
Sung, Ki Sa; Lee, Yun-Ah; Kim, Eui Tae; Lee, Seung-Rock; Ahn, Jin-Hyun; Choi, Cheol Yong
2011-01-01
Homeodomain-interacting protein kinase 2 (HIPK2) is a key regulator of various transcription factors including p53 and CtBP in the DNA damage signaling pathway. PML-nuclear body (NB) is required for HIPK2-mediated p53 phosphorylation at Ser46 and induction of apoptosis. Although PML-NB targeting of HIPK2 has been shown, much is not clear about the molecular mechanism of HIPK2 recruitment to PML-NBs. Here we show that HIPK2 colocalizes specifically with PML-I and PML-IV. Mutational analysis showed that HIPK2 recruitment to PML-IV-NBs is mediated by the SUMO-interaction motifs (SIMs) of both PML-IV and HIPK2. Wild-type HIPK2 associated with SUMO-conjugated PML-IV at a higher affinity than with un-conjugated PML-IV, while the association of a HIPK2 SIM mutant with SUMO-modified PML-IV was impaired. In colony formation assays, HIPK2 strongly suppressed cell proliferation, but HIPK2 SIM mutants did not. In addition, activation and phosphorylation of p53 at the Ser46 residue were impaired by HIPK2 SIM mutants. These results suggest that SIM-mediated HIPK2 targeting to PML-NBs is crucial for HIPK2-mediated p53 activation and induction of apoptosis.
The p53-dependent radioadaptive response
Ohnishi, Takeo
We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.
Ehm, Patrick; Nalaskowski, Marcus M; Wundenberg, Torsten; Jücker, Manfred
2015-01-01
The inositol 5-phosphatase SHIP1 is a negative regulator of signaling processes in haematopoietic cells. By converting PI(3,4,5)P3 to PtdIns(3,4)P2 at the plasma membrane, SHIP1 modifies PI3-kinase mediated signaling. We have recently demonstrated that SHIP1 is a nucleo-cytoplasmic shuttling protein and SHIP1 nuclear puncta partially colocalize with FLASH, a component of nuclear bodies. In this study, we demonstrate that endogenous SHIP1 localizes to intranucleolar regions of both normal and leukemic haematopoietic cells. In addition, we report that ectopically expressed SHIP1 accumulates in nucleolar cavities and colocalizes with the tumor suppressor protein p53 and components of PML nuclear bodies (e.g. SP100, SUMO-1 and CK2). Moreover, SHIP1 also colocalizes in nucleolar cavities with components of the ubiquitin-proteasome pathway. By using confocal microscopy data, we generated 3D-models revealing the enormous extent of the SHIP1 aggresomes in the nucleolus. Furthermore, treatment of cells with the proteasome inhibitor MG132 causes an enlargement of nucleolar SHIP1 containing structures. Unexpectedly, this accumulation can be partially prevented by treatment with the inhibitor of nuclear protein export Leptomycin B. In recent years, several proteins aggregating in nucleolar cavities were shown to be key factors of neurodegenerative diseases and cancerogenesis. Our findings support current relevance of nuclear localized SHIP1.
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-07-10
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.
International Nuclear Information System (INIS)
Klemm, Anna H.; Diez, Gerold; Alonso, Jose-Luis; Goldmann, Wolfgang H.
2009-01-01
Cytoskeletal reorganization is an ongoing process when cells adhere, move or invade extracellular substrates. The cellular force generation and transmission are determined by the intactness of the actomyosin-(focal adhesion complex)-integrin connection. We investigated the intracellular course of action in mouse embryonic fibroblasts deficient in the focal adhesion proteins vinculin and focal adhesion kinase (FAK) and the nuclear matrix protein p53 using magnetic tweezer and nanoparticle tracking techniques. Results show that the lack of these proteins decrease cellular stiffness and affect cell rheological behavior. The decrease in cellular binding strength was higher in FAK- to vinculin-deficient cells, whilst p53-deficient cells showed no effect compared to wildtype cells. The intracellular cytoskeletal activity was lowest in wildtype cells, but increased in the following order when cells lacked FAK+p53 > p53 > vinculin. In summary, cell mechanical processes are differently affected by the focal adhesion proteins vinculin and FAK than by the nuclear matrix protein, p53.
Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy
Directory of Open Access Journals (Sweden)
Christian M. Simon
2017-12-01
Full Text Available The hallmark of spinal muscular atrophy (SMA, an inherited disease caused by ubiquitous deficiency in the SMN protein, is the selective degeneration of subsets of spinal motor neurons. Here, we show that cell-autonomous activation of p53 occurs in vulnerable but not resistant motor neurons of SMA mice at pre-symptomatic stages. Moreover, pharmacological or genetic inhibition of p53 prevents motor neuron death, demonstrating that induction of p53 signaling drives neurodegeneration. At late disease stages, however, nuclear accumulation of p53 extends to resistant motor neurons and spinal interneurons but is not associated with cell death. Importantly, we identify phosphorylation of serine 18 as a specific post-translational modification of p53 that exclusively marks vulnerable SMA motor neurons and provide evidence that amino-terminal phosphorylation of p53 is required for the neurodegenerative process. Our findings indicate that distinct events induced by SMN deficiency converge on p53 to trigger selective death of vulnerable SMA motor neurons.
Prognosis for Survival of Young Women with Breast Cancer by Quantitative p53 Immunohistochemistry
Axelrod, David E.; Shah, Kinsuk; Yang, Qifeng; Haffty, Bruce G.
2015-01-01
p53 protein detected immunohistochemically has not been accepted as a biomarker for breast cancer patients because of disparate reports of the relationship between the amount of p53 protein detected and patient survival. The purpose of this study was to determine experimental conditions and methods of data analysis for which p53 stain intensity could be prognostic for survival of young breast cancer patients. A tissue microarray of specimens from 93 patients was stained with anti-p53 antibody, and stain intensity measured with a computer-aided image analysis system. A cut-point at one standard deviation below the mean of the distribution of p53 stain intensity separated patients into two groups with significantly different survival. These results were confirmed by Quantitative Nuclear Grade determined by DNA-specific Feulgen staining. P53 provided information beyond ER and PR status. Therefore, under the conditions reported here, p53 protein can be an effective prognostic factor for young breast cancer patients. PMID:26322145
S100A4 interacts with p53 in the nucleus and promotes p53 degradation.
Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J
2013-12-05
S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.
Paradiso, A; Rabinovich, M; Vallejo, C; Machiavelli, M; Romero, A; Perez, J; Lacava, J; Cuevas, M A; Rodriquez, R; Leone, B; Sapia, M G; Simone, G; De Lena, M
1996-12-20
In a series of 71 patients with advanced colorectal cancer treated with biochemically modulated 5-fluorouracil (5-FU) and methotrexate (MTX), we investigated the relationship between the proliferating-cell nuclear antigen (PCNA) (PC10) and p53 (Pab1801) primary-tumor immunohistochemical expression with respect to clinical response and long-term prognosis. Nuclear p53 expression was demonstrated in 44% of samples (any number of positive tumor cells) while all tumors showed a certain degree of PCNA immunostaining. PCNA immunostaining was correlated with histopathologic grade and p53 expression, while p53 was not correlated with any of the parameters considered. The probability of clinical response to biochemically modulated 5-FU was independent of p53 and PCNA expression. p53 expression (all cut-off values) was not associated with short- or long-term clinical prognosis, whereas patients with higher PCNA primary-tumor expression showed longer survival from treatment and survival from diagnosis, according to univariate and multivariate analysis, particularly in the sub-set of colon-cancer patients. We conclude that the clinical response of advanced-colorectal-cancer patients to biochemically modulated 5-FU and MTX cannot be predicted by PCNA and p53 primary-tumor expression, but high PCNA expression appears to be independently related to long-term prognosis.
Recent progress of the study of p53 control mechanism by ionizing radiation
International Nuclear Information System (INIS)
Kawai, Hidehiko
2004-01-01
Reviewed are the recent findings on the control mechanism of function and activity of p53 as a response factor to stress of ionizing radiation. The p53 protein is controlled to be essentially inactive in cells under normal conditions and is activated by various stresses. The role of p53 as a stress-responding and tumor-suppressing factor in cells with damaged DNA is discussed in relation with its participation in G1/S and G2/M checkpoints, DNA repair, and apoptosis. The stress like radiation affects the control mechanisms of stability and function of p53 through modification of its N-terminal region (the activation domain of transcription), DNA binding region (core domain) and C-terminal region (domains of the nuclear export signaling, tetramer formation and its own regulation). MDM2 (mouse double minute 2) family, the most important regulatory factor of p53, forms a negative feedback cycle since the family is the target factor of p53 transcription and also suppressor of p53. MDM2 is regulated by phosphorylation and by interaction with itself or other factors like p300/CBP. Further studies on p53 are thus important in various fields as well as in radiation biology. (N.I.)
Expression of p53 and p21 in primary glioblastomas
International Nuclear Information System (INIS)
Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.
2005-01-01
Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures
R248Q mutation--Beyond p53-DNA binding.
Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L
2015-12-01
R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.
Immunohistochemical study of p53 overexpression in radiation-induced colon cancers
International Nuclear Information System (INIS)
Minami, Kazunori; Hayashi, Nobuyuki; Mokarim, A.; Matsuzaki, Sumihiro; Ito, Masahiro; Sekine, Ichiro.
1998-01-01
The expressions of p53 and proliferating cell nuclear antigen (PCNA) were studied immunohistochemically from paraffin sections of 7 cases (9 lesions) of radiation-induced colon cancer and 42 cases of spontaneous colon cancer. Age distribution of radiation-induced and spontaneous colon cancer were 68.1 years (range, 56 to 77 years) and 67.4 years (range, 31 to 85 years), respectively. Among the radiation-induced colon cancers, there were 3 lesions of mucinous carcinoma (33%), a much higher than found for spontaneous mucinous cancer. Immunohistochemically, p53 protein expression was detected in 7/9 (78%) of radiation-induced cancers and in 23/42 (55%) of spontaneous colon cancers. χ 2 analysis found no significant differences between radiation-induced and spontaneous colon cancers in age distribution or p53-positive staining for frequency, histopathology, or Dukes'' classification. In radiation colitis around the cancers including aberrant crypts, spotted p53 staining and abnormal and scattered PCNA-positive staining were observed. In histologically normal cells, p53 staining was almost absent and PCNA-positive staining was regularly observed in the lower half of the crypt. In radiation colitis including aberrant glands, cellular proliferation increased and spotted p53 expression was observed. This study suggests that radiation colitis and aberrant glands might possess malignant potential and deeply associate with carcinogenesis of radiation-induced colon cancer. (author)
Immunohistochemical study of p53, pRb, p16 in esophageal cancer
International Nuclear Information System (INIS)
Zo, Jae Ill; Zo, Kyung Ja; Park, Jong Ho; Kim, Mi Hee
1998-01-01
To confirm the expression of molecular genetic alterations of p53, pRb, p16 in esophageal cancer and to investigate the expression of p53, pRb, p16 in esophageal cancer according to the pathologic steps of carcinogenesis, immuno-histochemistry was performed in 15 resected esophageal cancer specimens with multiple separated lesions after pathologic mapping. The accumulation of mutant p53 was observed in 60 % of dysplasia and 47 % of invasive cancer, while pRb was not detected in 91 % of dysplasia and 72.7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 28.6 % in invasive cancer. There was no simultaneous negative pRb and p16 expression. There was no relations between p53 and p16, pRb. As a results, the expression of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53 and pRb was common and early event in esophageal carcinogenesis in Korea, but inactivation of p16 was a infrequent change. (author). 17 refs., 2 tabs., 7 figs
Seth, Rohit; Corniola, Rikki S.; Gower-Winter, Shannon D.; Morgan, Thomas J., Jr.; Bishop, Brian; Levenson, Cathy W.
2015-01-01
Previous studies have shown that zinc deficiency leads to apoptosis of neuronal precursor cells in vivo and in vitro. In addition to the role of p53 as a nuclear transcription factor in zinc deficient cultured human neuronal precursors (NT-2), we have now identified the translocation of phosphorylated p53 to the mitochondria and p53-dependent…
International Nuclear Information System (INIS)
Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.
1995-01-01
Purpose: Most drug discovery efforts have focused on finding new DNA damaging agents to kill tumor cells preferentially. An alternative approach is to find ways to increase tumor specific killing by modifying tumor specific responses to that damage. We asked whether cells lacking the G1/S arrest in response to X-rays are more sensitive to X-ray damage when treated with agents that override G2/M arrest. Materials and Methods: Mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) p53 and rat embryonic fibroblasts (REF) made (+) or (-) for wild-type p53 function by transfection were irradiated with and without caffeine, a known checkpoint inhibitor. Caffeine treatment was maintained for 24 hours from 1 hour prior to irradiation. Cell survival following ionizing radiation was measured by clonogenic assay. For cell-cycle analysis, cells were in exponential asynchronous growth at the time of irradiation. The proportion of cells in G1, S and G2/M phases of the cell cycle were recorded immediately before and following irradiation and subsequently at 3,6,9,12,24 and 48 hours following irradiation. Results: Caffeine was found to cause radiosensitzation at low dose (0.5mM) in (-/-) cells but not in (+/+) cells. The sensitization enhancement ratio (SER) was 1.45 at 0.1 survival and 1.56 at 0.01 survival. At this dose of caffeine, this SER reflected therapeutic gain as there was no detectable effect on (+/+) cells. At 1mM caffeine, sensitization of (-/-) cells was 1.77, but (+/+) cells now also showed sensitization (SER=1.25). In (-/-) cells at 0.1mM caffeine the SER was 1.5 at 0.01 survival. The transfected REF cells (functionally null for p53) also exhibited caffeine-induced radiosensitization at both 0.5 and 2mM caffeine with a SER 1.45 for 2mM at 0.1 survival. No significant sensitization could be demonstrated for REF cells at the same doses of caffeine. The REF cells, with wild-type p53, transfected with pCMVneo alone showed no change in radiosensitivity or
Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J
2012-04-05
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.
p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors
Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't
1999-01-01
Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this
p53-Dependent suppression of genome instability in germ cells
Energy Technology Data Exchange (ETDEWEB)
Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2014-02-15
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.
p53-Dependent suppression of genome instability in germ cells
International Nuclear Information System (INIS)
Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi
2014-01-01
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells
SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53
International Nuclear Information System (INIS)
Milner, J.; Gamble, J.
1985-01-01
The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T
International Nuclear Information System (INIS)
Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.
2009-01-01
The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.
International Nuclear Information System (INIS)
Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.
2003-01-01
The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future
Directory of Open Access Journals (Sweden)
Tayebeh Hamzehloie
2012-03-01
Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.
Directory of Open Access Journals (Sweden)
Ivan Raimondi
Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.
Directory of Open Access Journals (Sweden)
Maria Teresa de Seixas Alves
2008-04-01
Full Text Available INTRODUÇÃO: Osteossarcoma (OS, o mais freqüente tumor primário maligno do osso, tem comportamento local agressivo e alto índice de disseminação sistêmica. Os eventos que permitem o crescimento e a disseminação tumoral ainda permanecem controversos. Os estudos sobre a carcinogênese e a progressão dessa neoplasia, com base na imunoexpressão de c-erb-B2, P-glicoproteína (P-gp e p53, apresentam resultados conflitantes acerca do real valor prognóstico e suas correlações com parâmetros histológicos. A anaplasia, em neoplasias na infância, constitui parâmetro histológico de agressividade tumoral e quimiorresistência. Nos OS primários ou metastáticos, seu significado permanece controverso. Por outro lado, em outras neoplasias humanas, a expressão do c-erb-B2 relaciona-se com p53, grau nuclear e outros parâmetros de agressividade. OBJETIVO: Avaliar a imunoexpressão de p53, c-erb-B2 e P-gp em OS, correlacionando os par��metros entre si e com a presença de anaplasia. MÉTODO: O estudo incluiu 96 biópsias pré-quimioterapia de pacientes com OS de alto grau, diagnosticados entre 1991 e 2000. A pesquisa imuno-histoquímica de p53, P-gp e c-erb-B2 foi feita pela técnica da estreptoavidina-biotina-peroxidase. Foram considerados positivos os casos onde havia imunoexpressão em 10% ou mais das células neoplásicas. Somente colorações membranosa (para cerb-B2 e P-gp e nuclear (para p53 foram consideradas positivas. Anaplasia foi definida como no tumor de Wilms, sendo considerada presente ou ausente. RESULTADOS: Anaplasia pôde ser avaliada em 82/96 casos, estando presente em 29 (35,36%. Imunoexpressão de p53 foi detectada em 25 dos 60 casos (36,23%; de P-gp, em 30 dos 73 casos (41,1%; e de c-erb-B2, em 22 dos 55 casos (40%. Os resultados demonstraram associação entre as imunoexpressões de c-erb-B2 e p53 (p = 0,042, p53 e o parâmetro anaplasia (p = 0,015, anaplasia e Pg (p = 0.034 CONCLUSÕES: A imunoexpressão de p53, c
International Nuclear Information System (INIS)
Langendijk, J.A.; Thunnissen, F.B.J.M.; Lamers, R.J.S.; Jong, J.M.A. de; Velde, G.P.M. ten; Wouters, E.F.M.
1995-01-01
In the present study the prognostic significance of accumulation of nuclear p53 protein on survival and freedom from local progression was investigated. Formalin-fixed, paraffin-embedded sections obtained by bronchoscopy or mediastinoscopy were used to examine the expression of nuclear p53 protein using immunohistochemistry. In 37 cases (57%), overexpression of the p53 protein was detected. No relation was found between p53 expression and other pretreatment variables. Response to radiotherapy was found in 11 p53-negative cases (65%) versus 10 p53-positive cases (42%). Freedom from local progression was significantly better in the p53-negative cases as compared with the p53-positive cases. The p53-negative cases who responded to radiotherapy showed an excellent freedom from local progression rate after 2 years of 100%, whereas all p53-positive cases without response to radiotherapy showed local progression within 24 months. Overall survival between p53-negative and -positive cases did not differ, however the disease-specific survival was found to be worse in the p53-positive cases as compared to the negative cases (median survival 8.4 vs. 14.4 months (P < 0.05)). No correlation was found between p53 expression and the frequency of distant metastases. In conclusion, the results of this study suggest that p53 protein expression may be of prognostic value on freedom from local progression in non-small cell lung carcinoma
Directory of Open Access Journals (Sweden)
Ajay Kumar
Full Text Available Minnelide/Triptolide (TL has recently emerged as a potent anticancer drug in non-small cell lung cancer (NSCLC. However, the precise mechanism of its action remains ambiguous. In this study, we elucidated the molecular basis for TL-induced cell death in context to p53 status. Cell death was attributed to dysfunction of mitochondrial bioenergetics in p53-deficient cells, which was characterized by decreased mitochondrial respiration, steady-state ATP level and membrane potential, but augmented reactive oxygen species (ROS. Increased ROS production resulted in oxidative stress in TL-treated cells. This was exhibited by elevated nuclear levels of a redox-sensitive transcriptional factor, NF-E2-related factor-2 (NRF2, along with diminished cellular glutathione (GSH content. We further demonstrated that in the absence of p53, TL blunted the expression of mitochondrial SIRT3 triggering increased acetylation of NDUAF9 and succinate dehydrogenase, components of complexes I and II of the electron transport chain (ETC. TL-mediated hyperacetylation of complexes I and II proteins and these complexes displayed decreased enzymatic activities. We also provide the evidence that P53 regulate steady-state level of SIRT3 through Proteasome-Pathway. Finally, forced overexpression of Sirt3, but not deacetylase-deficient mutant of Sirt3 (H243Y, restored the deleterious effect of TL on p53-deficient cells by rescuing mitochondrial bioenergetics. On contrary, Sirt3 deficiency in the background of wild-type p53 triggered TL-induced mitochondrial impairment that echoed TL effect in p53-deficeint cells. These findings illustrate a novel mechanism by which TL exerts its potent effects on mitochondrial function and ultimately the viability of NSCLC tumor.
Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq
2017-10-01
In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra
2017-09-29
p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
International Nuclear Information System (INIS)
Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira
2007-01-01
p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53ΔC) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53ΔC was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain
A limited role for p53 in modulating the immediate phenotype of Apc loss in the intestine
International Nuclear Information System (INIS)
Reed, Karen R; Meniel, Valerie S; Marsh, Victoria; Cole, Alicia; Sansom, Owen J; Clarke, Alan R
2008-01-01
p53 is an important tumour suppressor with a known role in the later stages of colorectal cancer, but its relevance to the early stages of neoplastic initiation remains somewhat unclear. Although p53-dependent regulation of Wnt signalling activity is known to occur, the importance of these regulatory mechanisms during the early stages of intestinal neoplasia has not been demonstrated. We have conditionally deleted the Adenomatous Polyposis coli gene (Apc) from the adult murine intestine in wild type and p53 deficient environments and subsequently compared the phenotype and transcriptome profiles in both genotypes. Expression of p53 was shown to be elevated following the conditional deletion of Apc in the adult small intestine. Furthermore, p53 status was shown to impact on the transcription profile observed following Apc loss. A number of key Wnt pathway components and targets were altered in the p53 deficient environment. However, the aberrant phenotype observed following loss of Apc (rapid nuclear localisation of β-catenin, increased levels of DNA damage, nuclear atypia, perturbed cell death, proliferation, differentiation and migration) was not significantly altered by the absence of p53. p53 related feedback mechanisms regulating Wnt signalling activity are present in the intestine, and become activated following loss of Apc. However, the physiological Wnt pathway regulation by p53 appears to be overwhelmed by Apc loss and consequently the activity of these regulatory mechanisms is not sufficient to modulate the immediate phenotypes seen following Apc loss. Thus we are able to provide an explanation to the apparent contradiction that, despite having a Wnt regulatory capacity, p53 loss is not associated with early lesion development
Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.
Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi
2016-04-01
P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.
Directory of Open Access Journals (Sweden)
Peiyuan Jia
Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.
p53 mutations promote proteasomal activity.
Oren, Moshe; Kotler, Eran
2016-07-27
p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
International Nuclear Information System (INIS)
Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.
2011-01-01
Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
Energy Technology Data Exchange (ETDEWEB)
Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)
2011-11-04
Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
International Nuclear Information System (INIS)
Tsutsui, Shinichi; Yasuda, Kazuhiro; Suzuki, Kosuke; Takeuchi, Hideya; Nishizaki, Takashi; Higashi, Hidefumi; Era, Shoichi
2006-01-01
Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. The Bcl-2 protein expression was found to be decreased in 105 (42%) cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089) associated with a worse disease free survival (DFS), while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer
Directory of Open Access Journals (Sweden)
Nishizaki Takashi
2006-07-01
Full Text Available Abstract Background Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. Methods The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. Results The Bcl-2 protein expression was found to be decreased in 105 (42% cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089 associated with a worse disease free survival (DFS, while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. Conclusion The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer.
Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.
Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K
2010-12-01
Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.
Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi
2004-06-01
The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.
Targeting the p53 Pathway in Ewing Sarcoma
Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.
2011-01-01
The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471
International Nuclear Information System (INIS)
Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming
2008-01-01
Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
Energy Technology Data Exchange (ETDEWEB)
Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)
2015-11-13
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
International Nuclear Information System (INIS)
Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.
2015-01-01
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena; Spiotto, Michael T
2016-01-01
p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways.
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit
2017-01-01
Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454
Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish
Directory of Open Access Journals (Sweden)
Seok-Hyung Kim
2013-07-01
Tuberous sclerosis complex (TSC is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1 kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors.
Generation of a selectively cytotoxic fusion protein against p53 mutated cancers
International Nuclear Information System (INIS)
Kousparou, Christina A; Yiacoumi, Efthymia; Deonarain, Mahendra P; Epenetos, Agamemnon A
2012-01-01
A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp) and wild-type, full-length p21 (Antp-p21). This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model) with differing p21 or p53 status. Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology
Generation of a selectively cytotoxic fusion protein against p53 mutated cancers
Directory of Open Access Journals (Sweden)
Kousparou Christina A
2012-08-01
Full Text Available Abstract Background A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. Methods The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp and wild-type, full-length p21 (Antp-p21. This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model with differing p21 or p53 status. Results Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Conclusions Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology.
Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice
Rani, Reena; Li, Jie; Pang, Qishen
2008-01-01
Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147
Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.
Rani, Reena; Li, Jie; Pang, Qishen
2008-12-01
Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.
Michaelis, M.; Rothweiler, F.; Agha, B.; Barth, S.; Voges, Y.; Loeschmann, N.; von Deimling, A.; Breitling, R.; Doerr, H. Wilhelm; Roedel, F.; Speidel, D.; Cinatl, J.; Cinatl Jr., J.; Stephanou, A.
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3,
Tumour suppression in skin and other tissues via cross-talk between vitamin D- and p53-signalling
Directory of Open Access Journals (Sweden)
Joerg eReichrath
2014-06-01
Full Text Available P53 and its family members have been implicated in the direct regulation of the vitamin D receptor (VDR. Vitamin D- and p53-signaling pathways have a significant impact on spontaneous or carcinogen-induced malignant transformation of cells, with VDR and p53 representing important tumour suppressors. VDR and the p53/p63/p73 proteins all function typically as receptors or sensors that turn into transcriptional regulators upon stimulus, with the main difference being that the nuclear VDR is activated as a transcription factor after binding its naturally occurring ligand 1,25-dihydroxyvitamin D with high affinity while the p53 family of transcription factors, mostly in the nucleoplasm, responds to a large number of alterations in cell homeostasis commonly referred to as stress. An increasing body of evidence now convincingly demonstrates a cross-talk between vitamin D- and p53-signaling that occurs at different levels, has genome-wide implications and that should be of high importance for many malignancies, including non-melanoma skin cancer. One interaction involves the ability of p53 to increase skin pigmentation via POMC derivatives including alpha-MSH and ACTH. Pigmentation protects the skin against UV-induced DNA damage and skin carcinogenesis, yet on the other hand reduces cutaneous synthesis of vitamin D. A second level of interaction may be through the ability of 1,25-dihydroxyvitamin D to increase the survival of skin cells after UV irradiation. UV irradiation-surviving cells show significant reductions in thymine dimers in the presence of 1,25-dihydroxyvitamin D that are associated with increased nuclear p53 protein expression, and significantly reduced NO products. A third level of interaction is documented by the ability of vitamin D compounds to regulate the expression of the murine double minute 2 (MDM2 gene in dependence of the presence of wild-type p53. MDM2 has a well established role as a key negative regulator of p53 activity
Biological and genetic properties of the p53 null preneoplastic mammary epithelium
Medina, Daniel; Kittrell, Frances S.; Shepard, Anne; Stephens, L. Clifton; Jiang, Cheng; Lu, Junxuan; Allred, D. Craig; McCarthy, Maureen; Ullrich, Robert L.
2002-01-01
The absence of the tumor suppressor gene p53 confers an increased tumorigenic risk for mammary epithelial cells. In this report, we describe the biological and genetic properties of the p53 null preneoplastic mouse mammary epithelium in a p53 wild-type environment. Mammary epithelium from p53 null mice was transplanted serially into the cleared mammary fat pads of p53 wild-type BALB/c female to develop stable outgrowth lines. The outgrowth lines were transplanted for 10 generations. The outgrowths were ductal in morphology and progressed through ductal hyperplasia and ductal carcinoma in situ before invasive cancer. The preneoplastic outgrowth lines were immortal and exhibited activated telomerase activity. They are estrogen and progesterone receptor-positive, and aneuploid, and had various levels of tumorigenic potential. The biological and genetic properties of these lines are distinct from those found in most hyperplastic alveolar outgrowth lines, the form of mammary preneoplasia occurring in most traditional models of murine mammary tumorigenesis. These results indicate that the preneoplastic cell populations found in this genetically engineered model are similar in biological properties to a subset of precurser lesions found in human breast cancer and provide a unique model to identify secondary events critical for tumorigenicity and invasiveness.
DEFF Research Database (Denmark)
Lukas, Claudia; Savic, Velibor; Bekker-Jensen, Simon
2011-01-01
stress increases the frequency of chromosomal lesions that are transmitted to daughter cells. Throughout G1, these lesions are sequestered in nuclear compartments marked by p53-binding protein 1 (53BP1) and other chromatin-associated genome caretakers. We show that the number of such 53BP1 nuclear bodies...... increases after genetic ablation of BLM, a DNA helicase associated with dissolution of entangled DNA. Conversely, 53BP1 nuclear bodies are partially suppressed by knocking down SMC2, a condensin subunit required for mechanical stability of mitotic chromosomes. Finally, we provide evidence that 53BP1 nuclear...... bodies shield chromosomal fragile sites sequestered in these compartments against erosion. Together, these data indicate that restoration of DNA or chromatin integrity at loci prone to replication problems requires mitotic transmission to the next cell generations....
p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells
Energy Technology Data Exchange (ETDEWEB)
Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)
2013-02-15
Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.
p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells
International Nuclear Information System (INIS)
Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer
2013-01-01
Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status
Detection of genotoxic and non-genotoxic carcinogens in Xpc−/−p53+/− mice
International Nuclear Information System (INIS)
Melis, Joost P.M.; Speksnijder, Ewoud N.; Kuiper, Raoul V.; Salvatori, Daniela C.F.; Schaap, Mirjam M.; Maas, Saskia; Robinson, Joke; Verhoef, Aart; Benthem, Jan van; Luijten, Mirjam; Steeg, Harry van
2013-01-01
An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed the Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Highlights: ► The Xpc*p53 mouse model is able to identify genotoxic and non-genotoxic carcinogens. ► Time, animals and cost can be significantly reduced compared to the 2-year bioassay. ► Xpc*p53 mice are more advantageous for carcinogen identification than Xpa*p53 mice. ► Xpc*p53 mice exhibit a wild type response upon exposure to genotoxicants.
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.
Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi
2003-04-01
Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.
Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.
Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer
2016-03-01
The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology
Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage
Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.
2009-01-01
Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133
International Nuclear Information System (INIS)
Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G
2013-01-01
Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches
TRIM65 negatively regulates p53 through ubiquitination
Energy Technology Data Exchange (ETDEWEB)
Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)
2016-04-22
Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.
Chemical Variations on the p53 Reactivation Theme
Directory of Open Access Journals (Sweden)
Carlos J. A. Ribeiro
2016-05-01
Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.
A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53
International Nuclear Information System (INIS)
Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.
2011-01-01
eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)
Nardilysin controls intestinal tumorigenesis through HDAC1/p53-dependent transcriptional regulation.
Kanda, Keitaro; Sakamoto, Jiro; Matsumoto, Yoshihide; Ikuta, Kozo; Goto, Norihiro; Morita, Yusuke; Ohno, Mikiko; Nishi, Kiyoto; Eto, Koji; Kimura, Yuto; Nakanishi, Yuki; Ikegami, Kanako; Yoshikawa, Takaaki; Fukuda, Akihisa; Kawada, Kenji; Sakai, Yoshiharu; Ito, Akihiro; Yoshida, Minoru; Kimura, Takeshi; Chiba, Tsutomu; Nishi, Eiichiro; Seno, Hiroshi
2018-04-19
Colon cancer is a complex disease affected by a combination of genetic and epigenetic factors. Here we demonstrate that nardilysin (N-arginine dibasic convertase; NRDC), a metalloendopeptidase of the M16 family, regulates intestinal tumorigenesis via its nuclear functions. NRDC is highly expressed in human colorectal cancers. Deletion of the Nrdc gene in ApcMin mice crucially suppressed intestinal tumor development. In ApcMin mice, epithelial cell-specific deletion of Nrdc recapitulated the tumor suppression observed in Nrdc-null mice. Moreover, epithelial cell-specific overexpression of Nrdc significantly enhanced tumor formation in ApcMin mice. Notably, epithelial NRDC controlled cell apoptosis in a gene dosage-dependent manner. In human colon cancer cells, nuclear NRDC directly associated with HDAC1, and controlled both acetylation and stabilization of p53, with alterations of p53 target apoptotic factors. These findings demonstrate that NRDC is critically involved in intestinal tumorigenesis through its epigenetic regulatory function, and targeting NRDC may lead to a novel prevention or therapeutic strategy against colon cancer.
REDOX IMAGING OF THE p53-DEPENDENT MITOCHONDRIAL REDOX STATE IN COLON CANCER EX VIVO
XU, HE N.; FENG, MIN; MOON, LILY; DOLLOFF, NATHAN; EL-DEIRY, WAFIK; LI, LIN Z.
2015-01-01
The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern
Zhuang, Chunlin; Miao, Zhenyuan; Wu, Yuelin; Guo, Zizhao; Li, Jin; Yao, Jianzhong; Xing, Chengguo; Sheng, Chunquan; Zhang, Wannian
2014-02-13
Simultaneous inactivation of p53 and hyperactivation of nuclear factor-κB (NF-κB) is a common occurrence in human cancer. Currently, antitumor agents are being designed to selectively activate p53 or inhibit NF-κB. However, there is no concerted effort yet to deliberately design inhibitors that can simultaneously do both. This paper provided a proof-of-concept study that p53-MDM2 interaction and NF-κB pathway can be simultaneously targeted by a small-molecule inhibitor. A series of pyrrolo[3,4-c]pyrazole derivatives were rationally designed and synthesized as the first-in-class inhibitors of p53-MDM2 interaction and NF-κB pathway. Most of the compounds were identified to possess nanomolar p53-MDM2 inhibitory activity. Compounds 5q and 5s suppressed NF-κB activation through inhibition of IκBα phosphorylation and elevation of the cytoplasmic levels of p65 and phosphorylated IKKα/β. Biochemical assay for the kinases also supported the fact that pyrrolo[3,4-c]pyrazole compounds directly targeted the NF-κB pathway. In addition, four compounds (5j, 5q, 5s, and 5u) effectively inhibited tumor growth in the A549 xenograft model. Further pharmacokinetic study revealed that compound 5q exhibited excellent oral bioavailability (72.9%).
International Nuclear Information System (INIS)
Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei
2009-01-01
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Energy Technology Data Exchange (ETDEWEB)
Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)
2009-09-04
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
p53 specific (auto)immunity in mice
Lauwen, Marjolein Monique
2008-01-01
Self-tolerance to p53 is a major potential limitation for the activation of the endogenous T-cell repertoire. So far, p53 specific CD8+ and CD4+ T-cell immunity has been described in cancer patients and healthy individuals. However, the restrictions of tolerance on the recruitment of p53 specific T
Exploring a minimal two-component p53 model
International Nuclear Information System (INIS)
Sun, Tingzhe; Zhu, Feng; Shen, Pingping; Yuan, Ruoshi; Xu, Wei
2010-01-01
The tumor suppressor p53 coordinates many attributes of cellular processes via interlocked feedback loops. To understand the biological implications of feedback loops in a p53 system, a two-component model which encompasses essential feedback loops was constructed and further explored. Diverse bifurcation properties, such as bistability and oscillation, emerge by manipulating the feedback strength. The p53-mediated MDM2 induction dictates the bifurcation patterns. We first identified irradiation dichotomy in p53 models and further proposed that bistability and oscillation can behave in a coordinated manner. Further sensitivity analysis revealed that p53 basal production and MDM2-mediated p53 degradation, which are central to cellular control, are most sensitive processes. Also, we identified that the much more significant variations in amplitude of p53 pulses observed in experiments can be derived from overall amplitude parameter sensitivity. The combined approach with bifurcation analysis, stochastic simulation and sampling-based sensitivity analysis not only gives crucial insights into the dynamics of the p53 system, but also creates a fertile ground for understanding the regulatory patterns of other biological networks
Loss of Geminin induces rereplication in the presence of functional p53
DEFF Research Database (Denmark)
Melixetian, Marina; Ballabeni, Andrea; Masiero, Laura
2004-01-01
nuclear foci. Abrogation of the checkpoint leads to abortive mitosis and death of rereplicated cells. In addition, we demonstrate that the induction of rereplication is dependent on the replication initiation factors CDT1 and CDC6, and independent of the functional status of p53. These data show...
Prisecaru, V I
2004-01-01
A new approach to the integration of results from a modular, complex biological systems analysis of nonlinear dynamics in cell cycling network transformations that are leading to carcinogenesis is proposed. Carcinogenesis is a complex process that involves dynamically inter-connected biomolecules in the intercellular, membrane, cytosolic, nuclear and nucleolar compartments that form numerous inter-related pathways referred to as networks. One such network module contains the cell cyclins whose functions are essential to cell cycling and division. Cyclins are proteins that also link to several critical pro-apoptotic and other cell cycling/division components, such as: c-Myc, p27, the tumor suppressor gene TP53 and its product-- the p53 protein with key roles in controlling DNA repair, inducing apoptosis and activating p21 (which can depress cell cyclins if activated), mdm2(with its biosynthesis activated by p53 and also, in its turn, inhibiting p53), p21, the Thomsen-Friedenreich antigen(T- antigen),Rb,Bax, Ba...
Directory of Open Access Journals (Sweden)
Izabella Paz Danezi Felin
2008-12-01
Full Text Available RACIONAL: O câncer de esôfago representa cerca de 2% dos tumores malignos e a terceira causa mais comum de câncer do trato gastrointestinal. A associação do prognóstico do câncer de esôfago com alguns marcadores imunoistoquímicos, como as proteínas p53, p16 e a ciclooxigenase 2 (COX-2 tem sido relatada. A detecção de marcadores moleculares através de imunoistoquímica pode ser utilizada para avaliação prognóstica. OBJETIVOS: Investigar a associação entre a expressão das proteínas p53, p16 e a COX-2 com o estádio do carcinoma escamoso de esôfago. MÉTODOS: Foram analisadas 31 amostras de ressecção cirúrgica por esofagectomia diagnosticadas como carcinoma de células escamosas de esôfago e 31 amostras não-tumorais referentes a cada caso. Realizou-se a revisão histopatológica e o estádio pTNM. Amostras tumorais e não-tumorais adjacentes foram submetidas a análise imunoistoquímica para avaliar o conteúdo das proteínas p53, p16 e COX-2. Foi considerada positiva a expressão nuclear para p53 em quantidade igual ou superior a 10,00% das células e presença da expressão citoplasmática de acordo com três escores (1, 2, 3 de intensidade (leve, moderada, acentuada de imunocoloração para COX-2. RESULTADOS: Em área tumoral, as análises revelaram 48,38% de positividade para p53, 16,12% de positividade para p16, e 100,00% de positividade escores 1+, 2+ ou 3+ para COX-2. No entanto, quando se avaliou possível relação da expressão destes marcadores com o estádio, apenas a COX-2, escore 3+ intensidade acentuada mostraram associação significativa. CONCLUSÃO: O presente estudo demonstrou que existe relação positiva entre a expressão de COX-2, escore 3+ e estádio mais avançado no carcinoma de esôfago.BACKGROUND: The esophageal carcinoma represents about 2% of malignant tumors and is the third most common cause of gastrointestinal cancer. The correlation between immunohistochemistry markers, such as p53, p16
Noda, Takeshi
2011-12-01
I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ben Stocks
2017-12-01
Full Text Available Tumour protein 53 (p53 has been implicated in the regulation of mitochondrial biogenesis in skeletal muscle, with whole-body p53 knockout mice displaying impairments in basal mitochondrial content, respiratory capacity, and enzyme activity. This study aimed to determine the effect of skeletal muscle-specific loss of p53 on mitochondrial content and enzyme activity. Mitochondrial protein content, enzyme activity and mRNA profiles were assessed in skeletal muscle of 8-week-old male muscle fibre-specific p53 knockout mice (p53 mKO and floxed littermate controls (WT under basal conditions. p53 mKO and WT mice displayed similar content of electron transport chain proteins I-V and citrate synthase enzyme activity in skeletal muscle. In addition, the content of proteins regulating mitochondrial morphology (MFN2, mitofillin, OPA1, DRP1, FIS1, fatty acid metabolism (β-HAD, ACADM, ACADL, ACADVL, carbohydrate metabolism (HKII, PDH, energy sensing (AMPKα2, AMPKβ2, and gene transcription (NRF1, PGC-1α, and TFAM were comparable in p53 mKO and WT mice (p > 0.05. Furthermore, p53 mKO mice exhibited normal mRNA profiles of targeted mitochondrial, metabolic and transcriptional proteins (p > 0.05. Thus, it appears that p53 expression in skeletal muscle fibres is not required to develop or maintain mitochondrial protein content or enzyme function in skeletal muscle under basal conditions.
p53 in differentiation of thyroid cancer
International Nuclear Information System (INIS)
Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.
1993-01-01
P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)
Lunatic Fringe and p53 Cooperatively Suppress Mesenchymal Stem-Like Breast Cancer
Directory of Open Access Journals (Sweden)
Wen-Cheng Chung
2017-11-01
Full Text Available Claudin-low breast cancer (CLBC is a poor prognosis molecular subtype showing stemness and mesenchymal features. We previously discovered that deletion of a Notch signaling modulator, Lunatic Fringe (Lfng, in the mouse mammary gland induced a subset of tumors resembling CLBC. Here we report that deletion of one copy of p53 on this background not only accelerated mammary tumor development but also led to a complete penetrance of the mesenchymal stem-like phenotype. All mammary tumors examined in the Lfng/p53 compound mutant mice displayed a mesenchymal/spindloid pathology. These tumors showed high level expressions of epithelial-to-mesenchymal transition (EMT markers including Vimentin, Twist, and PDGFRα, a gene known to be enriched in CLBC. Prior to tumor onset, Lfng/p53 mutant mammary glands exhibited increased levels of Vimentin and E-cadherin, but decreased expressions of cytokeratin 14 and cytokeratin 8, accompanied by elevated basal cell proliferation and an expanded mammary stem cell-enriched population. Lfng/p53 mutant glands displayed increased accumulation of Notch3 intracellular fragment, up-regulation of Hes5 and down-regulation of Hes1. Analysis in human breast cancer datasets found the lowest HES1 and second lowest LFNG expressions in CLBC among molecular subtypes, and low level of LFNG is associated with poor survival. Immunostaining of human breast cancer tissue array found correlation between survival and LFNG immunoreactivity. Finally, patients carrying TP53 mutations express lower LFNG than patients with wild type TP53. Taken together, these data revealed genetic interaction between Lfng and p53 in mammary tumorigenesis, established a new mouse model resembling CLBC, and may suggest targeting strategy for this disease.
International Nuclear Information System (INIS)
Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang
2007-01-01
Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is
p53 and the pathogenesis of skin cancer
International Nuclear Information System (INIS)
Benjamin, Cara L.; Ananthaswamy, Honnavara N.
2007-01-01
The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients
Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H
1997-05-01
To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.
Directory of Open Access Journals (Sweden)
Maria Dirlei F. S. Begnami
2005-08-01
Full Text Available INTRODUÇÃO: Em nosso meio, os carcinomas gástricos ainda são neoplasias bastante freqüentes e responsáveis por altas taxas de mortalidade. Recentemente, têm-se demonstrado a expressão de p53 e a amplificação do gene c-erb-B2 nos carcinomas gástricos. A relevância e o significado biológico destas alterações ainda não foram totalmente estabelecidos. OBJETIVO: Estudar as expressões imuno-histoquímicas de p53 e c-erb-B2 em 482 casos de carcinomas gástricos. MATERIAL E MÉTODOS: Foram construídos três blocos de tissue microarray (TMA utilizando-se duplicatas de 482 casos de carcinomas gástricos. Os cortes foram corados por hematoxilina e eosina (HE, tendo sido feita pesquisa para p53 e c-erb-B2. Foram considerados positivos para p53 os casos com marcação nuclear em mais de 10% das células tumorais. Para o c-erb-B2 foram considerados positivos os casos com marcação de membrana completa em mais de 10% das células tumorais. RESULTADOS: A expressão de p53 e c-erb-B2 foi observada em 30% e 12% dos casos, respectivamente. Em relação aos tipos histológicos observou-se correlação entre os carcinomas do tipo intestinal e a expressão de c-erb-B2 (p INTRODUCTION: Gastric cancer is one of the commonest cancers in our country being responsible for a high mortality rate. Recently, the expression of p53 and amplification of c-erb-B2 gene have been described in gastric carcinoma. The relevance and biological significance of these findings are not established yet. OBJECTIVE: The authors investigated p53, c-erb-B2 immunohistochemical expression in 482 cases of gastric carcinomas. MATERIAL AND METHODS: Tissue microarray (TMA blocks were designed using replicate samples of paraffin-embedded tissue from 482 gastric carcinomas. Sections were stained with HE, and antibodies to p53 and c-erb-B2. Cases were considered p53 positive if nuclear staining was detected in > 10% of the tumor cells. Cases were assessed c-erb-B2 positive if the
Directory of Open Access Journals (Sweden)
Alfredo Ribeiro-Silva
2003-06-01
Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human
System-based strategies for p53 recovery.
Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I
2018-06-01
The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.
Microbial Regulation of p53 Tumor Suppressor.
Directory of Open Access Journals (Sweden)
Alexander I Zaika
2015-09-01
Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.
Battle Against Cancer: An Everlasting Saga of p53
Directory of Open Access Journals (Sweden)
Qian Hao
2014-12-01
Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
Lai, Jonathan H; Fleming, Kirsten E; Ly, Thai Yen; Pasternak, Sylvia; Godlewski, Marek; Doucette, Steve; Walsh, Noreen M
2015-09-01
Merkel cell polyomavirus is of oncogenic significance in approximately 80% of Merkel cell carcinomas. Morphological subcategories of the tumor differ in regard to viral status, the rare combined type being uniformly virus negative and the predominant pure type being mainly virus positive. Indications that different biological subsets of the tumor exist led us to explore this diversity. In an Eastern Canadian cohort of cases (75 patients; mean age, 76 years [range, 43-91]; male/female ratio, 43:32; 51 [68%] pure and 24 [34%] combined tumors), we semiquantitatively compared the immunohistochemical expression of 3 cellular proteins (p53, Bcl-2, and c-kit) in pure versus combined groups. Viral status was known in a subset of cases. The significant overexpression of p53 in the combined group (mean [SD], 153.8 [117.8] versus 121.6 [77.9]; P = .01) and the increased epidermal expression of this protein (p53 patches) in the same group lend credence to a primary etiologic role for sun damage in these cases. Expression of Bcl-2 and c-kit did not differ significantly between the 2 morphological groups. A relative increase in c-kit expression was significantly associated with a virus-negative status (median [interquartile range], 100 [60-115] versus 70 [0-100]; P = .03). Emerging data reveal divergent biological pathways in Merkel cell carcinoma, each with a characteristic immunohistochemical profile. Virus-positive tumors (all pure) exhibit high retinoblastoma protein and low p53 expression, whereas virus-negative cases (few pure and all combined) show high p53 and relatively high c-kit expression. The potential biological implications of this dichotomy call for consistent stratification of these tumors in future studies. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Wei-Ru Huang
Full Text Available Avian reovirus (ARV protein p17 has been shown to regulate cell cycle and autophagy by activation of p53/PTEN pathway; nevertheless, it is still unclear how p53 and PTEN are activated by p17. Here, we report for the first time that p17 functions as a nucleoporin Tpr suppressor that leads to p53 nuclear accumulation and consequently activates p53, p21, and PTEN. The nuclear localization signal (119IAAKRGRQLD128 of p17 has been identified for Tpr binding. This study has shown that Tpr suppression occurs by p17 interacting with Tpr and by reducing the transcription level of Tpr, which together inhibit Tpr function. In addition to upregulation of PTEN by activation of p53 pathway, this study also suggests that ARV protein p17 acts as a positive regulator of PTEN. ARV p17 stabilizes PTEN by stimulating phosphorylation of cytoplasmic PTEN and by elevating Rak-PTEN association to prevent it from E3 ligase NEDD4-1 targeting. To activate PTEN, p17 is able to promote β-arrestin-mediated PTEN translocation from the cytoplasm to the plasma membrane via a Rock-1-dependent manner. The accumulation of p53 in the nucleus induces the PTEN- and p21-mediated downregulation of cyclin D1 and CDK4. Furthermore, Tpr and CDK4 knockdown increased virus production in contrast to depletion of p53, PTEN, and LC3 reducing virus yield. Taken together, our data suggest that p17-mediated Tpr suppression positively regulates p53, PTEN, and p21 and negatively regulates PI3K/AKT/mTOR and ERK signaling pathways, both of which are beneficial for virus replication.
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
Tumor hypoxia, p53, and prognosis in cervical cancers
International Nuclear Information System (INIS)
Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen
2001-01-01
Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p
Analysis of p53- immunoreactivity in astrocytic brain tumors
Directory of Open Access Journals (Sweden)
Shinkarenko T.V.
2016-12-01
Full Text Available P53 is an antioncogene with the frequently occured mutations in human tumor cells, leading to corresponding protein overexpression which can be detected by immunohistochemistry. Researches dedicated to the investigation of possibilities of using this technique gave controversial results. The authors investigated features of p53 protein expression in astrocytic brain tumors with different degrees of malignancy. Analyzed the relationship of the expression level of p53 by tumor cells with clinical parameters and Ki-67 proliferation index (PI as well. Tissues were collected from 52 cases with diagnosed astrocytic brain tumors. The sections were immunohistochemically stained with p53 and Ki-67. For each marker, 1000 tumor cells were counted and the ratio of positive tumor cells was calculated using software package ImageJ 1,47v. In normal brain tissue p53- expression was not identified. p53-immunoreactive tumor cells were detected in 25% (1/4 pilocytic astrocytomas, 33.3% (2/6 of diffuse astrocytomas, 53.8% (7/13 anaplastic astrocytomas, 58.6% (17/29 glioblastomas. A high proportion of p53-immunoreactive cells (> 30% was observed only in glioblastomas. The level of p53-imunoreactivity was not related to the age, gender and Grade WHO (p> 0,05. Spearman correlation coefficient between the relative quantity of ki-67- and p53-immunoreactive nuclei showed weak direct correlation (0.023, but the one was not statistically significant (p> 0,05. The level of p53-imunoreactivity is not dependent from age and sex of patients, Grade (WHO and proliferative activity (p>0,05 but the high level of p53-immunoreactive cells (>30% is found in glioblastoma specimens only, that may be due to the accumulation of mutations in DNA of tumor cells. There is insignificant weak relationship between relative quantities of ki-67- and p53-immunoreactive tumor cells (p>0,05.
Energy Technology Data Exchange (ETDEWEB)
Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.; Nakao, Aki; Guan, Yinghui; Long, Sydney B.T.; Vonguyen, Lien; Chen, David J.; Gray, Joe W; Chen, Fanqing
2009-09-07
The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expression levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.
The nucleolus directly regulates p53 export and degradation.
Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P
2011-09-05
The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.
Directory of Open Access Journals (Sweden)
Ge Q
2016-01-01
Full Text Available Qiangqiang Ge,1,* Chenghe Wang,2,* Yajun Ruan,1,* Zhong Chen,1 Jihong Liu,1 Zhangqun Ye1 1Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, 2Department of Urology, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Previous research has reported that a particular double-stranded RNA, named dsP53-285, has the capacity to induce expression of the tumor suppressor gene TP53 in chimpanzee cells by targeting its promoter. Usually, it is the wild-type p53 protein, rather than mutants, which exhibits potent cancer-inhibiting effects. In addition, nonhuman primates, such as chimpanzees, share almost identical genome sequences with humans. This prompted us to speculate whether dsP53-285 can trigger wild-type p53 protein expression in human prostate cancer (PCa cells and consequently suppress cell growth. The human PCa cell lines LNCaP and DU145 were transfected with dsP53-285 for 72 hours. Compared with the dsControl and mock transfection groups, expression of both p53 messenger RNA and p53 protein was significantly enhanced after dsP53-285 transfection, and this enhancement was followed by upregulation of p21, which indirectly indicated that dsP53-285 induced wild-type p53 expression. Moreover, overexpression of wild-type p53 mediated by dsP53-285 downregulated the expression of Cyclin D1 and cyclin-dependent kinase 4/6, thereby inducing PCa cell cycle arrest in G0/G1 phase and then inhibiting cell proliferation and clonogenicity. More importantly, dsP53-285 suppressed PCa cells mainly by modulating wild-type p53 expression. In conclusion, our study provides evidence that dsP53-285 can significantly stimulate wild-type p53 expression in the human PCa cell lines LNCaP and DU145 and can exert potent antitumor effects. Keywords: p53, small activating RNA, prostate
Immunohistochemical analysis of P53 protein in odontogenic cysts
Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.
2010-01-01
The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493
Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?
International Nuclear Information System (INIS)
Blackburn, Anneke C; Jerry, D Joseph
2002-01-01
The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer
DEFF Research Database (Denmark)
Savelyeva, I.; Dobbelstein, M.
2011-01-01
to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...
Autonomous feedback loop of RUNX1-p53-CBFB in acute myeloid leukemia cells.
Morita, Ken; Noura, Mina; Tokushige, Chieko; Maeda, Shintaro; Kiyose, Hiroki; Kashiwazaki, Gengo; Taniguchi, Junichi; Bando, Toshikazu; Yoshida, Kenichi; Ozaki, Toshifumi; Matsuo, Hidemasa; Ogawa, Seishi; Liu, Pu Paul; Nakahata, Tatsutoshi; Sugiyama, Hiroshi; Adachi, Souichi; Kamikubo, Yasuhiko
2017-11-30
Although runt-related transcription factor 1 (RUNX1) and its associating core binding factor-β (CBFB) play pivotal roles in leukemogenesis, and inhibition of RUNX1 has now been widely recognized as a novel strategy for anti-leukemic therapies, it has been elusive how leukemic cells could acquire the serious resistance against RUNX1-inhibition therapies and also whether CBFB could participate in this process. Here, we show evidence that p53 (TP53) and CBFB are sequentially up-regulated in response to RUNX1 depletion, and their mutual interaction causes the physiological resistance against chemotherapy for acute myeloid leukemia (AML) cells. Mechanistically, p53 induced by RUNX1 gene silencing directly binds to CBFB promoter and stimulates its transcription as well as its translation, which in turn acts as a platform for the stabilization of RUNX1, thereby creating a compensative RUNX1-p53-CBFB feedback loop. Indeed, AML cells derived from relapsed cases exhibited higher CBFB expression levels compared to those from primary AML cells at diagnosis, and these CBFB expressions were positively correlated to those of p53. Our present results underscore the importance of RUNX1-p53-CBFB regulatory loop in the development and/or maintenance of AML cells, which could be targeted at any sides of this triangle in strategizing anti-leukemia therapies.
p53 Loss Synergizes with Estrogen and Papillomaviral Oncogenes to Induce Cervical and Breast Cancers
Shai, Anny; Pitot, Henry C.; Lambert, Paul F.
2010-01-01
Whereas the tumor suppressor p53 gene is frequently mutated in most human cancers, this is not the case in human papillomavirus (HPV)-associated cancers, presumably because the viral E6 oncoprotein inactivates the p53 protein. The ability of E6 to transform cells in tissue culture and induce cancers in mice correlates in part with its ability to inactivate p53. In this study, we compared the expression of the HPV16 E6 oncogene to the conditional genetic disruption of p53 in the context of a mouse model for cervical cancer in which estrogen is a critical cofactor. Nearly all of the K14Crep53f/f mice treated with estrogen developed cervical cancer, a stark contrast to its complete absence in like-treated K14E6WTp53f/f mice, indicating that HPV16 E6 must only partially inactivate p53. p53-independent activities of E6 also contributed to carcinogenesis, but in the female reproductive tract, these activities were manifested only in the presence of the HPV16 E7 oncogene. Interestingly, treatment of K14Crep53f/f mice with estrogen also resulted in mammary tumors after only a short latency, many of which were positive for estrogen receptor α. The majority of these mammary tumors were of mixed cell types, suggestive of their originating from a multipotent progenitor. Furthermore, a subset of mammary tumors arising in the estrogen-treated, p53-deficient mammary glands exhibited evidence of an epithelial to mesenchymal transition. These data show the importance of the synergy between estrogen and p53 insufficiency in determining basic properties of carcinogenesis in hormone-responsive tissues, such as the breast and the reproductive tract. PMID:18413729
Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang
2012-08-01
Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.
Role of p53 status in radiation sensitivity and cell cycle progression
International Nuclear Information System (INIS)
Zellars, Richard C.; Loney, Tania; Schott, Ann F.; Davis, Mary A.; Maybaum, Jonathan; Clarke, Michael F.; Lawrence, Theodore S.
1995-01-01
Purpose: Although p53 function plays a major role in G1 arrest after radiation, the influence of p53 status on progress through other phases of the cell cycle and on radiation sensitivity of human tumors is less clear. We investigated these issues using cells with a conditional expression system for wild type p53. Methods: A temperature sensitive murine wild type p53 plasmid was used (Ginsberg D, et al: Mol. Cell.Biol . 11:582, 1991). At the permissive temperature (32 deg. C), this plasmid produces a protein which assumes a conformation that exhibits wild type p53 function. However, when cells are cultured at 38 deg. C, this protein assumes an inactive conformation. HT29 human colon cancer cells (which are p53 mutant) were transduced with this plasmid (designated PEP A and PEP G cells) or a control vector (designated CCH1 cells) using electroporation and Geneticin selection. The presence of murine p53 transcript in the PEP cells was confirmed by Northern analysis. Results: Cells were cultured under 3 conditions: 1) 38 deg. C at all times; 2) 32 deg. C for 24 hours prior to irradiation and 3) 32 deg. C for 24 hours after irradiation. We found that culturing under permissive temperatures produced a small decrease in surviving fraction in the PEP clones (0.61 ± 0.10 and 0.64 ± 0.07, for PEP A and G, respectively) but not the CCH1 controls (1.14 ± 0.15). PEP cells tended to be more radiosensitive than CCH1 cells (even under non-permissive conditions) and demonstrated a trend towards increased radiosensitivity under both Conditions 2 and 3. In addition, flow cytometry revealed that a 24 hour exposure to permissive conditions increased the fraction of cells in G1 slightly and in G2/M substantially. S phase was almost absent. Conclusion: Restoration of p53 function in HT29 human colon cancer cells using this temperature sensitive system produced increased cytotoxicity and radiation sensitivity as well as cell cycle redistribution. It will be important to assess the
Low grade inflammation inhibits VEGF induced HUVECs migration in p53 dependent manner
International Nuclear Information System (INIS)
Panta, Sushil; Yamakuchi, Munekazu; Shimizu, Toshiaki; Takenouchi, Kazunori; Oyama, Yoko; Koriyama, Toyoyasu; Kojo, Tsuyoshi; Hashiguchi, Teruto
2017-01-01
In the course of studying crosstalk between inflammation and angiogenesis, high doses of pro-inflammatory factors have been reported to induce apoptosis in cells. Under normal circumstances also the pro-inflammatory cytokines are being released in low doses and are actively involved in cell signaling pathways. We studied the effects of low grade inflammation in growth factor induced angiogenesis using tumor necrosis factor alfa (TNFα) and vascular endothelial growth factor A (VEGF) respectively. We found that low dose of TNFα can inhibit VEGF induced angiogenesis in human umbilical vein endothelial cells (HUVECs). Low dose of TNFα induces mild upregulation and moreover nuclear localization of tumor suppressor protein 53 (P53) which causes decrease in inhibitor of DNA binding-1 (Id1) expression and shuttling to the cytoplasm. In absence of Id1, HUVECs fail to upregulate β 3 -integrin and cell migration is decreased. Connecting low dose of TNFα induced p53 to β 3 -integrin through Id1, we present additional link in cross talk between inflammation and angiogenesis. - Highlights: • Low grade inflammation (low dose of TNF alfa) inhibits VEGF induced endothelial cells migration. • The low grade inflammation with VEGF treatment upregulates P53 to a nonlethal level. • P53 activation inhibits Id1 shuttling to the cytoplasm in endothelial cells. • Inhibition of Id1 resulted in downregulation of β 3 -integrin which cause decrease in cell migration. • Inflammation and angiogenesis might cross-talk by P53 – Id1 – β 3 -integrin pathway in endothelial cells.
[Punish or cherish: p53, metabolism and tumor suppression].
Albagli, Olivier
2015-10-01
The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.
Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S
2017-11-01
Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Mutations in p53, p53 protein overexpression and breast cancer survival
Czech Academy of Sciences Publication Activity Database
Rössner ml., Pavel; Gammon, M. D.; Zhang, Y.J.; Terry, M. B.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Gabrowski, G.; Agrawal, M.; Kalra, T.S.; Teitelbaum, S. L.; Neugut, A. I.; Santella, R. M.
2009-01-01
Roč. 13, č. 9B (2009), s. 3847-3857 ISSN 1582-1838 Institutional research plan: CEZ:AV0Z50390512 Keywords : Breast cancer * p53 mutations * Survival Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.228, year: 2009
Alcohol alters hepatic FoxO1, p53, and mitochondrial SIRT5 deacetylation function
International Nuclear Information System (INIS)
Lieber, Charles S.; Leo, Maria Anna; Wang, Xiaolei; DeCarli, Leonore M.
2008-01-01
Chronic alcohol consumption affects the gene expression of a NAD-dependent deacetylase Sirtuis 1 (SIRT1) and the peroxisome proliferator-activated receptor-γ coactivator1α (PGC-1α). Our aim was to verify that it also alters the forkhead (FoxO1) and p53 transcription factor proteins, critical in the hepatic response to oxidative stress and regulated by SIRT1 through its deacetylating capacity. Accordingly, rats were pair-fed the Lieber-DeCarli alcohol-containing liquid diets for 28 days. Alcohol increased hepatic mRNA expression of FoxO1 (p = 0.003) and p53 (p = 0.001) while corresponding protein levels remained unchanged. However phospho-FoxO1 and phospho-Akt (protein kinase) were both decreased by alcohol consumption (p = 0.04 and p = 0.02, respectively) while hepatic p53 was found hyperacetylated (p = 0.017). Furthermore, mitochondrial SIRT5 was reduced (p = 0.0025), and PGC-1α hyperacetylated (p = 0.027), establishing their role in protein modification. Thus, alcohol consumption disrupts nuclear-mitochondrial interactions by post-translation protein modifications, which contribute to alteration of mitochondrial biogenesis through the newly discovered reduction of SIRT5
The genetic alteration of p53 in esophageal cancer
Energy Technology Data Exchange (ETDEWEB)
Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)
1996-01-01
Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).
Stroescu, Cezar; Dragnea, Adrian; Ivanov, Bogdan; Pechianu, Catalin; Herlea, Vlad; Sgarbura, Olivia; Popescu, Andra; Popescu, Irinel
2008-12-01
Hepatocellular carcinoma is one of the most common malignant tumors that carry a poor prognosis. To improve the long-term outlook for HCC, an accurate prognosis is important. To study the immunohistochemical expressions of p53, Ki67, Bcl-2, VEGF and PCNA and their potential role as prognostic factors in patients with radical resection of hepatocellular carcinoma. Forty-seven formalin-fixed paraffin-embedded tumor samples from patients with HCC receiving liver resection were investigated immunohistochemically for the expression of cellular proliferation markers PCNA, Ki67, p53, Bcl-2 and VEGF and their correlation with tumor characteristics and survival time after resection. p53 was expressed in a higher percentage (85.7 vs. 42.1%) in undifferentiated histological tumor grades (Edmondson Steiner G3/G4 vs. G1/G2). Patients with p53 accumulating tumors showed a worse survival than patients with p53 non-accumulating tumors (median 9.5 vs. 16.5 months). Over-expression of VEGF was found in 38.3% of all HCCs. VEGF expression was significantly correlated with p53 expression and recurrence rates. The results showed that the labeling index of PCNA and expression of p53 are correlated. The high labeling index of PCNA or over-expression of p53 resulted in high risk of tumor recurrence, more aggressive growth and poor survival. High labeling index of PCNA, p53 nuclear accumulation and VEGF high expression are associated with poor survival in patients with HCC.
Conditional inactivation of PDCD2 induces p53 activation and cell cycle arrest
Directory of Open Access Journals (Sweden)
Celine J. Granier
2014-08-01
Full Text Available PDCD2 (programmed cell death domain 2 is a highly conserved, zinc finger MYND domain-containing protein essential for normal development in the fly, zebrafish and mouse. The molecular functions and cellular activities of PDCD2 remain unclear. In order to better understand the functions of PDCD2 in mammalian development, we have examined PDCD2 activity in mouse blastocyst embryos, as well as in mouse embryonic stem cells (ESCs and embryonic fibroblasts (MEFs. We have studied mice bearing a targeted PDCD2 locus functioning as a null allele through a splicing gene trap, or as a conditional knockout, by deletion of exon2 containing the MYND domain. Tamoxifen-induced knockout of PDCD2 in MEFs, as well as in ESCs, leads to defects in progression from the G1 to the S phase of cell cycle, associated with increased levels of p53 protein and p53 target genes. G1 prolongation in ESCs was not associated with induction of differentiation. Loss of entry into S phase of the cell cycle and marked induction of nuclear p53 were also observed in PDCD2 knockout blastocysts. These results demonstrate a unique role for PDCD2 in regulating the cell cycle and p53 activation during early embryonic development of the mouse.
A systematic review of p53 regulation of oxidative stress in skeletal muscle.
Beyfuss, Kaitlyn; Hood, David A
2018-12-01
transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p
Directory of Open Access Journals (Sweden)
Marie-Jo Halaby
2015-01-01
Full Text Available Synthesis of the p53 tumor suppressor increases following DNA damage. This increase and subsequent activation of p53 are essential for the protection of normal cells against tumorigenesis. We previously discovered an internal ribosome entry site (IRES that is located at the 5′-untranslated region (UTR of p53 mRNA and found that the IRES activity increases following DNA damage. However, the mechanism underlying IRES-mediated p53 translation in response to DNA damage is still poorly understood. In this study, we discovered that translational control protein 80 (TCP80 has increased binding to the p53 mRNA in vivo following DNA damage. Overexpression of TCP80 also leads to increased p53 IRES activity in response to DNA damage. TCP80 has increased association with RNA helicase A (RHA following DNA damage and overexpression of TCP80, along with RHA, leads to enhanced expression of p53. Moreover, we found that MCF-7 breast cancer cells with decreased expression of TCP80 and RHA exhibit defective p53 induction following DNA damage and diminished expression of its downstream target PUMA, a proapoptotic protein. Taken together, our discovery of the function of TCP80 and RHA in regulating p53 IRES and p53 induction following DNA damage provides a better understanding of the mechanisms that regulate IRES-mediated p53 translation in response to genotoxic stress.
ER, p53 and MIB-1 are significantly associated with malignant phyllodes tumor.
Munawer, Nurhayati H; Md Zin, Reena; Md Ali, Siti-Aishah; Muhammad, Rohaizak; Ali, Jasmi; Das, Srijit
2012-01-01
Fibroadenomas (FA) are common while phyllodes tumors (PT) are rare and both tumors are composed of epithelial and stromal components. We evaluated the expression status of ER, Bc12, p53, and MIB-1 protein in these tumors. One hundred and ninety-three tumors comprising of 117 FAs and 76 PTs were examined using immunohistochemistry on tissue microarray. The mean age of patients with FA was 28.5 years while the mean ages of patients with benign, borderline and malignant PTs were 41.7, 48.6 and 42.1 years, respectively. Also all types of PTs were large (>Scm). ER showed a strong nuclear staining in the epithelial component of all tumors while ER/3 immunoreactivity was detected in both the epithelial and stromal components ofF A and PT. ER/β (pcomponent were associated with tumor size. p53 expression was significantly associated with both the epithelial and stromal components of malignant PTs (pcomponent (p=0.000). In addition, MIB-1 was also found to be associated with ER and ER/3 in the stromal component (p=0.000). The expression of p53 with tumor size and histological grade in PT may increase the risk for malignancy.
International Nuclear Information System (INIS)
Fujita, Y.; Kamida, A.; Kato, I.; Yura, Y.; Ono, K.; Suzuki, M.; Sakurai, Y.; Ohnishi, T.; Ohnishi, K.
2006-01-01
The role of the p53 gene in the sensitivity of oral squamous cell carcinoma (SCC) to boron neutron capture therapy (BNCT) had not been studied. We examined the effect of boronophenylalanine (BPA)-mediated BNCT on oral SCC cells showing either wild-type p53 (SAS/neo) or mutated-type p53 (SAS/mp53). Survival ratio of cells was determined by colony formation. Cell viability was measured by MTT assay. Apoptotic cells were evaluated by flow cytometric analysis and nuclear DNA staining. When SAS/neo and SAS/mp53 cells were subjected to BNCT, more suppressive effects on colony formation and cell viability were observed in SAS/neo cells as compared with SAS/mp53. The proportion of apoptotic cells with DNA fragmentation was also increased in the cells with functional p53. These results suggest that oral SCC cells with mutated p53 cells are more resistant to BNCT than those with wild-type p53. BNCT must inhibit oral SCC cells in p53-dependent and p53-independent mechanisms. (author)
Caspase Activation and Aberrant Cell Growth in a p53+/+ Cell Line from a Li-Fraumeni Syndrome Family
Directory of Open Access Journals (Sweden)
Zaki A. Sherif
2015-01-01
Full Text Available Wild-type p53 is well known to induce cell cycle arrest and apoptosis to block aberrant cell growth. However, p53’s unique role in apoptosis and cell proliferation in Li-Fraumeni Syndrome (LFS has not been well elucidated. The aim of this study is to characterize the activity of wild-type p53 protein in LFS family dominated by a germline negative mutant p53. As expected, etoposide-treated wild-type p53-containing cell lines, LFS 2852 and control Jurkat, showed a greater rate of caspase- and annexin V-induced apoptotic cell death compared to the p53-mutant LFS 2673 cell line although mitochondrial and nuclear assays could not detect apoptosis in these organelles. The most intriguing part of the observation was the abnormal proliferation rate of the wild-type p53-containing cell line, which grew twice as fast as 2673 and Jurkat cells. This is important because apoptosis inducers acting through the mitochondrial death pathway are emerging as promising drugs against tumors where the role of p53 is not only to target gene regulation but also to block cell proliferation. This study casts a long shadow on the possible dysregulation of p53 mediators that enable cell proliferation. The deregulation of proliferation pathways represents an important anticancer therapeutic strategy for patients with the LFS phenotype.
Armitage, Mark
Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or
Wang, Yiping; Wong, Matthew Man-Kin; Zhang, Xiaojian; Chiu, Sung-Kay
2015-11-15
When cells are grown to confluence, cell-cell contact inhibition occurs and drives the cells to enter reversible quiescence rather than senescence. Confluent retinal pigment epithelial (RPE) cells exhibiting contact inhibition was used as a model in this study to examine the role of overexpression of transcription factor AP4, a highly expressed transcription factor in many types of cancer, in these cells during long-term culture. We generated stable inducible RPE cell clones expressing AP4 or AP4 without the DNA binding domain (DN-AP4) and observed that, when cultured for 24 days, RPE cells with a high level of AP4 exhibit a large, flattened morphology and even cease proliferating; these changes were not observed in DN-AP4-expressing cells or non-induced cells. In addition, AP4-expressing cells exhibited senescence-associated β-galactosidase activity and the senescence-associated secretory phenotype. We demonstrated that the induced cellular senescence was mediated by enhanced p53 expression and that AP4 regulates the p53 gene by binding directly to two of the three E-boxes present on the promoter of the p53 gene. Moreover, we showed that serum is essential for AP4 in inducing p53-associated cellular senescence. Collectively, we showed that overexpression of AP4 mediates cellular senescence involving in activation of p53 in long-term post-confluent RPE cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia
International Nuclear Information System (INIS)
Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina
2003-01-01
The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence
Hormonal control of p53 and chemoprevention
International Nuclear Information System (INIS)
Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C
2002-01-01
Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer
Sham, C L; To, K F; Chan, Paul K S; Lee, Dennis L Y; Tong, Michael C F; van Hasselt, C Andrew
2012-04-01
The purpose of this study of human papillomavirus (HPV), Epstein-Barr virus (EBV), p21, and p53 in sinonasal inverted papilloma (IP) was to help elucidate its pathogenesis. Seventy-three IPs, 48 nasal polyps, and 85 hypertrophied turbinates were subjected to HPV polymerase chain reaction (PCR) study. Seventy-three IPs, 30 nasal polyps, and 32 hypertrophied turbinates were subjected to EBV in situ hybridization (ISH), p21, and p53 immunohistochemical (IHC) studies. HPV was positive in 3 of 73 IPs (4.1%). All specimens were EBV negative. In all, 99% of IPs showed strong and diffuse p21 nuclear reactivity. Most nasal polyps and hypertrophied turbinates showed weak to moderate immunoreactivity of the basal and parabasal cells. Only focal p53 immunoreactivity of the basal and parabasal cells was found in 19% of IPs and 40% of nasal polyps. HPV prevalence of our IP is low. EBV is not present in IP. High p21 and low p53 expression in IP suggests a non-p53-dependent regulation pathway. Copyright © 2011 Wiley Periodicals, Inc.
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
Energy Technology Data Exchange (ETDEWEB)
Mohan, Vijay [School of Life Sciences, Central University of Gujarat, Gandhinagar, Gujarat (India); Agarwal, Rajesh [Department of Pharmaceutical Sciences, School of Pharmacy, University of Colorado Denver, Aurora, CO (United States); Singh, Rana P., E-mail: ranaps@hotmail.com [School of Life Sciences, Central University of Gujarat, Gandhinagar, Gujarat (India); Cancer Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi (India)
2016-09-02
Lung cancer is the most frequently diagnosed malignancy that contributes to high proportion of deaths globally among patients who die due to cancer. Chemotherapy remains the common mode of treatment for lung cancer patients though with limited success. We assessed the biological effects and associated molecular changes of evodiamine, a plant alkaloid, on human lung cancer A549 and H1299 cells along with other epithelial cancer and normal lung SAEC cells. Our data showed that 20–40 μM evodiamine treatment for 24–48 h strongly (up to 73%, P < 0.001) reduced the growth and survival of these cancer cells. However, it also moderately inhibited growth and survival of SAEC cells. A strong inhibition (P < 0.001) was observed on clonogenicity of A549 cells. Further, evodiamine increased (4-fold) mitochondrial membrane depolarization with 6-fold increase in apoptosis and a slight increase in Bax/Bcl-2 ratio. It increased the cytochrome-c release from mitochondria into the cytosol as well as nucleus. Cytosolic cytochrome-c activated cascade of caspase-9 and caspase-3 intrinsic pathway, however, DR5 and caspase-8 extrinsic pathway was also activated which could be due to nuclear cytochrome-c. Pan-caspase inhibitor (z-VAD.fmk) partially reversed evodiamine induced apoptosis. An increase in p53 as well as its serine 15 phosphorylation was also observed. Pifithrin-α, a p53 inhibitor, slightly inhibited growth of A549 cells and under p53 inhibitory condition evodiamine-induced apoptosis could not be reversed. Together these findings suggest that evodiamine is a strong inducer of apoptosis in lung epithelial cancer cells independent of their p53 status and that could involve both intrinsic as well as extrinsic pathway of apoptosis. Thus evodiamine could be a potential anticancer agent against lung cancer. - Highlights: • Evodiamine, a novel plant alkaloid, relatively selectively inhibited growth and survival of human lung cancer cells. • Increased cancer cell
International Nuclear Information System (INIS)
Djuzenova, Cholpon S.; Fiedler, Vanessa; Memmel, Simon; Katzer, Astrid; Hartmann, Susanne; Krohne, Georg; Zimmermann, Heiko; Scholz, Claus-Jürgen; Polat, Bülent; Flentje, Michael
2015-01-01
Glioblastoma cells exhibit highly invasive behavior whose mechanisms are not yet fully understood. The present study explores the relationship between the invasion capacity of 5 glioblastoma cell lines differing in p53 and PTEN status, expression of mTOR and several other marker proteins involved in cell invasion, actin cytoskeleton organization and cell morphology. We found that two glioblastoma lines mutated in both p53 and PTEN genes (U373-MG and SNB19) exhibited the highest invasion rates through the Matrigel or collagen matrix. In DK-MG (p53wt/PTENwt) and GaMG (p53mut/PTENwt) cells, F-actin mainly occurred in the numerous stress fibers spanning the cytoplasm, whereas U87-MG (p53wt/PTENmut), U373-MG and SNB19 (both p53mut/PTENmut) cells preferentially expressed F-actin in filopodia and lamellipodia. Scanning electron microscopy confirmed the abundant filopodia and lamellipodia in the PTEN mutated cell lines. Interestingly, the gene profiling analysis revealed two clusters of cell lines, corresponding to the most (U373-MG and SNB19, i.e. p53 and PTEN mutated cells) and less invasive phenotypes. The results of this study might shed new light on the mechanisms of glioblastoma invasion. - Highlights: • We examine 5 glioblastoma lines on the invasion capacity and actin cytoskeleton. • Glioblastoma cell lines mutated in both p53 and PTEN were the most invasive. • Less invasive cells showed much less lamellipodia, but more actin stress fibers. • A mechanism for the differences in tumor cell invasion is proposed
Energy Technology Data Exchange (ETDEWEB)
Djuzenova, Cholpon S., E-mail: djuzenova_t@ukw.de [Department of Radiation Oncology, University Hospital, Josef-Schneider-Strasse 11, D-97080 Würzburg (Germany); Fiedler, Vanessa [Department of Radiation Oncology, University Hospital, Josef-Schneider-Strasse 11, D-97080 Würzburg (Germany); Memmel, Simon [Lehrstuhl für Biotechnologie und Biophysik, Universität Würzburg, Biozentrum Am Hubland, 97070 Würzburg (Germany); Katzer, Astrid; Hartmann, Susanne [Department of Radiation Oncology, University Hospital, Josef-Schneider-Strasse 11, D-97080 Würzburg (Germany); Krohne, Georg [Elektronenmikroskopie, Biozentrum, Universität Würzburg, Am Hubland, 97070 Würzburg (Germany); Zimmermann, Heiko [Hauptabteilung Biophysik and Kryotechnologie, Fraunhofer-Institut für Biomedizinische Technik, Lehrstuhl für Molekulare und Zelluläre Biotechnologie/Nanotechnologie, Universität des Saarlandes, Ensheimer Strasse 48, 66386 St. Ingbert (Germany); Scholz, Claus-Jürgen [Interdisciplinary Center for Clinical Research, University Hospital, Versbacher Strasse 7, 97078 Würzburg (Germany); Polat, Bülent; Flentje, Michael [Department of Radiation Oncology, University Hospital, Josef-Schneider-Strasse 11, D-97080 Würzburg (Germany); and others
2015-01-15
Glioblastoma cells exhibit highly invasive behavior whose mechanisms are not yet fully understood. The present study explores the relationship between the invasion capacity of 5 glioblastoma cell lines differing in p53 and PTEN status, expression of mTOR and several other marker proteins involved in cell invasion, actin cytoskeleton organization and cell morphology. We found that two glioblastoma lines mutated in both p53 and PTEN genes (U373-MG and SNB19) exhibited the highest invasion rates through the Matrigel or collagen matrix. In DK-MG (p53wt/PTENwt) and GaMG (p53mut/PTENwt) cells, F-actin mainly occurred in the numerous stress fibers spanning the cytoplasm, whereas U87-MG (p53wt/PTENmut), U373-MG and SNB19 (both p53mut/PTENmut) cells preferentially expressed F-actin in filopodia and lamellipodia. Scanning electron microscopy confirmed the abundant filopodia and lamellipodia in the PTEN mutated cell lines. Interestingly, the gene profiling analysis revealed two clusters of cell lines, corresponding to the most (U373-MG and SNB19, i.e. p53 and PTEN mutated cells) and less invasive phenotypes. The results of this study might shed new light on the mechanisms of glioblastoma invasion. - Highlights: • We examine 5 glioblastoma lines on the invasion capacity and actin cytoskeleton. • Glioblastoma cell lines mutated in both p53 and PTEN were the most invasive. • Less invasive cells showed much less lamellipodia, but more actin stress fibers. • A mechanism for the differences in tumor cell invasion is proposed.
The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.
Directory of Open Access Journals (Sweden)
Krzysztof Puszynski
2014-12-01
Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.
Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy
Directory of Open Access Journals (Sweden)
Christian Bressy
2017-06-01
Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.
The role of p53 and pRB in apoptosis and cancer
DEFF Research Database (Denmark)
Hickman, Emma S; Moroni, M Cristina; Helin, Kristian
2002-01-01
Loss of function of both the p53 pathway and the retinoblastoma protein (pRB) pathway plays a significant role in the development of most human cancers. Loss of pRB results in deregulated cell proliferation and apoptosis, whereas loss of p53 desensitizes cells to checkpoint signals, including...
CLCA2 as a p53-Inducible Senescence Mediator
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2012-02-01
Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.
Targeting p53 by small molecules in hematological malignancies
Saha, Manujendra N; Qiu, Lugui; Chang, Hong
2013-01-01
p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their ant...
Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model
International Nuclear Information System (INIS)
Tong, Ying; Smith, M.A.; Tucker, S.B.
1997-01-01
Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab
Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua
2017-06-01
The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.
Milbradt, Jens; Sonntag, Eric; Wagner, Sabrina; Strojan, Hanife; Wangen, Christina; Lenac Rovis, Tihana; Lisnic, Berislav; Jonjic, Stipan; Sticht, Heinrich; Britt, William J; Schlötzer-Schrehardt, Ursula; Marschall, Manfred
2018-01-13
The nuclear phase of herpesvirus replication is regulated through the formation of regulatory multi-component protein complexes. Viral genomic replication is followed by nuclear capsid assembly, DNA encapsidation and nuclear egress. The latter has been studied intensely pointing to the formation of a viral core nuclear egress complex (NEC) that recruits a multimeric assembly of viral and cellular factors for the reorganization of the nuclear envelope. To date, the mechanism of the association of human cytomegalovirus (HCMV) capsids with the NEC, which in turn initiates the specific steps of nuclear capsid budding, remains undefined. Here, we provide electron microscopy-based data demonstrating the association of both nuclear capsids and NEC proteins at nuclear lamina budding sites. Specifically, immunogold labelling of the core NEC constituent pUL53 and NEC-associated viral kinase pUL97 suggested an intranuclear NEC-capsid interaction. Staining patterns with phospho-specific lamin A/C antibodies are compatible with earlier postulates of targeted capsid egress at lamina-depleted areas. Important data were provided by co-immunoprecipitation and in vitro kinase analyses using lysates from HCMV-infected cells, nuclear fractions, or infectious virions. Data strongly suggest that nuclear capsids interact with pUL53 and pUL97. Combined, the findings support a refined concept of HCMV nuclear trafficking and NEC-capsid interaction.
Directory of Open Access Journals (Sweden)
Jens Milbradt
2018-01-01
Full Text Available The nuclear phase of herpesvirus replication is regulated through the formation of regulatory multi-component protein complexes. Viral genomic replication is followed by nuclear capsid assembly, DNA encapsidation and nuclear egress. The latter has been studied intensely pointing to the formation of a viral core nuclear egress complex (NEC that recruits a multimeric assembly of viral and cellular factors for the reorganization of the nuclear envelope. To date, the mechanism of the association of human cytomegalovirus (HCMV capsids with the NEC, which in turn initiates the specific steps of nuclear capsid budding, remains undefined. Here, we provide electron microscopy-based data demonstrating the association of both nuclear capsids and NEC proteins at nuclear lamina budding sites. Specifically, immunogold labelling of the core NEC constituent pUL53 and NEC-associated viral kinase pUL97 suggested an intranuclear NEC-capsid interaction. Staining patterns with phospho-specific lamin A/C antibodies are compatible with earlier postulates of targeted capsid egress at lamina-depleted areas. Important data were provided by co-immunoprecipitation and in vitro kinase analyses using lysates from HCMV-infected cells, nuclear fractions, or infectious virions. Data strongly suggest that nuclear capsids interact with pUL53 and pUL97. Combined, the findings support a refined concept of HCMV nuclear trafficking and NEC-capsid interaction.
Knockdown of p53 suppresses Nanog expression in embryonic stem cells
Energy Technology Data Exchange (ETDEWEB)
Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)
2014-01-10
Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.
Directory of Open Access Journals (Sweden)
Hanqian Mao
2016-09-01
Full Text Available The exon junction complex (EJC is an RNA binding complex comprised of the core components Magoh, Rbm8a, and Eif4a3. Human mutations in EJC components cause neurodevelopmental pathologies. Further, mice heterozygous for either Magoh or Rbm8a exhibit aberrant neurogenesis and microcephaly. Yet despite the requirement of these genes for neurodevelopment, the pathogenic mechanisms linking EJC dysfunction to microcephaly remain poorly understood. Here we employ mouse genetics, transcriptomic and proteomic analyses to demonstrate that haploinsufficiency for each of the 3 core EJC components causes microcephaly via converging regulation of p53 signaling. Using a new conditional allele, we first show that Eif4a3 haploinsufficiency phenocopies aberrant neurogenesis and microcephaly of Magoh and Rbm8a mutant mice. Transcriptomic and proteomic analyses of embryonic brains at the onset of neurogenesis identifies common pathways altered in each of the 3 EJC mutants, including ribosome, proteasome, and p53 signaling components. We further demonstrate all 3 mutants exhibit defective splicing of RNA regulatory proteins, implying an EJC dependent RNA regulatory network that fine-tunes gene expression. Finally, we show that genetic ablation of one downstream pathway, p53, significantly rescues microcephaly of all 3 EJC mutants. This implicates p53 activation as a major node of neurodevelopmental pathogenesis following EJC impairment. Altogether our study reveals new mechanisms to help explain how EJC mutations influence neurogenesis and underlie neurodevelopmental disease.
Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.
Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M
2015-12-01
Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.
Regulation of Metabolic Activity by p53
Directory of Open Access Journals (Sweden)
Jessica Flöter
2017-05-01
Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.
Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa
2016-07-26
DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.
Post-translational regulation enables robust p53 regulation.
Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling
2013-08-30
The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.
Zhang, Qingyu; Liu, Jie; Liu, Bin; Xia, Juan; Chen, Nianping; Chen, Xiaofeng; Cao, Yi; Zhang, Chen; Lu, Caijie; Li, Mingyi; Zhu, Runzhi
2014-04-01
The development of antitumor chemotherapy drugs remains a key goal for oncologists, and natural products provide a vast resource for anti-cancer drug discovery. In the current study, we found that the flavonoid dihydromyricetin (DHM) exhibited antitumor activity against liver cancer cells, including primary cells obtained from hepatocellular carcinoma (HCC) patients. In contrast, DHM was not cytotoxic to immortalized normal liver cells. Furthermore, DHM treatment resulted in the growth inhibition and remission of xenotransplanted tumors in nude mice. Our results further demonstrated that this antitumor activity was caused by the activation of the p53-dependent apoptosis pathway via p53 phosphorylation at serine (15Ser). Moreover, our results showed that DHM plays a dual role in the induction of cell death when administered in combination with cisplatin, a common clinical drug that kills primary hepatoma cells but not normal liver cells.
An adaptive molecular timer in p53-meidated cell fate decision
Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei
The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).
DEFF Research Database (Denmark)
Hermann, G G; Horn, T; Steven, K
1998-01-01
and routinely grouped according to the level of lamina propria invasion. Invasion of the tumor stalk was defined as stage T1a, invasion of the lamina propria proper superficial to the level of muscularis mucosa as stage T1b and into or deeper than the muscularis mucosa as stage T1c. The p53 nuclear...
International Nuclear Information System (INIS)
Cardoso, F.M.; Kato, Sayuri E.M.; Huang Wenying; Flint, S. Jane; Gonzalez, Ramon A.
2008-01-01
It is well established that the human subgroup C adenovirus type 5 (Ad5) E1B 55 kDa protein can regulate the activity and concentration of the cellular tumor suppressor, p53. However, the contribution(s) of these functions of the E1B protein to viral reproduction remains unclear. To investigate this issue, we examined properties of p53 in normal human cells infected by E1B mutant viruses that display defective entry into the late phase or viral late mRNA export. The steady-state concentrations of p53 were significantly higher in cells infected by the E1B 55 kDa null mutant Hr6 or three mutants carrying small insertions in the E1B 55 kDa protein coding sequence than in Ad5-infected cells. Nevertheless, none of the mutants induced apoptosis in infected cells. Rather, the localization of p53 to E1B containing nuclear sites observed during infection by Ad5 was prevented by mutations that impair interaction of the E1B protein with p53 and/or with the E4 Orf6 protein. These results indicate that the E1B protein fulfills an early function that correlates efficient entry into the late phase with the localization of E1B and p53 in the nucleus of Ad5-infected normal human cells
Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef
2005-07-01
To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.
The p53 gene with emphasis on its paralogues in mosquitoes
Directory of Open Access Journals (Sweden)
Tien-Huang Chen
2017-12-01
Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Analysis of the K-ras and p53 pathways in x-ray-induced lung tumors in the rat
Energy Technology Data Exchange (ETDEWEB)
Belinsky, S.A.; Middleton, S.K.; Hahn, F.F.; Nikula, K.J. [Inhalation Toxicology Research Inst., Albuquerque, NM (United States); Picksley, S.M. [Medical Sciences Inst., Dundee (United Kingdom)
1996-04-01
The risk from exposure to low-dose radiation in conjunction with cigarette smoking has not been estimated due in part to lmited knowledge surrounding the molecular mechanisms underlying radiation-induced cancers. The purpose of this investigation was to determine the frequency for alterations in genes within the K-ras and p53 signal and cell cycle regulatory pathways, respectively, in X-ray-induced lung tumors in the F344/N rat. These tumors were examined for genetic alterations in the K-ras, c-raf-1, p53, mdm2 and cip1 genes. No K-ras mutations were detected by sequencing in 18 squamous cell carcinomas (SCCs) or 17 adenocarcinomas. However, using a K-ras codon 12 mutation selection assay, a codon 12 GGT {r_arrow} GAT mutation was detected in one SCC, suggesting that activation of the K-ras proto-oncogene is both a rare and late event. Single-strand conformation polymorphism (SSCP) analysis of the kinase-binding domain of the c-raf-1 gene did not detect any polymorphisms. Three of 18 SCCs but none of the adenocarcinomas showed p53 nuclear immunoreactivity. Single-strand conformation polymorphism analysis of exons 4-9 of the p53 gene detected only an exon 9 mutation in one SCC. Mutations were not detected in the three SCCs with immunoreactive p53 protein. No amplification of the mdm2 gene was detected; however, nuclear mdm2 immunoreactivity was present in one of the three SCCs that stained positive for the p53 protein. The complete cDNA of the rat cip1 gene comprising 810 bases was cloned and sequenced. The frequency of somatic mutations in exon 2 of the cip1 gene was determined by SSCP analysis. No alterations in electrophoretic mobility were detected. The results of this investigation indicate that alterations in the K-ras and p53 pathways do not play a major role in the genesis of X-ray-induced lung tumors in the rat. 49 refs., 5 figs.
Mitofusin-2 is a novel direct target of p53
International Nuclear Information System (INIS)
Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen
2010-01-01
Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.
ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway
International Nuclear Information System (INIS)
Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan
2007-01-01
We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang
2008-01-01
Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)
The Prognostic Impact of p53 Expression on Sporadic Colorectal Cancer Is Dependent on p21 Status
International Nuclear Information System (INIS)
Kruschewski, Martin; Mueller, Kathrin; Lipka, Sybille; Budczies, Jan; Noske, Aurelia; Buhr, Heinz Johannes; Elezkurtaj, Sefer
2011-01-01
The prognostic value of p53 and p21 expression in colorectal cancer is still under debate. We hypothesize that the prognostic impact of p53 expression is dependent on p21 status. The expression of p53 and p21 was immunohistochemically investigated in a prospective cohort of 116 patients with UICC stage II and III sporadic colorectal cancer. The results were correlated with overall and recurrence-free survival. The mean observation period was 51.8 ± 2.5 months. Expression of p53 was observed in 72 tumors (63%). Overall survival was significantly better in patients with p53-positive carcinomas than in those without p53 expression (p = 0.048). No differences were found in recurrence-free survival (p = 0.161). The p53+/p21− combination was seen in 68% (n = 49), the p53+/p21+ combination in 32% (n = 23). Patients with p53+/p21− carcinomas had significantly better overall and recurrence-free survival than those with p53+/p21+ (p < 0.0001 resp. p = 0.003). Our data suggest that the prognostic impact of p53 expression on sporadic colorectal cancer is dependent on p21 status
Gene expression patterns associated with p53 status in breast cancer
International Nuclear Information System (INIS)
Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M
2006-01-01
Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes
Clonal expansion to anaplasia in Wilms` tumors is associated with p53 mutations
Energy Technology Data Exchange (ETDEWEB)
Pelletier, J.; Beckwith, B.; Bardeesy, N. [Loma Linda Univ., CA (United States)]|[McGill Univ., Montreal (Canada)
1994-09-01
The genetics of Wilms` tumor (WT), a pediatric malignancy of the kidney, is complex. Three loci are implicated in WT initiation and include the WT1 tumor suppressor gene (residing at 11p13), an 11p15 locus, and a non-11p locus. As well, allelic loss at 16q24 in {approximately}20% of sporadic WTs suggests the location of (an) additional gene(s) involved in tumor progression. Initiation and progression in WTs is associated with multiple histological variants. Anaplasia is a rare WT subtype associated with poor prognosis and defined by enlarged and multipolar mitotic figures, a threefold nuclear enlargement (compared with adjacent nuclei of the same cell type), and hyperchromasia of the enlarged nuclei. We have previously demonstrated that p53 gene mutations are exclusively associated with anaplastic WTs, being absent from a large number of non-anaplastic WTs analyzed. To determine if such mutations are involved in clonal progression to anaplasia, we performed a retrospective analysis of histologically defined sections from tumor specimens. Six of ten WTs demonstrated p53 mutations by PCR-single stranded conformational polymorphism analysis. Two of these samples were paired, consisting of geographically demarcated anaplastic cells embedded within a non-anaplastic tumor bed. In these cases, p53 mutations were only present in the anaplastic region of the tumor. An overall decrease in the number of apoptotic cells was found associated with the anaplastic tumor region, compared to adjacent non-anaplastic tumor bed. These results indicate that p53 mutations arise during progression to anaplasia late in Wilms` tumor etiology and are associated with a more aggressive form of this cancer.
Effect of p53 genotype on gene expression profiles in murine liver
International Nuclear Information System (INIS)
Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.
2008-01-01
The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
Directory of Open Access Journals (Sweden)
Mauro Risio
2000-01-01
Full Text Available Western‐style diets (WDs trigger and sustain the early phases of tumorigenesis in mouse colon, and when continued throughout the life span lead to the development of dysplastic crypts. In order to evaluate the roles both of cell proliferation and programmed cell death (PCD in WD‐induced tumorigenesis, immunohistochemical detection of proliferating nuclear antigen (PCNA, in situ end labeling (TUNEL of DNA breaks, and p53 protein were carried out in mouse colonic mucosa during prolonged feeding of two WDs. PCNA Labeling Index of colonic crypts was significantly higher in WD‐treated animals than in controls only at the beginning of the nutritional study, the gap rapidly bridged by increased cell proliferation spontaneously occurring in the colonic mucosa during aging. A transient early homeostatic activation of PCD at the base of the crypt also was observed in WD groups. No changes in PCD were seen in the upper third of the crypt or in surface epithelium throughout the study, indicating that PCD in that colonic crypt segment produces a constant flux of cell loss, uninfluenced by homeostatic fluctuations. A major finding was an irreversible, progressive, age‐related decline of PCD at the crypt base in both control and treated animals that occurred during the second half of the rodents life span. p53 protein was not immunohistochemically detected, suggesting that neither overexpression of wild‐type nor mutated forms of the protein are involved in the above mentioned changes.
Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition
Energy Technology Data Exchange (ETDEWEB)
Yang, Zhihong; Zhang, Yuxia [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States); Wang, Li, E-mail: l.wang@hsc.utah.edu [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States)
2012-01-13
Highlights: Black-Right-Pointing-Pointer Mdm2 enhances HNF4{alpha} activation of the ApoCIII promoter via interaction with HNF4{alpha}. Black-Right-Pointing-Pointer p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer Mdm2 alters the enrichment of HNF4{alpha}, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4{alpha}. A direct association of Mdm2 protein with the HNF4{alpha} protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4{alpha} activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4{alpha} to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.
Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition
International Nuclear Information System (INIS)
Yang, Zhihong; Zhang, Yuxia; Wang, Li
2012-01-01
Highlights: ► Mdm2 enhances HNF4α activation of the ApoCIII promoter via interaction with HNF4α. ► p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. ► SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. ► Mdm2 alters the enrichment of HNF4α, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4α. A direct association of Mdm2 protein with the HNF4α protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4α activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4α to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.
The antagonism between MCT-1 and p53 affects the tumorigenic outcomes
Directory of Open Access Journals (Sweden)
Lin Tai-Du
2010-12-01
Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.
Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.
Directory of Open Access Journals (Sweden)
Kristina Kirschner
2015-03-01
Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.
International Nuclear Information System (INIS)
Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing; Guo Chun; Zhu Faliang; Yang Qiaozi; Gao Guimin; Gong Yaoqin; Shao Changshun
2009-01-01
Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis
Energy Technology Data Exchange (ETDEWEB)
Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Guo Chun; Zhu Faliang [Institute of Immunology, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Yang Qiaozi [Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States); Gao Guimin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Gong Yaoqin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China)], E-mail: yxg8@sdu.edu.cn; Shao Changshun [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States)], E-mail: shao@biology.rutgers.edu
2009-03-09
Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis.
DEFF Research Database (Denmark)
Honoré, Bent; Buus, Søren; Claësson, Mogens H
2008-01-01
ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two-dimensiona......ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two...... alpha type 3, transforming acidic coiled-coil containing protein 3, mitochondrial ornithine aminotransferase and epidermal fatty acid binding protein and down-regulation of adenylosuccinate synthetase, tubulin beta-3 chain, a 25 kDa actin fragment, proteasome subunit beta type 9, cofilin-1 and glia...
Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression
Directory of Open Access Journals (Sweden)
Shang-Jui Wang
2016-10-01
Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.
p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma
Directory of Open Access Journals (Sweden)
Sally Hopkins-Donaldson
2006-07-01
Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
International Nuclear Information System (INIS)
Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina
2006-01-01
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it
2006-02-22
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.
Directory of Open Access Journals (Sweden)
Vladim and iacute;r Barto and scaron;
2016-12-01
Full Text Available Objective: Nuclear expression of p53 protein is associated with a biological behavior in a variety of human malignancies. In cutaneous basal cell carcinoma (BCC, however, many studies have provided conflicting results in this regard. We aimed to determine whether there is relationship between p53 expression and different histologic subtypes of BCC, and whether it may indicate tumor aggressiveness. Materials and Methods: Biopsy samples from 66 cutaneous BCCs from 57 patients were collected. P53 expression was demonstrated by immunohistochemical staining using the anti-p53 antibody. Among them, 52 cases were also evaluated for Ki-67 antigen. Results: Immunoreactivity of p53 protein varied in the range of 0 to 100% of total tumor tissue (mean value 46.0%. The expression exceeding 5% of cancer tissue (positive staining was found in 54 BCCs (81.8%. Within this group, there were 25 cases (37.9% with low and 29 cases (43.9% with high expression. In superficial, superficial-nodular, nodular, nodular-infiltrative and infiltrative BCCs, p53 protein positivity was found in 100% (8/8, 80% (8/10, 70.4% (19/27, 88.2% (15/17 and 100% (4/4, respectively. We did not reveal a significant correlation between the extent of p53 protein expression and BCC subtypes except for nodular BCC, in which a number of negative cases (8/27, 29.6% were just above the threshold of statistical significance (P = 0.04. After merging cancers into non-aggressive and aggressive growth phenotype, no association with expression of p53 protein was found. There was no relationship between p53 protein expression and topographical sites after they have been gathered into sun-exposed and sun-protected locations. We did not observe any association between expression of p53 protein and Ki-67 antigen. Conclusion: In cutaneous BCC, the expression of p53 protein does not seem to reflect a biological behavior and tumor aggressiveness. Therefore, in a routine dermatopathological practice
Family matters: sibling rivalry and bonding between p53 and p63 in cancer.
Romano, Rose-Anne; Sinha, Satrajit
2014-04-01
The p53 family (p53, p63 and p73) is intimately linked with an overwhelming number of cellular processes during normal physiological as well as pathological conditions including cancer. The fact that these proteins are expressed in myriad isoforms, each with unique biochemical properties and distinct effects on tumorigenesis, complicates their study. A case in point is Squamous Cell Carcinoma (SCC) where p53 is often mutated and the ΔNp63 isoform is overexpressed. Given that p53 and p63 can hetero-dimerize, bind to quite similar DNA elements and share common co-factors, any alterations in their individual expression levels, activity and/or mutation can severely disrupt the family equilibrium. The burgeoning genomics data sets and new additions to the experimental toolbox are offering crucial insights into the complex role of the p53 family in SCC, but more mechanistic studies are needed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
p53 tumor suppressor gene: significance in neoplasia - a review
International Nuclear Information System (INIS)
Alam, J.M.
2000-01-01
p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)
Directory of Open Access Journals (Sweden)
Bongiovanni Laura
2012-06-01
Full Text Available Abstract Background Osteosarcoma (OSA represents the most common canine primary bone tumour. Despite several pathways have been investigated so far, few molecules have been identified as prognostic tools or potential therapeutic targets, and there is still the need to find out molecular pathways with specific influence over OSA progression to facilitate earlier prognosis and treatment. Aims of the present study were to evaluate the immunohistochemical pattern and levels of expression of a panel of molecules (survivin, β-catenin, caspase 3 -inactive and active forms- and p53 involved in cell cycle and apoptosis regulation in canine OSA samples, known to be of interest in the study also of human OSA, and to detect specific relations among them and with histological tumour grade, disease free interval (DFI and overall survival (OS. Results Nuclear β-catenin immunostaining was detected in normal osteoblasts adjacent to the tumour, and in 47% of the cases. Cytoplasmic and/or membranous immunostaining were also observed. Nuclear survivin and p53 positive cells were found in all cases. Moderate/high cytoplasmic β-catenin expression (≥10% positive cells was significantly associated with the development of metastasis (P = 0.014; moderate/high nuclear p53 expression (≥10% positive cells was significantly associated with moderate/high histological grade (P = 0.017 and shorter OS (P = 0.049. Moderate/high nuclear survivin expression (≥15% positive cells showed a tendency toward a longer OS (P = 0,088. Conclusions The present results confirmed p53 as negative prognostic marker, while suggested survivin as a potential positive prognostic indicator, rather than indicative of a poor prognosis. The detection of nuclear β-catenin immunostaining in normal osteoblasts and the absent/low expression in most of the OSAs, suggested that this pathway could not play a major role in oncogenic transformation of canine osteoblasts. Further studies
Directory of Open Access Journals (Sweden)
Fuqiang Xing
Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.
POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.
Energy Technology Data Exchange (ETDEWEB)
ANDERSON,C.W.APPELLA,E.
2003-10-23
The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.
Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73
Directory of Open Access Journals (Sweden)
Lu Xin
2009-06-01
Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.
The role of p53 molecule in radiation and hyperthermic therapies
International Nuclear Information System (INIS)
Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo
2003-01-01
In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4
Therapeutic targeting of the p53 pathway in cancer stem cells
Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.
2013-01-01
Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602
Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts
Energy Technology Data Exchange (ETDEWEB)
Dai, Jiawen [Molecular Radiobiology Laboratory, Division of Cellular and Molecular Research (Singapore); Itahana, Koji, E-mail: koji.itahana@duke-nus.edu.sg [Cancer and Stem Cell Biology Program, Duke-NUS Graduate Medical School (Singapore); Baskar, Rajamanickam, E-mail: r.baskar@nccs.com.sg [Molecular Radiobiology Laboratory, Division of Cellular and Molecular Research (Singapore); Department of Radiation Oncology, National Cancer Centre (Singapore)
2015-02-27
Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G{sub 1}/S or G{sub 2}/M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G{sub 0}, therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involved in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its
Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts
International Nuclear Information System (INIS)
Dai, Jiawen; Itahana, Koji; Baskar, Rajamanickam
2015-01-01
Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G 1 /S or G 2 /M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G 0 , therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involved in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its known role in
Roles of p53, MYC and HIF-1 in regulating glycolysis - the seventh hallmark of cancer.
Yeung, S J; Pan, J; Lee, M-H
2008-12-01
Despite diversity in genetic events in oncogenesis, cancer cells exhibit a common set of functional characteristics. Otto Warburg discovered that cancer cells have consistently higher rates of glycolysis than normal cells. The underlying mechanisms leading to the Warburg phenomenon include mitochondrial changes, upregulation of rate-limiting enzymes/proteins in glycolysis and intracellular pH regulation, hypoxia-induced switch to anaerobic metabolism, and metabolic reprogramming after loss of p53 function. The regulation of energy metabolism can be traced to a "triad" of transcription factors: c-MYC, HIF-1 and p53. Oncogenetic changes involve a nonrandom set of gene deletions, amplifications and mutations, and many oncogenes and tumor suppressor genes cluster along the signaling pathways that regulate c-MYC, HIF-1 and p53. Glycolysis in cancer cells has clinical implications in cancer diagnosis, treatment and interaction with diabetes mellitus. Many drugs targeting energy metabolism are in development. Future advances in technology may bring about transcriptome and metabolome-guided chemotherapy.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455
Evidence for the interaction of the regulatory protein Ki-1/57 with p53 and its interacting proteins
International Nuclear Information System (INIS)
Nery, Flavia C.; Rui, Edmilson; Kuniyoshi, Tais M.; Kobarg, Joerg
2006-01-01
Ki-1/57 is a cytoplasmic and nuclear phospho-protein of 57 kDa and interacts with the adaptor protein RACK1, the transcription factor MEF2C, and the chromatin remodeling factor CHD3, suggesting that it might be involved in the regulation of transcription. Here, we describe yeast two-hybrid studies that identified a total of 11 proteins interacting with Ki-1/57, all of which interact or are functionally associated with p53 or other members of the p53 family of proteins. We further found that Ki-1/57 is able to interact with p53 itself in the yeast two-hybrid system when the interaction was tested directly. This interaction could be confirmed by pull down assays with purified proteins in vitro and by reciprocal co-immunoprecipitation assays from the human Hodgkin analogous lymphoma cell line L540. Furthermore, we found that the phosphorylation of p53 by PKC abolishes its interaction with Ki-1/57 in vitro
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-07-15
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137
Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4
Directory of Open Access Journals (Sweden)
Ravshan Burikhanov
2014-01-01
Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...
Apoptosis in spermatogonia irradiated P53 null mice
International Nuclear Information System (INIS)
Streit-Bianchi, M.; Hendry, J.H.; Roberts, S.A.; Morris, J.D.; Durgaryan, A.A.
2007-01-01
Complete text of publication follows. The exposure of germ cells to ionizing radiations is of concern both from high-dose therapeutic exposures and from low doses causing deleterious trans-generational mutations. P53 protein plays an important role in cellular damage and is expressed in the testis normally during meiosis, its expression being localised to the preleptotene and early/mid pachytene spermatocytes. P53 null mice, heterozygotes possessing a 129 Sv/C57BL6 genetic background and B6D2F1 mice have been irradiated to 1 and 2 Gy single doses. Fractionated exposures of 1+1 Gy at 4 hours interval were also carried out. Apoptosis induction, spermatogonia and spermatocytes survival were assessed by microscope analysis of histological samples at 4 to 96 hours after irradiation in time-course experiments. The same end-points were also assessed at 72 and 96 hours after irradiation to single doses in the region between 20cGy to 2Gy. A dose dependent level of p53 expression was observed at 4 hours after irradiation to 1 and 2 Gy which returned to normal level by 24 hours. Our data support a two process mode of apoptosis with a first wave around 12 hours followed by a second wave at 2-3 days. The first wave apoptosis is substantially reduced in p53 null mice whereas the second wave is reduced in B6D2F1 mice. The initial increase in apoptosis was delayed in some stages of the of germ cells development which were identified by the spermatids shape. Clear correlation exists between apoptosis and survival assessed in stage XI-XII Tubules 72 hours after irradiation. The data are in agreement with other data in literature indicating that irradiated spermatogonia die through apoptosis. The lack of apoptosis observed in p53 null mice results in a very high survival rate of daughter cells assessed later. Theses spermatocytes and the following progenitor cells are likely to carry mutations as most will not die in the smaller second wave of apoptosis observed 3 days after
Pax3 stimulates p53 ubiquitination and degradation independent of transcription.
Directory of Open Access Journals (Sweden)
Xiao Dan Wang
Full Text Available Pax3 is a developmental transcription factor that is required for neural tube and neural crest development. We previously showed that inactivating the p53 tumor suppressor protein prevents neural tube and cardiac neural crest defects in Pax3-mutant mouse embryos. This demonstrates that Pax3 regulates these processes by blocking p53 function. Here we investigated the mechanism by which Pax3 blocks p53 function.We employed murine embryonic stem cell (ESC-derived neuronal precursors as a cell culture model of embryonic neuroepithelium or neural crest. Pax3 reduced p53 protein stability, but had no effect on p53 mRNA levels or the rate of p53 synthesis. Full length Pax3 as well as fragments that contained either the DNA-binding paired box or the homeodomain, expressed as GST or FLAG fusion proteins, physically associated with p53 and Mdm2 both in vitro and in vivo. In contrast, Splotch Pax3, which causes neural tube and neural crest defects in homozygous embryos, bound weakly, or not at all, to p53 or Mdm2. The paired domain and homeodomain each stimulated Mdm2-mediated ubiquitination of p53 and p53 degradation in the absence of the Pax3 transcription regulatory domains, whereas Splotch Pax3 did not stimulate p53 ubiquitination or degradation.Pax3 inactivates p53 function by stimulating its ubiquitination and degradation. This process utilizes the Pax3 paired domain and homeodomain but is independent of DNA-binding and transcription regulation. Because inactivating p53 is the only required Pax3 function during neural tube closure and cardiac neural crest development, and inactivating p53 does not require Pax3-dependent transcription regulation, this indicates that Pax3 is not required to function as a transcription factor during neural tube closure and cardiac neural crest development. These findings further suggest novel explanations for PAX3 functions in human diseases, such as in neural crest-derived cancers and Waardenburg syndrome types 1 and 3.
Application of the resonant 52(p,γ)53Mn reaction to the measurement of chromium depth distributions
International Nuclear Information System (INIS)
Switkowski, Z.E.; Petty, R.J.; Clark, G.J.
1979-01-01
A resonance in the 52 Cr(p,γ) 53 Mn reaction has been investigated as a probe for the quantitative determination of chromium depth distributions. The relevant nuclear parameters of this resonance were measured to be: resonance energy, Esub(p)1005.2 +- 0.2 keV, total width GAMMA < 100 eV, and resonance strength, (2J+1)GAMMAsub(p)GAMMAsub(γ)/GAMMA = 0.89 +-0.11 eV. As an example of the use of the nuclear resonance technique, the chromium profile of an electroplated chrome black solar absorber surface has been studied and the results are presented
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin
2016-01-01
with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...
Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine
2009-04-01
Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.
p53-dependent non-coding RNA networks in chronic lymphocytic leukemia
Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.
2015-01-01
Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We
Thymocyte apoptosis induced by p53-dependent and independent pathways
International Nuclear Information System (INIS)
Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.
1993-01-01
The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)
Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido
2004-01-01
The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-κB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor κB (NF-κB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p5...
The Neuronal Ischemic Tolerance Is Conditioned by the Tp53 Arg72Pro Polymorphism.
Ramos-Araque, Maria E; Rodriguez, Cristina; Vecino, Rebeca; Cortijo Garcia, Elisa; de Lera Alfonso, Mercedes; Sanchez Barba, Mercedes; Colàs-Campàs, Laura; Purroy, Francisco; Arenillas, Juan F; Almeida, Angeles; Delgado-Esteban, Maria
2018-04-23
Cerebral preconditioning (PC) confers endogenous brain protection after stroke. Ischemic stroke patients with a prior transient ischemic attack (TIA) may potentially be in a preconditioned state. Although PC has been associated with the activation of pro-survival signals, the mechanism by which preconditioning confers neuroprotection is not yet fully clarified. Recently, we have described that PC-mediated neuroprotection against ischemic insult is promoted by p53 destabilization, which is mediated by its main regulator MDM2. Moreover, we have previously described that the human Tp53 Arg72Pro single nucleotide polymorphism (SNP) controls susceptibility to ischemia-induced neuronal apoptosis and governs the functional outcome of patients after stroke. Here, we studied the contribution of the human Tp53 Arg72Pro SNP on PC-induced neuroprotection after ischemia. Our results showed that cortical neurons expressing the Pro72-p53 variant exhibited higher PC-mediated neuroprotection as compared with Arg72-p53 neurons. PC prevented ischemia-induced nuclear and cytosolic p53 stabilization in Pro72-p53 neurons. However, PC failed to prevent mitochondrial p53 stabilization, which occurs in Arg72-p53 neurons after ischemia. Furthermore, PC promoted neuroprotection against ischemia by controlling the p53/active caspase-3 pathway in Pro72-p53, but not in Arg72-p53 neurons. Finally, we found that good prognosis associated to TIA within 1 month prior to ischemic stroke was restricted to patients harboring the Pro72 allele. Our findings demonstrate that the Tp53 Arg72Pro SNP controls PC-promoted neuroprotection against a subsequent ischemic insult by modulating mitochondrial p53 stabilization and then modulates TIA-induced ischemic tolerance.
Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.
Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino
2015-10-01
The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.
HEXIM1, a New Player in the p53 Pathway
Energy Technology Data Exchange (ETDEWEB)
Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)
2013-07-04
Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.
Regulation of Mdmx and its role in the p53 pathway
Meulmeester, Erik
2006-01-01
The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to
p53 expression in biopsies from children with Langerhans cell histiocytosis
DEFF Research Database (Denmark)
Bank, Micha I; Lundegaard, Pia Rengtved; Carstensen, Henrik
2002-01-01
based on CD1a positivity. The slides were stained with p53 antibody and semiquantitatively evaluated using a grading system from 1 to 5 as an estimate for 0% to 20%, 20% to 40%, 40% to 60%, 60% to 80%, and 80% to 100% p53-positive for pathologic Langerhans cells (pLC), respectively. RESULTS: The p53...... protein was expressed in various degrees in pLC in all lesions. The degree of p53 expression could not be correlated to either clinical manifestation or outcome. CONCLUSIONS: An increased expression of p53 in pLC indicates an altered DNA repair control with or without abnormal control of apoptosis....
Mutual interactions between P53 and growth factors in cancer
Asschert, JGW; Vellenga, E; De Jong, S; De Vries, EGE
1998-01-01
The function of p53 armour suppressor protein is determined by various intrinsic properties of the protein. The effect of p53 DNA-binding, and platein-protein interactions are determined by the conformation of the protein. Thus p53 fulfils its role in cell cycle control and the onset of apoptotic
Lee, Sook-Jeong; Hwang, Sung-Ook; Noh, Eun Joo; Kim, Dong-Uk; Nam, Miyoung; Kim, Jong Hyeok; Nam, Joo Hyun; Hoe, Kwang-Lae
2014-02-14
Vorinostat (VOR) has been reported to enhance the cytotoxic effects of doxorubicin (DOX) with fewer side effects because of the lower DOX dosage in breast cancer cells. In this study, we investigated the novel mechanism underlying the synergistic cytotoxic effects of VOR and DOX co-treatment in cervical cancer cells HeLa, CaSki and SiHa cells. Co-treatment with VOR and DOX at marginal doses led to the induction of apoptosis through caspase-3 activation, poly (ADP-ribose) polymerase cleavage and DNA micronuclei. Notably, the synergistic growth inhibition induced by the co-treatment was attributed to the upregulation of the pro-apoptotic protein Bad, as the silencing of Bad expression using small interfering RNA (siRNA) abolished the phenomenon. As siRNA against p53 did not result in an increase in acetylated p53 and the consequent upregulation of Bad, the observed Bad upregulation was mediated by acetylated p53. Moreover, a chromatin immunoprecipitation analysis showed that the co-treatment of HeLa cells with VOR and DOX increased the recruitment of acetylated p53 to the bad promoter, with consequent bad transactivation. Conversely, C33A cervical cancer cells containing mutant p53 co-treated with VOR and DOX did not exhibit Bad upregulation, acetylated p53 induction or consequent synergistic growth inhibition. Together, the synergistic growth inhibition of cervical cancer cell lines induced by co-treatment with VOR and DOX can be attributed to the upregulation of Bad, which is induced by acetylated p53. These results show for the first time that the acetylation of p53, rather than histones, is a mechanism for the synergistic growth inhibition induced by VOR and DOX co-treatments.
International Nuclear Information System (INIS)
Wei Tang; Powell, Simon N.
1996-01-01
Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA
Restriction of human herpesvirus 6B replication by p53
DEFF Research Database (Denmark)
Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina
2008-01-01
Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK
International Nuclear Information System (INIS)
Abe, Yasuhito; Takeuchi, Takashi; Imai, Yoshinori; Murase, Ryuichi; Kamei, Yoshiaki; Fujibuchi, Taketsugu; Matsumoto, Suguru; Ueda, Norifumi; Ogasawara, Masahito; Shigemoto, Kazuhiro; Kito, Katsumi
2006-01-01
PRPK phosphorylates serine-15 residue of p53 and enhances transcriptional activity. PRPK possesses a bipartite nuclear localization signal and localizes in nucleus when over-expressed in cells. However, intrinsic PRPK localizes mainly in the cytosol in situ. While studying the mechanisms in the distribution of intrinsic PRPK, we identified a PRPK binding protein, an ubiquitously expressed Small Ras-like GTPase, Rab1c, also named Ray or Rab35. The over-expressed Ray was distributed in the nucleus, cytosol, and cell membrane. Both Ray wild type and GTP-restrictively binding mutant Ray-Q67L, but not guanine nucleotide unstable binding mutant Ray-N120I, partially distributed the over-expressed PRPK to the cytosol and also suppressed the PRPK-induced p53-transcriptional activity profoundly. A Small Ras-like GTPase protein Ray was thus indicated to modulate p53 transcriptional activity of PRPK
Mutations in the p53 homolog p63: allele-specific developmental syndromes in humans.
Bokhoven, J.H.L.M. van; McKeon, F.
2002-01-01
p63 is the most recently discovered but most ancient member of the p53 family. In marked contrast to p53, p63 is highly expressed in embryonic ectoderm and in the basal, regenerative layers of many epithelial tissues in the adult. The p63-knockout mouse dies at birth and lacks limbs, epidermis,
Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation
Directory of Open Access Journals (Sweden)
Giovanna Damia
2001-01-01
Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.
The pro-survival function of p53 in HeLa cells
Energy Technology Data Exchange (ETDEWEB)
Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)
2014-11-15
The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.
Directory of Open Access Journals (Sweden)
2006-01-01
Full Text Available Herpesvirus-associated ubiquitin-specific protease (HAUSP, also known as USP7, a deubiquitylating enzyme of the ubiquitin-specific processing protease family, specifically deubiquitylates both p53 and MDM2, hence playing an important yet enigmatic role in the p53-MDM2 pathway. Here we demonstrate that both p53 and MDM2 specifically recognize the N-terminal tumor necrosis factor-receptor associated factor (TRAF-like domain of HAUSP in a mutually exclusive manner. HAUSP preferentially forms a stable HAUSP-MDM2 complex even in the presence of excess p53. The HAUSP-binding elements were mapped to a peptide fragment in the carboxy-terminus of p53 and to a short-peptide region preceding the acidic domain of MDM2. The crystal structures of the HAUSP TRAF-like domain in complex with p53 and MDM2 peptides, determined at 2.3-A and 1.7-A resolutions, respectively, reveal that the MDM2 peptide recognizes the same surface groove in HAUSP as that recognized by p53 but mediates more extensive interactions. Structural comparison led to the identification of a consensus peptide-recognition sequence by HAUSP. These results, together with the structure of a combined substrate-binding-and-deubiquitylation domain of HAUSP, provide important insights into regulation of the p53-MDM2 pathway by HAUSP.
P53 expression in prostatic cancer: an immunohistochemical study
International Nuclear Information System (INIS)
Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.
2011-01-01
Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).
The critical role of catalase in prooxidant and antioxidant function of p53
Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J
2013-01-01
The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438
Mathematical Modeling of E6-p53 interactions in Cervical Cancer
Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar
2017-04-01
Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License
p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells
Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua
2011-01-01
Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149
International Nuclear Information System (INIS)
Tannapfel, Andrea; Nuesslein, Siegfried; Fietkau, Rainer; Katalinic, Alexander; Koeckerling, Ferdinand; Wittekind, Christian
1998-01-01
Purpose: To investigate the relationship between apoptotic cell death, proliferative activity, and the expression of apoptosis regulating proteins in rectal cancer prior to and after radiochemotherapy. Materials and Methods: In 32 patients dispositioned to receive preoperative radiochemotherapy for locally advanced rectal carcinoma, pretherapy biopsies and the final resected specimen after radiochemotherapy were available for analyses. Apoptotic cells were identified and quantified using in situ end labeling (ISEL) technique. The expression of the bax protein was assessed immunohistochemically. Additionally, double immunostaining was performed for apoptotic cells and bax expression. The proliferative activity was determined by immunohistochemical assessment of the Ki67 (MIB-1) and the proliferating cell nuclear antigen (PCNA). p53- and bcl-2 expression was analyzed immunohistochemically. A clinical-to-pathologic downstaging after radiochemotherapy was achieved in 25 of 32 patients (78%). During follow-up, tumor recurrence was observed in six cases. In one case, no residual tumor was detected after radiochemotherapy. Results: After radiochemotherapy, the apoptotic index increased significantly in almost every case examined. In contrast, the proliferative activity was significantly decreased in resected specimens as compared to biopsies. Bax immunostaining was detected in 12/31 (39%) biopsies and in 26/31 (84%) resected specimens. In the resected specimen, significantly more apoptotic cells that were bax-positive were found than in biopsies. Bcl-2 immunostaining occurred in 15/31 biopsies and 12/31 resected specimens, respectively. Tumors that were immunohistochemically negative for p53 (20/31 [65%]) generally exhibited a higher apoptotic index and a high expression level of bax than p53-positive tumors (11/31 [35%]). However, we did not find any correlation between the (pre- and post-therapeutic) rate of apoptosis or the level of bax expression and the degree of
P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors
International Nuclear Information System (INIS)
Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.
1999-01-01
Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy
Chronology of p53 protein accumulation in gastric carcinogenesis
Craanen, M. E.; Blok, P.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.
1995-01-01
p53 Protein accumulation in early gastric carcinoma was studied in relation to the histological type (Lauren classification) and the type of growth pattern, including the chronology of p53 protein accumulation during carcinogenesis. Forty five, paraffin embedded gastrectomy specimens from early
A nanobody modulates the p53 transcriptional program without perturbing its functional architecture
Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan
2014-01-01
The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313
International Nuclear Information System (INIS)
Li Xia; Wu, William K.K.; Sun Bin; Cui Min; Liu Shanshan; Gao Jian; Lou Hongxiang
2011-01-01
Dihydroptychantol A (DHA), a novel macrocyclic bisbibenzyl compound extracted from liverwort Asterella angusta, has antifungal and multi-drug resistance reversal properties. Here, the chemically synthesized DHA was employed to test its anti-cancer activities in human osteosarcoma U2OS cells. Our results demonstrated that DHA induced autophagy followed by apoptotic cell death accompanied with G 2 /M-phase cell cycle arrest in U2OS cells. DHA-induced autophagy was morphologically characterized by the formation of double membrane-bound autophagic vacuoles recognizable at the ultrastructural level. DHA also increased the levels of LC3-II, a marker of autophagy. Surprisingly, DHA-mediated apoptotic cell death was potentiated by the autophagy inhibitor 3-methyladenine, suggesting that autophagy may play a protective role that impedes the eventual cell death. Furthermore, p53 was shown to be involved in DHA-meditated autophagy and apoptosis. In this connection, DHA increased nuclear expression of p53, induced p53 phosphorylation, and upregulated p53 target gene p21 Waf1/Cip1 . In contrast, cytoplasmic p53 was reduced by DHA, which contributed to the stimulation of autophagy. In relation to the cell cycle, DHA decreased the expression of cyclin B 1 , a cyclin required for progression through the G 2 /M phase. Taken together, DHA induces G 2 /M-phase cell cycle arrest and apoptosis in U2OS cells. DHA-induced apoptosis was preceded by the induction of protective autophagy. DHA-mediated autophagy and apoptosis are associated with the cytoplasmic and nuclear functions of p53.
International Nuclear Information System (INIS)
Hafez, N.H.; Tahoun, N.S.
2011-01-01
The differentiation of benign mesothelial cells from malignant tumor cells, primary, or metastatic, in serous effusions based on cytomorphologic features alone can be problematic. Purpose: This study was conducted to evaluate the utility of p53 and ki67 imrminocytochemical markers in differentiating benign from malignant tumor cells in serous effusions. Patients and methods: Archival Papanicolaou-stained smears of 91 pleura and peritoneal effusions were retrieved from Cytology Unit, Pathology Department, NCI, Cairo University between 2008 and 2010. Forty-one cases were positive for malignant cells and 50 cases were benign based on cytomorphologic features. Cases having doubt were excluded from the study. The slides were de stained and subjected to immunocytochemical staining for p53 and ki67. Histologic sections of colonic carcinoma and tonsillar tissue were used as positive control for p53 and ki67, respectively. Smears having > 5% positively stained nuclei for p53 were taken as positive and labeling index 10% of ki67 was considered positive. Frequencies of the individual immunocytochemical stains; p53 and ki67, in benign and malignant effusion as well as the combination of both stains were calculated. Results: p53 immunostaining showed nuclear positivity in 31 out of 41 malignant effusions (75.6%) and in 3 out of 50 benign effusions (6%), p < 0.005. p53 had 75.6% sensitivity, 94% specificity, 91.2% PPV, and 82.5% NPV. ki67 immunostaining was positive in 30 out of 41 malignant effusions (73.2%) and in 17 out of 50 benign effusions (34%), p < 0.05. ki67 had 73.2% sensitivity, 66% specificity, 63.8% PPV, and 75% NPV. Cases were then analyzed for combined immuno profile of p3 and ki67. Among the 24 cases that coexpressed both antigens, 22 cases (91.7%) were malignant. Thirty two out of 34 cases (94.1%) that showed negative results for both antigens were benign. For the cases that showed p53 immunostaining only, 9 out of 10 cases (90%) were malignant. Fifteen out of
The prognostic value of p53 mutation in pediatric marrow hypoplasia
Directory of Open Access Journals (Sweden)
Sharaf Alzahraa EA
2011-06-01
Full Text Available Abstract Background The tumor suppressor gene p53 is involved in the control of cell proliferation, particularly in stressed cells. p 53 gene mutations are the most frequent genetic event found in human cancers. Fanconi Anemia (FA is the most common representative of inherited bone marrow failure syndromes (IBMFS with a leukemic propensity. P 53 DNA alteration has not been studied before in Egyptian children with FA. Patients and methods we investigated p53 mutation in the bone marrow and peripheral blood of forty children, FA (n = 10, acquired aplastic anemia (AAA (n = 10, and immune thrombocytopenia (ITP as a control (n = 20, using real-time PCR by TaqMan probe assay Results Mutation of p53 gene was demonstrated in the BM of 90% (9/10 of children with FA, compared to 10% (1/10 in AAA (p Conclusion mutation of p53 gene in hypoplastic marrow especially FA may represent an early indicator of significant DNA genetic alteration with cancer propensity.
Correlation between p53 expression and clinical-pathological characteristics of gastric cancer
Directory of Open Access Journals (Sweden)
Radovanović Dragče
2011-01-01
Full Text Available Backgraund/Aim. Gene p53, or “cell genome keeper”, has a preventive effect on the occurrence of genetic aberrations and prevents abnormal expansion of (tumor cells. In gastric cancer cells in most cases we register high expression of mutated p53 gene, which correlates with prognosis and specific clinicalpathological characteristics of gastric cancer. Methods. Using the imunohistochemical method we determined the level of expression of p53 protein in 62 gastric cancers and 30 precancerous conditions (intestinal metaplasia of the stomach. We analyzed the relationship of the level of p53 expression and clinical pathological characteristics of gastric cancer. Results. Expression of p53 was positive in 42 (67.7% tumor cases and in 7 (14.3% cases of intestinal metaplasia. Expression of P53 and stomach cancer were in direct correlation (p = 0.000. Sensitivity for p53 in stomach cancer cases was 67.7% (42/62, and specifility was 76.7% (23/30. Expression of mutated p53 protein was in direct correlation with the invasion of lymph nodes (p = 0.034 and with invasion of blood vessels by carcinoma cells (p = 0.042. Conclusion. There is a direct correlation between p53 expression and gastric cancer and it indicates the ability of carcinoma cells to invade blood vessels.
Mitochondrial localization of the low level p53 protein in proliferative cells
Energy Technology Data Exchange (ETDEWEB)
Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)
2009-10-02
p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.
p53 Maintains Genomic Stability by Preventing Interference between Transcription and Replication
Directory of Open Access Journals (Sweden)
Constance Qiao Xin Yeo
2016-04-01
Full Text Available p53 tumor suppressor maintains genomic stability, typically acting through cell-cycle arrest, senescence, and apoptosis. We discovered a function of p53 in preventing conflicts between transcription and replication, independent of its canonical roles. p53 deficiency sensitizes cells to Topoisomerase (Topo II inhibitors, resulting in DNA damage arising spontaneously during replication. Topoisomerase IIα (TOP2A-DNA complexes preferentially accumulate in isogenic p53 mutant or knockout cells, reflecting an increased recruitment of TOP2A to regulate DNA topology. We propose that p53 acts to prevent DNA topological stress originating from transcription during the S phase and, therefore, promotes normal replication fork progression. Consequently, replication fork progression is impaired in the absence of p53, which is reversed by transcription inhibition. Pharmacologic inhibition of transcription also attenuates DNA damage and decreases Topo-II-DNA complexes, restoring cell viability in p53-deficient cells. Together, our results demonstrate a function of p53 that may underlie its role in tumor suppression.
Mitochondrial localization of the low level p53 protein in proliferative cells
International Nuclear Information System (INIS)
Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc
2009-01-01
p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.
Choudhury, Sreetama; Ghosh, Sayan; Mukherjee, Sudeshna; Gupta, Payal; Bhattacharya, Saurav; Adhikary, Arghya; Chattopadhyay, Sreya
2016-12-01
Molecular mechanisms involved in arsenic-induced toxicity are complex and elusive. Liver is one of the most favored organs for arsenic toxicity as methylation of arsenic occurs mostly in the liver. In this study, we have selected a range of environmentally relevant doses of arsenic to examine the basis of arsenic toxicity and the role of pomegranate fruit extract (PFE) in combating it. Male Swiss albino mice exposed to different doses of arsenic presented marked hepatic injury as evident from histological and electron microscopic studies. Increased activities of enzymes alanine aminotransferase, aspartate aminotransferase, lactate dehydrogenase and alkaline phosphatase corroborated extensive liver damage. It was further noted that arsenic exposure initiated reactive oxygen species (ROS)-dependent apoptosis in the hepatocytes involving loss of mitochondrial membrane potential. Arsenic significantly increased nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB), coupled with increase in phosphorylated Iκ-B, possibly as adaptive cellular survival strategies. Arsenic-induced oxidative DNA damage to liver cells culminated in p53 activation and increased expression of p53 targets like miR-34a and Bax. Pomegranate polyphenols are known to possess remarkable antioxidant properties and are capable of protecting normal cells from various stimuli-induced oxidative stress and toxicities. We explored the protective role of PFE in ameliorating arsenic-induced hepatic damage. PFE was shown to reduce ROS generation in hepatocytes, thereby reducing arsenic-induced Nrf2 activation. PFE also inhibited arsenic-induced NF-κB-inflammatory pathway. Data revealed that PFE reversed arsenic-induced hepatotoxicity and apoptosis by modulating the ROS/Nrf2/p53-miR-34a axis. For the first time, we have mapped the possible signaling pathways associated with arsenic-induced hepatotoxicity and its rescue by pomegranate polyphenols. Copyright
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent
P53 suppresses expression of the 14-3-3gamma oncogene
Directory of Open Access Journals (Sweden)
Qi Wenqing
2011-08-01
Full Text Available Abstract Background 14-3-3 proteins are a family of highly conserved proteins that are involved in a wide range of cellular processes. Recent evidence indicates that some of these proteins have oncogenic activity and that they may promote tumorigenesis. We previously showed that one of the 14-3-3 family members, 14-3-3gamma, is over expressed in human lung cancers and that it can induce transformation of rodent cells in vitro. Methods qRTPCR and Western blot analysis were performed to examine 14-3-3gamma expression in non-small cell lung cancers (NSCLC. Gene copy number was analyzed by qPCR. P53 mutations were detected by direct sequencing and also by western blot. CHIP and yeast one hybrid assays were used to detect p53 binding to 14-3-3gamma promoter. Results Quantitative rtPCR results showed that the expression level of 14-3-3gamma was elevated in the majority of NSCLC that we examined which was also consistent with protein expression. Further analysis of the expression pattern of 14-3-3gamma in lung tumors showed a correlation with p53 mutations suggesting that p53 might suppress 14-3-3 gamma expression. Analysis of the gamma promoter sequence revealed the presence of a p53 consensus binding motif and in vitro assays demonstrated that wild-type p53 bound to this motif when activated by ionizing radiation. Deletion of the p53 binding motif eliminated p53's ability to suppress 14-3-3gamma expression. Conclusion Increased expression of 14-3-3gamma in lung cancer coincides with loss of functional p53. Hence, we propose that 14-3-3gamma's oncogenic activities cooperate with loss of p53 to promote lung tumorigenesis.
Comparison of p53 levels in lymphocytes and in blood plasma of nuclear power plant workers
Czech Academy of Sciences Publication Activity Database
Rössner ml., Pavel; Chvátalová, Irena; Schmuczerová, Jana; Milcová, Alena; Rössner, P.; Šrám, Radim
2004-01-01
Roč. 556, - (2004), s. 55-63 ISSN 0027-5107 Institutional research plan: CEZ:AV0Z5039906 Keywords : p53 in lymphopcytes Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 3.730, year: 2004
Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S
p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector
P53 autoantibodies in 1006 patients followed up for breast cancer
International Nuclear Information System (INIS)
Metcalfe, Su; Wheeler, Terence K; Picken, Sheila; Negus, Susanne; Jo Milner, A
2000-01-01
Serial plasma samples from 1006 patients with breast cancer revealed: (i) no correlation of p53 autoantibody status with disease status at the time of sample collection, or with menopausal status at time of primary diagnosis of breast cancer; (ii) 155 out of 1006 (15%) of patients were positive for p53 autoantibodies, and these patients tended to have a persistent autoantibody status throughout follow up, irrespective of disease behaviour; and (iii) where a negative autoantibody status was found at primary diagnosis of breast cancer, this negative status persisted throughout follow up, irrespective of later disease behaviour. We conclude that screening for p53 autoantibody status is not informative on residual tumour activity nor on therapeutic responsiveness. Dysfunction of the tumour-suppressor protein, p53, may be due to either mutational or epigenetic factors, each of which may lead to accumulation of cytoplasmic p53. Abnormal accumulation of p53 in breast cancer tissue is predictive of poor prognosis [1,2]. Humoral studies [3,4] have shown that cancer patients may develop immunity to abnormally expressed p53, as revealed by p53 autoantibodies in the blood. Again, prognostic correlates have been noted, with presence of circulating p53 autoantibodies at diagnosis of breast cancer being associated with reduced overall survival [5,6] and with poor prognostic factors such as high histological grade and the absence of hormone receptors [5,7,8]. Little is known of the potential value of p53 autoantibody in follow up of cancer. In lung cancer there is evidence that autoantibodies to p53 may provide a useful tool to monitor response to therapy [9,10], whereas serial measurements of autoantibodies to p53 in 40 patients with advanced ovarian cancer were not found to be clinically useful [11]. In breast cancer some 30% of node-negative patients will relapse within 5 years, but there is no current means to predict those who are at risk. We performed the present study to
Pre-irradiation at a low dose-rate blunted p53 response
International Nuclear Information System (INIS)
Takahashi, Akihisa
2002-01-01
We investigated whether chronic irradiation at a low dose-rate interferes with the p53-centered signal transduction pathyway induced by radiation in human cultured cells and C57BL/6N mice. In in vitro experiments, we found that a challenge with X-ray irradiation immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge alone in glioblastoma cells (A-172). In addition, the levels of p53-centered apoptosis and its related proteins after the challenge were strongly correlated with the above-mentioned phenomena in squamous cell carcinoma cells (SAS/neo). In in vivo experiments, the accumulation of p53 and Bax, and the induction of apoptosis were observed dose-dependently in mouse spleen at 12 h after a challenge with X-rays (3.0 Gy). However, we found significant suppression of p53 and Bax accumulation and the induction of apoptosis 12 h after challenge irradiation at 3.0 Gy with a high doses-rate following chronic pre-irradiation (1.5 Gy, 0.001 Gy/min). These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced signaling and/or p53 stability. (author)
miR-34 and p53: New Insights into a Complex Functional Relationship.
Directory of Open Access Journals (Sweden)
Francisco Navarro
Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.
Functions of MDMX in the Modulation of the p53-Response
Directory of Open Access Journals (Sweden)
Kristiaan Lenos
2011-01-01
Full Text Available The MDM family proteins MDM2 and MDMX are two critical regulators of the p53 tumor suppressor protein. Expression of both proteins is necessary for allowing the embryonal development by keeping the activity of p53 in check. Upon stresses that need to activate p53 to perform its function as guardian of the genome, p53 has to be liberated from these two inhibitors. In this review, we will discuss the various mechanisms by which MDMX protein levels are downregulated upon various types of stress, including posttranslational modifications of the MDMX protein and the regulation of mdmx mRNA expression, including alternative splicing. In addition, the putative function(s of the described MDMX splice variants, particularly in tumor development, will be discussed. Lastly, in contrast to common belief, we have recently shown the existence of a p53-MDMX feedback loop, which is important for dampening the p53-response at later phases after genotoxic stress.
Increased Arf/p53 activity in stem cells, aging and cancer.
Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander
2017-04-01
Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
Tachibana, Masatsugu; Shinagawa, Yasuhiro; Kawamata, Hitoshi; Omotehara, Fumie; Horiuchi, Hideki; Ohkura, Yasuo; Kubota, Keiichi; Imai, Yutaka; Fujibayashi, Takashi; Fujimori, Takahiro
2003-01-01
We present a new approach towards the detection of the mRNAs in formalin-fixed, paraffin-embedded samples using a reverse transcriptase (RT)-polymerase chain reaction (PCR). The total RNAs were extracted from 10-micron-thick sections and were reverse-transcribed, then the RT-products were subjected to PCR amplification of GAPDH mRNA for screening the mRNA degradation. Next, nested PCR was performed for examining the expression of p53-related genes, p21WAF1, MDM2, p33ING1 and p14ARF. GAPDH mRNA expression was detectable in 12 out of 21 oral squamous cell carcinoma (SCC) samples. p21WAF1 mRNA expression was detectable in 5 out of 12 SCC samples, MDM2 mRNA expression was detectable in 5 our of 12 SCC samples and p33ING1 mRNA expression was detectable in 6 out of 12 SCC samples. However, the expression of p14ARF mRNA was not detectable in any of the samples. Seven out of 12 oral SCC samples showed abnormal nuclear accumulation of p53 protein by immunohistochemical staining, whereas 5 out of 12 oral SCCs showed negative staining for p53 protein. Of of p33ING1 mRNA. One of these was a verrucous carcinoma in which the p53 gene products might be inactivated by the oncoprotein E6 of human papilloma virus. Thus, the p53 tumor suppressor pathway was disrupted in most oral SCCs at the cellular levels, due to either an abnormality in p53 itself or loss of expression of p53 regulatory factors. This method would assist in making diagnosis, determining therapeutic strategy and predicting the prognosis of various cancers including oral SCCs.
Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event
Directory of Open Access Journals (Sweden)
Alnawaz Rehemtulla
2004-01-01
Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.
Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido
2004-03-01
The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-kappaB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor kappaB (NF-kappaB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p53 abolished apoptosis and AP1 activation. Signs of NF-kappaB and p53 activation were also detected in lymph node biopsies from HIV-1-infected individuals. Microarrays revealed that most (85%) of the transcriptional effects of HIV-1 Env were blocked by the p53 inhibitor pifithrin-alpha. Macroarrays led to the identification of several Env-elicited, p53-dependent proapoptotic transcripts, in particular Puma, a proapoptotic "BH3-only" protein from the Bcl-2 family known to activate Bax/Bak. Down modulation of Puma by antisense oligonucleotides, as well as RNA interference of Bax and Bak, prevented Env-induced apoptosis. HIV-1-infected primary lymphoblasts up-regulated Puma in vitro. Moreover, circulating CD4+ lymphocytes from untreated, HIV-1-infected donors contained enhanced amounts of Puma protein, and these elevated Puma levels dropped upon antiretroviral therapy. Altogether, these data indicate that NF-kappaB and p53 cooperate as the dominant proapoptotic transcription factors participating in HIV-1 infection.
Robustness of the p53 network and biological hackers.
Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G
2005-06-06
The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.
Stabilization and activation of p53 are regulated independently by different phosphorylation events
Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.
1998-01-01
Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877
Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B
2017-01-01
PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I
Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...
African Journals Online (AJOL)
The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...
NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation
Directory of Open Access Journals (Sweden)
Labhart Paul
2007-05-01
Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...
2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.
Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R
2016-09-06
The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.
Basal p53 expression is indispensable for mesenchymal stem cell integrity.
Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G
2018-03-01
Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-11-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717
The expanding regulatory universe of p53 in gastrointestinal cancer.
Fesler, Andrew; Zhang, Ning; Ju, Jingfang
2016-01-01
Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
Directory of Open Access Journals (Sweden)
Rejane Mattar
2004-01-01
Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea
Super p53 for Treatment of Ovarian Cancer
2017-09-01
System 3, Clontech) containing wt-p53, p53-CC, and ZsGreen (control) were made. Ad-ZsGreen was tested in ID8 cells, which showed very high expression...views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army...MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14
Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.
Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido
2008-07-01
We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.
Inhibition of Endothelial p53 Improves Metabolic Abnormalities Related to Dietary Obesity
Directory of Open Access Journals (Sweden)
Masataka Yokoyama
2014-06-01
Full Text Available Accumulating evidence has suggested a role for p53 activation in various age-associated conditions. Here, we identified a crucial role of endothelial p53 activation in the regulation of glucose homeostasis. Endothelial expression of p53 was markedly upregulated when mice were fed a high-calorie diet. Disruption of endothelial p53 activation improved dietary inactivation of endothelial nitric oxide synthase that upregulated the expression of peroxisome proliferator-activated receptor-γ coactivator-1α in skeletal muscle, thereby increasing mitochondrial biogenesis and oxygen consumption. Mice with endothelial cell-specific p53 deficiency fed a high-calorie diet showed improvement of insulin sensitivity and less fat accumulation, compared with control littermates. Conversely, upregulation of endothelial p53 caused metabolic abnormalities. These results indicate that inhibition of endothelial p53 could be a novel therapeutic target to block the vicious cycle of cardiovascular and metabolic abnormalities associated with obesity.
The tumor suppressors pRB and p53 as regulators of adipocyte differentiation and function
DEFF Research Database (Denmark)
Hallenborg, Philip; Feddersen, Søren; Madsen, Lise
2009-01-01
BACKGROUND: The retinoblastoma protein (pRB) and p53 are crucial members of regulatory networks controlling the cell cycle and apoptosis, and a hallmark of virtually all cancers is dysregulation of expression or function of pRB or p53. Although they are best known for their role in cancer...
P53 overexpression in head and neck carcinoma and radiotherapy results
International Nuclear Information System (INIS)
Awwad, Saif; Jaros, Evelyn; Somes, James; Lunec, John
1996-01-01
Purpose: P53 gene mutations are the common genetic changes encountered in human cancers, and there is extensive evidence that the P53 status may determine tumor response to therapy. This study was carried out to investigate whether there is any correlation between accumulation (overexpression) of P53 protein and poor prognosis in patients with head and neck carcinomas treated with radical radiotherapy. Methods and Materials: Seventy-nine patients with head and neck carcinomas who were diagnosed and treated in 1989-90 with curative radiotherapy were studied retrospectively. Paraffin sections from archival material were studied using immunohistochemical staining (IHC) with mouse monoclonal antibodies (D0-7) to human P53 protein. Univariate and multivariate analysis of loco-regional tumor control and patient survival were performed on possible prognostic factors. Results: Forty-two (53%) patients showed positive IHC staining in their tumors. Fifty-three percent of the laryngeal, 64% of the oropharyngeal, and 43% of the oral cavity carcinomas showed P53 overexpression. All tumor specimens with vascular, lymphatic, and/or sarcolemmal invasion showed P53 overexpression. The proportion of tumor-stained nuclei was higher in the poorly differentiated than in the well and moderately differentiated tumors (p < 0.05), but there was no correlation with the patient overall or disease-free 5-year actuarial survival. There was no difference in the 5-year actuarial survival and disease-free survival between patients with P53 immunostaining in their tumors and those with no immunostaining (59% vs. 65% and 57% vs. 51%, respectively). The TNM tumor stage was the most significant prognostic factor with 5-year actuarial survival of 87% for early and 14% for late stages (p << 0.0001). There was a significant correlation between immunostaining and history of smoking (p = 0.02). Conclusion: The data demonstrate that the P53 accumulation as detected by immunohistochemical staining in a
Association of p53 protein expression with clinical outcome in advanced supraglottic cancer
International Nuclear Information System (INIS)
Kang, Jin Oh; Hong, Seong Eon
1998-01-01
To determine the incidence and prognostic effect of p53 expression in patients with advanced supraglottic cancer. Twenty-one cases of total 48 advanced supraglottic cancer patients who received postoperative adjuvant radiation therapy were evaluated by immunohistochemical staining employing p53 monoclonal antibody. Three out of six stage III patients and four out of fifteen stage IV patients showed p53 expression without statistically significant difference (p=0.608). Five year survival rates are 93% in p53 negative, 86% in p53 positive patients and there was no significant difference(p=0.776). p53 expression does not show statistically significant correlation with primary tumor status(p=0.877), lymph node status(p=0.874) and age(p=0.64). There was no statistically significant correlation between traditionally known risk factors and p53 expression
Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku
2016-01-01
Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981
Ouyang, Qiaohong; Duan, Zhongxiang; Jiao, Guangli; Lei, Jixiao
2015-07-01
A biomimic reconstituted high-density-lipoprotein-based drug and p53 gene co-delivery system (rHDL/CD-PEI/p53 complexes) was fabricated as a targeted co-delivery nanovector of drug and gene for potential bladder cancer therapy. Here, CD-PEI was utilized to effectively condense the p53 plasmid, to incorporate the plasmid into rHDL, and to act as an antitumor drug to suppress tumor angiogenesis. The rHDL/CD-PEI/p53 complexes exhibited desirable and homogenous particle size, neutral surface charge, and low cytotoxicity in vitro. The results of confocal laser scanning microscopy and flow cytometry confirmed that SR-BI-targeted function induced specific cytoplasmic delivery and high gene transfection efficiency in MBT-2 murine bladder cells. In addition, rHDL/CD-PEI/p53 complexes co-delivering CD and p53 gene achieved synergistic angiogenesis suppression by more effectively downregulating the expression of vascular endothelial growth factor (VEGF) messenger RNA (mRNA) and protein via different pathways in vitro. In vivo investigation on C3H/He mice bearing MBT-2 tumor xenografts revealed that rHDL/CD-PEI/p53 complexes possessed strong antitumor activity. These findings suggested that rHDL/CD-PEI/p53 complexes could be an ideal tumor-targeting system for simultaneous transfer of drug and gene, which might be a new promising strategy for effective bladder cancer therapy.
Directory of Open Access Journals (Sweden)
Riley E Alexander
Full Text Available BACKGROUND: Primary adenocarcinoma of the urinary bladder is rare. The molecular and cellular events leading to its pathogenesis are not well delineated. The goal of this study was to investigate p53 and p16 expression, as well as HPV status, in a relatively large series of primary bladder adenocarcinomas. MATERIALS AND METHODS: Thirty six cases of urinary bladder adenocarcinoma were chosen from participating institutions. The diagnosis and available clinical history were reviewed in each case. Immunostains for p53, p16 and HPV and high-risk and low-risk HPV-ISH were performed on all tumors. RESULTS: Patients had an average age of 61 years with a male predominance (1.5 ∶ 1 male ∶ female ratio. The average tumor size in cystectomy specimens was 4.3 cm. Of the cases managed by transurethral resection, 40% were pT2 at the time of diagnosis. In cystectomy specimens, 77% were either pT3 or pT4. Strong nuclear p16 expression was seen in 67% of all cases and p53 expression was present in 58% of the cases. Expression of both markers was seen in 33% of cases. Expression of p16 or p53 alone was present in 12 (33% and 9 (25% cases, respectively. Neither marker was expressed in only 3 (8% of the tumors. No significant correlation between clinical variables and any of the markers we studied was identified. No HPV infection was detected in any case. CONCLUSIONS: Expression of p53 and/or p16 is very common in urinary bladder adenocarcinoma. These findings implicate a high likelihood that alterations in these cell cycle proteins contribute to the pathogenesis of these tumors. Despite frequent immunohistochemical labeling for p16, no evidence of HPV infection was found.
Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan
2016-07-02
Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.
Conformational detection of p53's oligomeric state by FlAsH Fluorescence
Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.
2009-01-01
The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine ...
p21-LacZ reporter mice reflect p53-dependent toxic insult
International Nuclear Information System (INIS)
Vasey, Douglas B.; Wolf, C. Roland; MacArtney, Thomas; Brown, Ken; Whitelaw, C. Bruce A.
2008-01-01
There is an urgent need to discover less toxic and more selective drugs to treat disease. The use of transgenic mice that report on toxic insult-induced transcription can provide a valuable tool in this regard. To exemplify this strategy, we have generated transgenic mice carrying a p21-LacZ transgene. Transgene activity reflected endogenous p21 gene activation in various tissues, displayed compound-specific spatial expression signatures in the brain and immune tissues and enabled p53-dependent and p53-independent responses to be identified. We discuss the application of these mice in delineating the molecular events in normal cellular growth and disease and for the evaluation of drug toxicity
P53 overexpression and outcome of radiation therapy in head and neck cancers
International Nuclear Information System (INIS)
Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae
1999-01-01
Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers
P53 overexpression and outcome of radiation therapy in head and neck cancers
Energy Technology Data Exchange (ETDEWEB)
Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae [College of Medicine, The Catholic Univ., Seoul (Korea, Republic of)
1999-03-01
Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers.
p53 regulates cytoskeleton remodeling to suppress tumor progression.
Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko
2015-11-01
Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.
Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer
International Nuclear Information System (INIS)
Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko
2015-01-01
Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer
Wildtype p53-specific Antibody and T-Cell Responses in Cancer Patients
DEFF Research Database (Denmark)
Pedersen, Anders Elm; Stryhn, Anette; Justesen, Sune
2011-01-01
patients. Detection of antibodies against wt p53 protein has been used as a diagnostic and prognostic marker and discovery of new T-cell epitopes has enabled design of cancer vaccination protocols with promising results. Here, we identified wt p53-specific antibodies in various cancer patients......(264-272) in breast cancer patients and against HLA-A*01:01 binding peptide wt p53(226-234) and HLA-B*07:02 binding peptide wt p53(74-82) in renal cell cancer and breast cancer patients, respectively. Finally, we analyzed antibody and T-cell responses against wt p53 15-mer peptides in patients with metastatic renal...
International Nuclear Information System (INIS)
Wouters, An; Pauwels, Bea; Lambrechts, Hilde A.J.; Pattyn, Greet G.O.; Ides, Johan; Baay, Marc; Meijnders, Paul; Peeters, Marc; Vermorken, Jan B.; Lardon, Filip
2011-01-01
Purpose: Whereas radiosensitization by gemcitabine is well studied under normal oxygen conditions, little is known about its radiosensitizing potential under reduced oxygen conditions. Therefore, the present study evaluated the impact of anoxia on gemcitabine-mediated radiosensitization. Methods and Materials: The clonogenic assay was performed in three isogenic A549 cell lines differing in p53 status (24 h, 0-15 nM gemcitabine, 0-8 Gy irradiation, normoxia vs. anoxia). Using radiosensitizing conditions, cells were collected for cell cycle analysis and apoptosis detection. Results: Whereas wild-type p53 A549-LXSN cells were more sensitive to radiation than p53-deficient A549-E6 cells, both cell lines showed similar radiosensitization by gemcitabine under normoxia and anoxia. Independent of p53 functionality, gemcitabine was able to overcome anoxia-induced G 0/1 arrest and established an (early) S phase block in normoxic and anoxic cells. The percentage early and late apoptotic/necrotic cells increased with the gemcitabine/radiation combination, with a significant difference between A549-LXSN and A549-E6. Conclusions: This study is the first to show that gemcitabine retains its radiosensitizing potential under low oxygen conditions. Although radiosensitization was observed in both p53 wild-type and p53-deficient cells, p53 status might influence induction of apoptosis after gemcitabine/radiation treatment, whereas no effect on cell cycle progression was noticed.
Pre-irradiation at a low dose-rate blunted p53 response
International Nuclear Information System (INIS)
Takahashi, A.; Ohnishi, K.; Asakawa, I.; Tamamoto, T.; Yasumoto, J.; Yuki, K.; Ohnishi, T.; Tachibana, A.
2003-01-01
Full text: We have studied whether the p53-centered signal transduction pathway induced by acute radiation is interfered with chronic pre-irradiation at a low dose-rate in human cultured cells and whole body of mice. In squamous cell carcinoma cells, we found that a challenge irradiation with X-ray immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge irradiation alone. In addition, the induction of p53-centered apoptosis and the accumulation of its related proteins after the challenge irradiation were strongly correlated with the above-mentioned phenomena. In mouse spleen, the induction of apoptosis and the accumulation of p53 and Bax were observed dose-dependently at 12 h after a challenge irradiation. In contrast, we found significant suppression of them induced by challenge irradiation at a high dose-rate when mice were pre-irradiated with chronic irradiation at a low dose-rate. These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced p53-dependent signal transduction processes. There are numerous papers about p53 functions in apoptosis, radiosensitivity, genomic instability and cancer incidence in cultured cells or animals. According to our data and other findings, since p53 can prevent carcinogenesis, pre-irradiation at a low dose-rate might enhance the predisposition to cancer. Therefore, it is possible that different maximal permissible dose equivalents for the public populations are appropriate. Furthermore, concerning health of human beings, studies of the adaptive responses to radiation are quite important, because the radiation response strongly depends on experience of prior exposure to radiation
AAVPG: A vigilant vector where transgene expression is induced by p53
Energy Technology Data Exchange (ETDEWEB)
Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.; Strauss, Bryan E., E-mail: bstrauss@usp.br
2013-12-15
Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 fold increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.
Genetic Stabilization by p53 Involves Growth Regulatory and Repair Pathways
Directory of Open Access Journals (Sweden)
Lisa Wiesmüller
2001-01-01
Full Text Available p53 performs a plethora of activities, which are directed towards the maintenance of the genomic integrity and constitute its universal role as a tumor suppressor. 1000 to 10000 latent p53 molecules are permanently available in order to monitor DNA exchange processes in mitotically growing cells. After the introduction of major DNA injuries the levels of posttranslationally modified p53 proteins rise, which in turn transcriptionally signal transient cell cycle arrest or apoptotic cell death, depending on the extent of damage. Taken together, p53 inhibits the manifestation of genomic instabilities at different control levels both during naturally occurring metabolic processes and in response to genotoxic treatments.
Directory of Open Access Journals (Sweden)
Ching-Hao Li
2010-02-01
Full Text Available p53, can regulate cell apoptosis in both transcription-dependent and -independent manners. The transcription-independent pathway was demonstrated by the translocation of p53 to mitochondria. Our study showed that p53 mitochondrial translocation was found in mitomycin C (MMC-treated HepG2. The p53 C-terminal domain is clustered with potential nuclear leading sequences and showed strong electrostatic ion-ion interactions with cardiolipin, phosphatidylglycerol and phosphatidic acid in vitro. Disruption of cardiolipin biosynthesis by phosphatidylglycero-phosphate synthase (PGS or CDP-diacylglycerol synthase 2 (CDS-2 short hairpin RNA (shRNA transfection eliminated the MMC-induced translocation of mitochondrial p53. The elimination of mitochondrial p53 translocation also reduced Bcl-xL and Bcl-2 mitochondrial distribution. In HEK 293T models with saturated p53 expression, the mitochondrial partition of p53, Bcl-xL, and Bcl-2 obviously decreased in their PGS shRNA- or CDS-2 shRNA-expressing stable clones. In p53-null H1299 models, both the mitochondrial partitions of Bcl-xL and Bcl-2 were strongly reduced in relation to the HEK 293T models. The Bcl-xL mitochondrial partition was elevated in H1299 models expressing pCEP4-p53wt suggesting the direct carrier role of p53 in transporting Bcl-xL to the mitochondria. We also found that the cytosolic pool of Bcl-xL and Bcl-2 remained unaffected in the low-dose MMC treatment but decreased in the high-dose MMC treatment. The cytosolic pool of Bcl-2 and Bcl-xL directly regulated their amounts in p53-dependent mitochondrial distribution. In the low-dose MMC treatment, the increased mitochondrial p53, Bcl-xL, and Bcl-2 could attenuate apoptosis. However, in the high-dose MMC treatment, only the p53 translocated to the mitochondria and resulted in apoptosis progression. On the basis of this study, we thought mitochondrial p53 might regulate apoptosis in a biphasic manner.
Meng, X; Carlson, NR; Dong, J; Zhang, Y
2015-01-01
The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly s...
Vuister, P.H.
The 52Cr(p, γ)53Mn reaction was investigated in the energy region Ep = 1.36–2.26 MeV. The resonance energies, the corresponding 53Mn excitation energies and the resonance strengths of 199 resonances, assigned to this reaction, are reported. The excitation energies and gamma-ray branchings of 13
Directory of Open Access Journals (Sweden)
Liang Y
2018-03-01
Full Text Available Yayun Liang,1 Benford Mafuvadze,1 Cynthia Besch-Williford,2 Salman M Hyder1 1Deparment of Biomedical Sciences and Dalton Cardiovascular Research Center, Columbia, MO, USA; 2IDEXX BioResearch, Columbia, MO, USA Background: Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53 lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods: In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results: APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood
International Nuclear Information System (INIS)
Shu, H.-K.G.; Furman, Felix; Dee, Suzanne; Israel, Mark A.
1997-01-01
Purpose/Objective: Medulloblastoma cell lines readily undergo a p53-mediated apoptosis following exposure to ionizing radiation, while glioma cell lines do not undergo significant levels of apoptosis following irradiation. This study attempts to define some of the molecular events that characterize the differential ability medulloblastomas and gliomas to undergo radiation-induced apoptosis. Materials and Methods: The medulloblastoma cell lines D283 and D341 and the glioma cell lines U87, U343 and U563 were used in this study. All five cell lines were confirmed to have a wild type p53 by their ability to induce p21 protein levels and to undergo a cell-cycle arrest in G1 following treatment with ionizing radiation. Also, 3 clonal derivatives of D283 were used. Two of the clones were derived following transfection with an expression plasmid containing a dominant negative mutant p53 (Arg175 --> His) expressed from the CMV promoter (D283/53.6 and D283/53.7), while the remaining clone was derived following transfection with that same expression plasmid without mutant p53 (D283/vec). All irradiation experiments were performed on Phillips RT-250 X-ray unit using 250 Kvp X-rays. In each case, 5 Gy of ionizing radiation was given at a dose rate of 250 cGy/minute. Apoptosis was quantitated by staining fixed cells with propidium iodide and determining the percentage of cells with subdiploid DNA content by flow cytometry. Northern blot analysis was performed using standard methods. Results: The D283 and D341 cell lines exhibited a significant induction of apoptosis when assayed 2 days following treatment with radiation while the U87, U343 and U563 cell lines displayed only minimal induction of apoptosis when assayed following treatment at that time. RNA was prepared from the different cell lines that were unirradiated, 6 hours or 24 hours post-irradiation. Northern blots were made of the total RNAs and probed for bax, bcl-2 and bcl-x mRNA. This analysis detected no significant
Role of p53–fibrinolytic system cross-talk in the regulation of quartz-induced lung injury
International Nuclear Information System (INIS)
Bhandary, Yashodhar P.; Shetty, Shwetha K.; Marudamuthu, Amarnath S.; Fu, Jian; Pinson, Barbara M.; Levin, Jeffrey; Shetty, Sreerama
2015-01-01
Silica is the major component of airborne dust generated by wind, manufacturing and/or demolition. Chronic occupational inhalation of silica dust containing crystalline quartz is by far the predominant form of silicosis in humans. Silicosis is a progressive lung disease that typically arises after a very long latency and is a major occupational concern with no known effective treatment. The mechanism of silicosis is not clearly understood. However, silicosis is associated with increased cell death, expression of redox enzymes and pro-fibrotic cytokines and chemokines. Since alveolar epithelial cell (AEC) death and disruption of alveolar fibrinolysis is often associated with both acute and chronic lung injuries, we explored whether p53-mediated changes in the urokinase-type plasminogen activator (uPA) system contributes to silica-induced lung injury. We further sought to determine whether caveolin-1 scaffolding domain peptide (CSP), which inhibits p53 expression, mitigates lung injury associated with exposure to silica. Lung tissues and AECs isolated from wild-type (WT) mice exposed to silica exhibit increased apoptosis, p53 and PAI-1, and suppression of uPA expression. Treatment of WT mice with CSP inhibits PAI-1, restores uPA expression and prevents AEC apoptosis by suppressing p53, which is otherwise induced in mice exposed to silica. The process involves CSP-mediated inhibition of serine-15 phosphorylation of p53 by inhibition of protein phosphatase 2A-C (PP2A-C) interaction with silica-induced caveolin-1 in AECs. These observations suggest that changes in the p53–uPA fibrinolytic system cross-talk contribute to lung injury caused by inhalation of silica dust containing crystalline quartz and is protected by CSP by targeting this pathway. - Highlights: • Chronic exposure to quartz dusts is a major cause of lung injury and silicosis. • The survival of patients with silicosis is bleak due to lack of effective treatments. • This study defines a new role of
Relationship between P53 and bystander effect induced by radiated hepatoma cells
International Nuclear Information System (INIS)
Zhao Meijia; Shen Bo; Yuan Dexiao; Cheng Honghong; Shao Chunlin
2009-01-01
The role of p53 in bystander responses on normal liver cells were investigated by co-culturing irradiated hepatoma cells with non-irradiated bystander Chang liver cells. It was found that radiosensitivity of the hepatoma cells was relative to p53. HepG2 cells with wtp53 had the highest radiosensitivity followed by PLC/PRF/5 cells with mtp53 and Hep3B cells with null-p53. The induction of bystander micronucleus(MN) was observed only in the Chang liver cells that had been co-cultured with HepG2 cells but not co-cultured with PLC/PRF/5 or Hep3B. Also, this bystander MN was relative to the irradiation dose and the cell co-culture rime. When the hepatoma cells were treated with pifithrin-α, a p53 inhibitor, their radiosensitivities were reduced, and the bystander effect was diminished. The results indicate that p53 could regulate not only the radiosensitivity but also the bystander response. (authors)
International Nuclear Information System (INIS)
Hayashi, Yoko; Kondo, Takashi; Zhao Qingli; Ogawa Ryohei; Cui Zhengguo; Feril, Loreto B.; Teranishi, Hidetoyo; Kasuya, Minoru
2004-01-01
It has been reported that the hexavalent chromium compound (Cr(VI)) can induce both p53-dependent and p53-independent apoptosis. While a considerable amount of information is available on the p53-dependent pathway, only little is known about the p53-independent pathway. To elucidate the p53-independent mechanism, the roles of the Ca 2+ -calpain- and mitochondria-caspase-dependent pathways in apoptosis induced by Cr(VI) were investigated. When human lymphoma U937 cells, p53 mutated cells, were treated with 20 μM Cr(VI) for 24 h, nuclear morphological changes and DNA fragmentation were observed. Production of hydroxyl radicals revealed by electron paramagnetic resonance (EPR)-spin trapping, and increase of intracellular calcium ion concentration monitored by digital imaging were also observed in Cr(VI)-treated cells. An intracellular Ca 2+ chelator, BAPTA-AM, and calpain inhibitors suppressed the Cr(VI)-induced DNA fragmentation. The number of cells showing low mitochondrial membrane potential (MMP), high level of superoxide anion radicals (O 2 - ), and high activity of caspase-3, which are indicators of mitochondria-caspase-dependent pathway, increased significantly in Cr(VI)-treated cells. An antioxidant, N-acetyl-L-cysteine (NAC), decreased DNA fragmentation and inhibited the changes in MMP, O 2 - formation, and activation of caspase-3 induced by Cr(VI). No increase of the expressions of Fas and phosphorylated JNK was observed after Cr(VI) treatment. Cell cycle analysis revealed that the fraction of G2/M phase tended to increase after 24 h of treatment, suggesting that Cr(VI)-induced apoptosis is related to the G2 block. These results indicate that Ca 2+ -calpain- and mitochondria-caspase-dependent pathways play significant roles in the Cr(VI)-induced apoptosis via the G2 block, which are independent of JNK and Fas activation. The inhibition of apoptosis and all its signal transductions by NAC suggests that intracellular reactive oxygen species (ROS) are
p53-Mediated Molecular Control of Autophagy in Tumor Cells
Directory of Open Access Journals (Sweden)
Maria Mrakovcic
2018-03-01
Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.
A STUDY OF P53 EXPRESSION IN UROTHELIAL NEOPLASMS OF URINARY BLADDER
Directory of Open Access Journals (Sweden)
G. Sathish Kumar
2017-07-01
Full Text Available BACKGROUND Urothelial Cell Carcinoma (UCC of urinary bladder is the seventh commonest cancer wordwide.1 At initial diagnosis, 30% of UCC display solid and invasive growth patterns and are locally advanced or metastatic at the time of diagnosis. 70% of tumours are noninvasive papillary UCC confined to the epithelium and subepithelial connective tissue,2 which can be managed by endoscopic resection. A significant number of post-resected cases, progress for recurrence of tumour and infiltration to muscle layers. Invasive bladder cancer has high morbidity and uniform mortality when it is metastatic. There are no effective tools to predict aggressiveness of tumour, so that these cases can be managed more successfully. Mutated Tp53/p53 is the genetic abnormality most frequently associated with UCC and related to cell transformation, malignancy and high recurrence rates.2 MATERIALS AND METHODS This is a descriptive study conducted in the departments of urology and pathology and during the period of March 2014 to February 2015. All consecutive cystoscopic biopsies, Trans urethral resection of bladder tumour (TURBT and radical cystectomy specimens histopathologically diagnosed as UCC were included in the study. p53 expression was assessed by immunohistochemistry. Positive and negative controls were used. Bivariate analysis was done using Chi-square test in all cases. RESULTS A total of 80 cases were analysed. Significant association of p53 expression was found in higher grades of tumour. Also, noted relation of p53 mutation with tumour size, multifocality, multiplicity, muscle invasion and tumour stage, which were statistically not significant. CONCLUSION Bladder tumour grade shows significant association to p53 expression. Papillary neoplasm of low malignant potential (PUNLMP tumours are negative for p53, and in the present study, there was significant difference in p53 over expression low-grade papillary UCC compared with PUNLMP. 90% of low
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Changes in protein expression in p53 deleted spontaneous thymic lymphomas
DEFF Research Database (Denmark)
Honoré, Bent; Vorum, Henrik; Pedersen, Anders Elm
2004-01-01
with the protein expression in p53+/+ and p53-/- thymocytes. Only a minority (13 proteins) of the quantitatively changed proteins were common for the two thymic lymphoma cell lines, suggesting that the p53 deficiency mainly results in genetic dysfunctions which are individual for a given tumor. Two of the detected...... structure containing motifs of the glyoxalase-bleomycin resistance protein family (MDR) as deduced from the cDNA....
Synthesis and evaluation of modified chalcone based p53 stabilizing agents
Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdul-Hamid M.; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib
2017-01-01
Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.
Synthesis and evaluation of modified chalcone based p53 stabilizing agents
Iftikhar, Sunniya
2017-07-15
Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)
2012-07-13
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp
International Nuclear Information System (INIS)
Kim, W.-J.; Beardsley, Dillon I.; Adamson, Aaron W.; Brown, Kevin D.
2005-01-01
One of the cellular responses to DNA damaging events is the activation of programmed cell death, also known as apoptosis. Apoptosis is an important process in limiting tumorigenesis by eliminating cells with damaged DNA. This view is reinforced by the finding that many genes with pro-apoptotic function are absent or altered in cancer cells. The tumor suppressor p53 performs a significant role in apoptotic signaling by controlling expression of a host of genes that have pro-apoptotic or pro-survival function. The S N 1 DNA alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) triggers apoptosis and the upregulation/phosphorylation of p53; however, the mechanism(s) governing MNNG-induced cell death remain unresolved. We observed that the human lymphoblastoid cell line WTK-1, which expresses mutant p53, shows far less sensitivity to the cytotoxic effects of MNNG than the closely related, p53-normal line TK-6. Exposure to 15 μM MNNG (LD50 at 24 h in TK-6) leads to a kinetically slower rate of apoptotic onset in WTK-1 cells compared to TK-6 as judged by viability assays and approaches that directly examine apoptotic onset. Similar results were obtained using an unrelated human lymphoblastoid line B310 expressing reduced levels of p53 due to E6 oncoprotein expression, indicating that MNNG activates both p53-dependent and -independent apoptotic mechanisms and that these two mechanisms are discernable by the rates which they trigger apoptotic onset. We document, during time points corresponding to peak apoptotic response in TK6, WTK-1, B310, and B310-E6, that these cell lines show marked decreases in mitochondrial transmembrane potential and increases in cytochrome c within the cytosolic fraction of MNNG-treated cells. Consistent with these events, we observed that both caspase-9 and -3 are activated in our panel of lymphoblastoid cells after MNNG exposure. We also found, using both broad spectrum and specific inhibitors, that blocking caspase activity in TK-6 and
Mutant p53 drives cancer by subverting multiple tumour suppression pathways
Directory of Open Access Journals (Sweden)
Sue eHaupt
2016-01-01
Full Text Available The tumour suppressor p53 normally acts as a brake to halt damaged cells from perpetrating their genetic errors into future generations. If p53 is disrupted by mutation, it may not only lose these corrective powers, but counter-productively acquire new capacities that drive cancer. A newly emerging manner in which mutant p53 executes its cancer promoting functions is by harnessing key proteins (including many transcription factors, which normally partner with its wild type, tumour-inhibiting counterpart. In association with the subverted activities of these protein partners, mutant p53 is empowered to act across multiple fundamental cellular pathways (regulating cell division and metabolism and corrupt them to become cancer promoting.
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Rappsilber, Juri
2014-01-01
linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...
Substrate Stiffness Influences Doxorubicin-Induced p53 Activation via ROCK2 Expression
Directory of Open Access Journals (Sweden)
Takahiro Ebata
2017-01-01
Full Text Available The physical properties of the extracellular matrix (ECM, such as stiffness, are involved in the determination of the characteristics of cancer cells, including chemotherapy sensitivity. Resistance to chemotherapy is often linked to dysfunction of tumor suppressor p53; however, it remains elusive whether the ECM microenvironment interferes with p53 activation in cancer cells. Here, we show that, in MCF-7 breast cancer cells, extracellular stiffness influences p53 activation induced by the antitumor drug doxorubicin. Cell growth inhibition by doxorubicin was increased in response to ECM rigidity in a p53-dependent manner. The expression of Rho-associated coiled coil-containing protein kinase (ROCK 2, which induces the activation of myosin II, was significantly higher when cells were cultured on stiffer ECM substrates. Knockdown of ROCK2 expression or pharmacological inhibition of ROCK decreased doxorubicin-induced p53 activation. Our results suggest that a soft ECM causes downregulation of ROCK2 expression, which drives resistance to chemotherapy by repressing p53 activation.
Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas
Directory of Open Access Journals (Sweden)
Ming-Fu eChiang
2013-03-01
Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.
FATS is a transcriptional target of p53 and associated with antitumor activity
Directory of Open Access Journals (Sweden)
Zhang Xifeng
2010-09-01
Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.
Bajbouj, K; Mawrin, C; Hartig, R; Schulze-Luehrmann, J; Wilisch-Neumann, A; Roessner, A; Schneider-Stock, R
2012-05-01
Glioblastomas are known to be highly chemoresistant, but HDAC inhibitors (HDACi) have been shown to be of therapeutic relevance for this aggressive tumor type. We treated U87 glioblastoma cells with trichostatin A (TSA) to define potential epigenetic targets for HDACi-mediated antitumor effects. Using a cDNA array analysis covering 96 cell cycle genes, cyclin-dependent kinase inhibitor p21(WAF1) was identified as the major player in TSA-induced cell cycle arrest. TSA slightly inhibited proliferation and viability of U87 cells, cumulating in a G1/S cell cycle arrest. This effect was accompanied by a significant up-regulation of p53 and its transcriptional target p21(WAF1) and by down-regulation of key G1/S regulators, such as cdk4, cdk6, and cyclin D1. Nevertheless, TSA did not induce apoptosis in U87 cells. As expected, TSA promoted the accumulation of total acetylated histones H3 and H4 and a decrease in endogenous HDAC activity. Characterizing the chromatin modulation around the p21(WAF1) promoter after TSA treatment using chromatin immunoprecipitation, we found (1) a release of HDAC1, (2) an increase of acetylated H4 binding, and (3) enhanced recruitment of p53. p53-depleted U87 cells showed an abrogation of the G1/S arrest and re-entered the cell cycle. Immunofluorescence staining revealed that TSA induced the nuclear translocation of p21(WAF1) verifying a cell cycle arrest. On the other hand, a significant portion of p21(WAF1) was present in the cytoplasmic compartment causing apoptosis resistance. Furthermore, TSA-treated p53-mutant cell line U138 failed to show an induction in p21(WAF1), showed a deficient G2/M checkpoint, and underwent mitotic catastrophe. We suggest that HDAC inhibition in combination with other clinically used drugs may be considered an effective strategy to overcome chemoresistance in glioblastoma cells.
Conformational detection of p53's oligomeric state by FlAsH Fluorescence.
Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J
2009-06-19
The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.
NIC (Nuclear Industry in China) exhibition. Press file
International Nuclear Information System (INIS)
1998-01-01
Framatome participated to the NIC exhibition which took place in Beijing (China) on March 1998. This press dossier was distributed to visitors. It presents in a first part the activities of the Framatome group in people's republic of China (new constructions (Daya Bay, Ling Ao project), technological cooperation and contracts in the nuclear domain, technology transfers in the domain of nuclear fuels, activities and daughter companies in the domain of industrial equipments, Framatome Connectors International (FCI) daughter company in the domain of connectors engineering). Then, the general activities of Framatome in the nuclear, industrial equipment, and connectors engineering domains are summarized in the next 3 parts. (J.S.)
The (n,p) reaction as a probe of nuclear structure
International Nuclear Information System (INIS)
Jackson, K.P.; Celler, A.
1988-08-01
An account is given of some results of studies of the (n,p) reaction on nuclear targets at TRIUMF. The (n,p) reaction, inducing spin flip transitions in isospin space, appears to exhibit a unique sensitivity to certain aspects of nuclear structure. The TRIUMF facility is the first to exploit the (n,p) reaction as a detailed probe of nuclear structure at energies above 65 MeV. In the (n,p) reaction Fermi transitions are absent, but there is a dramatic impact on Gamow-Teller and other collective transactions. Some nuclear transition matrix elements can be estimated on the basis of (n,p) measurements. Experiments have been carried out at TRIUMF on Li 6 , Fe 5 4, and Zr 9 0 targets. The calibration of the (n,p) reaction as a probe of the Gamow-Teller strength B + GT has been achieved for three targets. (L.L.) (45 refs., 10 figs.)
Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.
Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I
2013-04-16
Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.
A dynamic P53-MDM2 model with time delay
Energy Technology Data Exchange (ETDEWEB)
Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com
2006-11-15
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.
A dynamic P53-MDM2 model with time delay
International Nuclear Information System (INIS)
Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.
2006-01-01
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results
p53 represses autophagy in a cell cycle-dependent fashion.
Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido
2008-10-01
Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.
Novel small molecule induces p53-dependent apoptosis in human colon cancer cells
International Nuclear Information System (INIS)
Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil
2007-01-01
Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent
Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.
Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina
2010-05-01
Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Non-Canonical Cell Death Induced by p53
Directory of Open Access Journals (Sweden)
Atul Ranjan
2016-12-01
Full Text Available Programmed cell death is a vital biological process for multicellular organisms to maintain cellular homeostasis, which is regulated in a complex manner. Over the past several years, apart from apoptosis, which is the principal mechanism of caspase-dependent cell death, research on non-apoptotic forms of programmed cell death has gained momentum. p53 is a well characterized tumor suppressor that controls cell proliferation and apoptosis and has also been linked to non-apoptotic, non-canonical cell death mechanisms. p53 impacts these non-canonical forms of cell death through transcriptional regulation of its downstream targets, as well as direct interactions with key players involved in these mechanisms, in a cell type- or tissue context-dependent manner. In this review article, we summarize and discuss the involvement of p53 in several non-canonical modes of cell death, including caspase-independent apoptosis (CIA, ferroptosis, necroptosis, autophagic cell death, mitotic catastrophe, paraptosis, and pyroptosis, as well as its role in efferocytosis which is the process of clearing dead or dying cells.
The prognostic value of p53 positive in colorectal cancer: A retrospective cohort study.
Wang, Peng; Liang, Jianwei; Wang, Zheng; Hou, Huirong; Shi, Lei; Zhou, Zhixiang
2017-05-01
This retrospective cohort study aimed to discuss the prognostic value of p53 positive in colorectal cancer. A total of 124 consecutive patients diagnosed with colorectal cancer were evaluated at the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College from 1 January 2009 to 31 December 2010. The expression of p53 in colorectal cancer was examined by immunohistochemistry. Based on the expression levels of p53, the 124 patients were divided into a p53 positive group and a p53 negative group. In this study, 72 patients were in the p53 positive group and 52 in the p53 negative group. The two groups were well balanced in gender, age, body mass index, American Society of Anesthesiologists scores, and number of lymph nodes harvested. p53 positive was associated with carcinoembryonic antigen ≥5 ng/mL ( p = 0.036), gross type ( p = 0.037), degree of tumor differentiation ( p = 0.026), pathological tumor stage ( p = 0.019), pathological node stage ( p = 0.004), pathological tumor-node-metastasis stage ( p = 0.017), nerve invasion ( p = 0.008), and vessel invasion ( p = 0.018). Tumor site, tumor size, and pathological pattern were not significantly different between these two groups. Disease-free survival and overall survival in the p53 positive group were significantly shorter than the p53 negative group ( p = 0.021 and 0.025, respectively). Colorectal cancer patients with p53 positive tended to be related to a higher degree of malignancy, advanced tumor-node-metastasis stage, and shorter disease-free survival and overall survival. p53 positive was independently an unfavorable prognostic marker for colorectal cancer patients.
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161
Koster, R.; Timmer-Bosscha, H.; Bischoff, R.; Gietema, J. A.; de Jong, S.
Wild-type p53 has a major role in the response and execution of apoptosis after chemotherapy in many cancers. Although high levels of wild-type p53 and hardly any TP53 mutations are found in testicular cancer (TC), chemotherapy resistance is still observed in a significant subgroup of TC patients.
Isolation and characterization of DUSP11, a novel p53 target gene
DEFF Research Database (Denmark)
Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina
2009-01-01
target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...
Protein expression of P13K and P53 in prediction of response to radiotherapy in cervical cancer
International Nuclear Information System (INIS)
Teja Kisnanto; Devita Tetriana; Iin Kurnia; Sudiono S; Mellova Amir; Budiningsih Siregar; Ramli; Andrijono; Setiawan Soetopo; Irwan; Tjahya Kurjana; Bethy S Hernowo; Maringan DL Tobing
2015-01-01
Cervical cancer is a malignant disease that is common in women and is the first order of malignant disease in Indonesia. Radiotherapy is the main treatment on cervical cancer, especially at an advanced stage (IIB-IIB). P13K and P-53 protein plays a role in the regulation of apoptosis (programmed cell death). The purpose of this study was to determine the protein expression of P13K and P-53 in the prediction of response to radiotherapy action in patients with cervical cancer. Microscopic preparations obtained from biopsy tissue cancer (IIB-IIIB) to 20 patients from RSCM and RSHS. The method used is the method of immunohistochemistry using P13K and P-53 protein biomarkers in cervical cancer tissue preparations. P13K protein expression value obtained by the method of immuno reactive Score (IRS). P13K protein positive expression marked in blue on the cell cytoplasm and P-53 protein is characterized by brown or dark colors contained in the cell nucleus. Results showed that IRS value by 10% a negative P13K, P13K IRS weaker by 70%, IRS P13K was at 15%, and the IRS P13K stronger by 5%. While the index positive P-53 was obtained by 75% and negative P-53 index by 5%. Radiotherapy response analysis showed that there were 75% good response and 25% a bad response. The conclusion from this study is the expression of the protein P13K and P-53 for response prediction of radiotherapy IRS P13K values obtained in response to both radiotherapy is higher compared with radiotherapy response is bad, and the P-53 protein is not found differences in response to radiotherapy between positive and negative expressions. (author)
Nucleoporin NUP153 guards genome integrity by promoting nuclear import of 53BP1
Czech Academy of Sciences Publication Activity Database
Moudrý, Pavel; Lukas, C.; Macůrek, Libor; Neumann, B.; Heriche, J.K.; Pepperkok, R.; Ellenberg, J.; Hodný, Zdeněk; Lukas, J.; Bartek, Jiří
2012-01-01
Roč. 19, č. 5 (2012), s. 798-807 ISSN 1350-9047 R&D Projects: GA ČR GA301/08/0353; GA ČR GAP301/10/1525; GA ČR GPP305/10/P420 Grant - others:7.RP EU(XE) CZ.1.05/2.1.00/01.0030 Institutional research plan: CEZ:AV0Z50520514 Keywords : DNA damage response * NUP153 * 53BP1 nuclear import Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.371, year: 2012
Energy Technology Data Exchange (ETDEWEB)
Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)
2002-03-01
The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)
P53 Gene Mutagenesis in Breast Cancer
National Research Council Canada - National Science Library
Sommer, Steve S
2005-01-01
.... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...
MDM2, p53 and pRb Expression Prior to Definitive Chemoradiotherapy in Esophageal Carcinoma
International Nuclear Information System (INIS)
Yoon, Mee Sun; Nam, Taek Keun; Lee, Jae Hyuk; Cho, Sang Hee; Song, Ju Young; Ahn, Sung Ja; Chung, Ik Joo; Chung, Woong Ki; Nah, Byung Sik
2007-01-01
Purpose: This study evaluated the pretreatment expression patterns of MDM2, p53, and pRb proteins to determine if the expression patterns could predict the outcome of concurrent chemoradiotherapy (CCRT) for esophageal squamous cell carcinoma and aid in the decisions for the selection of treatment modalities. Materials and Methods: Fifty-one patients that were treated with definitive hemoradiotherapy for stage I∼ IVa esohageal squamous cell carcinoma were selected for this study. Radiotherapy was administered with daily 1.8∼2 Gy fractions up to a median dose of 54 Gy for primary tumors, and with four cycles of cisplatin/5-fluorouracil chemotherapy that was administered every 4 weeks, the first two cycles of which were administered concurrently with radiotherapy. Expression of MDM2, p53, and pRb was investigated by immunohistochemical analysis using pretreatment biopsy specimens. Results: MDM2, p53, and pRb were detected with high immunoreactivity in 19.6%, 27.5%, and 66.7% of the patients, respectively. However, there was no significant correlation between expression of these factors and clinical outcome. By the use of multivariate analysis with nine covariates-age, tumor location, tumor length, stage, pathological response, clinical response, MDM2 expression, p53 expression, and pRb expression, only pathological response and stage were significant factors for cause-specific survival. Conclusion: Expression of MDM2, p53, and pRb was not found to be clinically significant for predicting outcomes after CCRT in this study. Further studies with a larger patient population and longer follow-up periods are needed to re-evaluate the expression pattern and to identify new predictors for CCRT response
Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.
Suppiah, Aravind; Greenman, John
2013-08-07
Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.
Structure and stability insights into tumour suppressor p53 evolutionary related proteins.
Directory of Open Access Journals (Sweden)
Bruno Pagano
Full Text Available The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.
Impact of Alu repeats on the evolution of human p53 binding sites
Directory of Open Access Journals (Sweden)
Sirotin Michael V
2011-01-01
Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu
Synergistic anti-tumor effects of nitroreductase mutants and p53
Directory of Open Access Journals (Sweden)
Mahboobeh Razmkhah
2014-01-01
Conclusion: Combination of T41L/F70A NTR with p53 may have more advantages for treatment of different types of cancers compared to the other NTRs and p53 alone. The present study results may open new windows for getting desired outcome in gene therapy of different types of cancer.
Coxsackievirus B5 induced apoptosis of HeLa cells: Effects on p53 and SUMO
International Nuclear Information System (INIS)
Gomes, Rogerio; Guerra-Sa, Renata; Arruda, Eurico
2010-01-01
Coxsackievirus B5 (CVB5), a human enterovirus of the family Picornaviridae, is a frequent cause of acute and chronic human diseases. The pathogenesis of enteroviral infections is not completely understood, and the fate of the CVB5-infected cell has a pivotal role in this process. We have investigated the CVB5-induced apoptosis of HeLa cells and found that it happens by the intrinsic pathway by a mechanism dependent on the ubiquitin-proteasome system, associated with nuclear aggregation of p53. Striking redistribution of both SUMO and UBC9 was noted at 4 h post-infection, simultaneously with a reduction in the levels of the ubiquitin-ligase HDM2. Taken together, these results suggest that CVB5 infection of HeLa cells elicit the intrinsic pathway of apoptosis by MDM2 degradation and p53 activation, destabilizing protein sumoylation, by a mechanism that is dependent on a functional ubiquitin-proteasome system.
p53 and the Viral Connection: Back into the Future ‡
Directory of Open Access Journals (Sweden)
Ronit Aloni-Grinstein
2018-06-01
Full Text Available The discovery of the tumor suppressor p53, through its interactions with proteins of tumor-promoting viruses, paved the way to the understanding of p53 roles in tumor virology. Over the years, accumulating data suggest that WTp53 is involved in the viral life cycle of non-tumor-promoting viruses as well. These include the influenza virus, smallpox and vaccinia viruses, the Zika virus, West Nile virus, Japanese encephalitis virus, Human Immunodeficiency Virus Type 1, Human herpes simplex virus-1, and more. Viruses have learned to manipulate WTp53 through different strategies to improve their replication and spreading in a stage-specific, bidirectional way. While some viruses require active WTp53 for efficient viral replication, others require reduction/inhibition of WTp53 activity. A better understanding of WTp53 functionality in viral life may offer new future clinical approaches, based on WTp53 manipulation, for viral infections.
Expression of p53 protein in high-grade gastroenteropancreatic neuroendocrine carcinoma
DEFF Research Database (Denmark)
Ali, Abir Salwa; Grönberg, Malin; Federspiel, Birgitte
2017-01-01
of immunoreactive p53 protein in GEP-NEC. Materials and methods Tumor tissues from 124 GEP-NEC patients with locally advanced or metastatic disease treated with platinum-based chemotherapy were collected from Nordic centers and clinical data were obtained from the Nordic NEC register. Tumor proliferation rate...... In this cohort of GEP-NEC patients, p53 expression could not be correlated with clinical outcome. However, in patients with colorectal NECs, p53 expression was correlated with shorter PFS and OS. Further studies are needed to establish the role of immunoreactive p53 as a prognostic marker for GEP-NEC patients.......Background Gastroenteropancreatic neuroendocrine carcinomas (GEP-NECs) are aggressive, rapidly proliferating tumors. Therapeutic response to current chemotherapy regimens is usually short lasting. The aim of this study was to examine the expression and potential clinical importance...
p53 Represses the Oncogenic Sno-MiR-28 Derived from a SnoRNA.
Directory of Open Access Journals (Sweden)
Feng Yu
Full Text Available p53 is a master tumour repressor that participates in vast regulatory networks, including feedback loops involving microRNAs (miRNAs that regulate p53 and that themselves are direct p53 transcriptional targets. We show here that a group of polycistronic miRNA-like non-coding RNAs derived from small nucleolar RNAs (sno-miRNAs are transcriptionally repressed by p53 through their host gene, SNHG1. The most abundant of these, sno-miR-28, directly targets the p53-stabilizing gene, TAF9B. Collectively, p53, SNHG1, sno-miR-28 and TAF9B form a regulatory loop which affects p53 stability and downstream p53-regulated pathways. In addition, SNHG1, SNORD28 and sno-miR-28 are all significantly upregulated in breast tumours and the overexpression of sno-miR-28 promotes breast epithelial cell proliferation. This research has broadened our knowledge of the crosstalk between small non-coding RNA pathways and roles of sno-miRNAs in p53 regulation.
Directory of Open Access Journals (Sweden)
Marie Lue Antony
Full Text Available Benzyl isothiocyanate (BITC, a constituent of edible cruciferous vegetables, decreases viability of cancer cells by causing apoptosis but the mechanism of cell death is not fully understood. The present study was undertaken to determine the role of Bcl-2 family proteins in BITC-induced apoptosis using MDA-MB-231 (breast, MCF-7 (breast, and HCT-116 (colon human cancer cells. The B-cell lymphoma 2 interacting mediator of cell death (Bim protein was dispensable for proapoptotic response to BITC in MCF-7 and MDA-MB-231 cells as judged by RNA interference studies. Instead, the BITC-treated MCF-7 and MDA-MB-231 cells exhibited upregulation of p53 upregulated modulator of apoptosis (PUMA protein. The BITC-mediated induction of PUMA was relatively more pronounced in MCF-7 cells due to the presence of wild-type p53 compared with MDA-MB-231 with mutant p53. The BITC-induced apoptosis was partially but significantly attenuated by RNA interference of PUMA in