WorldWideScience

Sample records for europium 161

  1. Fluorescent Europium Chelate Stain

    Science.gov (United States)

    Scaff, W. L.; Dyer, D. L.; Mori, K.

    1969-01-01

    The europium chelate of 4,4,4-trifluoro-1-(2-thienyl)-1,3-butanedione (thenoyl-trifluoroacetone; TTA) is firmly bound to microorganisms. It fluoresces brightly at 613 nm with activation at 340 nm. Cells may be stained with 10−3m chelate in 50% ethyl alcohol, followed by washing with 50% ethyl alcohol. Equal or better stains are produced with 10−3m aqueous europium salt, water wash, and 10−2m aqueous TTA. A noncomplexing buffer should be used to maintain the pH at 6.5 to 6.8. Images PMID:4181107

  2. Europium-155 in Debris from Nuclear Weapons

    DEFF Research Database (Denmark)

    Aarkrog, Asker; Lippert, Jørgen Emil

    1967-01-01

    The lithium-drifted germanium detector enables determination of europium-155 on a routine basis in environmental samples contaminated with debris from nuclear weapons. From measurements of europium-155, cesium-144, and strontium-90 in air filters collected between 1961 and 1966, the yield...... of europium-155 from weapons was estimated at 1400 atoms per 10$^{6}$ fissions, which is close to the yield of europium-155 from fast fission of uranium-238....

  3. The electrochemical synthesis of europium boride

    Directory of Open Access Journals (Sweden)

    Bukatova G.A.

    2003-01-01

    Full Text Available The electroreduction of boron, europium and the electrochemical synthesis of europium boride have been investigated in NaCl-KCl-NaF(10 wt. % melt on silver and molybdenum electrodes. The parameters of boron reduction in the chloride-fluoride melt have been obtained and the character of its joint deposition with europium has been studied.

  4. The electrochemical synthesis of europium boride

    OpenAIRE

    Bukatova G.A.; Kuznetsov S.A.; Gaune-Escard M.

    2003-01-01

    The electroreduction of boron, europium and the electrochemical synthesis of europium boride have been investigated in NaCl-KCl-NaF(10 wt. %) melt on silver and molybdenum electrodes. The parameters of boron reduction in the chloride-fluoride melt have been obtained and the character of its joint deposition with europium has been studied.

  5. Liposome Biodistribution via Europium Complexes.

    Science.gov (United States)

    Mignet, Nathalie; Scherman, Daniel

    2017-01-01

    The drug delivery field needs tools to follow vector biodistribution. Radioactive tracers and conventional fluorophores are widely used. We propose here to use europium complexes. Use of pulsed light source time-resolved fluorimetry takes into account the fluorescence decay time of the lanthanide chelates to gain sensitivity in biological media. The method was developed to follow liposome biodistribution. Octadecyl-DTPA.Eu compound has been prepared and incorporated into liposomes without alteration of its fluorescence signal. The method has been validated by comparison with fluorophore-labeled liposomes. The way to proceed to use this method for liposomes or other vectors is detailed.

  6. Resonance ionization scheme development for europium

    CERN Document Server

    Chrysalidis, K; Fedosseev, V N; Marsh, B A; Naubereit, P; Rothe, S; Seiffert, C; Kron, T; Wendt, K

    2017-01-01

    Odd-parity autoionizing states of europium have been investigated by resonance ionization spectroscopy via two-step, two-resonance excitations. The aim of this work was to establish ionization schemes specifically suited for europium ion beam production using the ISOLDE Resonance Ionization Laser Ion Source (RILIS). 13 new RILIS-compatible ionization schemes are proposed. The scheme development was the first application of the Photo Ionization Spectroscopy Apparatus (PISA) which has recently been integrated into the RILIS setup.

  7. Resonance ionization scheme development for europium

    Energy Technology Data Exchange (ETDEWEB)

    Chrysalidis, K., E-mail: katerina.chrysalidis@cern.ch; Goodacre, T. Day; Fedosseev, V. N.; Marsh, B. A. [CERN (Switzerland); Naubereit, P. [Johannes Gutenberg-Universität, Institiut für Physik (Germany); Rothe, S.; Seiffert, C. [CERN (Switzerland); Kron, T.; Wendt, K. [Johannes Gutenberg-Universität, Institiut für Physik (Germany)

    2017-11-15

    Odd-parity autoionizing states of europium have been investigated by resonance ionization spectroscopy via two-step, two-resonance excitations. The aim of this work was to establish ionization schemes specifically suited for europium ion beam production using the ISOLDE Resonance Ionization Laser Ion Source (RILIS). 13 new RILIS-compatible ionization schemes are proposed. The scheme development was the first application of the Photo Ionization Spectroscopy Apparatus (PISA) which has recently been integrated into the RILIS setup.

  8. Electronic state of europium atoms on surface of oxidized tungsten

    CERN Document Server

    Davydov, S Y

    2001-01-01

    The energy scheme of the europium atoms adsorption system on the tungsten surface, coated with the oxygen monolayer, is considered. The evaluations of the europium adatoms charged state on the oxidized tungsten surface are performed. It is established, that europium, adsorbed at the oxidized tungsten surface, is a positive ion with the charge close to the unit. The zonal scheme of the Eu-O/W adsorption system for the europium low and high concentrations is proposed

  9. Europium anomaly in plagioclase feldspar - Experimental results and semiquantitative model.

    Science.gov (United States)

    Weill, D. F.; Drake, M. J.

    1973-01-01

    The partition of europium between plagioclase feldspar and magmatic liquid is considered in terms of the distribution coefficients for divalent and trivalent europium. A model equation is derived giving the europium anomaly in plagioclase as a function of temperature and oxygen fugacity. The model explains europium anomalies in plagioclase synthesized under controlled laboratory conditions as well as the variations of the anomaly observed in natural terrestrial and extraterrestrial igneous rocks.

  10. Fermi Surface and Antiferromagnetism in Europium Metal

    DEFF Research Database (Denmark)

    Andersen, O. Krogh; Loucks, T. L.

    1968-01-01

    We have calculated the Fermi surface of europium in order to find those features which determine the wave vector of the helical moment arrangement below the Néel point. We find that there are two pieces of Fermi surface: an electron surface at the symmetry point H, which has the shape of rounded...... of the nearly cubical part of the hole surface at P, and we also discuss the effects of the electron surface at H. Since it is likely that barium and europium have similar Fermi surfaces, we have presented several extremal areas and the corresponding de Haas-van Alphen frequencies in the hope that experimental...

  11. Organophosphate Nerve Agent Detection with Europium Complexes

    Directory of Open Access Journals (Sweden)

    Jake R. Schwierking

    2004-01-01

    Full Text Available We explore the detection of paraoxon, a model compound for nonvolatile organophosphate nerve agents such as VX. The detection utilizes europium complexes with 1,10 phenanthroline and thenoyltrifluoroacetone as sensitizing ligands. Both europium luminescence quenching and luminescence enhancement modalities are involved in the detection, which is simple, rapid, and sensitive. It is adaptable as well to the more volatile fluorophosphate nerve agents. It involves nothing more than visual luminescence observation under sample illumination by an ordinary hand-held ultraviolet lamp.

  12. Europium enabled luminescent nanoparticles for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Syamchand, S.S., E-mail: syamchand.ss@gmail.com; Sony, G., E-mail: emailtosony@gmail.com

    2015-09-15

    Lanthanide based nanoparticles are receiving great attention ought to their excellent luminescent and magnetic properties and find challenging biomedical applications. Among the luminescent lanthanide NPs, europium based NPs (Eu-NPs) are better candidates for immunoassay and imaging applications. The Eu-NPs have an edge over quantum dots (QDs) by means of their stable luminescence, long fluorescence lifetime, sharp emission peaks with narrow band width, lack of blinking and biocompatibility. This review surveys the synthesis and properties of a variety of Eu-NPs consolidated from different research articles, for their applications in medicine and biology. The exquisite luminescent properties of Eu-NPs are explored for developing biomedical applications such as immunoassay and bioimaging including multimodal imaging. The biomedical applications of Eu-NPs are mostly diagnostic in nature and mainly focus on various key analytes present in biological systems. The luminescent properties of europium enabled NPs are influenced by a number of factors such as the site symmetry, the metal nanoparticles, metal ions, quantum dots, surfactants, morphology of Eu-NPs, crystal defect, phenomena like antenna effect and physical parameters like temperature. Through this review we explore and assimilate all the factors which affect the luminescence in Eu-NPs and coil a new thread of parameters that control the luminescence in Eu-NPs, which would provide further insight in developing Eu-based nanoprobes for future biomedical prospects. - Highlights: • The review describes 14 major factors that influence the luminescence properties of europium enabled luminescent nanoparticles (Eu-NPs). • Surveys different types of europium containing nanoparticles that have been reported for their biomedical applications. • Eu-NPs are conveniently divided into four different categories, based on the type of the substrates involved. The four categories are (1) virgin Eu-substrate based NPs; (2

  13. The Europium Oxybarometer: Power and Pitfalls

    Science.gov (United States)

    McKay, G.

    2004-01-01

    One of the most important characteristics of a planet is the oxidation state of its mantle, as reflected in primitive basalts. Petrologists have devised several methods to estimate the oxygen fugacity under which basalts crystallized. One method that has been the subject of recent interest involves the depth of the Eu anomaly in first-crystallizing minerals. A discussion detailing the experimental calibration of the Europium oxybarometer and the application of this device to Angrites and Martian basaltic meteorites are presented. The strengths and weaknesses of the instrument are also included.

  14. Europium Effect on the Electron Transport in Graphene Ribbons

    Energy Technology Data Exchange (ETDEWEB)

    Bobadilla, Alfredo D.; Ocola, Leonidas E.; Sumant, Anirudha V.; Kaminski, Michael; Kumar, Narendra; Seminario, Jorge M.

    2015-10-01

    We report in this complementary theoretical-experimental work the effect of gating on the election transport of grapheme ribbons when exposed to very low concentration of europium in an aqueous solution. We find a direct correlation between the level of concentration of europium ions in the solvent and the change in electron transport in graphene, observing a change of up to 3 orders of magnitude at the lowest level of concentration tested (0.1 mM), suggesting a possibility that graphene ribbons can be used for detecting very low concentrations of europium in liquid solutions.

  15. Paramagnetic Europium Salen Complex and Sickle-Cell Anemia

    Science.gov (United States)

    Wynter, Clive I.; Ryan, D. H.; May, Leopold; Oliver, F. W.; Brown, Eugene; Hoffman, Eugene J.; Bernstein, David

    2005-04-01

    A new europium salen complex, Eu(salen)2NH4, was synthesized, and its composition was confirmed by chemical analysis and infrared spectroscopy. Further characterization was carried out by 151 Eu Mössbauer spectroscopy and magnetic susceptibility measurements. Mössbauer spectroscopic measurements were made at varying temperatures between 9 K and room temperature and a value of Debye temperature of 133 ±5 K was computed. Both Mössbauer and magnetic susceptibility measurements confirmed the paramagnetic behavior of this complex and the trivalent state of the europium ion. In view of the fact that the "odd" paramagnetic molecule NO has been shown to reverse sickling of red blood cells in sickle cell anemia, the interaction between the paramagnetic europium salen complex and sickle cells was examined after incubation with this europium complex and shown to have similar effects.

  16. Europium polyoxometalates encapsulated in silica nanoparticles - characterization and photoluminescence studies

    Energy Technology Data Exchange (ETDEWEB)

    Neves, Cristina S.; Granadeiro, Carlos M.; Cunha-Silva, Luis; Eaton, Peter; Balula, Salete S.; Pereira, Eulalia [REQUIMTE/Departamento de Quimica e Bioquimica, Faculdade de Ciencias, Universidade do Porto (Portugal); Ananias, Duarte [CICECO, Departamento de Quimica, Universidade de Aveiro (Portugal); Gago, Sandra [REQUIMTE, Departamento de Quimica, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Feio, Gabriel [CENIMAT/I3N, Departamento de Ciencia dos Materiais, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Monte de Caparica (Portugal); Carvalho, Patricia A. [ICEMS/Departamento de Bioengenharia, Instituto Superior Tecnico, Lisboa (Portugal)

    2013-06-15

    The incorporation of europium polyoxometalates into silica nanoparticles can lead to a biocompatible nanomaterial with luminescent properties suitable for applications in biosensors, biological probes, and imaging. Keggin-type europium polyoxometalates Eu(PW{sub 11}){sub x} (x = 1 and 2) with different europium coordination environments were prepared by using simple methodologies and no expensive reactants. These luminescent compounds were then encapsulated into silica nanoparticles for the first time through the water-in-oil microemulsion methodology with a nonionic surfactant. The europium polyoxometalates and the nanoparticles were characterized by using several techniques [FTIR, FT-Raman, {sup 31}P magic angle spinning (MAS) NMR, and TEM/energy-dispersive X-ray spectroscopy (TEM-EDS), AFM, dynamic light scattering (DLS), and inductively coupled plasma MS (ICP-MS) analysis]. The stability of the material and the integrity of the europium compounds incorporated were also examined. Furthermore, the photoluminescence properties of the Eu(PW{sub 11}){sub x} rate at SiO{sub 2} nanomaterials were evaluated and compared with those of the free europium polyoxometalates. The silica surface of the most stable nanoparticles was successfully functionalized with appropriate organosilanes to enable the covalent binding of oligonucleotides. (Copyright copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  17. Spectral Properties of a bis-Azospiropyran Complexed with Europium

    Science.gov (United States)

    Nourmohammadian, F.; Ghahari, M.; Gholami, M. Davoudzadeh

    2015-09-01

    The complexation of recently synthesized symmetrical bifunctional bis-azospiropyran photochromic dye with europium nitrate and its effect on UV-vis absorption and fluorescent emission was studied. Upon addition of Eu 3+ to colorless spiropyran, a yellow merocyanine europium complex was obtained with an absorption band at 410 nm. Negatively charged phenolic oxygenin zwitterionic ring-open form provides an effective metal binding site for Eu 3+ . Meanwhile, the inherent fluorescence emission of the photochromic dye at 380 nm is switched off due to the Eu 3+ - induced drive of spiro-mero equilibrium to form mero form. The stoichiometry of dye-europium complexation was evaluated by fluorescence emission and UV-vis absorption spectroscopy and a 8:1 ratio was obtained in both cases. The binding constant (K) value of the dye-europium complex was 3 × 106 M -1 . In conclusion, the current molecular switch is a useful sensitive dual measuring tool for solutions containing europium or europium-like elements by evaluation of visible absorption or fluorescent emission spectroscopy.

  18. Metal plasmon enhanced europium complex luminescence

    Energy Technology Data Exchange (ETDEWEB)

    Liu Feng [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada); Aldea, Gabriela [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada); Petru Poni Institute of Macromolecular Chemistry Iasi, Aleea Grigore Ghica Voda 41A, 700487 Iasi (Romania); Nunzi, Jean-Michel, E-mail: nunzijm@queensu.c [Department of Chemistry, Queen' s University, 90 Bader Lane, Kingston, Ontario, K7L 3N6 (Canada)

    2010-01-15

    The plasmon enhanced luminescence of a rare-earth complex Tris(6, 6, 7, 7, 8, 8, 8-heptafluoro-2, 2-dimethyl-3, 5-octanedionato) europium (Eu(fod){sub 3}) was investigated. A polyvinyl alcohol (PVA) thin film was successfully adopted as a spacer to separate the Eu complex from the silver island film (SIF), and five-fold enhancement of the radiative decay rate of the Eu complex on SIF was demonstrated based on the luminescence intensity and lifetime measurement. Investigation of the distance dependent luminescence indicates that 7 nm is an optimal distance for SIF enhanced Eu luminescence. Plasmon enhanced rare-earth luminescence based on an organic film spacer would find potential applications in plasmon enhanced organic light emitting diode (OLED) devices.

  19. Novel fluorescent probe for low density lipoprotein, based on the enhancement of Europium emission band

    OpenAIRE

    Courrol, Lilia Coronato; Monteiro, A.M.; SILVA, F.R.O.; L. Gomes; VIEIRA, N.D.; Gidlund, Magnus; Figueiredo Neto, A.M.

    2007-01-01

    We report here the observation of the enhancement of Europium-tetracycline complex emission in Low Density Lipoprotein (LDL) solutions. Europium emission band of tetracycline solution containing Europium (III) chloride hexahydrate was tested to obtain effective enhancement in the presence of native LDL and oxidized LDL. Europium emission lifetime in the presence of lipoproteins was measured, resulting in a simple method to measure the lipoproteins quantity in an aqueous solution at physiologi...

  20. 40 CFR 35.161 - Definition.

    Science.gov (United States)

    2010-07-01

    ... ASSISTANCE Environmental Program Grants Water Pollution Control (section 106) § 35.161 Definition. Recurrent expenditures are those expenditures associated with the activities of a continuing Water Pollution Control... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Definition. 35.161 Section 35.161...

  1. 46 CFR 161.012-9 - Performance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 6 2010-10-01 2010-10-01 false Performance. 161.012-9 Section 161.012-9 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Personal Flotation Device Lights § 161.012-9 Performance. (a) If...

  2. 7 CFR 1427.161 - Administration.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Administration. 1427.161 Section 1427.161 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.161 Administration...

  3. 46 CFR 161.012-7 - Construction.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 6 2010-10-01 2010-10-01 false Construction. 161.012-7 Section 161.012-7 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Personal Flotation Device Lights § 161.012-7 Construction. (a...

  4. 14 CFR 21.161 - Display.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Display. 21.161 Section 21.161 Aeronautics... PROCEDURES FOR PRODUCTS AND PARTS Production Certificates § 21.161 Display. The holder of a production certificate shall display it prominently in the main office of the factory in which the product concerned is...

  5. 14 CFR 161.5 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... NOTICE AND APPROVAL OF AIRPORT NOISE AND ACCESS RESTRICTIONS General Provisions § 161.5 Definitions. For... definition does not include peak-period pricing programs where the objective is to align the number of... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Definitions. 161.5 Section 161.5...

  6. Europium ion as a probe for binding sites to carrageenans

    Energy Technology Data Exchange (ETDEWEB)

    Ramos, Ana P.; Goncalves, Rogeria R.; Serra, Osvaldo A. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil); Zaniquelli, Maria Elisabete D. [Departamento de Quimica, Faculdade de Filosofia, Ciencias e Letras de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, Sao Paulo 14040-901 (Brazil)], E-mail: medzaniquelli@ffclrp.usp.br; Wong, Kenneth [Laboratorio de Fisico-Quimica, Centro de Pesquisas de Paulinia, Rhodia Brasil, Paulinia, Sao Paulo (Brazil)

    2007-12-15

    Carrageenans, sulfated polysaccharides extracted from red algae, present a coil-helix transition and helix aggregation dependence on the type and concentration of counterions. In this study, we focus attention on a mixed valence counterion system: Eu{sup 3+}/Na{sup +} or K{sup +} with different gel-forming carrageenans: kappa, iota, and kappa-2. Results of stationary and time-dependent luminescence showed to be a suitable tool to probe ion binding to both the negatively charged sulfate group and the hydroxyl groups present in the biopolymer. For lower europium ion concentrations, a single longer decay emission lifetime was detected, which was attributed to the binding of europium ion to the carrageenan sulfate groups. An additional decay ascribed to europium binding to hydroxyl groups was observed above a threshold concentration, and this decay was dependent on the carrageenan charge density. Symmetry of the europium ion microenvironment was estimated by the ratio between the intensities of its emission bands, which has been shown to depend on the concentration of europium ions and on the specificity of the monovalent counterion bound to the carrageenan.

  7. First-Principles Investigations on Europium Monoxide

    KAUST Repository

    Wang, Hao

    2011-05-01

    Europium monoxide is both an insulator and a Heisenberg ferromagnet (Tc=69 K). In the present thesis, the author has investigated the electronic structure of different types of EuO by density functional theory. The on-site Coulomb interaction of the localized Eu 4f and 5d electrons, which is wrongly treated in the standard generalized gradient approximation method, is found to be crucial to obtain the correct insulating ground state as observed in experiments. Our results show that the ferromagnetism is stable under pressure, both hydrostatic and uniaxial. For both types of pressure an insulator-metal transition is demonstrated. Moreover, the experimentally observed insulator-metal transition in oxygen deficient and gadolinium-doped EuO is reproduced in our calculations for impurity concentrations of 6.25% and 25%. Furthermore, a 10- layer EuO thin film is theoretically predicted to be an insulator with a narrow band gap of around 0.08 eV, while the Si/EuO interface shows metallic properties with the Si and O 2p as well as Eu 5d bands crossing the Fermi level.

  8. Chloride, bromide and iodide scintillators with europium

    Science.gov (United States)

    Zhuravleva, Mariya; Yang, Kan

    2016-09-27

    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  9. Electrochemical extraction of europium from molten fluoride media

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France); Massot, L., E-mail: massot@chimie.ups-tlse.f [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France); Chamelot, P.; Cassayre, L.; Taxil, P. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, Departement Procedes Electrochimiques, F-31062 Toulouse cedex 09 (France); CNRS, Laboratoire de Genie Chimique, F-31062 Toulouse cedex 09 (France)

    2009-12-15

    This work concerns the extraction of europium from molten fluoride media. Two electrochemical ways have been examined: (i) the use of a reactive cathode made of copper and (ii) the co-deposition with aluminium on inert electrode, leading to the formation of europium-copper and europium-aluminium alloys, respectively, as identified by SEM-EDS analysis. Cyclic voltammetry and square wave voltammetry were used to identify the reduction pathway and to characterise the step of Cu-Eu and Al-Eu alloys formation. Then, electrochemical extractions using the two methodologies have been performed with extraction efficiency around 92% for copper electrode and 99.7% for co-reduction with aluminium ions.

  10. Solubilization of europium fulvate in aqueous solutions containing complexing agents

    Energy Technology Data Exchange (ETDEWEB)

    Legin, E.K.; Trifonov, Yu.I.; Khokhlov, M.L. [Khlopin Radium Inst., St. Petersburg (Russian Federation)] [and others

    1995-07-01

    The europium fulvate complex is synthesized and characterized by spectroscopic and chemical methods. By an example of this complex, it is demonstrated that metal complexes of humic substances are solubilized in the presence of complexing anions such as OAc{sup {minus}}, C{sub 2}O{sup 2{minus}}{sub 4}, and EDTA{sup 2{minus}}. The solubilization is studied by the optical and radioactive tracer methods. The solubilization of europium fulvate increases parallel to the complexing power of anions. In the solid fulvate europium is bonded stronger than in the ethylenediaminetetraacetate complex. The solubilization is considered as a potential source for decomposition of the {open_quotes}absorbing soil complex,{close_quotes} resulting in mobile forms of a metal and humic component in soils and soil waters.

  11. Excess europium content in Precambrian sedimentary rocks and continental evolution

    Science.gov (United States)

    Jakes, P.; Taylor, S. R.

    1974-01-01

    It is proposed that the europium excess in Precambrian sedimentary rocks, relative to those of younger age, is derived from volcanic rocks of ancient island arcs, which were the source materials for the sediments. Precambrian sedimentary rocks and present-day volcanic rocks of island arcs have similar REE patterns, total REE abundances, and excess Eu, relative to the North American shale composite. The present upper crustal REE pattern, as exemplified by that of sediments, is depleted in Eu, relative to chondrites. This depletion is considered to be a consequence of development of a granodioritic upper crust by partial melting in the lower crust, which selectively retains europium.

  12. Murine High Specificity/Sensitivity Competitive Europium Insulin Autoantibody Assay

    Science.gov (United States)

    Babaya, Naru; Liu, Edwin; Miao, DongMei; Li, Marcella; Yu, Liping

    2009-01-01

    Abstract Background Most insulin autoantibody assays for both human and animal models are in a radioassay format utilizing 125I-insulin, but despite the radioassay format international workshops have documented difficulty in standardization between laboratories. There is thus a need for simpler assay formats that do not utilize radioactivity, yet retain the high specificity and sensitivity of radioassays. Methods To establish an easier enzyme-linked immunosorbent assay (ELISA) for insulin autoantibodies of non-obese diabetic (NOD) mice, we used an ELISA format, competition with unlabeled insulin, europium-avidin, and time-resolved fluorescence detection (competitive europium insulin autoantibody assay). Results The competitive europium assay of insulin autoantibodies when applied to sera from NOD mice had high sensitivity and specificity (92% sensitivity, 100% specificity) compared to our standard insulin autoantibody radioassay (72% sensitivity, 100% specificity) in analyzing blind workshop sera. It is noteworthy that though the assay has extremely high sensitivity for murine insulin autoantibodies and utilizes human insulin as target autoantigen, human sera with high levels of insulin autoantibodies are not detected. Conclusions Our results clearly indicate that low levels of insulin autoantibodies can be detected in an ELISA-like format. Combining a europium-based ELISA with competition with fluid-phase autoantigen can be applicable to many autoantigens to achieve high specificity and sensitivity in an ELISA format. PMID:19344197

  13. Tridentate benzimidazole-pyridine-tetrazolates as sensitizers of europium luminescence.

    Science.gov (United States)

    Shavaleev, Nail M; Eliseeva, Svetlana V; Scopelliti, Rosario; Bünzli, Jean-Claude G

    2014-05-19

    We report on new anionic tridentate benzimidazole-pyridine-tetrazolate ligands that form neutral 3:1 complexes with trivalent lanthanides. The ligands are UV-absorbing chromophores that sensitize the red luminescence of europium with energy-transfer efficiency of 74-100%. The lifetime and quantum yield of the sensitized europium luminescence increase from 0.5 ms and 12-13% for the as-prepared solids to 2.8 ms and 41% for dichloromethane solution. From analysis of the data, the as-prepared solids can be described as aqua-complexes [Ln(κ(3)-ligand)2(κ(1)-ligand)(H2O)x] where the coordinated water molecules are responsible for the strong quenching of the europium luminescence. In solution, the coordinated water molecules are replaced by the nitrogen atoms of the κ(1)-ligand to give anhydrous complexes [Ln(κ(3)-ligand)3] that exhibit efficient europium luminescence. X-ray structures of the anhydrous complexes confirm that the lanthanide ion (La(III), Eu(III)) is nine-coordinate in a distorted tricapped trigonal prismatic environment and that coordination of the lanthanide ion by tetrazolate is weaker than by carboxylate.

  14. Europium 2-benzofuranoate: Synthesis and use for bioimaging

    Science.gov (United States)

    Utochnikova, V. V.; Koshelev, D. S.; Medvedko, A. V.; Kalyakina, A. S.; Bushmarinov, I. S.; Grishko, A. Yu; Schepers, U.; Bräse, S.; Vatsadze, S. Z.

    2017-12-01

    Europium 2-benzofuranoate Eu(BFC)3(H2O)3 was successfully used for bioimaging in cellulo due to the combination of high solubility and high luminescence intensity in solution. It was possible due to the purposeful variation of the aromatic core of carboxylate anion.

  15. 29 CFR 1952.161 - Developmental schedule.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.161 Section 1952.161 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... provided by the plan: (a) Enabling legislation becomes effective (Chapter 88 of Iowa Code)—July 1972. (b...

  16. 50 CFR 14.161 - Primary enclosures.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Primary enclosures. 14.161 Section 14.161... Primary enclosures. (a) Except as provided in § 14.106(j), ventilation openings must be located on at least two walls of a primary enclosure. When the required ventilation openings are located on two...

  17. 46 CFR 161.006-4 - Requirements.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 6 2010-10-01 2010-10-01 false Requirements. 161.006-4 Section 161.006-4 Shipping COAST... Requirements. (a) Corrosion-resisting materials. Silver, corrosion-resisting steel, copper, brass, bronze and... intensity. (k) Bolts, nuts, and screws. Bolts and nuts shall conform to the requirements of Navy Department...

  18. 40 CFR 417.161 - Specialized definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Specialized definitions. 417.161 Section 417.161 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS SOAP AND DETERGENT MANUFACTURING POINT SOURCE CATEGORY Manufacture of Liquid Detergents...

  19. SEPARATION OF EUROPIUM FROM OTHER LANTHANIDE RAE EARTHS BY SOLVENT EXTRACTION

    Science.gov (United States)

    Peppard, D.F.; Horwitz, E.P.; Mason, G.W.

    1963-02-12

    This patent deals with a process of separating europium from other lanthanides present in aqueous hydrochloric or sulfuric acid solutions. The europium is selectively reduced to the divalent state with a divalent chromium salt formed in situ from chromium(III) salt plus zinc amalgam. The other trivalent lanthanides are then extracted away from the divalent europium with a nitrogen-flushed phosphoric acid ester or a phosphonic acid ester. (AEC)

  20. Distribution, elimination, and renal effects of single oral doses of europium in rats.

    Science.gov (United States)

    Ohnishi, Keiko; Usuda, Kan; Nakayama, Shin; Sugiura, Yumiko; Kitamura, Yasuhiro; Kurita, Akihiro; Tsuda, Yuko; Kimura, Motoshi; Kono, Koichi

    2011-11-01

    Single doses of europium (III) chloride hexahydrate were orally administered to several groups of rats. Cumulative urine samples were taken at 0-24 h, and blood samples were drawn after 24-h administration. The europium concentration was determined in these samples by inductively coupled plasma atomic emission spectroscopy. The volume, creatinine, ß-2-microglobulin, and N-acetyl-ß-D-glucosaminidase were measured in the urine samples to evaluate possible europium-induced renal effects. The blood samples showed low europium distribution, with an average of 77.5 μg/L for all groups. Although the urinary concentration and excretion showed dose-dependent increases, the percentage of europium excreted showed a dose-dependent decrease, with an average of 0.31% in all groups. The administration of europium resulted in a significant decrease of creatinine and a significant increase of urinary volume, N-acetyl-ß-D-glucosaminidase, and ß-2-microglobulin. Rare earth elements, including europium, are believed to form colloidal conjugates that deposit in the reticuloendothelial system and glomeruli. This specific reaction may contribute to low europium bioavailability and renal function disturbances. Despite low bioavailability, the high performance of the analytical method for determination of europium makes the blood and urine sampling suitable tools for monitoring of exposure to this element. The results presented in this study will be of great importance in future studies on the health impacts of rare earth elements.

  1. [Synthesis and luminescence properties of reactive ternary europium complexes].

    Science.gov (United States)

    Guo, Dong-cai; Shu, Wan-gen; Zhang, Wei; Liu, You-nian; Zhou, Yue

    2004-09-01

    In this paper, five new reactive ternary europium complexes were synthesized with the first ligand of 1,10-phenanthroline and the reactive second ligands of maleic anhydride, acrylonitrile, undecenoic acid, oleic acid and linoleic acid, and also characterized by means of elemental analysis, EDTA titrimetric method, FTIR spectra and UV spectra. The fluorescence spectra show that the five new ternary complexes have much higher luminescence intensity than their corresponding binary complexes, and the synergy ability sequence of the five reactive ligands is as follows: linoleic acid > oleic acid > acrylonitrile > maleic anhydride > undecenoic acid. At the same time, the reactive ternary europium complexes coordinated with the reactive ligands, which can be copolymerized with other monomers, will provide a new way for the synthesis of bonding-type rare earth polymer functional materials with excellent luminescence properties.

  2. Solvent extraction of europium(III) to a fluorine-free ionic liquid phase with a diglycolamic acid extractant

    OpenAIRE

    Rout, Alok; Souza, Ernesto Rezende; Binnemans, Koen

    2014-01-01

    Europium(III) was extracted by bis(2-ethylhexyl)diglycolamic acid (DEHDGA) dissolved in the non-fluorinated ionic liquid tetraoctylammonium dodecyl sulphate, [N8888][DS]. The extraction behaviour of europium(III) was investigated as a function of various parameters: pH, extractant concentration, concentration of the europium(III) ion in the aqueous feed and concentration of the salting-out agent. A comparison was made with extraction of europium(III) by the acidic extractants bis(2-ethylhexyl...

  3. Silver lead borate glasses doped with europium ions for phosphors ...

    Indian Academy of Sciences (India)

    2017-07-25

    Jul 25, 2017 ... Abstract. Europium (Eu3+) doped silver lead borate glasses with the composition of xEu2O3−(1 − x)Ag2. O−29PbO−70B2O3 (x = 0, 0.1, 0.2, 0.3, 0.4 and 0.5 mol%) have been successfully prepared by conventional melt quenching method. Thermal, structural and luminescence properties have been studied ...

  4. Silver lead borate glasses doped with europium ions for phosphors ...

    Indian Academy of Sciences (India)

    Europium (Eu 3 + ) doped silver lead borate glasses with the composition of x Eu 2 O 3 −( 1 − x )Ag 2 O−29PbO−70B 2 O 3 ( x = 0 , 0.1, 0.2, 0.3, 0.4 and 0.5 mol%) have been successfully prepared by conventional meltquenching method. Thermal, structural and luminescence properties have been studied using ...

  5. Synthesis and luminescence properties for europium oxide nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Mo Zunli, E-mail: mozl@163.com [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China) and State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xi' an 710072 (China); Deng Zhepeng; Guo Ruibin [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China); Fu Qiangang [State Key Laboratory of Solidification Processing, Northwestern Polytechnical University, Xi' an 710072 (China); Feng Chao; Liu Pengwei; Sun Yu [Key Laboratory of Eco-Environment-Related Polymer Materials, Ministry of Education of China, Key Laboratory of Polymer Materials of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou 730070 (China)

    2012-01-25

    Highlights: Black-Right-Pointing-Pointer A novel high temperature sensitive fluorescent CNTs/Eu{sub 2}O{sub 3} nanocomposite was fabricated. Black-Right-Pointing-Pointer The nanocomposite showed strong fluorescent emission peaks at around 540 and 580 nm after calcined beyond 620 Degree-Sign C for 4 h. Black-Right-Pointing-Pointer The ultrahigh fluorescence intensity of the nanocomposites resulted from a synergetic effect of CNTs and europium oxide. Black-Right-Pointing-Pointer We also discovered that CNTs had an effect of fluorescence quenching. - Abstract: A novel high temperature sensitive fluorescent nanocomposite has been successfully synthesized by an economic hydrothermal method using carbon nanotubes (CNTs), europium oxide, and sodium dodecyl benzene sulfonate (SDBS). To our great interest, the nanocomposites show high temperature sensitivity after calcinations at various temperatures, suggesting a synergetic effect of CNTs and europium oxide which leads to ultrahigh fluorescence intensity of europium oxide nanotubes. When the novel high temperature sensitive fluorescent nanocomposites were calcined beyond 620 Degree-Sign C for 4 h, the obtained nanocomposites have a strong emission peak at around 540 and 580 nm, due to the {sup 5}D{sub 0} {yields} {sup 7}F{sub j} (j = 0, 1) forced electric dipole transition of Eu{sup 3+} ions. In turn, the emission spectra showed a slight blue shift. The intensity of this photoluminescence (PL) band is remarkably temperature-dependent and promotes strongly beyond 620 Degree-Sign C. This novel feature is attributed to the thermally activated carrier transfer process from nanocrystals and charged intrinsic defects states to Eu{sup 3+} energy levels. The novel high temperature sensitive fluorescent nanocomposite has potential applications in high temperature warning materials, sensors and field emission displays. It is also interesting to discover that CNTs have the effect of fluorescence quenching.

  6. 46 CFR 161.012-3 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... used in this subpart, PFD means Coast Guard approved personal flotation device. (b) For the purpose of § 161.012-7, storage life means the amount of time after the date of manufacture of the power source of...

  7. 161 Teachers' Continuing Professional Development as Correlates ...

    African Journals Online (AJOL)

    User

    Pp. 161-177). Iyunade .... The statistics for 2008 is 1724. Teachers' Continuing Professional Development as Correlates of Sustainable UBE. .... implementation while instilling in them virtues of dedication, loyalty, commitment, discipline and ...

  8. Optical and magnetization studies on europium based iron pnictides

    Energy Technology Data Exchange (ETDEWEB)

    Zapf, Sina Maria Ute

    2015-07-01

    The investigations carried out in the framework of this thesis mainly concentrate on europium based iron pnictides. These are a peculiar member of the 122 family as they develop at low temperatures (∝20K) an additional magnetic order of the local rare earth moments. Therefore, europium based iron pnictides provide a unique platform to study the interplay of structural, magnetic and electronic effects in high-temperature superconductors. For this challenging purpose, we have employed SQUID magnetometry and Fourier-transform infrared spectroscopy on EuFe{sub 2}(As{sub 1-x}P{sub x}){sub 2} single crystals. By systematic studies of the in- and out-of-plane magnetic properties of a series of single crystals, we derived the complex magnetic phase diagram of europium based iron pnictides, which contains an A-type antiferromagnetic and a re-entrant spin glass phase. Furthermore, we have investigated the magneto-optical properties of EuFe{sub 2}As{sub 2}, revealing a much more complex magnetic detwinning process than expected. These studies demonstrate a remarkable interdependence between magnetic, electronic and structural effects that might be very important to understand the unconventional superconductivity in these fascinating materials.

  9. Use of europium ions for SAD phasing of lysozyme at the Cu Kα wavelength

    OpenAIRE

    Vijayakumar, Balakrishnan; Velmurugan, Devadasan

    2012-01-01

    Europium(III) ions bound to the surface of hen egg-white lysozyme were found to exhibit good anomalous signal facilitating SAD phasing using laboratory-source data and automated model building. The europium ion-binding sites were observed up to the 15σ level.

  10. Dicty_cDB: CHF161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF161 (Link to dictyBase) - - - Contig-U16411-1 | Contig-U16470-1 CHF...161P (Link to Original site) CHF161F 559 CHF161Z 759 CHF161P 1298 - - Show CHF161 Library CH (Link to library) Clone ID CHF...411-1 | Contig-U16470-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHF1-C/CHF...161Q.Seq.d/ Representative seq. ID CHF161P (Link to Original site) Representative DNA sequence >CHF161 (CHF...161Q) /CSM/CH/CHF1-C/CHF161Q.Seq.d/ ATTAATAAATAATAATTAAAATTTGCATATATAAAAGAAATAAAAATTTTTTATTTTTTG

  11. Enhancement in red emission at room temperature from europium doped ZnO nanowires by 1,10 phenanthroline-europium interface induced resonant excitations

    Directory of Open Access Journals (Sweden)

    Soumen Dhara

    2017-02-01

    Full Text Available We show that europium doped ZnO nanowires after surface modification with organic ligand, 1,10 phenanthroline (phen leads to strong red emission at 613 nm which is a characteristic emission from the atomic levels of Eu3+. Surface modification with phen leads to formation of phenanthroline-europium interface on the surface of the nanowires due to attachment of Eu3+ ions. After an optimized surface modification with phen, intensity of both the UV emission (band edge and red emission improved by two orders of magnitude at room temperature. We observed multiple energy transfer pathways to the energy levels of Eu3+ ions through the phenanthroline-europium interface, which found to be very effective to the significant enhancement of emission from the dopant Eu3+. This study shows a new insight in to the energy transfer process from phen to the europium doped ZnO system.

  12. Dual doped graphene oxide for electrochemical sensing of europium ion

    Science.gov (United States)

    Kumar, Sunil; Patra, Santanu; Madhuri, Rashmi; Sharma, Prashant K.

    2017-05-01

    This present work represents a single step hydrothermal method for the preparation of N, and N, S dual doped graphene oxide (GO). First time, a comparative electrochemical study between single dope and dual doped GO was carried out using potassium ferrocyanide as an electro-active probe molecule and found that the dual doped GO has the highest electrocatalytic activity than single doped, due to the presence of two heteroatoms as a doping material. Afterwards, the dual doped GO was successfully applied for the electrochemical detection of a rare earth element i.e. europium, with LOD value of 5.92 μg L-1.

  13. Crystal growth of nanoscaled europium selenide having characteristic crystal shapes

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Atsushi; Adachi, Taka-aki [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan); Hasegawa, Yasuchika, E-mail: hasegawa@ms.naist.j [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan); Kawai, Tsuyoshi [Graduate School of Materials Science, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192 (Japan)

    2009-12-04

    Tetrapod-shaped EuSe nanocrystals were prepared through the thermal reduction of europium chloride an organic selenide complex, n-hexadecylamine, and two additives oleic acid and oleylamine. The obtained EuSe nanoparticles were characterized by X-ray diffraction (XRD). The crystal grain size from the XRD spectrum was estimated to be 50 nm. In contrast, observation of the transmission electron microscope (TEM) gave larger sized EuSe (average size: 200 nm). Anisotropic crystal-growth of EuSe nanocrystals was achieved by addition of a small amount of oleic acid in the crystal growth process.

  14. Photoprotective properties of the fluorescent europium complex in UV-irradiated skin.

    Science.gov (United States)

    Vogt, O; Lademann, J; Rancan, F; Meinke, M C; Schanzer, S; Stockfleth, E; Sterry, W; Lange-Asschenfeldt, B

    2013-01-01

    In this study, we compared the UV-protective abilities of the europium complex compared to titanium dioxide, which represents the most common physical filter for ultraviolet light in the broad-band spectral range. The UV absorption and light transformative capacities of the europium complex were evaluated using a spectrometer with a double-integrating sphere showing that the europium complex does not only absorb and reflect UV light, but transforms it into red and infrared light. It was found that the europium complex binds to the surface of Jurkat cells in vitro. Cells incubated with the europium complex showed a significantly higher viability after UVA and UVB irradiation as compared to untreated cells and cells incubated with titanium dioxide pointing out its photoprotective properties. The europium complex and titanium dioxide show similar penetration capacities into the stratum corneum as tested in human and porcine skin using tape stripping analysis. The europium complex has proved to be an efficient UV filter with a low cyto- and phototoxic profile and therefore represents a potential candidate for use in sunscreen formulations. Copyright © 2013 S. Karger AG, Basel.

  15. 40 CFR 161.45 - Waivers.

    Science.gov (United States)

    2010-07-01

    ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES General Provisions § 161.45 Waivers. (a) Rationale and... not be useful in the Agency's evaluation of the risks or benefits of the product. The Agency will...

  16. 40 CFR 161.20 - Overview.

    Science.gov (United States)

    2010-07-01

    ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES General Provisions § 161.20 Overview. (a) Legal authority... information the Agency requires in order to make regulatory judgments about the risks and benefits of various...

  17. 25 CFR 16.1 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... individual who is either an enrolled member of the Cherokee, Chickasaw, Choctaw, Creek, or Seminole Tribes of... AFFAIRS, DEPARTMENT OF THE INTERIOR PROBATE ESTATES OF INDIANS OF THE FIVE CIVILIZED TRIBES § 16.1... affecting properties in which a restricted interest is owned by an Indian of the Five Civilized Tribes. (c...

  18. 33 CFR 161.21 - Automated reporting.

    Science.gov (United States)

    2010-07-01

    ...) PORTS AND WATERWAYS SAFETY VESSEL TRAFFIC MANAGEMENT Vessel Movement Reporting System § 161.21 Automated... required to make continuous, all stations, AIS broadcasts, in lieu of voice Position Reports, to those..., until restored a vessel must: (1) Notify the Center; (2) Make voice radio Position Reports at designated...

  19. 40 CFR 161.155 - Product composition.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Product composition. 161.155 Section... composition. Information on the composition of the pesticide product must be furnished. The information... or chemical composition of an ingredient is not known to the applicant because it is proprietary or...

  20. Low-voltage cathodoluminescence of europium-activated yttrium orthovanadate

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, M.L.F.

    1995-03-01

    Emissive flat panel display systems operating in full color demand higher performance at low voltages (ca. 501000 V) from cathodoluminescent (CL) phosphors than cathode ray tubes require. Hydrothermal synthesis has been suggested as a route to phosphors with improved efficiencies, lower voltage thresholds, and increased saturation power. This hypothesis was tested in europium-doped yttrium orthovanadate (YVO{sub 4}:Eu), an efficient, red emitting CL phosphor. The CL efficiency of YVO{sub 4}:Eu crystallized from aqueous solution at 200{degrees}C is relatively low until it is annealed. The distribution of particle sizes in the low-temperature phosphor is similar to that in material made via a solid-state route, but crystallites remain much smaller (ca. 400 {Angstrom}) until they are annealed. These observations, along with the anomalously strong dependence of CL intensity on europium concentration, support a model in which efficiency principally depends on crystallite size. CL efficiency of both solid state and hydrothermal YVO{sub 4}:Eu increases with voltage at constant power. Surface-bound electrons are likely the dominant influence on efficiency at voltages near threshold. Saturation power is independent of synthetic route. It is apparent that the CL properties of hydrothermally synthesized YVO{sub 4}:Eu are essentially the same as those of YVO{sub 4}:Eu produced via conventional, high-temperature routes.

  1. In Vivo Toxicity Studies of Europium Hydroxide Nanorods in Mice

    Science.gov (United States)

    Patra, Chitta Ranjan; Abdel Moneim, Soha S.; Wang, Enfeng; Dutta, Shamit; Patra, Sujata; Eshed, Michal; Mukherjee, Priyabrata; Gedanken, Aharon; Shah, Vijay H; Mukhopadhyay, Debabrata

    2009-01-01

    Lanthanide nanoparticles and nanorods have been widely used for diagnostic and therapeutic applications in biomedical nanotechnology due to their fluorescence properties and pro-angiogenic to endothelial cells, respectively. Recently, we have demonstrated that europium (III) hydroxide [EuIII(OH)3] nanorods, synthesized by the microwave technique and characterized by several physico-chemical techniques, can be used as pro-angiogenic agents which introduce future therapeutic treatment strategies for severe ischemic heart/limb disease, and peripheral ischemic disease. The toxicity of these inorganic nanorods to endothelial cells was supported by several in vitro assays. To determine the in vivo toxicity, these nanorods were administered to mice through intraperitoneal injection (IP) everyday over a period of seven days in a dose dependent (1.25 to 125 mgKg−1day−1) and time dependent manner (8–60 days). Bio-distribution of europium elements in different organs was analyzed by inductively coupled plasma mass spectrometry (ICPMS). Short-term (S-T) and long-term (L-T) toxicity studies (mice sacrificed on day 8 and 60 for S-T and L-T, respectively) show normal blood hematology and serum clinical chemistry with the exception of a slight elevation of liver enzymes. Histological examination of nanorod treated vital organs (liver, kidney, spleen and lungs) showed no or only mild histological changes that indicate mild toxicity at the higher dose of nanorods. PMID:19616569

  2. Temperature dependences in electron-stimulated desorption of neutral europium

    CERN Document Server

    Ageev, V N; Madey, T E

    2003-01-01

    The electron-stimulated desorption (ESD) yield for neutral europium (Eu) atoms from Eu layers adsorbed on oxygen-covered tungsten surfaces has been measured as a function of electron energy, europium coverage and degree of oxidation of tungsten, with an emphasis on effects of substrate temperature. The measurements have been carried out using a time-of-flight method and surface ionization detector. We expand on an earlier report, and compare ESD of multivalent Eu with ESD of monovalent alkali atoms, studied previously. The Eu atom ESD is a complicated function of Eu coverage, electron energy and substrate temperature. In the coverage range 0.05-0.35 monolayer (ML), overlapping resonant-like Eu atom yield peaks are observed at electron energies E sub e of 36 and 41 eV that might be associated with Eu or W shallow core level excitations. Additional resonant-like peaks are seen at E sub e of 54 and 84 eV that are associated with W 5p and 5s level excitations. The Eu atom yield peaks at 36 and 41 eV are seen only...

  3. The Oxidation State of Europium in Halide Glasses

    Science.gov (United States)

    Weber, J.K.R.; Vu, M.; Paßlick, C.; Schweizer, S.; Brown, D.E.; Johnson, C.E.; Johnson, J.A.

    2012-01-01

    The luminescent properties of divalent europium ions can be exploited to produce storage phosphors for x-ray imaging applications. The relatively high cost and limited availability of divalent europium halides makes it desirable to synthesize them from the readily available trivalent salts. In this work, samples of pure EuCl3 and fluoride glass melts doped with EuCl3 were processed at 700-800 °C in an inert atmosphere furnace. The Eu oxidation state in the resulting materials was determined using fluorescence and Mössbauer spectroscopy. Heat treatment of pure EuCl3 for 10 minutes at 710 °C resulted in a material comprising approximately equal amounts of Eu2+ and Eu3+. Glasses made using mixtures of EuCl2 and EuCl3 in the starting material contained both oxidation states. This paper describes the sample preparation and analysis and discusses the results in the context of chemical equilibria in the melts. PMID:22101252

  4. Innovative triboluminescence study of multivitamin doped europium tetrakis

    Energy Technology Data Exchange (ETDEWEB)

    Fontenot, R.S. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, Alabama 35762 (United States); University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States); Bhat, K.N.; Aggarwal, M.D. [Alabama A and M University, Department of Physics, Chemistry, and Mathematics, P.O. Box 1268, Normal, Alabama 35762 (United States); Hollerman, W.A. [University of Louisiana at Lafayette, Department of Physics, P.O. Box 44210, Lafayette, LA 70504 (United States)

    2012-05-15

    As the Space Shuttle program ends, NASA is developing the next generation of space vehicles. These new concept designs will require new and innovative structural health monitoring capabilities. One way to solve this problem is with smart impact sensors that use triboluminescent materials. In 2011, the authors reported an 82% increase in the triboluminescence yield of europium dibenzoylmethide triethylammonium (EuD{sub 4}TEA) by changing the starting material. It has been shown that introduction of dopants tends to enhance the triboluminescent light yield. Here we report the successful synthesis of a multivitamin doped europium tetrakis which appears to be spherical in shape. Inductively Coupled Plasma - Optical Emission Spectroscopy analysis showed the presence of 3.6% calcium, 0.62% magnesium, 0.1% iron, 0.01% copper and manganese. This new product has no shift in the triboluminescent or photoluminescent emission peaks, but only a change in the intensity. In addition, the doped EuD{sub 4}TEA powder statistically emits more triboluminescence while having the same decay time. (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  5. Photoactive thin films of polycaprolactam doped with europium (III) complex using phenylalanine as ligand

    Energy Technology Data Exchange (ETDEWEB)

    Santos Garcia, Irene Teresinha, E-mail: irene@iq.ufrgs.br [Departamento de Fisico-Quimica, Instituto de Quimica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Bairro Agronomia, CEP 91501-970, Porto Alegre, RS (Brazil); Velleda Ribeiro, Patricia; Silva Correa, Diogo; Neto da Cunha, Igor Michel; Lenin Villarreal Carreno, Neftali [Instituto de Quimica e Geociencias, Universidade Federal de Pelotas, Campus Capao do Leao, s/n. CEP 96010-900, Pelotas, RS (Brazil); Ceretta Moreira, Eduardo [PPGEE, Universidade Federal do Pampa, Campus Bage, Bage- RS (Brazil); Severo Rodembusch, Fabiano [Departamento de Quimica Organica, Instituto de Quimica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Bairro Agronomia, CEP 91501-970, Porto Alegre, RS (Brazil)

    2011-12-01

    A photoactive complex based on europium(III) using the amino acid phenylalanine as ligand was prepared and characterized. The obtained europium(III)/phenylalanine complex presents an effective energy transfer from ligands to the rare earth center. The observed photoluminescent behavior for europium(III)/phenylalanine complex was similar to the well known europium(III)/ acetyl-{beta}-acetonate hydrate. New photoactive polyamide thin films were prepared using polycaprolactam as host of these complexes. The structural characterizations of the films were studied through Rutherford backscattering (RBS), Fourier transform infrared (FTIR) and Raman spectroscopies. The polyamide films doped with the amino acid and acetyl-{beta}-acetonate rare earth complexes maintain the original photoluminescent behavior, narrow emission bands corresponding to transitions {sup 5}D{sub 0} {yields} {sup 7}F{sub 0-4}, which indicates that this polymer is an excellent host to these complexes.

  6. Synthesis and luminescence properties of salicylaldehyde isonicotinoyl hydrazone derivatives and their europium complexes.

    Science.gov (United States)

    Shan, Wenfei; Liu, Fen; Liu, Jiang; Chen, Yanwen; Yang, Zehui; Guo, Dongcai

    2015-09-01

    Four novel salicylaldehyde isonicotinoyl hydrazone derivatives and their corresponding europium ion complexes were synthesized and characterized, while the luminescence properties and the fluorescence quantum yields of the target complexes were investigated. The results indicated that the ligands favored energy transfers to the emitting energy level of europium ion, and four target europium complexes showed the characteristic luminescence of central europium ion. Besides the luminescence intensity of the complex with methoxy group, which possessed the highest fluorescence quantum yield (0.522), was stronger than that of other complexes. Furthermore, the electrochemical properties of the target complexes were further investigated by cyclic voltammetry, the results indicated that the highest occupied molecular orbital (HOMO), lowest unoccupied molecular orbital (LUMO) energy levels and the oxidation potential of the complexes with electron donating group increased, however, that of the complexes with accepting electron group decreased. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. [Synthesis and luminescence properties of ternary complexes of europium with aromatic carboxylic acid and acrylonitrile].

    Science.gov (United States)

    Guo, Dong-cai; Yi, Li-ming; Shu, Wan-gen; Zhang, Zhen-zhen; Zeng, Zhao-rong; Zhang, Xi-qian

    2006-11-01

    Five ternary complexes were synthesized from europium with aromatic carboxylic acid (p-methylbenzoic acid, methoxybenzoic acid, m-chlorobenzoic acid and benzoic acid, p-hydroxylbenzoic acid) and acrylonitrile, and characterized by means of elemental analysis, thermal analysis, FTIR spectra and UV spectra. The fluorescence spectra show that five ternary complexes have good luminescence properties, and the sequence of the ability of the aromatic carboxylic acids to transfer light energy to europium ion is as follows: p-methylbenzoic acid>benzoic acid>m-chlorobenzoic acid>p-hydroxylbenzoic acid>methoxybenzoic acid. Meanwhile, the ternary europium complexes containing a reactive ligand acrylonitrile will possibly have a potential application to the fabrication of bonding-type europium polymer luminescent materials.

  8. Optical characterization of europium-doped indium hydroxide nanocubes obtained by Microwave-Assisted Hydrothermal method

    OpenAIRE

    Motta, Fabiana Villela da; Marques,Ana Paula de Azevedo; Araújo,Vinícius Dantas de; Tavares, Mara Tatiane De Souza; Delmonte,Mauricio Roberto Bomio; Paskocimas, Carlos Alberto; Li, Máximo Siu; Nascimento, Rubens Maribondo do; Longo, Elson [UNESP

    2014-01-01

    Crystalline europium-doped indium hydroxide (In(OH)3:Eu) nanostructures were prepared by rapid and efficient Microwave-Assisted Hydrothermal (MAH) method. Nanostructures were obtained at low temperature. FE-SEM images confirm that these samples are composed of 3D nanostructures. XRD, optical diffuse reflectance and photoluminescence (PL) measurements were used to characterize the products. Emission spectra of europium-doped indium hydroxide (IH:xEu) samples under excitation (350.7 nm) present...

  9. Structural and optical properties of europium doped zirconia single crystals fibers grown by laser floating zone

    OpenAIRE

    Soares, M.R.N.; Nico, C.; Peres, M.; Ferreira, N.; Fernandes, A.J.S.; Monteiro, T.; COSTA, F.M.

    2011-01-01

    Yttria stabilized zirconia single crystal fibers doped with europium ions were developed envisaging optical applications. The laser floating zone technique was used in order to grow millimetric high quality single crystal fibers. The as-grown fibers are completely transparent and inclusion free, exhibiting a cubic structure. Under ultraviolet (UV) excitation, a broad emission band appears at 551 nm. The europium doped fibers are translucent with a tetragonal structure and exhibit an intense r...

  10. 40 CFR 161.590 - Nontarget insect data requirements.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Nontarget insect data requirements... § 161.590 Nontarget insect data requirements. (a) Table. Sections 161.100 through 161.102 describe how to use this table to determine the nontarget insect data requirements and the substance to be tested...

  11. 25 CFR 161.702 - Who will enforce this subpart?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Who will enforce this subpart? 161.702 Section 161.702... GRAZING PERMITS Trespass § 161.702 Who will enforce this subpart? (a) BIA enforces the provisions of this subpart. If the Navajo Nation adopts the provisions of this subpart, the Navajo Nation will have...

  12. 27 CFR 44.161 - Discontinuance of operations.

    Science.gov (United States)

    2010-04-01

    ... Operations § 44.161 Discontinuance of operations. Every export warehouse proprietor who desires to discontinue operations and close out his warehouse shall dispose of all cigars, cigarettes, and cigarette... operations. 44.161 Section 44.161 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE...

  13. 40 CFR 161.340 - Toxicology data requirements.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Toxicology data requirements. 161.340 Section 161.340 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES Data Requirement Tables § 161.340...

  14. 46 CFR 161.013-11 - Prototype test.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 6 2010-10-01 2010-10-01 false Prototype test. 161.013-11 Section 161.013-11 Shipping...: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Electric Distress Light for Boats § 161.013-11 Prototype test. (a) Each manufacturer must test a prototype light identical to the lights to be certified prior to...

  15. 25 CFR 161.203 - Are range management plans required?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Are range management plans required? 161.203 Section 161... LANDS GRAZING PERMITS General Provisions § 161.203 Are range management plans required? Yes. BIA will... range restoration activities for the Navajo Partitioned Lands. (b) Develop range management plans with...

  16. 49 CFR 38.161 - Moveable aisle armrests.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Moveable aisle armrests. 38.161 Section 38.161 Transportation Office of the Secretary of Transportation AMERICANS WITH DISABILITIES ACT (ADA) ACCESSIBILITY SPECIFICATIONS FOR TRANSPORTATION VEHICLES Over-the-Road Buses and Systems § 38.161 Moveable aisle armrests. A...

  17. A non-aqueous reduction process for purifying ¹⁵³Gd produced in natural europium targets.

    Science.gov (United States)

    Johnsen, Amanda M; Soderquist, Chuck Z; McNamara, Bruce K; Fisher, Darrell R

    2013-12-01

    Gadolinium-153 is a low-energy gamma-emitter used in nuclear medicine imaging quality assurance. Produced in nuclear reactors using natural Eu₂O₃ targets, ¹⁵³Gd is radiochemically separated from europium isotopes by europium reduction. However, conventional aqueous europium reduction produces hydrogen gas, a flammability hazard in radiological hot cells. We altered the traditional reduction method, using methanol as the process solvent to nearly eliminate hydrogen gas production. This new, non-aqueous reduction process demonstrates greater than 98% europium removal and gadolinium yields of 90%. © 2013 Elsevier Ltd. All rights reserved.

  18. Intercalated europium metal in epitaxial graphene on SiC

    Science.gov (United States)

    Anderson, Nathaniel A.; Hupalo, Myron; Keavney, David; Tringides, Michael C.; Vaknin, David

    2017-10-01

    X-ray magnetic circular dichroism (XMCD) reveals the magnetic properties of intercalated europium metal under graphene on SiC(0001). The intercalation of Eu nanoclusters (average size 2.5 nm) between graphene and SiC substate are formed by deposition of Eu on epitaxially grown graphene that is subsequently annealed at various temperatures while keeping the integrity of the graphene layer. Using sum-rules analysis of the XMCD of Eu M4 ,5 edges at T =15 K, our samples show paramagnetic-like behavior with distinct anomaly at T ≈90 K, which may be related to the Nèel transition, TN=91 K, of bulk metal Eu. We find no evidence of ferromagnetism due to EuO or antiferromagnetism due to Eu2O3 , indicating that the graphene layer protects the intercalated metallic Eu against oxidation over months of exposure to atmospheric environment.

  19. 40 CFR 721.9511 - Silicic acid (H6SiO2O7), magnesium, strontium salt(1:1:2), dysprosium and europium-doped.

    Science.gov (United States)

    2010-07-01

    ..., strontium salt(1:1:2), dysprosium and europium-doped. 721.9511 Section 721.9511 Protection of Environment...), magnesium, strontium salt(1:1:2), dysprosium and europium-doped. (a) Chemical substance and significant new..., strontium salt(1:1:2), dysprosium and europium-doped. (PMN P-98-848; CAS No.181828-07-9) is subject to...

  20. Fluorescent lifetime imaging microscopy using Europium complexes improves atherosclerotic plaques discrimination.

    Science.gov (United States)

    Sicchieri, Letícia Bonfante; de Andrade Natal, Rodrigo; Courrol, Lilia Coronato

    2016-10-01

    The objective of this study is to characterize arterial tissue with and without atherosclerosis by fluorescence lifetime imaging microscopy (FLIM) using Europium Chlortetracycline complex (EuCTc) as fluorescent marker. For this study, twelve rabbits were randomly divided into a control group (CG) and an experimental group (EG), where they were fed a normal and hypercholesterolemic diet, respectively, and were treated for 60 days. Cryosections of the aortic arch specimens were cut in a vertical plane, mounted on glass slides, and stained with Europium (Eu), Chlortetracycline (CTc), Europium Chlortetracycline (EuCTc), and Europium Chlortetracycline Magnesium (EuCTcMg) solutions. FLIM images were obtained with excitation at 405 nm. The average autofluorescence lifetime within plaque depositions was ~1.36 ns. Reduced plaque autofluorescence lifetimes of 0.23 and 0.31 ns were observed on incubation with EuCTc and EuCTcMg respectively. It was observed a quenching of collagen, cholesterol and TG emission spectra increasing EuCTc concentration. The drastic reduction in fluorescence lifetimes is due to a resonant energy transfer between collagen, triglycerides, cholesterol and europium complexes, quenching fluorescence.

  1. Visible-light sensitized luminescent europium(III)-β-diketonate complexes: bioprobes for cellular imaging.

    Science.gov (United States)

    Reddy, M L P; Divya, V; Pavithran, Rani

    2013-11-21

    Visible-light sensitized luminescent europium(III) molecular materials are of considerable importance because their outstanding photophysical properties make them well suited as labels in fluorescence-based bioassays and low-voltage driven pure red-emitters in optoelectronic technology. One challenge in this field is development of visible-light sensitizing ligands that can form highly emissive europium(III) complexes with sufficient stability and aqueous solubility for practical applications. Indeed, some of the recent reports have demonstrated that the excitation-window can be shifted to longer-wavelengths in europium(III)-β-diketonate complexes by appropriate molecular engineering and suitably expanded π-conjugation in the complex molecules. In this review, attention is focused on the latest innovations in the syntheses and photophysical properties of visible-light sensitized europium(III)-β-diketonate complexes and their application as bioprobes for cellular imaging. Furthermore, luminescent nanomaterials derived from long-wavelength sensitized europium(III)-β-diketonate complexes and their application in life sciences are also highlighted.

  2. The electronic properties of mixed valence hydrated europium chloride thin film.

    Science.gov (United States)

    Silly, M G; Charra, F; Lux, F; Lemercier, G; Sirotti, F

    2015-07-28

    We investigate the electronic properties of a model mixed-valence hydrated chloride europium salt by means of high resolution photoemission spectroscopy (HRPES) and resonant photoemission spectroscopy (RESPES) at the Eu 3d → 4f and 4d → 4f transitions. From the HRPES spectra, we have determined that the two europium oxidation states are homogeneously distributed in the bulk and that the hydrated salt film is exempt from surface mixed valence transition. From the RESPES spectra, the well separated resonant contributions characteristic of divalent and trivalent europium species (4f(6) and 4f(7) final states, respectively) are accurately extracted and quantitatively determined from the resonant features measured at the two edges. The partial absorption yield spectra, obtained by integrating the photoemission intensity in the valence-band region, can be well reproduced by atomic multiplet calculation at the M(4,5) (3d-4f) absorption edge and by an asymmetric Fano-like shape profile at the N(4,5) (4d-4f) absorption edge. The ratio of Eu(2+) and Eu(3+) species measured at the two absorption edges matches with the composition of the mixed valence europium salt as determined chemically. We have demonstrated that the observed spectroscopic features of the mixed valence salt are attributed to the mixed-valence ground state rather than surface valence transition. HRPES and RESPES spectra provide reference spectra for the study of europium salts and their derivatives.

  3. Europium-doped calcium titanate: Optical and structural evaluations

    Energy Technology Data Exchange (ETDEWEB)

    Mazzo, Tatiana Martelli; Pinatti, Ivo Mateus [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Macario, Leilane Roberta [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil); Avansi, Waldir [Centro de Ciências Exatas e de Tecnologia, Departamento de Física, Universidade Federal de São Carlos, Jardim Guanabara, 13565-905 São Carlos, SP (Brazil); Moreira, Mario Lucio [Instituto de Física e Matemática, Universidade Federal de Pelotas, P.O. Box 354, Campus do Capão do Leão, 96001-970 Pelotas, RS (Brazil); Rosa, Ieda Lucia Viana, E-mail: ilvrosa@ufscar.br [INCTMN, LIEC, Departamento de Química, Universidade Federal de São Carlos, P.O. Box 676, 13565-905 São Carlos, SP (Brazil); Mastelaro, Valmor Roberto [Instituto de Física de São Carlos, Departamento de Física e Ciência dos Materiais, Universidade de São Paulo, P.O. Box 369, Av Trabalhador São Carlense 400, 13560-970 São Carlos, SP (Brazil); Varela, José Arana; Longo, Elson [INCTMN, LIEC, Instituto de Química, Universidade Estadual Paulista, P.O. Box 355, 14800-900 Araraquara, SP (Brazil)

    2014-02-05

    Highlights: • CaTiO{sub 3}:Eu{sup 3+} were obtained using low temperatures and very short reactional times. • The Eu{sup 3+} changes the local order–disorder of the [TiO{sub 6}] and [CaO{sub 12}] clusters. • Lifetime decay curves reveal two sites of symmetry of the Eu{sup 3+} in the CT matrix. • CaTiO{sub 3}:Eu{sup 3+} exhibit the strongest luminescent intensity and pure red color. -- Abstract: Pure Calcium Titanate (CT-pure) and Europium doped Calcium Titanate Ca{sub 1−x}Eu{sub x}TiO{sub 3} (x = 0.5%, 1.0% and 2.0% molar ratio of Eu{sup 3+} ions) powders were synthesized by hydrothermal microwave method (HTMW) at 140 °C for 8 min. The HTMW method appears to be an efficient method to prepare the luminescence materials using low temperatures and very short reactional times. In addition it is possible to determine specific correlations imposed by TiCl{sub 4} replacement by titanium isopropoxide [Ti(OC{sub 3}H{sub 7}){sub 4}] changing the reaction character and resulting in two different options of europium doping CT syntesis. To evaluate the influence of the structural order–disorder among the reactions and different properties of these materials, the following techniques were used for characterization. XANES spectroscopy that revealed that the introduction of Eu{sup 3+} ions into the CT lattice induces to significant changes in the local order–disorder around both, [TiO{sub 6}] and [CaO{sub 12}], complex clusters. PL spectra show Eu{sup 3+} emission lines ascribed to the Eu{sup 3+} transitions from {sup 5}D{sub 0} excited states to {sup 7}F{sub J} (J = 0, 1–4) fundamental states in CT:Eu{sup 3+} powders excited at 350 and 394 nm.

  4. Dicty_cDB: VSK161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VS (Link to library) VSK161 (Link to dictyBase) - - - Contig-U15185-1 VSK161P (Link to Original site)...VSK161Z 343 VSK161P 692 - - Show VSK161 Library VS (Link to library) Clone ID VSK161 (Link to dictyBase)...AL116011 |AL116011.1 Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 84 2e-14...AL116009 |AL116009.1 Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 84 2e-14...AL115603 |AL115603.1 Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 84 2e-14

  5. 26 CFR 31.3401(a)(16)-1 - Tips.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 15 2010-04-01 2010-04-01 false Tips. 31.3401(a)(16)-1 Section 31.3401(a)(16)-1... Income Tax at Source § 31.3401(a)(16)-1 Tips. Tips paid to an employee are excepted from wages and hence not subject to withholding if— (a) The tips are paid in any medium other than cash, or (b) The cash...

  6. RBS and RNRA studies on sorption of europium by apatite

    Energy Technology Data Exchange (ETDEWEB)

    Ohnuki, Toshihiko; Kozai, Naofumi; Isobe, Hiroshi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Murakami, Takashi; Yamamoto, Shunya; Aoki, Yasushi; Naramoto, Hiroshi

    1997-03-01

    The sorption mechanism of europium, alternative of trivalent TRU has been studied based on the depth profiles of elements obtained by Rutherford Backscattering Spectroscopy (RBS) and Resonant Nuclear Reaction Analysis (RNRA). The positive peak for Eu and the negative peak for Ca were observed in the subtracted RBS spectra of the apatites on which Eu was sorbed from that of the fresh apatite. This indicates that Eu was sorbed on apatite, while a fraction of Ca was released from apatite. The peak height for Eu in the RBS spectrum of the apatite obtained at 75degC was higher than that of the apatite at 40degC. The depth profile of hydrogen of the apatite on which Eu was sorbed was similar to that of the fresh apatite. The concentration of Eu in the solution decreased with increasing temperature. On the contrary, the concentration of Ca increased with increasing temperature. Thus, it is concluded that a fraction of Eu is exchanged for Ca in the structure of apatite. (author)

  7. Spectrofluorimetric determination of heparin using doxycycline-europium probe

    Energy Technology Data Exchange (ETDEWEB)

    Li Jing [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Liu Jinkai [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Zhu Xiaojing [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Peng Qian [Department of Chemistry, Shandong Normal University, Jinan 250014 (China); Jiang Chongqiu [Department of Chemistry, Shandong Normal University, Jinan 250014 (China)]. E-mail: jiangchongqiu@sdnu.edu.cn

    2005-06-15

    A new spectrofluorimetric method was developed for the determination of the trace amount of heparin (Hep). Using doxycycline (DC)-europium ion (Eu{sup 3+}) as a fluorescent probe, in the buffer solution of pH=8.9, Hep can remarkably enhance the fluorescence intensity of the DC-Eu{sup 3+} complex at {lambda}=612 nm and the enhanced fluorescence intensity of Eu{sup 3+} ion is in proportion to the concentration of Hep. Optimum conditions for the determination of Hep were also investigated. The linear range and detection limit for the determination of Hep are 0.04-0.8 {mu}g/mL and 19.7 ng/mL, respectively. This method is simple, practical, and relatively free of interference from coexisting substances and can be successfully applied to assess Hep in biological samples. By the Rosenthal graphic method, the association constant and binding numbers of Hep with the probe are 6.60x10{sup 4} L/mol and 33.9. Moreover, the enhancement mechanism of the fluorescence intensity in the DC-Eu{sup 3+} system and the DC-Eu{sup 3+}-Hep-CTMAB system have been also discussed.

  8. Extraction of americium and europium by CMPO-substituted adamantylcalixarenes

    Energy Technology Data Exchange (ETDEWEB)

    Babain, V.A.; Alyapyshev, M.Yu.; Karavan, M.D. [V.G. Khlopin Radium Inst., St. Petersburg (Russian Federation); Boehmer, V.; Wang, L. [Johannes Guttenberg Univ., Mainz (Germany); Shokova, E.A.; Motornaya, A.E.; Vatsouro, I.M.; Kovalev, V.V. [M. V. Lomonosov Moscow State Univ., Moscow (Russian Federation)

    2005-07-01

    Eight p-adamantylcalix[4]arene derivatives, bearing four CMPO-like functions [-(CH{sub 2}){sub n}-NH-C(O)-CH{sub 2-}P(O)Ph{sub 2}] at the wide (4a,b, n = 0, 1) or narrow (5a-c and 6a-c, n = 2-4) rims were synthesized for the first time. Studies of the extraction of americium(III) and europium(III) from 3 M HNO{sub 3} solutions to organic phases (dichloromethane, m-nitro-trifluoromethylbenzene) showed: (i) The extraction ability for all the adamantylcalixarene ligands is much better than for their monomeric analogues -N-(1-adamantyl)-, N-(1-adamantylmethyl)- and N,N-(dibutyl)carbamoylmethyldiphenylphosphine oxides 7a, 7b, 8; (ii) The extraction percentage increases strongly with increasing length of the spacer for all types of ligands 4-6, and best extraction results were found for 4b (n = 1) and 5c (n = 4); (iii) The separation coefficient D{sub Am}/D{sub Eu} for the investigated compounds did not exceed 2, which is close to the narrow rim CMPO calixarenes, studied earlier; (iv) Variation of the spacer length between CMPO groups attached to the 1,3- and 2,4-positions of the calixarene platform in 6 did not lead to appreciably improved extractants, neither with respect to the extraction abilities (D) nor to the selectivities (D{sub Am}/D{sub Eu}). (orig.)

  9. Preparation of europium-labelled DNA probes and their properties.

    Science.gov (United States)

    Hurskainen, P; Dahlén, P; Ylikoski, J; Kwiatkowski, M; Siitari, H; Lövgren, T

    1991-01-01

    A chemical method for labelling DNA with a europium chelate is presented. First, primary aliphatic amino groups are introduced onto DNA in a transamination reaction. The transamination reaction is altered by adjusting temperature and duration of the reaction. Subsequently, the modified DNA is reacted with an isothiocyanate derivative of a Eu chelate. The optimum amount of Eu chelates on a DNA probe is 4-8% of total nucleotides. There is a decrease of 0.7 degrees C in the melting temperature of DNA for each incorporated Eu chelate on 100 bases. Hybridization efficiency is lowered by the introduction of Eu chelates but this effect can be partly overcome by using high DNA probe concentrations. The detection limit of the Eu-labelled probe is 0.15 attomoles of target DNA in a mixed-phase hybridization assay on microtitration wells. In addition to high sensitivity the Eu-labelled probes offer convenience in use and results which are quantitative and easy to interpret. PMID:1826948

  10. Chloride, bromide and iodide scintillators with europium doping

    Science.gov (United States)

    Zhuravleva, Mariya; Yang, Kan

    2014-08-26

    A halide scintillator material is disclosed where the halide may comprise chloride, bromide or iodide. The material is single-crystalline and has a composition of the general formula ABX.sub.3 where A is an alkali, B is an alkali earth and X is a halide which general composition was investigated. In particular, crystals of the formula ACa.sub.1-yEu.sub.yI.sub.3 where A=K, Rb and Cs were formed as well as crystals of the formula CsA.sub.1-yEu.sub.yX.sub.3 (where A=Ca, Sr, Ba, or a combination thereof and X=Cl, Br or I or a combination thereof) with divalent Europium doping where 0.ltoreq.y.ltoreq.1, and more particularly Eu doping has been studied at one to ten mol %. The disclosed scintillator materials are suitable for making scintillation detectors used in applications such as medical imaging and homeland security.

  11. Spectrofluorimetric determination of lecithin using a tetracycline-europium probe

    Energy Technology Data Exchange (ETDEWEB)

    Wang Ting [Department of Chemistry, Shandong Normal University, Jinan, Shandong 250014 (China); Jiang Chongqiu [Department of Chemistry, Shandong Normal University, Jinan, Shandong 250014 (China)]. E-mail: jiangchongqiu@sdnu.edu.cn

    2006-03-02

    Trace amount of lecithin (PC) was determined in the buffer solution of pH 5.7, using tetracycline (TC)-europium ion (Eu{sup 3+}) as a fluorescent probe. PC can remarkably enhance the fluorescence intensity of the TC-Eu{sup 3+} complex at {lambda} = 612 nm and the enhanced fluorescence intensity of Eu{sup 3+} is in proportion to the concentration of PC. Optimum conditions for the determination of PC were also investigated. The linear range and detection limit for the determination of PC are 4.0 x 10{sup -7} to 1.4 x 10{sup -5} mol/L and 3.9 x 10{sup -8} mol/L. This method is simple, practical and relatively free of interference from coexisting substances and can be successfully applied to assess PC in serum samples. Moreover, the enhancement mechanism of the fluorescence intensity in the TC-Eu{sup 3+} system, the TC-Eu{sup 3+}-PC system, and the TC-Eu{sup 3+}-PC-sodium dodecyl benzene sulfonate (SDS) system is also discussed.

  12. Artifacts in the determination of the binding of americium and europium to an aquatic fulvic acid

    Energy Technology Data Exchange (ETDEWEB)

    Lead, J.R.; Hamilton-Taylor, J.; Kelly, M. [Institute of Environmental and Biological Sciences, Lancaster University, Lancaster (United Kingdom)

    1995-11-23

    The binding of europium and americium by an aquatic fulvic acid was investigated using an equilibrium ion exchange technique (Schubert`s method). The results for europium were consistent with literature data. Americium gave anomalous results for both the D{sub o} values (partition coefficient of the metal between the resin and solution phases in the absence of the fulvic acid) and D values (partition coefficient of the metal between the resin and solution phases in the presence of the fulvic acid). The values for americium were unexpectedly low and, in the case of D values, only slightly pH dependent. The cause of the discrepancy was found to be the partial dissolution of the resin or the loss of small colloidal material from the resin. The effects on the europium results were minimal due to the use of lower resin weights and higher metal concentrations

  13. Synthesis and luminescence properties of 2-(benzylcarbamoyl)phenyl derivatives and their europium complexes.

    Science.gov (United States)

    Guo, Dongcai; He, Wei; Liu, Bang; Gou, Lining; Li, Ruixia

    2013-01-01

    Six novel 2-(benzylcarbamoyl)phenyl derivatives were synthesized and characterized by (1) H-NMR, mass spectrometry, infrared spectra and elemental analysis. Their europium complexes were prepared and characterized by elemental analysis, EDTA titrimetric analysis, IR and UV spectra as well as molar conductivity measurements. The luminescence properties of these complexes were investigated and results show that 2-(benzylcarbamoyl)phenyl derivatives possess high selectivity and good coordination with the europium ion. Complex Eu-2-(benzylcarbamoyl)phenyl-2-phenylacetate showed green luminescence that was emitted by the ligand of 2-(benzylcarbamoyl)phenyl-2-phenylacetate, while other complexes showed the characteristic red luminescence of europium ion and also possessed high luminescence intensity. Copyright © 2012 John Wiley & Sons, Ltd.

  14. Induction of Circularly Polarized Luminescence from Europium by Amino Acid Based Ionic Liquids.

    Science.gov (United States)

    Zercher, Ben; Hopkins, Todd A

    2016-11-07

    Materials that emit circularly polarized light have application in several important industries. Because they show large optical activity and emit sharp visible light transitions, europium complexes are often exploited in applications that require circularly polarized luminescence (CPL). Chiral and coordinating ionic liquids based on prolinate, valinate, and aspartate anions are used to induce CPL from a simple achiral europium triflate salt. The sign of the induced CPL is dependent on the handedness (l vs d) of the amino acid anion. Comparison of the CPL spectra in ionic liquid with proline and valine vs aspartate shows that the number of carboxylate groups in the amino acid anion influences the europium coordination environment. DFT calculations predict a chiral eight-coordinate Eu(Pro)4- structure in the prolinate ionic liquid and a chiral seven- or eight-coordinate Eu(Asp)33- structure in the aspartate ionic liquid.

  15. Comparative analysis of conjugated alkynyl chromophore-triazacyclononane ligands for sensitized emission of europium and terbium.

    Science.gov (United States)

    Soulié, Marine; Latzko, Frédéric; Bourrier, Emmanuel; Placide, Virginie; Butler, Stephen J; Pal, Robert; Walton, James W; Baldeck, Patrice L; Le Guennic, Boris; Andraud, Chantal; Zwier, Jurriaan M; Lamarque, Laurent; Parker, David; Maury, Olivier

    2014-07-07

    A series of europium and terbium complexes based on a functionalized triazacyclononane carboxylate or phosphinate macrocyclic ligand is described. The influence of the anionic group, that is, carboxylate, methylphosphinate, or phenylphosphinate, on the photophysical properties was studied and rationalized on the basis of DFT calculated structures. The nature, number, and position of electron-donating or electron-withdrawing aryl substituents were varied systematically within the same phenylethynyl scaffold in order to optimize the brightness of the corresponding europium complexes and investigate their two-photon absorption properties. Finally, the europium complexes were examined in cell-imaging applications, and selected terbium complexes were studied as potential oxygen sensors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Magnetic and structural properties of yellow europium oxide compound and Eu(OH){sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dongwook, E-mail: dongwookleedl324@gmail.com [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Seo, Jiwon, E-mail: jiwonseo@yonsei.ac.kr [Department of Physics and IPAP, Yonsei University, Seoul 120-749 (Korea, Republic of); Valladares, Luis de los Santos [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom); Avalos Quispe, O. [Laboratorio de Cerámicos y Nanomateriales, Facultad de Ciencias Físicas, Universidad Nacional Mayor de San Marcos, Ap. Postal 14-0149, Lima, Perú (Peru); Barnes, Crispin H.W. [Cavendish Laboratory, University of Cambridge, J. J Thomson Av., Cambridge CB3 0HE (United Kingdom)

    2015-08-15

    A new material based on a yellow europium oxide compound was prepared from europium oxide in a high vacuum environment. The structural and magnetic properties of the material were investigated. Owing to the absence of a crystal structure, the material exhibited a disordered magnetic behavior. In a reaction with deionized (DI) water without applied heat, the compound assumed a white color as soon as the DI water reached the powder, and the structure became polycrystalline Eu(OH){sub 3}. The magnetic properties, such as the thermal hysteresis, disappeared after the reaction with DI water, and the magnetic susceptibility of the yellow oxide compound weakened. The magnetic properties of Eu(OH){sub 3} were also examined. Although Eu{sup 3+} is present in Eu(OH){sub 3}, a high magnetic moment due to the crystal field effect was observed. - Graphical abstract: (top left) Optical image of the yellow europium oxide compound. (top right) Optical image of the product of DI water and yellow europium oxide. (bottom) Magnetization curves as a function of temperature measured in various magnetic field. - Highlights: • We prepared a new material based on a yellow europium oxide compound from europium oxide. • We characterized the magnetic properties of the material which exhibits a disordered magnetic behavior such as thermal hysteresis. • The compound turned white (Eu(OH){sub 3}) as soon as the DI water reached the powder. • The thermal hysteresis disappeared after the reaction with DI water and the magnetic susceptibility of the yellow oxide compound weakened.

  17. Europium stearate additives delay oxidation of UHMWPE for orthopaedic applications: a pilot study.

    Science.gov (United States)

    Gallardo, Luis A; Carpentieri, Ilenia; Laurent, Michel P; Costa, Luigi; Wimmer, Markus A

    2011-08-01

    Ultrahigh-molecular-weight polyethylene (UHMWPE) is used as an articulating surface in prosthetic devices. Its failure under various mechanisms after oxidation is of utmost concern. Free radicals formed during the sterilization process using high-energy irradiation result in oxidation. Europium, an element of the lanthanide family, has a unique electron configuration with an unusual lack of preference for directional bonding and notable bonding to oxygen. Because of this, it currently is used in studies for stabilization of polymers such as polyvinyl chloride. We asked whether europium stearate could enhance the oxidation resistance after irradiation in nitrogen of UHMWPE. Conventional nonirradiated and gamma-irradiated in nitrogen UHMWPE were compared with polyethylene doped with 375 ppm and 3750 ppm europium(III) stearate under the same treatment conditions. Chemical characterization was performed by Fourier transform infrared (FTIR) microspectroscopy using 200-μm thin films. The oxidation of doped samples with time was compared with that of conventional samples using accelerated oven aging. The types of oxidation products were identified by FTIR and quantified per material and treatment condition as indications of the oxidation level and mechanism. The generation rate of hydroperoxides and ketones was decelerated proportionally with concentration of europium stearates. The oxidative mechanism appeared similar to that of conventional polyethylene with the same types of measurable end products as ketones and hydroperoxides. Yet, the rate of generation of the latter appeared to be slowed down by the action of europium stearate. Europium stearate mixed in UHMWPE decelerated the oxidation reactions triggered by gamma irradiation in nitrogen, seemingly without major alteration of the oxidation mechanism.

  18. Temperature dependent luminescence of a europium complex incorporated in poly(methyl methacrylate).

    Science.gov (United States)

    Liang, Hao; Xie, Fang; Ren, Xiaojun; Chen, Yifa; Chen, Biao; Guo, Fuquan

    2013-12-01

    An europium β-diketonate complex with a dipyrazolyltriazine derivative ligand, Eu(TTA)3DPBT, has been incorporated into poly(methyl methacryate) (PMMA). The influence of temperature on its luminescence properties has been investigated. The fluorescence emission spectra and luminescence lifetimes showed temperature sensitivity. The analysis of the relative intensity ratio (R) of (5)D0 → (7)F2 to (5)D0 → (7)F1 transition and Judd-Ofelt experimental intensity parameters Ω2 indicated that the local structure and asymmetry in the vicinity of europium ions show no obvious change when the temperature is increased. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. 29 CFR 1910.161 - Fixed extinguishing systems, dry chemical.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 5 2010-07-01 2010-07-01 false Fixed extinguishing systems, dry chemical. 1910.161 Section... § 1910.161 Fixed extinguishing systems, dry chemical. (a) Scope and application. This section applies to all fixed extinguishing systems, using dry chemical as the extinguishing agent, installed to meet a...

  20. 12 CFR 563.161 - Management and financial policies.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Management and financial policies. 563.161... ASSOCIATIONS-OPERATIONS Financial Management Policies § 563.161 Management and financial policies. (a)(1) For... corporation must be well managed and operate safely and soundly. Each also must pursue financial policies that...

  1. 22 CFR 161.6 - Responsibilities of departmental officials.

    Science.gov (United States)

    2010-04-01

    ... Secretary for Congressional Relations in the preparation of environmental documents relating to legislation....6 Section 161.6 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION REGULATIONS FOR IMPLEMENTATION OF THE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) NEPA and Departmental Decisionmaking § 161.6...

  2. 21 CFR 516.161 - Modifications to indexed drugs.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Modifications to indexed drugs. 516.161 Section 516.161 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS NEW ANIMAL DRUGS FOR MINOR USE AND MINOR SPECIES Index...

  3. 40 CFR 161.35 - Flexibility of the data requirements.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Flexibility of the data requirements. 161.35 Section 161.35 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE... Flexibility of the data requirements. Several provisions of this part provide EPA flexibility in requiring (or...

  4. 27 CFR 20.161 - Withdrawals under permit.

    Science.gov (United States)

    2010-04-01

    ... permittee may obtain domestic specially denatured spirits only. The alcohol in domestic denatured spirits... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Withdrawals under permit. 20.161 Section 20.161 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU...

  5. 7 CFR 1150.161 - Promotion, research and nutrition education.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Promotion, research and nutrition education. 1150.161... Dairy Promotion and Research Order Promotion, Research and Nutrition Education § 1150.161 Promotion, research and nutrition education. (a) The Board shall receive and evaluate, or on its own initiative...

  6. 27 CFR 1.61 - Use of wine.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Use of wine. 1.61 Section..., NONINDUSTRIAL USE OF DISTILLED SPIRITS AND WINE, BULK SALES AND BOTTLING OF DISTILLED SPIRITS Nonindustrial Use of Distilled Spirits and Wine Uses Regarded As Industrial § 1.61 Use of wine. The following uses of...

  7. 24 CFR 982.161 - Conflict of interest.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Conflict of interest. 982.161... and PHA Administration of Program § 982.161 Conflict of interest. (a) Neither the PHA nor any of its... responsibilities with respect to the programs; or (4) Any member of the Congress of the United States. (b) Any...

  8. Study of the europium behavior in aqueous media; Estudio sobre el comportamiento del europio en medios acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez R, E.; Jimenez R, M.; Solache R, M.; Martinez M, V. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)

    2000-07-01

    Europium as waste can produce a pollution problem in water that is in contact with it, what would has a heavy environmental impacts, because of the possibilities of diffusion of these wastes from their place of confinement or storage until the geo and biosphere. The solution of such problem requires of a lot of knowledge over the behavior of several chemical elements such as europium in aqueous solutions. In this work it was used a low ion force (0.02 M). The data set will allow extrapolate the hydrolytic behavior of europium in too much minors ion force media, such as the ground waters, including in ion force zero.

  9. Thermodynamic and structural description of europium complexation in 1-octanol - H{sub 2}O solutions

    Energy Technology Data Exchange (ETDEWEB)

    Vu, T.H.; Charbonnel, M.C.; Boubals, N.; Couston, L. [CEA Marcoule, DEN/DRCP/SCPS/LCAM, BP 17171, 30207 Bagnols-sur-Ceze (France); Arnaud, F. [Laboratoire de Chimie Physique, IPHC, 25 rue Becquerel, 67087 Strasbourg (France)

    2008-07-01

    Polydentate N-bearing ligands such as bis-triazinyl-pyridines (BTPs) are interesting extractants for actinide(III)/lanthanide(III) separation. A description of europium complexation in 1-octanol solutions was undertaken to enhance the knowledge of the extraction mechanisms. The first solvation shell for europium(III) nitrate, chloride, and perchlorate with different amounts of water was determined by Time-Resolved Laser-Induced Fluorescence (TRLIF) spectroscopy. Europium nitrate complexation by iPr-BTP was then studied by TRLIF and micro-calorimetry; similar stability constants related to the formation of Eu(BTP){sub 2}{sup 3+} and Eu(BTP){sub 3}{sup 3+} were obtained by both techniques (log({beta}{sub 2}) = 9.0 {+-} 0.3 and log({beta}{sub 3}) = 13.8 {+-} 0.2). The presence of water in the octanol diluent has an influence on solvation of europium and also on the [Eu(BTP){sub 2}{sup 3+}] / [Eu(BTP){sub 3}{sup 3+}] ratio. (authors)

  10. A novel biocompatible europium ligand for sensitive time-gated immunodetection.

    Science.gov (United States)

    Sayyadi, Nima; Connally, Russell E; Try, Andrew

    2016-01-21

    We describe the synthesis of a novel hydrophilic derivative of a tetradentate β-diketone europium ligand that was used to prepare an immunoconjugate probe against Giardia lamblia cysts. We used a Gated Autosynchronous Luminescence Detector (GALD) to obtain high quality delayed luminescence images of cells 30-fold faster than ever previously reported.

  11. Europium-doped barium halide scintillators for x-ray and ?-ray detections

    NARCIS (Netherlands)

    Selling, J.; Birowosuto, M.D.; Dorenbos, P.; Schweizer, S.

    2007-01-01

    Single crystals of undoped or europium-doped barium chloride, bromide, and iodide were investigated under x-ray and ?-ray excitations. The Eu2+-related x-ray excited luminescence found in the Eu-doped barium halides occurs at 402, 404, and 425?nm for the chloride, bromide, and iodide, respectively.

  12. A europium luminescence assay of lactate and citrate in biological fluids†

    Science.gov (United States)

    Pal, Robert; Costello, Leslie C.

    2013-01-01

    Ratiometric methods of analysis have been developed for the selective determination of lactate or citrate in microlitre samples of human serum, urine or prostate fluids following comparison of anion binding affinities for a family of nine luminescent europium(III) complexes. PMID:19343236

  13. Molecular interactions of Leucoagaricus naucinus with uranium(VI) and europium(III)

    Energy Technology Data Exchange (ETDEWEB)

    Wollenberg, Anne; Raff, Johannes [Helmholtz-Zentrum Dresden-Rossendorf e.V., Dresden (Germany). Biogeochemistry; Guenther, A. [Helmholtz Institute Freiberg for Resource Technology, Freiberg (Germany)

    2017-06-01

    With regard to a molecular understanding of the interaction of fungal mycelium with radionuclides and its possible application for precautionary radiation protection and bio-remediation, the binding mechanism of the radionuclide uranium and the metal europium, as surrogate for trivalent actinides, where investigated with different starting conditions by the living fungal cells of Leucoagaricus naucinus.

  14. Europium doped In(Zn)P/ZnS colloidal quantum dots

    NARCIS (Netherlands)

    Thuy, Ung Thi Dieu; Maurice, Axel; Liem, Nguyen Quang; Reiss, Peter

    2013-01-01

    Chemically synthesised In(Zn)P alloy nanocrystals are doped with Eu(3+) ions using europium oleate as a molecular precursor and are subsequently covered with a ZnS shell. The presence of zinc in the synthesis of the InP core nanocrystals leads to the formation of an In(Zn)P alloy structure, making

  15. NO fluorescence sensing by europium tetracyclines complexes in the presence of H2O2.

    Science.gov (United States)

    Simões, Eliana F C; Leitão, João M M; Esteves da Silva, Joaquim C G

    2013-07-01

    The effect on the fluorescence of the europium:tetracycline (Eu:Tc), europium:oxytetracycline (Eu:OxyTc) and europium:chlortetracycline (Eu:ClTc) complexes in approximately 2:1 ratio of nitric oxide (NO), peroxynitrite (ONOO(-)), hydrogen peroxide (H2O2) and superoxide (O2 (·-)) was assessed at three ROS/RNS concentrations levels, 30 °C and pH 6.00, 7.00 and 8.00. Except for the NO, an enhancement of fluorescence intensity was observed at pH 7.00 for all the europium tetracyclines complexes-the high enhancement was observed for H2O2. The quenching of the fluorescence of the Tc complexes, without and with the presence of other ROS/RNS species, provoked by NO constituted the bases for an analytical strategy for NO detection. The quantification capability was evaluated in a NO donor and in a standard solution. Good quantification results were obtained with the Eu:Tc (3:1) and Eu:OxyTc (4:1) complexes in the presence of H2O2 200 μM with a detection limit of about 3 μM (Eu:OxyTc).

  16. Long-term tagging of elvers, Anguilla anguilla, with radioactive europium

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Fattah, A. T. A.

    1986-01-01

    -life of added europium of 1.6 .+-. 0.5 years. Thirteen hundred 155Eu-labelled elvers (50 Bq per eel), each weighing on average 0.21 g, were set out near Oskarshamn on the east coast of Sweden in June 1982. Three of these were caught nearby in May 1985 and one was caught in August 1985. They weighed...

  17. ULTRAVIOLET TRANSITIONS IN EUROPIUM STUDIED WITH A FREQUENCY-DOUBLED CW RING DYE-LASER

    NARCIS (Netherlands)

    Eliel, E.R.; Hogervorst, W.; van Leeuwen, K.A.H.; Post, B.H.

    1981-01-01

    High resolution laser spectroscopy has been applied to the study of three ultraviolet transitions in Europium at λ = 294.8, 295.1 and 295.8 nm. The tunable narrowband UV has been generated by intracavity frequency doubling in a cw ring dye laser using a temperate tuned, Brewster angled ADA crystal.

  18. Optical and Morphological Characterization of Sonochemically Assisted Europium Doped Copper (I) Oxide Nanostructures

    Science.gov (United States)

    Cosico, J. A. M.; Ruales, P. K.; Marquez, M. C.

    2017-06-01

    In the age where application of nanotechnology in our society has proven to be eminent, different routes of synthesizing nanoparticles have emerged. In this study nanoparticles of cuprous oxide (Cu2O) doped with different amounts of europium was prepared by using solution precursor route approach with the aid of ultrasonic sound. Copper sulphate and europium (III) nitrate pentahydrate was used as source for copper ions and europium ions respectively. X-ray diffraction (XRD) and Fourier Transform Infrared spectroscopy (FTIR) were used to elucidate the cubic crystal structure and organic impurities present on Cu2Onanoparticles. UV-Vis spectroscopy was used to determine the absorption spectrum of the nanoparticles in the wavelength range of 400nm to 700nm. The bandgap of the undoped and doped Cu2O were found to fall between 2.1eV - 2.3eV. Scanning Electron Microscopy (SEM) coupled with energy dispersive x-ray was used to observe the dendritic and rodlike morphology and the presence of europium in the synthesized Cu2O nanoparticles. The observed effect on the absorbance of Cu2O upon adding Eu and a facile way of synthesizing Cu2O nanoparticles could bring a positive impact on the production of functional devices for optoelectronic and energy applications.

  19. Occurrence of photoluminescence and onion like structures decorating graphene oxide with europium using sodium dodecyl sulfate surfactant

    Science.gov (United States)

    Cedeño, V. J.; Rangel, R.; Cervantes, J. L.; Lara, J.; Alvarado, J. J.; Galván, D. H.

    2017-07-01

    Graphene oxide decoration with europium was carried out using SDS (sodium dodecyl sulfate) as the surfactant. The reaction was performed in a microwave oven and subsequently underwent thermal treatment under hydrogen flow. The results found in the present work demonstrate that through the use of SDS surfactant aggregates of hemi-cylindrical and onion-like structures could be obtained; which propitiate an enhanced synergistic photoluminescence located at the red wavelength. On the other hand, after thermal treatment the aggregates disappear providing a good dispersion of europium, however a decrease in the photoluminescence signal is observed. The graphene oxide decorated with europium was characterized by scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS), Fourier infrared transform spectroscopy (FTIR), RAMAN spectroscopy, x-ray photoelectron spectroscopy (XPS) and transmission electron microscopy (TEM) techniques, showing the characteristic features of graphene oxide and europium.

  20. Synthesis, characterization, and properties of reduced europium molybdates and tungstates

    Energy Technology Data Exchange (ETDEWEB)

    Abeysinghe, Dileka [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Gerke, Birgit [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Morrison, Gregory; Hsieh, Chun H.; Smith, Mark D. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Pöttgen, Rainer [Institut für Anorganische und Analytische Chemie, Universität Münster , Corrensstrasse 30, Münster D-48149 (Germany); Makris, Thomas M. [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States); Loye, Hans-Conrad zur, E-mail: zurloye@mailbox.sc.edu [Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 (United States)

    2015-09-15

    Single crystals of K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} were grown from molten chloride fluxes contained in vacuum-sealed fused silica and structurally characterized via single crystal X-ray diffraction. The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. All four compounds crystallize in the tetragonal space group of I4{sub 1}/a and adopt the scheelite (CaWO{sub 4}) structure type. The magnetic susceptibility of the reported compounds shows paramagnetic behavior down to 2 K. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. All the compounds were further characterized by EPR, and UV-vis spectroscopy. - Graphical abstract: TOC Caption Two new reduced europium containing quaternary oxides, K{sub 0.094}Eu{sub 0.906}MoO{sub 4} and K{sub 0.097}Eu{sub 0.903}WO{sub 4}, and two previously reported ternary reduced oxides, EuWO{sub 4} and EuMoO{sub 4}, were synthesized via an in situ reduction of Eu{sup 3+} to Eu{sup 2+} under flux method using Mo, W, and Zn as metal reducing agents. {sup 151}Eu Mössbauer spectroscopy was used to analyze the relative Eu{sup 2+} and Eu{sup 3+} content of the samples. - Highlights: • K{sub 0.094}Eu{sub 0.906}MoO{sub 4}, K{sub 0.097}Eu{sub 0.903}WO{sub 4}, EuWO{sub 4}, and EuMoO{sub 4} have been synthesized and characterized. • The in situ reduction of Eu{sup 3+} to Eu{sup 2+} was carried out using Mo, W, and Zn as metal reducing agents. • Magnetic susceptibility data were collected. • {sup 151}Eu Mössbauer spectroscopy was used to analyze Eu{sup 2+} and Eu{sup 3+} content.

  1. A highly sensitive and selective fluorescent sensor for detection of Al(3+) using a europium(III) quinolinecarboxylate.

    Science.gov (United States)

    Xu, Wentao; Zhou, Youfu; Huang, Decai; Su, Mingyi; Wang, Kun; Hong, Maochun

    2014-07-07

    Eu2PQC6 has been developed to detect Al(3+) by monitoring the quenching of the europium-based emission, with the lowest detection limit of ∼32 pM and the quantitative detection range to 150 μM. Eu2PQC6 is the first ever example that the europium(III) complex serves as an Al(3+) fluorescent sensor based on "competition-displacement" mode.

  2. Phenotype abnormality: 161 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 161 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u667i decreased efficiency... in organ named stem during process named growth ... stem ... decreased efficiency ... growth ...

  3. Eestist osaleb rahvusvahelisel reklaamifestivalil 161 reklaami / Sergo Selder

    Index Scriptorium Estoniae

    Selder, Sergo

    2005-01-01

    Riias toimuvast kuuendast Baltimaade reklaamifestivalist "Kuldne haamer" ("Golden Hammer"). Eestist on esitatud 161 reklaami. Žüriisse kuulub eestlastest Jaanus Vahtra reklaamifirmast Saatchi & Saatchi, kelle Diseli õllereklaam võitis möödunud aastal telereklaamide Kuldhaamri

  4. 22 CFR 161.7 - Categories of actions.

    Science.gov (United States)

    2010-04-01

    ... documents and delivering retirement checks, social security payments and veterans benefits; (3) Conduct of... in § 161.11 of these regulations); and (3) Ocean dumping, control of toxic substances, disposal and...

  5. 46 CFR 161.012-11 - Approval tests.

    Science.gov (United States)

    2010-10-01

    ...: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Personal Flotation Device Lights § 161.012-11 Approval tests. (a... procedures necessary to conduct the approval tests required by this subpart, and that is free of influence...

  6. The effect of two additional Eu3+ lumophors in two novel trinuclear europium complexes on their photoluminescent properties.

    Science.gov (United States)

    Yang, Chaolong; Xu, Jing; Ma, Jianying; Zhu, Dongyu; Zhang, Yunfei; Liang, Liyan; Lu, Mangeng

    2013-02-01

    Two novel trinuclear europium complexes based on trisphen(1,3,5-tris{4-((1,10-phenanthroline-[5,6-d]imidazol-2yl)phenoxy)methyl}-2,4,6-trimethyl-benzene) as a second ligand were designed, synthesized, and characterized by FT-IR, (1)H NMR, UV-visible, photoluminescence (PL) spectroscopy, elemental analysis (EA) and ESI-MS. The geometries of these two trinuclear europium complexes were predicted using the Sparkle/PM3 model and suggested a chemical environment of very low symmetry around the lanthanide ions (C(1)), which is in agreement with the luminescent spectra. CV analysis demonstrated that the trinuclear complexes possessed excellent electro-injection abilities. The effects of two additional Eu(3+) lumophors in these trinuclear europium complexes on their photoluminescent properties were investigated in detail. The results indicated that these trinuclear europium complexes exhibited highly luminescent quantum efficiencies and experimental intensity parameters in the solid state. Especially, due to the contribution of the two additional Eu(3+) lumophors in the trinuclear europium complexes, the quantum efficiency of the trinuclear complex Eu(3)(TTA)(9)trisphen was higher (ca. 34%) than the mononuclear europium complex Eu(TTA)(3)imidazophen.

  7. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro

    2015-07-01

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  8. Incorporation of europium III complex into nanoparticles and films obtained by the Sol-Gel methodology

    Directory of Open Access Journals (Sweden)

    Faley Jean de Sousa

    2010-03-01

    Full Text Available The sol-gel process is very effective for the preparation of new materials with potential applications in optics, sensors, catalyst supports, coatings, and specialty inorganic polymers that can be used as hosts for the accommodation of organic molecules. The low temperature employed in the process is the main advantage of this methodology. In this work, the europium (III complex with 1,10-phenantroline was prepared, and this luminescent complex was incorporated into silica nanoparticles and films by the sol-gel process. The nanoparticles were obtained by the modified Stöber methodology. The films were obtained by the dip-coating technique, at different deposition rates and numbers of layers. The nanoparticles and films were characterized by photoluminescence, thermal analysis, and Raman and infrared spectroscopies. Characterization revealed that the europium (III complex was not affected upon incorporation into the nanoparticles and films, opening a new field for the application of these materials.

  9. A Simple and Sensitive Method to Quantify Biodegradable Nanoparticle Biodistribution using Europium Chelates.

    Science.gov (United States)

    Crawford, Lindsey; Higgins, Jaclyn; Putnam, David

    2015-09-08

    The biodistribution of biodegradable nanoparticles can be difficult to quantify. We report a method using time resolved fluorescence (TRF) from a lanthanide chelate to minimize background autofluorescence and maximize the signal to noise ratio to detect biodegradable nanoparticle distribution in mice. Specifically, antenna chelates containing europium were entrapped within nanoparticles composed of polylactic acid-polyethylene glycol diblock copolymers. Tissue accumulation of nanoparticles following intravenous injection was quantified in mice. The TRF of the nanoparticles was found to diminish as a second order function in the presence of serum and tissue compositions interfered with the europium signal. Both phenomena were corrected by linearization of the signal function and calculation of tissue-specific interference, respectively. Overall, the method is simple and robust with a detection limit five times greater than standard fluorescent probes.

  10. A Comprehensive Strategy to Boost the Quantum Yield of Luminescence of Europium Complexes

    Science.gov (United States)

    Lima, Nathalia B. D.; Gonçalves, Simone M. C.; Júnior, Severino A.; Simas, Alfredo M.

    2013-01-01

    Lanthanide luminescence has many important applications in anion sensing, protein recognition, nanosized phosphorescent devices, optoelectronic devices, immunoassays, etc. Luminescent europium complexes, in particular, act as light conversion molecular devices by absorbing ultraviolet (UV) light and by emitting light in the red visible spectral region. The quantum yield of luminescence is defined as the ratio of the number of photons emitted over the number of UV photons absorbed. The higher the quantum yield of luminescence, the higher the sensitivity of the application. Here we advance a conjecture that allows the design of europium complexes with higher values of quantum yields by simply increasing the diversity of good ligands coordinated to the lanthanide ion. Indeed, for the studied cases, the percent boost obtained on the quantum yield proved to be strong: of up to 81%, accompanied by faster radiative rate constants, since the emission becomes less forbidden. PMID:23928866

  11. Assembly of europium organic framework–gold nanoparticle composite thin films on silicon substrate

    Energy Technology Data Exchange (ETDEWEB)

    Deep, Akash, E-mail: dr.akashdeep@gmail.com [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India); Kaur, Rajnish [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India); Kumar, Parveen [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Kumar, Pawan; Paul, A.K. [Central Scientific Instruments Organisation (CSIR-CSIO), Sector 30 C, Chandigarh 160030 (India); Academy of Scientific and Innovative Research, CSIR-CSIO, Sector 30 C, Chandigarh 160030 (India)

    2014-08-28

    Metal organic frameworks are a sub-class of coordination polymers and rapidly generating huge research interests in several technological areas. One of the emerging areas of their potential applications is the photovoltaics. The present study proposes the assembly of europium organic framework–gold nanoparticle nanocomposite thin film on silicon substrate. Microscopic, X-ray diffraction, surface area measurement and thermal studies have indicated the formation of the desired thin film. Spectral studies have been used to highlight their solid state optical property. Current–voltage studies have established semiconducting property of the above thin films. - Highlights: • Thin film of europium organic framework/gold nanoparticles is prepared on silicon. • Fairly homogeneous films with a roughness factor of 5–10 nm are obtained. • Above thin films offer solid-state photoluminescence and semiconducting properties.

  12. Synthesis and optical features of an europium organic-inorganic silicate hybrid

    Energy Technology Data Exchange (ETDEWEB)

    Franville, A.C.; Zambon, D.; Mahiou, R.; Chou, S.; Cousseins, J.C. [Universite Blaise Pascal, Aubiere (France). Lab. des Materiaux Inorganiques; Troin, Y. [Laboratoire de Chimie des Heterocycles et des Glucides, EA 987, Universite Blaise-Pascal and ENSCCF, F-63177 Aubiere Cedex (France)

    1998-07-24

    A europium organic-inorganic silicate hybrid was synthesized by grafting a coordinative group (dipicolinic acid) to a silicate network precursor (3-aminopropyltriethoxysilane) via a covalent bonding. Sol-gel process and complexation were performed using different experimental conditions. The hybrid materials, in particular the Eu{sup 3+} coordination mode, were characterized by infrared and luminescence spectroscopies. Morphology of the materials and TG analysis showed that grafted silica enhanced thermal and mechanical resistances of the organic part. (orig.) 7 refs.

  13. Development of a microchip Europium nanoparticle immunoassay for sensitive point-of-care HIV detection.

    Science.gov (United States)

    Liu, Jikun; Du, Bingchen; Zhang, Panhe; Haleyurgirisetty, Mohan; Zhao, Jiangqin; Ragupathy, Viswanath; Lee, Sherwin; DeVoe, Don L; Hewlett, Indira K

    2014-11-15

    Rapid, sensitive and specific diagnostic assays play an indispensable role in determination of HIV infection stages and evaluation of efficacy of antiretroviral therapy. Recently, our laboratory developed a sensitive Europium nanoparticle-based microtiter-plate immunoassay capable of detecting target analytes at subpicogram per milliliter levels without the use of catalytic enzymes and signal amplification processes. Encouraged by its sensitivity and simplicity, we continued to miniaturize this assay to a microchip platform for the purpose of converting the benchtop assay technique to a point-of-care test. It was found that detection capability of the microchip platform could be readily improved using Europium nanoparticle probes. We were able to routinely detect 5 pg/mL (4.6 attomoles) of HIV-1 p24 antigen at a signal-to-blank ratio of 1.5, a sensitivity level reasonably close to that of microtiter-plate Europium nanoparticle assay. Meanwhile, use of the microchip platform effectively reduced sample/reagent consumption 4.5 fold and shortened total assay time 2 fold in comparison with microtiter plate assays. Complex matrix substance in plasma negatively affected the microchip assays and the effects could be minimized by diluting the samples before loading. With further improvements in sensitivity, reproducibility, usability, assay process simplification, and incorporation of portable time-resolved fluorescence reader, Europium nanoparticle immunoassay technology could be adapted to meet the challenges of point-of-care diagnosis of HIV or other health-threatening pathogens at bedside or in resource-limited settings. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Green Luminescence of Divalent Europium in the Hydride Chloride EuHCl

    NARCIS (Netherlands)

    Kunkel, Nathalie; Rudolph, Daniel; Meijerink, A; Rommel, Stefan; Weihrich, Richard; Kohlmann, Holger; Schleid, Thomas

    Luminescence properties of divalent europium in the mixed-anion hydride chloride EuHCl were studied for the first time. Olive-green single crystals of EuHCl (PbFCl-type structure: tetragonal, P4/nmm, a = 406.58(3) pm, c = 693.12(5) pm, c/a = 1.705, Z = 2) resulted from the reaction of elemental

  15. Ferromagnetic semiconductor-metal transition in heterostructures of electron doped europium monoxide

    Energy Technology Data Exchange (ETDEWEB)

    Stollenwerk, Tobias

    2013-09-15

    In the present work, we develop and solve a self-consistent theory for the description of the simultaneous ferromagnetic semiconductor-metal transition in electron doped Europium monoxide. We investigate two different types of electron doping, Gadolinium impurities and Oxygen vacancies. Besides the conduction band occupation, we can identify low lying spin fluctuations on magnetic impurities as the driving force behind the doping induced enhancement of the Curie temperature. Moreover, we predict the signatures of these magnetic impurities in the spectra of scanning tunneling microscope experiments. By extending the theory to allow for inhomogeneities in one spatial direction, we are able to investigate thin films and heterostructures of Gadolinium doped Europium monoxide. Here, we are able to reproduce the experimentally observed decrease of the Curie temperature with the film thickness. This behavior is attributed to missing coupling partners of the localized 4f moments as well as to an electron depletion at the surface which leads to a reduction of the number of itinerant electrons. By investigating the influence of a metallic substrate onto the phase transition in Gadolinium doped Europium monoxide, we find that the Curie temperature can be increased up to 20%. However, as we show, the underlying mechanism of metal-interface induced charge carrier accumulation is inextricably connected to a suppression of the semiconductor-metal transition.

  16. Redox electrochemistry of europium fluoride complexes in an equimolar NaCl-KCl melt

    Energy Technology Data Exchange (ETDEWEB)

    Kuznetsov, S.A., E-mail: kuznet@chemy.kolasc.net.ru [Institute of Chemistry, Kola Science Centre RAS, 26 Akademgorodok., 184209 Apatity, Murmansk region (Russian Federation); Gaune-Escard, M. [Ecole Polytechnique, Mecanique Energetique, Technopole de Chateau Gombert, 5 rue Enrico Fermi, 13453 Marseille Cedex 13 (France)

    2011-07-15

    The electrochemical behavior of europium fluoride complexes was studied by different electrochemical methods at a glassy carbon electrode in the temperature range 973-1100 K in the NaCl-KCl melt. The diffusion coefficients of Eu(III) and Eu(II) were determined by linear sweep voltammetry. The standard rate constants of charge transfer for the Eu(III)/Eu(II) redox couple were found on the base cyclic voltammetry, impedance spectroscopy and chronoamperometry data. The formal standard redox potentials E{sub Eu(III)/Eu(II)}{sup *} were obtained by linear sweep and cyclic voltammetry. The electrochemical behavior of europium fluoride and europium chloride complexes in NaCl-KCl melt was compared and discussed in connection with the strength and stability of these complexes. It was shown that the formation of stronger fluoride complexes reduced values of diffusion coefficients, standard rate constants for charge transfer of the Eu(III)/Eu(II) redox couple and shifted the formal standard redox potentials to the more electronegative values.

  17. Lateral flow immunoassay using europium chelate-loaded silica nanoparticles as labels.

    Science.gov (United States)

    Xia, Xiaohu; Xu, Ye; Zhao, Xilin; Li, Qingge

    2009-01-01

    Despite their ease of use, lateral flow immunoassays (LFIAs) often suffer from poor quantitative discrimination and low analytical sensitivity. We explored the use of a novel class of europium chelate-loaded silica nanoparticles as labels to overcome these limitations. Antibodies were covalently conjugated onto europium chelate-loaded silica nanoparticles with dextran as a linker. The resulting conjugates were used as labels in LFIA for detection of hepatitis B surface antigen (HBsAg). We performed quantification with a digital camera and Adobe Photoshop software. We also used 286 clinical samples to compare the proposed method with a quantitative ELISA. A detection limit of 0.03 microg/L was achieved, which was 100 times lower than the colloidal gold-based LFIAs and lower than ELISA. A precise quantitative dose-response curve was obtained, and the linear measurement range was 0.05-3.13 microg/L, within which the CVs were 2.3%-10.4%. Regression analysis of LFIA on ELISA results gave: log (LFIA) = -0.14 log (ELISA) + 1.03 microg/L with r = 0.99 for the quantification of HBsAg in 35 positive serum samples. Complete agreement was observed for the qualitative comparison of 286 clinical samples assayed with LFIA and ELISA. Europium chelate-loaded silica nanoparticle labels have great potential to improve LFIAs, making them useful not only for simple screening applications but also for more sensitive and quantitative immunoassays.

  18. Luminescent solutions and films of new europium complexes with chelating ligands

    Science.gov (United States)

    Kharcheva, Anastasia V.; Ivanov, Alexey V.; Borisova, Nataliya E.; Kaminskaya, Tatiana P.; Patsaeva, Svetlana V.; Popov, Vladimir V.; Yuzhakov, Viktor I.

    2015-03-01

    The development of new complexes of rare earth elements (REE) with chelating organic ligands opens up the possibility of purposeful alteration in the composition and structure of the complexes, and therefore tuning their optical properties. New ligands possessing two pyridine rings in their structure were synthesized to improve coordination properties and photophysical characteristics of REE compounds. Complexes of trivalent europium with novel chelating ligands were investigated using luminescence and absorption spectroscopy, as well as atomic force microscopy. Luminescence properties of new compounds were studied both for solutions and films deposited on the solid support. All complexes exhibit the characteristic red luminescence of Eu (III) ion with the absolute lumenescence quantum yield in polar acetonitrile solution varying from 0.21 to 1.45 % and emission lifetime ranged from 0.1 to 1 ms. Excitation spectra of Eu coordination complexes correspond with absorption bands of chelating ligand. The energy levels of the triplet state of the new ligands were determined from the phosphorescence at 77 K of the corresponding Gd (III) complexes. The morphology of films of europium complexes with different substituents in the organic ligands was investigated by atomic force microscopy (AFM). It strongly depends both on the type of substituent in the organic ligand, and the rotation speed of the spin-coater. New europium complexes with chelating ligands containing additional pyridine fragments represent outstanding candidates for phosphors with improved luminescence properties.

  19. Use of europium ions for SAD phasing of lysozyme at the Cu Kα wavelength.

    Science.gov (United States)

    Vijayakumar, Balakrishnan; Velmurugan, Devadasan

    2013-01-01

    Europium is shown to be a good anomalous scatterer in SAD phasing for solving the structure of biological macromolecules. The large value of the anomalous contribution of europium, f'' = 11.17 e(-), at the Cu Kα wavelength is an advantage in de novo phasing and automated model building. Tetragonal crystals of hen egg-white lysozyme (HEWL) incorporating europium(III) chloride (50 mM) were obtained which diffracted to a resolution of 2.3 Å at a wavelength of 1.54 Å (Cu Kα). The master data set (360° frames) was split and analyzed for anomalous signal-to-noise ratio, multiplicity, completeness, SAD phasing and automated building. The structure solution and model building of the split data sets were carried out using phenix.autosol and phenix.autobuild. The contributions of the Eu ions to SAD phasing using in-house data collection are discussed. This study revealed successful lysozyme phasing by SAD using laboratory-source data involving Eu ions, which are mainly coordinated by the side chains of Asn46, Asp52 and Asp101 together with some water molecules.

  20. Hydrothermal treatment for preparation of europium-lanthanum phosphates and exploration of their fluorescence properties

    Directory of Open Access Journals (Sweden)

    Hiroaki Onoda

    2014-04-01

    Full Text Available Europium-substituted lanthanum phosphates (Eu; 5 mol% were prepared from lanthanum nitrate, europium nitrate, and sodium polyphosphate solutions by a hydrothermal process at 120 and 160 °C up to 8 h. The obtained phosphates were studied using XRD, IR spectroscopy, TG–DTA, and SEM. UV–vis absorbance and reflectance, as well as fluorescence, were estimated as functional properties of these phosphate materials. We found that samples prepared without hydrothermal treatment were amorphous (as indicated by their XRD patterns, whereas those prepared by a hydrothermal treatment contained peaks corresponding to lanthanum orthophosphate, indicating that the hydrothermal process caused the polyphosphate(s to decompose into orthophosphate(s. The TG–DTA curves of the samples prepared by a hydrothermal treatment were different from those of the samples prepared without hydrothermal treatment. All samples reported herein had no specified shape despite using prolonged hydrothermal treatment times. Although the samples prepared without hydrothermal treatment showed only weak fluorescence peaks, those prepared by a hydrothermal treatment showed strong peaks at 556, 590, 615, and 690 nm. These peaks corresponded to transitions from 5D0 to 7F0, 7F1, 7F2, and 7F4, respectively. Collectively, these results indicate that the hydrothermal treatment is a useful method of obtaining europium-substituted lanthanum phosphates with fluorescence properties.

  1. Fabrication of coated graphite electrode for the selective determination of europium (III) ions.

    Science.gov (United States)

    Upadhyay, Anjali; Singh, Ashok Kumar; Bandi, Koteswara Rao; Jain, A K

    2013-10-15

    Preliminary complexation study showed that two ligands (ionophores) (2-((2-phenyl-2-(pyridin-2-yl)hydazono)methyl)pyridine) [L1], (2-((2-phenyl-2-(pyridin-2-yl)hydazono) methyl)phenol) [L2] can act as europium selective electrode. Europium selective coated graphite electrodes (CGE) were prepared by using ligands [L1] and [L2] and their potentiometric characteristics were determined. Membranes having different compositions of poly(vinylchloride) (PVC), the different plasticizers, anionic additives and ionophores were coated onto the graphite surface. The potential response measurements showed that the best performance was exhibited by the proposed CGE. This electrode had the widest working concentration range, Nernstian slope and fast response times of 10s. The selectivity studies showed that this electrode have higher selectivity towards Eu(3+) over a large number of cations. Furthermore, the electrode generated constant potentials in the pH range 2.7-9.0. This electrode can be used to quantify europium in soil, binary mixtures and also used as an indicator electrode in the potentiometric titration of Eu(3+) with EDTA. The proposed electrode was also successfully applied to the determination of fluoride ions in real samples. © 2013 Elsevier B.V. All rights reserved.

  2. Fluorescent Sulfur-Tagged Europium(III) Coordination Polymers for Monitoring Reactive Oxygen Species.

    Science.gov (United States)

    Wang, Huai-Song; Bao, Wen-Jing; Ren, Shi-Bin; Chen, Ming; Wang, Kang; Xia, Xing-Hua

    2015-07-07

    Oxidative stress caused by reactive oxygen species (ROS) is harmful to biological systems and implicated in various diseases. A variety of selective fluorescent probes have been developed for detecting ROS to uncover their biological functions. Generally, the preparation of the fluorescent probes usually undergoes multiple synthetic steps, and the successful fluorescent sensing usually relies on trial-and-error tests. Herein we present a simple way to prepare fluorescent ROS probes that can be used both in biological and environmental systems. The fluorescent europium(III) coordination polymers (CPs) are prepared by simply mixing the precursors [2,2'-thiodiacetic acid and Eu(NO3)3·6H2O] in ethanol. Interestingly, with the increase of reaction temperature, the product undergoes a morphological transformation from microcrystal to nanoparticle while the structure and fluorescent properties retain. The fluorescence of the sulfur-tagged europium(III) CPs can be selectively quenched by ROS, and thus, sensitive and selective monitoring of ROS in aerosols by the microcrystals and in live cells by the nanoparticles has been achieved. The results reveal that the sulfur-tagged europium(III) CPs provide a novel sensor for imaging ROS in biological and environmental systems.

  3. Facile Synthesis, Characterization, and Cytotoxic Activity of Europium-Doped Nanohydroxyapatite

    Science.gov (United States)

    Niño-Martínez, Nereyda; Patiño-Marín, Nuria

    2016-01-01

    The objective of this study was to synthetize europium-doped nanohydroxyapatite using a simple aqueous precipitation method and, thereafter, characterize and impregnate selected samples with 5-fluorouracil in order to explore the properties and the releasing capacity of this material. The nanohydroxyapatite was doped with 3, 5, 10, and 20 wt% of europium. The obtained samples were characterized after they were dried at 80°C and hydrothermal treated at 120°C by 2 hours. The samples were analyzed by transmission electron microscopy, X-ray diffraction analysis, Fourier transform infrared spectroscopy, and photoluminescence. Also, impregnation and release of 5-fluorouracil were assessed in PBS. The toxicity effects of all samples were studied using viability assays on human fibroblasts cells (HGF-1) in vitro. The sizes of the crystallites were about 10–70 nm with irregular morphology and present the phase corresponding to the JCPDS card 9–0432 for hydroxyapatite. The results of the toxicity experiments indicated that doped and undoped powders are biocompatible with fibroblasts cells. Hydroxyapatite samples doped with 5% of europium and loaded with 5-fluorouracil release almost 7 mg/L of the drug after 60 minutes in PBS and decrease the viability of HeLa cells after 24 hours. PMID:27965525

  4. Lifetimes in {sup 161}Lu measured with recoil distance method

    Energy Technology Data Exchange (ETDEWEB)

    Yu, C.H.; Lewis, J.M.; Riedinger, L.L. [and others

    1993-04-01

    High spin states of {sup 161}Lu are populated using the {sup 120}Sn({sup 45}Sc,4n){sup 161}Lu reaction with a 205 MeV {sup 45}Sc beam provided by the Oak Ridge National Lab. A plunger was used to stop the recoils at various distances and the {gamma}-rays were detected by the compact array of 20 Compton-suppressed Ge detectors of 17, 30, 60, 85, 140, 210, and 320 micrometers. These data are being analyzed in order to extract lifetimes. High spin lifetimes in the {pi}h{sub 11/12}, 9/2[514] band of {sup 161}Lu were previously measured with DSAM technique. Large energy signature splitting was observed in the low spin portion of this band, which has been interpreted as the evidence for triaxiality and small quadrupole deformation. The authors measured lifetimes at low spin will be helpful for the verification of this prediction.

  5. Real-time in situ monitoring via europium emission of the photo-release of antitumor cisplatin from a Eu-Pt complex.

    Science.gov (United States)

    Li, Hongguang; Lan, Rongfeng; Chan, Chi-Fai; Jiang, Lijun; Dai, Lixiong; Kwong, Daniel W J; Lam, Michael Hon-Wah; Wong, Ka-Leung

    2015-09-25

    A water-soluble light-responsive antitumor agent, PtEuL, based on a cisplatin-linked europium-cyclen complex has been synthesized and evaluated for controlled cisplatin release by linear/two-photon excitation in vitro with concomitant turn-on and long-lived europium emission as a responsive traceable signal.

  6. Europium doping induced symmetry deviation and its impact on the second harmonic generation of doped ZnO nanowires

    Science.gov (United States)

    Dhara, Soumen; Imakita, Kenji; Mizuhata, Minoru; Fujii, Minoru

    2014-06-01

    In this work, we investigated the effects of europium doping on the second harmonic generation (SHG) of ZnO nanowires (NWs). A non-monotonic enhancement in the SHG is observed with the increase of the europium concentration. Maximum SHG is observed from the 1 at.% europium doped ZnO NWs with an enhancement factor of 4.5. To understand the underlying mechanism, the effective second order non-linear coefficient (deff) is calculated from the theoretical fitting with consideration of the absorption effect. Microstructural characterization reveals the structural deformation of the ZnO NWs caused by europium doping. We estimated the deviation in the crystal site symmetry around the Eu3+ ions (defined as the asymmetric factor) from photoluminescence measurement and it is found to be strongly correlated with the calculated deff value. A strong linear dependence between the magnitudes of deff and the asymmetric factor suggests that deviation in the local site symmetry of the ZnO crystal by europium doping could be the most probable origin of the observed large second order non-linearity.

  7. 14 CFR 161.409 - Required analysis by reevaluation petitioner.

    Science.gov (United States)

    2010-01-01

    ... procedures in § 161.407 and shall include the following: (1) A copy of the restriction or the language of the... noise environment using methodology specified in this part; (4) Evidence of the relationship between... exclusion under FAA orders implementing the National Environmental Policy Act of 1969 (42 U.S.C. 4321). (c...

  8. 50 CFR 300.161 - Alternatives and exceptions.

    Science.gov (United States)

    2010-10-01

    ... container or package containing fish or wildlife if the shipper has a valid wildlife import/export license... FISHERIES REGULATIONS Transportation and Labeling of Fish or Wildlife § 300.161 Alternatives and exceptions... containing fish or wildlife with the word “fish” or “wildlife” as appropriate for its contents, or with the...

  9. 46 CFR 161.002-1 - Incorporation by reference.

    Science.gov (United States)

    2010-10-01

    ... Section 4 Albert Embankment, London SE1 7SR, United Kingdom. International Convention for the Safety of Life at Sea, 1974 (SOLAS 74) Consolidated Edition (Including 1992 Amendments to SOLAS 74, and 1994 Amendments to SOLAS 74), 1992—161.002-4(b). National Fire Protection Association (NFPA) National Fire...

  10. 14 CFR 121.161 - Airplane limitations: Type of route.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Airplane limitations: Type of route. 121... OPERATING REQUIREMENTS: DOMESTIC, FLAG, AND SUPPLEMENTAL OPERATIONS Aircraft Requirements § 121.161 Airplane... specifications, no certificate holder may operate a turbine-engine-powered airplane over a route that contains a...

  11. 33 CFR 161.12 - Vessel operating requirements.

    Science.gov (United States)

    2010-07-01

    ... VTS. (b) If, in a specific circumstance, a VTS User is unable to safely comply with a measure or... respond promptly when hailed and communicate in the English language. Note to § 161.12(c): As stated in 47... Monitoring Areas Center MMSI 1 Call Sign Designated frequency (Channel designation)—purpose 2 Monitoring area...

  12. 30 CFR 75.161 - Plans for training programs.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Plans for training programs. 75.161 Section 75... for training programs. Each operator must submit to the district manager, of the Coal Mine Safety and... qualified. The program must provide— (a) For certified persons, annual training courses in first aid...

  13. 14 CFR 171.161 - Maintenance and operations requirements.

    Science.gov (United States)

    2010-01-01

    ... shall provide a stock of spare parts of such a quantity to make possible the prompt replacement of... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Maintenance and operations requirements... (DME) § 171.161 Maintenance and operations requirements. (a) The owner of the facility shall establish...

  14. Charge growth, dispersion in europium manganite (EuMnO{sub 3-{delta}}) ceramics revealed using opto-impedance probe

    Energy Technology Data Exchange (ETDEWEB)

    Radhakrishnan, S. [Central Electrochemical Research Institute, Karaikudi-630006, T.N. (India); Jagannathan, R., E-mail: jags57_99@yahoo.com [Central Electrochemical Research Institute, Karaikudi-630006, T.N. (India)

    2011-05-19

    Highlights: > In this study, using opto-, magneto-opto impedance techniques, experimental proof for charge growth in europium manganite (EuMnO{sub 3}) near the region of its Neel temperature is presented. > This study gives data related to dielectric properties of europium manganite. > This study may open-up new avenues for investigating the dielectric characteristics of many electronic-ceramics. - Abstract: In this preliminary report, we present the impedance characteristics of poly-crystalline europium manganite, a promising colossal magneto resistance (CMR) system investigated under optical ({approx}5 eV) and magnetic (0.1 T) perturbations yielding some clues on the charge build-up and dispersion processes. This may possibly be resulting from switching between ferromagnetic and anti-ferromagnetic phases through a charge transfer transition mediated process centering Mn{sup 3+/4+} 3d spins thereby meriting a more detailed study correlating with magnetic measurements.

  15. Rapid and accurate tumor-target bio-imaging through specific in vivo biosynthesis of a fluorescent europium complex.

    Science.gov (United States)

    Ye, Jing; Wang, Jianling; Li, Qiwei; Dong, Xiawei; Ge, Wei; Chen, Yun; Jiang, Xuerui; Liu, Hongde; Jiang, Hui; Wang, Xuemei

    2016-04-01

    A new and facile method for rapidly and accurately achieving tumor targeting fluorescent images has been explored using a specifically biosynthesized europium (Eu) complex in vivo and in vitro. It demonstrated that a fluorescent Eu complex could be bio-synthesized through a spontaneous molecular process in cancerous cells and tumors, but not prepared in normal cells and tissues. In addition, the proteomics analyses show that some biological pathways of metabolism, especially for NADPH production and glutamine metabolism, are remarkably affected during the relevant biosynthesis process, where molecular precursors of europium ions are reduced to fluorescent europium complexes inside cancerous cells or tumor tissues. These results proved that the specific self-biosynthesis of a fluorescent Eu complex by cancer cells or tumor tissues can provide a new strategy for accurate diagnosis and treatment strategies in the early stages of cancers and thus is beneficial for realizing precise surgical intervention based on the relevant cheap and readily available agents.

  16. Polystyrene latex particles containing europium complexes prepared by miniemulsion polymerization using bovine serum albumin as a surfactant for biochemical diagnosis.

    Science.gov (United States)

    Aikawa, Tatsuo; Mizuno, Akihiro; Kohri, Michinari; Taniguchi, Tatsuo; Kishikawa, Keiki; Nakahira, Takayuki

    2016-09-01

    Luminescent particles have been attracting significant attention because they can be used in biochemical applications, such as detecting and imaging biomolecules. In this study, luminescent polystyrene latex particles were prepared through miniemulsion polymerization of styrene with dissolved europium complexes in the presence of bovine serum albumin (BSA) and poly(ethylene glycol) monomethoxy methacrylate as surfactants. The solubility of the europium complex in styrene has a strong effect on the yield of the particle. Europium tris(2-thenoyl trifluoroacetonate) di(tri-n-octyl phosphine oxide), which has a high solubility in styrene, was sufficiently incorporated into the polystyrene particles compared to europium tris(2-thenoyl trifluoroacetonate), which has a low solubility in styrene. The luminescence property of the europium complex could remain intact even after its incorporation through the miniemulsion polymerization. In the aqueous dispersion, the resulting particles could emit strong luminescence, which is a characteristic of the europium complex. The antibody fragments were covalently attached to BSA-covered particles after a reaction with a bifunctional linker, N-(6-maleimidocaproyloxy)succinimide. The time-resolved fluoroimmunoassay technique showed that 3.3pg/mL of human α-fetoproteins (AFP) can be detected by using the resulting luminescent particles. An immunochromatographic assay using the resulting particles was also performed as a convenient method to qualitatively detect biomolecules. The detection limit of AFP measured by the immunochromatographic assay was determined to be 2000pg/mL. These results revealed that the luminescent particles obtained in this study can be utilized for the highly sensitive detection of biomolecules and in vitro biochemical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Highly specific ''sensing'' of tryptophan by a luminescent europium(III) complex

    Energy Technology Data Exchange (ETDEWEB)

    Stubenrauch, Jan A.; Mevissen, Christian; Schulte, Marie F.; Bochenek, Steffen; Albrecht, Markus [RWTH Univ. Aachen (Germany). Inst. fuer Organische Chemie; Subramanian, Palani S. [Central Salt and Marine Chemicals, Research Institute (CSRI), Gujarat (India)

    2016-07-01

    The europium(III) complex 1-Cl{sub 3} (S,S-2,2{sup '}-(((1,10-phenanthroline-2,9-diyl)bis(methanylylidene))bis (azanylyliden e))bis(3-methylbutanamide)europiumtrichloride) undergoes, only in the presence of the amino acid tryptophan, a change of emission at 615 nm. In the presence of few equivalents of tryptophan, emission of the europium complex is enhanced while it disappears upon addition of large amounts. This behavior can be assigned to displacement of the sensitizing phenanthroline ligand of 1-Cl{sub 2} x Trp in the latter case.

  18. Electron-induced desorption of europium atoms from oxidized tungsten surface: concentration dependence of low-energy peak

    CERN Document Server

    Davydov, S Y

    2002-01-01

    One discusses nature of electron induced desorption of Eu sup 0 europium atoms under E sub e irradiating electron low-energies (approx 30 eV) and peculiarities of yield dependence of Eu sup 0 atoms on their concentration at oxidized tungsten surface. Primary act of vacancy origination in europium adatom inner 5p-shell turned to be the determining stage. Evaluations have shown that just the first of two possible scenarios of ionization (electron intra-atomic to Eu adatom external quasi-level or realise of knocked out electron into vacuum) leads to Eu sup 0 desorption. One determined concentration threshold for yield of Eu sup 0 atoms

  19. Optical properties of europium(III) {beta}-diketonate/polymer-doped systems using supercritical carbon dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Gerasimova, V.I., E-mail: vis@srd.sinp.msu.ru [Skobel' tsyn Research Institute of Nuclear Physics, Moscow State University, Leninskie Gory 1-2, GSP-1, 119991 Moscow (Russian Federation); Antoshkov, A.A.; Zavorotny, Yu.S.; Rybaltovskii, A.O. [Skobel' tsyn Research Institute of Nuclear Physics, Moscow State University, Leninskie Gory 1-2, GSP-1, 119991 Moscow (Russian Federation); Lemenovskii, D.A., E-mail: dali@org.chem.msu.ru [Chemistry Department, Moscow State University, Leninskie Gory 1-3, GSP-1, 119991 Moscow (Russian Federation)

    2013-02-15

    The optical properties of fluoropolymers and polypropylene doped with europium(III) {beta}-diketonates Eu(L){sub 3}{center_dot}2H{sub 2}O and Eu(L){sub 3}phen (L: fod=6,6,7,7,8,8,8-heptafluoro-2,2-dimethyl-3,5-octanedionato, bta=4,4,4-trifluoro-1-phenyl-1,3-butanedione, tta=4,4,4-trifluoro-1-(2-thienyl)-1,3-butanedione, and phen=1,10-phenanthroline) using supercritical carbon dioxide were investigated by absorption and emission spectra. A comparative analysis of the PL decay times of Eu{sup 3+} ions in the initial europium (III) {beta}-diketonates and impregnated fluoropolymers was carried out. The supercritical fluid (SCF) impregnation of polymer samples with europium(III) {beta}-diketonates containing 1,10-phenanthroline was found to be obstructed differently depending on the type of ligand in the entire investigated impregnation temperature range (T{sub SCF}=50-90 Degree-Sign S). It is shown that from the variety of Eu(L){sub 3}phen only Eu(fod){sub 3}phen can be introduced into the polymer matrix by this method. - Highlights: Black-Right-Pointing-Pointer The optical properties of polymers doped with Eu{sup 3+} {beta}-diketonates using SC CO{sub 2} were investigated. Black-Right-Pointing-Pointer A comparative analysis of the PL decay times in the initial Eu{sup 3+} {beta}-diketonates and doped polymers was carried out. Black-Right-Pointing-Pointer The SC CO{sub 2} impregnation of polymers with Eu{sup 3+} {beta}-diketonates containing 1,10-phenanthroline was found to be obstructed.

  20. Reverse lyotropic liquid crystals from europium nitrate and P123 with enhanced luminescence efficiency.

    Science.gov (United States)

    Yi, Sijing; Li, Qintang; Liu, Hongguo; Chen, Xiao

    2014-10-02

    Fabrication of lyotropic aggregates containing the lanthanide ions is becoming a preferable way to prepare novel functional materials. Here, the lyotropic liquid crystals (LLCs) of reverse hexagonal, reverse bicontinuous cubic, and lamellar phases have been constructed in sequence directly from the mixtures of Eu(NO3)3·6H2O and Pluronic P123 amphiphilc block copolymer with increasing the salt proportion. Their phase types and structural characteristics were analyzed using polarized optical microscopy (POM) and small-angle X-ray scattering (SAXS) measurements. The driving forces of reverse LLC phase formation were investigated using Fourier-transformed infrared spectroscopy (FTIR) and rheological measurements. The hydrated europium salt was found to act not only as a solvent here, but also as the bridge to form hydrogen bonding between coordinated water molecules and PEO blocks, which played a key role in the reverse LLCs formation. Compared to those in aqueous solutions and solid state, the enhanced luminescence quantum yields and prolonged excited state lifetimes were observed in two europium containing reverse mesophases. The luminescence quenching effect of lanthanide ions was efficiently suppressed, probably due to the substitution of coordinated water molecules by oxyethyl groups of P123 and ordered phase structures of LLCs, where the coordinated europium ions were confined and isolated by PEO blocks. The optimum luminescence performance was then found to exist in the reverse hexagonal phase. The obtained results on such lanthanide-induced reverse LLCs should be referable for designing new luminescent soft materials construction to expand their application fields.

  1. How Do Radionuclides Accumulate in Marine Organisms? A Case Study of Europium with Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Shuh, David K; Minasian, Stefan G; Pacold, Joseph I; Solari, Pier-Lorenzo; Michel, Hervé; Oberhaensli, François R; Bottein, Yasmine; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2016-10-04

    In the ocean, complex interactions between natural and anthropogenic radionuclides, seawater, and diverse marine biota provide a unique window through which to examine ecosystem and trophic transfer mechanisms in cases of accidental dissemination. The nature of interaction between radionuclides, the marine environment, and marine species is therefore essential for better understanding transfer mechanisms from the hydrosphere to the biosphere. Although data pertaining to the rate of global transfer are often available, little is known regarding the mechanism of environmental transport and uptake of heavy radionuclides by marine species. Among marine species, sponges are immobile active filter feeders and have been identified as hyperaccumulators of several heavy metals. We have selected the Mediterranean sponge Aplysina cavernicola as a model species for this study. Actinide elements are not the only source of radioactive release in cases of civilian nuclear events; however, their physicochemical transfer mechanisms to marine species remain largely unknown. We have targeted europium(III) as a representative of the trivalent actinides such as americium or curium. To unravel biological uptake mechanisms of europium in A. cavernicola, we have combined radiometric (γ) measurements with spectroscopic (time-resolved laser-induced fluorescence spectroscopy, TRLIFS, and X-ray absorption near-edge structure, XANES) and imaging (transmission electron microscopy, TEM, and scanning transmission X-ray microscopy, STXM) techniques. We have observed that the colloids of NaEu(CO3)2·nH2O formed in seawater are taken up by A. cavernicola with no evidence that lethal dose has been reached in our working conditions. Spectroscopic results suggest that there is no change of speciation during uptake. Finally, TEM and STXM images recorded at different locations across a sponge cross section, together with differential cell separation, indicate the presence of europium particles (around

  2. Trace electrochemical analysis of Europium, Ytterbium, and Cerium at their joint presence in solution

    Directory of Open Access Journals (Sweden)

    Rema Matakova

    2012-03-01

    Full Text Available In the course of several decades at the department of analytical chemistry and chemistry of rare elements there were studied the electrode processes with participation of rare-earth metals (REM in accordance with the long awaiting problem of the development of rare-metal and rare-earth branch of non-ferrous metallurgy of Kazakhstan. With the aim of express and highly sensitive analytical control of raw materials and final product of rare-earth industry there were developed the methods of inversion-voltamperometric determination of low concentrations of europium, ytterbium and cerium under the conditions of their individual and combined presence in the solution.

  3. Synergistic extraction of europium and americium into nitrobenzene by using hydrogen dicarbollylcobaltate and dodecaethylene glycol.

    Science.gov (United States)

    Makrlík, Emanuel; Vaňura, Petr; Selucký, Pavel

    2013-01-01

    Extraction of microamounts of europium and americium by a nitrobenzene solution of hydrogen dicarbollylcobaltate (H+B-) in the presence of dodecaethylene glycol (DDEG, L) has been investigated. The equilibrium data have been explained assuming that the species HL+, H2L2+, ML3+ and MH-1L2+ (M3+ = Eu3+, Am3+; L = DDEG) are extracted into the organic phase. The values of extraction and stability constants of the complex species in nitrobenzene saturated with water have been determined. It was found that in this nitrobenzene medium, the stability constant of the EuL3+ complex is comparable with that of AmL3+.

  4. Red/blue electroluminescence from europium-doped organic light emitting diodes

    Science.gov (United States)

    Hagen, Joshua A.; Li, Wayne X.; Grote, James G.; Steckl, Andrew J.

    2006-02-01

    Red/Blue emitting organic light emitting diodes (OLED) devices have been obtained using a Europium-doped organic emitting layer (NPB:Eu). The Eu-doped OLEDs emit in 2 color ranges: a broad blue (~420-500nm) band due to NPB emission and a narrow red peak at 620nm due to Eu emission. The red/blue devices achieve a brightness ~13x more intense than a similarly structured green (Alq 3) emitting OLED. These NPB:Eu emitting structures also reach a maximum efficiency of 0.2 cd/A at brightnesses above 100 cd/m2.

  5. Test of zircon materials for sorption of europium; Pruebas de materiales circoniferos para sorcion de europio

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Fernandez V, S.M.; Garcia R, G. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2003-07-01

    In previous works it has already been made notice that some phosphates have the property of sipping radioactive metals in solution, what takes advantage to fabricate reactive barriers that are placed in the repositories of nuclear wastes. In our laboratory it has been obtained to the zirconium silicate (ZrSiO{sub 4}) and the alpha zirconium hydrogen phosphate (Zr(HPO{sub 4}) 2H{sub 2}0) starting from sea sand in an easy and economic way. With the interest of knowing if these compounds can be used in contention barriers the evaluation of their surface properties it is made and of europium sorption. (Author)

  6. Sol-Gel Synthesis, X-Ray Diffraction Studies, and Electric Conductivity of Sodium Europium Silicate

    Directory of Open Access Journals (Sweden)

    Ekaterina V. Borisova

    2013-01-01

    Full Text Available Sodium europium silicate, NaEu9(SiO46O2, with apatite structure has been obtained and studied using X-ray diffraction and SEM. It has been shown that sodium sublimation does not take place upon synthesis by the sol-gel method. Rietveld refinement has revealed that sodium atoms are ordered and occupy the 4f position. O(4 atoms not related to silicate ions are placed at the centers of Eu(2 triangles. DC and AC electric conductivity and activation energy have been determined for the compound studied.

  7. New Class of Bright and Highly Stable Chiral Cyclen Europium Complexes for Circularly Polarized Luminescence Applications.

    Science.gov (United States)

    Dai, Lixiong; Lo, Wai-Sum; Coates, Ian D; Pal, Robert; Law, Ga-Lai

    2016-09-06

    High glum values of +0.30 (ΔJ = 1, 591 nm, in DMSO) and -0.23 (ΔJ = 1, 589 nm, in H2O) were recorded in our series of newly designed macrocyclic europium(III) complexes. A sterically locking approach involving a bidentate chromophore is adopted to control the formation of one stereoisomer, giving rise to extreme rigidity, high stability, and high emission intensity. The combination of a chiral substituent on a macrocyclic chelate for lanthanide ions opens up new perspectives for the further development of circulary polarized luminescent chiral tags in optical and bioapplications.

  8. A microemulsion preparation of nanoparticles of europium in silica with luminescence enhancement using silver

    Science.gov (United States)

    Ma, Zhi Ya; Dosev, Dosi; Kennedy, Ian M

    2010-01-01

    A facile one-pot microemulsion method has been developed for the synthesis of spherical silver core–silica shell (Ag@SiO2) nanoparticles with europium chelates doped in the shell through a silane agent. The method is significantly more straightforward than other extant methods. Measurements of the luminescent emissions from the Ag@SiO2 nanoparticles, in comparison with control silica nanoparticles without silver cores, showed that the presence of the silver cores can increase the fluorescence intensity approximately 24-fold and decrease the luminescence lifetime. This enhancement offers a potential increase in overall particle detectability with increased fluorophore photostability. PMID:19417456

  9. Metal Controlled Diastereoselective Self-assembly and Circularly Polarized Luminescence of a Chiral Heptanuclear Europium Wheel

    Science.gov (United States)

    Bozoklu, Gülay; Gateau, Christelle; Imbert, Daniel; Pécaut, Jacques; Robeyns, Koen; Filinchuk, Yaroslav; Memon, Farah; Muller, Gilles

    2012-01-01

    The chiral dissymmetric tetradentate ligand SPhbipox (6’-(4-phenyloxazolin-2-yl)-2,2’-bipyridine-6-carboxylic acid) leads to the diastereoselective assembly of a homochiral Eu(III) triangle and of a highly emissive (QY=27%) heptanuclear wheel which is the largest example of chiral luminescent complex of Eu(III) reported to date. We show that the nuclearity of the assembly is controlled by the solvent and the europium cation. All the compounds show large circularly polarized luminescence with an activity which varies with the nature of the assembly (highest for the homochiral trimer). PMID:22548280

  10. A europium(III)-based PARACEST agent for sensing singlet oxygen by MRI

    Science.gov (United States)

    Song, Bo; Wu, Yunkou; Yu, Mengxiao; Zhao, Piyu; Zhou, Cheng; Kiefer, Garry E.

    2013-01-01

    A europium (III) DOTA-tetraamide complex was designed as a MRI sensor of singlet oxygen (1O2). The water soluble, thermodynamically stable complex reacts rapidly with 1O2 to form an endoperoxide derivative that results in an ∼3 ppm shift in the position of the Eu(III)-bound water chemical exchange saturation transfer (CEST) peak. The potential of using this probe to detect accumulation of the endoperoxide derivative in biological media by ratiometric CEST imaging was demonstrated. PMID:23575743

  11. Closure report for underground storage tank 161-R1U1 and its associated underground piping

    Energy Technology Data Exchange (ETDEWEB)

    Mallon, B.J.; Blake, R.G.

    1994-05-01

    Underground storage tank (UST) 161-31 R at the Lawrence Livermore National Laboratory (LLNL) was registered with the State Water Resources Control Board on June 27, 1984. UST 161-31R was subsequently renamed UST 161-R1U1 (Fig. A-1, Appendix A). UST 161-R1U1 was installed in 1976, and had a capacity of 383 gallons. This tank system consisted of a fiberglass reinforced plastic tank, approximately 320 feet of polyvinyl chloride (PVC) underground piping from Building 161, and approximately 40 feet of PVC underground piping from Building 160. The underground piping connected laboratory drains and sinks inside Buildings 160 and 161 to UST 161-R1U1. The wastewater collected in UST 161-R1U1, contained organic solvents, metals, inorganic acids, and radionuclides, most of which was produced within Building 161. On June 28, 1989, the UST 161-R1U1 piping system.around the perimeter of Building 161 failed a precision test performed by Gary Peters Enterprises (Appendix B). The 161-R1U1 tank system was removed from service after the precision test. In July 1989, additional hydrostatic tests and helium leak detection tests were performed (Appendix B) to determine the locations of the piping failures in the Building 161 piping system. The locations of the piping system failures are shown in Figure A-2 (Appendix A). On July 11, 1989, LLNL submitted an Unauthorized Release Report to Alameda County Department of Environmental Health (ACDEH), Appendix C.

  12. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M

    2004-11-30

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  13. Colloidal europium nanoparticles via a solvated metal atom dispersion approach and their surface enhanced Raman scattering studies.

    Science.gov (United States)

    Urumese, Ancila; Jenjeti, Ramesh Naidu; Sampath, S; Jagirdar, Balaji R

    2016-08-15

    Chemistry of lanthanide metals in their zerovalent state at the nanoscale remains unexplored due to the high chemical reactivity and difficulty in synthesizing nanoparticles by conventional reduction methods. In the present study, europium(0) nanoparticles, the most reactive of all the rare earth metals have been synthesized by solvated metal atom dispersion (SMAD) method using hexadecyl amine as the capping agent. The as-prepared europium nanoparticles show surface Plasmon resonance (SPR) band in the visible region of the electromagnetic spectrum. This lead to the investigation of its surface enhanced Raman scattering (SERS) using visible light excitation source. The SERS activity of europium nanoparticles has been followed using 4-aminothiophenol and biologically important molecules such as hemoglobin and Cyt-c as the analytes. This is the first example of lanthanide metal nanoparticles as SERS substrate which can possibly be extended to other rare-earth metals. Since hemoglobin absorbs in the visible region, the use of visible light excitation source leads to surface enhanced resonance Raman spectroscopy (SERRS). The interaction of biomolecules with Eu(0) has been followed using FT-IR and UV-visible spectroscopy techniques. The results indicate that there is no major irreversible change in the structure of biomolecules upon interaction with europium nanoparticles. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Rapid screening of oxytetracycline residue in catfish muscle by dispersive liquid-liquid microextraction and europium-sensitized luminescence

    Science.gov (United States)

    Oxytetracycline (OTC) residue in catfish muscle was screened by dispersive liquid-liquid microextraction (DLLME) and europium-sensitized luminescence (ESL). After extraction in EDTA, HCl, and acetonitrile, cleanup was carried out by DLLME, and ESL was measured at microgram = 385 nm and wavelength = ...

  15. Luminescence variations in europium-doped silicon-substituted hydroxyapatite nanobiophosphor via three different methods

    Energy Technology Data Exchange (ETDEWEB)

    Thang, Cao Xuan; Pham, Vuong-Hung, E-mail: vuong.phamhung@hust.edu.vn

    2015-07-15

    Highlights: • Europium doped silicon-substituted hydroxyapatite was synthesized by wet chemical synthesis method. • Morphology of nanoparticles depended on the synthesized method. • Photoluminescence intensity of the sample increases with the increasing of Si substitutions, Eu dopants and thermal annealing. - Abstract: This paper reports the first attempt for the synthesis of europium-doped Si-substituted hydroxyapatite (HA) nanostructure to achieve strong and stable luminescence of nanobiophosphor, particularly, by addition of different Eu dopants, Si substitutions, and application of optimum annealing temperatures of up to 1000 °C. The nanobiophosphor was synthesized by the coprecipitation, microwave, and hydrothermal methods. The nanoparticles demonstrated a nanowire to a spindle-like morphology, which was dependent on the method of synthesis. The photoluminescence (PL) intensity of the sample increases with the increase in Si substitutions and Eu dopants. The luminescent nanoparticles also showed the typical luminescence of Eu{sup 3+} centered at 610 nm, which was more efficient for the annealed Eu-doped Si-HA nanoparticles than for the as-synthesized nanoparticles. Among the different synthesis methods, the hydrothermal method reveals the best light emission represented by high PL intensity and narrow PL spectra. These results suggest the potential application of Eu-doped Si-HA in stable and biocompatible nanophosphors for light emission and nanomedicine.

  16. Resonance ionization spectroscopy of Europium The first application of the PISA at ISOLDE-RILIS

    CERN Document Server

    AUTHOR|(CDS)2099873; Marsh, Bruce Alan

    The following work has been carried out at the radioactive ion beam facility ISOLDE at CERN. A compact atomic beam unit named PISA (Photo Ionization Spectroscopy Apparatus) has been implemented as a recent addition to the laboratory of the Resonance Ionization Laser Ion Source (RILIS). The scope of this thesis work was to demonstrate different applications of the PISA, using the existing and highly developed laser setup of the RILIS installation. In a demonstration of the suitability of PISA for ionization scheme development, a new ionization scheme for Europium has been developed. This resulted in the observation of several new autoionizing states and Rydberg series. Through the analysis of the observed Rydberg resonances a refined value of $45734.33(3)(3)$ cm$^{-1}$ for the ionization potential of the europium atom has been determined. In addition this thesis reports on the feasibility of the use of the PISA as a RILIS performance monitoring device during laser ion source operations. Finally the present wor...

  17. Structural and electrical properties of the europium-doped indium zinc oxide thin film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Ting, Chu-Chi, E-mail: ccting@ccu.edu.tw [Graduate Institute of Opto-Mechatronics Engineering, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China); Advanced Institute for Manufacturing with High-Tech Innovations, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China); Li, Wei-Yang; Wang, Ching-Hua; Yong, Hua-En [Graduate Institute of Opto-Mechatronics Engineering, National Chung Cheng University, 168 University Rd., Min-Hsiung, Chia-Yi, Taiwan, ROC (China)

    2014-07-01

    The EuInZnO (EIZO) thin film transistor (TFT) devices were fabricated by the sol–gel spin-coating technique. The EIZO TFT operates in the n-channel depletion mode and exhibits a well-defined pinch-off and saturation region. Because europium ion possesses lower electronegativity (1.2) and standard electrode potential (− 1.991 V), it can act as the carrier suppressor to reduce the carrier concentrations of the IZO (In:Zn = 1:1) thin film. Eu{sup 3+} (13 mol%)-doped IZO TFT possesses the optimum performance, and its field-effect mobility in the saturated regime, threshold voltage, on–off ratio, and S-factor are 1.23 cm{sup 2}/Vs, 3.28 V, 1.07 × 10{sup 6}, and 2.28 V/decade, respectively. - Highlights: • Europium ions can act as the carrier suppressor in the InZnO system. • The EuInZnO forms an n-channel material for the thin film transistor (TFT) device. • The optimum performance of the EuInZnO TFT is the sample with 13 mol% Eu{sup 3+} doping.

  18. Europium phosphomolybdate and osmium metallopolymer multi-functional LbL films: redox and electrocatalytic properties.

    Science.gov (United States)

    Fernandes, Diana M; Vos, Johannes G; Freire, Cristina

    2014-04-15

    Hybrid multilayer films composed by osmium metallopolymer [Os(bpy)2(PVP)10Cl]Cl (Os-poly) and europium phosphomolybdate, K₁₁[Eu(III)(PMo₁₁O₃₉)₂] (Eu(PMo11)2), were prepared using the electrostatic layer-by-layer (LbL) self-assembly method. The film build-up, monitored by electronic spectroscopy, showed a regular stepwise growth indicating a strong interaction between layers. The XPS measurements corroborated the successful fabrication of the hybrid films with the Os-poly/Eu(PMo11)2 composition. SEM images revealed a completely covered surface with a highly roughened texture. Electrochemical characterisation of films by cyclic voltammetry revealed three Mo-based reduction processes (Mo(VI)→Mo(V)) in the potential range between -0.4 and 0.1 V and one Os reduction process (Os(III)→Os(II)) at ≈0.270 V. The cyclic voltammograms of two electroactive probes, [Fe(CN)₆](3-/4-) and [Ru(NH₃)₆](3+/2+) on {Os-poly/Eu(PMo11)2}n modified electrodes revealed redox mediation between film and the probes. Furthermore, the {Os-poly/Eu(PMo11)2}n multilayer films also showed excellent Mo-based electrocatalytic activity towards reduction of nitrite and iodate, confirming the multi-functional properties of the hybrid europium phosphomolybdate - osmium metallopolymer LbL films. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

    2013-02-15

    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  20. pH-controlled delivery of luminescent europium coated nanoparticles into platelets

    Science.gov (United States)

    Davies, Amy; Lewis, David J.; Watson, Stephen P.; Thomas, Steven G.; Pikramenou, Zoe

    2012-01-01

    Water soluble, luminescent gold nanoparticles are delivered into human platelets via a rapid, pH-controlled mechanism using a pH low insertion peptide, pHLIP. The approach introduces cocoating of gold nanoparticles with a europium luminescent complex, EuL and the pHLIP peptide to give pHLIP•EuL•Au. The 13-nm diameter gold nanoparticles act as a scaffold for the attachment of both the luminescent probe and the peptide to target delivery. Their size allows delivery of approximately 640 lanthanide probes per nanoparticle to be internalized in human platelets, which are not susceptible to transfection or microinjection. The internalization of pHLIP•EuL•Au in platelets, which takes just minutes, was studied with a variety of imaging modalities including luminescence, confocal reflection, and transmission electron microscopy. The results show that pHLIP•EuL•Au only enters the platelets in low pH conditions, pH 6.5, mediated by the pHLIP translocation across the membrane, and not at pH 7.4. Luminescence microscopy images of the treated platelets show clearly the red luminescence signal from the europium probe and confocal reflection microscopy confirms the presence of the gold particles. Furthermore, transmission electron microscopy gives a detailed insight of the internalization and spatial localization of the gold nanoparticles in the platelets. Thus, we demonstrate the potential of the design to translocate multimodal nanoparticle probes into cells in a pH dependent manner. PMID:22308346

  1. Analysis of metal surfaces coated with europium-doped titanium dioxide by laser induced breakdown spectroscopy.

    Science.gov (United States)

    Głogocka, Daria; Noculak, Agnieszka; Pucińska, Joanna; Jopek, Wojciech; Podbielska, Halina; Langner, Marek; Przybyło, Magdalena

    2015-01-01

    The surface passivation with titanium sol-gel coatings is a frequently used technique to control the adsorption of selected biological macromolecules and to reduce the exposure of the bulk material to biological matter. Due to the increasing number of new coating-preparation methods and new gel compositions with various types of additives, the quality and homogeneity determination of the surface covering is a critical factor affecting performance of any implanted material. While coating thickness is easy to determine, the homogeneity of the surface distribution of coating materials requires more elaborate methodologies. In the paper, the laser induced breakdown spectroscopy (LIBS) based method, capable to quantitate the homogeneity and uniformity of the europium in titanium dioxide sol-gel coatings on stainless steel surfaces prepared with two different procedures: spin-coating and dip-coating, is presented. The emission intensity of titanium has been used to determine the coating thickness whereas the relative values of europium and titanium emission intensities provide data on the coating homogeneity. The obtained results show that the spin-coating technique provides better surface coverage with titanium dioxide. However, when the surface coating compositions were compared the dip-coating technique was more reliable.

  2. Europium(III) Macrocyclic Complexes with Alcohol Pendant Groups as Chemical Exchange Saturation Transfer Agents

    Science.gov (United States)

    Woods, Mark; Woessner, Donald E.; Zhao, Piyu; Pasha, Azhar; Yang, Meng-Yin; Huang, Ching-Hui; Vasalitiy, Olga; Morrow, Janet R.; Sherry, A. Dean

    2009-01-01

    Paramagnetic lanthanide(III) complexes that contain hyperfine-shifted exchangeable protons offer considerable advantages over diamagnetic molecules as chemical exchange saturation transfer (CEST) agents for MRI. As part of a program to investigate avenues to improve the sensitivity of such agents, the CEST characteristics of europium(III) macrocyclic complexes having appended hydroxyethyl groups were investigated. The CEST spectrum of the asymmetrical complex, EuCNPHC3+, shows five distinct peaks for each magnetically nonequivalent exchangeable proton in the molecule. The CEST spectra of this complex were fitted to NMR Bloch theory to yield exchange rates between each of six exchanging proton pools (five on the agent plus bulk water). Exchange between the Eu3+-bound hydroxyl protons and bulk water protons was slow in dry acetonitrile but accelerated incrementally upon stepwise addition of water. In pure water, exchange was too fast to observe a CEST effect. The utility of this class of europium(III) complex for CEST imaging applications is ultimately limited by the small chemical shifts induced by the hydroxyl-appended ligands of this type and the resulting small Δω values for the exchangeable hydroxyl protons. PMID:16881645

  3. Red light emission from europium doped zinc sodium bismuth borate glasses

    Science.gov (United States)

    Hegde, Vinod; Viswanath, C. S. Dwaraka; Upadhyaya, Vyasa; Mahato, K. K.; Kamath, Sudha D.

    2017-12-01

    Zinc sodium bismuth borate (ZNBB) glasses doped with different concentrations of europium were prepared by conventional melt quenching method and characterized through the measurements of density, refractive index, X-ray diffraction (XRD), Fourier Transform Infrared (FTIR) spectra, optical absorption, luminescence and radiative lifetimes. FTIR spectra showed seven characteristic peaks of bismuth and borate functional groups in the range of 400-1600 cm-1. The optical band gap and bonding parameters have been calculated from absorption spectra. Photoluminescence spectra recorded in the visible region with 394 nm excitation are used to calculate the Judd-Ofelt (JO) intensity parameters (Ω2 and Ω4). The JO intensity parameters have been used to calculate the radiative parameters such as branching ratio (β), stimulated emission cross-section (σse), transition probability (A) for the fluorescent level of 5D0→7F2. Decay rates through single exponential are used to calculate the lifetime (τm) of the meta-stable state 5D0 of (Eu3+ ion) these glasses. The radiative parameters measured for all these glasses show 0.7 mol% europium doped zinc sodium bismuth borate glass 5D0→7F2 transition has the potential for red laser applications. The quality of the colour emitted by the present glasses are estimated quantitatively by CIE chromaticity coordinates, which confirms the suitability of these glasses as a red emitting material for field emission technologies and LEDs.

  4. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities.

    Science.gov (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S

    2015-02-01

    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  5. Induced Europium Circularly Polarized Luminescence Monitors Reversible Drug Binding to Native α1 -Acid Glycoprotein.

    Science.gov (United States)

    Jennings, Laura; Waters, Ryan S; Pal, Robert; Parker, David

    2017-02-03

    Alpha-1-acid glycoprotein (α1 -AGP) is an important blood plasma glycoprotein. Following an acute-phase reaction such as stress, inflammation, burn, or infection, the bloodstream concentration of α1 -AGP can increase up to 400 % of its normal concentration. A wide range of drugs is known to bind α1 -AGP. Increased binding of pharmacologically active compounds to α1 -AGP moderates their clinical effect by decreasing the amount of unbound drug in the bloodstream. This has important clinical ramifications for such applications as the duration of anesthesia and in determining dosage for drug therapy. In this study, the competitive binding to α1 -AGP of a dynamically racemic europium(III) complex with seven pharmacologically active drugs absorbing in the range λ 250-290 nm was monitored by following changes in europium total emission and in induced circularly polarized luminescence (CPL). Binding affinities corresponding to Kd values in the range 0.5-100 μm were measured, in good agreement with published data. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Europium-doped amorphous calcium phosphate porous nanospheres: preparation and application as luminescent drug carriers

    Directory of Open Access Journals (Sweden)

    Zhang Kui-Hua

    2011-01-01

    Full Text Available Abstract Calcium phosphate is the most important inorganic constituent of biological tissues, and synthetic calcium phosphate has been widely used as biomaterials. In this study, a facile method has been developed for the fabrication of amorphous calcium phosphate (ACP/polylactide-block-monomethoxy(polyethyleneglycol hybrid nanoparticles and ACP porous nanospheres. Europium-doping is performed to enable photoluminescence (PL function of ACP porous nanospheres. A high specific surface area of the europium-doped ACP (Eu3+:ACP porous nanospheres is achieved (126.7 m2/g. PL properties of Eu3+:ACP porous nanospheres are investigated, and the most intense peak at 612 nm is observed at 5 mol% Eu3+ doping. In vitro cytotoxicity experiments indicate that the as-prepared Eu3+:ACP porous nanospheres are biocompatible. In vitro drug release experiments indicate that the ibuprofen-loaded Eu3+:ACP porous nanospheres show a slow and sustained drug release in simulated body fluid. We have found that the cumulative amount of released drug has a linear relationship with the natural logarithm of release time (ln(t. The Eu3+:ACP porous nanospheres are bioactive, and can transform to hydroxyapatite during drug release. The PL properties of drug-loaded nanocarriers before and after drug release are also investigated.

  7. 26 CFR 31.3121(b)(16)-1 - Services performed under share-farming arrangement.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 15 2010-04-01 2010-04-01 false Services performed under share-farming arrangement. 31.3121(b)(16)-1 Section 31.3121(b)(16)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT... Revenue Code of 1954) General Provisions § 31.3121(b)(16)-1 Services performed under share-farming...

  8. 20 CFR 702.161 - Liens against assets of insurance carriers and employers.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Liens against assets of insurance carriers and employers. 702.161 Section 702.161 Employees' Benefits EMPLOYMENT STANDARDS ADMINISTRATION... AND PROCEDURE General Provisions Liens on Compensation § 702.161 Liens against assets of insurance...

  9. 43 CFR 16.1 - Agreements to dispose of helium in natural gas.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Agreements to dispose of helium in natural gas. 16.1 Section 16.1 Public Lands: Interior Office of the Secretary of the Interior CONSERVATION OF HELIUM § 16.1 Agreements to dispose of helium in natural gas. (a) Pursuant to his authority and...

  10. 50 CFR 216.161 - Specified activity and incidental take levels by species.

    Science.gov (United States)

    2010-10-01

    ... levels by species. 216.161 Section 216.161 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE.... Atlantic Coast § 216.161 Specified activity and incidental take levels by species. (a) Regulations in this... species: Minke whale (Balaenoptera acutorostrata), dwarf sperm whale (Kogia simus); pygmy sperm whale (K...

  11. 22 CFR 161.9 - Specific steps in the Department's NEPA process.

    Science.gov (United States)

    2010-04-01

    ... identify those persons, community organizations, environmental interest groups, international organizations.... 161.9 Section 161.9 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION REGULATIONS FOR IMPLEMENTATION OF THE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) Environmental Review Procedures § 161.9 Specific...

  12. 33 CFR 161.60 - Vessel Traffic Service Prince William Sound.

    Science.gov (United States)

    2010-07-01

    ... William Sound. 161.60 Section 161.60 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Movement Reporting System Areas and Reporting Points § 161.60 Vessel Traffic Service Prince William Sound... Cape Hinchinbrook Light to Schooner Rock Light, comprising that portion of Prince William Sound between...

  13. 40 CFR 161.55 - Agricultural vs. non-agricultural pesticides.

    Science.gov (United States)

    2010-07-01

    ... pesticides. 161.55 Section 161.55 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES General Provisions § 161.55 Agricultural vs. non-agricultural pesticides. Section 25(a)(1) of FIFRA instructs the...

  14. "Rigid" Luminescent Soft Materials: Europium-Containing Lyotropic Liquid Crystals Based on Polyoxyethylene Phytosterols and Ionic Liquids.

    Science.gov (United States)

    Yi, Sijing; Wang, Jiao; Feng, Zhenyu; Chen, Xiao

    2017-10-05

    Soft materials of europium β-diketonate complexes constructed in lyotropic liquid crystals (LLCs) mediated by ionic liquids (ILs) are impressive for their excellent luminescence performance and stability. For the aim to further improve their mechanical processability and luminescent tunablility, the polyoxyethylene phytosterols (BPS-n) were introduced here as structure directing agents to prepare relatively "rigid" lamellar luminescent LLCs in 1-butyl-3-methyl-imidazolium hexafluorophosphate by doping europium β-diketonate complexes with different imidazolium counterions. As a result of the solvophobic sterol ring structure of BPS-n, the more effective isolation and confinement effects of europium complexes could be achieved. The longest fluorescence lifetime and the highest quantum efficiency reported so far for europium containing lyotropic organized soft materials were thus obtained. Changing the molecular structures of BPS-n with different oxyethylene chains or doped complexes with imidazolium counterions of different alkyl chain lengths, the spacings of lamellar LLC matrixes and position of dispersed complexes became tunable. The measured luminescent and rheological properties for such composite LLCs showed a dependence on the rigidity and isolation capability afforded by sterol molecules. It was also found that the increase of counterion alkyl chain length would weaken the LLC matrix's confinement and isolation effects and therefore exhibit the deteriorated luminescence performance. The enhanced luminescence efficiency and stability of doped BPS-n LLCs reflected the excellent segregation of europium complexes from each other and therefore the reduced self-quenching process. The obtained results here present the designability of LLC matrixes and their great potential to promote achieving the luminescence tunability of soft materials.

  15. Preparation and photoluminescence of some europium (III) ternary complexes with β-diketone and nitrogen heterocyclic ligands

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Dunjia, E-mail: dunjiawang@163.com; Pi, Yan; Zheng, Chunyang; Fan, Ling; Hu, Yanjun; Wei, Xianhong

    2013-10-15

    Highlights: •Preparation of europium (III) ternary complexes with β-diketone and nitrogen heterocyclic ligands. •Photoluminescence behavior of europium (III) ternary complexes. •Analysis of the Judd–Ofelt intensity parameters (Ω{sub t}), the lifetime (τ) and the luminescent quantum yield (η). -- Abstract: Preparation and photoluminescence behavior of four new europium (III) ternary complexes with β-diketones (1-(6-methoxy-naphthalen-2-yl)-3-phenyl-propane-1,3-dione (MNPPD) and 1-(4-tert-butyl-phenyl)-3-(6-methoxy-naphthalen-2-yl)-propane-1,3-dione (BPMPD)) and 2,2-dipyridine (Bipy) or 1,10-phenanthroline (Phen) were reported, in the solid state. Complexes Eu(MPPD){sub 3}·Bipy, Eu(BMPD){sub 3}·Bipy, Eu(MPPD){sub 3}·Phen and Eu(BMPD){sub 3}·Phen were characterized by elemental analysis, FT-IR, {sup 1}H NMR, UV–vis absorption. The emission spectra show narrow emission bands that arise from the {sup 5}D{sub 0} → {sup 7}F{sub J} (J = 0–4) transitions of the europium ion. Based on the emission spectra and luminescence decay curves in solid state, the intensity parameters (Ω{sub t}), lifetime (τ) and emission quantum efficiency (η) were determined. The Ω{sub 2} values indicate that the Eu(III) ion in these complexes is in a highly polarizable chemical environment. Complexes Eu(MPPD){sub 3}·Bipy and Eu(MPPD){sub 3}·Phen showed a longer lifetime (τ) and a higher luminescence quantum efficiency (η), which indicated that the energy transfer to the europium ion from MNPPD ligand is more efficient than that from BPMPD ligand.

  16. Luminescent method of determination of composition of europium and terbium complexes in solution by change of intensity ratio of luminescence bands

    Energy Technology Data Exchange (ETDEWEB)

    Bel' tyukova, S.V.; Nazarenko, N.A.; Poluehktov, N.S.

    1982-03-01

    The complexes of europium and terbium with phenanthroline, ethylenediaminetetraacetate, nitrilotriacetate, some acids-phenol derivatives and ..beta..-diketones series have been used as an example to demonstrate that the value of the ratio of intensities on the two bands of europium(terbium) luminescence spectra - the one corresponding to the hypersensitive'' transition and the other, to the magnetic dipole one - can be used for determination of the complexes composition in solutions.

  17. Syntheses and electroluminescent properties of two europium ternary complexes Eu(DBM){sub 3}(PBO) and Eu(DBM){sub 3}(PBT)

    Energy Technology Data Exchange (ETDEWEB)

    Guan Min [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China); Gao Lihua [Department of Chemistry, Beijing Normal University, Beijing 100875 (China); Wang Shanshan [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China); Huang Chunhui [State Key Laboratory of Rare Earth Materials Chemistry and Applications, Peking University, Beijing 100871 (China)], E-mail: chhuang@pku.edu.cn; Wang Kezhi [Department of Chemistry, Beijing Normal University, Beijing 100875 (China)

    2007-12-15

    Two europium complexes, Eu(DBM){sub 3}(PBO) and Eu(DBM){sub 3}(PBT) (DBM=dibenzoylmethanato, PBO=2-(2-pyridyl)benzoxazole, PBT=2-(2-pyridyl)benzothiazole), were prepared and used as emitting materials in organic electroluminescent (EL) devices. The devices with the structures ITO/TPD/Eu(DBM){sub 3}(PBO) (or Eu(DBM){sub 3}(PBT)/BCP/Alq{sub 3}/Mg:Ag/Ag emit red light originating from the europium complexes.

  18. Stability constants of europium complexes with a nitrogen heterocycle substituted methane-1,1-diphosphonic acid

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, M.P.; Rickert, P.G.; Schmidt, M.A.; Nash, K.L.

    1996-06-01

    Even in moderately acidic solutions ([H{sup +}] > 0.01 M), N-piperidinomethane-1,1-diphosphonic acid (H{sub 4}PMDPA) is a strong complexant of trivalent lanthanide ions that shows enhanced complex solubility over previously studied 1,1-diphosphonic acids. The protonation constants of PMDPA in 2.0 M H/NaClO{sub 4} were determined by potentiometric and NMR titrations, and the stability constants for formation of complexes with Eu{sup 3+} were determined by solvent extraction. Difference in protonation equilibria induced by addition of the nitrogen heterocycle results in an increase in the complexation strength of PMDPA. In solutions containing 0.1 M H{sup +} and ligand concentrations greater than 0.02 M, PMDPA is the most effective 1,1-diphosphonic acid for europium complexation studied thus far.

  19. Sorption of Europium in zirconium silicate; Sorcion de Europio en silicato de circonio

    Energy Technology Data Exchange (ETDEWEB)

    Garcia R, G. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)

    2004-07-01

    Some minerals have the property of sipping radioactive metals in solution, that it takes advantage to manufacture contention barriers that are placed in the repositories of nuclear wastes. The more recent investigations are focused in the development of new technologies guided to the sorption of alpha emissors on minerals which avoid their dispersion in the environment. In an effort to contribute to the understanding of this type of properties, some studies of sorption of Europium III are presented like homologous of the americium, on the surface of zirconium silicate (ZrSiO{sub 4}). In this work the results of sorption experiences are presented as well as the interpretation of the phenomena of the formation of species in the surface of the zirconium silicate. (Author)

  20. First principles description of the insulator-metal transition in europium monoxide

    KAUST Repository

    Wang, Hao

    2012-02-01

    Europium monoxide, EuO, is a ferromagnetic insulator. Its electronic structure under pressure and doping is investigated by means of density functional theory. We employ spin polarized electronic structure calculations including onsite electron-electron interaction for the localized Eu 4f and 5d electrons. Our results show that under pressure the ferromagnetism is stable, both for hydrostatic and uniaxial pressure, while the compound undergoes an insulator-metal transition. The insulator-metal transition in O deficient and Gd doped EuO is reproduced for an impurity concentration of 6.25%. A 10 monolayer thick EuO(1 0 0) thin film is predicted to be an insulator with a narrow band gap of 0.08 eV. © 2011 Elsevier B.V. All rights reserved.

  1. Development of europium doped BaSO4 TL OSL dual phosphor for radiation dosimetry applications

    Science.gov (United States)

    Patle, Anita; Patil, R. R.; Kulkarni, M. S.; Bhatt, B. C.; Moharil, S. V.

    2015-08-01

    This paper presents the results on the preparation and characterization of Europium-doped Barium sulfate (BaSO4: Eu) TL /OSL dual phosphor. The OSL sensitivity was found to be 11% of the commercially available Al2O3: C, using area integration method. The sample also shows good TL sensitivity and the dosimetric peak appears around 190°C with a shoulder at 282°C. After OSL readout, No change in the TL glow curve is observed. Since the observed TL peaks are not responsible for the observed OSL, good OSL as well as TL sensitivity and low fading will make this phosphor suitable for applications in radiation dosimetry using OSL as well as TL.

  2. Chemiluminescence determination of tetracyclines using Fenton system in the presence europium(III) ions

    Energy Technology Data Exchange (ETDEWEB)

    Kaczmarek, Malgorzata [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland); Lis, Stefan, E-mail: blis@amu.edu.pl [Department of Rare Earths, Faculty of Chemistry, Adam Mickiewicz University, Grunwaldzka 6, 60 - 780 Poznan (Poland)

    2009-04-20

    A new simple chemiluminescent method for the determination of chlortetracycline (Chlor-TC), oxytetracycline (Oxy-TC) and doxycycline (Doxy-TC) is described. This method is based on the europium(III) emission as a result of the energy transfer process from the excited product of the tetracyclines oxidation to the uncomplexed Eu(III). Under the optimum conditions, calibration graphs were obtained for 4 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Chlor-TC; 2 x 10{sup -7} to 2 x 10{sup -5} mol L{sup -1} of Oxy-TC and 1 x 10{sup -7} to 3 x 10{sup -5} mol L{sup -1} of Doxy-TC. The method was successfully applied to the determination of these drugs in pharmaceutical and veterinary formulation and honey.

  3. Europium-doped aluminum oxide phosphors as indicators for frontal polymerization dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Carranza, Arturo; Gewin, Mariah; Pojman, John A., E-mail: japojman@lsu.edu [Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803-1804 (United States)

    2014-06-15

    In this study, we present an inexpensive and practical method that allows the monitoring and visualization of front polymerization, propagation, and dynamics. Commercially available europium-doped aluminum oxide powders were combined with video imaging to visualize free-radical propagating polymer fronts. In order to demonstrate the applicability of this method, frontal copolymerization reactions of propoxylated glycerin triacrylate (EB53), pentaerythritol triacrylate (PETA), and pentaerythritol tetra-acrylate (PETEA) with 1,1-Bis(tert-butylperoxy)-3,3,5-trimethylcyclohexane (Luperox 231®) as an initiator were studied and compared to the results obtained by IR imaging. Systems exhibiting higher filler loading, higher EB53 content, and less acrylated monomers showed a marked decrease in front velocity, while those with more acrylated monomers and higher crosslinking density showed a marked increase in front velocity. Finally, in order to show the potential of the imaging technique, we studied fronts propagating in planar and spherical geometries.

  4. Europium-doped aluminum oxide phosphors as indicators for frontal polymerization dynamics.

    Science.gov (United States)

    Carranza, Arturo; Gewin, Mariah; Pojman, John A

    2014-06-01

    In this study, we present an inexpensive and practical method that allows the monitoring and visualization of front polymerization, propagation, and dynamics. Commercially available europium-doped aluminum oxide powders were combined with video imaging to visualize free-radical propagating polymer fronts. In order to demonstrate the applicability of this method, frontal copolymerization reactions of propoxylated glycerin triacrylate (EB53), pentaerythritol triacrylate (PETA), and pentaerythritol tetra-acrylate (PETEA) with 1,1-Bis(tert-butylperoxy)-3,3,5-trimethylcyclohexane (Luperox 231®) as an initiator were studied and compared to the results obtained by IR imaging. Systems exhibiting higher filler loading, higher EB53 content, and less acrylated monomers showed a marked decrease in front velocity, while those with more acrylated monomers and higher crosslinking density showed a marked increase in front velocity. Finally, in order to show the potential of the imaging technique, we studied fronts propagating in planar and spherical geometries.

  5. Electrochemiluminescence Study of Europium (III Complex with Coumarin3-Carboxylic Acid

    Directory of Open Access Journals (Sweden)

    Stefan Lis

    2008-01-01

    Full Text Available The europium (III complex of coumarin-3-carboxylic acid (C3CA has been prepared and characterized on the basis of elemental analysis, IR, and emission (photoluminescence and electrochemiluminescence spectroscopy. The synthesised complex having a formula Eu(C3CA2(NO3(H2O2 was photophysically characterized in solution and in the solid state. Electrochemiluminescence, ECL, of the system containing the Eu(III/C3CA complex was studied using an oxide-covered aluminium electrode. The goal of these studies was to show the possibility of the use of electrochemical excitation of the Eu(III ion in aqueous solution for emission generation. The generated ECL emission was very weak, and therefore its measurements and spectral analysis were carried out with the use of cut-off filters method. The studies proved a predominate role of the ligand-to-metal energy transfer (LMET in the generated ECL.

  6. Europium incorporated in silica matrix obtained by sol-gel: luminescent materials

    Directory of Open Access Journals (Sweden)

    Nassar Eduardo José

    2003-01-01

    Full Text Available In this work we report some aspects of the chemistry involved in the preparation of modified silicon oxide by the sol-gel process. Europium III compounds were used as luminescent probe. An organic-inorganic hybrid was obtained by hydrolysis of tetraethylorthosilicate (TEOS and 3-aminopropyltriethoxysilane (APTS. The Eu III compounds were added in different ways. In the first, silica was prepared in the presence of Eu III, and in the second, Eu III was added on the silica surface. These materials were studied by luminescence, infrared spectroscopy and termogravimetric analysis. The results obtained for the hybrid material show different behavior for Eu III emission, which could be excited by the antenna effect and the influence of the surrounding in the luminescence quenching. The thermogravimetric data present different mass loss in samples to range temperature 50 - 150 °C. Thermogravimetric and infrared spectra showed that inorganic polymers incorporated the organic part.

  7. Europium as an inhibitor of Amyloid-β(1-42) induced membrane permeation.

    Science.gov (United States)

    Williams, Thomas L; Urbanc, Brigita; Marshall, Karen E; Vadukul, Devkee M; Jenkins, A Toby A; Serpell, Louise C

    2015-10-24

    Soluble Amyloid-beta (Aβ) oligomers are a source of cytotoxicity in Alzheimer's disease (AD). The toxicity of Aβ oligomers may arise from their ability to interact with and disrupt cellular membranes mediated by GM1 ganglioside receptors within these membranes. Therefore, inhibition of Aβ-membrane interactions could provide a means of preventing the toxicity associated with Aβ. Here, using Surface Plasmon field-enhanced Fluorescence Spectroscopy, we determine that the lanthanide, Europium III chloride (Eu(3+)), strongly binds to GM1 ganglioside-containing membranes and prevents the interaction with Aβ42 leading to a loss of the peptides ability to cause membrane permeation. Here we discuss the molecular mechanism by which Eu(3+) inhibits Aβ42-membrane interactions and this may lead to protection of membrane integrity against Aβ42 induced toxicity. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Radiation effects on beta /10.6/ of pure and europium doped KCl

    Science.gov (United States)

    Grimes, H. H.; Maisel, J. E.; Hartford, R. H.

    1975-01-01

    Changes in the optical absorption coefficient as the result of X-ray and electron bombardment of pure monocrystalline and polycrystalline KCl and of divalent europium doped polycrystalline KCl were determined. A constant heat flow calorimetric method was used to measure the optical absorption coefficients. Both 300 kV X-ray irradiation and 2 MeV electron irradiation produced increases in the optical absorption coefficient at room temperature. X-ray irradiation produced more significant changes in pure monocrystalline KCl than equivalent amounts of electron irradiation. Electron irradiation of pure and Eu-doped polycrystalline KCl produced increases in the absorption by as much as a factor of 20 over untreated material. Bleaching of the electron-irradiated doped KCl with 649 millimicron light produced a further increase.

  9. Excitation functions for the formation of longer lived isotopes by deuteron irradiation of Europium

    Energy Technology Data Exchange (ETDEWEB)

    Takács, S., E-mail: stakacs@atomki.hu [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Hermanne, A.; Adam-Rebeles, R. [Cyclotron Laboratory, Vrije Universiteit Brussel, Brussels 1090 (Belgium); Takács, M.P. [Institute for Nuclear Research, Hungarian Academy of Sciences, 4026 Debrecen (Hungary); Institute of Physics, University of Debrecen, 4026 Debrecen (Hungary)

    2013-09-01

    Excitation functions for nuclear reactions induced on natural europium targets by energetic deuterons were studied up to 50 MeV. A standard stacked foil technique was used for irradiation and high resolution gamma spectrometry was applied for activity assessment. Direct or cumulative cross sections for reaction products with half-life longer than 2 h were determined. Reactions leading to the formation of the radionuclides {sup 147,149,151,153}Gd, {sup 147,148,149,150m,150g,152m,152g,154g}Eu, {sup 153}Sm and {sup 150}Pm were studied. In most cases no earlier data were available in the literature. The new experimental results were compared with values tabulated in the on-line TENDL2011 library.

  10. Quadrupole splitting and Eu partial lattice dynamics in europium orthophosphate EuPO {sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Klobes, B., E-mail: b.klobes@fz-juelich.de [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Arinicheva, Y., E-mail: y.arinicheva@fz-juelich.de; Neumeier, S., E-mail: s.neumeier@fz-juelich.de [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Simon, R. E., E-mail: r.simon@fz-juelich.de; Jafari, A., E-mail: a.jafari@fz-juelich.de [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany); Bosbach, D., E-mail: d.bosbach@fz-juelich.de [Forschungszentrum Jülich GmbH, Institute of Energy and Climate Research (IEK-6) Nuclear Waste Management and Reactor Safety (Germany); Hermann, R. P., E-mail: hermannrp@ornl.gov [JARA-FIT - Forschungszentrum Jülich GmbH, Jülich Centre for Neutron Science JCNS and Peter Grünberg Institute PGI (Germany)

    2016-12-15

    Hyperfine interactions in europium orthophosphate EuPO{sub 4} were investigated using {sup 151}Eu Mössbauer spectroscopy from 6 to 300 K. The value of the quadrupole splitting and the asymmetry parameter were refined and further substantiated by nuclear forward scattering data obtained at room temperature. The temperature dependence of the relative absorption was modeled with an Eu specific Debye temperature of 221(1) K. Eu partial lattice dynamics were probed by means of nuclear inelastic scattering and the mean force constant, the Lamb-Mössbauer factor, the internal energy, the vibrational entropy, the average phonon group velocity were calculated using the extracted density of phonon states. In general, Eu specific vibrations are characterized by rather small phonon energies and contribute strongly to the total entropy of the system. Although there is no classical Debye like behavior at low vibrational energies, the average phonon group velocity can be reasonably approximated using a linear fit.

  11. Photoluminescent polymer electrolyte based on agar and containing europium picrate for electrochemical devices

    Energy Technology Data Exchange (ETDEWEB)

    Lima, E. [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Raphael, E.; Sentanin, F. [IQSC, Universidade de Sao Paulo, 13566-590 Sao Carlos, SP (Brazil); Rodrigues, L.C. [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Ferreira, R.A.S.; Carlos, L.D. [Departamento de Fisica, CICECO, Universidade de Aveiro, 3810-193 Aveiro (Portugal); Silva, M.M., E-mail: nini@quimica.uminho.pt [Centro de Quimica, Universidade do Minho, Gualtar, 4710-057 Braga (Portugal); Pawlicka, A. [IQSC, Universidade de Sao Paulo, 13566-590 Sao Carlos, SP (Brazil)

    2012-04-15

    Highlights: Black-Right-Pointing-Pointer We prepared ionic conducting membranes for the specific requirements of the device. Black-Right-Pointing-Pointer Luminescent reporter groups, with many applications in biotechnology. Black-Right-Pointing-Pointer Thermal and electrochemical stability of electrolytes is adequate for application. - Abstract: Dispersion of photoluminescent rare earth metal complexes in polymer matrices is of great interest due to the possibility of avoiding the saturation of the photoluminescent signal. The possibility of using a natural ionic conducting polymer matrix was investigated in this study. Samples of agar-based electrolytes containing europium picrate were prepared and characterized by physical and chemical analyses. The FTIR spectra indicated strong interaction of agar O-H and 3,6-anhydro-galactose C-O groups with glycerol and europium picrate. The DSC analyses revealed no glass transition temperature of the samples in the -60 to 250 Degree-Sign C range. From the thermogravimetry (TG), a thermal stability of the samples of up to 180 Degree-Sign C was stated. The membranes were subjected to ionic conductivity measurement, which provided the values of 2.6 Multiplication-Sign 10{sup -6} S/cm for the samples with acetic acid and 1.6 Multiplication-Sign 10{sup -5} S/cm for the samples without acetic acid. Moreover, the temperature-dependent ionic conductivity measurements revealed both Arrhenius and VTF models of the conductivity depending on the sample. Surface visualization through scanning electron microscopy (SEM) demonstrated good uniformity. The samples were also applied in small electrochromic devices and showed good electrochemical stability. The present work confirmed that these materials may perform as satisfactory multifunctional component layers in the field of electrochemical devices.

  12. Spectroscopic investigation on europium doped heavy metal borate glasses for red luminescent application

    Energy Technology Data Exchange (ETDEWEB)

    Hegde, Vinod; Wagh, Akshatha; Kamath, Sudha D. [Manipal University, Department of Physics, Manipal Institute of Technology, Manipal (India); Hegde, Hemanth [Manipal University, Department of Chemistry, Manipal Institute of Technology, Manipal (India); Vishwanath, C.S.D. [Sri Venkateswara University, Department of Physics, Tirupati (India)

    2017-05-15

    The present study explores a new borate family glasses based on 10ZnO-5Na{sub 2}O-10Bi{sub 2}O{sub 3}-(75 - x) B{sub 2}O{sub 3}-xEu{sub 2}O{sub 3} (x = 0, 0.1, 0.5, 1, 1.5, 2, 3 mol%) composition, synthesized by rapid melt quench technique. Prepared glasses were subjected to the density and refractive index measurements and their values were used to calculate other physical properties of the glass matrix as a function of Eu{sup 3+} concentration. XRD confirmed amorphous nature of the glasses. FTIR spectra in the absorption mode were recorded in the 400-4000 cm{sup -1} region to identify different functional groups in the glass matrix. Deconvoluted FTIR spectra showed increase in BO{sub 4} units with rise in europium content which confirmed the 'network strengthener' role of europium ions by creating bridging oxygens (BOs). Optical properties were investigated for their luminescence behavior through various spectroscopic techniques such as UV-Vis-NIR absorption, excitation, emission, decay profiles, and color measurements at room temperature. Lasing properties of the glasses like total radiative life time, branching ratio, emission cross section, and optical gain were obtained from the calculated Judd-Ofelt (Ω{sub 2},Ω{sub 4}) intensity parameters. From the measured values of emission, cross sections, branching ratios, life times, strong photoluminescence features, and CIE chromaticity coordinates, 0.5 mol% of Eu{sup 3+} ions doped ZnNaBiB glasses showed optimum performance and are potential candidate for red light generation at 613 nm. (orig.)

  13. Europium nanoparticle-based high performing immunoassay for the screening of treponemal antibodies.

    Directory of Open Access Journals (Sweden)

    Sheikh M Talha

    Full Text Available Treponema pallidum subspecies pallidum (Tp is the causative agent of syphilis which mainly spreads through sexual contact, blood transfusion and perinatal route. In order to curtail the spread of the infection and to clinically manage the disease, timely, accurate and reliable diagnosis is very important. We have developed an immunoassay for the detection of treponemal antibodies in human serum or plasma samples. In vivo biotinylated and non-biotinylated versions of the recombinant antigen were designed by the fusion of three Tp-specific antigens namely Tp15, Tp17 and Tp47. These fusion antigens were expressed in E. coli and purified using single-step metal affinity chromatography. Biotinylated fusion antigen immobilized on streptavidin coated plate was used to capture the treponemal antibodies and the non-biotinylated antigen coated on europium nanoparticles was used as tracer. Assays with two different incubation times of 10 min and 1 h were developed, and following the incubation the europium fluorescence was measured using time-resolved fluorometry. The developed time-resolved fluorometric (TRF immunoassays were evaluated with in-house and commercial serum/plasma sample panels. For well-established treponemal antibodies positive or negative samples, the sensitivity of TRF immunoassay with 10 min incubation time was 97.4%, and of TRF immunoassay with 1 h incubation time was 98.7%, and the specificities of both the TRF immunoassays were 99.2%. For the samples with discordant results with the reference assays, both the TRF immunoassays showed better specificity than the Enzygnost syphilis enzyme immunoassay as a screening test. The two different incubation times did not have any significant effect on the signal to cutoff (S/Co ratios obtained with the two immunoassays (p=0.06. Our results indicate that the developed immunoassay with a short incubation time of 10 min has the potential to be used in clinical laboratories and in blood

  14. Visible-light-excited and europium-emissive nanoparticles for highly-luminescent bioimaging in vivo.

    Science.gov (United States)

    Wu, Yongquan; Shi, Mei; Zhao, Lingzhi; Feng, Wei; Li, Fuyou; Huang, Chunhui

    2014-07-01

    Europium(III)-based material showing special milliseconds photoluminescence lifetime has been considered as an ideal time-gated luminescence probe for bioimaging, but is still limited in application in luminescent small-animal bioimaging in vivo. Here, a water-soluble, stable, highly-luminescent nanosystem, Ir-Eu-MSN (MSN = mesoporous silica nanoparticles, Ir-Eu = [Ir(dfppy)2(pic-OH)]3Eu·2H2O, dfppy = 2-(2,4-difluorophenyl)pyridine, pic-OH = 3-hydroxy-2-carboxypyridine), was developed by an in situ coordination reaction to form an insoluble dinuclear iridium(III) complex-sensitized-europium(III) emissive complex within mesoporous silica nanoparticles (MSNs) which had high loading efficiency. Compared with the usual approach of physical adsorption, this in-situ reaction strategy provided 20-fold the loading efficiency (43.2%) of the insoluble Ir-Eu complex in MSNs. These nanoparticles in solid state showed bright red luminescence with high quantum yield of 55.2%, and the excitation window extended up to 470 nm. These Ir-Eu-MSN nanoparticles were used for luminescence imaging in living cells under excitation at 458 nm with confocal microscopy, which was confirmed by flow cytometry. Furthermore, the Ir-Eu-MSN nanoparticles were successfully applied into high-contrast luminescent lymphatic imaging in vivo under low power density excitation of 5 mW cm(-2). This synthetic method provides a universal strategy of combining hydrophobic complexes with hydrophilic MSNs for in vivo bioimaging. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Europium Nanoparticle-Based High Performing Immunoassay for the Screening of Treponemal Antibodies

    Science.gov (United States)

    Talha, Sheikh M.; Hytönen, Jukka; Westhorpe, Adam; Kumar, Sushil; Khanna, Navin; Pettersson, Kim

    2013-01-01

    Treponema pallidum subspecies pallidum (Tp) is the causative agent of syphilis which mainly spreads through sexual contact, blood transfusion and perinatal route. In order to curtail the spread of the infection and to clinically manage the disease, timely, accurate and reliable diagnosis is very important. We have developed an immunoassay for the detection of treponemal antibodies in human serum or plasma samples. In vivo biotinylated and non-biotinylated versions of the recombinant antigen were designed by the fusion of three Tp-specific antigens namely Tp15, Tp17 and Tp47. These fusion antigens were expressed in E. coli and purified using single-step metal affinity chromatography. Biotinylated fusion antigen immobilized on streptavidin coated plate was used to capture the treponemal antibodies and the non-biotinylated antigen coated on europium nanoparticles was used as tracer. Assays with two different incubation times of 10 min and 1 h were developed, and following the incubation the europium fluorescence was measured using time-resolved fluorometry. The developed time-resolved fluorometric (TRF) immunoassays were evaluated with in-house and commercial serum/plasma sample panels. For well-established treponemal antibodies positive or negative samples, the sensitivity of TRF immunoassay with 10 min incubation time was 97.4%, and of TRF immunoassay with 1 h incubation time was 98.7%, and the specificities of both the TRF immunoassays were 99.2%. For the samples with discordant results with the reference assays, both the TRF immunoassays showed better specificity than the Enzygnost syphilis enzyme immunoassay as a screening test. The two different incubation times did not have any significant effect on the signal to cutoff (S/Co) ratios obtained with the two immunoassays (p = 0.06). Our results indicate that the developed immunoassay with a short incubation time of 10 min has the potential to be used in clinical laboratories and in blood-bank settings as a

  16. Semiconducting polymer encapsulated mesoporous silica particles with conjugated Europium complexes: toward enhanced luminescence under aqueous conditions.

    Science.gov (United States)

    Zhang, Jixi; Prabhakar, Neeraj; Näreoja, Tuomas; Rosenholm, Jessica M

    2014-01-01

    Immobilization of lanthanide organic complexes in meso-organized hybrid materials for luminescence applications have attracted immense interest due to the possibility of controlled segregation at the nanoscopic level for novel optical properties. Aimed at enhancing the luminescence intensity and stability of the hybrid materials in aqueous media, we developed polyvinylpyrrolidone (PVP) stabilized, semiconducting polymer (poly(9-vinylcarbazole), PVK) encapsulated mesoporous silica hybrid particles grafted with Europium(III) complexes. Monosilylated β-diketonate ligands (1-(2-naphthoyl)-3,3,3-trifluoroacetonate, NTA) were first co-condensed in the mesoporous silica particles as pendent groups for bridging and anchoring the lanthanide complexes, resulting in particles with an mean diameter of ∼ 450 nm and a bimodal pore size distribution centered at 3.5 and 5.3 nm. PVK was encapsulated on the resulted particles by a solvent-induced surface precipitation process, in order to seal the mesopores and protect Europium ions from luminescence quenching by producing a hydrophobic environment. The obtained polymer encapsulated MSN-EuLC@PVK-PVP particles exhibit significantly higher intrinsic quantum yield (Φ(Ln) = 39%) and longer lifetime (τ(obs) = 0.51 ms), as compared with those without polymer encapsulation. Most importantly, a high luminescence stability was realized when MSN-EuLC@PVK-PVP particles were dispersed in various aqueous media, showing no noticeable quenching effect. The beneficial features and positive attributes of both mesoporous silica and semiconducting polymers as lanthanide-complex host were merged in a single hybrid carrier, opening up the possibility of using these hybrid luminescent materials under complex aqueous conditions such as biological/physiological environments.

  17. Surface-imprinted nanofilaments for europium-amplified luminescent detection of fluoroquinolone antibiotics.

    Science.gov (United States)

    Zdunek, Jolanta; Benito-Peña, Elena; Linares, Ana; Falcimaigne-Cordin, Aude; Orellana, Guillermo; Haupt, Karsten; Moreno-Bondi, María C

    2013-07-29

    The development and characterization of novel, molecularly imprinted polymer nanofilament-based optical sensors for the analysis of enrofloxacin, an antibiotic widely used for human and veterinary applications, is reported. The polymers were prepared by nanomolding in porous alumina by using enrofloxacin as the template. The antibiotic was covalently immobilized on to the pore walls of the alumina by using different spacers, and the prepolymerization mixture was cast in the pores and the polymer synthesized anchored onto a glass support through UV polymerization. Various parameters affecting polymer selectivity were evaluated to achieve optimal recognition, namely, the spacer arm length and the binding solvent. The results of morphological characterization, binding kinetics, and selectivity of the optimized polymer material for ENR and its derivatives are reported. For sensing purposes, the nanofilaments were incubated in solutions of the target molecule in acetonitrile/HEPES buffer (100 mM, pH 7.5, 50:50, v/v) for 20 min followed by incubation in a 10 mM solution of europium(III) ions to generate a europium(III)-enrofloxacin complex on the polymer surface. The detection event was based on the luminescence of the rare-earth ion (λexc=340 nm; λem=612 nm) that results from energy transfer from the antibiotic excited state to the metal-ion emitting excited state. The limit of detection of the enrofloxacin antibiotic was found to be 0.58 μM. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Faster Synthesis of Beta-Diketonate Ternary Europium Complexes: Elapsed Times & Reaction Yields.

    Science.gov (United States)

    Lima, Nathalia B D; Silva, Anderson I S; Gerson, P C; Gonçalves, Simone M C; Simas, Alfredo M

    2015-01-01

    β-diketonates are customary bidentate ligands in highly luminescent ternary europium complexes, such as Eu(β-diketonate)3(L)2, where L stands for a nonionic ligand. Usually, the syntheses of these complexes start by adding, to an europium salt such as EuCl3(H2O)6, three equivalents of β-diketonate ligands to form the complexes Eu(β-diketonate)3(H2O)2. The nonionic ligands are subsequently added to form the target complexes Eu(β-diketonate)3(L)2. However, the Eu(β-diketonate)3(H2O)2 intermediates are frequently both difficult and slow to purify by recrystallization, a step which usually takes a long time, varying from days to several weeks, depending on the chosen β-diketonate. In this article, we advance a novel synthetic technique which does not use Eu(β-diketonate)3(H2O)2 as an intermediate. Instead, we start by adding 4 equivalents of a monodentate nonionic ligand L straight to EuCl3(H2O)6 to form a new intermediate: EuCl3(L)4(H2O)n, with n being either 3 or 4. The advantage is that these intermediates can now be easily, quickly, and efficiently purified. The β-diketonates are then carefully added to this intermediate to form the target complexes Eu(β-diketonate)3(L)2. For the cases studied, the 20-day average elapsed time reduced to 10 days for the faster synthesis, together with an improvement in the overall yield from 42% to 69%.

  19. Modified magnetic and optical properties of manganese nanoparticles incorporated europium doped magnesium borotellurite glass

    Energy Technology Data Exchange (ETDEWEB)

    Aziz, Siti Maisarah; Sahar, M.R., E-mail: mrahim057@gmail.com; Ghoshal, S.K.

    2017-02-01

    This paper reports the modified optical and magnetic properties of europium (Eu{sup 3+}) ions doped and Manganese nanoparticles (NPs) embedded Magnesium Borotellurite glass synthesized via melt quenching method. The influence of varying Mn NPs concentrations on the magnetic, absorption and emission properties of such glass samples are determined. Stables, transparent and amorphous glasses are obtained. The observed modification of the electronic polarizability is interpreted in terms of the generation of non-bridging oxygen (NBO) and bridging oxygen (BO) in the amorphous network. TEM images manifested the growth of Mn NPs with average diameter 11±1 nm. High-resolution TEM reveals that the lattice spacing of manganese nanoparticles is 0.308 nm at (112) plane. The emission spectra revealed four prominent peaks centered at 587 nm, 610 nm, 651 nm and 700 nm assigned to the transition from {sup 5}D{sub 0} →{sup 7}F{sub J} (J=1, 2, 3, 4) states of Eu{sup 3+} ion. A significant drop in the luminescence intensity due to the incorporation of Mn NPs is ascribed to the enhanced energy transfer from the Eu{sup 3+} ion to NPs. Prepared glass systems exhibited paramagnetic behavior. - Highlights: • The europium doped magnesium borotellurite glasses embedded Mn NPs prepared using the conventional melt-quenching method. • The TEM result reveals the size of Mn NPs while its planar spacing has been determined by HRTEM. • The luminescence properties of TeO{sub 2}–B{sub 2}O{sub 3}–MgO–Eu{sub 2}O{sub 3}–Mn{sub 3}O{sub 4} glasses have been investigated as effect of Mn NPs content. • The magnetization measurement of glass sample is carried out using vibrating sample magnetometer (VSM)

  20. Red polymer light-emitting devices based on an oxadiazole-functionalized europium(III) complex

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yu, E-mail: liuyu03b@126.com [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Wang, Yafei [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Li, Chun [Institute of Polymer Optoelectronic Materials and Devices, South China University of Technology, Guangzhou 510640 (China); Huang, Ying; Dang, Dongfeng; Zhu, Meixiang [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Zhu, Weiguo, E-mail: zhuwg18@126.com [Department of Chemistry, Key Lab of Environment-Friendly Chemistry and Application in the Ministry of Education, Xiangtan University, Xiangtan 411105 (China); Cao, Yong, E-mail: yongcao@scut.edu.cn [Institute of Polymer Optoelectronic Materials and Devices, South China University of Technology, Guangzhou 510640 (China)

    2014-02-14

    A novel tris(dibenzoylmethanato)[5-(2-(4-tert-butylbenzenyl)-5-benzenyl-1,3, 4-oxadiazole-4′)-1,10-phenanthroline]europium(III) [Eu(DBM){sub 3}(BuOXD-Phen)] containing an electron-transporting oxadiazole-functionalized phenanthroline ligand was synthesized and characterized. Its UV–vis absorption and photoluminescence (PL), as well as the electroluminescence (EL) in polymer light-emitting devices (PLEDs) were investigated. The double-layer PLEDs with a configuration of ITO/PEDOT:PSS (50 nm)/PVK (40 nm)/PFO:PBD (30%):Eu(DBM){sub 3}(BuOXD-Phen) (1–8 wt %) (80 nm)/Ba (4 nm)/Al (150 nm) were fabricated. Saturated red Eu{sup 3+} ion emission, based on the {sup 5}D{sub 0} → {sup 7}F{sub 2} transition, is centered at a wavelength of 614 nm with a full width at half maximum (FWHM) of 10 nm. The highest external quantum efficiency (QE{sub ext}) of 1.26% at current density of 1.65 mA cm{sup −2}, with a maximum brightness of 568 cd m{sup −2} at 137.8 mA cm{sup −2} was achieved from the device at 1 wt % dopant concentration. - Highlights: • An oxadiazole-functionalized europium(III) complex of Eu(DBM){sub 3}(BuOXD-Phen) was presented. • The optophysical properties of Eu(DBM){sub 3}(BuOXD-Phen) were investigated. • Saturated red emission was observed in the PLEDs. • An external quantum efficiency of 1.26% was obtained in these devices.

  1. Electron paramagnetic resonance and photoluminescence investigation of europium local structure in oxyfluoride glass ceramics containing SrF2 nanocrystals

    Science.gov (United States)

    Antuzevics, A.; Kemere, M.; Krieke, G.; Ignatans, R.

    2017-10-01

    Different compositions of europium doped aluminosilicate oxyfluoride glass ceramics prepared in air atmosphere have been studied by electron paramagnetic resonance (EPR) and optical spectroscopy methods. X-ray diffraction (XRD) and transmission electron microscopy (TEM) measurements show presence of homogenously distributed SrF2 nanocrystals after the heat treatment of the precursor glass. Efficient Eu3+ incorporation in the high symmetry environment of glass ceramics is observed from the photoluminescence spectra. EPR spectra indicate Eu3+ → Eu2+ reduction upon precipitation of crystalline phases in the glass matrix. For composition abundant with Eu2+ in the glassy state such behaviour is not detected. Local structure around europium ions is discussed based on differences in chemical compositions.

  2. Bright, highly water-soluble triazacyclononane europium complexes to detect ligand binding with time-resolved FRET microscopy.

    Science.gov (United States)

    Delbianco, Martina; Sadovnikova, Victoria; Bourrier, Emmanuel; Mathis, Gérard; Lamarque, Laurent; Zwier, Jurriaan M; Parker, David

    2014-09-26

    Luminescent europium complexes are used in a broad range of applications as a result of their particular emissive properties. The synthesis and application of bright, highly water-soluble, and negatively charged sulfonic- or carboxylic acid derivatives of para-substituted aryl-alkynyl triazacyclononane complexes are described. Introduction of the charged solubilizing moieties suppresses cellular uptake or adsorption to living cells making them applicable for labeling and performing assays on membrane receptors. These europium complexes are applied to monitor fluorescent ligand binding on cell-surface proteins with time-resolved Förster resonance energy transfer (TR-FRET) assays in plate-based format and using TR-FRET microscopy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Optical and spectral studies on pure and europium doped olgite type Na(Sr,Ba)PO4 ceramics.

    Science.gov (United States)

    Jawaher, K Rackesh; Jagannathan, R; Das, S Jerome; Krishnan, S

    2015-04-05

    Europium ion doped olgite type Na(Sr,Ba)PO4 ceramics, a new generation of light emitting bulb, was prepared by a high temperature solid-state reaction method. The synthesized materials were subjected to various characterizations such as X-ray powder diffraction, Scanning electron microscopy and FT-IR spectra measurements. The EPR spectrum of the sample exhibits a well-resolved hyperfine structure of 151Eu2+ and 153Eu2+ isotopes and the g value has been calculated. Fluorescence spectra revealed that europium ions were present in divalent as well as in the trivalent oxidation states. The critical distance for energy transfer between Eu2+ and Eu2+ ion is calculated as 20Å, which is in good agreement with that of experimental data. The FTIR analysis reveals all the vibrations of PO4(3-) ions. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Dicty_cDB: SSE161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 5' similar to SW:IPYR_CAEEL Q18680 PROBABLE INORGANIC PYROPHOSPHATASE ;, mRNA sequence. 36 2e-04 3 X14230...N-(5'-phosphoribosyl)anthranilate isomerase, histone H3 and inorganic pyrophosphatase (EC 3.6.1.1) respectively. 38 5e-04...RecName: Full=Inorganic pyrophosphatase; EC=3.... 317 2e-85 (Q6C1T4) RecName: Full=Inorganic pyrophosphatase;...RecName: Full=Inorganic pyrophosphatase; EC=3.... 164 1e-39 ( P13998 ) RecName: Full=Inorganic pyrophosphatase;...RecName: Full=Inorganic pyrophosphatase; EC=3.... 161 1e-38 (Q6FRB7) RecName: Full=Inorganic pyrophosphatase;

  5. Spectroscopy of ^161Yb with ATLAS/Gammasphere

    Science.gov (United States)

    Gaison, J.; Carroll, J.; Litz, M.; Wang, X.; Riley, M.; Baron, J.; Miller, S.; Simpson, J.; Paul, E.; Boston, A.; Boston, H.; Nolan, J.; Rees, M.; Revill, J.; Janssens, R.; Carpenter, M.; Kondev, F.; Lauritsen, T.; Zhu, S.; Riedinger, L.; Hartley, D.; Ayangeakaa, A.; Garg, U.; Chiara, C.

    2012-10-01

    An experiment was performed at Argonne National Laboratory's ATLAS accelerator using the Gammasphere array (˜100 HPGe detectors) whose primary aim was to investigate the collective bands beyond band termination in ^160Yb via the ^120Sn(^44Ca,4n) fusion-evaporation reaction. The high spin yield of the 4n channel was enhanced significantly by selecting a beam energy of 222 MeV and a considerable amount of data of 3n and 5n channels were also obtained. Here is presented the preliminary result of an initial spectroscopic analysis of ^161Yb, the product of the 3n channel. The RadWare (coincidence analysis) software package was utilized and the possibility of revised level placements has been suggested by the analysis, in comparison with previous level schemes.

  6. A highly sensitive europium nanoparticle-based immunoassay for detection of influenza A/B virus antigen in clinical specimens.

    Science.gov (United States)

    Zhang, Panhe; Vemula, Sai Vikram; Zhao, Jiangqin; Du, Bingchen; Mohan, Haleyurgirisetty; Liu, Jikun; El Mubarak, Haja Sittana; Landry, Marie L; Hewlett, Indira

    2014-12-01

    We report the development of a novel europium nanoparticle-based immunoassay (ENIA) for rapid detection of influenza A and influenza B viruses. The ENIA demonstrated sensitivities of 90.7% (147/162) for influenza A viruses and 81.80% (9/11) for influenza B viruses compared to those for an in-house reverse transcription (RT)-PCR assay in testing of influenza-positive clinical samples. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  7. Semiconducting polymer dots doped with europium complexes showing ultranarrow emission and long luminescence lifetime for time-gated cellular imaging.

    Science.gov (United States)

    Sun, Wei; Yu, Jiangbo; Deng, Ruiping; Rong, Yu; Fujimoto, Bryant; Wu, Changfeng; Zhang, Hongjie; Chiu, Daniel T

    2013-10-18

    Bright dots: Semiconducting polymer dots (Pdots) doped with europium complexes possess line-like fluorescence emission, high quantum yield, and long fluorescence lifetime. The Pdots successfully labeled receptors on cells. The long fluorescence lifetime of the Pdots was used to distinguish them from other red fluorescence emitting nanoparticles, and improve the signal-to-noise ratio for time-gated cellular imaging. PVK=poly(9-vinylcarbazole). Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Translocation and biokinetic behavior of nanoscaled europium oxide particles within 5 days following an acute inhalation in rats.

    Science.gov (United States)

    Creutzenberg, Otto; Kock, Heiko; Schaudien, Dirk

    2016-03-01

    Nanoscaled europium oxide (Eu2O3) particles were inhaled by rats after acute exposure and the potential translocation of particles followed by chemical analysis and transmission electron microscopy (TEM) was investigated. An aqueous dispersion (phosphate buffer/bovine serum albumin) of a commercially available Eu2O3 particle fraction consisting partially of nanoscaled particles was aerosolized with pressurized air. After rapid evaporation, rats inhaled the dry aerosol for 6 h in a single exposure resulting in an alveolar calculated dose of approximately 39.5 μg Eu2O3. Using chemical analysis, 36.8 μg Eu2O3 was detected 1 h after lung inhalation. The amount declined slightly to 34.5 μg after 1 day and 35.0 μg after 5 days. The liver showed an increase of Eu2O3 from 32.3 ng 1 h up to 294 ng 5 days after inhalation. Additionally, lung-associated lymph nodes, thymus, kidneys, heart and testis exhibited an increase of europium over the period investigated. In the blood, the highest amount of europium was found 1 h after treatment whereas feces, urine and mesenteric lymph nodes revealed the highest amount 1 day after treatment. Using TEM analysis, particles could be detected only in lungs, and in the liver, no particles were detectable. In conclusion, the translocation of Eu2O3 within 5 days following inhalation could be determined very precisely by chemical analysis. A translocation of Eu2O3 particulate matter to liver was not detectable by TEM analysis; thus, the overproportional level of 0.8% of the lung load observed in the liver after 5 days suggests a filtering effect of dissolved europium with accumulation. Copyright © 2015 John Wiley & Sons, Ltd.

  9. A Highly Sensitive Europium Nanoparticle-Based Immunoassay for Detection of Influenza A/B Virus Antigen in Clinical Specimens

    Science.gov (United States)

    Zhang, Panhe; Zhao, Jiangqin; Du, Bingchen; Mohan, Haleyurgirisetty; Liu, Jikun; El Mubarak, Haja Sittana; Landry, Marie L.

    2014-01-01

    We report the development of a novel europium nanoparticle-based immunoassay (ENIA) for rapid detection of influenza A and influenza B viruses. The ENIA demonstrated sensitivities of 90.7% (147/162) for influenza A viruses and 81.80% (9/11) for influenza B viruses compared to those for an in-house reverse transcription (RT)-PCR assay in testing of influenza-positive clinical samples. PMID:25297327

  10. Nature of the concentration thresholds of europium atom yield from the oxidized tungsten surface under electron stimulated desorption

    CERN Document Server

    Davydov, S Y

    2002-01-01

    The nature of the electron-stimulated desorption (ESD) of the europium atoms by the E sub e irradiating electrons energies, equal to 50 and 80 eV, as well as peculiarities of the Eu atoms yield dependence on their concentration on the oxidized tungsten surface are discussed. It is shown, that the ESD originates by the electron transition from the interval 5p- or 5s shell of the tungsten surface atom onto the oxygen external unfilled 2p-level

  11. Ultrasmall Superparamagnetic Iron Oxide Nanoparticles with Europium(III) DO3A as a Bimodal Imaging Probe.

    Science.gov (United States)

    Carron, Sophie; Bloemen, Maarten; Vander Elst, Luce; Laurent, Sophie; Verbiest, Thierry; Parac-Vogt, Tatjana N

    2016-03-18

    A new prototype consisting of ultrasmall superparamagnetic iron oxide (USPIO) nanoparticles decorated with europium(III) ions encapsulated in a DO3A organic scaffold was designed as a platform for further development of bimodal contrast agents for MRI and optical imaging. The USPIO nanoparticles act as negative MRI contrast agents, whereas the europium(III) ion is a luminophore that is suitable for use in optical imaging detection. The functionalized USPIO nanoparticles were characterized by TEM, DLS, XRD, FTIR, and TXRF analysis, and a full investigation of the relaxometric and optical properties was conducted. The typical luminescence emission of europium(III) was observed and the main red emission wavelength was found at 614 nm. The relaxometric study of these ultrasmall nanoparticles showed r2 values of 114.8 mM(-1) Fes(-1) at 60 MHz, which is nearly double the r2 relaxivity of Sinerem(®). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. A lysosome targetable luminescent bioprobe based on a europium β-diketonate complex for cellular imaging applications.

    Science.gov (United States)

    George, T M; Krishna, Mahesh S; Reddy, M L P

    2016-11-22

    Herein, we report a novel lysosome targetable luminescent bioprobe derived from a europium coordination compound, namely Eu(pfphOCH3IN)3(DDXPO) 4 [where HpfphOCH3IN = 4,4,5,5,5-pentafluoro-3-hydroxy-1-(1-(4-methoxyphenyl)-1H-indol-3-yl)pent-2-en-1-one and DDXPO = 4,5-bis(diphenylphosphino)-9,9-dimethylxanthene oxide]. Notably, the newly designed europium complex exhibits significant quantum yield (Φoverall = 25 ± 3%) and 5D0 excited state lifetime (τ = 398 ± 3 μs) values under physiological pH (7.2) conditions when excited at 405 nm. Hence the developed europium complex has been evaluated for live cell imaging applications using mouse pre-adipocyte cell lines (3T3L1). Colocalization studies of the designed bio-probe with commercial Lysosome-GFP in 3T3L1 cells demonstrated the specific localization of the probe in the lysosome with a high colocalization coefficient (A = 0.83). Most importantly, the developed bioprobe exhibits good cell permeability, photostability and non-cytotoxicity.

  13. Mössbauer spectroscopy of europium-doped fluorochlorozirconate glasses and glass ceramics: optimization of storage phosphors in computed radiography.

    Science.gov (United States)

    Pfau, C; Paßlick, C; Gray, S K; Johnson, J A; Johnson, C E; Schweizer, S

    2013-05-22

    Eu(2+)-doped fluorochlorozirconate (FCZ) glasses and glass ceramics, which are being developed for medical and photovoltaic applications, have been analysed by Mössbauer spectroscopy. The oxidation state and chemical environment of the europium ions, which are important for the performance of these materials, were investigated. Routes for maximizing the divalent europium content were also investigated. By using EuCl2 instead of EuF2 in the starting material a fraction of about 90% of the europium was maintained in the Eu(2+) state as opposed to about 70% when using EuF2. The glass ceramics produced by subsequent thermal processing contain BaCl2 nanocrystals in which Eu(2+) is incorporated, as shown by the narrower linewidth in the Mössbauer spectrum. Debye temperatures of 147 K and 186 K for Eu(2+) and Eu(3+), respectively, were determined from temperature dependent Mössbauer measurements. The f-factors were used to obtain the Eu(2+)/Eu(3+) ratio from the area ratio of the corresponding absorption lines.

  14. CD161 Defines a Transcriptional and Functional Phenotype across Distinct Human T Cell Lineages

    Directory of Open Access Journals (Sweden)

    Joannah R. Fergusson

    2014-11-01

    Full Text Available The C-type lectin CD161 is expressed by a large proportion of human T lymphocytes of all lineages, including a population known as mucosal-associated invariant T (MAIT cells. To understand whether different T cell subsets expressing CD161 have similar properties, we examined these populations in parallel using mass cytometry and mRNA microarray approaches. The analysis identified a conserved CD161++/MAIT cell transcriptional signature enriched in CD161+CD8+ T cells, which can be extended to CD161+ CD4+ and CD161+TCRγδ+ T cells. Furthermore, this led to the identification of a shared innate-like, TCR-independent response to interleukin (IL-12 plus IL-18 by different CD161-expressing T cell populations. This response was independent of regulation by CD161, which acted as a costimulatory molecule in the context of T cell receptor stimulation. Expression of CD161 hence identifies a transcriptional and functional phenotype, shared across human T lymphocytes and independent of both T cell receptor (TCR expression and cell lineage.

  15. Preparation of extractive resins for producing terbium-161; Preparacion de resinas extractivas para produccion de terbio-161

    Energy Technology Data Exchange (ETDEWEB)

    De la Cruz B, C. C.; Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)], e-mail: fabiola.monroy@inin.gob.mx

    2009-10-15

    This paper presents the development of a methodology for extractive resins preparation to base of HDEHP, which allows to separation of Tb from Gd generating an own technology of preparation of these resins. The study included the extractive resins preparation from 6 different supports: kieselguhr Dg, alumina, red volcanic rock, chiluca, quarry and fluorite; two treatment types of of supports and varied concentrations of HDEHP extractant (di(2-etil hexyl) orthophosphoric acid), in order to determine which resin has improved efficiency of Gd and Tb separation, and radionuclide purity of {sup 161}Tb. Resins were prepared to base of kieselguhr to determine the most appropriate silicon deposition process. Two silicon deposition treatments were realized: treatment I , by contact with silicon deposition solution (dimethyldichlorosilane / heptane 1:30) and treatment II by contact with vapors of dimethyldichlorosilane in vacuum. The extractant retention was carried out to different concentrations of HDEHP / acetone: 1:4, 1:8, 1:15, 1:20, 1:30 and 1:40. According to the results, there is not direct relation of HDEHP concentration used in extractive resins preparation to base of kieselguhr over the efficiency of Gd and Tb separation and of radionuclide purity of {sup 161}Tb. The effect of support in the efficiency of Gd and Tb separation was studied to prepare resins with the supports kieselguhr, alumina, quarry, chiluca, volcanic rock and fluorite, using the silicon deposition treatment II for the supports and a concentration of HDEHP / acetone 1:20, for extractant retention. Only resins based on kieselguhr could separate to Gd from Tb quantitatively, the resin at a concentration of HDEHP / Acetone 1:20 was the best results obtained in Gd and Tb separation, achieving a separation efficiency greater than 90% and a radionuclide purity higher than 99%. (Author)

  16. Fast and Selective Preconcentration of Europium from Wastewater and Coal Soil by Graphene Oxide/Silane@Fe3O4 Dendritic Nanostructure.

    Science.gov (United States)

    Patra, Santanu; Roy, Ekta; Madhuri, Rashmi; Sharma, Prashant K

    2015-05-19

    In this study, nanocomposite of graphene oxide and silane modified magnetic nanoparticles (silane@Fe3O4) were synthesized in a form of dendritic structure. For this, silane@Fe3O4 nanoparticle gets sandwiched between two layers of graphene oxide by chemical synthesis route. The synthesized dendritic structure was used as a monomer for synthesis of europium ion imprinted polymer. The synthesis of imprinted polymer was contemplated onto the surface of the vinyl group modified silica fiber by activated generated free radical atom-transfer radical polymerization, that is, AGET-ATRP technique. The synthesized dendritic monomer was characterized by XRD, FT-IR, VSM, FE-SEM, and TEM analyses. The imprinted polymer modified silica fiber was first validated in the aqueous and blood samples for successful extraction and detection of europium ion with limit of detection = 0.050 pg mL(-1) (signal/noise = 3). The imprinted polymer modified silica fiber was also used for preconcentration and separation of europium metal ion from various soil samples of coal mine areas. However, the same silica fiber was also used for wastewater treatment and shows 100% performance for europium removal. The findings herein suggested that dendritic nanocomposite could be potentially used as a highly effective material for the enrichment and preconcentration of europium or other trivalent lanthanides/actinides in nuclear waste management.

  17. Development of europium doped core-shell silica cobalt ferrite functionalized nanoparticles for magnetic resonance imaging.

    Science.gov (United States)

    Kevadiya, Bhavesh D; Bade, Aditya N; Woldstad, Christopher; Edagwa, Benson J; McMillan, JoEllyn M; Sajja, Balasrinivasa R; Boska, Michael D; Gendelman, Howard E

    2017-02-01

    The size, shape and chemical composition of europium (Eu3+) cobalt ferrite (CFEu) nanoparticles were optimized for use as a "multimodal imaging nanoprobe" for combined fluorescence and magnetic resonance bioimaging. Doping Eu3+ ions into a CF structure imparts unique bioimaging and magnetic properties to the nanostructure that can be used for real-time screening of targeted nanoformulations for tissue biodistribution assessment. The CFEu nanoparticles (size ∼7.2nm) were prepared by solvothermal techniques and encapsulated into poloxamer 407-coated mesoporous silica (Si-P407) to form superparamagnetic monodisperse Si-CFEu nanoparticles with a size of ∼140nm. Folic acid (FA) nanoparticle decoration (FA-Si-CFEu, size ∼140nm) facilitated monocyte-derived macrophage (MDM) targeting. FA-Si-CFEu MDM uptake and retention was higher than seen with Si-CFEu nanoparticles. The transverse relaxivity of both Si-CFEu and FA-Si-CFEu particles were r2=433.42mM-1s-1 and r2=419.52mM-1s-1 (in saline) and r2=736.57mM-1s-1 and r2=814.41mM-1s-1 (in MDM), respectively. The results were greater than a log order-of-magnitude than what was observed at replicate iron concentrations for ultrasmall superparamagnetic iron oxide (USPIO) particles (r2=31.15mM-1s-1 in saline) and paralleled data sets obtained for T2 magnetic resonance imaging. We now provide a developmental opportunity to employ these novel particles for theranostic drug distribution and efficacy evaluations. A novel europium (Eu3+) doped cobalt ferrite (Si-CFEu) nanoparticle was produced for use as a bioimaging probe. Its notable multifunctional, fluorescence and imaging properties, allows rapid screening of future drug biodistribution. Decoration of the Si-CFEu particles with folic acid increased its sensitivity and specificity for magnetic resonance imaging over a more conventional ultrasmall superparamagnetic iron oxide particles. The future use of these particles in theranostic tests will serve as a platform for

  18. Tuning Eu{sup 3+} emission in europium sesquioxide films by changing the crystalline phase

    Energy Technology Data Exchange (ETDEWEB)

    Mariscal, A., E-mail: antonio.mariscal@csic.es [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Quesada, A. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Camps, I. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain); Palomares, F.J. [Instituto de Ciencia de Materiales de Madrid, C/ Sor Juana Inés de la Cruz 3, 28049 Madrid (Spain); Fernández, J.F. [Ceramics for Smart Systems Group, Instituto de Cerámica y Vidrio, C/ Kelsen 5, 28049 Madrid (Spain); Serna, R. [Laser Processing Group, Instituto de Óptica, CSIC, C/ Serrano 121, 28006 Madrid (Spain)

    2016-06-30

    Highlights: • PLD production of high quality europium sesquioxide (Eu{sub 2}O{sub 3}) films. • The deposition of Al{sub 2}O{sub 3} capping and/or buffer layers modifies the crystallization for Eu{sub 2}O{sub 3} films upon annealing. • The formation of cubic or monoclinic phases can be favored. • Eu{sup 3+} emission tuning is achieved as a consequence of crystal field effects. - Abstract: We report the growth of europium sesquioxide (Eu{sub 2}O{sub 3}) thin films by pulsed laser deposition (PLD) in vacuum at room temperature from a pure Eu{sub 2}O{sub 3} ceramic bulk target. The films were deposited in different configurations formed by adding capping and/or buffer layers of amorphous aluminum oxide (a-Al{sub 2}O{sub 3}). The optical properties, refractive index and extinction coefficient of the as deposited Eu{sub 2}O{sub 3} layers were obtained. X-ray photoelectron spectroscopy (XPS) measurements were done to assess its chemical composition. Post-deposition annealing was performed at 500 °C and 850 °C in air in order to achieve the formation of crystalline films and to accomplish photoluminescence emission. According to the analysis of X-ray diffraction (XRD) spectra, cubic and monoclinic phases were formed. It is found that the relative amount of the phases is related to the different film configurations, showing that the control over the crystallization phase can be realized by adequately designing the structures. All the films showed photoluminescence emission peaks (under excitation at 355 nm) that are attributed to the intra 4f-transitions of Eu{sup 3+} ions. The emission spectral shape depends on the crystalline phase of the Eu{sub 2}O{sub 3} layer. Specifically, changes in the hypersensitive {sup 5}D{sub 0} → {sup 7}F{sub 2} emission confirm the strong influence of the crystal field effect on the Eu{sup 3+} energy levels.

  19. 49 CFR 173.161 - Chemical kits and first aid kits.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Chemical kits and first aid kits. 173.161 Section... Class 7 § 173.161 Chemical kits and first aid kits. (a) Chemical kits and First aid kits must conform to... 10 kg. (b) Chemical kits and First aid kits are excepted from the specification packaging...

  20. 25 CFR 1000.161 - What is a self-governance compact?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false What is a self-governance compact? 1000.161 Section 1000... EDUCATION ACT Negotiation Process for Annual Funding Agreements Negotiating A Self-Governance Compact § 1000.161 What is a self-governance compact? A self-governance compact is an executed document that affirms...

  1. 34 CFR 222.161 - How is State aid treated under section 8009 of the Act?

    Science.gov (United States)

    2010-07-01

    ... the school year in an elementary (including pre-kindergarten) or secondary school program. “Current... 34 Education 1 2010-07-01 2010-07-01 false How is State aid treated under section 8009 of the Act? 222.161 Section 222.161 Education Regulations of the Offices of the Department of Education OFFICE OF...

  2. 9 CFR 161.2 - Requirements and application procedures for accreditation.

    Science.gov (United States)

    2010-01-01

    ... vaccination tags, and determine the state of origin of eartags, to properly identify animals in interstate... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Requirements and application procedures for accreditation. 161.2 Section 161.2 Animals and Animal Products ANIMAL AND PLANT HEALTH...

  3. 26 CFR 1.501(c)(16)-1 - Corporations organized to finance crop operations.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 7 2010-04-01 2010-04-01 true Corporations organized to finance crop operations. 1.501(c)(16)-1 Section 1.501(c)(16)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... Corporations organized to finance crop operations. A corporation organized by a farmers' cooperative marketing...

  4. 9 CFR 381.161 - “(Kind) A La Kiev.”

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false â(Kind) A La Kiev.â 381.161 Section 381.161 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and Standards of Identity or...

  5. Circulating Glucagon 1-61 Regulates Blood Glucose by Increasing Insulin Secretion and Hepatic Glucose Production

    DEFF Research Database (Denmark)

    Wewer Albrechtsen, Nicolai J.; Kuhre, Rune E.; Hornburg, Daniel

    2017-01-01

    that PG 1-61 dose-dependently increases levels of cAMP, through the glucagon receptor, and increases insulin secretion and protein levels of enzymes regulating glycogenolysis and gluconeogenesis. In rats, PG 1-61 increases blood glucose and plasma insulin and decreases plasma levels of amino acids in...

  6. 75 FR 61655 - Airworthiness Directives; Piper Aircraft, Inc. Model PA-28-161 Airplanes

    Science.gov (United States)

    2010-10-06

    ... Federal Aviation Administration 14 CFR Part 39 RIN 2120-AA64 Airworthiness Directives; Piper Aircraft, Inc... directive (AD) for all Piper Aircraft, Inc. (Piper) Model PA-28-161 airplanes equipped with Thielert.... Piper Model PA-28-161 airplanes modified by STC No. SA03303AT have a similar unsafe design feature that...

  7. 21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Artificially sweetened fruit preserves and jams. 150.161 Section 150.161 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric...

  8. 22 CFR 161.12 - Environmental effects abroad of major departmental actions.

    Science.gov (United States)

    2010-04-01

    ... analysis shall be prepared in accordance with separate Departmental procedures (Foreign Affairs Manual... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Environmental effects abroad of major departmental actions. 161.12 Section 161.12 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION...

  9. 22 CFR 161.8 - General description of the Department's NEPA process.

    Science.gov (United States)

    2010-04-01

    ... (Foreign Affairs Manual, Volume 2). (b) Environmental Assessment. An environmental assessment is a concise... 22 Foreign Relations 1 2010-04-01 2010-04-01 false General description of the Department's NEPA process. 161.8 Section 161.8 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION REGULATIONS...

  10. Management of sinonasal chondrosarcoma: a systematic review of 161 patients.

    Science.gov (United States)

    Khan, Mohemmed N; Husain, Qasim; Kanumuri, Vivek V; Boghani, Zain; Patel, Chirag R; Liu, James K; Eloy, Jean Anderson

    2013-08-01

    This study reviews the published literature related to management of sinonasal chondrosarcoma. Clinical presentation, demographics, radiographic diagnosis, treatment, and management outcomes of this uncommon disease are reported. A systematic review of studies for sinonasal chondrosarcoma from 1950 to 2012 was conducted. A PubMed search for articles related to this condition, along with bibliographies of the selected articles was performed. Articles were examined for patient data that reported survivability. Demographic data, disease site, treatment strategies, follow-up, outcome, and survival were analyzed. A total of 63 journal articles were included, comprising a total of 161 cases of sinonasal chondrosarcoma. The average follow-up was 77.4 months (range, 1 to 325.2 months). Surgical resection was the most common treatment modality, used in 72.0% of cases. A combination of surgery and radiation therapy was the second most commonly used treatment modality, used in 21.7% of cases. This review contains the largest pool of sinonasal chondrosarcoma patients to date and suggests aggressive surgical resection is the most common treatment modality for this condition. The use of adjuvant radiotherapy for prevention of local recurrence after subtotal or total resection has not been proven effective. However, the use of radiotherapy in addition to surgical resection has shown benefit in some studies in terms of survival. © 2013 ARS-AAOA, LLC.

  11. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions

    Energy Technology Data Exchange (ETDEWEB)

    Guezel, Yueksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Guenther K. [Leopold-Franzens University, Institute of Analytical Chemistry and Radiochemistry, Innsbruck (Austria)

    2012-05-15

    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt. (orig.)

  12. Effects of europium polyoxometalate encapsulated in silica nanoparticles (nanocarriers) in soil invertebrates

    Science.gov (United States)

    Bicho, Rita C.; Soares, Amadeu M. V. M.; Nogueira, Helena I. S.; Amorim, Mónica J. B.

    2016-12-01

    Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO2 NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO2 NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO2 NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of "no effect" are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.

  13. Spectral Interferences Manganese (Mn) - Europium (Eu) Lines in X-Ray Fluorescence Spectrometry Spectrum

    Science.gov (United States)

    Tanc, Beril; Kaya, Mustafa; Gumus, Lokman; Kumral, Mustafa

    2016-04-01

    X-ray fluorescence (XRF) spectrometry is widely used for quantitative and semi quantitative analysis of many major, minor and trace elements in geological samples. Some advantages of the XRF method are; non-destructive sample preparation, applicability for powder, solid, paste and liquid samples and simple spectrum that are independent from chemical state. On the other hand, there are some disadvantages of the XRF methods such as poor sensitivity for low atomic number elements, matrix effect (physical matrix effects, such as fine versus course grain materials, may impact XRF performance) and interference effect (the spectral lines of elements may overlap distorting results for one or more elements). Especially, spectral interferences are very significant factors for accurate results. In this study, semi-quantitative analyzed manganese (II) oxide (MnO, 99.99%) was examined. Samples were pelleted and analyzed with XRF spectrometry (Bruker S8 Tiger). Unexpected peaks were obtained at the side of the major Mn peaks. Although sample does not contain Eu element, in results 0,3% Eu2O3 was observed. These result can occur high concentration of MnO and proximity of Mn and Eu lines. It can be eliminated by using correction equation or Mn concentration can confirm with other methods (such as Atomic absorption spectroscopy). Keywords: Spectral Interferences; Manganese (Mn); Europium (Eu); X-Ray Fluorescence Spectrometry Spectrum.

  14. Performance of fluorescent europium(III) nanoparticles and colloidal gold reporters in lateral flow bioaffinity assay.

    Science.gov (United States)

    Juntunen, Etvi; Myyryläinen, Tiina; Salminen, Teppo; Soukka, Tero; Pettersson, Kim

    2012-09-01

    Lateral flow (LF) immunoassays (i.e., immunochromatographic assays) have traditionally been applied to analytes that do not require very high analytical sensitivity or quantitative results. The selection of potential analytes is often limited by the performance characteristics of the assay technology. Analytes with more demanding sensitivity requirements call for reporter systems enabling high analytical sensitivity. In this study, we systematically compared the performance of fluorescent europium(III) [Eu(III)] chelate dyed polystyrene nanoparticles and colloidal gold particles in lateral flow assays. The effect of time-resolved measurement mode was also studied. Because binder molecules used in immunoassays might not behave similarly when conjugated to different reporter particles, two model assays were constructed to provide reliable technical comparison of the two reporter systems. The comparative experiment demonstrated that the fluorescent nanoparticles yielded 7- and 300-fold better sensitivity compared with colloidal gold in the two test systems, respectively. Although the two reporter particles may induce variable effects using individual binders, overall the high specific activity of Eu(III) nanoparticles has superior potential over colloidal gold particles for the development of robust high-sensitivity bioaffinity assays. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Carbon nanotube-loaded Nafion film electrochemical sensor for metal ions: europium.

    Science.gov (United States)

    Wang, Tingting; Zhao, Daoli; Guo, Xuefei; Correa, Jaime; Riehl, Bill L; Heineman, William R

    2014-05-06

    A Nafion film loaded with novel catalyst-free multiwalled carbon nanotubes (MWCNTs) was used to modify a glassy carbon (GC) electrode to detect trace concentrations of metal ions, with europium ion (Eu(3+)) as a model. The interaction between the sidewalls of MWCNTs and the hydrophobic backbone of Nafion allows the MWCNTs to be dispersed in Nafion, which was then coated as a thin film on the GC electrode surface. The electrochemical response to Eu(3+) was found to be ∼10 times improved by MWCNT concentrations between 0.5 and 2 mg/mL, which effectively expanded the electrode surface into the Nafion film and thereby reduced the diffusion distance of Eu(3+) to the electrode surface. At low MWCNT concentrations of 0.25 and 0.5 mg/mL, no significant improvement in signal was obtained compared with Nafion alone. Scanning electron microscopy and electrochemical impedance spectroscopy were used to characterize the structure of the MWCNT-Nafion film, followed by electrochemical characterization with Eu(3+) via cyclic voltammetry and preconcentration voltammetry. Under the optimized conditions, a linear range of 1-100 nM with a calculated detection limit of 0.37 nM (signal/noise = 3) was obtained for determination of Eu(3+) by Osteryoung square-wave voltammetry after a preconcentration time of 480 s.

  16. Effects of europium polyoxometalate encapsulated in silica nanoparticles (nanocarriers) in soil invertebrates

    Energy Technology Data Exchange (ETDEWEB)

    Bicho, Rita C., E-mail: ritabicho@ua.pt; Soares, Amadeu M.V.M. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal); Nogueira, Helena I.S. [Universidade de Aveiro, Departamento de Química & CICECO (Portugal); Amorim, Mónica J.B. [Universidade de Aveiro, Departamento de Biologia & CESAM (Portugal)

    2016-12-15

    Polyoxometalates (POMs) are metal oxo clusters that have been investigated for several applications in material sciences, catalysis, and biomedicine; these gained increasing interest in the field of nanotechnology as nanocarriers for drug delivery. Associated to the increasing applications, there is the need for information regarding the effects on the environment of these compounds, which is completely absent in the literature. In the present study, the effects of europium polyoxometalates encapsulated into silica nanoparticles (Eu-POM/SiO{sub 2} NPs) were assessed on the soil representative Enchytraeus crypticus. The individual materials were also assessed (Eu-POMs and SiO{sub 2} NPs). Toxicity was evaluated in various test media with increasing complexity: water, soil/water extracts, and soil. Toxicity was only observed for Eu-POM/SiO{sub 2} NPs and in the presence of soil components. Despite the fact that effects were observed for concentrations higher than current predicted environmental concentration (PEC), attention should be given to the growing use of these compounds. The present study shows the importance of assessing the effects in soil media, also compared to water. Moreover, results of “no effect” are critically needed and often unpublished. The present study can contribute to the improvement of the OECD guidelines for safety of manufactured nanomaterials on environmental toxicity in the soil compartment providing an improved test alternative.

  17. EUROPIUM ION INFLUENCE ON THE FORMATION OF Ag-NANOPARTICLES IN FLUORINE PHOSPHATE GLASSES

    Directory of Open Access Journals (Sweden)

    R. O. Pysh'ev

    2015-05-01

    Full Text Available The paper deals with research of formation characteristics of silver nanoparticles in fluorophosphate glasses 0.25 Na2O - 0.5 P2O5 - 0.10 Ga2O3 - 0.075 AlF3 - 0.025 NaF - 0.05 ZnF2 doped with EuF3 (0.8 and 4 wt.% and without them. The synthesis was carried out in closed glassy carbon crucibles in argon atmosphere. Nanoparticles were formed after a low temperature process of Ag+ → Na+ ion-exchange (320 °C and subsequent heat treatment. It was shown that in the initial glasses doped with EuF3, rare earth ions exist in two valence forms (Eu2+ and Eu3+ in dynamic equilibrium and the concentration of Eu2+ increases proportionally to the total concentration of fluoride. It was shown that sizes of molecular clusters or metal nanoparticles depend on the concentration of europium fluoride and duration of ion exchange. The metallic Ag-nanoparticles sizes were defined for different times of heat treatment and ion exchange. The possibility of the stimulating growth of nanoparticles through the introduction of additional EuF3 in the glass was proved. The possibility of obtaining nanoparticles without the heat treatment in glasses with a high concentration of EuF3 was shown. Chemical mechanism for the formation of Ag-nanoparticles during the ion exchange was suggested.

  18. Nanoparticles in the zirconia-europium niobate system via hydrothermal route.

    Science.gov (United States)

    Hirano, Masanori; Dozono, Hayato

    2013-10-01

    The effect of the composition on the hydrothermal formation, structure, and properties of nanocrystalline luminescent materials in the zirconia (ZrO2)-europium niobate 1/4(Eu3NbO7) system was investigated. In the composition range 40 particles with crystallite size 6.0-7.6 nm that were hydrothermally formed from the precursor solutions of NbCl5, ZrOCI2, and EuCl3 under weakly basic conditions at 240 degrees C showed cubic structure. The lattice parameter when estimated as a single cubic phase linearly decreased as the concentration of ZrO2 increased. The presence of zirconia component effectively promoted the formation of nanocrystals containing the niobate, Eu3NbO7 under hydrothermal condition. The nanocrystalline particles could be excited by ultraviolet light 395 nm (f-f transition) and emitted orange (590 nm) and red light (610 nm) corresponding to 5D0 --> 7F1 and 5D0 --> 7F2 transitions of Eu3+, respectively. The intensity of the electric dipole transition (5D0 --> 7F2) that was expressed in values relative to the magnetic dipole transition (5D0 --> 7F1) increased with increased heat-treatment temperature in the range from 950 to 1200 degrees C.

  19. Photoluminescence of monocrystalline and stain-etched porous silicon doped with high temperature annealed europium

    Energy Technology Data Exchange (ETDEWEB)

    Guerrero-Lemus, R; Montesdeoca-Santana, A; Gonzalez-Diaz, B; Diaz-Herrera, B; Hernandez-Rodriguez, C; Jimenez-Rodriguez, E [Departamento de Fisica Basica, Universidad de La Laguna (ULL), Avenida AstrofIsico Francisco Sanchez, 2. 38206 La Laguna, Tenerife (Spain); Velazquez, J J, E-mail: rglemus@ull.es [Departamento de Fisica Fundamental y Experimental, Electronica y Sistemas, Universidad de La Laguna (ULL), Avenida Astrofisico Francisco Sanchez, 2. 38206 La Laguna, Tenerife (Spain)

    2011-08-24

    In this work, for the first time, the photoluminescent emission and excitation spectra of non-textured layers and stain-etched porous silicon layers (PSLs) doped with high temperature annealed europium (Eu) are evaluated. The PSLs are evaluated as a host for rare earth ions and as an antireflection coating. The applied doping process, which consists in a simple impregnation method followed by a high-temperature annealing step, is compatible with the standard processes in the fabrication of solar cells. The results show down-shifting processes with a maximum photoluminescent intensity at 615 nm, related to the transition {sup 5}D{sub 0} {yields} {sup 7}F{sub 2}. Different initial concentrations of Eu(NO{sub 3}){sub 3} are evaluated to study the influence of the rare earth concentration on the photoluminescent intensity. The chemical composition and the morphology of Eu-doped PSLs are examined by means of x-ray dispersion spectroscopy, Fourier-transform infrared spectroscopy and scanning electron microscopy. These Eu-doped layers are considered to be applied as energy converters in silicon-based third generation solar cells.

  20. Europium (III) and Uranium (VI) complexation by natural organic matter (NOM): Effect of source.

    Science.gov (United States)

    Kautenburger, Ralf; Sander, Jonas M; Hein, Christina

    2017-03-01

    For the safe long-term storage of high-level radioactive waste (HLW), detailed information about geo-chemical behavior of radioactive and toxic metal ions under environmental conditions is important. Natural organic matter (NOM) can play a crucial role in the immobilization or mobilization of these metal ions due to its complexation and colloid formation tendency. In this study, the complexation of europium (as chemical homologue of trivalent actinides such as americium) and uranium (as main component of HLW) by ten humic acids (HA) from different sources and Suwannee NOM river extract has been analyzed. Capillary electrophoresis in combination with inductively coupled plasma mass spectrometry has been used for the evaluation of complex stability constants log β. In order to determine the complex stability constants a conservative single site model was used in this study. In dependence of their source and thus of NOM structure the log β values for the analyzed humic acids are in the range of 6.1-7.0 for Eu(III) and 5.2-6.4 for U(VI) (UO 2 2+ ), respectively. In contrast to the results for HA the used Suwannee river NOM reveals log β values in the range of nearly two orders of magnitude lower (4.6 for Eu 3+ and 4.5 for UO 2 2+ ) under the geochemical conditions applied in this study. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Europium incorporated into titanium oxide by the sol-gel method

    Directory of Open Access Journals (Sweden)

    Lucas Alonso Rocha

    2005-09-01

    Full Text Available In this work titanium sol was prepared from tetraethylorthotitanate (TEOT in ethanol, stabilized with beta-diketonate 2,4 pentanedione in molar ratio 1:1 homogenized by magnetic stirring, europium ion was add as structural probe. The xerogels were heat treated at 500, 750 and 1000 °C and the characterization was realized by x-ray diffraction (XRD, transmission electron microscopy (TEM, thermogravimetric analysis (TGA/DSC and photoluminescence (PL. The excitation spectra of Eu (III ion present maximum in 394 nm correspondent to 5L6 level and emission spectra present bands characteristic transitions arising from the 5 D0 -> 7F J (J = 0, 1, 2, 3, 4 manifolds to samples treat at 500 and 750 °C. The Eu (III emission disappear, when heated at 1000 °C, probably due to phase transition anatase to rutile and migrations of ions to the external surface that was proved by x-ray diffraction, transmission electronic microscopy and the thermogravimetric analyses of xerogels.

  2. Luminescence studies on the europium doped strontium metasilicate phosphor prepared by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu

    2017-03-01

    Full Text Available Europium doped strontium meta-silicate (namely SrSiO3:Eu3+ phosphor was prepared by a high temperature solid state reaction method. The sintered SrSiO3:Eu3+ phosphor possesses a monoclinic structure by the XRD. Energy dispersive X-ray spectrum (EDS confirms the presence of elements in the desired sample. Thermoluminescence (TL kinetic parameters such as activation energy (E, order of kinetics (b, and frequency factor (s were calculated by the peak shape method. The orange–red emission was shown to originate from the 5D0–7FJ (J = 0, 1, 2, 3, 4 transitions of Eu3+ ions as the sample was excited at 396 nm. The SrSiO3:Eu3+ phosphor with almost pure orange-red color purity (99.62% shows the quantum efficiency of 10.2% (excited by 396 nm, which is higher than those of commercial red phosphors Y2O3:Eu3+ and Y2O2S:Eu3+ with quantum efficiencies of 9.6% (excited by 394 nm and 4.2% (excited by 395 nm, respectively. Mechanoluminescence (ML intensity of the SrSiO3:Eu3+ phosphor was also found to increase linearly with increasing the impact velocity of the moving piston, suggesting that the discussed phosphor can be used as a stress sensor.

  3. Europium Luminescence Used for Logic Gate and Ions Sensing with Enoxacin As the Antenna.

    Science.gov (United States)

    Lu, Lixia; Chen, Chuanxia; Zhao, Dan; Sun, Jian; Yang, Xiurong

    2016-01-19

    Luminescent lanthanide ion complexes have received increasing attention because of their unique optical properties. Herein, we discovered that the luminescence of europium(III) (Eu(3+)) could be regulated by Ag(+) and SCN(-) in seconds with enoxacin (ENX) as the antenna. Under given conditions, only the simultaneous introduction of Ag(+) and SCN(-) could remarkably enhance the luminescence intensity of Eu(3+)-ENX complexes. This phenomenon has been exploited to design an "AND" logic gate and specific luminescence turn-on assays for sensitively sensing Ag(+) and SCN(-) for the first time. Furthermore, the addition of S(2-) resulted in efficient luminescence quenching of the Eu(3+)/ENX/Ag(+)/SCN(-) system due to the strong affinity between Ag(+) and S(2-). Thus, a new luminescent sensing platform for S(2-) was established, which exhibited excellent selectivity and high sensitivity. S(2-) could be detected within the concentration range of 100 nM to 12.5 μM with a detection limit of 60 nM. Such sensing system features simplicity, rapidity, and flexibility. Moreover, this proposed Eu(3+)-based luminescent assay could be successfully applied in the real environmental water sample analysis.

  4. Radiation effects on beta 10.6 of pure and europium doped KCl

    Science.gov (United States)

    Grimes, H. H.; Maisel, J. E.; Hartford, R. H.

    1975-01-01

    Changes in the optical absorption coefficient as a result of X-ray and electron bombardment of pure KCl (monocrystalline and polycrystalline), and divalent europium doped polycrystalline KCl were determined. The optical absorption coefficients were measured by a constant heat flow calorimetric method. Both 300 KV X-irradiation and 2 MeV electron irradiation produced significant increases in beta 10.6, measured at room temperature. The X-irradiation of pure moncrystalline KCl increased beta 10.6 by 0.005/cm for a 113 MR dose. For an equivalent dose, 2 MeV electrons were found less efficient in changing beta 10.6. However, electron irradiation of pure and Eu-doped polycrystalline KCl produced marked increases in adsorption. Beta increased to over 0.25/cm in Eu-doped material for a 30 x 10 to the 14th power electrons/sq cm dose, a factor of 20 increase over unirradiated material. Moreover, bleaching the electron irradiated doped KCl with 649 m light produced and additional factor of 1.5 increase. These findings will be discussed in light of known defect-center properties in KCl.

  5. Accelerating the clearance of mutant huntingtin protein aggregates through autophagy induction by europium hydroxide nanorods.

    Science.gov (United States)

    Wei, Peng-Fei; Zhang, Li; Nethi, Susheel Kumar; Barui, Ayan Kumar; Lin, Jun; Zhou, Wei; Shen, Yi; Man, Na; Zhang, Yun-Jiao; Xu, Jing; Patra, Chitta Ranjan; Wen, Long-Ping

    2014-01-01

    Autophagy is one of the well-known pathways to accelerate the clearance of protein aggregates, which contributes to the therapy of neurodegenerative diseases. Although there are numerous reports that demonstrate the induction of autophagy with small molecules including rapamycin, trehalose and lithium, however, there are few reports mentioning the clearance of aggregate-prone proteins through autophagy induction by nanoparticles. In the present article, we have demonstrated that europium hydroxide [Eu(III)(OH)3] nanorods can reduce huntingtin protein aggregation (EGFP-tagged huntingtin protein with 74 polyQ repeats), responsible for neurodegenerative diseases. Again, we have found that these nanorods induce authentic autophagy flux in different cell lines (Neuro 2a, PC12 and HeLa cells) through the expression of higher levels of characteristic autophagy marker protein LC3-II and degradation of selective autophagy substrate/cargo receptor p62/SQSTM1. Furthermore, depression of protein aggregation clearance through the autophagy blockade has also been observed by using specific inhibitors (wortmannin and chloroquine), indicating that autophagy is involved in the degradation of huntingtin protein aggregation. Since [Eu(III)(OH)3] nanorods can enhance the degradation of huntingtin protein aggregation via autophagy induction, we strongly believe that these nanorods would be useful for the development of therapeutic treatment strategies for various neurodegenerative diseases in near future using nanomedicine approach. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. High-resolution Thermal Micro-imaging Using Europium Chelate Luminescent Coatings.

    Science.gov (United States)

    Benseman, Timothy M; Hao, Yang; Vlasko-Vlasov, Vitalii K; Welp, Ulrich; Koshelev, Alexei E; Kwok, Wai-Kwong; Divan, Ralu; Keiser, Courtney; Watanabe, Chiharu; Kadowaki, Kazuo

    2017-04-16

    Micro-electronic devices often undergo significant self-heating when biased to their typical operating conditions. This paper describes a convenient optical micro-imaging technique which can be used to map and quantify such behavior. Europium thenoyltrifluoroacetonate (EuTFC) has a 612 nm luminescence line whose activation efficiency drops strongly with increasing temperature, due to T-dependent interactions between the Eu3+ ion and the organic chelating compound. This material may be readily coated on to a sample surface by thermal sublimation in vacuum. When the coating is excited with ultraviolet light (337 nm) an optical micro-image of the 612 nm luminescent response can be converted directly into a map of the sample surface temperature. This technique offers spatial resolution limited only by the microscope optics (about 1 micron) and time resolution limited by the speed of the camera employed. It offers the additional advantages of only requiring comparatively simple and non-specialized equipment, and giving a quantitative probe of sample temperature.

  7. In vivo synthesis of europium selenide nanoparticles and related cytotoxicity evaluation of human cells.

    Science.gov (United States)

    Kim, Eun Bee; Seo, Ji Min; Kim, Gi Wook; Lee, Sang Yup; Park, Tae Jung

    2016-12-01

    Nanotechnology strives to combine new materials for development of noble nanoparticles. As the nanoparticles exhibit unique optical, electronic, and magnetic properties depending on their composition, developing safe, cost-effective and environmentally friendly technologies for the synthesis have become an important issue. In this study, in vivo synthesis of europium selenide (EuSe) nanoparticles was performed using recombinant Escherichia coli cells expressing heavy-metal binding proteins, phytochelatin synthase and metallothionein. The formation of EuSe nanoparticles was confirmed by using UV-vis spectroscopy, spectrofluorometry, X-ray diffraction, energy dispersive X-ray and transmission electron microscopy. The synthesized EuSe nanoparticles exhibited high fluorescence intensities as well as strong magnetic properties. Furthermore, anti-cancer effect of EuSe nanoparticles against cancer cell lines was investigated. This strategy for the biogenic synthesis of nanoparticles has a great potential as bioimaging tools and drug carrying agents in biomedical fields due to its simplicity and nontoxicity. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Circularly Polarized Luminescence in Enantiopure Europium and Terbium Complexes with Modular, All-Oxygen Donor Ligands

    Science.gov (United States)

    Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.

    2009-01-01

    Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983

  9. Complexation and molecular modeling studies of europium(III)-gallic acid-amino acid complexes.

    Science.gov (United States)

    Taha, Mohamed; Khan, Imran; Coutinho, João A P

    2016-04-01

    With many metal-based drugs extensively used today in the treatment of cancer, attention has focused on the development of new coordination compounds with antitumor activity with europium(III) complexes recently introduced as novel anticancer drugs. The aim of this work is to design new Eu(III) complexes with gallic acid, an antioxida'nt phenolic compound. Gallic acid was chosen because it shows anticancer activity without harming health cells. As antioxidant, it helps to protect human cells against oxidative damage that implicated in DNA damage, cancer, and accelerated cell aging. In this work, the formation of binary and ternary complexes of Eu(III) with gallic acid, primary ligand, and amino acids alanine, leucine, isoleucine, and tryptophan was studied by glass electrode potentiometry in aqueous solution containing 0.1M NaNO3 at (298.2 ± 0.1) K. Their overall stability constants were evaluated and the concentration distributions of the complex species in solution were calculated. The protonation constants of gallic acid and amino acids were also determined at our experimental conditions and compared with those predicted by using conductor-like screening model for realistic solvation (COSMO-RS) model. The geometries of Eu(III)-gallic acid complexes were characterized by the density functional theory (DFT). The spectroscopic UV-visible and photoluminescence measurements are carried out to confirm the formation of Eu(III)-gallic acid complexes in aqueous solutions. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Luminescent single-walled carbon nanotube-sensitized europium nanoprobes for cellular imaging

    Science.gov (United States)

    Avti, Pramod K; Sitharaman, Balaji

    2012-01-01

    Lanthanoid-based optical probes with excitation wavelengths in the ultra-violet (UV) range (300–325 nm) have been widely developed as imaging probes. Efficient cellular imaging requires that lanthanoid optical probes be excited at visible wavelengths, to avoid UV damage to cells. The efficacy of europium-catalyzed single-walled carbon nanotubes (Eu-SWCNTs), as visible nanoprobes for cellular imaging, is reported in this study. Confocal fluorescence microscopy images of breast cancer cells (SK-BR-3 and MCF-7) and normal cells (NIH 3T3), treated with Eu-SWCNT at 0.2 μg/mL concentration, showed bright red luminescence after excitation at 365 nm and 458 nm wavelengths. Cell viability analysis showed no cytotoxic effects after the incubation of cells with Eu-SWCNTs at this concentration. Eu-SWCNT uptake is via the endocytosis mechanism. Labeling efficiency, defined as the percentage of incubated cells that uptake Eu-SWCNT, was 95%–100% for all cell types. The average cellular uptake concentration was 6.68 ng Eu per cell. Intracellular localization was further corroborated by transmission electron microscopy and Raman microscopy. The results indicate that Eu-SWCNT shows potential as a novel cellular imaging probe, wherein SWCNT sensitizes Eu3+ ions to allow excitation at visible wavelengths, and stable time-resolved red emission. The ability to functionalize biomolecules on the exterior surface of Eu-SWCNT makes it an excellent candidate for targeted cellular imaging. PMID:22619533

  11. Europium(III) DOTA-derivatives having ketone donor pendant arms display dramatically slower water exchange

    Science.gov (United States)

    Green, Kayla N.; Viswanathan, Subha; Rojas-Quijano, Federico A.; Kovacs, Zoltan; Sherry, A. Dean

    2011-01-01

    A series of new 1,4,7,10-tetraazacyclododecane-derivatives having a combination of amide and ketone donor groups as side-arms were prepared and their complexes with europium(III) studied in detail by high resolution NMR spectroscopy. The chemical shift of the Eu3+-bound water resonance, the chemical exchange saturation transfer (CEST) characteristics of the complexes, and the bound water residence lifetimes (τm) were found to vary dramatically with the chemical structure of the side-arms. Substitution of ketone oxygen donor atoms for amide oxygen donor atoms resulted in an increase in residence water lifetimes (τm) and a decrease in chemical shift of the Eu3+-bound water molecule (Δω). These experimental results along with density functional theory (DFT) calculations demonstrate that introduction of weakly donating oxygen atoms in these complexes results in a much weaker ligand field, more positive charge on the Eu3+ ion and an increased water residence lifetime as expected for a dissociative mechanism. These results provide new insights into the design of paramagnetic CEST agents with even slower water exchange kinetics that will make them more efficient for in vivo imaging applications. PMID:21306137

  12. Urinary monitoring of exposure to yttrium, scandium, and europium in male Wistar rats.

    Science.gov (United States)

    Kitamura, Yasuhiro; Usuda, Kan; Shimizu, Hiroyasu; Fujimoto, Keiichi; Kono, Rei; Fujita, Aiko; Kono, Koichi

    2012-12-01

    On the assumption that rare earth elements (REEs) are nontoxic, they are being utilized as replacements of toxic heavy metals in novel technological applications. However, REEs are not entirely innocuous, and their impact on health is still uncertain. In the past decade, our laboratory has studied the urinary excretion of REEs in male Wistar rats given chlorides of europium, scandium, and yttrium solutions by one-shot intraperitoneal injection or oral dose. The present paper describes three experiments for the suitability and appropriateness of a method to use urine for biological monitoring of exposure to these REEs. The concentrations of REEs were determined in cumulative urine samples taken at 0-24 h by inductively coupled plasma atomic emission spectroscopy, showing that the urinary excretion of REEs is <2 %. Rare earth elements form colloidal conjugates in the bloodstream, which make high REEs accumulation in the reticuloendothelial system and glomeruli and low urinary excretion. The high sensitivity of inductively coupled plasma-argon emission spectrometry analytical methods, with detection limits of <2 μg/L, makes urine a comprehensive assessment tool that reflects REE exposure. The analytical method and animal experimental model described in this study will be of great importance and encourage further discussion for future studies.

  13. Europium Luminescence: Electronic Densities and Superdelocalizabilities for a Unique Adjustment of Theoretical Intensity Parameters

    Science.gov (United States)

    Dutra, José Diogo L.; Lima, Nathalia B. D.; Freire, Ricardo O.; Simas, Alfredo M.

    2015-09-01

    We advance the concept that the charge factors of the simple overlap model and the polarizabilities of Judd-Ofelt theory for the luminescence of europium complexes can be effectively and uniquely modeled by perturbation theory on the semiempirical electronic wave function of the complex. With only three adjustable constants, we introduce expressions that relate: (i) the charge factors to electronic densities, and (ii) the polarizabilities to superdelocalizabilities that we derived specifically for this purpose. The three constants are then adjusted iteratively until the calculated intensity parameters, corresponding to the 5D0→7F2 and 5D0→7F4 transitions, converge to the experimentally determined ones. This adjustment yields a single unique set of only three constants per complex and semiempirical model used. From these constants, we then define a binary outcome acceptance attribute for the adjustment, and show that when the adjustment is acceptable, the predicted geometry is, in average, closer to the experimental one. An important consequence is that the terms of the intensity parameters related to dynamic coupling and electric dipole mechanisms will be unique. Hence, the important energy transfer rates will also be unique, leading to a single predicted intensity parameter for the 5D0→7F6 transition.

  14. Structural and spectroscopic analyses of europium doped yttrium oxyfluoride powders prepared by combustion synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Rakov, Nikifor [PG-Ciência dos Materiais, Universidade Federal do Vale do São Francisco, 48902-300 Juazeiro, BA (Brazil); Guimarães, R. B.; Maciel, Glauco S. [Instituto de Física, Universidade Federal Fluminense, 24210-346 Niterói, RJ (Brazil); Lozano B, W. [Departamento de Física, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil)

    2013-07-28

    A facile widely spread technique employed to produce low-cost high-yield oxide powders, combustion synthesis, was used to prepare yttrium oxyfluoride crystalline ceramic powders. The structure of the powders was analyzed by X-ray powder diffraction and Rietveld refinement. Samples heat treated at 700 °C had a predominance of vernier orthorhombic Y{sub 6}O{sub 5}F{sub 8} phase, while samples heat treated at 800 °C crystallized in stoichiometric rhombohedral YOF phase. The samples were doped with luminescent europium trivalent ions (Eu{sup 3+}) in different concentrations (1–15 wt.%) and Judd-Ofelt theory was used to probe the distortion from the inversion symmetry of the local crystal field and the degree of covalency between the rare-earth ion and the surrounding ligands. The luminescence lifetime was measured and the luminescence quantum efficiency (LQE) was estimated. We observed that Eu{sup 3+}:Y{sub 6}O{sub 5}F{sub 8} samples presented higher LQE in spite of the larger local crystal field anisotropy found for Eu{sup 3+}:YOF samples.

  15. Synthesis, photophysics, electrochemistry, thermal stability and electroluminescent performances of a new europium complex with bis(β-diketone) ligand containing carbazole group.

    Science.gov (United States)

    Liu, Jian; Liang, Quan-Bin; Wu, Hong-Bin

    2017-05-01

    We synthesized a new europium complex [Eu(ecbpd)3 (Phen)] with bis(β-diketone) ligand containing a carbazole group, in which ecbpd and Phen are dehydro-3,3'-(9-ethyl-9H-carbazole-3,6-diyl)bis(1-phenylpropane-1,3-dione) and 1,10-phenanthroline, respectively. Its UV/vis and photoluminescent spectra, quantum yield, luminescence lifetime, electrochemistry, thermal stability and electroluminescent performances were studied. This europium complex showed low efficiency luminescence, which is probably due to the mismatching energy levels of its ligand and Eu3+ , as well as the double Eu3+ core resonance. Copyright © 2016 John Wiley & Sons, Ltd.

  16. Europium (III) PVC membrane sensor based on N-pyridine-2-carboxamido-8-aminoquinoline as a sensing material

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hassan Ali, E-mail: haszamani@yahoo.com [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Kamjoo, Rahman [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Mohammadhosseini, Majid [Department of Chemistry, Faculty of Basic Sciences, Shahrood Branch, Islamic Azad University, Shahrood (Iran, Islamic Republic of); Zaferoni, Mojdeh; Rafati, Zynab [Department of Applied Chemistry, Quchan branch, Islamic Azad University, Quchan (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Faridbod, Farnoush [Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Meghdadi, Soraia [Department of Chemistry, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)

    2012-04-01

    Conductometric study in acetonitrile solution shows the selectivity of PCQ toward europium ion. Therefore, a new europium PVC membrane electrode was prepared based on N-pyridine-2-carboxamido-8-aminoquinoline (PCQ) as an ion carrier. The electrode has a wide concentration range from 1.0 Multiplication-Sign 10{sup -2} and 1.0 Multiplication-Sign 10{sup -6} mol L{sup -1}, Nernstian slope of 19.8 {+-} 0.3 mV per decade and a detection limit of 6.4 Multiplication-Sign 10{sup -7} mol L{sup -1}. The potentiometric response is pH independent in the range of 2.4-7.4. The proposed sensor has a relatively fast response time less than 10 s and it can be used for at least 2 months without any considerable divergence in its potentials. The proposed electrode revealed good selectivity toward europium ion in comparison with variety of other metal ions. The practical utility of the electrodes has been demonstrated by their use as indicator electrodes in the potentiometric titration of Eu{sup 3+} ions with EDTA and for determination of Eu{sup 3+} ion concentration in mixtures of two and three different ions. - Highlights: Black-Right-Pointing-Pointer A new ion carrier is introduced to preparation of a selective sensor for Eu{sup 3+} ions. Black-Right-Pointing-Pointer This technique is very simple and it's not necessary to use sophisticated equipment. Black-Right-Pointing-Pointer The novelty of this work is the high affinity of the ionophore toward the Eu{sup 3+} ions. Black-Right-Pointing-Pointer The sensor is superior to the formerly reported Eu{sup 3+} sensors in terms of selectivity.

  17. A novel tridentate bis(phosphinic acid)phosphine oxide based europium(III)-selective Nafion membrane luminescent sensor.

    Science.gov (United States)

    Sainz-Gonzalo, F J; Popovici, C; Casimiro, M; Raya-Barón, A; López-Ortiz, F; Fernández, I; Fernández-Sánchez, J F; Fernández-Gutiérrez, A

    2013-10-21

    A new europium(III) membrane luminescent sensor based on a new tridentate bis(phosphinic acid)phosphine oxide (3) system has been developed. The synthesis of this new ligand is described and its full characterization by NMR, IR and elemental analyses is provided. The luminescent complex formed between europium(III) chloride and ligand 3 was evaluated in solution, observing that its spectroscopic and chemical characteristics are excellent for measuring in polymer inclusion membranes. Included in a Nafion membrane, all the parameters (ligand and ionic additives) that can affect the sensitivity and selectivity of the sensing membrane as well as the instrumental conditions were carefully optimized. The best luminescence signal (λexc = 229.06 nm and λem = 616.02 nm) was exhibited by the sensing film having a Nafion : ligand composition of 262.3 : 0.6 mg mL(-1). The membrane sensor showed a short response time (t95 = 5.0 ± 0.2 min) and an optimum working pH of 5.0 (25 mM acetate buffer solution). The membrane sensor manifested a good selectivity toward europium(III) ions with respect to other trivalent metals (iron, chromium and aluminium) and lanthanide(III) ions (lanthanum, samarium, terbium and ytterbium), although a small positive interference of terbium(III) ions was observed. It provided a linear range from 1.9 × 10(-8) to 5.0 × 10(-6) M with a very low detection limit (5.8 × 10(-9) M) and sensitivity (8.57 × 10(-7) a.u. per M). The applicability of this sensing film has been demonstrated by analyzing different kinds of spiked water samples obtaining recovery percentages of 95-97%.

  18. A Responsive Europium(III) Chelate that Provides a Direct Readout of pH by MRI

    Science.gov (United States)

    Wu, Yunkou; Soesbe, Todd C.; Kiefer, Garry E.; Zhao, Piyu; Sherry, A. Dean

    2010-01-01

    A europium(III) DO3A-tris(amide) complex is reported for imaging pH by MRI using ratiometric CEST principles. Deprotonation of a single phenolic proton between pH 6 and 7.6 results in an ~5 ppm shift in the water exchange CEST peak that is easily detected by MRI. Collection of two CEST images at two slightly different activation frequencies provides a direct readout of solution pH without the need of a concentration marker. PMID:20853833

  19. The influence of quasineutron configurations on {sup 161}Ta and nearby odd-A nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Joss, D. T.; Thomson, J.; Bianco, L.; O' Donnell, D.; Page, R. D.; Paul, E. S.; Sapple, P. J.; Wiseman, D. R. [Oliver Lodge Laboratory, University of Liverpool, Liverpool, L69 7ZE (United Kingdom); Lagergren, K. [Joint Institute for Heavy Ion Research, Holifield Radioactive Ion Beam Facility, Oak Ridge, TN 37381 (United States); Appelbe, D. E.; Barton, C. J.; Gomez-Hornillos, M. B.; Labiche, M.; Simpson, J.; Warner, D. D. [STFC Daresbury Laboratory, Daresbury, Warrington, WA4 4AD (United Kingdom); Cederwall, B.; Hadinia, B.; Wyss, R. [Department of Physics, Royal Institute of Technology, S-10691 Stockholm (Sweden); Darby, I. G.; Grahn, T. [Department of Physics, University of Jyvaeskylae, P.O. Box 35, FI-40014 (Finland); and others

    2011-11-30

    Several strongly coupled bands in the neutron-deficient nucleus {sup 161}Ta have been identified and quasiparticle configuration assignments have been made on the basis of rotational alignments and cranked shell model calculations. The level scheme elucidated for {sup 161}Ta highlights the competition between the {nu}(h{sub 9/2}) and {nu}(i{sub 13/2}) orbitals to form the yrast spectrum. The band structures in {sup 161}Ta also provide new insights into the structural features of other heavy odd-A nuclei populated with much lower reaction cross sections in this region at the proton drip line.

  20. 34 CFR 403.161 - How must funds be used under the Comprehensive Career Guidance and Counseling Programs?

    Science.gov (United States)

    2010-07-01

    ... Guidance and Counseling Programs? 403.161 Section 403.161 Education Regulations of the Offices of the... the Special Programs? Comprehensive Career Guidance and Counseling Programs § 403.161 How must funds be used under the Comprehensive Career Guidance and Counseling Programs? (a) A State shall use not...

  1. 33 CFR 165.161 - Safety zones: Coast Guard Captain of the Port New York annual fireworks displays.

    Science.gov (United States)

    2010-07-01

    ... of the Port New York annual fireworks displays. 165.161 Section 165.161 Navigation and Navigable... Coast Guard District § 165.161 Safety zones: Coast Guard Captain of the Port New York annual fireworks displays. (a) Safety zones. The following areas are designated safety zones: (1) Bar Beach fireworks...

  2. Spectroscopic properties and luminescence behaviour of europium doped lithium borate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Anjaiah, J., E-mail: anjaiah.juluru@gmail.com [Department of Physics, The University of Dodoma, Tanzania, East Africa (Tanzania, United Republic of); Department of Physics, Geethanjali College of Engineering and Technology, Keesara, RR Dist., Hyderabad 501 301 (India); Laxmikanth, C. [Department of Physics, The University of Dodoma, Tanzania, East Africa (Tanzania, United Republic of); Veeraiah, N. [Department of Physics, Acharya Nagarjuna University, Nagarjuna Nagar, Guntur 522 510, AP. (India)

    2014-12-01

    Li{sub 2}O–MO–B{sub 2}O{sub 3} (MO=ZnO, CaO and CdO) glasses doped with europium are prepared by using the melt quenching technique to study their absorption and luminescence properties to understand their lasing potentialities. The XRD pattern of the glasses confirmed the amorphous nature and the IR spectra reveal the presence of BO{sub 3} and BO{sub 4} units in the glass network. Judd–Ofelt intensity parameters Ω{sub λ} (λ=2, 4, 6) are evaluated from the intensities of various absorption bands of optical absorption spectra. The J–O parameters have been used to calculate transition probabilities (A), lifetime (τ{sub R}), branching ratios (β{sub R}) and stimulated emission cross-section (σ{sub P}) for the {sup 5}D{sub 0}→{sup 7}F{sub J} (J=1–4) transitions of the Eu{sup 3+} ions. The decay from the {sup 5}D{sub 0} level of Eu{sup 3+} ions in these glasses has been measured and analysed. Branching ratios and stimulated emission cross-sections measured for all these glasses show that the {sup 5}D{sub 0}→{sup 7}F{sub 1} transition under investigation has the potential for laser applications. The high stimulated emission cross-section and branching ratios from the present glasses suggests their potential for infra red lasers. The study of the thermoluminescence is also carried out and the data suggests that the CdBEu glass is suitable for thermoluminescence emission output among the three Eu{sup 3+} doped glasses.

  3. Size-dependent cytotoxicity of europium doped NaYF{sub 4} nanoparticles in endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Shizhu; Zhang, Cuimiao; Jia, Guang; Duan, Jianlei; Wang, Shuxiang, E-mail: wsx@hbu.edu.cn; Zhang, Jinchao, E-mail: jczhang6970@163.com

    2014-10-01

    Lanthanide-doped sodium yttrium fluoride (NaYF{sub 4}) nanoparticles exhibit novel optical properties which make them be widely used in various fields. The extensive applications increase the chance of human exposure to these nanoparticles and thus raise deep concerns regarding their riskiness. In the present study, we have synthesized europium doped NaYF{sub 4} (NaYF{sub 4}:Eu{sup 3+}) nanoparticles with three diameters and used endothelial cells (ECs) as a cell model to explore the potential toxic effect. The cell viability, cytomembrane integrity, cellular uptake, intracellular localization, intracellular reactive oxygen species (ROS), mitochondrial membrane potential (MMP), apoptosis detection, caspase-3 activity and expression of inflammatory gene were studied. The results indicated that these nanoparticles could be uptaken into ECs and decrease the cell viability, induce the intracellular lactate dehydrogenase (LDH) release, increase the ROS level, and decrease the cell MMP in a size-dependent manner. Besides that, the cells were suffered to apoptosis with the caspase-3 activation, and the inflammation specific gene expressions (ICAM1 and VCAM1) were also increased. Our results suggest that the damage pathway may be related to the ROS generation and mitochondrial damage. The results provide novel evidence to elucidate their toxicity mechanisms and may be helpful for more rational applications of these compounds in the future. - Highlights: • NaYF{sub 4}:Eu{sup 3+} nanoparticles with three diameters have been synthesized. • NaYF{sub 4}:Eu{sup 3+} nanoparticles could be uptaken by endothelial cells (ECs). • NaYF{sub 4}:Eu{sup 3+} nanoparticles show a significant cytotoxicity on ECs. • The size of NaYF{sub 4}:Eu{sup 3+} nanoparticles may be important to their toxicology effect.

  4. Two-dimensional high spatial-resolution dosimeter using europium doped potassium chloride: a feasibility study

    Science.gov (United States)

    Li, H. Harold; Driewer, Joseph P.; Han, Zhaohui; Low, Daniel A.; Yang, Deshan; Xiao, Zhiyan

    2014-01-01

    Recent research has shown that KCl:Eu2+ has great potential for use in megavoltage radiation therapy dosimetry because this material exhibits excellent storage performance and is reusable due to strong radiation hardness. This work reports the authors’ attempts to fabricate 2D KCl:Eu2+ storage phosphor films (SPFs) using both a physical vapor deposition (PVD) method and a tape casting method. X ray diffraction analysis showed that a 10 µm thick PVD sample was composed of highly crystalline KCl. No additional phases were observed, suggesting that the europium activator had completed been incorporated into the KCl matrix. Photostimulated luminescence and photoluminescence spectra suggested that F (Cl-) centers were the electron storage centers post×ray irradiation and that Eu2+ cations acted as luminescence centers in the photostimulation process. The 150-µm thick casted KCl:Eu2+ SPF showed sub-millimeter spatial resolution. Monte Carlo simulations further demonstrated that the admixture of 20% KCl:Eu2+ and 80% low Z polymer binder exhibited almost no energy dependence in a 6 MV beam. KCl:Eu2+ pellet samples showed a large dynamic range from 0.01 cGy to 60 Gy dose-to-water, and saturated at approximately 500 Gy as a result of KCl’s intrinsic high radiation hardness. Taken together, this work provides strong evidence that KCl:Eu2+ based SPF with associated readout apparatus could result in a novel electronic film system that has all the desirable features associated with classic radiographic film and, importantly, water equivalence and the capability of permanent identification of each detector. PMID:24651448

  5. A Novel Europium Chelate Coated Nanosphere for Time-Resolved Fluorescence Immunoassay

    Science.gov (United States)

    Shen, Yifeng; Xu, Shaohan; He, Donghua

    2015-01-01

    A novel europium ligand 2, 2’, 2’’, 2’’’-(4, 7-diphenyl-1, 10-phenanthroline-2, 9-diyl) bis (methylene) bis (azanetriyl) tetra acetic acid (BC-EDTA) was synthesized and characterized. It shows an emission spectrum peak at 610 nm when it is excited at 360 nm, with a large Stock shift (250 nm). It is covalently coated on the surface of a bare silica nanosphere containi free amino groups, using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and N-Hydroxysuccinimide. We also observed an interesting phenomenon that when BC-EDTA is labeled with a silica nanosphere, the chelate shows different excitation spectrum peaks of about 295 nm. We speculate that the carboxyl has a significant influence on its excitation spectrum. The BC-EDTA/Eu3+coated nanosphere could be used as a fluorescent probe for time-resolved fluorescence immunoassay. We labeled the antibody with the fluorescent nanosphere to develop a nanosphere based hepatitis B surface antigen as a time-resolved fluorescence immunoassay reagent, which is very easy to operate and eliminates potential contamination of Eu3+ contained in the environment. The analytical and functional sensitivities are 0.0037 μg/L and 0.08 μg/L (S/N≥2.0) respectively. The detection range is 0.08-166.67 μg/L, which is much wider than that of ELISA (0.2-5μg/L). It is comparable to the commercial dissociation-enhanced lanthanide fluoro-immunoassay system (DELFIA) reagents (0.2-145μg/L). We propose that it can fulfill clinical applications. PMID:26056826

  6. A Novel Europium Chelate Coated Nanosphere for Time-Resolved Fluorescence Immunoassay.

    Directory of Open Access Journals (Sweden)

    Yifeng Shen

    Full Text Available A novel europium ligand 2,2',2'',2'''-(4,7-diphenyl-1,10-phenanthroline-2,9-diyl bis (methylene bis (azanetriyl tetra acetic acid (BC-EDTA was synthesized and characterized. It shows an emission spectrum peak at 610 nm when it is excited at 360 nm, with a large Stock shift (250 nm. It is covalently coated on the surface of a bare silica nanosphere containi free amino groups, using 1-ethyl-3-(3-dimethylaminopropyl carbodiimide hydrochloride and N-Hydroxysuccinimide. We also observed an interesting phenomenon that when BC-EDTA is labeled with a silica nanosphere, the chelate shows different excitation spectrum peaks of about 295 nm. We speculate that the carboxyl has a significant influence on its excitation spectrum. The BC-EDTA/Eu3+coated nanosphere could be used as a fluorescent probe for time-resolved fluorescence immunoassay. We labeled the antibody with the fluorescent nanosphere to develop a nanosphere based hepatitis B surface antigen as a time-resolved fluorescence immunoassay reagent, which is very easy to operate and eliminates potential contamination of Eu3+ contained in the environment. The analytical and functional sensitivities are 0.0037 μg/L and 0.08 μg/L (S/N≥2.0 respectively. The detection range is 0.08-166.67 μg/L, which is much wider than that of ELISA (0.2-5 μg/L. It is comparable to the commercial dissociation-enhanced lanthanide fluoro-immunoassay system (DELFIA reagents (0.2-145 μg/L. We propose that it can fulfill clinical applications.

  7. TOF SIMS analysis and generation of white photoluminescence from strontium silicate codoped with europium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Tshabalala, Modiehi A.; Swart, Hendrik C.; Ntwaeaborwa, Odireleng M., E-mail: ntwaeab@ufs.ac.za [Department of Physics, University of the Free State, P.O Box 339, Bloemfontein 9300 South Africa (South Africa)

    2014-03-15

    White light emitting terbium (Tb{sup 3+}) and europium (Eu{sup 3+}) codoped strontium silicate (Sr{sub 2}SiO{sub 4}) phosphors were prepared by a solid state reaction process. The structure, particle morphology, chemical composition, ion distribution, photoluminescence (PL), and decay characteristics of the phosphors were analyzed by x-ray diffraction (XRD), scanning electron microscopy (SEM), time-of-flight secondary ion mass spectrometry (TOF-SIMS), and PL spectroscopy, respectively. The XRD data showed that our Sr{sub 2}SiO{sub 4} composed of two phases, namely, β-Sr{sub 2}SiO{sub 4} and α′-Sr{sub 2}SiO{sub 4}, and the α′-Sr{sub 2}SiO{sub 4} phase was more prominent than the β-Sr{sub 2}SiO{sub 4} phase. The SEM micrographs showed that the particles were agglomerated together and they did not have definite shapes. All ions (i.e., negative and positive) present in our materials were identified by TOF-SIMS. In addition, the chemical imaging performed with the TOF-SIMS demonstrated how the individual ions including the dopants (Eu{sup 3+} and Tb{sup 3+}) were distributed in the host lattice. White photoluminescence was observed when the Sr{sub 2}SiO{sub 4}:Tb{sup 3+}, Eu{sup 3+} phosphor was excited at 239 nm using a monochromatized xenon lamp as the excitation source. The phosphor exhibited fast decay lifetimes implying that it is not a good candidate for long afterglow applications.

  8. Thermoluminescence of europium-doped zinc oxide exposed to beta particle irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Iriqui R, J. L.; Cruz V, C. [Universidad de Sonora, Departamento de Investigacion en Polimeros y Materiales, Apdo. Postal 130, 83000 Hermosillo, Sonora (Mexico); Bernal, R. [Universidad de Sonora, Departamento de Investigacion en Fisica, Apdo. Postal 5-088, 83000 Hermosillo, Sonora (Mexico); Castano, V. M., E-mail: jorgeiriqui@gimmunison.com [UNAM, Instituto de Fisica, Centro de Fisica Aplicada y Tecnologia Avanzada, Apdo. Postal 1-1010, 76000 Queretaro, Qro. (Mexico)

    2015-10-15

    Full text: Zn O is a promising material for a range of optoelectronics applications, due to its direct wide band gap (E{sub g} ∼3.3 eV at 300 K) and large exciton binding energy (60 MeV). Its applications include UV light emitters, varistors, surface acoustic wave devices, piezoelectric transducers, and chemical and gas sensing. Rare-earth activation of phosphors has long been seen as an effective process since coupling energy into the rare-earth-ion site, either by ionization, charge exchange or a resonance energy process, results in light production. It is reported that Europium modifies the response thermoluminescence (Tl) for pure zinc oxide, when is irradiated with X-ray, created a peak at 365 degrees C. In this work, Zn O:Eu phosphors were synthesized by a chemical method. Some samples were exposed to beta particle irradiation for doses ranging from 1 up to 100 Gy. Tl response as a function of dose is linear throughout the studied dose range. The glow curve exhibits three maxima, centered at 176, 279 and 340 degrees C. The reusability studies obtained after ten repeated cycles of annealing irradiation readout for the Zn O:Eu shows that the variation in the Tl response is ten percent and tends to stabilization. The results indicate that these new Zn O:Eu phosphors are promising detectors and dosimeters for beta radiation. The structural and morphological characterization was carried out by X-ray diffraction and scanning electron microscopy, respectively. (Author)

  9. Yeast Interacting Proteins Database: YGL161C, YDR084C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGL161C YIP5 Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computational...GTPases, localized to late Golgi vesicles; computational analysis of large-scale protein-protein interaction

  10. 22 CFR 161.10 - Non-Federal applicants for permits.

    Science.gov (United States)

    2010-04-01

    ... IMPLEMENTATION OF THE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) Coordination of Other Requirements of NEPA § 161... permits for the construction of bridges and oil pipelines that cross the international boundaries with...

  11. Synthesis and characterization of barium titanate, doped with europium and neodymium; Sintese e caracterizacao de titanato de bario, dopados com europio e neodimio

    Energy Technology Data Exchange (ETDEWEB)

    Sousa, Fernanda L.C.; Cabral, Alciney M.; Silva, Ademir O.; Oliveiro, Joao B.L., E-mail: nanda_louise@yahoo.com.br [Universidade Federal do Rio Grande do Norte (UFRN), Natal (Brazil). Instituto de Quimica

    2013-07-01

    This work aims at synthesize and characterize mixed oxides in Barium Titanium matrix in doping with Neodymium and Europium analyzing thermogravimetric curves, characteristic bands at infrared region of the polymer complex, which are intermediates to mixed oxides, and identify the formation thereof, and the crystallinity using XRD analysis.

  12. Stability constants of the Europium complexes with the chloride ions; Constantes de estabilidad de los complejos del europio con los iones cloruro

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)

    2000-07-01

    The stability constants of lanthanides complexes with chloride ions which were determined at the same ionic force but in different media, are significantly different. It does not exist a systematic study over these stability constants. The purpose of this work is to determine the stability constants of the europium complexes with chloride ions at 303 K, by the solvents extraction method. (Author)

  13. LA-ICP-MS Allows Quantitative Microscopy of Europium-Doped Iron Oxide Nanoparticles and is a Possible Alternative to Ambiguous Prussian Blue Iron Staining.

    Science.gov (United States)

    Scharlach, Constantin; Müller, Larissa; Wagner, Susanne; Kobayashi, Yuske; Kratz, Harald; Ebert, Monika; Jakubowski, Norbert; Schellenberger, Eyk

    2016-05-01

    The development of iron oxide nanoparticles for biomedical applications requires accurate histological evaluation. Prussian blue iron staining is widely used but may be unspecific when tissues contain substantial endogenous iron. Here we tested whether microscopy by laser ablation coupled to inductively coupled plasma mass spectrometry (LA-ICP-MS) is sensitive enough to analyze accumulation of very small iron oxide particles (VSOP) doped with europium in tissue sections. For synthesis of VSOP, a fraction of Fe3+ (5 wt%) was replaced by Eu3+, resulting in particles with 0.66 mol% europium relative to iron (Eu-VSOP) but with otherwise similar properties as VSOP. Eu-VSOP or VSOP was intravenously injected into ApoE-/- mice on Western cholesterol diet and accumulated in atherosclerotic plaques of these animals. Prussian blue staining was positive for ApoE-/- mice with particle injection but also for controls. LA-ICP-MS microscopy resulted in sensitive and specific detection of the europium of Eu-VSOP in liver and atherosclerotic plaques. Furthermore, calibration with Eu-VSOP allowed calculation of iron and particle concentrations in tissue sections. The combination of europium-doped iron oxide particles and LA-ICP-MS microscopy provides a new tool for specific and quantitative analysis of particle distribution at the tissue level and allows correlation with other elements such as endogenous iron.

  14. Novel Time-Resolved Fluorescence Europium Nanoparticle Immunoassay for Detection of Human Immunodeficiency Virus-1 Group O Viruses Using Microplate and Microchip Platforms.

    Science.gov (United States)

    Haleyur Giri Setty, Mohan Kumar; Liu, Jikun; Mahtani, Prerna; Zhang, Panhe; Du, Bingchen; Ragupathy, Viswanath; Devadas, Krishnakumar; Hewlett, Indira K

    2016-06-01

    Accurate detection and quantification of HIV-1 group O viruses have been challenging for currently available HIV assays. We have developed a novel time-resolved fluorescence (TRF) europium nanoparticle immunoassay for HIV-1 group O detection using a conventional microplate enzyme-linked immunosorbent assay (ELISA) and a microchip platform. We screened several antibodies for optimal reactivity with several HIV-1 group O strains and identified antibodies that can detect all the strains of HIV-1 group O that were available for testing. The antibodies were used to develop a conventional ELISA format assay and an in-house developed europium nanoparticle-based assay for sensitivity. The method was evaluated on both microwell plate and microchip platforms. We identified two specific and sensitive antibodies among the six we screened. The antibodies, C65691 and ANT-152, were able to quantify 15 and detect all 17 group O viruses, respectively, as they were broadly cross-reactive with all HIV-1 group O strains and yielded better signals compared with other antibodies. We have developed a sensitive assay that reflects the actual viral load in group O samples by using an appropriate combination of p24 antibodies that enhance group O detection and a highly sensitive TRF-based europium nanoparticle for detection. The combination of ANT-152 and C65690M in the ratio 3:1 was able to give significantly higher signals in our europium-based assay compared with using any single antibody.

  15. Lanthanide-to-lanthanide energy-transfer processes operating in discrete polynuclear complexes: can trivalent europium be used as a local structural probe?

    Science.gov (United States)

    Zaïm, Amir; Eliseeva, Svetlana V; Guénée, Laure; Nozary, Homayoun; Petoud, Stéphane; Piguet, Claude

    2014-09-15

    This work, based on the synthesis and analysis of chemical compounds, describes a kinetic approach for identifying intramolecular intermetallic energy-transfer processes operating in discrete polynuclear lanthanide complexes, with a special emphasis on europium-containing entities. When all coordination sites are identical in a (supra)molecular complex, only heterometallic communications are experimentally accessible and a Tb → Eu energy transfer could be evidenced in [TbEu(L5)(hfac)6] (hfac = hexafluoroacetylacetonate), in which the intermetallic separation amounts to 12.6 Å. In the presence of different coordination sites, as found in the trinuclear complex [Eu3(L2)(hfac)9], homometallic communication can be induced by selective laser excitation and monitored with the help of high-resolution emission spectroscopy. The narrow and non-degenerated character of the Eu((5)D0 ↔ (7)F0) transition excludes significant spectral overlap between donor and acceptor europium cations. Intramolecular energy-transfer processes in discrete polynuclear europium complexes are therefore limited to short distances, in agreement with the Fermi golden rule and with the kinetic data collected for [Eu3(L2)(hfac)9] in the solid state and in solution. Consequently, trivalent europium can be considered as a valuable local structural probe in discrete polynuclear complexes displaying intermetallic separation in the sub-nanometric domain, a useful property for probing lanthanido-polymers. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Optical isomers of N,N′-bis(1-phenylethyl)-2,6-pyridinedicarboxamide coordinated to europium(III) ions as reliable circularly polarized luminescence calibration standards†

    Science.gov (United States)

    Bonsall, Steven D.; Houcheime, Mona; Straus, Daniel A.; Muller, Gilles

    2009-01-01

    The synthesis of two optical isomers of N,N′-bis(1-phenylethyl)-2,6-pyridinedicarboxamide and the constant circularly polarized luminescence (CPL) activity of their acetonitrile trivalent europium complex solutions over a long period of time open new perspectives for performing accurate routine CPL calibration tests at low cost. PMID:17728891

  17. Photoluminescence behavior of europium (III) complexes containing 1-(4-tert-butylphenyl)-3-(2-naphthyl)-propane-1,3-dione ligand.

    Science.gov (United States)

    Wang, Dunjia; Zheng, Chunyang; Fan, Ling; Hu, Yanjun; Zheng, Jing

    2014-01-03

    Three novel europium complexes with 1-(4-tert-butylphenyl)-3-(2-naphthyl)-propane-1,3-dione (TNPD) and 2,2-dipyridine (Bipy) or 1,10-phenan-throline (Phen) were synthesized and confirmed by FT-IR, (1)H NMR, UV-vis absorption and elemental analysis. Photoluminescence behavior of complexes Eu(TNPD)3, Eu(TNPD)3·Bipy and Eu(TNPD)3·Phen were investigated in detail. Their emission spectra exhibited the characteristic emission bands that arise from the (5)D0→(7)FJ (J=0-4) transitions of the europium ion in solid state. Meanwhile, the results of their lifetime decay curves indicated that only one chemical environment existed around the europium ion. The intrinsic luminescence quantum efficiency (η) and the experimental intensity parameters (Ωt) of europium complexes were determined according to the emission spectra and luminescence decay curves in solid state. The complex Eu(TNPD)3·Phen showed much longer lifetime (τ) and higher luminescence quantum efficiency (η) than complexes Eu(TNPD)3 and Eu(TNPD)3·Bipy. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Synthesis, crystal structure and photophysical properties of europium(III) and terbium(III) complexes with pyridine-2,6-dicarboxamide

    NARCIS (Netherlands)

    Tanase, S.; Gallego, P.M.; Gelder, R. de; Fu, W.T.

    2007-01-01

    The reactions of pyridine-2,6-dicarboxamide with europium(III) and terbium(III) triflates led to the formation of mononuclear complexes of formula [Ln(pcam)(3)](CF3SO3)(3) (Ln = Eu 1, Tb 2; pcam stands for pyridine-2,6-dicarboxamide). From single-crystal X-ray diffraction analysis, the complexes

  19. Structural investigation and photoluminescent properties of gadolinium(III), europium(III) and terbium(III) 3-mercaptopropionate complexes.

    Science.gov (United States)

    Souza, E R; Mazali, I O; Sigoli, F A

    2014-01-01

    This work reports on the synthesis, crystallographic determination and spectroscopic characterization of gadolinium(III), terbium(III) and europium(III) 3-mercaptopropionate complexes, aqua-tris(3-mercaptopropionate)lanthanide(III)--[Ln(mpa)3(H2O)]. The Judd-Ofelt intensity parameters were experimentally determined from emission spectrum of the [Eu(mpa)3(H2O)]complex and they were also calculated from crystallographic data. The complexes are coordination polymers, where the units of each complex are linked together by carboxylate groups leading to an unidimensional and parallel chains that by chemical interactions form a tridimensional framework. The emission spectrum profile of the [Eu(mpa)3(H2O)] complex is discussed based on point symmetry of the europium(III) ion, that explains the bands splitting observed in its emission spectrum. Photoluminescent analysis of the [Gd(mpa)3(H2O)] complex show no efficient ligand excitation but an intense charge transfer band. The excitation spectra of the [Eu(mpa)3(H2O)] and [Tb(mpa)3(H2O)] complexes do not show evidence of energy transfer from the ligand to the excited levels of these trivalent ions. Therefore the emission bands are originated only by direct f-f intraconfigurational excitation of the lantanide(III) ions.

  20. Simple preparation of fluorescent composite films based on cerium and europium doped LaF3 nanoparticles

    Science.gov (United States)

    Secco, Henrique de L.; Ferreira, Fabio F.; Péres, Laura O.

    2018-03-01

    The combination of materials to form hybrids with unique properties, different from those of the isolated components, is a strategy used to prepare functional materials with improved properties aiming to allow their application in specific fields. The doping of lanthanum fluoride with other rare earth elements is used to obtain luminescent particles, which may be useful to the manufacturing of electronic devices' displays and biological markers, for instance. The application of the powder of nanoparticles has limitations in some fields; to overcome this, the powder may be incorporated in a suitable polymeric matrix. In this work, lanthanum fluoride nanoparticles, undoped and doped with cerium and europium, were synthesized through the co-precipitation method in aqueous solution. Aiming the formation of solid state films, composites of nanoparticles in an elastomeric matrix, the nitrile rubber (NBR), were prepared. The flexibility and the transparency of the matrix in the regions of interest are advantages for the application of the luminescent composites. The composites were applied as films using the casting and the spin coating techniques and luminescent materials were obtained in the samples doped with europium and cerium. Scanning electron microscopy images showed an adequate dispersion of the particles in the matrix in both film formation techniques. Aggregates of the particles were detected in the samples which may affect the uniformity of the emission of the composites.

  1. A microwave-assisted solution combustion synthesis to produce europium-doped calcium phosphate nanowhiskers for bioimaging applications.

    Science.gov (United States)

    Wagner, Darcy E; Eisenmann, Kathryn M; Nestor-Kalinoski, Andrea L; Bhaduri, Sarit B

    2013-09-01

    Biocompatible nanoparticles possessing fluorescent properties offer attractive possibilities for multifunctional bioimaging and/or drug and gene delivery applications. Many of the limitations with current imaging systems center on the properties of the optical probes in relation to equipment technical capabilities. Here we introduce a novel high aspect ratio and highly crystalline europium-doped calcium phosphate nanowhisker produced using a simple microwave-assisted solution combustion synthesis method for use as a multifunctional bioimaging probe. X-ray diffraction confirmed the material phase as europium-doped hydroxyapatite. Fluorescence emission and excitation spectra and their corresponding peaks were identified using spectrofluorimetry and validated with fluorescence, confocal and multiphoton microscopy. The nanowhiskers were found to exhibit red and far red wavelength fluorescence under ultraviolet excitation with an optimal peak emission of 696 nm achieved with a 350 nm excitation. Relatively narrow emission bands were observed, which may permit their use in multicolor imaging applications. Confocal and multiphoton microscopy confirmed that the nanoparticles provide sufficient intensity to be utilized in imaging applications. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  2. Europium nanoparticle-based simple to perform dry-reagent immunoassay for the detection of hepatitis B surface antigen.

    Science.gov (United States)

    Talha, Sheikh M; Salminen, Teppo; Juntunen, Etvi; Spangar, Anni; Gurramkonda, Chandrasekhar; Vuorinen, Tytti; Khanna, Navin; Pettersson, Kim

    2016-03-01

    Hepatitis B infection, caused by hepatitis B virus (HBV), presents a huge global health burden. Serological diagnosis of HBV mainly relies on the detection of hepatitis B surface antigen (HBsAg). Although there are high sensitivity commercial HBsAg enzyme immunoassays (EIAs) available, many low-resource laboratories lacking trained technicians continue to use rapid point-of-care assays with low sensitivities for HBsAg detection, due to their simplicity to operate. We developed a time-resolved fluorometric dry-reagent HBsAg immunoassay which meets the detection limit of high sensitivity EIAs but is simple to operate. To develop the assay, anti-HBsAg monoclonal antibody coated on europium nanoparticles was dried atop of biotinylated anti-HBsAg polyclonal antibody immobilized on streptavidin-coated microtiter wells. To test a sample in dry-reagent assay, serum sample and assay buffer were added to the wells, incubated, washed and europium signals were measured. The assay showed a detection limit of 0.25 ng/ml using HBsAg spiked in serum sample. When evaluated with 24 HBV positive and 37 negative serum samples, assay showed 100% sensitivity and specificity. Assay wells are stable for at least 26 weeks when stored at 4°C, and can tolerate elevated temperatures of up to 35°C for two weeks. The developed assay has high potential to be used in low-resource laboratories. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Bright mono-aqua europium complexes based on triazacyclononane that bind anions reversibly and permeate cells efficiently.

    Science.gov (United States)

    Butler, Stephen J; McMahon, Brian K; Pal, Robert; Parker, David; Walton, James W

    2013-07-15

    A series of five europium(III) complexes has been prepared from heptadentate N5O2 ligands that possess a brightness of more than 10 mM(-1) cm(-1) in water, following excitation over the range λ=330-355 nm. Binding of several oxy anions has been assessed by emission spectral titrimetric analysis, with the binding of simple carboxylates, lactate and citrate involving a common ligation mode following displacement of the coordinated water. Selectivity for bicarbonate allows the rapid determination of this anion in human serum, with K(d)=37 mM (295 K). The complexes are internalised quickly into mammalian cells and exhibit a mitochondrial localisation at early time points, migrating after a few hours to reveal a predominant lysosomal distribution. Herein, we report the synthesis and complexation behaviour of strongly emissive europium (III) complexes that bind oxy-anions in aqueous media with an affinity and selectivity profile that is distinctively different from previously studied systems. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Highly luminescent charge-neutral europium(iii) and terbium(iii) complexes with tridentate nitrogen ligands.

    Science.gov (United States)

    Senthil Kumar, Kuppusamy; Schäfer, Bernhard; Lebedkin, Sergei; Karmazin, Lydia; Kappes, Manfred M; Ruben, Mario

    2015-09-21

    We report on the synthesis of tridentate-nitrogen pyrazole-pyridine-tetrazole (L(1)H) and pyrazole-pyridine-triazole (L(2)H) ligands and their complexation with lanthanides (Ln = Gd(iii), Eu(iii) and Tb(iii)) resulting in stable, charge-neutral complexes Ln(L(1))3 and Ln(L(2))3, respectively. X-ray crystallographic analysis of the complexes with L(1) ligands revealed tricapped trigonal coordination geometry around the lanthanide ions. All complexes show bright photoluminescence (PL) in the solid state, indicating efficient sensitization of the lanthanide emission via the triplet states of the ligands. In particular, the terbium complexes show high PL quantum yields of 65 and 59% for L(1) and L(2), respectively. Lower PL efficiencies of the europium complexes (7.5 and 9%, respectively) are attributed to large energy gaps between the triplet states of the ligands and accepting levels of Eu(iii). The triplet state energy can be reduced by introducing an electron withdrawing (EW) group at the 4 position of the pyridine ring. Such substitution of L(1)H with a carboxylic ester (COOMe) EW group leads to a europium complex with increased PL quantum yield of 31%. A comparatively efficient PL of the complexes dissolved in ethanol indicates that the lanthanide ions are shielded against nonradiative deactivation via solvent molecules.

  5. Highly Sensitive Luminescence Assessment of Bile Acid Using a Balofloxacin-Europium(III) Probe in Micellar Medium

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Huan; Zhao, Fang; Si, Hailin; Zhang, Shuaishuai; Wang, Chunchun; Qi, Peirong [Shihezi Univ., Shihezi (China)

    2012-12-15

    A novel and simple method of luminescence enhancement effect for the determination of trace amounts of bile acid was proposed. The procedure was based on the luminescence intensity of the balofloxacin-europium(III) complex that could be strongly enhanced by bile acid in the presence of sodium dodecyl benzene sulfonate (SDBS). Under the optimum conditions, the enhanced luminescence intensity of the system exhibited a good linear relationship with the bile acid concentration in the range 5.0 Χ 10{sup -9} - 7.0 Χ 10{sup -7} mol L{sup -1} with a detection limit of 1.3 Χ 10{sup -9} mol L.1 (3σ). The relative standard deviation (RSD) was 1.7% (n = 11) for 5.0 Χ 10{sup -8} mol L{sup -1} bile acid. The applicability of the method to the determination of bile acid was demonstrated by investigating the effect of potential interferences and by analyzing human serum and urine samples. The possible enhancement mechanism of luminescence intensity in balofloxacin-europium(III)-bile acid-SDBS system was also discussed briefly.

  6. Investigation of the influence of silver and tin on the luminescence of trivalent europium ions in glass

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez, J.A. [Department of Chemistry, University of Puerto Rico, Mayagueez, PR 00681 (United States); Lysenko, S. [Department of Physics, University of Puerto Rico, Mayagueez, PR 00681 (Puerto Rico); Liu, H., E-mail: hliu@uprm.ed [Department of Physics, University of Puerto Rico, Mayagueez, PR 00681 (Puerto Rico); Fachini, E.; Cabrera, C.R. [Center for Nanoscale Materials, University of Puerto Rico, Rio Piedras, PR 00931 (Puerto Rico)

    2010-01-15

    Europium-doped aluminophosphate glasses prepared by the melt-quenching technique have been studied by photoluminescence (PL) and X-ray photoelectron spectroscopy (XPS). The effects of silver and tin doping, and of further thermal processing on Eu{sup 3+} ions luminescence have been assessed. For the glass system containing only europium, Eu{sup 3+} PL observed under UV excitation is suggested to occur through energy transfer from the excited glass host. After silver and tin doping, an enhanced UV excited Eu{sup 3+} PL has been indicated to occur essentially due to radiative energy transfer from isolated Ag{sup +} ions and/or two fold-coordinated Sn centers. Since thermal processing of the material leads to a quenching effect on Eu{sup 3+} PL and Ag nanoparticles (NPs) formation due to reduction of silver ions by tin, XPS was employed in order to investigate the possibility for Eu{sup 3+}->Eu{sup 2+} reduction during HT as a potential source of the PL decrease. The data points towards Ag NPs as main responsible for the observed weakening of Eu{sup 3+} PL.

  7. Biologic and serologic characterization of the 161A strain of Naegleria fowleri.

    Science.gov (United States)

    Visvesvara, G S; Healy, G R

    1975-01-01

    The 161A strain of Naegleria isolated from the nasal swab of a boy (9) was grown axenically in Nelson's medium. When 10,000 amoebae from the axenic medium were inoculated onto each monkey kidney cell (Vero) culture, characteristic cytopathic effects (CPE) were noticed in 4 to 5 days. The CPE consisted of granulation of the host cell cytoplasm, cell shrinkage, nuclear pycnosis, and discontinuity of cell sheet. When 10,000 amoebae were instilled intranasally into a group of ten 2- to 3-week-old mice, 8 of the 10 mice exhibited characteristic symptoms of primary amoebic meningoencephalitis and died within 10 to 12 days. Histopathology of the brain revealed necrotic tissue and an acute inflammatory reaction in the superficial regions of the brain. In the gel diffusion and immunoelectrophoresis tests the sonically disrupted antigens of 161A amoebae reacted extensively with the hyper-immune sera against 3 strains (CA, CJ, HB-1) of pathogenic N. fowleri and produced patterns very similar to those produced by the homologous systems. Further, anti-HB-1 serum absorbed with the 161A antigens failed to react with the antigens of HB-1, CA, CJ, and 161A strains thus indicating antigenic identity of 161A strain with N. fowleri. In view of these observations it was concluded that the strain 161A is pathogenic and should be reclassified as N. fowleri.

  8. Circulating Glucagon 1-61 Regulates Blood Glucose by Increasing Insulin Secretion and Hepatic Glucose Production

    Directory of Open Access Journals (Sweden)

    Nicolai J. Wewer Albrechtsen

    2017-11-01

    Full Text Available Glucagon is secreted from pancreatic α cells, and hypersecretion (hyperglucagonemia contributes to diabetic hyperglycemia. Molecular heterogeneity in hyperglucagonemia is poorly investigated. By screening human plasma using high-resolution-proteomics, we identified several glucagon variants, among which proglucagon 1-61 (PG 1-61 appears to be the most abundant form. PG 1-61 is secreted in subjects with obesity, both before and after gastric bypass surgery, with protein and fat as the main drivers for secretion before surgery, but glucose after. Studies in hepatocytes and in β cells demonstrated that PG 1-61 dose-dependently increases levels of cAMP, through the glucagon receptor, and increases insulin secretion and protein levels of enzymes regulating glycogenolysis and gluconeogenesis. In rats, PG 1-61 increases blood glucose and plasma insulin and decreases plasma levels of amino acids in vivo. We conclude that glucagon variants, such as PG 1-61, may contribute to glucose regulation by stimulating hepatic glucose production and insulin secretion.

  9. Behaviour of europium (III) and its hydroxo and carbonate complexes in a solvent extraction system with HDBM in 2 M NaCl at 303 K

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez-Reyes, M. [Inst. Nacional de Investigaciones Nucleares, Dept. de Quimica, Mexico, D. F. (Mexico); Univ. Autonoma Metropolitana-Iztapalapa, Area de Electroquimica, Mexico, D. F. (Mexico); Solache-Rios, M. [Inst. Nacional de Investigaciones Nucleares, Dept. de Quimica, Mexico, D. F. (Mexico); Rojas-Hernandez, A. [Univ. Autonoma Metropolitana-Iztapalapa, Area de Electroquimica, Mexico, D. F. (Mexico)

    1999-07-01

    The behaviour of europium in the solvent extraction system Eu{sup 3+}-water-2 M NaCl-HDBM-benzene was studied, taking into account the pC{sub H} and the carbonate ion concentration in the solutions. The stability constants for the hydrolysis and carbonate complexes of europium were determined at 303 K in the same medium by pH titration followed by a computational refinement. The obtained data were: log {beta}{sub Eu,H} = -8.29 {+-} 0.02, log {beta}{sub Eu,2H} = -16.37 {+-} 0.02, log {beta}{sub Eu,3H} = -24.54 {+-} 0.11, log {beta}{sub Eu,4H} = -34.91 {+-} 0.26, log {beta}{sub CO{sub 2}{sup 2-},H} = 9.30 {+-} 0.05, log {beta}{sub Eu,CO{sub 3}{sup 2-}} = 5.96 {+-} 0.03, log {beta}{sub Eu,CO{sub 3}{sup 2-},H} = -1.24 {+-} 0.05 and log {beta}{sub Eu,CO{sub 3}{sup 2-},2H} = -11.39 {+-} 0.11. Log K{sub W} was -13.78 {+-} 0.06. The behaviour of europium in this solvent extraction system was simulated, taking into account the hydrolysis and carbonate complexes plus the formation of Eu(DBM){sub 3}(OH){sup 1-} and Eu(DBM){sub 3}(CO{sub 3}){sup 2-} in the aqueous phase. The only europium species considered in the organic phase was Eu(DBM){sub 3}. The first hydrolysis constant of europium was also determined by using this solvent extraction system under the same conditions. A good conformity was found with the results obtained by both techniques. (orig.)

  10. Bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex a new apoptotic agent through Flk-1 down regulation, caspase-3 activation and oligonucleosomes DNA fragmentation.

    Science.gov (United States)

    Azab, Hassan A; Hussein, Belal H M; El-Azab, Mona F; Gomaa, Mohamed; El-Falouji, Abdullah I

    2013-01-01

    New bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex was synthesized and characterized. In vivo anti-angiogenic activities of bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex against Ehrlich ascites carcinoma (EAC) cells are described. The newly synthesized complex resulted in inhibition of proliferation of EAC cells and ascites formation. The anti-tumor effect was found to be through anti-angiogenic activity as evident by the reduction of microvessel density in EAC solid tumors. The anti-angiogenic effect is mediated through down-regulation of VEGF receptor type-2 (Flk-1). The complex was also found to significantly increase the level of caspase-3 in laboratory animals compared to the acridine ligand and to the control group. This was also consistent with the DNA fragmentation detected by capillary electrophoresis that proved the apoptotic effect of the new complex. Our complex exhibited anti-angiogenic and apoptotic activity in vivo, a thing that makes it a potential effective chemotherapeutic agent. The interaction of calf thymus DNA (ct-DNA) with bis(acridine-9-carboxylate)-nitro-europium(III) dihydrate complex has been investigated using fluorescence technique. A competitive experiment of the europium(III)-acridine complex with ethidium bromide (EB) to bind DNA revealed that interaction between the europium(III)-acridine and DNA was via intercalation. The interaction of the synthesized complex with tyrosine kinases was also studied using molecular docking simulation to further substantiate its mode of action. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Europium(III) reduction and speciation within a Wells-Dawson heteropolytungstate.

    Science.gov (United States)

    Jing, Jing; Burton-Pye, Benjamin P; Francesconi, Lynn C; Antonio, Mark R

    2008-08-04

    The redox speciation of Eu(III) in the 1:1 stoichiometric complex with the alpha-1 isomer of the Wells-Dawson anion, [alpha-1-P 2W 17O 61] (10-), was studied by electrochemical techniques (cyclic voltammetry and bulk electrolysis), in situ XAFS (X-ray absorption fine structure) spectroelectrochemistry, NMR spectroscopy ( (31)P), and optical luminescence. Solutions of K 7[(H 2O) 4Eu(alpha-1-P 2W 17O 61)] in a 0.2 M Li 2SO 4 aqueous electrolyte (pH 3.0) show a pronounced concentration dependence to the voltammetric response. The fully oxidized anion and its reduced forms were probed by Eu L 3-edge XANES (X-ray absorption near edge structure) measurements in simultaneous combination with controlled potential electrolysis, demonstrating that Eu(III) in the original complex is reduced to Eu(II) in conjunction with the reduction of polyoxometalate (POM) ligand. After exhaustive reduction, the heteropoly blue species with Eu(II) is unstable with respect to cluster isomerization, fragmentation, and recombination to form three other Eu-POMs as well as the parent Wells-Dawson anion, alpha-[P 2W 18O 62] (6-). EXAFS data obtained for the reduced, metastable Eu(II)-POM before the onset of Eu(II) autoxidation provides an average Eu-O bond length of 2.55(4) A, which is 0.17 A longer than that for the oxidized anion, and consistent with the 0.184 A difference between the Eu(II) and Eu(III) ionic radii. The reduction of Eu(III) is unusual among POM complexes with Lindqvist and alpha-2 isomers of Wells-Dawson anions, that is, [Eu(W 5O 18) 2] (9-) and [Eu(alpha-2-As 2W 17O 61) 2] (17-), but not to the Preyssler complex anion, [EuP 5W 30O 110] (12-), and fundamental studies of materials based on coupling Eu and POM redox properties are still needed to address new avenues of research in europium hydrometallurgy, separations, and catalysis sciences.

  12. Structural, optical and electrical properties of europium picrate tetraethylene glycol complex as emissive material for OLED

    Energy Technology Data Exchange (ETDEWEB)

    Kusrini, Eny, E-mail: ekusrini@che.ui.ac.id [Department of Chemical Engineering, Faculty of Engineering, Universitas Indonesia, 16424 Depok (Indonesia); Saleh, Muhammad I.; Adnan, Rohana [School of Chemical Sciences, Universiti Sains Malaysia, 11800 Penang (Malaysia); Yulizar, Yoki [Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, 16424 Depok (Indonesia); Sha Shiong, Ng; Fun, H.K. [School of Physics, Universiti Sains Malaysia, 11800 Penang (Malaysia); Adhha Abdullah, M.A.; Mamat, Mazidah [Department of Chemical Sciences, Faculty of Science and Technology, Universiti Malaysia Terengganu, 21030 Kuala Terengganu, Terengganu Darul Iman (Malaysia); Za' aba, N.K.; Abd. Majid, W.H. [Solid State Research Laboratory, Department of Physics, Universiti Malaya, 50603 Kuala Lumpur (Malaysia)

    2012-01-15

    A new europium complex [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75H{sub 2}O was synthesized and used as the emission material for the single layer device structure of ITO/EO4-Eu-Pic/Al, using a spin-coating technique. Study on the optical properties of the [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75H{sub 2}O complex where EO4=tetraethylene glycol and Pic=picrate anion, had to be undertaken before being applicable to the study of an organic light emitting diode (OLED). The electrical property of an OLED using current-voltage (I-V) measurement was also studied. In complex, the Eu(III) ion was coordinated with the EO4 ligand as a pentadentate mode, one water molecule, and with two Pic anions as bidentate and monodentate modes, forming a nine-coordination number. The photoluminescence (PL) spectra of the crystalline complex in the solid state and its thin film showed a hypersensitive peak at 613.5-614.9 nm that assigned to the {sup 5}D{sub 0}{yields}{sup 7}F{sub 2} transition. A narrow band emission from the thin film EO4-Eu-Pic was obtained. The typical semiconductor I-V curve of device ITO/EO4-Eu-Pic/Al showed the threshold and turn on voltages at 1.08 and 4.6 V, respectively. The energy transfer process from the ligand to the Eu(III) ion was discussed by investigating the excitation and PL characteristics. Effect of the picrate anion on the device performance was also studied. - Highlights: > The [Eu(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).0.75(H{sub 2}O) is crystallized in triclinic with space group P-1. > The complex is applied as a emissive center in single layer device structure of ITO/EO4-Eu-Pic/Al. > The complex displays a red luminescence in both the crystalline complex and its thin film state. > The low turn on voltage of the device (4.6 V), indicating that this material is suitable for OLED. > The roughness and morphology of the thin film affects luminance and electrical properties of OLED.

  13. Performance evaluation of heat pump system using R744/R161 mixture refrigerant

    Directory of Open Access Journals (Sweden)

    Zhang Xian-Ping

    2014-01-01

    Full Text Available As an efficient and energy conservation technology, heat pumps working with R22, which are scheduled to be phased out by Montreal Protocol, are widely used in China at present. The global deteriorating ecology environment would accelerate the phase-out time of R22 in developing countries. Therefore, as a matter of urgency, an eco-friendly substitute should be investigated in order to replace R22. Under this context, and with a consideration of the environmental protection, R744/R161 mixture refrigerant is proposed. R744/R161 mixture refrigerant’s condensation pressure is reduced and its flammability and explosivity are suppressed. A thermodynamic model is developed, and under the given working conditions, the performances of subcritical heat pump system using R744/R161 mixture of variable mass fraction are discussed and compared with those of the R22 system. The optimal mass fraction of R744/R161 is given, which corresponds to a maximal heating coefficient of performance. The simulation results show that R744/R161 mixture can work as a competitive alternative to R22 in heat pump system.

  14. Synthesis of Luminescent Ink from Europium-Doped Y2O3 Dispersed in Polyvinyl Alcohol Solution

    Directory of Open Access Journals (Sweden)

    Astuti

    2009-01-01

    Full Text Available Luminescent ink from europium-doped Y2O3 ( Y2O3:Eu has been synthesized by two steps method: first, synthesis of luminescent powder of Y2O3:Eu by simple heating of metallic nitrates in a polymer solution and second, dispersing the powder in a polyvinyl alcohol (PVA solution. The stability of the ink (luminescent colloid was strongly affected by mixing process of the powder and the solution. Mixing process must be performed for a long time (about 8 hours at above room temperature to product stable colloids. We observed that mixing at 30–40∘C resulted in a stable and highly dispersed colloid. The writing test was performed on a white paper to show the potential use of the colloid for making security codes.

  15. Induced europium CPL for the selective signalling of phosphorylated amino-acids and O-phosphorylated hexapeptides.

    Science.gov (United States)

    Neil, Emily R; Fox, Mark A; Pal, Robert; Parker, David

    2016-05-17

    Two bright, europium(iii) complexes based on an achiral heptadentate triazacyclononane ligand bearing two strongly absorbing chromophores have been evaluated for the selective emission and CPL signalling of various chiral O-phosphono-anions. Binding of O-phosphono-Ser and Thr gives rise to a strong induced CPL signature and a favoured Δ complex configuration is adopted. A similarly large induced CPL signal arises when [Eu·](2+) binds to lysophosphatidic acid (LPA), where the strong binding (log K 5.25 (295 K)) in methanol allowed its detection over the range 5 to 40 μM. Strong and chemoselective binding to the phosphorylated amino-acid residues was also observed with a set of four structurally related hexapeptides: in one case, the sign of the gem value in the ΔJ = 1 transition allowed differentiation between the binding to O-P-Ser and O-P-Tyr residues.

  16. Percentages of CD4+CD161+ and CD4−CD8−CD161+ T Cells in the Synovial Fluid Are Correlated with Disease Activity in Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Jinlin Miao

    2015-01-01

    Full Text Available Objective. CD161 has been identified as a marker of human IL-17-producing T cells that are implicated in the pathogenesis of rheumatoid arthritis (RA. This study aimed to investigate the potential link between the percentage of CD161+ T cells and disease activity in RA patients. Methods. Peripheral blood (PB from 54 RA patients and 21 healthy controls was evaluated. Paired synovial fluid (SF (n = 17 was analyzed. CD161 expression levels on CD4+, CD8+, and CD4−CD8− T cells were assessed by flow cytometry. Results. The percentage of CD4+CD161+ T cells in RA SF was higher than RA PB, and it was positively correlated with DAS28, erythrocyte sedimentation rate (ESR, and C-reactive protein (CRP. CD4−CD8−CD161+ T cell percentage was decreased in RA PB and was further reduced in RA SF, and its level in SF was inversely correlated with DAS28, ESR, and CRP. However, CD8+CD161+ T cell percentage was neither changed in RA PB and SF nor correlated with disease activity indices. Conclusion. An increased CD4+CD161+ T cell percentage and a decreased CD4−CD8−CD161+ T cell percentage are present in RA SF and are associated with disease activity, and the accumulation of CD4+CD161+ T cells in SF may contribute to the local inflammation of RA.

  17. A new europium(III)-β-diketonate complex based on diphenylethyne as red phosphors applied in LED

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Guang, E-mail: shaog@mail.sysu.edu.cn [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Zhang, Na; Lin, Duan [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Feng, Kenjun [Department of Chemical Engineering, Hui-Zhou University, Huizhou 516007 (China); Cao, Rihui, E-mail: caorihui@mail.sysu.edu.cn [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Gong, Menglian [School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China)

    2013-06-15

    A new europium(III) ternary complex based on a fluorinated β-diketonate ligand and 1,10-phenanthroline as an ancillary ligand has been prepared and evaluated as a candidate for light-emitting diode (LED). The complex exhibits a high decomposition temperature (316 °C). Photophysical properties such as FT-IR spectra, UV–vis absorption spectra, excitation and emission spectra, luminescence decay curve and quantum yield were investigated. The excitation band is well matched with the characteristic emission of 395 nm-emitting InGaN chips. The complex exhibits an efficient energy transfer pathway from the ligands to the central Eu{sup 3+} ion via a ligand-sensitized luminescence process. An intense red-emitting LED was fabricated by coating the complex onto a 395 nm-emitting InGaN chip, and its Commission International de I'Eclairage (CIE) chromaticity coordinate (x=0.6389, y=0.3255) is close to the National Television Standard Committee (NTSC) standard value for red color. Meanwhile, the energy transfer from the InGaN chip to the complex is very efficient. All the findings demonstrate the potential application of the Eu(III) complex as red-emitting phosphors for UV-based white LEDs. -- Highlights: ► A new europium(III)-β-diketonate complex was synthesized and characterized. ► Thermal stability and photophysical properties were investigated in detail. ► PL mechanism was proposed to involve a ligand-sensitized luminescence process. ► An intense red-emitting LED was fabricated by using the complex. ► CIE chromaticity coordinate is close to NTSC standard value for red color.

  18. Mitochondria Targetable Time-Gated Luminescence Probe for Singlet Oxygen Based on a β-Diketonate-Europium Complex.

    Science.gov (United States)

    Sun, Jingyan; Song, Bo; Ye, Zhiqiang; Yuan, Jingli

    2015-12-21

    Singlet oxygen ((1)O2) plays a key role in the photodynamic therapy (PDT) technique of neoplastic diseases. In this work, by using a 9,10-dimethyl-2-anthryl-containing β-diketone, 1,1,1,2,2-pentafluoro-5-(9',10'-dimethyl-2'-anthryl)-3,5-pentanedione (Hpfdap), as a (1)O2-recognition ligand, a novel β-diketonate-europium(III) complex that can act as a luminescence probe for (1)O2, [Eu(pfdap)3(tpy)] (tpy = 2,2',2″-terpyridine), has been designed and synthesized for the time-gated luminescence detection of (1)O2 in living cells. The complex is weakly luminescent due to the quenching effect of 9,10-dimethyl-2-anthryl groups. After reaction with (1)O2, accompanied by the formation of endoperoxides of 9,10-dimethyl-2-anthryl groups, the luminescence quenching disappears, so that the long-lived luminescence of the europium(III) complex is switched on. The complex showed highly selective luminescence response to (1)O2 with a remarkable luminescence enhancement. Combined with the time-gated luminescence imaging technique, the complex was successfully used as a luminescent probe for the monitoring of the time-dependent generation of (1)O2 in 5-aminolevulinic acid (a PDT drug) loaded HepG2 cells during the photodynamic process. In addition, by coloading the complex and a mitochondrial indicator, Mito-Tracker Green, into HepG2 cells, the specific localization of [Eu(pfdap)3(tpy)] molecules in mitochondria of HepG2 cells was demonstrated by confocal fluorescence imaging measurements.

  19. CD3+CD8+CD161high Tc17 cells are depleted in HIV-infection

    DEFF Research Database (Denmark)

    Gaardbo, Julie Christine; Hartling, Hans Jakob; Thorsteinsson, Kristina

    2012-01-01

    CD8+ Tc17 cells with pro-inflammatory properties have only recently been acknowledged, and Tc17 cells in HIV-infection are undescribed. CD3+CD8+CD161 Tc17 cells and the production of Interleukin-17 were examined in untreated and treated HIV-infected patients, HIV-HCV co-infected patients...... and healthy controls. Depletion of CD3+CD8+CD161 Tc17 cells and diminished production of Interleukin-17 in HIV-infected patients was found. The level of Tc17 cells was associated with the level of the CD4+ count in treated patients....

  20. Excitation energy transfer in europium chelate with doxycycline in the presence of a second ligand in micellar solutions of nonionic surfactants

    Science.gov (United States)

    Smirnova, T. D.; Shtykov, S. N.; Kochubei, V. I.; Khryachkova, E. S.

    2011-01-01

    The complexation of Eu3+ with doxycycline (DC) antibiotic in the presence of several second ligands and surfactant micelles of different types is studied by the spectrophotometric and luminescence methods. It is found that the efficiency of excitation energy transfer in Eu3+-DC chelate depends on the nature of the second ligand and surfactant micelles. Using thenoyltrifluoroacetone (TTA) as an example, it is shown that the second ligand additionally sensitizes the europium fluorescence, and the possibility of intermediate sensitization of DC and then of europium is shown by the example of 1,10-phenanthroline. In all cases, the excitation energy transfer efficiency was increased due to the so-called antenna effect. The decay kinetics of the sensitized fluorescence of the binary and mixed-ligand chelates in aqueous and micellar solutions of nonionic surfactants is studied and the relative quantum yields and lifetimes of fluorescence are determined.

  1. A Smart Europium-Ruthenium Complex as Anticancer Prodrug: Controllable Drug Release and Real-Time Monitoring under Different Light Excitations.

    Science.gov (United States)

    Li, Hongguang; Xie, Chen; Lan, Rongfeng; Zha, Shuai; Chan, Chi-Fai; Wong, Wing-Yan; Ho, Ka-Lok; Chan, Brandon Dow; Luo, Yuxia; Zhang, Jing-Xiang; Law, Ga-Lai; Tai, William C S; Bünzli, Jean-Claude G; Wong, Ka-Leung

    2017-11-09

    A unique, dual-function, photoactivatable anticancer prodrug, RuEuL, has been tailored that features a ruthenium(II) complex linked to a cyclen-europium chelate via a π-conjugated bridge. Under irradiation at 488 nm, the dark-inactive prodrug undergoes photodissociation, releasing the DNA-damaging ruthenium species. Under evaluation-window irradiation (λirr = one-photon 350 nm or two-photon 700 nm), the drug delivery process can be quantitatively monitored in real-time because of the long-lived red europium emission. Linear relationships between released drug concentration and ESI-MS or luminescence responses are established. Finally, the efficiency of the new prodrug is demonstrated both in vitro RuEuL anticancer prodrug over some existing ones and open the way for decisive improvements in multipurpose prodrugs.

  2. Structural and optical analysis on europium doped AZrO{sub 3} (A=Ba, Ca, Sr) phosphor for display devices application

    Energy Technology Data Exchange (ETDEWEB)

    Dubey, Vikas, E-mail: jsvikasdubey@gmail.com [Department of Physics, Bhilai Institute of Technology Raipur, 493661 (India); Tiwari, Neha [Department of Physics, Govt. Model Science College, Jabalpur (India)

    2016-05-06

    Behavior displayed by europium doped AZrO{sub 3} phosphor which was synthesized by solid state reaction method. For synthesis of BaZrO{sub 3}, SrZrO{sub 3} and CaZrO{sub 3} phosphor with fixed concentration of europium ion was calcination at 1000°C and sintered at 1300°C following intermediate grinding. Synthesized sample was characterized by X-ray diffraction analysis and crystallite sized was calculated by Scherer’s formula. From PL spectra of prepared phosphors shows intense emission centred at 612nm (red emission) with high intensity for SrZrO{sub 3}:Eu{sup 3+}. For europium doped BaZrO{sub 3} and CaZrO{sub 3} (613nm) phosphor shows less intense PL spectra as compared to SrZrO{sub 3}:Eu{sup 3+}. The strong emission peak of AZrO{sub 3}:Eu{sup 3+} phosphor is due to forced electric dipole transition of {sup 5}D{sub 0} to {sup 7}F{sub 2} centered at 612 and 613nm. It is characteristic red emission for europium ion. The excitation spectra of AZrO{sub 3}:Eu{sup 3+} phosphor mainly consists of the charge transfer and (CTB) of Eu{sup 3+} located in 200–350 nm centred at 254nm. The present phosphors can act as single host for red light emission in display devices. The CIE coordinates were calculated by Spectrophotometric method using the spectral energy distribution of the AZrO{sub 3}:Eu{sup 3+} sample.

  3. CD147-mediated chemotaxis of CD4+CD161+ T cells may contribute to local inflammation in rheumatoid arthritis.

    Science.gov (United States)

    Lv, Minghua; Miao, Jinlin; Zhao, Peng; Luo, Xing; Han, Qing; Wu, Zhenbiao; Zhang, Kui; Zhu, Ping

    2018-01-01

    CD161 is used as a surrogate marker for Th17 cells, which are implicated in the pathogenesis of rheumatoid arthritis (RA). In this study, we evaluated the percentage, clinical significance, and CD98 and CD147 expression of CD4+CD161+ T cells. The potential role of CD147 and CD98 in cyclophilin A-induced chemotaxis of CD4+CD161+ T cells was analyzed. Thirty-seven RA patients, 15 paired synovial fluid (SF) of RA, and 22 healthy controls were recruited. The cell populations and surface expression of CD98 and CD147 were analyzed by flow cytometry. Spearman's rank correlation coefficient and multiple linear regression were applied to calculate the correlations. Chemotaxis assay was used to investigate CD4+CD161+ T cell migration. We found that the percentage of CD4+CD161+ T cells and their expression of CD147 and CD98 in SF were higher than in the peripheral blood of RA patients. Percentage of SF CD4+CD161+ T cells was positively correlated with 28-Joint Disease Activity Score (DAS28). CD147 monoclonal antibody (HAb18) attenuated the chemotactic ability of CD4+CD161+ T cells. An increased CD4+CD161+ T cell percentage and expression of CD147 and CD98 were shown in RA SF. Percentage of SF CD4+CD161+ T cells can be used as a predictive marker of disease activity in RA. CD147 block significantly decreased the chemotactic index of CD4+CD161+ cells induced by cyclophilin A (CypA). These results imply that the accumulation of CD4+CD161+ T cells in SF and their high expression of CD147 may be associated with CypA-mediated chemotaxis and contribute to local inflammation in RA.

  4. An Amphiphysin-Like Domain in Fus2p Is Required for Rvs161p Interaction and Cortical Localization

    Directory of Open Access Journals (Sweden)

    Richard A. Stein

    2016-02-01

    Full Text Available Cell–cell fusion fulfils essential roles in fertilization, development and tissue repair. In the budding yeast, Saccharomyces cerevisiae, fusion between two haploid cells of opposite mating type generates the diploid zygote. Fus2p is a pheromone-induced protein that regulates cell wall removal during mating. Fus2p shuttles from the nucleus to localize at the shmoo tip, bound to Rvs161p, an amphiphysin. However, Rvs161p independently binds a second amphiphysin, Rvs167p, playing an essential role in endocytosis. To understand the basis of the Fus2p–Rvs161p interaction, we analyzed Fus2p structural domains. A previously described N-terminal domain (NTD is necessary and sufficient to regulate nuclear/cytoplasmic trafficking of Fus2p. The Dbl homology domain (DBH binds GTP-bound Cdc42p; binding is required for cell fusion, but not localization. We identified an approximately 200 amino acid region of Fus2p that is both necessary and sufficient for Rvs161p binding. The Rvs161p binding domain (RBD contains three predicted alpha-helices; structural modeling suggests that the RBD adopts an amphiphysin-like structure. The RBD contains a 13-amino-acid region, conserved with Rvs161p and other amphiphysins, which is essential for binding. Mutations in the RBD, predicted to affect membrane binding, abolish cell fusion without affecting Rvs161p binding. We propose that Fus2p/Rvs161p form a novel heterodimeric amphiphysin required for cell fusion. Rvs161p binding is required but not sufficient for Fus2p localization. Mutations in the C-terminal domain (CTD of Fus2p block localization, but not Rvs161p binding, causing a significant defect in cell fusion. We conclude that the Fus2p CTD mediates an additional, Rvs161p-independent interaction at the shmoo tip.

  5. Page 1 Numerical simulation of the Indian monsoon 161 points out ...

    Indian Academy of Sciences (India)

    Numerical simulation of the Indian monsoon 161 points out “the dynamics of the whole terrestrial climate cannot be separated from the heat Storage effects of the upper ocean". For monsoon studies, the Indian. 9°ºan is the only ocean which experiences a bi-annual reversal of the wind circu- lation. The generation of the ...

  6. 28 CFR 35.161 - Telecommunication devices for the deaf (TDD's).

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Telecommunication devices for the deaf... BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES Communications § 35.161 Telecommunication... beneficiaries, TDD's or equally effective telecommunication systems shall be used to communicate with...

  7. 78 FR 20888 - Foreign-Trade Zone (FTZ) 161-Sedgwick County, Kansas; Notification of Proposed Production...

    Science.gov (United States)

    2013-04-08

    ... Production Activity; Siemens Energy, Inc., (Wind Turbine Nacelles and Hubs), Hutchinson, Kansas Siemens Energy, Inc. (SEI), an operator of FTZ 161, submitted a notification of proposed production activity for.../hoses/seals/sheets/tape/bags/ containers; bushings; funnels; weather strips; hydraulic hoses; rubber...

  8. 27 CFR 31.161 - Conversion between metric and U.S. units.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Conversion between metric... Wholesale Dealers' Records and Reports § 31.161 Conversion between metric and U.S. units. When liters are... proof in metric bottles may be converted to U.S. units by multiplying the liters in one case by the...

  9. Yeast Interacting Proteins Database: YDR425W, YGL161C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available with this bait as prey (0) YGL161C YIP5 Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computational...IP5 Prey description Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computatio...nal analysis of large-scale protein-protein interaction data suggests a possible ro

  10. 40 CFR 161.100 - How to determine registration data requirements.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false How to determine registration data...) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES How To Use Data Tables § 161.100 How to determine registration data requirements. To determine the specific kinds of data...

  11. 25 CFR 700.161 - Substitute personal property-nonresidential moves.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false Substitute personal property-nonresidential moves. 700... RELOCATION PROCEDURES Moving and Related Expenses, Temporary Emergency Moves § 700.161 Substitute personal... substitute item at the replacement site, the displaced person is entitled to payment of the lesser of— (1...

  12. 21 CFR 133.161 - Muenster and munster cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Muenster and munster cheese for manufacturing. 133... Specific Standardized Cheese and Related Products § 133.161 Muenster and munster cheese for manufacturing. Muenster cheese for manufacturing conforms to the definition and standard of identity for muenster cheese...

  13. 46 CFR 161.002-10 - Automatic fire detecting system control unit.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 6 2010-10-01 2010-10-01 false Automatic fire detecting system control unit. 161.002-10...-10 Automatic fire detecting system control unit. (a) General. The fire detecting system control unit... control unit to silence the audible fire alarms, but operation of the audible fire alarm device shall...

  14. 26 CFR 31.3306(c)(16)-1 - Services in employ of international organization.

    Science.gov (United States)

    2010-04-01

    ... of 1954) § 31.3306(c)(16)-1 Services in employ of international organization. (a) Subject to the provisions of section 1 of the International Organizations Immunities Act (22 U.S.C. 228), services performed in the employ of an international organization as defined in section 7701(a)(18) are excepted from...

  15. Metal-organic framework luminescence in the yellow gap by codoping of the homoleptic imidazolate ∞(3)[Ba(Im)2] with divalent europium.

    Science.gov (United States)

    Rybak, Jens-Christoph; Hailmann, Michael; Matthes, Philipp R; Zurawski, Alexander; Nitsch, Jörn; Steffen, Andreas; Heck, Joachim G; Feldmann, Claus; Götzendörfer, Stefan; Meinhardt, Jürgen; Sextl, Gerhard; Kohlmann, Holger; Sedlmaier, Stefan J; Schnick, Wolfgang; Müller-Buschbaum, Klaus

    2013-05-08

    The rare case of a metal-triggered broad-band yellow emitter among inorganic-organic hybrid materials was achieved by in situ codoping of the novel imidazolate metal-organic framework ∞(3)[Ba(Im)2] with divalent europium. The emission maximum of this dense framework is in the center of the yellow gap of primary light-emitting diode phosphors. Up to 20% Eu2+ can be added to replace Ba2+ as connectivity centers without causing observable phase segregation. High-resolution energy-dispersive X-ray spectroscopy showed that incorporation of even 30% Eu2+ is possible on an atomic level, with 2-10% Eu2+ giving the peak quantum efficiency (QE = 0.32). The yellow emission can be triggered by two processes: direct excitation of Eu2+ and an antenna effect of the imidazolate linkers. The emission is fully europium-centered, involving 5d → 4f transitions, and depends on the imidazolate surroundings of the metal ions. The framework can be obtained by a solvent-free in situ approach starting from barium metal, europium metal, and a melt of imidazole in a redox reaction. Better homogeneity for the distribution of the luminescence centers was achieved by utilizing the hydrides BaH2 and EuH2 instead of the metals.

  16. α-Titanium phosphate intercalated with propylamine: An alternative pathway for efficient europium(III uptake into layered tetravalent metal phosphates

    Directory of Open Access Journals (Sweden)

    Jorge García-Glez

    2017-09-01

    Full Text Available α-Ti(HPO42·H2O (α-TiP and its propylamine intercalation product, Ti(HPO42·2C3H7NH2·H2O (α-TiPPr, have been synthesized and characterized. Later, their sorption capacity for europium(III was investigated, and this purpose was accomplished by treating α-TiP and α-TiPPr with europium(III nitrate solutions at different concentrations until the equilibrium is reached. All samples were characterized, among others, by powder X-ray diffraction (PXRD, scanning and transmission electron microscopies (SEM, TEM, STEM-EDX, SAED, thermogravimetric analysis (TGA, and photoluminescence (PL measurements. The results show that the Eu3+ uptake is limited to surface when α-TiP is used as sorbent. Nevertheless, the Eu-retention is considerably enhanced with α-TiPPr as a consequence of an ion-exchange process into the interlayer space of the layered titanium phosphate (involving propylammonium cations, C3H7NH3+, and hexahydrate europium(III species, [Eu(H2O6]3+, and the crystal structure of a hypothetical final product, α-[Eu(H2O6]2/3Ti(PO42·[(H2O6]1/3, has been proposed by using DFT calculations.

  17. Molecular genetics of FAM161A in North American patients with early-onset retinitis pigmentosa.

    Directory of Open Access Journals (Sweden)

    Giulia Venturini

    Full Text Available Retinitis pigmentosa (RP is a hereditary disease that leads to the progressive degeneration of retinal photoreceptor cells and to blindness. It is caused by mutations in several distinct genes, including the ciliary gene FAM161A, which is associated with a recessive form of this disorder. Recent investigations have revealed that defects in FAM161A represent a rather prevalent cause of hereditary blindness in Israel and the Palestinian territories, whereas they seem to be rarely present within patients from Germany. Genetic or clinical data are currently not available for other countries. In this work, we screened a cohort of patients with recessive RP from North America to determine the frequency of FAM161A mutations in this ethnically-mixed population and to assess the phenotype of positive cases. Out of 273 unrelated patients, only 3 subjects had defects in FAM161A. A fourth positive patient, the sister of one of these index cases, was also identified following pedigree analysis. They were all homozygous for the p.T452Sfx3 mutation, which was previously reported as a founder DNA variant in the Israeli and Palestinian populations. Analysis of cultured lymphoblasts from patients revealed that mutant FAM161A transcripts were actively degraded by nonsense-mediated mRNA decay. Electroretinographic testing showed 30 Hz cone flicker responses in the range of 0.10 to 0.60 microvolts in all cases at their first visit (age 12 to 23 (lower norm  =  50 μV and of 0.06 to 0.32 microvolts at their most recent examination (age 27 to 43, revealing an early-onset of this progressive disease. Our data indicate that mutations in FAM161A are responsible for 1% of recessive RP cases in North America, similar to the prevalence detected in Germany and unlike the data from Israel and the Palestinian territories. We also show that, at the molecular level, the disease is likely caused by FAM161A protein deficiency.

  18. Nicotine Mediates CD161a+ Renal Macrophage Infiltration and Premature Hypertension in the Spontaneously Hypertensive Rat

    Science.gov (United States)

    Harwani, Sailesh C.; Ratcliff, Jason; Sutterwala, Fayyaz S.; Ballas, Zuhair K.; Meyerholz, David K.; Chapleau, Mark W.; Abboud, Francois M.

    2016-01-01

    Rationale Renal inflammation contributes to the pathophysiology of hypertension. CD161a+ immune cells are dominant in the Spontaneously Hypertensive Rat (SHR) and expand in response to nicotinic cholinergic activation. Objective We aimed to phenotype CD161a+ immune cells in pre-hypertensive SHR following cholinergic activation with nicotine, and determine if these cells are involved in renal inflammation and the development of hypertension. Methods and Results Studies utilized young SHR and Wistar Kyoto (WKY) rats. Splenocytes and bone marrow cells were exposed to nicotine ex-vivo and nicotine was infused in-vivo. Blood pressures, kidney, serum, and urine were obtained. Flow cytometry, Luminex/ELISA, immunohistochemistry, confocal microscopy, and Western blot were used. Nicotinic cholinergic activation induced proliferation of CD161a+/CD68+ macrophages in SHR-derived splenocytes, their renal infiltration, and premature hypertension in SHR. These changes were associated with increased renal expression of monocyte-chemoattractant-protein-1 (MCP-1) and very-late-antigen-4 (VLA-4). Lectin-Like-Transcript 1 (LLT1), the ligand for CD161a, was overexpressed in SHR kidney, while vascular cellular (VCAM-1) and intracellular adhesion molecules (ICAM-1) were similar to WKY. Inflammatory cytokines were elevated in SHR kidney and urine following nicotine infusion. Nicotine mediated renal macrophage infiltration/inflammation was enhanced in denervated kidneys, not explained by angiotensin-II levels or expression of angiotensin type-1/2 receptors. Moreover, expression of the anti-inflammatory α7-nicotinic-acetylcholine receptor was similar in young SHR and WKY. Conclusions A novel, inherited nicotinic cholinergic inflammatory effect exists in young SHR, measured by expansion of CD161a+/CD68+ macrophages. This leads to renal inflammation and premature hypertension, which may be partially explained by increased renal expression of LLT-1, MCP-1, and VLA-4. PMID:27660287

  19. 42 CFR 84.161 - Man test for gases and vapors; Type B and Type BE respirators; test requirements.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Man test for gases and vapors; Type B and Type BE respirators; test requirements. 84.161 Section 84.161 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES OCCUPATIONAL SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air...

  20. Electron tunneling transport across heterojunctions between europium sulfide and indium arsenide

    Science.gov (United States)

    Kallaher, Raymond L.

    This dissertation presents research done on utilizing the ferromagnetic semiconductor europium sulfide (EuS) to inject spin polarized electrons into the non-magnetic semiconductor indium arsenide (InAs). There is great interest in expanding the functionality of modern day electronic circuits by creating devices that depend not only on the flow of charge in the device, but also on the transport of spin through the device. Within this mindset, there is a concerted effort to establish an efficient means of injecting and detecting spin polarized electrons in a two dimensional electron system (2DES) as the first step in developing a spin based field effect transistor. Thus, the research presented in this thesis has focused on the feasibility of using EuS, in direct electrical contact with InAs, as a spin injecting electrode into an InAs 2DES. Doped EuS is a concentrated ferromagnetic semiconductor, whose conduction band undergoes a giant Zeeman splitting when the material becomes ferromagnetic. The concomitant difference in energy between the spin-up and spin-down energy bands makes the itinerant electrons in EuS highly spin polarized. Thus, in principle, EuS is a good candidate to be used as an injector of spin polarized electrons into non-magnetic materials. In addition, the ability to adjust the conductivity of EuS by varying the doping level in the material makes EuS particularly suited for injecting spins into non-magnetic semiconductors and 2DES. For this research, thin films of EuS have been grown via e-beam evaporation of EuS powder. This growth technique produces EuS films that are sulfur deficient; these sulfur vacancies act as intrinsic electron donors and the resulting EuS films behave like heavily doped ferromagnetic semiconductors. The growth parameters and deposition procedures were varied and optimized in order to fabricate films that have minimal crystalline defects. Various properties and characteristics of these EuS films were measured and compared to

  1. Synthesis, Optical Investigation and Biological Properties of Europium(III) Complexes with 2-(4-Chlorophenyl)-1-(2-Hydroxy-4-Methoxyphenyl)Ethan-1-one and Ancillary Ligands.

    Science.gov (United States)

    Nandal, Poonam; Khatkar, S P; Kumar, Rajesh; Khatkar, Avni; Taxak, V B

    2017-01-01

    Synthesis and photoluminescence behaviour of six novel europium complexes with novel β-hydroxyketone ligand, 2-(4-chlorophenyl)-1-(2-hydroxy-4-methoxyphenyl)ethan-1-one (CHME) and 2,2'-bipyridine (bipy) or neocuproine (neo) or 1,10-phenanthroline (phen) or 5,6-dimethyl-1,10-phenanthroline (dmphen) or bathophenanthroline (bathophen) were reported in solid state. The free ligand CHME and europium complexes, Eu(CHME)3.2H2O [1] Eu(CHME)3.bipy [2], Eu(CHME)3.neo [3], Eu(CHME)3.phen [4], Eu(CHME)3.dmphen [5] and Eu(CHME)3.bathophen [6]were characterized by elemental analysis, FT-IR and 1H-NMR. The photoluminescence emission spectra exhibited four characteristic peaks arising from the 5D0 → 7FJ (J = 1-4) transitions of the europium ion in the solid state on monitoring excitation at λex = 395 nm. The luminescence decay curves of these europium complexes possess single exponential behaviour indicating the presence of a single luminescent species and having only one site symmetry in the complexes. The luminescence quantum efficiency (η) and the experimental intensity parameters, Ω 2 and Ω 4 of europium complexes have also been calculated on the basis of emission spectra and luminescence decay curves. In addition, the antimicrobial and antioxidant activities were also studied of the investigated complexes.

  2. Highly luminescent pure-red-emitting fluorinated β-diketonate europium(III) complex for full solution-processed OLEDs

    Energy Technology Data Exchange (ETDEWEB)

    Martins, Joao P. [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Serviço de Medicina Nuclear, SESARAM E.P.E., Avenida Luís de Camões 57, Funchal 9004-514, Madeira (Portugal); Martín-Ramos, Pablo [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Higher Technical School of Telecommunications Engineering, Universidad de Valladolid, Campus Miguel Delibes, Paseo Belén 15, Valladolid 47011 (Spain); Coya, Carmen, E-mail: carmen.coya@urjc.es [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Silva, Manuela Ramos [CEMDRX, Physics Department, Universidade de Coimbra, Rua Larga, Coimbra P-3004-516 (Portugal); Eusebio, M. Ermelinda S. [Chemistry Department, Faculdade de Ciências e Tecnologia, Universidade de Coimbra, Coimbra P-3004-535 (Portugal); Andrés, Alicia de [Instituto de Ciencia de Materiales de Madrid, Consejo Superior de Investigaciones Científicas (CSIC), Cantoblanco, Madrid 28049 (Spain); Álvarez, Ángel L. [Escuela Superior de Ciencias Experimentales y Tecnología (ESCET), Universidad Rey Juan Carlos, Madrid 28933 (Spain); Martín-Gil, Jesús [Advanced Materials Laboratory, ETSIIAA, Universidad de Valladolid, Avenida de Madrid 44, Palencia 34004 (Spain)

    2015-03-15

    Current manufacturing technologies for OLEDs involve the use of expensive high vacuum techniques and call for thermal stability requirements which are not fulfilled by many materials. These problems disappear when the OLED films are deposited directly from solution. In this study, we have designed, synthesized and characterized a novel octacoordinated complex, Tris(1-(4-chlorophenyl)-4,4,4-trifluoro-1, 3-butanedionate)mono(bathophenanthroline) europium(III), to be used as a “complex-only” emissive layer in wet-processed OLEDs. Upon excitation in the UV region, very efficient energy transfer from the ligands to Eu{sup 3+} takes place, giving rise to intense red emission with very high monochromaticity (R=19), both in powder and as a thin film. The decay times of 754 µs (powder) and 620 µs (thin film) are comparable to those of the most efficient Eu{sup 3+} β-diketonate complexes reported to date. The same energy transfer leading to saturated red and narrow emission is also observed in the OLED device (glass/ITO/PEDOT:PSS/[Eu(cbtfa){sub 3}(bath)]/Ca/Al) when biased at >5.2 V. Its high quantum efficiency (∼60%), good thermal stability up to 200 °C and adequate thin film forming properties make this material a promising chromophore for cost-effective OLEDs. - Highlights: • A highly fluorinated europium(III) octacoordinated complex, [Eu(cbtfa)3(bath)], has been synthesized and its structure elucidated by single crystal X-ray diffraction. • The chosen coordination environment is well-suited for sensitizing the luminescence of the Eu{sup 3+} ion, achieving very efficient energy transfer from the organic ligands (excited in the UV region) to the rare earth ion, leading to highly efficient (Q∼60% in crystalline powder and Q∼50% in thin film) and saturated red photoluminescence. • The material has also been integrated into a single active layer, full solution-processed OLED, with ITO/PEDOT:PSS/[Eu(cbtfa)3(bath)]/ Ca/Al structure.

  3. Simultaneous analysis of free and humic acid complexed europium and gadolinium species by CE-ICP-MS

    Energy Technology Data Exchange (ETDEWEB)

    Kautenburger, R.; Nowotka, K.; Beck, H.P. [Institut fuer Anorganische und Analytische Chemie und Radiochemie, Universitaet des Saarlandes, P.O. Box 151150, 66041 Saarbruecken (Germany)

    2005-07-01

    Full text of publication follows: For the long-term safety assessment of waste repositories, detailed information about geo-chemical behaviour of radioactive and toxic metal ions under environmental conditions (geological matrix and aquifer systems) is necessary. It includes knowledge about the mechanism of relevant geochemical reactions, as well as thermodynamic and kinetic data. Several previous studies have shown that humic acid can play an important role in the immobilisation or mobilization of metal ions due to complexation and colloid formation. In this project we investigate the complexation behaviour of humic acid (purified Aldrich humic acid) and its influence on the migration of the lanthanides europium and gadolinium (homologues of the actinides americium and curium) in the the ternary system consisting of these heavy metals, humic acid and kaolinite (KGa-1b) as geological model system under conditions close to nature. Capillary electrophoresis (CE, Beckman Coulter P/ACE MDQ), with its excellent separation performance, was coupled to Inductively Coupled Plasma Mass Spectrometry (ICP-MS, VG Elemental Plasma Quad 3) to obtain a high sensitivity for the determination of the rare earth elements europium (Eu{sup 3+}) and gadolinium (Gd{sup 3+}) and their complexes with humic acid. Additionally, the used humic acid was halogenated with iodine as ICP-MS marker. A fused-silica capillary was flexibly fitted into a MicroMist 50 {mu}l nebulizer with a Cinnabar cyclonic spray chamber. The chamber was chilled to a temperature of 4 deg. C for best sensitivity. 200 ppb of caesium were added to the CE separation buffer to observe the capillary flow. A make-up fluid including 4 ppb Ho as an internal standard was combined with the flow from the capillary within the interface to obtain a fluid throughput high enough to maintain a continuous nebulization. Very low detection limits were achieved, 100 ppt for {sup 153}Eu and 125 ppt for {sup 158}Gd. With this optimized CE

  4. Temperature effects on the interaction mechanisms between the europium (III) and uranyl ions and zirconium diphosphate; Effets de la temperature sur les mecanismes d'interaction entre les ions europium (3) et uranyle et le diphosphate de zirconium

    Energy Technology Data Exchange (ETDEWEB)

    Finck, N

    2006-10-15

    Temperature should remain higher than 25 C in the near field environment of a nuclear waste repository for thousands years. In this context, the aim of this work is to study the temperature influence on the interaction mechanisms between europium (III) and uranyl ions and zirconium diphosphate, as well as the influence of a complexing medium (nitrate) on the sorption of the lanthanide. The experimental definition of the equilibria was achieved by combining a structural investigation with the macroscopic sorption data. Surface complexes were characterized at all temperatures (25 C to 90 C) by TRLFS experiments carried out on dry and in situ samples using an oven. This characterization was completed by XPS experiments carried out at 25 C on samples prepared at 25 C and 90 C. The reaction constants (surface hydration and cations sorption) were obtained by simulating the experimental data with the constant capacitance surface complexation model. The reaction constants temperature dependency allowed one to characterize thermodynamically the different reactions by application of the van't Hoff relation. The validity of this law was tested by performing microcalorimetric measurements of the sorption heat for both cations. (author)

  5. 161 | Page

    African Journals Online (AJOL)

    Fr. Ikenga

    A treaty is basically an agreement between parties on the international scene. Although treaties may be concluded, or made between States and international organizations, they are primarily concerned with relations between States.13In this wise, the 1969 Vienna Convention on the Law of Treaties defines a. 'Treaty' as: ...

  6. 161 | Page

    African Journals Online (AJOL)

    Fr. Ikenga

    49 JA Cohen 'The Personal Security of Businessmen and Trade Representatives' in VH Li Law and Politics in .... was not immune from prosecution by Spanish courts for the crimes of torture ..... Unofficial translation by Human Rights Watch.

  7. Expression of Lectin-Like Transcript 1, the Ligand for CD161, in Rheumatoid Arthritis.

    Directory of Open Access Journals (Sweden)

    Paulina Chalan

    Full Text Available Precursor Th17 lineage cells expressing CD161 are implicated in Rheumatoid Arthritis (RA pathogenesis. CD4+CD161+ T-cells accumulate in RA joints and may acquire a non classical Th1 phenotype. The endogenous ligand for CD161 is lectin-like transcript 1 (LLT1. CD161/LLT1 ligation may co-stimulate T-cell IFN-γ production. We investigated the presence and identity of LLT1-expressing cells in RA synovial fluid (SF and synovial tissue (ST. We also assessed levels of soluble LLT1 (sLLT1 in different phases of RA development.Paired samples of peripheral blood mononuclear cells (MC and SFMC (n = 14, digested ST cells (n = 4 and ST paraffin sections (n = 6 from late-stage RA were analyzed for LLT1 expression by flow cytometry and immunohistochemistry. sLLT1 was measured using a sandwich ELISA. Sera and SF from late-stage RA (n = 26, recently diagnosed RA patients (n = 39, seropositive arthralgia patients (SAP, n = 31, spondyloarthropathy patients (SpA, n = 26 and healthy controls (HC, n = 31 were assayed.In RA SF, LLT1 was expressed by a small proportion of monocytes. In RA ST, LLT1-expressing cells were detected in the lining, sublining layer and in areas with infiltrates. The LLT1 staining pattern overlapped with the CD68 staining pattern. FACS analysis of digested ST confirmed LLT1 expression by CD68+ cells. Elevated systemic sLLT1 was found in all patient groups.In RA joints, LLT1 is expressed by cells of the monocyte/macrophage lineage. Serum levels of sLLT1 were increased in all patient groups (patients with early- and late-stage RA, seropositive arthralgia and spondyloarthropathy when compared to healthy subjects.

  8. Yeast Interacting Proteins Database: YGL161C, YGL198W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGL161C YIP5 Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computational...that interacts with Rab GTPases, localized to late Golgi vesicles; computational ...eracts with Rab GTPases, localized to late Golgi vesicles; computational analysis of large-scale protein-pro...ized to late Golgi vesicles; computational analysis of large-scale protein-protein interaction data suggests

  9. Chemical stratification in the Orion Bar : JCMT spectral legacy survey observations (vol 498, pg 161, 2009)

    NARCIS (Netherlands)

    van der Wiel, M. H. D.; van der Tak, F. F. S.; Ossenkopf, V.; Spaans, M.; Roberts, H.; Fuller, G. A.; Plume, R.

    The integrated line intensities in Table 1 of Van der Wiel et al. (2009, A&A 498, 161) should be modified due to an error in the adopted channel widths: values are reduced by similar to 20% for C2H, H2CO and SO, reduced by a factor similar to 5 for (CO)-O-18 and HCN, and increased by similar to 40%

  10. Foot strike pattern and gait changes during a 161-km ultramarathon.

    Science.gov (United States)

    Kasmer, Mark E; Wren, Jeremy J; Hoffman, Martin D

    2014-05-01

    Foot strike pattern has not been examined during ultramarathons where fatigue or avoidance of impact might have greater effect on foot strike and other gait parameters than in shorter events. In this study, video analysis from 3 level sites at a 161-km ultramarathon was used to: (a) examine changes in foot strike pattern, stride rate, and stride length; (b) determine if foot strike pattern is related to performance; and (c) ascertain if post-race blood creatine phosphokinase (CK) concentrations differ by foot strike pattern. Rear-foot strike (RFS) prevalence was 79.9, 89.0, and 83.9% at 16.5, 90.3, and 161.1 km, respectively. There was a significant distance effect observed between the 90.3 and 161.1-km site for stride rate (p foot strike pattern on performance. However, top 20 finishers had greater use (p = 0.02) of a non-RFS pattern at 161.1 km than the remaining finishers. There was a trend toward greater post-race blood CK values among non-RFS runners compared with RFS runners, reaching significance at the 90.3 km site (p race midpoint was likely because of greater muscular demands of non-RFS patterns as supported by the higher post-race blood CK concentrations among non-RFS runners. Faster runners maintained higher stride rates and lengths throughout the race and made greater use of a non-RFS pattern at the end of the race compared with the slower finishers.

  11. Quantum dot based on tin/titanium mixed oxide doped with europium synthesized by protein sol-gel method

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula P.; Felinto, Maria Claudia F.C., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (IQ/USP), Sao Paulo, SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f

    2011-07-01

    Special luminescence biomarkers have been developed to find more sensitive fluoroimmunoassay methods. A new generation of these biomarkers is the semiconductors nanocrystals, known as quantum dots, doped with lanthanides. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. The protein sol-gel is a modification of conventional method, in which the coconut water replacing the alkoxides normally used. The advantage is that, the proteins present in coconut water bind chemically with metal salts forming a polymer chain. This work presents nanoparticles based on tin/titanium mixed oxide doped with 3% of europium synthesized by protein sol-gel method. The nanoparticles were burned at 300 deg C, 500 deg C, 800 deg C and 1100 deg C. The samples were analyzed and characterized by thermal analysis, X-ray powder diffraction (XRD), infrared spectroscopy (IR) and scanning electron microscopy (SEM). The synthesis was effective and the nanoparticles showed nanometric size and structural differences with the annealing. To be used in the fluoroimmunoassays tests, these particles need to be functionalized before be connect with biological molecules and after this process, these nanoparticles going to be submitted at gamma radiation for sterilization. (author)

  12. 340nm UV LED excitation in time-resolved fluorescence system for europium-based immunoassays detection

    Science.gov (United States)

    Rodenko, Olga; Fodgaard, Henrik; Tidemand-Lichtenberg, Peter; Pedersen, Christian

    2017-02-01

    In immunoassay analyzers for in-vitro diagnostics, Xenon flash lamps have been widely used as excitation light sources. Recent advancements in UV LED technology and its advantages over the flash lamps such as smaller footprint, better wall-plug efficiency, narrow emission spectrum, and no significant afterglow, have made them attractive light sources for gated detection systems. In this paper, we report on the implementation of a 340 nm UV LED based time-resolved fluorescence system based on europium chelate as a fluorescent marker. The system performance was tested with the immunoassay based on the cardiac marker, TnI. The same signal-to-noise ratio as for the flash lamp based system was obtained, operating the LED below specified maximum current. The background counts of the system and its main contributors were measured and analyzed. The background of the system of the LED based unit was improved by 39% compared to that of the Xenon flash lamp based unit, due to the LEDs narrower emission spectrum and longer pulse width. Key parameters of the LED system are discussed to further optimize the signal-to-noise ratio and signal-to-background, and hence the sensitivity of the instrument.

  13. Interaction of europium and nickel with calcite studied by Rutherford Backscattering Spectrometry and Time-Resolved Laser Fluorescence Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sabau, A. [Agence Nationale pour la gestion des Déchets RAdioactifs, 1-7 rue J. Monnet, Parc de la Croix Blanche, 92298 Châtenay-Malabry Cedex (France); Université de Nice Sophia Antipolis, Ecosystèmes Côtiers Marins et Réponses aux Stress (ECOMERS), 28 avenue Valrose, 06108 Nice Cedex 2 (France); Pipon, Y., E-mail: pipon@ipnl.in2p3.fr [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); Institut Universitaire de Technologie (IUT) Lyon-1, Université Claude Bernard Lyon 1, 69 622 Villeurbanne Cedex (France); Toulhoat, N. [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); CEA/DEN, Saclay, 91191 Gif sur Yvette (France); Lomenech, C. [Université de Nice Sophia Antipolis, Ecosystèmes Côtiers Marins et Réponses aux Stress (ECOMERS), 28 avenue Valrose, 06108 Nice Cedex 2 (France); Jordan, N. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Resource Ecology (IRE) (Germany); Moncoffre, N. [Institut de Physique Nucléaire de Lyon (IPNL), Université Lyon 1, CNRS/IN2P3, 4 rue Enrico Fermi, 69 622 Villeurbanne Cedex (France); Barkleit, A. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Resource Ecology (IRE) (Germany); and others

    2014-08-01

    This study aims at elucidating the mechanisms regulating the interaction of Eu and Ni with calcite (CaCO{sub 3}). Calcite powders or single crystals (some mm sized) were put into contact with Eu or Ni solutions at concentrations ranging from 10{sup −3} to 10{sup −5} mol L{sup −1} for Eu and 10{sup −3} mol L{sup −1} for Ni. The sorption durations ranged from 1 week to 1 month. Rutherford Backscattering Spectrometry (RBS) well adapted to discriminate incorporation processes such as: (i) adsorption or co precipitation at the mineral surfaces or, (ii) incorporation into the mineral structure (through diffusion for instance), has been carried out. Moreover, using the fluorescence properties of europium, the results have been compared to those obtained by Time-Resolved Laser Fluorescence Spectroscopy (TRLFS) on calcite powders. For the single crystals, complementary SEM observations of the mineral surfaces at low voltage were also performed. Results showed that Ni accumulates at the calcite surface whereas Eu is also incorporated at a greater depth. Eu seems therefore to be incorporated into two different states in calcite: (i) heterogeneous surface accumulation and (ii) incorporation at depth greater than 160 nm after 1 month of sorption. Ni was found to accumulate at the surface of calcite without incorporation.

  14. Orange-red emitting europium doped strontium ortho-silicate phosphor prepared by a solid state reaction method.

    Science.gov (United States)

    Sahu, Ishwar Prasad

    2017-05-01

    In the present article we report europium-doped strontium ortho-silicates, namely Sr 2 SiO 4 :xEu 3+ (x = 1.0, 1.5, 2.0, 2.5 or 3.0 mol%) phosphors, prepared by solid state reaction method. The crystal structures of the sintered phosphors were consistent with orthorhombic crystallography with a Pmna space group. The chemical compositions of the sintered phosphors were confirmed by energy dispersive X-ray spectroscopy (EDS). Thermoluminescence (TL) kinetic parameters such as activation energy, order of kinetics and frequency factors were calculated by the peak shape method. Orange-red emission originating from the 5 D 0 - 7 F J (J = 0, 1, 2, 3) transitions of Eu 3+ ions could clearly be observed after samples were excited at 395 nm. The combination of these emissions constituted orange-red light as indicated on the Commission Internationale de l'Eclairage (CIE) chromaticity diagram. Mechanoluminescence (ML) intensity of the prepared phosphor increased linearly with increasing impact velocity of the moving piston that suggests that these phosphors can also be used as sensors to detect the stress of an object. Thus, the present investigation indicates that the piezo-electricity was responsible for producing ML in the prepared phosphor. Copyright © 2016 John Wiley & Sons, Ltd.

  15. Application of Europium Multiwalled Carbon Nanotubes as Novel Luminophores in an Electrochemiluminescent Aptasensor for Thrombin Using Multiple Amplification Strategies.

    Science.gov (United States)

    Wu, Dan; Xin, Xia; Pang, Xuehui; Pietraszkiewicz, Marek; Hozyst, Robert; Sun, Xian'ge; Wei, Qin

    2015-06-17

    A novel electrochemiluminescent (ECL) aptasensor was proposed for the determination of thrombin (TB) using exonuclease-catalyzed target recycling and hybridization chain reaction (HCR) to amplify the signal. The capture probe was immobilized on an Au-GS-modified electrode through a Au-S bond. Subsequently, the hybrid between the capture probe and the complementary thrombin binding aptamer (TBA) was aimed at obtaining double-stranded DNA (dsDNA). The interaction between TB and its aptamer led to the dissociation of dsDNA because TB has a higher affinity to TBA than the complementary strands. In the presence of exonuclease, aptamer was selectively digested and TB could be released for target recycling. Extended dsDNA was formed through HCR of the capture probe and two hairpin DNA strands (NH2-DNA1 and NH2-DNA1). Then, numerous europium multiwalled carbon nanotubes (Eu-MWCNTs) could be introduced through amidation reaction between NH2-terminated DNA strands and carboxyl groups on the Eu-MWCNTs, resulting in an increased ECL signal. The multiple amplification strategies, including the amplification of analyte recycling and HCR, and high ECL efficiency of Eu-MWCNTs lead to a wide linear range (1.0×10(-12)-5.0×10(-9) mol/L) and a low detection limit (0.23 pmol/L). The method was applied to serum sample analysis with satisfactory results.

  16. Spectrophotometric Determination and Removal of Unchelated Europium Ions from Solutions Containing Eu-Diethylenetriaminepentaacetic Acid Chelate-Peptide Conjugates1

    Science.gov (United States)

    Dayan Elshan, N. G. R.; Patek, Renata; Vagner, Josef; Mash, Eugene A.

    2014-01-01

    Europium chelates conjugated with peptide ligands are routinely used as probes for conducting in vitro binding experiments. The presence of unchelated Eu ions in these formulations gives high background luminescence and can lead to poor results in binding assays. In our experience, the reported methods for purification of these probes do not achieve adequate removal of unchelated metal ions in a reliable manner. In this work, a xylenol orange-based assay for the quantification of unchelated metal ions was streamlined and used to determine levels of metal ion contamination, as well as the success of metal ion removal upon attempted purification. We compared the use of Empore™ chelating disks and Chelex® 100 resin for the selective removal of unchelated Eu ions from several Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. Both purification methods gave complete and selective removal of the contaminant metal ions. However, Empore™ chelating disks were found to give much higher recoveries of the probes under the conditions utilized. Related to the issue of probe recovery, we also describe a significantly more efficient method for the synthesis of one such probe using Rink amide AM resin in place of Tentagel S resin. PMID:25058927

  17. Reusable temperature-sensitive luminescent material based on vitrified film of europium(III) β-diketonate complex

    Science.gov (United States)

    Lapaev, Dmitry V.; Nikiforov, Victor G.; Lobkov, Vladimir S.; Knyazev, Andrey A.; Galyametdinov, Yury G.

    2018-01-01

    We have proposed a novel temperature-sensitive luminescent material which is a 20 μm thick vitrified film (sandwiched between two quartz plates) fabricated from an amorphous powder of a mesogenic europium(III) β-diketonate complex through a melt-processing technique. The film photoexcited by a 337 nm pulsed nitrogen laser displays a typical Eu3+ ion luminescence bands with the strongest peak at 612 nm and with the decay time of 537 μs at 298 K. It is obtained that both the mean luminescence intensity and the luminescence decay time at 612 nm decrease significantly with temperature increasing from 298 to 348 K; the average values of the relative and absolute temperature sensitivities of the luminescence decay time in the range of 298-348 K are -1.2%·K-1 and -6.5 μs·K-1, respectively. The thermal quenching mechanism of the luminescent properties was analyzed and discussed. The experiments showed that, the luminescent properties of the film is insensitive to oxygen, the film is photostable under UV light, there is full reversibility of the temperature-dependent luminescence intensity and the decay time, and the high luminescence brightness of the film can be observed with violet light excitation. These factors indicated that the film is promising material for reusable luminescent thermometers, suitable for long-term monitoring in the range of 298-348 K.

  18. Differential ERK activation during autophagy induced by europium hydroxide nanorods and trehalose: Maximum clearance of huntingtin aggregates through combined treatment.

    Science.gov (United States)

    Wei, Peng-Fei; Jin, Pei-Pei; Barui, Ayan Kumar; Hu, Yi; Zhang, Li; Zhang, Ji-Qian; Shi, Shan-Shan; Zhang, Hou-Rui; Lin, Jun; Zhou, Wei; Zhang, Yun-Jiao; Ruan, Ren-Quan; Patra, Chitta Ranjan; Wen, Long-Ping

    2015-12-01

    Accelerating the clearance of intracellular protein aggregates through elevation of autophagy represents a viable approach for the treatment of neurodegenerative diseases. In our earlier report, we have demonstrated the enhanced degradation of mutant huntingtin protein aggregates through autophagy process induced by europium hydroxide nanorods [EHNs: Eu(III)(OH)3], but the underlying molecular mechanism of EHNs mediated autophagy was unclear. The present report reveals that EHNs induced autophagy does not follow the classical AKT-mTOR and AMPK signaling pathways. The inhibition of ERK1/2 phosphorylation using the specific MEK inhibitor U0126 partially abrogates the autophagy as well as the clearance of mutant huntingtin protein aggregates mediated by EHNs suggesting that nanorods stimulate the activation of MEK/ERK1/2 signaling pathway during autophagy process. In contrast, another mTOR-independent autophagy inducer trehalose has been found to induce autophagy without activating ERK1/2 signaling pathway. Interestingly, the combined treatment of EHNs and trehalose leads to more degradation of mutant huntingtin protein aggregates than that obtained with single treatment of either nanorods or trehalose. Our results demonstrate the rational that further enhanced clearance of intracellular protein aggregates, needed for diverse neurodegenerative diseases, may be achieved through the combined treatment of two or more autophagy inducers, which stimulate autophagy through different signaling pathways. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Synthesis of europium-doped VSOP, customized enhancer solution and improved microscopy fluorescence methodology for unambiguous histological detection.

    Science.gov (United States)

    de Schellenberger, Angela Ariza; Hauptmann, Ralf; Millward, Jason M; Schellenberger, Eyk; Kobayashi, Yuske; Taupitz, Matthias; Infante-Duarte, Carmen; Schnorr, Jörg; Wagner, Susanne

    2017-10-10

    Intrinsic iron in biological tissues frequently precludes unambiguous the identification of iron oxide nanoparticles when iron-based detection methods are used. Here we report the full methodology for synthesizing very small iron oxide nanoparticles (VSOP) doped with europium (Eu) in their iron oxide core (Eu-VSOP) and their unambiguous qualitative and quantitative detection by fluorescence. The resulting Eu-VSOP contained 0.7 to 2.7% Eu relative to iron, which was sufficient for fluorescent detection while not altering other important particle parameters such as size, surface charge, or relaxivity. A customized enhancer solution with high buffer capacity and nearly neutral pH was developed to provide an antenna system that allowed fluorescent detection of Eu-VSOP in cells and histologic tissue slices as well as in solutions even under acidic conditions as frequently obtained from dissolved organic material. This enhancer solution allowed detection of Eu-VSOP using a standard fluorescence spectrophotometer and a fluorescence microscope equipped with a custom filter set with an excitation wavelength (λex) of 338 nm and an emission wavelength (λem) of 616 nm. The fluorescent detection of Eu-doped very small iron oxide nanoparticles (Eu-VSOP) provides a straightforward tool to unambiguously characterize VSOP biodistribution and toxicology at tissue, and cellular levels, providing a sensitive analytical tool to detect Eu-doped IONP in dissolved organ tissue and biological fluids with fluorescence instruments.

  20. Efficient solution-processed double-layer red OLEDs based on a new europium complex with a carbazole group.

    Science.gov (United States)

    Liu, Jian; Miao, Jing-Sheng; Wu, Hong-Bin

    2015-06-01

    A new europium complex EuL3 (Phen) was used as guest dopant, and a blend of Polyvinylcarbazole and 2-(biphenyl-4-yl)-5-(4-tert-butylphenyl)-1,3,4-oxadiazole (PVK and PBD) as host matrix. Efficient red organic light-emitting devices (OLEDs) with double-layer structures were manufactured via a solution-processed technique. The guest-doped levels were 1, 3 and 5 wt% relative to the blend mass, respectively. For the 1 wt% doping-level device, the luminous efficiency and luminance were up to 2.96 cd/A and 635.78 cd/m(2) with emissions from both EuL3 (Phen) and from the host; for the 3 wt% doping-level device, the maximum luminous efficiency and luminance were 1.01 cd/A and 370.91 cd/m(2) for the single emission from EuL3 (Phen) only. Copyright © 2014 John Wiley & Sons, Ltd.

  1. Europium Nanospheres-Based Time-Resolved Fluorescence for Rapid and Ultrasensitive Determination of Total Aflatoxin in Feed.

    Science.gov (United States)

    Wang, Du; Zhang, Zhaowei; Li, Peiwu; Zhang, Qi; Ding, Xiaoxia; Zhang, Wen

    2015-12-02

    Immunochromatographic (IC) assays are considered suitable diagnostic tools for the determination of mycotoxins. A europium nanospheres-based time-resolved fluorescence immunoassay (Eu-Nano-TRFIA), based on a monoclonal antibody and a portable TRFIA reader, was developed to determine total aflatoxin (including aflatoxins B1, B2, G1, and G2) levels in feed samples. Under optimized conditions, the Eu-Nano-TRFIA method detected total aflatoxin within 12 min. It showed good linearity (R(2) > 0.985), LOD of 0.16 μg/kg, a wide dynamic range of 0.48-30.0 μg/kg, recovery rates of 83.9-113.9%, and coefficients of variation (CVs) of 3.5-8.8%. In the 397 samples from company and livestock farms throughout China, the detection rate was 78.3%, concentrations were 0.50-145.30 μg/kg, the highest total aflatoxin content was found in cottonseed meal, and corn was found to be the most commonly contaminated feed. This method could be a powerful alternative for the rapid and ultrasensitive determination of total aflatoxin in quality control and meet the required Chinese maximum residue limits.

  2. Spectrophotometric determination and removal of unchelated europium ions from solutions containing Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates.

    Science.gov (United States)

    Elshan, N G R Dayan; Patek, Renata; Vagner, Josef; Mash, Eugene A

    2014-11-01

    Europium chelates conjugated with peptide ligands are routinely used as probes for conducting in vitro binding experiments. The presence of unchelated Eu ions in these formulations gives high background luminescence and can lead to poor results in binding assays. In our experience, the reported methods for purification of these probes do not achieve adequate removal of unchelated metal ions in a reliable manner. In this work, a xylenol orange-based assay for the quantification of unchelated metal ions was streamlined and used to determine levels of metal ion contamination as well as the success of metal ion removal on attempted purification. We compared the use of Empore chelating disks and Chelex 100 resin for the selective removal of unchelated Eu ions from several Eu-diethylenetriaminepentaacetic acid chelate-peptide conjugates. Both purification methods gave complete and selective removal of the contaminant metal ions. However, Empore chelating disks were found to give much higher recoveries of the probes under the conditions used. Related to the issue of probe recovery, we also describe a significantly more efficient method for the synthesis of one such probe using Rink amide AM resin in place of Tentagel S resin. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Formation and structural characterization of a europium(II mono(scorpionate complex and a sterically crowded pyrazabole

    Directory of Open Access Journals (Sweden)

    Phil Liebing

    2017-12-01

    Full Text Available The reaction of EuI2(THF2 with potassium hydrotris(3,5-diisopropylpyrazolylborate (K[HB(3,5-iPr2pz3] (= KTpiPr2, pz = pyrazolyl in a molar ratio of 1:1.5 resulted in extensive ligand fragmentation and formation of the europium(II mono(scorpionate complex bis(3,5-diisopropyl-1H-pyrazole[hydrotris(3,5-diisopropylpyrazolylborato]iodidoeuropium(II, [Eu(C27H46BN6I(C9H16N22] or (TpiPr2(3,5-iPr2pzH2EuIII, 1, in high yield (78%. As a typical by-product, small amounts of the sterically crowded pyrazabole derivative trans-4,8-bis(3,5-diisopropylpyrazol-1-yl-1,3,5,7-tetraisopropylpyrazabole, C36H62B2H8 or trans-{(3,5-iPr2pzHB(μ-3,5-iPr2pz}2, 2, were formed. Both title compounds have been structurally characterized through single-crystal X-ray diffraction. In 1, two isopropyl groups are each disordered over two orientations with occupancy ratios of 0.574 (10:0.426 (10 and 0.719 (16:0.281 (16. In 2, one isopropyl group is similarly disordered, occupancy ratio 0.649 (9:0.351 (9.

  4. Spectrofluorimetric study of the interaction between europium(III) and moxifloxacin in micellar solution and its analytical application

    Science.gov (United States)

    Kamruzzaman, Mohammad; Alam, Al-Mahmnur; Lee, Sang Hak; Ragupathy, Dhanusuraman; Kim, Young Ho; Park, Sang-Ryoul; Kim, Sung Hong

    2012-02-01

    A sensitive spectrofluorimetric method has been developed for the determination of moxifloxacin (MOX) using europium(III)-MOX complex as a fluorescence probe in the presence of an anionic surfactant, sodium dodecyl benzene sulfonate (SDBS). The fluorescence (FL) intensity of Eu 3+ was enhanced by complexation with MOX at 614 nm after excitation at 373 nm. The FL intensity of the Eu 3+-MOX complex was significantly intensified in the presence of SDBS. Under the optimum conditions, it was found that the enhanced FL intensity of the system showed a good linear relationship with the concentration of MOX over the range of 1.8 × 10 -11-7.3 × 10 -9 g mL -1 with a correlation coefficient of 0.9998. The limit of detection of MOX was found to be 2.8 × 10 -12 g mL -1 with relative standard deviation (RSD) of 1.25% for 5 replicate determination of 1.5 × 10 -8 g mL -1 MOX. The proposed method is simple, offers higher sensitivity with wide linear range and can be successfully applied to determine MOX in pharmaceutical and biological samples with good reproducibility. The luminescence mechanism is also discussed in detail with ultraviolet absorption spectra.

  5. Photoluminescence properties of europium doped di-strontium magnesium di-silicate phosphor by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu

    2015-01-01

    Full Text Available Europium doped di-strontium magnesium di-silicate phosphor namely (Sr2MgSi2O7:Eu3+ was prepared by the traditional high temperature solid state reaction method. The phase structure of sintered phosphor was akermanite type structure which belongs to the tetragonal crystallography with space group P42¯1m, this structure is a member of the melilite group and forms a layered compound. The EDX and FTIR spectra confirm the present elements in Sr2MgSi2O7:Eu3+ phosphor. Photoluminescence measurements showed that the phosphor exhibited strong emission peak with good intensity, corresponding to 5D0 → 7F2 (613 nm red emission and weak 5D0 → 7F1 (590 nm orange emission. The excitation spectra monitored at 613 nm show broad band from 220 to 300 nm ascribed to O–Eu charge-transfer band (CTB centered at about 269 nm, and the other peaks in the range of 300–400 nm originated from f–f transitions of Eu3+ ions. The strongest band at 395 nm can be assigned to 7F0 / 5L6 transition of Eu3+ ions due to the typical f–f transitions within Eu3+ of 4f6 configuration.

  6. Highly selective luminescent sensing of picric acid based on a water-stable europium metal-organic framework

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Tifeng; Zhu, Fengliang; Cui, Yuanjing, E-mail: cuiyj@zju.edu.cn; Yang, Yu; Wang, Zhiyu; Qian, Guodong, E-mail: gdqian@zju.edu.cn

    2017-01-15

    A water-stable metal-organic framework (MOF) EuNDC has been synthesized for selective detection of the well-known contaminant and toxicant picric acid (PA) in aqueous solution. Due to the photo-induced electron transfer and self-absorption mechanism, EuNDC displayed rapid, selective and sensitive detection of PA with a detection limit of 37.6 ppb. Recyclability experiments revealed that EuNDC retains its initial luminescent intensity and same quenching efficiency in each cycle, suggesting high photostability and reusability for long-term sensing applications. The excellent detection performance of EuNDC makes it a promising PA sensing material for practical applications. - Graphical abstract: A water-stable europium-based metal-organic framework has been reported for highly selective sensing of picric acid (PA) with a detection limit of 37.6 ppb in aqueous solution. - Highlights: • A water-stable metal-organic framework (MOF) EuNDC was synthesized. • The highly selective detection of picric acid with a detection limit of 37.6 ppb was realized. • The detection mechanism were also presented and discussed.

  7. One-pot carbonization synthesis of europium-doped carbon quantum dots for highly selective detection of tetracycline

    Science.gov (United States)

    Li Liu, Meng; Chen, Bin Bin; Yang, Tong; Wang, Jian; Liu, Xi Dong; Zhi Huang, Cheng

    2017-03-01

    The detection of tetracycline is of great significance because of its damaging effects on human health, such as renal toxicity and hemolytic anemia. Any release of tetracycline into the surrounding environment can produce bacterial drug resistance. We develop a new sensitive and selective detection approach for tetracycline in complex water samples by preparing europium-doped carbon quantum dots (Eu-CQDs) through a simple and rapid carbonization method operating at 200 °C for 5 min. The Eu-CQDs are characterized by blue photoluminescence, excitation-wavelength-dependent emission and excellent stability. Importantly, the fluorescence of the Eu-CQDs can be quenched efficiently by tetracycline, based on the strong inner filter effect mechanism between Eu-CQDs and tetracycline, making the fluorescence intensity ratio (I 0/I) of the Eu-CQDs at 465 nm correlate linearly with the concentration of tetracycline in the range of 0.5-200 μM, with a limit of detection of 0.3 μM. This shows the broad applicability of the Eu-CQDs in pursuing the concepts of simplicity and specificity for analytical purposes.

  8. Mesoporous Europium-Doped Titania Nanoparticles (Eu-MTNs) for Luminescence-Based Intracellular Bio-Imaging.

    Science.gov (United States)

    Chen, Kuan-Chou; Dutta, Saikat; Yamauchi, Yusuke; Alshehri, Saad M; Nguyen, Mai Thanh; Yonezawa, Tetsu; Shen, Kun-Hung; Wu, Kevin C W

    2015-12-01

    Monodisperse and mesoporous europium (Eu)-doped titania nanoparticles (denoted as Eu-MTNs) were prepared by a co-synthesis method with the presence of a cationic surfactant (i.e., CTAB). A maximum loading amount of 8 mol% of Eu could be successfully incorporated into the framework of MTNs. The synthesized Eu-MTNs samples were characterized with X-ray diffraction (XRD) and scanning electron microscopy (SEM), with their luminescent property examined by photoluminescence (PL). Under ultraviolet irradiation, the Eu-MTNs samples exhibit several characteristic luminescence corresponding to 5D0-7F(j) for Eu+3 ions, which can be attributed to the energy transfer from titania nanocrystallite to Eu3+ ions dispersed in amorphous mesoporous titania region. The potential intracellular bio-imaging application of the synthesized Eu-MTN nanoparticles was demonstrated with a breast cancer cell line (i.e., BT-20). High biocompatibility and strong luminescence of the Eu-MTNs show great potential in biomedical applications.

  9. Investigation of production routes for the 161Ho Auger-electron emitting radiolanthanide, a candidate for therapy

    OpenAIRE

    Tárkányi, F.; Ditrói, F.; Hermanne, A.; Takács, S.; Ignatyuk, A. V.

    2013-01-01

    The radiolanthanide 161Ho (2.48 h) is a promising Auger-electron emitter for internal radiotherapy that can be produced with particle accelerators. The excitation functions of the natDy(p,xn)161Ho and natDy(d,x)161Ho reactions were measured up to 40 and 50 MeV respectively by using the stacked foil activation method and gamma-ray spectrometry. The experimental data were compared with results of the TALYS code available in the TENDL 2011 library [1]. The main parameters of different production...

  10. The europium and praseodymium hydrolysis in a 2M NaCl environment; La hidrolisis del europio y del praseodimio en un medio 2M de NaCl

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Lopez G, H.; Solache R, M.; Rojas H, A. [Instituto Nacional de Investigaciones Nucleares, Departamento de quimica, A.P. 18-1027, 11801 Mexico D.F. (Mexico)

    1998-07-01

    It was studied the europium and praseodymium hydrolysis in a 2M NaCl ion force environment at 303 K, through two methods: this one extraction with dissolvents (lanthanide-water-NaCl-dibenzoylmethane) in presence of a competitive ligand (diglycolic acid) and that one direct potentiometric titration, of soluble species, followed by a computer refining. The values of one or another techniques of the first hydrolysis constants obtained were similar, which demonstrates that the results are reliable. The set of data obtained on the stability constants of hydrolysis products allowed to draw up the distribution diagrams of chemical species, as europium as praseodymium in aqueous environment. (Author)

  11. Specific chiral sensing of amino acids using induced circularly polarized luminescence of bis(diimine)dicarboxylic acid europium(III) complexes.

    Science.gov (United States)

    Okutani, Kazuhiro; Nozaki, Koichi; Iwamura, Munetaka

    2014-06-02

    The circularly polarized luminescence (CPL) from [Eu(pda)2](-) (pda = 1,10-phenanthroline-2,9-dicarboxylic acid) and [Eu(bda)2](-) (bda = 2,2'-bipyridine-6,6'-dicarboxylic acid) in aqueous solutions containing various amino acids was investigated. The europium(III) complexes exhibited bright-red luminescence assignable to the f-f transition of the Eu(III) ion when irradiated with UV light. Although the luminescence was not circularly polarized in the solid state or in aqueous solutions, in accordance with the achiral crystal structure, the complexes exhibited detectable induced CPL (iCPL) in aqueous solutions containing chiral amino acids. In the presence of L-pyrrolidonecarboxylic acid, both [Eu(pda)2](-) and [Eu(bda)2](-) showed similar iCPL intensity (glum ∼ 0.03 for the (5)D0 → (7)F1 transition at 1 mol·dm(-3) of the amino acid). On the other hand, in the presence of L-histidine or L-arginine, [Eu(pda)2](-) exhibited intense CPL (glum ∼ 0.08 for the (5)D0 → (7)F1 transition at 0.10 mol·dm(-3) of the amino acid), whereas quite weak CPL was observed for [Eu(bda)2](-) under the same conditions (glum europium(III) complexes possess coordination structures similar to that in the crystal with slight distortion to form a chiral structure due to specific interaction with two zwitterionic amino acids. This mechanism was in stark contrast to that of the europium(III) complex-pyrrolidonecarboxylic acid system in which one amino acid coordinates to the Eu(III) ion to yield an achiral coordination structure.

  12. A convenient method for europium-labeling of a recombinant chimeric relaxin family peptide R3/I5 for receptor-binding assays.

    Science.gov (United States)

    Zhang, Wei-Jie; Jiang, Qian; Wang, Xin-Yi; Song, Ge; Shao, Xiao-Xia; Guo, Zhan-Yun

    2013-06-01

    Relaxin family peptides have important biological functions, and so far, four G-protein-coupled receptors have been identified as their receptors (RXFP1-4). A chimeric relaxin family peptide R3/I5, containing the B-chain of relaxin-3 and the A-chain of INSL5, is a selective agonist for both RXFP3 and RXFP4. In a previous study, europium-labeled R3/I5, as a nonradioactive and low-background receptor-binding tracer, was prepared through a chemical synthesis approach. In the present study, we established a convenient alternative approach for preparing the europium-labeled R3/I5 tracer based on a recombinant R3/I5 designed to carry a solubilizing tag at the A-chain N-terminus and a pyroglutamate residue at the B-chain N-terminus. Because of the presence of a single primary amine moiety, the recombinant R3/I5 peptide was site-specifically mono-labeled at the A-chain N-terminus by a diethylenetriaminepentaacetic acid/europium moiety through a convenient one-step procedure. The diethylenetriaminepentaacetic acid/Eu3+-labeled R3/I5 bound both receptors RXFP3 and RXFP4 with high binding affinities and low nonspecific binding. Thus, we have presented a valuable nonradioactive tracer for future interaction studies on RXFP3 and RXFP4 with various natural or designed ligands. The present approach could also be adapted for preparing and labeling of other chimeric relaxin family peptides. Copyright © 2013 European Peptide Society and John Wiley & Sons, Ltd.

  13. The low-energy {beta}{sup -} and electron emitter {sup 161}Tb as an alternative to {sup 177}Lu for targeted radionuclide therapy

    Energy Technology Data Exchange (ETDEWEB)

    Lehenberger, Silvia; Barkhausen, Christoph [Institute for Radiochemistry, Technical University of Munich, Walther-Meissner-Strasse 3, 85748 Garching (Germany); Cohrs, Susan; Fischer, Eliane; Gruenberg, Juergen; Hohn, Alexander [Center for Radiopharmaceutical Sciences, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Koester, Ulli [Institut Laue-Langevin, 6 rue Jules Horowitz, 38042 Grenoble (France); Schibli, Roger [Center for Radiopharmaceutical Sciences, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Tuerler, Andreas [Institute for Radiochemistry, Technical University of Munich, Walther-Meissner-Strasse 3, 85748 Garching (Germany); Laboratory of Radiochemistry and Environmental Chemistry, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Laboratory of Radiochemistry and Environmental Chemistry, Department of Chemistry and Biochemistry, University of Bern, Freiestr. 3, 3012 Bern (Switzerland); Zhernosekov, Konstantin, E-mail: konstantin.zhernosekov@psi.ch [Institute for Radiochemistry, Technical University of Munich, Walther-Meissner-Strasse 3, 85748 Garching (Germany); Center for Radiopharmaceutical Sciences, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Laboratory of Radiochemistry and Environmental Chemistry, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland)

    2011-08-15

    Introduction: The low-energy {beta}{sup -} emitter {sup 161}Tb is very similar to {sup 177}Lu with respect to half-life, beta energy and chemical properties. However, {sup 161}Tb also emits a significant amount of conversion and Auger electrons. Greater therapeutic effect can therefore be expected in comparison to {sup 177}Lu. It also emits low-energy photons that are useful for gamma camera imaging. Methods: The {sup 160}Gd(n,{gamma}){sup 161}Gd{yields}{sup 161}Tb production route was used to produce {sup 161}Tb by neutron irradiation of massive {sup 160}Gd targets (up to 40 mg) in nuclear reactors. A semiautomated procedure based on cation exchange chromatography was developed and applied to isolate no carrier added (n.c.a.) {sup 161}Tb from the bulk of the {sup 160}Gd target and from its stable decay product {sup 161}Dy. {sup 161}Tb was used for radiolabeling DOTA-Tyr3-octreotate; the radiolabeling profile was compared to the commercially available n.c.a. {sup 177}Lu. A {sup 161}Tb Derenzo phantom was imaged using a small-animal single-photon emission computed tomography camera. Results: Up to 15 GBq of {sup 161}Tb was produced by long-term irradiation of Gd targets. Using a cation exchange resin, we obtained 80%-90% of the available {sup 161}Tb with high specific activity, radionuclide and chemical purity and in quantities sufficient for therapeutic applications. The {sup 161}Tb obtained was of the quality required to prepare {sup 161}Tb-DOTA-Tyr3-octreotate. Conclusions: We were able to produce {sup 161}Tb in n.c.a. form by irradiating highly enriched {sup 160}Gd targets; it can be obtained in the quantity and quality required for the preparation of {sup 161}Tb-labeled therapeutic agents.

  14. Europium-activated phosphors containing oxides of rare-earth and group-IIIB metals and method of making the same

    Science.gov (United States)

    Comanzo, Holly Ann; Setlur, Anant Achyut; Srivastava, Alok Mani; Manivannan, Venkatesan

    2004-07-13

    Europium-activated phosphors comprise oxides of at least a rare-earth metal selected from the group consisting of gadolinium, yttrium, lanthanum, and combinations thereof and at least a Group-IIIB metal selected from the group consisting of aluminum, gallium, indium, and combinations thereof. A method for making such phosphors comprises adding at least a halide of at least one of the selected Group-IIIB metals in a starting mixture. The method further comprises firing the starting mixture in an oxygen-containing atmosphere. The phosphors produced by such a method exhibit improved absorption in the UV wavelength range and improved quantum efficiency.

  15. Synthesis and pharmacological characterization of a europium-labelled single-chain antagonist for binding studies of the relaxin-3 receptor RXFP3.

    Science.gov (United States)

    Haugaard-Kedström, Linda M; Wong, Lilian L L; Bathgate, Ross A D; Rosengren, K Johan

    2015-06-01

    Relaxin-3 and its endogenous receptor RXFP3 are involved in fundamental neurological signalling pathways, such as learning and memory, stress, feeding and addictive behaviour. Consequently, this signalling system has emerged as an attractive drug target. Development of leads targeting RXFP3 relies on assays for screening and ligand optimization. Here, we present the synthesis and in vitro characterization of a fluorescent europium-labelled antagonist of RXFP3. This ligand represents a cheap and safe but powerful tool for future mechanistic and cell-based receptor-ligand interaction studies of the RXFP3 receptor.

  16. Bis{[6-methoxy-2-(4-methylphenyliminiomethyl]phenolate-κ2O,O′}tris(nitrato-κ2O,O′europium(III

    Directory of Open Access Journals (Sweden)

    Hang-Ming Guo

    2010-11-01

    Full Text Available The crystal structure of title compound, [Eu(NO33(C15H15NO22], contains two Schiff base 6-methoxy-2-[(4-methylphenyliminomethyl]phenolate (L ligands and three independent nitrate ions that chelate to the europium(III ion via the O atoms. The coordination number of the EuIII ion is ten. The L ligands chelate with a strong Eu—O(deprotonated phenolate bond and a weak Eu—O(methoxy contact, the latter can be interpreted as the apices of the bicapped square-antiprismatic EuIII polyhedron. Intramolecular N—H...O hydrogen bonds occur.

  17. Carbon footprint assessment of recycling technologies for rare earth elements: A case study of recycling yttrium and europium from phosphor.

    Science.gov (United States)

    Hu, Allen H; Kuo, Chien-Hung; Huang, Lance H; Su, Chao-Chin

    2017-02-01

    Rare earth elements are key raw materials in high-technology industries. Mining activities and manufacturing processes of such industries have caused considerable environmental impacts, such as soil erosion, vegetation destruction, and various forms of pollution. Sustaining the long-term supply of rare earth elements is difficult because of the global shortage of rare earth resources. The diminishing supply of rare earth elements has attracted considerable concern because many industrialized countries regarded such elements as important strategic resources for economic growth. This study aims to explore the carbon footprints of yttrium and europium recovery techniques from phosphor. Two extraction recovery methods, namely, acid extraction and solvent extraction, were selected for the analysis and comparison of carbon footprints. The two following functional units were used: (1) the same phosphor amounts for specific Y and Eu recovery concentrations, and (2) the same phosphor amounts for extraction. For acid extraction method, two acidic solutions (H2SO4 and HCl) were used at two different temperatures (60 and 90°C). For solvent extraction method, acid leaching was performed followed by ionic liquid extraction. Carbon footprints from acid and solvent extraction methods were estimated to be 10.1 and 10.6kgCO2eq, respectively. Comparison of the carbon emissions of the two extraction methods shows that the solvent extraction method has significantly higher extraction efficiency, even though acid extraction method has a lower carbon footprint. These results may be used to develop strategies for life cycle management of rare earth resources to realize sustainable usage. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Europium doped di-calcium magnesium di-silicate orange–red emitting phosphor by solid state reaction method

    Directory of Open Access Journals (Sweden)

    Ishwar Prasad Sahu

    2015-07-01

    Full Text Available A new orange–red europium doped di-calcium magnesium di-silicate (Ca2MgSi2O7:Eu3+ phosphor was prepared by the traditional high temperature solid state reaction method. The prepared Ca2MgSi2O7:Eu3+ phosphor was characterized by X-ray diffractometer (XRD, transmission electron microscopy (TEM, field emission scanning electron microscopy (FESEM with energy dispersive x-ray spectroscopy (EDX, fourier transform infrared spectra (FTIR, photoluminescence (PL and decay characteristics. The phase structure of sintered phosphor was akermanite type structure which belongs to the tetragonal crystallography with space group P4¯21m, this structure is a member of the melilite group and forms a layered compound. The chemical composition of the sintered Ca2MgSi2O7:Eu3+ phosphor was confirmed by EDX spectra. The PL spectra indicate that Ca2MgSi2O7:Eu3+ can be excited effectively by near ultraviolet (NUV light and exhibit bright orange–red emission with excellent color stability. The fluorescence lifetime of Ca2MgSi2O7:Eu3+ phosphor was found to be 28.47 ms. CIE color coordinates of Ca2MgSi2O7:Eu3+ phosphor is suitable as orange-red light emitting phosphor with a CIE value of (X = 0.5554, Y = 0.4397. Therefore, it is considered to be a new promising orange–red emitting phosphor for white light emitting diode (LED application.

  19. Evaluation of in vivo cytogenetic toxicity of europium hydroxide nanorods (EHNs) in male and female Swiss albino mice.

    Science.gov (United States)

    Bollu, Vishnu Sravan; Nethi, Susheel Kumar; Dasari, Rama Krishna; Rao, Soma Shiva Nageshwara; Misra, Sunil; Patra, Chitta Ranjan

    2016-01-01

    Our group already demonstrated that europium hydroxide nanorods (EHNs) show none or mild toxicity in C57BL/6 mice even at high dose and exhibited excellent pro-angiogenic activity towards in vitro and in vivo models. In the present study, we evaluated the in vivo cytogenetic toxicity of intraperitoneally administered EHNs (12.5-250 mg/kg/b.w.) in male and female Swiss albino mice by analyzing chromosomal aberrations (CAs), mitotic index (MI), micronucleus (MN) from bone marrow and peripheral blood. Furthermore, we performed the cytogenetic toxicity study of EHNs towards Chinese hamster ovary (CHO) cells, in order to compare with the in vivo results. The results of CA assay of mice treated with EHNs (12.5-125 mg/kg/b.w.) showed no significant change in the formation of aberrant metaphases compared to the control group. Also, there was no significant difference in the number of dividing cells between the control group and EHNs-treated groups observed by MI study, suggesting the non-cytotoxicity of EHNs. Additionally, FACS study revealed that EHNs do not arrest cells at any phase of cell cycle in the mouse model. Furthermore, MN test of both bone marrow and peripheral blood showed no significant differences in the induction of MNs when compared with the control group. In vitro results from CHO cells also support our in vivo observations. Considering the role of angiogenesis by EHNs and the absence of its genotoxicity in mouse model, we strongly believe the future application of EHNs in treating various diseases, where angiogenesis plays an important role such as cardiovascular diseases, ischemic diseases and wound healing.

  20. A 16:1 Serializer ASIC for Data Transmission at 5 Gbps

    CERN Document Server

    Gong, D; The ATLAS collaboration

    2010-01-01

    A high speed, low power 16:1 serializer is developed using a commercial 0.25 μm silicon-on-sapphire CMOS technology. It operates from 4.0 to 5.8 Gbps in the lab test. Its total jitter is measured to be 62 ps and the bathtub scan demonstrates a 122 ps opening at BER of less than 10-12 level at 5 Gbps. The measured power consumption is 507 mW at this data rate. A proton test of this chip is scheduled in June and test results will be discussed when available.

  1. A 16:1 Serializer ASIC for Data Transmission at 5 Gbps

    CERN Document Server

    Gong, D; The ATLAS collaboration

    2010-01-01

    A high speed, low power 16:1 serializer has been developed with a commercial 0.25 μm silicon-on-sapphire CMOS technology. The serializer operates from 4.0 to 5.7 Gbps. Total jitter is 62 ps and the eye openning of the bathtub curve is 122 ps at bit rate error of 10-12 at 5 Gbps. Power consumption is 463 mW at 5 Gbps. A proton beam test indicates the serializer is suitable for applications in high energy physics experiments.

  2. Development of A 16:1 serializer for data transmission at 5 Gbps

    CERN Document Server

    Gong, Datao; Liang, Zhihua; Liu, Chonghan; Liu, Tiankuan; Da-Shun Su,; Teng, Ping-Kun; Xiang, Annie C; Ye, Jingbo

    2009-01-01

    Radiation tolerant, high speed and low power serializer ASIC is critical for optical link systems in particle physics experiments. Based on a commercial 0.25 μm silicon-onsapphire CMOS technology, we design a 16:1 serializer with 5 Gbps serial data rate. This ASIC has been submitted for fabrication. The post-layout simulation indicates the deterministic jitter is 54 ps (pk-pk) and random jitter is 3 ps (rms). The power consumption of the serializer is 500 mW. The design details and post layout simulation results are presented in this paper.

  3. Corneal Opacity in a Participant of a 161-km Mountain Bike Race at High Altitude.

    Science.gov (United States)

    Khodaee, Morteza; Torres, David R

    2016-06-01

    Visual dysfunction is a relatively uncommon complaint among athletes during ultraendurance races. The pathophysiology of most of these cases is unknown. Corneal opacity has been speculated as the etiology for most of reported cases. We are presenting a case of a 56-year-old man with a partial unilateral corneal opacity and edema at kilometer 150 of a 161-km mountain bike race in high altitude. He was not able to finish the race (12-hour cutoff) because of his visual symptoms. He completely recovered in 3 days with no sequelae. Copyright © 2016 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  4. Enhanced Th1/Th17 Functions of CD161+ CD8+ T Cells in Mucosal Tissues of Rhesus Macaques.

    Directory of Open Access Journals (Sweden)

    Namita Rout

    Full Text Available Expression of the C-type lectin-like receptor CD161 by human T cells is associated with type-17 responses, which play critical regulatory roles in immunity and inflammation at mucosal sites. However, the functions of CD161-expressing T cells in macaques, the pre-clinical model of several human diseases, remain unknown. This study examined the phenotypic and functional characteristics of CD161+ T cells in peripheral blood, mucosal tissues and lymph nodes of rhesus macaques. Majority of CD161-expressing T cells in peripheral blood and lung/intestinal mucosal tissues of rhesus macaques were found to be CD8+CD4- in phenotype. There was a significant enrichment of CD161+CD8+ T cells in the lungs and colonic mucosa (16.1%±6.6 and 16.8%±5.7 in comparison to peripheral blood (4.2%±1.2 and mesenteric lymph nodes (1.3%±0.8. Regardless of the tissue compartment, CD161+CD8+ T cells mainly comprised of γδ T cells and TCR Vα7.2+ MAIT cells (up to 80%, and displayed Th1 and Th17 cytokine responses to mitogen stimulation. Mucosal CD161+CD8+ T cells were characterized by very high expression of CD69, a recent activation marker that is preferentially expressed on tissue resident cells. Furthermore, lung and colonic mucosal CD161+CD8+ T cells showed enhanced IFN-γ, IL-17, and Perforin production in comparison to those in blood. Thus, macaque CD161+CD8+ T cells represent mucosal tissue-homing innate-like CD8+ T-cell populations with Th1/Th17 type cytokine and cytotoxic effector functions that can potentially enhance the recruitment of adaptive immune cells and control initial pathogen burden/dissemination in tissues. Analysis of their role in early immune responses to mucosal pathogens will be valuable in the design of vaccines and therapeutics.

  5. Synthesis, characterization, crystal structure, DNA/BSA binding ability and antibacterial activity of asymmetric europium complex based on 1,10- phenanthroline

    Science.gov (United States)

    Alfi, Nafiseh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam; Molčanov, Krešimir

    2017-06-01

    A heteroleptic europium coordination compound formulated as [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) (phen = 1,10-phenanthroline), has been synthesized and characterized by elemental analysis, FT-IR spectroscopy, and single-crystal X-ray diffractometer. Crystal structure analysis reveals the complex is crystallized in orthorhombic system with Pca21 space group. Electronic absorption and various emission methods for investigation of the binding system of europium(III) complex to Fish Salmon deoxyribonucleic acid (FS-DNA) and Bovamin Serum Albumin (BSA) have been explored. Furthermore, the binding constants, binding sites and the corresponding thermodynamic parameters of the interaction system based on the van't Hoff equation for FS-DNA and BSA were calculated. The thermodynamic parameters reflect the exothermic nature of emission process (ΔH°DNA by non-intercalative mode which the groove binding is preferable mode. Also, the complex exhibits a brilliant antimicrobial activity in vitro against standard bacterial strains.

  6. Investigation on the co-luminescence effect of europium (III)-lanthanum(III)-dopamine-sodium dodecylbenzene sulfonate system and its application.

    Science.gov (United States)

    Si, Hailin; Zhao, Fang; Cai, Huan

    2013-01-01

    A novel luminescence, enhancement phenomenon in the europium(III)-dopamine-sodium dodecylbenzene sulfonate system was observed when lanthanum(III) was added. Based on this, a sensitive co-luminescence method was established for the determination of dopamine. The luminescence signal for the europium (III)-lanthanum(III)-dopamine-sodium dodecylbenzene sulfonate system was monitored at λ(ex) = 300 nm, λ(em) = 618 nm and pH 8.3. Under optimized conditions, the enhanced luminescence signal responded linearly to the concentration of dopamine in the range 1.0 × 10(-10)-5.0 × 10(-7) mol/L with a correlation coefficient of 0.9993 (n = 11). The detection limit (3σ) was 2.7 × 10(-11) mol/L and the relative standard deviation for 11 parallel measurements of 3.0 × 10(-8) mol/L dopamine was 1.9%. The presented method was successfully applied for the estimation of dopamine in samples of pharmaceutical preparations, human serum and urine. The possible luminescence enhancement mechanism of the system is discussed briefly. Copyright © 2013 John Wiley & Sons, Ltd.

  7. Europium-phenolic network coated BaGdF5 nanocomposites for tri-modal computed tomography/magnetic resonance/luminescence imaging.

    Science.gov (United States)

    Zhu, Wei; Liang, Shuang; Wang, Jing; Yang, Zhe; Zhang, Li; Yuan, Tianmeng; Xu, Zushun; Xu, Haibo; Li, Penghui

    2017-05-01

    Multifunctional nanocomposites based on BaGdF5 nanoparticles (NPs) and metal phenolic network (MPN) have been engineered as novel contrast agents for potential applications in X-ray computed tomography, magnetic resonance and luminescence imaging. The BaGdF5@MPN nanocomposites were synthesized at room temperature by coating BaGdF5 NPs with europium-phenolic network, which was obtained by the coordination of europium (III) with tannic acid (TA). The in vitro cytotoxicity assays against HepG2 cells revealed that the BaGdF5@MPN nanocomposites presented better cytocompatibility and lower cytotoxity than pure BaGdF5 NPs. In addition, vivid red and green luminescence can be observed by confocal laser scanning microscope (CLSM) from the BaGdF5@MPN nanocomposites laden HepG2 cells under the excitation of UV (390 nm) and visible light (440 nm), respectively. The longitudinal relaxivity value (r1) of the nanocomposites was 2.457 mM-1s-1. Moreover, the nanocomoposites exhibited X-ray computed tomography (CT) and T1-weighted magnetic resonance (MR) imaging capacities, and the intensities of the enhanced signals of in vitro CT and MR images were proportional to the concentrations of the nanocomposites. These results indicated that the as-prepared BaGdF5@MPN nanocomposites are promising contrast agents for CT/MR/luminescence imaging.

  8. Effective visible light-active boron and europium co-doped BiVO4 synthesized by sol-gel method for photodegradion of methyl orange.

    Science.gov (United States)

    Wang, Min; Che, Yinsheng; Niu, Chao; Dang, Mingyan; Dong, Duo

    2013-11-15

    Eu-B co-doped BiVO4 visible-light-driven photocatalysts have been synthesized using the sol-gel method. The resulting materials were characterized by a series of joint techniques, including XPS, XRD, SEM, BET, and UV-vis DRS analyses. Compared with BiVO4 and B-BiVO4 photocatalysts, the Eu-B-BiVO4 photocatalysts exhibited much higher photocatalytic activity for methyl orange (MO) degradation under visible light irradiation. The optimal Eu doping content is 0.8 mol%. It was revealed that boron and europium were doped into the lattice of BiVO4 and this led to more surface oxygen vacancies, high specific surface areas, small crystallite size, a narrower band gap and intense light absorbance in the visible region. The doped Eu(III) cations can help in the separation of photogenerated electrons. The synergistic effects of boron and europium in doped BiVO4 were the main reason for improving visible light photocatalytic activity. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Emission tunability and local environment in europium-doped OH{sup −}-free calcium aluminosilicate glasses for artificial lighting applications

    Energy Technology Data Exchange (ETDEWEB)

    Farias, Aline M.; Sandrini, Marcelo; Viana, José Renato M.; Baesso, Mauro L.; Bento, Antônio C.; Rohling, Jurandir H. [Departamento de Física, Universidade Estadual de Maringá, Av Colombo, 5790, 87020-900, Maringá, PR (Brazil); Guyot, Yannick [Laboratoire de Physico–Chimie des Matériaux Luminescents, Université de Lyon, Université Claude Bernard Lyon 1, Villeurbanne, UMR 5620 CNRS 69622 (France); De Ligny, Dominique [Department of Materials Science and Engineering, University of Erlangen Nürnberg, Martens str. 5, 91058, Erlangen (Germany); Nunes, Luiz Antônio O. [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador São-Carlense400, 13566-590, São Carlos, SP (Brazil); Gandra, Flávio G. [Instituto de Física Gleb Wataghin, Universidade Estadual de Campinas, 13083-859, Campinas, SP (Brazil); Sampaio, Juraci A. [Lab Ciências Físicas, Universidade Estadual Norte Fluminense, 28013-602, Campos Dos Goytacazes, RJ (Brazil); Lima, Sandro M.; Andrade, Luis Humberto C. [Grupo de Espectroscopia Óptica e Fototérmica, Universidade Estadual de Mato Grosso do Sul-UEMS, Dourados, MS, C. P. 351, CEP 79804-970 (Brazil); and others

    2015-04-15

    The relationship between emission tunability and the local environment of europium ions in OH{sup −}-free calcium aluminosilicate glasses was investigated, focusing on the development of devices for artificial lighting. Significant conversion of Eu{sup 3+} to Eu{sup 2+} was obtained by means of melting the glasses under a vacuum atmosphere and controlling the silica content, resulting in broad, intense, and tunable luminescence ranging from blue to red. Electron spin resonance and X-ray absorption near edge structure measurements enabled correlation of the luminescence behavior of the material with the Eu{sup 2+}/Eu{sup 3+} concentration ratio and changes in the surrounding ions' crystal field. The coordinates of the CIE 1931 chromaticity diagram were calculated from the spectra, and the contour maps showed that the light emitted from Eu{sup 2+} presented broad bands and enhanced color tuning, ranging from reddish-orange to blue. The results showed that these Eu doped glasses can be used for tunable white lighting by combining matrix composition and the adjustment of the pumping wavelength. - Highlights: • Eu{sup 2+}-doped OH{sup −} free calcium aluminosilicate glass as a new source for white lighting. • Correlation between emission tunability and local environment of europium ions. • Significant reduction of Eu{sup 3+} to Eu{sup 2+} by melting the glasses under vacuum atmosphere. • Broad, intense and tunable luminescence ranging from blue to red.

  10. β-decay spectroscopy of neutron-rich 160,161,162Sm isotopes

    Directory of Open Access Journals (Sweden)

    Patel Z.

    2016-01-01

    Full Text Available Neutron-rich 160,161,162Sm isotopes have been populated at the RIBF, RIKEN via β first time. β-coincident γ rays were observed in all three isotopes including γ rays from the isomeric decay of 160Sm and 162Sm. The isomers in 160Sm and 162Sm have previously been observed but have been populated via β decay for the first time. The isomeric state in 162Sm is assigned a 4−v72+[ 633 ]⊗v12−[ 521 ]${4^ - }v{{7 \\over 2}^ + }\\left[ {633} \\right] \\otimes v{{1 \\over 2}^ - }\\left[ {521} \\right]$ configuration based on the decay pattern. The level schemes of 160Sm and 162Sm are presented. The ground states in the parent nuclei 160Pm and 162Pm are both assigned a 6−v72+[633]⊗π52−[532]${6^ - }v{{7 \\over 2}^ + }\\left[ {633} \\right] \\otimes \\pi {{5 \\over 2}^ - }\\left[ {532} \\right]$ configuration based on the population of states in the daughter nuclei. Blocked BCS calculations were performed to further investigate the spin-parities of the ground states in 160Pm, 161Pm, and 162Pm, and the isomeric state in 162Sm

  11. Innate signals overcome acquired TCR signaling pathway regulation and govern the fate of human CD161(hi) CD8α⁺ semi-invariant T cells.

    Science.gov (United States)

    Turtle, Cameron J; Delrow, Jeff; Joslyn, Rochelle C; Swanson, Hillary M; Basom, Ryan; Tabellini, Laura; Delaney, Colleen; Heimfeld, Shelly; Hansen, John A; Riddell, Stanley R

    2011-09-08

    Type 17 programmed CD161(hi)CD8α(+) T cells contribute to mucosal immunity to bacteria and yeast. In early life, microbial colonization induces proliferation of CD161(hi) cells that is dependent on their expression of a semi-invariant Vα7.2(+) TCR. Although prevalent in adults, CD161(hi)CD8α(+) cells exhibit weak proliferative and cytokine responses to TCR ligation. The mechanisms responsible for the dichotomous response of neonatal and adult CD161(hi) cells, and the signals that enable their effector function, have not been established. We describe acquired regulation of TCR signaling in adult memory CD161(hi)CD8α(+) T cells that is absent in cord CD161(hi) cells and adult CD161(lo) cells. Regulated TCR signaling in CD161(hi) cells was due to profound alterations in TCR signaling pathway gene expression and could be overcome by costimulation through CD28 or innate cytokine receptors, which dictated the fate of their progeny. Costimulation with IL-1β during TCR ligation markedly increased proinflammatory IL-17 production, while IL-12-induced Tc1-like function and restored the response to TCR ligation without costimulation. CD161(hi) cells from umbilical cord blood and granulocyte colony stimulating factor-mobilized leukaphereses differed in frequency and function, suggesting future evaluation of the contribution of CD161(hi) cells in hematopoietic stem cell grafts to transplant outcomes is warranted.

  12. Determination of the hydrolysis constants of Europium (III), in ion strength media 4, 5 and 6 M NaClO{sub 4} at 303 K; Determinacion de las constantes de hidrolisis del Europio (III), en medios de fuerza ionica 4, 5 y 6 M de NaClO{sub 4} a 303 K

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado B, A.; Jimenez R, M.; Solache R, M. [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, 11801 Mexico D.F. (Mexico)

    1999-07-01

    This work was made with the purpose to complete information about the hydrolysis constants of Europium (III) in high ion strength media. So it was determined at a ion forces media 4, 5 and 6 M of sodium perchlorate at 303 K. The method used was the potentiometric with the aid of the Super quad computer program. In high ion strength media, the measurements of p H do not correspond directly to negative logarithm of the concentration of hydrogen ions, by this it is necessary to calibrate the electrode in these conditions. The Europium was hydrolized at pC{sub H} values greater 6 in all cases. The potentiometric method used under the described experimental conditions is adequate to determine the hydrolysis constants of Europium (III). According to the results and diagrams of chemical species of Europium obtained we can conclude that the hydrolysis constants, differ by its distribution but not in its identity. (Author)

  13. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak

    2009-08-01

    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  14. Europium-Labeled Synthetic C3a Protein as a Novel Fluorescent Probe for Human Complement C3a Receptor.

    Science.gov (United States)

    Dantas de Araujo, Aline; Wu, Chongyang; Wu, Kai-Chen; Reid, Robert C; Durek, Thomas; Lim, Junxian; Fairlie, David P

    2017-06-21

    Measuring ligand affinity for a G protein-coupled receptor is often a crucial step in drug discovery. It has been traditionally determined by binding putative new ligands in competition with native ligand labeled with a radioisotope of finite lifetime. Competing instead with a lanthanide-based fluorescent ligand is more attractive due to greater longevity, stability, and safety. Here, we have chemically synthesized the 77 residue human C3a protein and conjugated its N-terminus to europium diethylenetriaminepentaacetate to produce a novel fluorescent protein (Eu-DTPA-hC3a). Time-resolved fluorescence analysis has demonstrated that Eu-DTPA-hC3a binds selectively to its cognate G protein-coupled receptor C3aR with full agonist activity and similar potency and selectivity as native C3a in inducing calcium mobilization and phosphorylation of extracellular signal-regulated kinases in HEK293 cells that stably expressed C3aR. Time-resolved fluorescence analysis for saturation and competitive binding gave a dissociation constant (Kd) of 8.7 ± 1.4 nM for Eu-DTPA-hC3a and binding affinities for hC3a (pKi of 8.6 ± 0.2 and Ki of 2.5 nM) and C3aR ligands TR16 (pKi of 6.8 ± 0.1 and Ki of 138 nM), BR103 (pKi of 6.7 ± 0.1 and Ki of 185 nM), BR111 (pKi of 6.3 ± 0.2 and Ki of 544 nM) and SB290157 (pKi of 6.3 ± 0.1 and Ki of 517 nM) via displacement of Eu-DTPA-hC3a from hC3aR. The macromolecular conjugate Eu-DTPA-hC3a is a novel nonradioactive probe suitable for studying ligand-C3aR interactions with potential value in accelerating drug development for human C3aR in physiology and disease.

  15. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints.

    Science.gov (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin

    2009-08-28

    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  16. Entropy in hot $^{161,162}Dy$ and $^{171,172}Yb$ nuclei

    CERN Document Server

    Guttormsen, M; Hjorth-Jensen, M; Melby, E; Rekstad, J; Schiller, A; Siem, S; Belic, A

    2000-01-01

    The density of accessible levels at low spin in the (^3He,\\alpha \\gamma) reaction has been extracted for the ^{161,162}Dy and ^{171,172}Yb nuclei. The entropy of the even-odd and even-even nuclei has been deduced as a function of excitation energy, and found to reach a maximum of 15 k_B before neutron evaporation. The entropy of one quasi-particle outside an even-even core is found to be 1.70(15) k_B. This quasi-particle picture of hot nuclei is well accounted for within a simple pairing model. The onset of two, four and six quasi-particle excitations in the ^{162}Dy and ^{172}Yb nuclei is discussed and compared to theory. The number of quasi-particles excited per excitation energy is a measure for the ratio of the level energy spacing and the pairing strength.

  17. Neutron cross section evaluations of europium isotopes in 1 keV - 30 MeV energy range. Format - validation - comparison; Evaluation de sections efficaces pour des neutrons incidents sur des isotopes d'europium aux energies 1 keV - 30 MeV. Format - validation - comparaison

    Energy Technology Data Exchange (ETDEWEB)

    Dossantos-Uzarralde, P.; Le Luel, C.; Bauge, E. [CEA Bruyeres le Chatel, 91 (France). Dept. de Physique Theorique et Appliquee

    2004-07-01

    This paper presents neutron cross section evaluations of Europium isotopes. The cross sections are evaluated in 1 keV - 30 MeV energy range for the isotopes {sup 146}Eu, {sup 147}Eu, {sup 148}Eu, {sup 149}Eu, {sup 150}Eu, {sup 151}Eu, {sup 152}Eu, {sup 153}Eu, {sup 154}Eu in their ground state. This evaluation includes cross section productions of the long life isomeric states. Special attention is put on the options used for the description of the files written in ENDF-6 format. The final issue is a proposal of a new breed of ENDF-6 formatted neutron activation file. (authors)

  18. Cross-section measurement of some deuteron induced reactions on $^{160}$Gd for possible production of the therapeutic radionuclide $^{161}$Tb

    OpenAIRE

    Tárkányi, F.; Hermanne, A.; Takács, S.; Ditrói, F.; Csikai, J.; Ignatyuk, A. V.

    2013-01-01

    The radionuclide 161Tb (T1/2=6.89 d) is potentially important for internal radiotherapy. It is generally produced through the 160Gd(n,{\\gamma})161Gd - 161Tb route at research reactors. In this work the possibility of its production at a cyclotron was investigated. Determination of the excitation function of the 160Gd(d,x)161Tb production route and that of the disturbing 160Gd(d,2n)160Tb side reaction was done over the deuteron energy range up to 50 MeV using the stacked-foil technique and hig...

  19. Differential Effect of Cytomegalovirus Infection with Age on the Expression of CD57, CD300a, and CD161 on T-Cell Subpopulations

    Directory of Open Access Journals (Sweden)

    Fakhri Hassouneh

    2017-06-01

    Full Text Available Immunosenescence is a progressive deterioration of the immune system with aging. It affects both innate and adaptive immunity limiting the response to pathogens and to vaccines. As chronic cytomegalovirus (CMV infection is probably one of the major driving forces of immunosenescence, and its persistent infection results in functional and phenotypic changes to the T-cell repertoire, the aim of this study was to analyze the effect of CMV-seropositivity and aging on the expression of CD300a and CD161 inhibitory receptors, along with the expression of CD57 marker on CD4+, CD8+, CD8+CD56+ (NKT-Like and CD4−CD8− (DN T-cell subsets. Our results showed that, regardless of the T-cell subset, CD57−CD161−CD300a+ T-cells expand with age in CMV-seropositive individuals, whereas CD57−CD161+CD300a+ T-cells decrease. Similarly, CD57+CD161−CD300a+ T-cells expand with age in CMV-seropositive individuals in all subsets except in DN cells and CD57−CD161+CD300a− T-cells decrease in all T-cell subsets except in CD4+ T-cells. Besides, in young individuals, CMV latent infection associates with the expansion of CD57+CD161−CD300a+CD4+, CD57−CD161−CD300a+CD4+, CD57+CD161−CD300a+CD8+, CD57−CD161−CD300a+CD8+, CD57+CD161−CD300a+NKT-like, and CD57+CD161−CD300a+DN T-cells. Moreover, in young individuals, CD161 expression on T-cells is not affected by CMV infection. Changes of CD161 expression were only associated with age in the context of CMV latent infection. Besides, CD300a+CD57+CD161+ and CD300a−CD57+CD161+ phenotypes were not found in any of the T-cell subsets studied except in the DN subpopulation, indicating that in the majority of T-cells, CD161 and CD57 do not co-express. Thus, our results show that CMV latent infection impact on the immune system depends on the age of the individual, highlighting the importance of including CMV serology in any study regarding immunosenescence.

  20. Complexation of lactate with neodymium(III) and europium(III) at variable temperatures: studies by potentiometry, microcalorimetry, optical absorption, and luminescence spectroscopy.

    Science.gov (United States)

    Tian, Guoxin; Martin, Leigh R; Rao, Linfeng

    2010-11-15

    The complexation of neodymium(III) and europium(III) with lactate was studied at variable temperatures by potentiometry, absorption spectrophotometry, luminescence spectroscopy, and microcalorimetry. The stability constants of three successive lactate complexes (ML(2+), ML(2)(+), and ML(3)(aq), where M stands for Nd and Eu and L stands for lactate) at 10, 25, 40, 55, and 70 °C were determined. The enthalpies of complexation at 25 °C were determined by microcalorimetry. Thermodynamic data show that the complexation of trivalent lanthanides (Nd(3+) and Eu(3+)) with lactate is exothermic and the complexation becomes weaker at higher temperatures. Results from optical absorption and luminescence spectroscopy suggest that the complexes are inner-sphere chelate complexes in which the protonated α-hydroxyl group of lactate participates in the complexation.

  1. Selective separation of americium from europium using 2,9-bis(triazine)-1,10-phenanthrolines in ionic liquids: a new twist on an old story.

    Science.gov (United States)

    Williams, Neil J; Dehaudt, Jérémy; Bryantsev, Vyacheslav S; Luo, Huimin; Abney, Carter W; Dai, Sheng

    2017-02-28

    Bis-triazine phenanthrolines have shown great promise for f-block metal separations, attributable to their highly preorganized structure, nitrogen donors, and more enhanced covalent bonding with actinides over lanthanides. However, their limited solubility in traditional solvents remains a technological bottleneck. Herein we report our recent work using a simple 2,9-bis(triazine)-1,10-phenanthroline (Me-BTPhen) dissolved in an ionic liquid (IL), demonstrating the efficacy of IL extraction systems for the selective separation of americium from europium, achieving separation factors in excess of 7500 and selectively removing up to 99% of the americium. Characterization of the coordination environment was performed using a combination of X-ray absorption fine structure spectroscopy (XAFS) and density functional theory (DFT) calculations.

  2. Experimental and Theoretical Studies on the Structure and Photoluminescent Properties of New Mononuclear and Homodinuclear Europium(III β-Diketonate Complexes

    Directory of Open Access Journals (Sweden)

    João P. Martins

    2015-01-01

    Full Text Available Two novel europium(III complexes, a monomer and a homodimer, with 1-(4-chlorophenyl-4,4,4-trifluoro-1,3-butanedione (Hcbtfa and 5-chloro-1,10-phenanthroline (cphen ligands, formulated as [Eu(cbtfa3(cphen] and [Eu2(cbtfa4(cphen2(CH3O2], have been synthesized. Their structures have been elucidated by X-ray diffraction and their absorption and emission properties have been studied in the solid state. The experimental data has then been used to test the recently released LUMPAC software, a promising tool which can facilitate the design of more efficient lanthanide light-conversion molecular devices by combining ground state geometry, excited state energy, and luminescent properties calculations.

  3. Optical Temperature Probe Based on the Fluorescence Decay Time of Tris-(dibenzoylmethane mono (5-amino-1,10-phenanthroline-europium(III

    Directory of Open Access Journals (Sweden)

    Hung T. LAM

    2010-08-01

    Full Text Available The measurement of temperature is essential in defining the physical and chemical properties of any system. This is particularly true in dynamic systems where the temperature may fluctuate during the process. In this paper we investigated the potential of tris-(dibenzoylmethane mono (5-amino-1, 10-phenanthroline-europium(III ( Eu[tdap] as an optical temperature probe. The principle of the measurement is based on the temperature dependence of the fluorescence decay time of Eu(tdap embedded in polystyrene. Within the investigated temperature range between 3 and 70°C a linear correlation between temperature and decay time was found. The probe is accurate and repeatable and there is no cross-sensitivity to pH changes. Continuous measurement for more than 2.5 hours at which the temperature is switched between two different temperatures shows no signal drift. The relative standard deviation is less than 0.65 percent.

  4. Crystal structure and luminescence of a europium coordination polymer {[Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy)} ∞

    Science.gov (United States)

    Li, X.; Zheng, X.; Jin, L.; Lu, S.; Qin, W.

    2000-02-01

    The structure of the complex [Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy) ( m-MOBA: m-methoxybenzoate, 4,4'-bpy: 4,4'-bipyridine) was determined by single crystal X-ray diffraction. The bonding around each europium consists of two oxygen atoms of the chelated carboxyl group, two oxygen atoms of two water molecules and four oxygen atoms of the bidentate bridging carboxylate groups, forming an infinite polymeric chain structure. The luminescence behaviour of Eu 3+ in {[Eu( m-MOBA) 3·2H 2O]1/2(4,4'-bpy)} ∞ was observed at 77 K. The emission spectra of 5D 1→ 7F J ( J=1-3) and 5D 0→ 7F J ( J=0-4) transitions were recorded. The complex displays intense luminescence which may be related to the m-MOBA ligand and the polymeric coordination.

  5. IAC 25 (Pedrinhas e IAC 161 (Taiamã: novos cultivares de trigo IAC 25 (Pedrinhas and IAC 161 (Taiamã: new wheat cultivars

    Directory of Open Access Journals (Sweden)

    João Carlos Felíco

    1990-01-01

    Full Text Available Avaliaram-se os cultivares de trigo IAC 25 (Pedrinhas e IAC 161 (Taiamã, provenientes de cruzamentos artificiais e obtidos por seleção pelo método genealógico, quanto à produtividade de grãos e às reações aos agentes causais da ferrugem-do-colmo e da-folha e da helmintosporiose no Vale do Paranapanema (SP, em condições de sequeiro, e na região Norte (SP, com irrigação por aspersão. Avaliaram-nos também em relação às qualidades industriais de panificação. Em condições de sequeiro, as produções médias de grãos dos novos cultivares não se apresentaram estatisticamente diferentes das da testemunha 'Anahuac', porém 'Pedrinhas' confirmou como grande vantagem o ciclo precoce (100-115 dias. Para as áreas com irrigação por aspersão, em solos com elevada acidez (porcentagem de saturação por bases inferior a 60% 'Pedrinhas' e Taiamã' exibiram melhor produção de grãos em relação ao 'Anahuac'. Para solos com baixa acidez, não houve diferença estatística entre os três cultivares. O 'Pedrinhas' e o 'Taiamã' apresentaram moderada tolerância ao Al3+, quando testados em soluções nutritivas contendo esse elemento; 'Taiamã' demonstrou alta suscetibilidade à toxicidade de ferro e, 'Pedrinhas', moderada tolerância, enquanto para o manganês ambos exibiram tolerância. O 'Taiamã' mostrou resistência à ferrugem-do-colmo e, o 'Pedrinhas', moderada resistência, em testes em casa de vegetação. O 'Pedrinhas' revelou-se mais suscetível à ferrugem-da-folha que o 'Taiamã' e o 'Anahuac' em condições de campo, enquanto, para a helmintosporiose, os três apresentaram-se suscetíveis. Nos ensaios de panificação, a farinha do 'Taiamã' foi superior à do 'Pedrinhas', proporcionando pães de excelente qualidade física, com volume específico bastante superior à farinha de trigo comercial.The wheat cultivars IAC 25 (Pedrinhas and IAC 161 (Taiamã originated from artificial crosses and selected by the pedigree method

  6. Synthesis and luminescence properties of two novel europium (III) perchlorate complexes with bis(benzylsulfinyl)methane and 1,10-phenanthroline

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wen-Xian, E-mail: nmglwx@163.com [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China); Guo, Feng [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China); Zheng, Yu-Shan [Inner Mongolia Autonomous Region Product Quality Inspection Institute, Hohhot 010010 (China); Cao, Xiao-Fang; Feng, Shu-Yan; Bai, Juan; Xin, Xiao-Dong [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China)

    2014-09-15

    Two novel binary and ternary Europium (III) perchlorate complexes were synthesized. The binary complex was prepared with bis(benzylsulfinyl)methane as ligand, and the ternary complex was with bis(benzylsulfinyl)methane as first ligand and 1,10-Phenanthroline as second ligand. They were characterized by element analysis, molar conductivity, coordination titration analysis, IR, TG-DSC, {sup 1}HNMR and UV spectra. The results indicated that the composition of binary and ternary complexes was EuL{sub 2.5}·(ClO{sub 4}){sub 3}·3H{sub 2}O and Eu{sub 2}L{sub 4}·phen·(ClO{sub 4}){sub 6}·12H{sub 2}O (L=C{sub 6}H{sub 5}CH{sub 2}SOCH{sub 2}SOCH{sub 2}C{sub 6}H{sub 5}), respectively. The fluorescent spectra illustrated that the complexes displayed characteristic Europium (III) ion fluorescence in solid state, indicating the ligands favored energy transfer to the excitation state energy level of it. The strongest characteristic fluorescence emission intensity of the ternary system was 1.87 times as strong as that of the binary system. The fluorescent quantum yields of the Eu (III) ternary and binary complexes were also calculated. Additionally, the phosphorescence spectra and the luminescence mechanisms of the complexes were studied and explained. - Highlights: • Two rare earth complexes are new. And they are stabilized. • The intensities of the two rare earth complexes were all stronger and the lifetimes were longer. • The introduction of the second organic ligand1,10-Phenanthroline enhanced the fluorescence intensity. • The fluorescent quantum yields of two complexes being calculated are both very high.

  7. 77 FR 28406 - 161st Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of...

    Science.gov (United States)

    2012-05-14

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF LABOR Employee Benefits Security Administration 161st Meeting of the Advisory Council on Employee Welfare and Pension... Council on Employee Welfare and Pension Benefit Plans (also known as the ERISA Advisory Council) will be...

  8. CNV-association meta-analysis in 191,161 European adults reveals new loci associated with anthropometric traits

    DEFF Research Database (Denmark)

    Macé, Aurélien; Tuke, Marcus A; Deelen, Patrick

    2017-01-01

    There are few examples of robust associations between rare copy number variants (CNVs) and complex continuous human traits. Here we present a large-scale CNV association meta-analysis on anthropometric traits in up to 191,161 adult samples from 26 cohorts. The study reveals five CNV associations ...

  9. CNV-association meta-analysis in 191,161 European adults reveals new loci associated with anthropometric traits

    NARCIS (Netherlands)

    Macé, Aurélien; Tuke, Marcus A; Deelen, Patrick; Kristiansson, Kati; Mattsson, Hannele; Nõukas, Margit; Sapkota, Yadav; Schick, Ursula; Porcu, Eleonora; Rüeger, Sina; McDaid, Aaron F; Porteous, David; Winkler, Thomas W; Salvi, Erika; Shrine, Nick; Liu, Xueping; Ang, Wei Q; Zhang, Weihua; Feitosa, Mary F; Venturini, Cristina; van der Most, Peter J; Rosengren, Anders; Wood, Andrew R; Beaumont, Robin N; Jones, Samuel E; Ruth, Katherine S; Yaghootkar, Hanieh; Tyrrell, Jessica; Havulinna, Aki S; Boers, Harmen; Mägi, Reedik; Kriebel, Jennifer; Müller-Nurasyid, Martina; Perola, Markus; Nieminen, Markku; Lokki, Marja-Liisa; Kähönen, Mika; Viikari, Jorma S; Geller, Frank; Lahti, Jari; Palotie, Aarno; Koponen, Päivikki; Lundqvist, Annamari; Rissanen, Harri; Bottinger, Erwin P; Afaq, Saima; Wojczynski, Mary K; Lenzini, Petra; Nolte, Ilja M; Sparsø, Thomas; Schupf, Nicole; Christensen, Kaare; Perls, Thomas T; Newman, Anne B; Werge, Thomas; Snieder, Harold; Spector, Timothy D; Chambers, John C; Koskinen, Seppo; Melbye, Mads; Raitakari, Olli T; Lehtimäki, Terho; Tobin, Martin D; Wain, Louise V; Sinisalo, Juha; Peters, Annette; Meitinger, Thomas; Martin, Nicholas G; Wray, Naomi R; Montgomery, Grant W; Medland, Sarah E; Swertz, Morris A; Vartiainen, Erkki; Borodulin, Katja; Männistö, Satu; Murray, Anna; Bochud, Murielle; Jacquemont, Sébastien; Rivadeneira, Fernando; Hansen, Thomas F; Oldehinkel, Albertine J; Mangino, Massimo; Province, Michael A; Deloukas, Panos; Kooner, Jaspal S; Freathy, Rachel M; Pennell, Craig; Feenstra, Bjarke; Strachan, David P; Lettre, Guillaume; Hirschhorn, Joel; Cusi, Daniele; Heid, Iris M; Hayward, Caroline; Männik, Katrin; Beckmann, Jacques S; Loos, Ruth J F; Nyholt, Dale R; Metspalu, Andres; Eriksson, Johan G; Weedon, Michael N; Salomaa, Veikko; Franke, Lude; Reymond, Alexandre; Frayling, Timothy M; Kutalik, Zoltán

    2017-01-01

    There are few examples of robust associations between rare copy number variants (CNVs) and complex continuous human traits. Here we present a large-scale CNV association meta-analysis on anthropometric traits in up to 191,161 adult samples from 26 cohorts. The study reveals five CNV associations at

  10. Role of cysteine at positions 67, 161 and 241 of a Bacillus sphaericus binary toxin BinB.

    Science.gov (United States)

    Boonyos, Patcharaporn; Soonsanga, Sumarin; Boonserm, Panadda; Promdonkoy, Boonhiang

    2010-01-01

    Binary toxin consisting of BinA and BinB from Bacillus sphaericus is toxic to mosquito larvae. BinB is responsible for specific binding to the larval gut cell membrane while BinA is crucial for toxicity. To investigate functional role of cysteine in BinB, three cysteine residues at positions 67, 161, and 241 were replaced by alanine or serine. Mutations at these positions did not affect protein production and overall structure of BinB. These cysteine residues are not involved in disulfide bond formation between BinB molecules. Mosquito-larvicidal assays revealed that C67 and C161 are essential for toxicity, whereas C241 is not. Mutations at C67 and C161 resulted in weaker BinA-BinB interaction. The loss of toxicity may be due to the reduction of interactions between BinA and BinB or BinB and its receptor. C67 and C161 could also play a part during conformational changes or internalization of the binary toxin into the target cell. [BMB reports 2010; 43(1): 23-28].

  11. Kui naine tahab olla kangelane : kestvus-perfomance "Äng - 161 km palja rindkerega" / Fideelia-Signe Roots

    Index Scriptorium Estoniae

    Roots, Fideelia-Signe, 1976-

    2014-01-01

    Fideelia-Signe Roots oma aktsioonist tegevuskunstiürituse "Äng" raames, mille käigus kunstnik kõndis jalgsi alasti ülakehaga 161 kilomeetrit Tartust Karepale eesmärgiga testida naise kehakuvandi piire. Kangelase ja superkangelase mõistest

  12. Luminescent europium and terbium complexes of dipyridoquinoxaline and dipyridophenazine ligands as photosensitizing antennae: structures and biological perspectives.

    Science.gov (United States)

    Dasari, Srikanth; Patra, Ashis K

    2015-12-14

    The europium(III) and terbium(III) complexes, namely [Eu(dpq)(DMF)2(NO3)3] (1), [Eu(dppz)2(NO3)3] (2), [Tb(dpq)(DMF)2Cl3] (3), and [Tb(dppz)(DMF)2Cl3] (4), where dipyrido[3,2-d:2',3'-f]quinoxaline (dpq in 1 and 3), dipyrido[3,2-a:2',3'-c]phenazine (dppz in 2 and 4) and N,N'-dimethylformamide (DMF) have been isolated, characterized from their physicochemical data, luminescence studies and their interaction with DNA, serum albumin protein and photo-induced DNA cleavage activity are studied. The X-ray crystal structures of complexes 1-4 show discrete mononuclear Ln(3+)-based structures. The Eu(3+) in [Eu(dpq)(DMF)2(NO3)3] (1) and [Eu(dppz)2(NO3)3] (2) as [Eu(dppz)2(NO3)3]·dppz (2a) adopts a ten-coordinated bicapped dodecahedron structure with a bidentate N,N-donor dpq ligand, two DMF and three NO3(-) anions in 1 and two bidentate N,N-donor dppz ligands and three NO3(-) anions in 2. Complexes 3 and 4 show a seven-coordinated mono-capped octahedron structure where Tb(3+) contains bidentate dpq/dppz ligands, two DMF and three Cl(-) anions. The complexes are highly luminescent in nature indicating efficient photo-excited energy transfer from the dpq/dppz antenna to Ln(3+) to generate long-lived emissive excited states for characteristic f → f transitions. The time-resolved luminescence spectra of complexes 1-4 show typical narrow emission bands attributed to the (5)D0 → (7)F(J) and (5)D4 → (7)F(J) f-f transitions of Eu(3+) and Tb(3+) ions respectively. The number of inner-sphere water molecules (q) was determined from luminescence lifetime measurements in H2O and D2O confirming ligand-exchange reactions with water in solution. The complexes display significant binding propensity to the CT-DNA giving binding constant values in the range of 1.0 × 10(4)-6.1 × 10(4) M(-1) in the order 2, 4 (dppz) > 1, 3 (dpq). DNA binding data suggest DNA groove binding with the partial intercalation nature of the complexes. All the complexes also show binding propensity (K(BSA)

  13. Application of a room temperature ionic liquid for nuclear spent fuel reprocessing: speciation of trivalent europium and solvatation effects; Application d'un liquide ionique basse temperature pour les procedes de separation: speciation de l'europium trivalent et effets solvatation

    Energy Technology Data Exchange (ETDEWEB)

    Moutiers, G.; Mekki, S. [CEA Saclay, Dept. de Physico-Chimie, Service de Chimie Physique, 91 - Gif sur Yvette (France); Billard, I. [IN2P3/CNRS, 69 - Villeurbanne (France)

    2007-07-01

    One of the solutions proposed for the optimization of the long term storage and conditioning of spent nuclear fuel is to separate actinide and lanthanide both from each other and from other less radioactive metallic species. The industrial proposed processes, based on liquid liquid extraction steps, involve solvents with non negligible vapour pressure and may generate contaminated liquid wastes that will have to be reprocessed. During the last decade, some room-temperature ionic liquids have been studied and integrated into industrial processes. The interest on this class of solvent came out from their 'green' properties (non volatile, non flammable, recyclable, etc...), but also from the variability of their physico-chemical properties (stability, hydrophobicity, viscosity) as a function of the RTIL chemical composition. Indeed, it has been shown that classical chemical industrial processes could be transferred into those media, even more improved, while a certain number of difficulties arising from using traditional solvent can be avoided. In this respect, it could be promising to investigate the ability to use room temperature ionic liquid into the spent nuclear fuel reprocessing field. The aim of this this study is to test the ability of the specific ionic liquid bumimTf{sub 2}N to allow trivalent europium extraction. The choice of this metal is based on the chemical analogy with trivalent minor actinides Curium and Americium which are contributing the greatest part of the long-lived high level radioactive wastes. Handling these elements needs to be very cautious for the safety and radioprotection aspect. Moreover, europium is a very sensitive luminescent probe to its environment even at the microscopic scale. The report is structured with four parts. In a first chapter, we present the main physico-chemical properties of an imidazolium-based ionic liquid family, and then we choose the ionic liquid bumimTf{sub 2}N for the whole thesis and start with

  14. An investigation of genetic heterogeneity and linkage disequilibrium in 161 families with spinal muscular atrophy

    Energy Technology Data Exchange (ETDEWEB)

    Merette, C.; Gilliam, T.C.; Brzustowicz, L.M. (Columbia Univ., New York, NY (United States)); Daniels, R.J.; Davies, K.E. (Institute of Molecular Medicine, Oxford (United Kingdom)); Melki, J.; Munnich, A. (Hopital des Enfants-Malades, Paris (France)); Pericak-Vance, M.A. (Duke Univ Medical Center, Durham, NC (United States)); Siddique, T. (Northwestern Univ., Chicago, IL (United States)); Voosen, B. (Institute fuer Humangenetik der Universitaet, Bonn (Germany)) (and others)

    1994-05-01

    The authors performed linkage analysis of 161 families with spinal muscular atrophy (SMA) in which affected individuals suffer from the intermediate or mild form of the disease (Types II or III). Markers for six loci encompassing the chromosome 5q11.2-q13.3 region were typed. The best map location for the disease locus was found to be between D5S6 and MAP1B. The corresponding 1 lod unit support interval is confined to this interval and spans 0.5 cM. The data strongly support the hypothesis of linkage heterogeneity (likelihood ratio, 1.14 [times] 10[sup 4]), with 5% of the families unlinked. Four families have a probability of less than 50% of segregating the SMA gene linked to the region 5q11.2-q13.3. A likelihood approach to test for linkage disequilibrium revealed no significant departure from Hardy-Weinberg equilibrium with any marker under study. 28 refs., 4 figs., 3 tabs.

  15. Development and initial performance results of a Solo 161 Stirling refrigerator for temperatures between -30 C and -90 C; Entwicklung und erste Betriebserfahrungen einer Solo 161 Stirling-Kaeltemaschine fuer die Kaeltebereitstellung bei Temperaturen zwischen -30 C und -90 C

    Energy Technology Data Exchange (ETDEWEB)

    Schikora, H.; Siegel, A. [Essen Univ. (Gesamthochschule) (Germany). Inst. fuer Angewandte Thermodynamik und Klimatechnik

    2000-07-01

    Several theoretical investigations have shown that Stirling refrigerators could be a promising alternative for refrigeration at 'near-ambient' temperatures (above -40 C). These theoretical statements shall be validated in an actual research project by measurements taken from a Stirling refrigerator that is optimised for this range of temperature. In this paper first measurement results of this new developed Solo 161 Stirling refrigerator will be presented. Problems are investigated by detailed measurements. Possible improvements are described. (orig.) [German] Verschiedene theoretische Untersuchungen haben gezeigt, dass Stirling-Kaeltemaschinen eine interessante Alternative fuer die Kaelteerzeugung im sog. 'umgebungsnahen' Temperaturbereich (oberhalb von -40 C) darstellen koennten. In einem derzeit laufenden Forschungsvorhaben sollen diese theoretischen Untersuchungen durch Messungen an einer fuer diesen Temperaturbereich optimierten Stirling-Kaeltemaschine ueberprueft werden. In diesem Aufsatz werden erste Messergebnisse dieser neu entwickelten Solo 161 Stirling-Kaeltemaschine praesentiert. Anhand detaillierter Messergebnisse werden Schwachstellen lokalisiert und moegliche Verbesserungsmassnahmen beschrieben. (orig.)

  16. Measurement of Trilinear Gauge Couplings in $e^+ e^-$ Collisions at 161 GeV and 172 GeV

    CERN Document Server

    Abreu, P; Adye, T; Adzic, P; Alekseev, G D; Alemany, R; Allport, P P; Almehed, S; Amaldi, Ugo; Amato, S; Andersson, P; Andreazza, A; Antilogus, P; Apel, W D; Arnoud, Y; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barão, F; Barbier, R; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Bärring, O; Bates, M J; Battaglia, Marco; Baubillier, M; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Benvenuti, Alberto C; Bérat, C; Berggren, M; Bertini, D; Bertrand, D; Besançon, M; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bizouard, M A; Bloch, D; Bonesini, M; Bonivento, W; Boonekamp, M; Booth, P S L; Borgland, A W; Borisov, G; Bosio, C; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozovic, I; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Brown, R; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Cabrera, S; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Carena, F; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Cerruti, C; Chabaud, V; Chapkin, M M; Charpentier, P; Chaussard, L; Checchia, P; Chelkov, G A; Chen, M; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Chudoba, J; Collins, P; Colomer, M; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Cowell, J H; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; D'Almagne, B; Damgaard, G; Dauncey, P D; Davenport, Martyn; Da Silva, W; Deghorain, A; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; Dijkstra, H; Di Ciaccio, Lucia; Di Diodato, A; Djannati, A; Dolbeau, J; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Duperrin, A; Durand, J D; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Ellert, M; Elsing, M; Engel, J P; Erzen, B; Espirito-Santo, M C; Falk, E; Fanourakis, G K; Fassouliotis, D; Fayot, J; Feindt, Michael; Ferrari, P; Ferrer, A; Fichet, S; Firestone, A; Fischer, P A; Flagmeyer, U; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frodesen, A G; Frühwirth, R; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gaspar, M; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Gerdyukov, L N; Ghodbane, N; Glege, F; Gokieli, R; Golob, B; Gonçalves, P; González-Caballero, I; Gopal, Gian P; Gorn, L; Górski, M; Guz, Yu; Gracco, Valerio; Grahl, J; Graziani, E; Green, C; Grefrath, A; Gris, P; Grosdidier, G; Grzelak, K; Günther, M; Guy, J; Hahn, F; Hahn, S; Haider, S; Hajduk, Z; Hallgren, A; Hamacher, K; Harris, F J; Hedberg, V; Heising, S; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Heuser, J M; Higón, E; Holmgren, S O; Holt, P J; Holthuizen, D J; Hoorelbeke, S; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, C; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, Christian; Juillot, P; Kapusta, F; Karafasoulis, K; Katsanevas, S; Katsoufis, E C; Keränen, R; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klapp, O; Klein, H; Kluit, P M; Knoblauch, D; Kokkinias, P; Koratzinos, M; Korcyl, K; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Krammer, Manfred; Kreuter, C; Kronkvist, I J; Krumshtein, Z; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Lapin, V; Laugier, J P; Lauhakangas, R; Leder, Gerhard; Ledroit, F; Lefébure, V; Legan, C K; Leisos, A; Leitner, R; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Lethuillier, M; Libby, J; Liko, D; Lipniacka, A; Lippi, I; Lörstad, B; Loken, J G; Lopes, J H; López, J M; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J N; Mahon, J R; Maio, A; Malek, A; Malmgren, T G M; Malychev, V; Mandl, F; Marco, J; Marco, R P; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, F; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; McPherson, G; Medbo, J; Meroni, C; Meyer, W T; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Moreau, X; Morettini, P; Münich, K; Mulders, M; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Myklebust, T; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Nawrocki, K; Negri, P; Némécek, S; Neufeld, N; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Nikolenko, M; Niss, P; Nomerotski, A; Normand, Ainsley; Nygren, A; Oberschulte-Beckmann, W; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Orazi, G; Österberg, K; Ouraou, A; Paganini, P; Paganoni, M; Paiano, S; Pain, R; Paiva, R; Palka, H; Papadopoulou, T D; Papageorgiou, K; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Pegoraro, M; Pernegger, H; Pernicka, Manfred; Perrotta, A; Petridou, C; Petrolini, A; Phillips, H T; Piana, G; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Podobrin, O; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Privitera, P; Pukhaeva, N; Pullia, Antonio; Radojicic, D; Ragazzi, S; Rahmani, H; Rames, J; Ratoff, P N; Read, A L; Rebecchi, P; Redaelli, N G; Regler, Meinhard; Reid, D; Reinhardt, R; Renton, P B; Resvanis, L K; Richard, F; Rídky, J; Rinaudo, G; Røhne, O M; Romero, A; Ronchese, P; Rosenberg, E I; Rosinsky, P; Roudeau, Patrick; Rovelli, T; Ruhlmann-Kleider, V; Ruiz, A; Saarikko, H; Sacquin, Yu; Sadovskii, A; Sajot, G; Salt, J; Sampsonidis, D; Sannino, M; Schneider, H; Schwickerath, U; Schyns, M A E; Scuri, F; Seager, P; Sedykh, Yu; Segar, A M; Sekulin, R L; Senko, V A; Shellard, R C; Sheridan, A; Silvestre, R; Simonetto, F; Sissakian, A N; Skaali, T B; Smadja, G; Smirnov, N; Smirnova, O G; Smith, G R; Solovyanov, O; Sopczak, André; Sosnowski, R; Souza-Santos, D; Spassoff, Tz; Spiriti, E; Sponholz, P; Squarcia, S; Stampfer, D; Stanescu, C; Stanic, S; Stapnes, Steinar; Stavitski, I; Stevenson, K; Stocchi, A; Strauss, J; Strub, R; Stugu, B; Szczekowski, M; Szeptycka, M; Tabarelli de Fatis, T; Chikilev, O G; Tegenfeldt, F; Terranova, F; Thomas, J; Tilquin, A; Timmermans, J; Tkatchev, L G; Todorov, T; Todorova, S; Toet, D Z; Tomaradze, A G; Tomé, B; Tonazzo, A; Tortora, L; Tranströmer, G; Treille, D; Tristram, G; Trombini, A; Troncon, C; Tsirou, A L; Turluer, M L; Tyapkin, I A; Tyndel, M; Tzamarias, S; Überschär, B; Ullaland, O; Uvarov, V; Valenti, G; Vallazza, E; van Apeldoorn, G W; van Dam, P; Van Doninck, W K; Van Eldik, J; Van Lysebetten, A; Van Vulpen, I B; Vassilopoulos, N; Vegni, G; Ventura, L; Venus, W A; Verbeure, F; Verlato, M; Vertogradov, L S; Verzi, V; Vilanova, D; Vincent, P; Vishnevski, N K; Vitale, L; Vlasov, E; Vodopyanov, A S; Vrba, V; Wahlen, H; Walck, C; Weiser, C; Wetherell, Alan M; Wicke, D; Wickens, J H; Wilkinson, G R; Williams, W S C; Winter, M; Witek, M; Wlodek, T; Wolf, G; Yi, J; Yushchenko, O P; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zevgolatakos, E; Zimin, N I; Zucchelli, G C; Zumerle, G

    1998-01-01

    Trilinear gauge boson couplings are measured using data taken by DELPHI at 161~GeV and 172~GeV. Values for $WWV$ couplings ($V=Z, \\gamma$) are determined from a study of the reactions \\eeWW\\ and \\eeWev, using differential distributions from the $WW$ final state in which one $W$ decays hadronically and the other leptonically, and total cross-section4AU LWit

  17. Circulating CD3+CD4+CD161+ Cells Are Associated with Early Complications after Autologous Stem Cell Transplantation in Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Sung-Eun Lee

    2018-01-01

    Full Text Available The aim of this study was to explore if measurement of pretransplant circulating CD161-expressing cells, in addition to clinical risk factors, could predict mucositis and infections in patients with multiple myeloma (MM undergoing autologous stem cell transplantation (ASCT. To determine if CD161-expressing cells are likely to predict early complications, namely, mucositis (≥grade 3, infections, and cytomegalovirus (CMV reactivation, we prospectively examined CD161-expressing cells (CD3+CD4+CD161+ and CD3+CD8+CD161+ in peripheral blood samples from 108 patients with MM undergoing ASCT. After adjusting for factors identified by univariate analysis that predicted mucositis (≥grade 3, infection before engraftment, and CMV reactivation, multivariate analyses revealed that the low proportion of CD3+CD4+CD161+ cells in peripheral blood was an independent predictor of mucositis (≥grade 3 (P=0.020, infections before engraftment (P=0.014, and CMV reactivation (P=0.010. In addition, we found that female sex and decreased glomerular filtration rate were independent factors for predicting mucositis. Female sex and severe pulmonary comorbidity were independent factors for predicting infection before engraftment. We found that the proportion of circulating CD3+CD4+CD161+ cells is useful for predicting the occurrence of early complications, including mucositis and infections, after ASCT in patients with MM.

  18. Disruption of δ-opioid receptor phosphorylation at threonine 161 attenuates morphine tolerance in rats with CFA-induced inflammatory hypersensitivity.

    Science.gov (United States)

    Chen, Hai-Jing; Xie, Wei-Yan; Hu, Fang; Zhang, Ying; Wang, Jun; Wang, Yun

    2012-04-01

    Our previous study identified Threonine 161 (Thr-161), located in the second intracellular loop of the δ-opioid receptor (DOR), as the only consensus phosphorylation site for cyclin-dependent kinase 5 (Cdk5). The aim of this study was to assess the function of DOR phosphorylation by Cdk5 in complete Freund's adjuvant (CFA)-induced inflammatory pain and morphine tolerance. Dorsal root ganglion (DRG) neurons of rats with CFA-induced inflammatory pain were acutely dissociated and the biotinylation method was used to explore the membrane localization of phosphorylated DOR at Thr-161 (pThr-161-DOR), and paw withdrawal latency was measured after intrathecal delivery of drugs or Tat-peptide, using a radiant heat stimulator in rats with CFA-induced inflammatory pain. Both the total amount and the surface localization of pThr-161-DOR were significantly enhanced in the ipsilateral DRG following CFA injection. Intrathecal delivery of the engineered Tat fusion-interefering peptide corresponding to the second intracellular loop of DOR (Tat-DOR-2L) increased inflammatory hypersensitivity, and inhibited DOR- but not µ-opioid receptor-mediated spinal analgesia in CFA-treated rats. However, intrathecal delivery of Tat-DOR-2L postponed morphine antinociceptive tolerance in rats with CFA-induced inflammatory pain. Phosphorylation of DOR at Thr-161 by Cdk5 attenuates hypersensitivity and potentiates morphine tolerance in rats with CFA-induced inflammatory pain, while disruption of the phosphorylation of DOR at Thr-161 attenuates morphine tolerance.

  19. Synthesis, characterization and luminescence of europium perchlorate with MABA-Si complex and coating structure SiO2@Eu(MABA-Si) luminescence nanoparticles.

    Science.gov (United States)

    Fu, Zhi-Fang; Li, Wen-Xian; Bai, Juan; Bao, Jin-Rong; Cao, Xiao-Fang; Zheng, Yu-Shan

    2017-05-01

    This article reports a novel category of coating structure SiO 2 @Eu(MABA-Si) luminescence nanoparticles (NPs) consisting of a unique organic shell, composed of perchlorate europium(III) complex, and an inorganic core, composed of silica. The binary complex Eu(MABA-Si) 3 ·(ClO 4 ) 3 ·5H 2 O was synthesized using HOOCC 6 H 4 N(CONH(CH 2 ) 3 Si(OCH 2 CH 3 ) 3 ) 2 (MABA-Si) and was used as a ligand. Furthermore, the as-prepared silica NPs were successfully coated with the -Si(OCH 2 CH 3 ) 3 group of MABA-Si to form Si-O-Si chemical bonds by means of the hydrolyzation of MABA-Si. The binary complexes were characterized by elemental analysis, molar conductivity and coordination titration analysis. The results indicated that the composition of the binary complex was Eu(MABA-Si) 3 ·(ClO 4 ) 3 ·5H 2 O. Coating structure SiO 2 @Eu(MABA-Si) NPs were characterized using transmission electron microscopy (TEM), scanning electron microscopy (SEM) and infrared (IR) spectra. Based on the SEM and TEM measurements, the diameter of core-SiO 2 particles was ~400 and 600 nm, and the thickness of the cladding layer Eu(MABA-Si) was ~20 nm. In the binary complex Eu(MABA-Si) 3 ·(ClO 4 ) 3 ·5H 2 O, the fluorescence spectra illustrated that the energy of the ligand MABA-Si transferred to the energy level for the excitation state of europium(III) ion. Coating structure SiO 2 @Eu(MABA-Si) NPs exhibited intense red luminescence compared with the binary complex. The fluorescence lifetime and fluorescence quantum efficiency of the binary complex and of the coating structure NPs were also calculated. The way in which the size of core-SiO 2 spheres influences the luminescence was also studied. Moreover, the luminescent mechanisms of the complex were studied and explained. Copyright © 2016 John Wiley & Sons, Ltd.

  20. The structures of CyMe4-BTBP complexes of americium(iii) and europium(iii) in solvents used in solvent extraction, explaining their separation properties.

    Science.gov (United States)

    Ekberg, Christian; Löfström-Engdahl, Elin; Aneheim, Emma; Foreman, Mark R StJ; Geist, Andreas; Lundberg, Daniel; Denecke, Melissa; Persson, Ingmar

    2015-11-14

    Separation of trivalent actinoid (An(iii)) and lanthanoid (Ln(iii)) ions is extremely challenging due to their similar ionic radii and chemical properties. Poly-aromatic nitrogen compounds acting as tetradentate chelating ligands to the metal ions in the extraction, have the ability to sufficiently separate An(iii) from Ln(iii). One of these compounds, 6,6'-bis(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-benzol[1,2,4]triazin-3-yl)[2,2]bipyridine, CyMe4-BTBP, has proven to be resistant towards acidic environments and strong radiation from radioactive decomposition. EXAFS studies of the dicomplexes of CyMe4-BTBP with americium(iii) and europium(iii) in nitrobenzene, cyclohexanone, 1-hexanol, 1-octanol and malonamide (DMDOHEMA) in 1-octanol have been carried out to get a deeper understanding of the parameters responsible for the separation. The predominating complexes independent of solvent used are [Am(CyMe4-BTBP)2(NO3)](2+) and [Eu(CyMe4-BTBP)2](3+), respectively, which are present as outer-sphere ion-pairs with nitrate ions in the studied solvents with low relative permittivity. The presence of a nitrate ion in the first coordination sphere of the americium(iii) complex compensates the charge density of the complex considerably in comparison when only outer-sphere ion-pairs are formed as for the [Eu(CyMe4-BTBP)2](3+) complex. The stability and solubility of a complex in a solvent with low relative permittivity increase with decreasing charge density. The [Am(CyMe4-BTBP)2(NO3)](2+) complex will therefore be increasingly soluble and stabilized over the [Eu(CyMe4-BTBP)2](3+) complex in solvents with decreasing relative permittivity of the solvent. The separation of americium(iii) from europium(iii) with CyMe4-BTBP as extraction agent will increase with decreasing relative permittivity of the solvent, and thereby also with decreasing solubility of CyMe4-BTBP. The choice of solvent is therefore a balance of a high separation factor and sufficient solubility of the CyMe4-BTBP

  1. Europium-decorated graphene quantum dots as a fluorescent probe for label-free, rapid and sensitive detection of Cu{sup 2+} and L-cysteine

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Liping [College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou, 350002 (China); Song, Xinhong; Chen, Yiying; Rong, Mingcong; Wang, Yiru [Department of Chemistry and the MOE Key Laboratory of Spectrochemical Analysis & Instrumentation, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361005 (China); Zhao, Li; Zhao, Tingting [Xiamen Huaxia College, Xiamen, 361024 (China); Chen, Xi, E-mail: xichen@xmu.edu.cn [Department of Chemistry and the MOE Key Laboratory of Spectrochemical Analysis & Instrumentation, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361005 (China); State Key Laboratory of Marine Environmental Science, Xiamen University, Xiamen, 361005 (China)

    2015-09-03

    In this work, europium-decorated graphene quantum dots (Eu-GQDs) were prepared by treating three-dimensional Eu-decorated graphene (3D Eu-graphene) via a strong acid treatment. Various characterizations revealed that Eu atoms were successfully complexed with the oxygen functional groups on the surface of graphene quantum dots (GQDs) with the atomic ratio of 2.54%. Compared with Eu free GQDs, the introduction of Eu atoms enhanced the electron density and improved the surface chemical activities of Eu-GQDs. Therefore, the obtained Eu-GQDs were used as a novel “off-on” fluorescent probe for the label-free determination of Cu{sup 2+} and L-cysteine (L-Cys) with high sensitivity and selectivity. The fluorescence intensity of Eu-GQDs was quenched in the presence of Cu{sup 2+} owing to the coordination reaction between Cu{sup 2+} and carboxyl groups on the surface of the Eu-GQDs. The fluorescence intensity of Eu-GQDs recovered with the subsequent addition of L-Cys because of the strong affinity of Cu{sup 2+} to L-Cys via the Cu–S bond. The experimental results showed that the fluorescence variation of the proposed approach had a good linear relationship in the range of 0.1–10 μM for Cu{sup 2+} and 0.5–50 μM for L-Cys with corresponding detection limits of 0.056 μM for Cu{sup 2+} and 0.31 μM for L-Cys. The current approach also displayed a special response to Cu{sup 2+} and L-Cys over the other co-existing metal ions and amino acids, and the results obtained from buffer-diluted serum samples suggested its applicability in biological samples. - Highlights: • The europium-decorated graphene quantum dots (Eu-GQDs) have been successfully prepared. • Various characterizations results proved that Eu atoms were successfully introduced into graphene quantum dots. • The introduced Eu atoms changed the electron density and surface chemical activities of Eu-GQDs. • Eu-GQDs were used as an “off-on” fluorescent probe for Cu{sup 2+} and L-cysteine detection

  2. Completion Report for Well ER-16-1 Corrective Action Unit 99: Rainier Mesa - Shoshone Mountain

    Energy Technology Data Exchange (ETDEWEB)

    NSTec Environmental Management

    2006-12-01

    Well ER-16-1 was drilled for the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office, in support of the Nevada Environmental Restoration Project at the Nevada Test Site, Nye County, Nevada. The well was drilled in June and July 2005 as part of a hydrogeologic investigation program for the Rainier Mesa-Shoshone Mountain Corrective Action Unit, Number 99. The overall purpose of the well was to gather subsurface data to better characterize the hydrogeology of the Shoshone Mountain area, especially in the older Tertiary and pre-Tertiary strata. The main 46.99-centimeter hole was drilled to a depth of 702.9 meters and cased with 33.97-centimeter casing to 663.7 meters. The hole diameter was then decreased to 31.1 centimeters, and the well was drilled to total depth of 1,220.7 meters. A completion string set at the depth of 1,162.4 meters consisted of 13.97-centimeter stainless-steel casing, with one continuous slotted interval open to the lower carbonate aquifer. The fluid level in the borehole soon dropped, so the borehole was deepened in July 2006. To deepen the borehole, the slotted section was cemented and a 12.1-centimeter hole was drilled through the bottom of the completion string to the new total depth of 1,391.7 meters, which is 171.0 meters deeper than the original borehole. A string of 6.03-centimeter carbon-steel tubing with one continuous slotted interval at 1,361.8 to 1,381.4 meters, and open to the lower carbonate aquifer, was installed in the well with no gravel packing or cement, to serve as a monitoring string. Data gathered during and shortly after hole construction include composite drill cuttings samples collected every 3 meters (extra cuttings samples were collected from the Paleozoic rocks for paleontological analyses), sidewall core samples from 37 depths, various geophysical logs, and water level measurements. These data indicate that the well penetrated 646.8 meters of Tertiary volcanic rocks and 744.9 meters

  3. Synthesis, structural characterization and luminescent properties of a novel europium ternary complex Eu(2-A-4-CBA){sub 3}phen

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yongjie, E-mail: cyj200507@aliyun.com; Wu, Shengnan; Xing, Zhenfang; Cao, Shuang; Geng, Xiujuan; Yang, Ying; Xiao, Linjiu

    2015-11-15

    The preparation of a novel europium ternary complex with the formula of Eu(2-A-4-CBA){sub 3}phen (where, 2-A-4-CBA = 2-amino-4-chlorobenzoic acid, phen = 1,10-phenanthroline) under solvothermal condition is described. The composition and structure of the resulting complex were investigated by elemental analysis, Fourier transform infrared (FT-IR) spectroscopy. The complex is polycrystalline, and the morphology is clean and regular as revealed by scanning electron microscope (SEM). The luminescent and thermal properties of the complex were researched by fluorescence spectroscopy and thermogravimetric analysis, respectively. Of importance here is that, the room-temperature luminescence spectra of the complex show strong characteristic emission of the corresponding Eu{sup 3+}, which is attributed to the energy transfer from ligands to Eu{sup 3+} via an Antenna effect. It is also found that the complex exhibits pure red light and high color purity. In addition, the complex does not decompose until 300 °C, so it exhibits good thermal stability. - Highlights: • A novel Eu(III) complex was synthesized by solvothermal synthesis method. • The structure and properties of complex were studied. • The complex can emits pure red light and has a high color purity. • The complex does not decompose until 300 °C and it has a good thermal stability.

  4. Size- and dimensionality-dependent optical, magnetic and magneto-optical properties of binary europium-based nanocrystals: EuX (X = O, S, Se, Te).

    Science.gov (United States)

    Zhou, Xingzhi; Zhang, Kelvin H L; Xiong, Jie; Park, Ju-Hyun; Dickerson, James H; He, Weidong

    2016-05-13

    Europium chalcogenides (EuX, X = O, S, Se, Te), a class of prototypical Heisenberg magnetic semiconductors, exhibit intriguing properties in optics, magnetism, and magneto-optics at the nanoscale, and have broad application potential in optical/magnetic sensors, spintronics, optical isolators, etc. EuX nanocrystals (NCs) exhibit enhanced properties, such as high saturation magnetization, a strong magneto-optic effect (Faraday rotation), and high magneto resistance, which are all unanimously dependent on the NC's size, shape, and surface information. In this report, we give an overview of the fundamental properties of bulk EuX, and illustrate the quantum confinement effects on the optical, magnetic and magneto-optical properties of EuX nanostructures. We then focus on doping and self-assembly-two efficient methods that enhance magnetic properties by manipulating magnetic coupling in EuX nanostructures. In particular, we look towards future research on Eu(2+) NCs, which along with the overview provides an up-to-date platform for evaluating the fundamental properties and application potential of Eu-based semiconductors.

  5. Crystal structure and luminescence properties of the first hydride oxide chloride with divalent europium. LiEu{sub 2}HOCl{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Rudolph, Daniel; Schleid, Thomas [Institute for Inorganic Chemistry, University of Stuttgart (Germany); Enseling, David; Juestel, Thomas [Department of Chemical Engineering, Muenster University of Applied Sciences, Steinfurt (Germany)

    2017-11-17

    The mixed-anionic hydride oxide chloride LiEu{sub 2}HOCl{sub 2} with divalent europium was synthesized by the reduction of Eu{sub 2}O{sub 3} with LiH in a LiCl flux at 750 C for 4 d in silica-jacketed niobium capsules. According to structure determination by single-crystal X-ray diffraction the yellow compound crystallizes in the orthorhombic space group Cmcm (a = 1492.30(11) pm, b = 570.12(4) pm, c = 1143.71(8) pm, Z = 8) with a crystal structure closely related to that one of the quaternary hydride oxide LiLa{sub 2}HO{sub 3} and the hydride nitride LiSr{sub 2}H{sub 2}N. On the other hand it can also be derived from the PbFCl-type structure of EuHCl showing astonishingly short Eu{sup 2+}..Eu{sup 2+} contacts of 326 and 329 pm. Both crystallographically different Eu{sup 2+} cations have nine anionic neighbors, while all other ions (Li{sup +}, H{sup -}, O{sup 2-} and Cl{sup -}) reside in six-membered coordination spheres. LiEu{sub 2}OCl{sub 2}H exhibits a bright yellow luminescence with an emission maximum at 581 nm upon excitation at 440 nm. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  6. Highly sensitive and novel point-of-care system, aQcare Chlamydia TRF kit for detecting Chlamydia trachomatis by using europium (Eu) (III) chelated nanoparticles.

    Science.gov (United States)

    Ham, Ji Yeon; Jung, Jaean; Hwang, Byung-Gap; Kim, Won-Jung; Kim, Young-Seop; Kim, Eun-Ju; Cho, Mi-Yeon; Hwang, Mi-Sun; Won, Dong Il; Suh, Jang Soo

    2015-01-01

    The bacterium Chlamydia trachomatis is one of the leading causes of sexually transmitted diseases worldwide. Since no simple and effective tool exists to diagnose C. trachomatis infections, we evaluated a novel point-of-care (POC) test, aQcare Chlamydia TRF kit, which uses europium-chelated nanoparticles and a time-resolved fluorescence reader. The test performance was evaluated by comparing the results obtained using the novel POC testing kit with those obtained using a nucleic acid amplification test (NAAT), using 114 NAAT-positive and 327 NAAT-negative samples. The cut-off value of the novel test was 20.8 with a detection limit of 0.27 ng/mL. No interference or cross-reactivity was observed. Diagnostic accuracy showed an overall sensitivity of 93.0% (106/114), specificity of 96.3% (315/327), positive predictive value (PPV) of 89.8% (106/118), and negative predictive value (NPV) of 97.5% (315/323). The sensitivity of the novel test was much higher than that of currently available POC tests. Furthermore, the relative ease and short turnaround time (30 min) of this assay enables C. trachomatis-infected individuals to be treated without a diagnostic delay. This simple and novel test is a potential tool to screen a larger population, especially those in areas with limited resources.

  7. Fluorescence enhancement of europium (III) perchlorate by 1,10-phenanthroline on the 1-(naphthalen-2-yl)-2-(phenylsulthio)ethanone complex and luminescence mechanism.

    Science.gov (United States)

    Li, Wen-Xian; Xin, Xiao-Dong; Feng, Shu-Yan; Liu, Yu; Zhang, Jing; Ao, Bo-Yang; Li, Ying-Jie

    2014-11-01

    A novel ligand, 1-(naphthalen-2-yl)-2-(phenylsulthio)ethanone was synthesized using a new method and its two europium (Eu) (III) complexes were synthesized. The compounds were characterized by elemental analysis, coordination titration analysis, molar conductivity, infrared, thermo gravimetric analyzer-differential scanning calorimetry (TGA-DSC), (1)H NMR and UV spectra. The composition was suggested as EuL5 · (ClO4)3 · 2H2O and EuL4 · phen(ClO4)3 · 2H2O (L = C(10)H(7)COCH(2)SOC(6)H(5)). The fluorescence spectra showed that the Eu(III) displayed strong characteristic metal-centered fluorescence in the solid state. The ternary rare earth complex showed stronger fluorescence intensity than the binary rare earth complex in such material. The strongest characteristic fluorescence emission intensity of the ternary system was 1.49 times as strong as that of the binary system. The phosphorescence spectra were also discussed. Copyright © 2014 John Wiley & Sons, Ltd.

  8. Matrix-Assisted Ionization-Ion Mobility Spectrometry-Mass Spectrometry: Selective Analysis of a Europium-PEG Complex in a Crude Mixture.

    Science.gov (United States)

    Fischer, Joshua L; Lutomski, Corinne A; El-Baba, Tarick J; Siriwardena-Mahanama, Buddhima N; Weidner, Steffen M; Falkenhagen, Jana; Allen, Matthew J; Trimpin, Sarah

    2015-12-01

    The analytical utility of a new and simple to use ionization method, matrix-assisted ionization (MAI), coupled with ion mobility spectrometry (IMS) and mass spectrometry (MS) is used to characterize a 2-armed europium(III)-containing poly(ethylene glycol) (Eu-PEG) complex directly from a crude sample. MAI was used with the matrix 1,2-dicyanobenzene, which affords low chemical background relative to matrix-assisted laser desorption/ionization (MALDI) and electrospray ionization (ESI). MAI provides high ion abundance of desired products in comparison to ESI and MALDI. Inductively coupled plasma-MS measurements were used to estimate a maximum of 10% of the crude sample by mass was the 2-arm Eu-PEG complex, supporting evidence of selective ionization of Eu-PEG complexes using the new MAI matrix, 1,2-dicyanobenzene. Multiply charged ions formed in MAI enhance the IMS gas-phase separation, especially relative to the singly charged ions observed with MALDI. Individual components are cleanly separated and readily identified, allowing characterization of the 2-arm Eu-PEG conjugate from a mixture of the 1-arm Eu-PEG complex and unreacted starting materials. Size-exclusion chromatography, liquid chromatography at critical conditions, MALDI-MS, ESI-MS, and ESI-IMS-MS had difficulties with this analysis, or failed. Graphical Abstract ᅟ.

  9. Synthesis, characterization and luminescent properties of europium complexes with 2,4,6-tris-(2-pyridyl)-s-triazine as highly efficient sensitizers.

    Science.gov (United States)

    Kang, Jie; Chen, Ying-Nan; Wang, Ai-Ling; Li, Hai-Yan; Qu, Yan-Rong; Zhang, Hai-Xia; Chu, Hai-Bin; Zhao, Yong-Liang

    2015-12-01

    Using 2,4,6-tris-(2-pyridyl)-s-triazine (TPTZ) as a neutral ligand, and p-hydroxybenzoic acid, terephthalic acid and nitrate as anion ligands, five novel europium complexes have been synthesized. These complexes were characterized using elemental analysis, rare earth coordination titrations, UV/vis absorption spectroscopy and infrared spectroscopy. Luminescence spectra, luminescence lifetime and quantum efficiency were investigated and the mechanism discussed in depth. The results show that the complexes have excellent emission intensities, long emission lifetimes and high quantum efficiencies. The superior luminescent properties of the complexes may be because the triplet energy level of the ligands matches well with the lowest excitation state energy level of Eu(3+). Moreover, changing the ratio of the ligands and metal ions leads to different luminescent properties. Among the complexes, Eu2(TPTZ)2(C8H4O4)(NO3)4(C2H5OH)·H2O shows the strongest luminescence intensity, longest emission lifetime and highest quantum efficiency. Copyright © 2015 John Wiley & Sons, Ltd.

  10. Photo-catalytic inactivation of an Enterococcus biofilm: the anti-microbial effect of sulphated and europium-doped titanium dioxide nanopowders.

    Science.gov (United States)

    Dworniczek, Ewa; Plesch, Gustav; Seniuk, Alicja; Adamski, Ryszard; Michal, Róbert; Čaplovičová, Mária

    2016-04-01

    The control and prevention of biofilm-related infections is an important public healthcare issue. Given the increasing antibiotic resistance among bacteria and fungi that cause serious infections in humans, promotion of new strategies combating microorganisms has been essential. One attractive approach to inactivate microorganisms is the use of semiconductor photo-catalysis, which has become the subject of extensive research. In this study, the bactericidal properties of four photo-catalysts, TiO₂, TiO₂-S, TiO₂-Eu and TiO₂-Eu-S, were investigated against established 24, 48, 72 and 96 h biofilms of Enterococcus The exposure of biofilms to the catalysts induced the production of superoxide radical anions. The best photo-catalytic inactivation was achieved with the TiO₂-Eu-S and TiO₂-S nanopowders and 24 h biofilms. Transmission electron microscopy images showed significant changes in the structure of the biofilm cells following photo-inactivation. The results suggest that doping with europium and modifying the surface with sulphate groups enhanced the bactericidal activity of the TiO₂ nanoparticles against enterococcal biofilms. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Reversible modulation in luminescence intensity of a single vesicle composed of diblock azo-copolymer and tris(dibenzoylmethanate)(phenanthroline)europium(III)

    Science.gov (United States)

    Yan, Qing; Su, Wei; Chen, Yilong; Luo, Yanhua; Zhang, Qijin

    2009-01-01

    Tris(dibenzoylmethanate)(phenanthroline)europium(III)[Eu(DBM) 3Phen]-doped amphiphilic vesicles were obtained by self-assembling of poly( N-isopropylacrylamide)- b-poly{6-[4-(4-methylphenyl-azo) phenoxy] hexylacrylate} (PNIPAM 83- b-PAzoM 20) in presence of Eu(DBM) 3Phen in the mixed solvent of THF/H 2O (50/50 vol.%). Their optical properties were studied by UV-vis and fluorescence spectroscopies. The UV-vis spectrum showed that the electronic transition bands of azobenzene and Eu(DBM) 3Phen were overlapped at about 365 nm and the main peak of fluorescence emission band appeared at 612 nm. So the vesicles showed obvious red luminescence. It was found that the fluorescence intensity of a single Eu(DBM) 3Phen-doped vesicle could be modulated by irradiation with UV and visible light due to the reversible trans- cis- trans photoisomerization reaction of azobenzene moiety. Possible energy allocation process for this property was discussed in details.

  12. Size- and dimensionality-dependent optical, magnetic and magneto-optical properties of binary europium-based nanocrystals: EuX (X = O, S, Se, Te)

    Science.gov (United States)

    Zhou, Xingzhi; Zhang, Kelvin HL; Xiong, Jie; Park, Ju-Hyun; Dickerson, James H.; He, Weidong

    2016-05-01

    Europium chalcogenides (EuX, X = O, S, Se, Te), a class of prototypical Heisenberg magnetic semiconductors, exhibit intriguing properties in optics, magnetism, and magneto-optics at the nanoscale, and have broad application potential in optical/magnetic sensors, spintronics, optical isolators, etc. EuX nanocrystals (NCs) exhibit enhanced properties, such as high saturation magnetization, a strong magneto-optic effect (Faraday rotation), and high magneto resistance, which are all unanimously dependent on the NC’s size, shape, and surface information. In this report, we give an overview of the fundamental properties of bulk EuX, and illustrate the quantum confinement effects on the optical, magnetic and magneto-optical properties of EuX nanostructures. We then focus on doping and self-assembly—two efficient methods that enhance magnetic properties by manipulating magnetic coupling in EuX nanostructures. In particular, we look towards future research on Eu2+ NCs, which along with the overview provides an up-to-date platform for evaluating the fundamental properties and application potential of Eu-based semiconductors.

  13. A novel near monochromatic red emissive europium(III) metal-organic framework based on 1,2,4,5-benzenetetracarboxylate: From synthesis to photoluminescence studies

    Science.gov (United States)

    Lahoud, Marcelo G.; Frem, Regina C. G.; Marques, Lippy F.; Arroyos, Guilherme; Brandão, Paula; Ferreira, Rute A. S.; Carlos, Luís D.

    2017-09-01

    This work presents the synthesis, solid state characterization (infrared spectroscopy, thermal analysis (TGA/DTA), powder and single crystal X-ray diffraction) and photoluminescence studies of a new europium metal-organic framework (MOF), [Eu2(Btec)1,5(H2O)]n (Btec4-=1,2,4,5-benzenetetracarboxylate anion). Single crystal X-ray diffraction analysis reveals that the material has a three-dimensional network, with two crystallographically independent Eu(III) ions adopting different coordination geometries. This structure presents one of the Btec4- anions acting as a μ8-bridging linker, with the carboxylate groups in distinct connection to Eu(III) ions, culminating into an unknown coordination mode for the linker. The results of thermogravimetric analyses indicate that the MOF has high thermal stability, with this characteristic being of great interest for the application of these compounds in several fields such as catalysis and photonics. The luminescent properties showed that the Eu(III) ions are a local-spectroscopic probe, with the compound presenting a red emission when excited in the UV spectral region with absolute emission quantum yield values of 0.48 ± 0.05. The thermal dependence on the intensity of the transitions originating from the 7F1 level, especially the 7F1 → 5D1 transition, was studied. These results opens the possibility to test this MOF [Eu2(Btec)1.5(H2O)]n in the field of molecular thermometry.

  14. Activation cross sections of proton and deuteron induced nuclear reactions on holmium and erbium, related to the production of (161)Er and (160)Er medical isotopes.

    Science.gov (United States)

    Tárkányi, F; Ditrói, F; Takács, S; Hermanne, A; Baba, M

    2016-09-01

    Experimental excitation functions for long-lived products in proton induced reactions were measured with the activation method in the 37-65MeV energy range on natural holmium. Stacked foil irradiation technique and high resolution gamma spectrometry were used in order to measure cross-section data for the production of (161)Er, (160)Er and (1)(59,157)Dy. For comparison of the production routes of medically related (161)Er and (160)Er radioisotopes new experimental cross section data were deduced for the (162)Er(p,x)(161,160)Er and (162)Er(d,x)(161,160)Er reactions by re-evaluating gamma-ray spectra from earlier measurements. No earlier data were found in the literature for these reactions. The experimental data are compared with results of TALYS theoretical code reported in TENDL-2015. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Clinical and Molecular Characterization of a Cohort of 161 Unrelated Women with Nonclassical Congenital Adrenal Hyperplasia Due to 21-Hydroxylase Deficiency and 330 Family Members

    National Research Council Canada - National Science Library

    Bidet, Maud; Bellanné-Chantelot, Christine; Galand-Portier, Marie-Béatrice; Tardy, Véronique; Billaud, Line; Laborde, Kathleen; Coussieu, Christiane; Morel, Yves; Vaury, Christelle; Golmard, Jean-Louis; Claustre, Aurélie; Mornet, Etienne; Chakhtoura, Zeina; Mowszowicz, Irene; Bachelot, Anne; Touraine, Philippe; Kuttenn, Frédérique

    2009-01-01

    .... Patients and Methods: A total of 161 NC-CAH unrelated women diagnosed on late-onset symptoms, mainly hirsutism, and post-ACTH 17-hydroxyprogesterone more than 10 ng/ml, and 330 of their relatives was explored...

  16. Cross-section measurement of some deuteron induced reactions on $^{160}$Gd for possible production of the therapeutic radionuclide $^{161}$Tb

    CERN Document Server

    Tárkányi, F; Takács, S; Ditrói, F; Csikai, J; Ignatyuk, A V

    2013-01-01

    The radionuclide 161Tb (T1/2=6.89 d) is potentially important for internal radiotherapy. It is generally produced through the 160Gd(n,{\\gamma})161Gd - 161Tb route at research reactors. In this work the possibility of its production at a cyclotron was investigated. Determination of the excitation function of the 160Gd(d,x)161Tb production route and that of the disturbing 160Gd(d,2n)160Tb side reaction was done over the deuteron energy range up to 50 MeV using the stacked-foil technique and high-resolution gamma-ray spectrometry. A comparison of this production route with the established (n,\\gamma) reaction at a nuclear reactor is made.

  17. Contribution of Auger/conversion electrons to renal side effects after radionuclide therapy: preclinical comparison of (161)Tb-folate and (177)Lu-folate.

    Science.gov (United States)

    Haller, Stephanie; Pellegrini, Giovanni; Vermeulen, Christiaan; van der Meulen, Nicholas P; Köster, Ulli; Bernhardt, Peter; Schibli, Roger; Müller, Cristina

    2016-12-01

    The radiolanthanide (161)Tb has, in recent years, attracted increasing interest due to its favorable characteristics for medical application. (161)Tb exhibits similar properties to the widely-used therapeutic radionuclide (177)Lu. In contrast to (177)Lu, (161)Tb yields a significant number of short-ranging Auger/conversion electrons (≤50 keV) during its decay process. (161)Tb has been shown to be more effective for tumor therapy than (177)Lu if applied using the same activity. The purpose of this study was to investigate long-term damage to the kidneys after application of (161)Tb-folate and compare it to the renal effects caused by (177)Lu-folate. Renal side effects were investigated in nude mice after the application of different activities of (161)Tb-folate (10, 20, and 30 MBq per mouse) over a period of 8 months. Renal function was monitored by the determination of (99m)Tc-DMSA uptake in the kidneys and by measuring blood urea nitrogen and creatinine levels in the plasma. Histopathological analysis was performed by scoring of the tissue damage observed in HE-stained kidney sections from euthanized mice. Due to the co-emitted Auger/conversion electrons, the mean absorbed renal dose of (161)Tb-folate (3.0 Gy/MBq) was about 24 % higher than that of (177)Lu-folate (2.3 Gy/MBq). After application of (161)Tb-folate, kidney function was reduced in a dose- and time-dependent manner, as indicated by the decreased renal uptake of (99m)Tc-DMSA and the increased levels of blood urea nitrogen and creatinine. Similar results were obtained when (177)Lu-folate was applied at the same activity. Histopathological investigations confirmed comparable renal cortical damage after application of the same activities of (161)Tb-folate and (177)Lu-folate. This was characterized by collapsed tubules and enlarged glomeruli with fibrin deposition in moderately injured kidneys and glomerulosclerosis in severely damaged kidneys. Tb-folate induced dose-dependent radionephropathy over

  18. Alterations in the mir-15a/16-1 Loci Impairs Its Processing and Augments B-1 Expansion in De Novo Mouse Model of Chronic Lymphocytic Leukemia (CLL.

    Directory of Open Access Journals (Sweden)

    Siddha Kasar

    Full Text Available New Zealand Black (NZB mice, a de novo model of CLL, share multiple characteristics with CLL patients, including decreased expression of miR-15a/16-1. We previously discovered a point mutation and deletion in the 3' flanking region of mir-16-1 of NZB and a similar mutation has been found in a small number of CLL patients. However, it was unknown whether the mutation is the cause for the reduced miR-15a/16-1 expression and CLL development. Using PCR and in vitro microRNA processing assays, we found that the NZB sequence alterations in the mir-15a/16-1 loci result in deficient processing of the precursor forms of miR-15a/16-1, in particular, we observe impaired conversion of pri-miR-15a/16-1 to pre-miR-15a/16-1. The in vitro data was further supported by derivation of congenic strains with replaced mir-15a/16-1 loci at one or both alleles: NZB congenic mice (NmiR+/- and DBA congenic mice (DmiR-/-. The level of miR-15a/16-1 reflected the configuration of the mir-15a/16-1 loci with DBA congenic mice (DmiR-/- showing reduced miR-15a levels compared to homozygous wild-type allele, while the NZB congenic mice (NmiR+/- showed an increase in miR-15a levels relative to homozygous mutant allele. Similar to Monoclonal B-cell Lymphocytosis (MBL, the precursor stage of the human disease, an overall expansion of the B-1 population was observed in DBA congenic mice (DmiR-/- relative to wild-type (DmiR+/+. These studies support our hypothesis that the mutations in the mir-15a/16-1 loci are responsible for decreased expression of this regulatory microRNA leading to B-1 expansion and CLL development.

  19. Use of the Signature Fatty Acid 16:1ω5 as a Tool to Determine the Distribution of Arbuscular Mycorrhizal Fungi in Soil

    Directory of Open Access Journals (Sweden)

    Christopher Ngosong

    2012-01-01

    Full Text Available Biomass estimation of arbuscular mycorrhiza (AM fungi, widespread plant root symbionts, commonly employs lipid biomarkers, predominantly the fatty acid 16:1ω5. We briefly reviewed the application of this signature fatty acid, followed by a case study comparing biochemical markers with microscopic techniques in an arable soil following a change to AM non-host plants after 27 years of continuous host crops, that is, two successive cropping seasons with wheat followed by amaranth. After switching to the non-host amaranth, spore biomass estimated by the neutral lipid fatty acid (NLFA 16:1ω5 decreased to almost nil, whereas microscopic spore counts decreased by about 50% only. In contrast, AM hyphal biomass assessed by the phospholipid (PLFA 16:1ω5 was greater under amaranth than wheat. The application of PLFA 16:1ω5 as biomarker was hampered by background level derived from bacteria, and further enhanced by its incorporation from degrading spores used as microbial resource. Meanwhile, biochemical and morphological assessments showed negative correlation for spores and none for hyphal biomass. In conclusion, the NLFA 16:1ω5 appears to be a feasible indicator for AM fungi of the Glomales group in the complex field soils, whereas the use of PLFA 16:1ω5 for hyphae is unsuitable and should be restricted to controlled laboratory studies.

  20. Cytoplasmic Localization of WT1 and Decrease of miRNA-16-1 in Nephrotic Syndrome

    Directory of Open Access Journals (Sweden)

    Pablo Zapata-Benavides

    2017-01-01

    Full Text Available Nephrotic syndrome (NS is a glomerular disease that is defined by the leakage of protein into the urine and is associated with hypoalbuminemia, hyperlipidemia, and edema. Steroid-resistant NS (SRNS patients do not respond to treatment with corticosteroids and show decreased Wilms tumor 1 (WT1 expression in podocytes. Downregulation of WT1 has been shown to be affected by certain microRNAs (miRNAs. Twenty-one patients with idiopathic NS (68.75% were SSNS and 31.25% SRNS and 10 healthy controls were enrolled in the study. Podocyte number and WT1 location were determined by immunofluorescence, and the serum levels of miR-15a, miR-16-1, and miR-193a were quantified by RT-qPCR. Low expression and delocalization of WT1 protein from the nucleus to the cytoplasm were found in kidney biopsies of patients with SRNS and both nuclear and cytoplasmic localization were found in steroid-sensitive NS (SSNS patients. In sera from NS patients, low expression levels of miR-15a and miR-16-1 were found compared with healthy controls, but only the miR-16-1 expression levels showed statistically significant decrease (p=0.019. The miR-193a expression levels only slightly increased in NS patients. We concluded that low expression and delocalization from the WT1 protein in NS patients contribute to loss of podocytes while modulation from WT1 protein is not associated with the miRNAs analyzed in sera from the patients.

  1. Cytoplasmic Localization of WT1 and Decrease of miRNA-16-1 in Nephrotic Syndrome

    Science.gov (United States)

    Rangel-Ochoa, Gloria Azucena; Rodríguez-Padilla, Cristina

    2017-01-01

    Nephrotic syndrome (NS) is a glomerular disease that is defined by the leakage of protein into the urine and is associated with hypoalbuminemia, hyperlipidemia, and edema. Steroid-resistant NS (SRNS) patients do not respond to treatment with corticosteroids and show decreased Wilms tumor 1 (WT1) expression in podocytes. Downregulation of WT1 has been shown to be affected by certain microRNAs (miRNAs). Twenty-one patients with idiopathic NS (68.75% were SSNS and 31.25% SRNS) and 10 healthy controls were enrolled in the study. Podocyte number and WT1 location were determined by immunofluorescence, and the serum levels of miR-15a, miR-16-1, and miR-193a were quantified by RT-qPCR. Low expression and delocalization of WT1 protein from the nucleus to the cytoplasm were found in kidney biopsies of patients with SRNS and both nuclear and cytoplasmic localization were found in steroid-sensitive NS (SSNS) patients. In sera from NS patients, low expression levels of miR-15a and miR-16-1 were found compared with healthy controls, but only the miR-16-1 expression levels showed statistically significant decrease (p = 0.019). The miR-193a expression levels only slightly increased in NS patients. We concluded that low expression and delocalization from the WT1 protein in NS patients contribute to loss of podocytes while modulation from WT1 protein is not associated with the miRNAs analyzed in sera from the patients. PMID:28299339

  2. Study of sorption mechanisms of europium(3) and uranium(6) ions on clays : impact of silicates; Etude des mecanismes de retention des ions U(6) et Eu(3) sur les argiles: influence des silicates

    Energy Technology Data Exchange (ETDEWEB)

    Kowal-Fouchard, A

    2002-11-01

    Bentonite clay has been selected as a potential buffer or backfill material in a number of disposal programmes for high level waste. In order to enhance the thermodynamic database of sorption phenomena at the solid-water interface, we have investigated sorption mechanisms of europium(III) and uranium(VI) ions onto montmorillonite and bentonite. Thermodynamic data were obtained for different ions concentrations, different background electrolytes and different ionic strengths. The structural identification of the surface complexes and sorption sites was carried out using two spectroscopies, XPS and TRLIFS, while sorption edges were performed using batch experiments. However, clays are complex minerals and in order to understand these sorption mechanisms we have studied europium(III) and uranium(VI) retention on a silica and an alumina because these solids are often considered as basic components of clays. The comparison of structural results shows that europium ions are significantly sorbed on permanently charged sites of clay until pH 7. But this ion is also sorbed on {identical_to}SiOH and {identical_to}AlOH sites of montmorillonite at pH higher than 6. Uranyl ions sorption on montmorillonite is mainly explained by retention of three complexes on {identical_to}SiOH sites. Moreover, we have shown that nitrate ions and dissolved silicates affect on uranium(VI) sorption mechanisms onto alumina. Nevertheless, uranyl ions sorption on montmorillonite and bentonite only decreases with increasing carbonate concentration. Finally, all the sorption edges were then modeled using these results and a surface complexation model (2 pK and constant capacitance models). (author)

  3. The possible role of CD8+/Vα7.2+/CD161++ T (MAIT) and CD8+/Vα7.2+/CD161loT (MAIT-like) cells in the pathogenesis of early-onset pre-eclampsia.

    Science.gov (United States)

    Meggyes, Matyas; Szanto, Julia; Lajko, Adrienn; Farkas, Balint; Varnagy, Akos; Tamas, Peter; Hantosi, Eszter; Miko, Eva; Szereday, Laszlo

    2018-02-01

    The objective of this study was to compare the expressions of different immune-checkpoint molecules by MAIT and MAIT-like cells in healthy pregnancy and in early-onset pre-eclampsia. Peripheral blood mononuclear cells (PBMC) were stained with monoclonal antibodies to characterize MAIT and MAIT-like cells. Flow cytometric analyses were used to measure PD-1, TIM-3, activation markers, and intracellular perforin expression. We identified CD3+/CD8+/Vα7.2+/CD161++ MAIT cells and a minor cell population characterized by CD3+/CD8+/Vα7.2+/CD161 lo surface markers. In measuring the expression of PD-1 receptor, we found a significantly lower expression by MAIT cells in women with early-onset pre-eclampsia. CD69 expression by MAIT cells was significantly elevated in early-onset pre-eclamptic patients. Intracellular perforin content by MAIT and PD-1+ MAIT cells was significantly increased in pre-eclamptic patients compared with healthy individuals. Altered frequency and reduced PD-1 expression combined together with the elevated perforin content of MAIT cells insinuate their potential roles in the pathogenesis of early-onset pre-eclampsia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Distribution of micro-amounts of europium in the two-phase water–HCl–nitrobenzene–N,N’-dimethyl-N,N’-diphenyl-2,6-di-picolinamide–hydrogen dicarbollylcobaltate extraction system

    Directory of Open Access Journals (Sweden)

    EMANUEL MAKRLÍK

    2009-07-01

    Full Text Available Extraction of micro-amounts of europium by a nitrobenzene solution of hydrogen dicarbollylcobaltate (H+B- in the presence of N,N’-dimethyl-N,N’-diphenyl-2,6-dipicolinamide (MePhDPA, L was investigated. The equilibrium data were explained assuming that the species HL+, HL+2, HL3+2 and HL3+3 are extracted into the organic phase. The values of the extraction and stability constants of the species in nitrobenzene saturated with water were determined.

  5. Investigation of the miR16-1 (C>T + 7 Substitution in Seven Different Types of Cancer from Three Ethnic Groups

    Directory of Open Access Journals (Sweden)

    Hulya Yazici

    2009-01-01

    Full Text Available Background. MicroRNAs are a type of small noncoding RNA molecules that have been shown to control gene expression in eukaryotes. Aberrant expression and alteration of miRNAs may be responsible for human diseases including cancer. An miR16-1 (C>T  + 7 gene mutation has been previously found in familial chronic lymphocytic leukemia patients, one of which reported a family history of breast cancer. miR16-1 regulates the expression of bcl-2, which is important in retinoblastoma, and is located in a genomic region that is frequently lost in nasopharyngeal and hepatocellular carcinomas (HCCs. Therefore, miR16-1 may be potentially important in the etiology of several solid tumors. To understand the power of the miR16-1 (C>T  + 7 mutation as a prognostic and diagnostic risk factor, we investigated the mutation in patients with seven different types of cancer including 188 with breast, 102 with ovarian, and 22 nasopharyngeal carcinomas, 96 HCC, 872 chronic myeloid leukemia (CML, 39 chronic lymphocytic leukemia (CLL, and 46 retinoblastoma cases from three different ethnic groups and of hereditary and sporadic etiology. Methods. 5′Nuclease TaqMan SNP genotyping assay was used to detect the miR16-1 gene C>T substitution. Results. The miR16-1 (C>T  + 7 substitution was not detected in any of the groups studied. Conclusions. Considering the large scale of our study, the representation of different ethnicities and levels of hereditary risk, we conclude that the miR-16-1 (C>T  + 7 mutation is not a good diagnostic or prognostic indicator of risk for the cancers tested.

  6. Europium-doped Gd2O3 nanotubes cause the necrosis of primary mouse bone marrow stromal cells through lysosome and mitochondrion damage.

    Science.gov (United States)

    Jin, Yi; Chen, Shizhu; Duan, Jianlei; Jia, Guang; Zhang, Jinchao

    2015-05-01

    With the wide applications of europium-doped Gd2O3 nanoparticles (Gd2O3:Eu(3+) NPs) in biomedical fields, it will inevitably increase the chance of human exposure. It was reported that Gd2O3:Eu(3+) NPs could accumulate in bone. However, there have been few reports about the potential effect of Gd2O3:Eu(3+) NPs on bone marrow stromal cells (BMSCs). In this study, the Gd2O3:Eu(3+) nanotubes were prepared and characterized by powder X-ray diffraction (XRD), photoluminescence (PL) excitation and emission spectra, scanning electron microscope (SEM), and transmission electron microscopy (TEM). The cytotoxicity of Gd2O3:Eu(3+) nanotubes on BMSCs and the associated mechanisms were further studied. The results indicated that they could be uptaken into BMSCs by an energy-dependent and macropinocytosis-mediated endocytosis process, and primarily localized in lysosome. Gd2O3:Eu(3+) nanotubes effectively inhibited the viability of BMSCs in concentration and time-dependent manners. A significant increase in the percentage of late apoptotic/necrotic cells, lactate dehydrogenase (LDH) leakage and the number of PI-stained cells was found after BMSCs were treated by 10, 20, and 40μg/mL of Gd2O3:Eu(3+) nanotubes for 12h. No obvious DNA ladders were detected, but a dispersed band was observed. The above results revealed that Gd2O3:Eu(3+) nanotubes could trigger cell death by necrosis instead of apoptosis. Two mechanisms were involved in Gd2O3:Eu(3+) nanotube-induced BMSCs necrosis: lysosomal rupture and release of cathepsins B; and the overproduction of reactive oxygen species (ROS) injury to the mitochondria and DNA. The study provides novel evidence to elucidate the toxicity mechanisms and may be beneficial to more rational applications of these nanomaterials in the future. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Europium-decorated graphene quantum dots as a fluorescent probe for label-free, rapid and sensitive detection of Cu(2+) and L-cysteine.

    Science.gov (United States)

    Lin, Liping; Song, Xinhong; Chen, Yiying; Rong, Mingcong; Wang, Yiru; Zhao, Li; Zhao, Tingting; Chen, Xi

    2015-09-03

    In this work, europium-decorated graphene quantum dots (Eu-GQDs) were prepared by treating three-dimensional Eu-decorated graphene (3D Eu-graphene) via a strong acid treatment. Various characterizations revealed that Eu atoms were successfully complexed with the oxygen functional groups on the surface of graphene quantum dots (GQDs) with the atomic ratio of 2.54%. Compared with Eu free GQDs, the introduction of Eu atoms enhanced the electron density and improved the surface chemical activities of Eu-GQDs. Therefore, the obtained Eu-GQDs were used as a novel "off-on" fluorescent probe for the label-free determination of Cu(2+) and l-cysteine (L-Cys) with high sensitivity and selectivity. The fluorescence intensity of Eu-GQDs was quenched in the presence of Cu(2+) owing to the coordination reaction between Cu(2+) and carboxyl groups on the surface of the Eu-GQDs. The fluorescence intensity of Eu-GQDs recovered with the subsequent addition of L-Cys because of the strong affinity of Cu(2+) to L-Cys via the Cu-S bond. The experimental results showed that the fluorescence variation of the proposed approach had a good linear relationship in the range of 0.1-10 μM for Cu(2+) and 0.5-50 μM for L-Cys with corresponding detection limits of 0.056 μM for Cu(2+) and 0.31 μM for L-Cys. The current approach also displayed a special response to Cu(2+) and L-Cys over the other co-existing metal ions and amino acids, and the results obtained from buffer-diluted serum samples suggested its applicability in biological samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Sensitive detection of influenza viruses with Europium nanoparticles on an epoxy silica sol-gel functionalized polycarbonate-polydimethylsiloxane hybrid microchip.

    Science.gov (United States)

    Liu, Jikun; Zhao, Jiangqin; Petrochenko, Peter; Zheng, Jiwen; Hewlett, Indira

    2016-12-15

    In an effort to develop new tools for diagnosing influenza in resource-limited settings, we fabricated a polycarbonate (PC)-polydimethylsiloxane (PDMS) hybrid microchip using a simple epoxy silica sol-gel coating/bonding method and employed it in sensitive detection of influenza virus with Europium nanoparticles (EuNPs). The incorporation of sol-gel material in device fabrication provided functionalized channel surfaces ready for covalent immobilization of primary antibodies and a strong bonding between PDMS substrates and PC supports without increasing background fluorescence. In microchip EuNP immunoassay (µENIA) of inactivated influenza viruses, replacing native PDMS microchips with hybrid microchips allowed the achievement of a 6-fold increase in signal-to-background ratio, a 12-fold and a 6-fold decreases in limit-of-detection (LOD) in influenza A and B tests respectively. Using influenza A samples with known titers, the LOD of influenza µENIA on hybrid microchips was determined to be ~10(4) TCID50 titer/mL and 10(3)-10(4) EID50 titer/mL. A comparison test indicated that the sensitivity of influenza µENIA enhanced using the hybrid microchips even surpassed that of a commercial laboratory influenza ELISA test. In addition to the sensitivity improvement, assay variation was clearly reduced when hybrid microchips instead of native PDMS microchips were used in the µENIA tests. Finally, infectious reference viruses and nasopharyngeal swab patient specimens were successfully tested using μENIA on hybrid microchip platforms, demonstrating the potential of this unique microchip nanoparticle assay in clinical diagnosis of influenza. Meanwhile, the tests showed the necessity of using nucleic acid confirmatory tests to clarify ambiguous test results obtained from prototype or developed point-of-care testing devices for influenza diagnosis. Published by Elsevier B.V.

  9. A visible-light-excited europium(III) complex-based luminescent probe for visualizing copper ions and hydrogen sulfide in living cells

    Science.gov (United States)

    Wang, Yiren; Wang, Huan; Yang, Mei; Yuan, Jingli; Wu, Jing

    2018-01-01

    Development of visible-light-excited lanthanide (III) complex-based luminescent probes is highly appealing due to their superiority of less damage to the living biosystems over the conventional UV-light-excited ones. In this work, a visible-light-excited europium (III) complex-based luminescent probe, BPED-BHHCT-Eu3+-BPT, has been designed and synthesized by conjugating the Cu2+-binding N,N-bis(2-pyridylmethyl)ethanediamine (BPED) to a tetradentate β-diketone ligand 4,4‧-bis(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedione-6″-yl)chlorosulfo-o-terphenyl (BHHCT) and coordinating with a coligand 2-(N,N-diethylanilin-4-yl)-4,6-bis(pyrazol-1-yl)-1,3,5-triazine) (BPT) for the time-gated luminescence detection of Cu2+ ions and hydrogen sulfide (H2S) in living cells. BPED-BHHCT-Eu3+-BPT exhibited a sharp excitation peak at 407 nm and a wide excitation window extending to beyond 460 nm. Upon its reaction with Cu2+ ions, the luminescence of BPED-BHHCT-Eu3+-BPT was efficiently quenched, which could be reversibly restored by the addition of H2S due to the strong affinity between Cu2+ ions and H2S. The "on-off-on" type luminescence behavior of BPED-BHHCT-Eu3+-BPT towards Cu2+ ions and H2S enabled the sensing of the two species with high sensitivity and selectivity. The performances of BPED-BHHCT-Eu3+-BPT for visualizing intracellular Cu2+ ions and H2S were investigated, and the results have demonstrated the practical applicability of the probe for molecular imaging of cells.

  10. Chemical species of europium (III) in ionic force media 0.02M, 0.1M, and 0.7M NaClO{sub 4} at 298 K; Especies quimicas del europio (III) en medios de fuerza ionica 0.02M, 0.1M y 0.7M NaClO{sub 4} a 298 K

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez R, E.; Jimenez R, M.; Solache R, M. [Instituto Nacional de Investigaciones Nucleares, Departamento de Quimica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)

    2000-07-01

    In order to know the effects of the controlled or accidental liberation of the europium in the environment, it is necessary to know its chemical behavior in found conditions in oceans, ground and surface water. The behavior of this element in these environments can be controlled mainly by the hydrolysis and its interaction with inorganic and organic ions. (Author)

  11. Preliminary measurements on a Solo 161 Stirling refrigerator at temperatures below -30 C; Erste Messergebnisse einer Solo 161 Stirling-Kaeltemaschine bei Temperaturen der Kaeltebereitstellung unterhalb von -30 C

    Energy Technology Data Exchange (ETDEWEB)

    Schikora, H.; Siegel, A.; Steimle, F. [Essen Univ. (Gesamthochschule) (Germany). Inst. fuer Angewandte Thermodynamik und Klimatechnik

    2000-07-01

    Theoretical investigations have shown that Stirling refrigerators may be an interesting alternative in this temperature range; they are now being verified by measurements. The authors present preliminary results. [German] Verschiedene theoretische Untersuchungen haben gezeigt, dass Stirling-Kaeltemaschinen eine interessante Alternative fuer die Kaelteerzeugung bei umgebungsnahen Temperaturen (oberhalb von -40 C) darstellen koennten. In einem derzeit laufenden Forschungsvorhaben sollen diese theoretischen Untersuchungen durch Messungen an einer fuer diesen Temperaturbereich optimierten Stirling-Kaeltemaschine ueberprueft werden. In diesem Aufsatz werden erste Messergebnisse dieser neu entwickelten Solo 161 Stirling-Kaeltemaschine praesentiert. Neben den herkoemmlichen Leistungsdaten wie Kaelteleistung und Leistungsaufnahme werden weitere Groessen im Inneren der Maschine gemessen. Dazu gehoeren die mittleren Gastemperaturen an einigen Stellen in der Maschine. Die Druckverlaeufe in den Arbeitsraeumen werden ueber eine Kurbelumdrehung aufgeloest. Aus den damit erstellten p,V-Diagrammen koennen wichtige Groessen wie die Reibleistung im Kurbeltrieb und den Zylindern ermittelt werden. Anhand so detaillierter Messtechnik werden Schwachstellen lokalisiert und moegliche Verbesserungsmassnahmen beschrieben. (orig.)

  12. Synthesis, single-crystal structure determination, and vibrational spectroscopy of the europium borate Eu[B{sub 6}O{sub 8}(OH){sub 5}].H{sub 3}BO{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Ortner, Teresa S.; Wurst, Klaus; Huppertz, Hubert [Institut fuer Allgemeine, Anorganische und Theoretische Chemie, Leopold-Franzens-Universitaet Innsbruck (Austria); Seibald, Markus [OSRAM GmbH, Corporate Innovation, Schwabmuenchen (Germany); Joachim, Bastian [Institut fuer Mineralogie und Petrographie, Leopold-Franzens-Universitaet Innsbruck (Austria)

    2016-07-15

    The new europium borate Eu[B{sub 6}O{sub 8}(OH){sub 5}].H{sub 3}BO{sub 3} was obtained by hydrothermal synthesis from europium nitrate hydrate and boric acid. The compound crystallizes in the triclinic space group P1 (no. 2) with the lattice parameters a = 681.59(3), b = 714.17(3), c = 1271.88(6) pm, α = 96.02(1), β = 98.60(1), γ = 101.73(1) (Z = 2). The structure of Eu[B{sub 6}O{sub 8}(OH){sub 5}].H{sub 3}BO{sub 3} is isotypic to that of the samarium borate Sm[B{sub 6}O{sub 8}(OH){sub 5}].H{sub 3}BO{sub 3} and is built up from tetrahedral BO{sub 4} and trigonal-planar BO{sub 3} units, both of which are protonated at terminal and bridging oxygen positions. Boric acid molecules reside between the borate layers. Through hydrogen bonding, the structure forms a three-dimensional network. In channels down [110], the Eu{sup 3+} cations are eightfold coordinated by oxygen ions. The compound was also characterized by IR and Raman spectroscopy, and it shows typical Eu{sup 3+} line emission. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  13. A Study of Single W Production in $e^{+}e^{-}$ Collisions at $\\sqrt{s}$ = 161 - 183 GeV

    CERN Document Server

    Barate, R; Ghez, P; Goy, C; Jézéquel, S; Lees, J P; Martin, F; Merle, E; Minard, M N; Pietrzyk, B; Przysiezniak, H; Alemany, R; Casado, M P; Chmeissani, M; Crespo, J M; Fernández, E; Fernández-Bosman, M; Garrido, L; Graugès-Pous, E; Juste, A; Martínez, M; Merino, G; Miquel, R; Mir, L M; Morawitz, P; Pacheco, A; Park, I C; Riu, I; Colaleo, A; Creanza, D; De Palma, M; Iaselli, Giuseppe; Maggi, G; Maggi, M; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Becker, U; Boix, G; Cattaneo, M; Cerutti, F; Ciulli, V; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Gianotti, F; Greening, T C; Halley, A W; Hansen, J B; Harvey, J; Janot, P; Jost, B; Lehraus, Ivan; Leroy, O; Loomis, C; Maley, P; Mato, P; Minten, Adolf G; Moutoussi, A; Ranjard, F; Rolandi, Luigi; Schlatter, W D; Schmitt, M; Schneider, O; Spagnolo, P; Tejessy, W; Teubert, F; Tomalin, I R; Tournefier, E; Ajaltouni, Ziad J; Badaud, F; Chazelle, G; Deschamps, O; Dessagne, S; Falvard, A; Ferdi, C; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Perret, P; Podlyski, F; Hansen, J D; Hansen, J R; Hansen, P H; Nilsson, B S; Rensch, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Vayaki, Anna; Blondel, A; Brient, J C; Machefert, F P; Rougé, A; Swynghedauw, M; Tanaka, R; Valassi, Andrea; Videau, H L; Focardi, E; Parrini, G; Zachariadou, K; Cavanaugh, R J; Corden, M; Georgiopoulos, C H; Antonelli, A; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Chiarella, V; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Chalmers, M; Curtis, L; Lynch, J G; Negus, P; O'Shea, V; Räven, B; Raine, C; Smith, D; Teixeira-Dias, P; Thompson, A S; Ward, J J; Buchmüller, O L; Dhamotharan, S; Geweniger, C; Hanke, P; Hansper, G; Hepp, V; Kluge, E E; Putzer, A; Sommer, J; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Goodsir, S M; Marinelli, N; Martin, E B; Nash, J; Nowell, J; Sedgbeer, J K; Thomson, E; Williams, M D; Ghete, V M; Girtler, P; Kneringer, E; Kuhn, D; Rudolph, G; Bowdery, C K; Buck, P G; Ellis, G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Robertson, N A; Smizanska, M; Williams, M; Giehl, I; Hölldorfer, F; Jakobs, K; Kleinknecht, K; Kröcker, M; Müller, A S; Nürnberger, H A; Quast, G; Renk, B; Rohne, E; Sander, H G; Schmeling, S; Wachsmuth, H W; Zeitnitz, C; Ziegler, T; Aubert, Jean-Jacques; Benchouk, C; Bonissent, A; Carr, J; Coyle, P; Ealet, A; Fouchez, D; Motsch, F; Payre, P; Rousseau, D; Talby, M; Thulasidas, M; Tilquin, A; Aleppo, M; Antonelli, M; Ragusa, F; Büscher, V; Dietl, H; Ganis, G; Hüttmann, K; Lütjens, G; Mannert, C; Männer, W; Moser, H G; Schael, S; Settles, Ronald; Seywerd, H C J; Stenzel, H; Wiedenmann, W; Wolf, G; Boucrot, J; Callot, O; Chen, S; Davier, M; Duflot, L; Grivaz, J F; Heusse, P; Jacholkowska, A; Kado, M; Kim, D W; Lefrançois, J; Serin, L; Veillet, J J; Videau, I; De Vivie de Régie, J B; Zerwas, D; Azzurri, P; Bagliesi, G; Bettarini, S; Boccali, T; Bozzi, C; Calderini, G; Dell'Orso, R; Fantechi, R; Ferrante, I; Giassi, A; Gregorio, A; Ligabue, F; Lusiani, A; Marrocchesi, P S; Messineo, A; Palla, Fabrizio; Rizzo, G; Sanguinetti, G; Sciabà, A; Sguazzoni, G; Tenchini, Roberto; Vannini, C; Venturi, A; Verdini, P G; Blair, G A; Chambers, J T; Coles, J; Cowan, G D; Green, M G; Hutchcroft, D E; Jones, L T; Medcalf, T; Strong, J A; Von Wimmersperg-Töller, J H; Botterill, David R; Clifft, R W; Edgecock, T R; Norton, P R; Thompson, J C; Wright, A E; Bloch-Devaux, B; Colas, P; Fabbro, B; Faïf, G; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Rander, J; Renardy, J F; Rosowsky, A; Trabelsi, A; Tuchming, B; Vallage, B; Black, S N; Dann, J H; Kim, H Y; Konstantinidis, N P; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Cartwright, S L; Combley, F; Hodgson, P N; Kelly, M S; Lehto, M H; Thompson, L F; Affholderbach, K; Böhrer, A; Brandt, S; Foss, J; Grupen, Claus; Hess, J; Misiejuk, A; Prange, G; Sieler, U; Smolik, L; Stephan, F; Giannini, G; Gobbo, B; Pütz, J; Rothberg, J E; Wasserbaech, S R; Williams, R W; Armstrong, S R; Elmer, P; Ferguson, D P S; Gao, Y; González, S; Hayes, O J; Hu, H; Jin, S; McNamara, P A; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Vogt, M; Walsh, J; Wu Sau Lan; Wu, X; Zobernig, G

    1999-01-01

    Single W production is studied in the data recorded with the ALEPH detector at LEP at centre-of-mass energies between 161 and 183 GeV. The cross section is measured to be sigma_W=0.41+-0.17 (stat) +-0.04 (syst) pb at 183 GeV, consistent with the Standard Model expectation. Limits on non-standard WWgamma couplings are deduced as -1.6 < kg < 1.5 (lg=0) and -1.6 < lg < 1.6 (kg=1) at 95% C.L. A search for effectively invisible decays of the W boson in W pair production is performed, leading to an upper limit on the branching ratio of 1.3% (\\Gamma_inv= 27 MeV) at 95% C.L.

  14. Evaluation of the topoisomerase II-inactive bisdioxopiperazine ICRF-161 as a protectant against doxorubicin-induced cardiomyopathy

    DEFF Research Database (Denmark)

    Martin, E.; Thougaard, A.V.; Grauslund, M.

    2009-01-01

    Anthracycline-induced cardiomyopathy is a major problem in anti-cancer therapy. The only approved agent for alleviating this serious dose limiting side effect is ICRF-187 (dexrazoxane). The current thinking is that the ring-opened hydrolysis product of this agent, ADR-925, which is formed inside...... or in cells, it is well tolerated and shows similar exposure to ICRF-187 in rodents, and it does not induce myelosuppression when given at high doses to mice as opposed to ICRF-187. However, when tested in a model of chronic anthracycline-induced cardiomyopathy in spontaneously hypertensive rats, ICRF-161...... chelation alone does not appear to be sufficient for protection against anthracycline-induced cardiomyopathy Udgivelsesdato: 2009/1/8...

  15. Age and CD161 expression contribute to inter-individual variation in interleukin-23 response in CD8+ memory human T cells.

    Directory of Open Access Journals (Sweden)

    Hui Shen

    Full Text Available The interleukin-23 (IL-23 pathway plays a critical role in the pathogenesis of multiple chronic inflammatory disorders, however, inter-individual variability in IL-23-induced signal transduction in circulating human lymphocytes has not been well-defined. In this study, we observed marked, reproducible inter-individual differences in IL-23 responsiveness (measured by STAT3 phosphorylation in peripheral blood CD8+CD45RO+ memory T and CD3+CD56+ NKT cells. Age, but not gender, was a significant (Pearson's correlation coefficient, r = -0.37, p = 0.001 source of variability observed in CD8+CD45RO+ memory T cells, with IL-23 responsiveness gradually decreasing with increasing age. Relative to cells from individuals demonstrating low responsiveness to IL-23 stimulation, CD8+CD45RO+ memory T cells from individuals demonstrating high responsiveness to IL-23 stimulation showed increased gene expression for IL-23 receptor (IL-23R, RORC (RORγt and CD161 (KLRB1, whereas RORA (RORα and STAT3 expression were equivalent. Similar to CD4+ memory T cells, IL-23 responsiveness is confined to the CD161+ subset in CD8+CD45RO+ memory T cells, suggesting a similar CD161+ precursor as has been reported for CD4+ Th17 cells. We observed a very strong positive correlation between IL-23 responsiveness and the fraction of CD161+, CD8+CD45RO+ memory T cells (r = 0.80, p<0.001. Moreover, the fraction of CD161+, CD8+CD45RO+ memory T cells gradually decreases with aging (r = -0.34, p = 0.05. Our data define the inter-individual differences in IL-23 responsiveness in peripheral blood lymphocytes from the general population. Variable expression of CD161, IL-23R and RORC affects IL-23 responsiveness and contributes to the inter-individual susceptibility to IL-23-mediated defenses and inflammatory processes.

  16. Anti-L1CAM radioimmunotherapy is more effective with the radiolanthanide terbium-161 compared to lutetium-177 in an ovarian cancer model

    Energy Technology Data Exchange (ETDEWEB)

    Gruenberg, Juergen; Lindenblatt, Dennis; Cohrs, Susan; Fischer, Eliane [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); Dorrer, Holger [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); Zhernosekov, Konstantin [ITG Isotope Technologies Garching GmbH, Garching (Germany); Koester, Ulli [Institut Laue-Langevin, Grenoble (France); Tuerler, Andreas [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); University of Bern, Department of Chemistry and Biochemistry, Berne (Switzerland); Schibli, Roger [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); ETH Zurich, Department of Chemistry and Applied Biosciences, Zurich (Switzerland)

    2014-10-15

    The L1 cell adhesion molecule (L1CAM) is considered a valuable target for therapeutic intervention in different types of cancer. Recent studies have shown that anti-L1CAM radioimmunotherapy (RIT) with {sup 67}Cu- and {sup 177}Lu-labelled internalising monoclonal antibody (mAb) chCE7 was effective in the treatment of human ovarian cancer xenografts. In this study, we directly compared the therapeutic efficacy of anti-L1CAM RIT against human ovarian cancer under equitoxic conditions with the radiolanthanide {sup 177}Lu and the potential alternative {sup 161}Tb in an ovarian cancer therapy model. Tb was produced by neutron bombardment of enriched {sup 160}Gd targets. {sup 161}Tb and {sup 177}Lu were used for radiolabelling of DOTA-conjugated antibodies. The in vivo behaviour of the radioimmunoconjugates (RICs) was assessed in IGROV1 tumour-bearing nude mice using biodistribution experiments and SPECT/CT imaging. After ascertaining the maximal tolerated doses (MTD) the therapeutic impact of 50 % MTD of {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 was evaluated in groups of ten mice by monitoring the tumour size of subcutaneous IGROV1 tumours. The average number of DOTA ligands per antibody was 2.5 and maximum specific activities of 600 MBq/mg were achieved under identical radiolabelling conditions. RICs were stable in human plasma for at least 48 h. {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 showed high tumour uptake (37.8-39.0 %IA/g, 144 h p.i.) with low levels in off-target organs. SPECT/CT images confirmed the biodistribution data. {sup 161}Tb-labelled chCE7 revealed a higher radiotoxicity in nude mice (MTD: 10 MBq) than the {sup 177}Lu-labelled counterpart (MTD: 12 MBq). In a comparative therapy study with equitoxic doses, tumour growth inhibition was better by 82.6 % for the {sup 161}Tb-DOTA-chCE7 than the {sup 177}Lu-DOTA-chCE7 RIT. Our study is the first to show that anti-L1CAM {sup 161}Tb RIT is more effective compared to {sup 177}Lu RIT in ovarian cancer xenografts

  17. Rapid and sensitive lateral flow immunoassay method for determining alpha fetoprotein in serum using europium (III) chelate microparticles-based lateral flow test strips

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Rong-Liang; Xu, Xu-Ping; Liu, Tian-Cai; Zhou, Jian-Wei; Wang, Xian-Guo; Ren, Zhi-Qi [Institute of Antibody Engineering, School of Biotechnology, Southern Medical University, Guangzhou 510515, Guangdong (China); Hao, Fen [DaAn Gene Co. Ltd. of Sun Yat-sen University, 19 Xiangshan Road, Guangzhou 510515 (China); Wu, Ying-Song, E-mail: wg@smu.edu.cn [Institute of Antibody Engineering, School of Biotechnology, Southern Medical University, Guangzhou 510515, Guangdong (China)

    2015-09-03

    Alpha-fetoprotein (AFP), a primary marker for many diseases including various cancers, is important in clinical tumor diagnosis and antenatal screening. Most immunoassays provide high sensitivity and accuracy for determining AFP, but they are expensive, often complex, time-consuming procedures. A simple and rapid point-of-care system that integrates Eu (III) chelate microparticles with lateral flow immunoassay (LFIA) has been developed to determine AFP in serum with an assay time of 15 min. The approach is based on a sandwich immunoassay performed on lateral flow test strips. A fluorescence strip reader was used to measure the fluorescence peak heights of the test line (H{sub T}) and the control line (H{sub C}); the H{sub T}/H{sub C} ratio was used for quantitation. The Eu (III) chelate microparticles-based LFIA assay exhibited a wide linear range (1.0–1000 IU mL{sup −1}) for AFP with a low limit of detection (0.1 IU mL{sup −1}) based on 5ul of serum. Satisfactory specificity and accuracy were demonstrated and the intra- and inter-assay coefficients of variation (CV) for AFP were both <10%. Furthermore, in the analysis of human serum samples, excellent correlation (n = 284, r = 0.9860, p < 0.0001) was obtained between the proposed method and a commercially available CLIA kit. Results indicated that the Eu (III) chelate microparticles-based LFIA system provided a rapid, sensitive and reliable method for determining AFP in serum, indicating that it would be suitable for development in point-of-care testing. - Highlights: • Europium (III) chelate microparticles was used as a label for LIFA. • Quantitative detection by using H{sub T}/H{sub C} ratio was achieved. • LIFA for simple and rapid AFP detection in human serum. • The sensitivity and linearity was more excellent compared with QD-based ICTS. • This method could be developed for rapid point-of-care screening.

  18. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)

    2016-11-01

    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  19. The adsorption of europium to colloidal iron oxyhydroxides and quartz - the impact of pH and an aquatic fulvic acid

    Energy Technology Data Exchange (ETDEWEB)

    Ledin, A. [Dept. of Water and Environmental Studies, Linkoeping Univ. (Sweden); Karlsson, S. [Dept. of Water and Environmental Studies, Linkoeping Univ. (Sweden); Dueker, A. [Dept. of Water and Environmental Studies, Linkoeping Univ. (Sweden); Allard, B. [Dept. of Water and Environmental Studies, Linkoeping Univ. (Sweden)

    1994-12-31

    The adsorption of europium to colloidal Fe{sub 2}O{sub 3}, FeOOH, Fe(OH){sub 3} and SiO{sub 2} was investigated as a function of pH and the presence of an aquatic fulvic acid (FA). The colloids were present at concentrations repressentative of the upper levels of natural waters (50-500 mg/l). Measurements with Photon Correlation Spectroscopy showed size distribution typically within the ranges 200-700 nm, 40-400 nm and 50-300 nm for Fe{sub 2}O{sub 3}, FeOOH and SiO{sub 2}, respectively, while the amorphous Fe(OH){sub 3} formed relatively large particles (>1000 nm; outside the range of the method for measurements of size distribution). Total concentrations of Eu and the fulvic acid were 10{sup -8} mol l{sup -1} and 2 mg l{sup -1}, respectively. The adsorption was affected by pH, the composition of the colloidal phase as well as the presence of fulvic acid. The uptake was almost quantitative in the Fe-systems at pH>5.5-6, with 50% uptake at pH of 4.5-5.5 (4-5 units below pH{sub zpc}). For quartz, the maximum adsorption was around 90% (at pH 9), with 50% adsorption at pH 7 (4 pH units above pH{sub zpc}). The adsorption can not be related to coulombic attraction between the surfaces and the metal species alone, but rather to a specific chemical adsorption, where the pH-dependence would be related to the distribution of Eu between different species (on the surface and in solution). The presence of FA slightly increased the absorption in the lower pH range, corresponding to an adsorption of Eu-fulvate complexes. The adsorption was reaching 100% at higher pH values in the Fe(OH){sub 3} system, while it was decreased in the other three systems compared to the experiments without FA. The decrease could be attributed to competition between inorganic Eu species and the FA-molecules about sites on the surfaces, an effect not obvious in the Fe(OH){sub 3}-systems due to the much larger surface area available. (orig./MBS)

  20. CD161+CD4+ T cells are enriched in the liver during chronic hepatitis and associated with co-secretion of IL-22 and Interferon-gamma

    Directory of Open Access Journals (Sweden)

    Yu-Hoi eKang

    2012-11-01

    Full Text Available Hepatitis C virus infection is a major cause of chronic liver disease. CD4+ T cells play a key role in disease outcome. However, the critical functions and associated phenotypes of intrahepatic CD4+ T cells are not well defined. We have previously shown that CD8+ T cells expressing the C type lectin CD161 are highly enriched in the human liver, especially during chronic hepatitis. These cells are associated with a type 17 differentiation pattern and express cytokines including IL-17A, IL-22 and IFNγ. We therefore analysed expression of CD161 on CD4+ T cells in blood and liver and addressed the relevant phenotype and functional capacity of these populations. We observed marked enrichment of CD161+CD4+ T cells in the liver during chronic hepatitis such that they are the dominant subtype (mean 55% of CD4+ T cells. IL-22 and IL-17 secreting CD4+ cells were readily found in the livers of HCV+ and NASH donors, although not enriched compared to blood. There was, however, specific enrichment of a novel subset of IL-22/IFN-γ dual secretors (p=0.02 compared to blood, a result reconfirmed with direct ex vivo analyses. These data indicate the dominance of CD161+ expressing lymphocyte populations within the hepatic infiltrate, associated with a distinct cytokine profile. Given their documented roles as antiviral and hepatoprotective cytokines respectively, the impact of co-secretion of IFNγ and IL-22 in the liver may be particularly significant.

  1. Complement activation in Mycoplasma fermentans-induced mycoplasma clearance from infected cells: probing of the organism with monoclonal antibodies against M161Ag.

    Science.gov (United States)

    Kikkawa, S; Matsumoto, M; Sasaki, T; Nishiguchi, M; Tanaka, K; Toyoshima, K; Seya, T

    2000-03-01

    Mycoplasma fermentans, a cell wall-less prokaryote, is capable of infecting humans and has been suggested to serve as a cofactor in AIDS development. Recently, we discovered a novel lipoprotein with a molecular mass of 43 kDa originating from M. fermentans. This protein, named M161Ag, activated human complement via the alternative pathway and efficiently induced the proinflammatory cytokines interleukin 1beta (IL-1beta), tumor necrosis factor alpha, IL-6, IL-10, and IL-12 in human peripheral blood monocytes. It is likely that M161Ag of M. fermentans affects the host immune system upon mycoplasma infection. In this study, we developed monoclonal antibodies (MAbs) against M161Ag and examined the direct role of complement in M. fermentans infection using these MAbs as probes. M. fermentans was rapidly cleared from the surfaces of infected cells by human complement, but a low-grade infection persisted in human tumor cell lines. Mycoplasma particles remaining alive in host cells may cause recurrent infection, and liberated M161Ag may serve as a biological response modifier affecting both innate and acquired immunity.

  2. How Are Substrate Binding and Catalysis Affected by Mutating Glu127 and Arg161 in Prolyl-4-hydroxylase? A QM/MM and MD Study

    Directory of Open Access Journals (Sweden)

    Amy Timmins

    2017-11-01

    Full Text Available Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM study on wildtype and mutant structures. In a previous study (Timmins et al., 2017 we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter.

  3. Effect of the ion force on the hydrolysis constants and of the solubility product of Europium; Efecto de la fuerza ionica sobre las constantes de hidrolisis y del producto de solubilidad del europio

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez R, M.; Ramirez G, J.J.; Solache R, M.; Rojas H, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2003-07-01

    A study on the behavior of the first hydrolysis constant {beta}{sub Eu,H}{sup l-0} and the constant of the solubility product Kps of the europium in front of the changes of the ion force: 0. 02 M, 0.1 M, 0.7M, 2M, 3M and 4M of sodium perchlorate, at 303 K. Experimentally the potentiometry and also radioactivity measures its were used. The specific interaction of ions theory (SIT) of Bronsted-Guggenheim-Scatchard allows the extrapolation of the values to infinite dilution and the results were: log {beta}{sub Eu,H}{sup l-0} = -7 36 and log K{sub sp}{sup l-0} = -24. 68. A discussion of the group of results with the data of the literature is presented. (Author)

  4. Search for R-Parity violating effects at $\\sqrt{s}$ 161 and 172 GeV

    CERN Document Server

    Arnoud, Y; Berat, C; Witek, M; Vassilopoulos, N; Sajot, G; Richard, F; Nicolaidou, R; Pimenta M; Papadopoulou, Th D; Palka, H; Onofre, A; Lola, S; Kluit, P; Katsanevas, S; Gris, P; Fichet, S; Cieslik, K; Boonekamp, M

    1997-01-01

    Searches for charginos, neutralinos and sleptons in e+ e collisions at center-of-mass energies of 161 and 172 GeV have been performed on DELPHI data, under the assumptions that R-Parity is not conserved and that the dominant R-Parity violating couplings involve only leptonic or only quark elds. Particular emphasis is given in decays involving, the minimally constrained by low-energy studies, third generation couplings including 's and b quarks in the decay products. Squark decays are also studied for the same energies assuming that the dominant R-Parity violating couplings involve a mixture of leptonic and quark elds. In the above studies, it is assumed that the strength of the couplings is such that the lifetimes can be neglected. These searches are used to constraint domains of the parameter space, previously explored under the assumption of R-Parity conservation. Further, the single sparticle production, possible when R-parity is not conserved, is studied. In particular the single squark production and the...

  5. Sleep Behavior and EEG Oscillations in Aged Dp(16)1Yey/+ Mice: A Down Syndrome Model.

    Science.gov (United States)

    Levenga, J; Peterson, D J; Cain, P; Hoeffer, C A

    2018-02-16

    Down syndrome (DS) results from the triplication of genes located on human chromosome 21 (Hsa21). Though many cognitive and behavioral impairments are associated with DS, sleep disturbances remain poorly understood despite being a reported phenotype in approximately 60% of individuals diagnosed with DS. In this study, sleep and electroencephalography (EEG) oscillations were recorded from aged (12-14 mos.) Dp(16)1Yey/+ mice (Dp16), a mouse model of DS. We observed disrupted sleep demonstrated by increased activity during the dark phase and increased time awake at the expense of NREM sleep compared to wild-type mice. In addition, we found that Dp16 mice display significant differences in relative EEG power distribution among oscillation frequencies in both sleep and awake states. These results in Dp16 mice are consistent with sleep disturbances found in individuals with DS, and the abnormal EEG oscillations in aged Dp16 mice suggest a potential role for GABAergic activity in these sleep and EEG abnormalities. These sleep and EEG data reflect underlying differences in neuronal activity at the network level and thus are causative agents rather than merely symptoms of DS. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. Central and Eastern European countries between the 16+1 platform and Chinese OBOR - One Belt, One Road - Initiative

    Directory of Open Access Journals (Sweden)

    George Cornel Dumitrescu

    2016-04-01

    Full Text Available This paper aims at analysing the projects and the initiatives of the Central and Eastern European countries that have been finalised, are in progress or will be developed in the near future with the help of the existing or future financial instruments specific to the 16+1 platform and the One Belt, One Road complex program. For our research we selected four countries, namely: Poland, Romania, Serbia and Hungary, the group being relevant from the perspective of the transportation corridors connected to the ”One Belt, One Road” initiative: (1 - Piraeus, Skopje, Belgrade, Budapest, Western Europe; (2 - Suez Canal, Constanta and then Danube, Western Europe, or through Moldova towards Ukraine and Poland; (3 – Constanta, through the Black Sea and Caspian Sea and then the corridors mentioned at the previous point. We based our analysis on the data provided by the National Bureau of Statistics of China, China-CEEC think-tank network and the literature in the field.

  7. Searches for charginos and neutralinos in $e^+ e^-$ collisions at $\\sqrt{s}$ = 161 and 172 GeV

    CERN Document Server

    Barate, R; Décamp, D; Ghez, P; Goy, C; Lees, J P; Lucotte, A; Minard, M N; Nief, J Y; Pietrzyk, B; Casado, M P; Chmeissani, M; Comas, P; Crespo, J M; Delfino, M C; Fernández, E; Fernández-Bosman, M; Garrido, L; Juste, A; Martínez, M; Merino, G; Miquel, R; Mir, L M; Padilla, C; Park, I C; Pascual, A; Perlas, J A; Riu, I; Sánchez, F; Colaleo, A; Creanza, D; De Palma, M; Gelao, G; Iaselli, Giuseppe; Maggi, G; Maggi, M; Marinelli, N; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Alemany, R; Bazarko, A O; Becker, U; Bright-Thomas, P G; Cattaneo, M; Cerutti, F; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Gianotti, F; Hagelberg, R; Hansen, J B; Harvey, J; Janot, P; Jost, B; Kneringer, E; Lehraus, Ivan; Mato, P; Minten, Adolf G; Moneta, L; Pacheco, A; Pusztaszeri, J F; Ranjard, F; Rizzo, G; Rolandi, Luigi; Rousseau, D; Schlatter, W D; Schmitt, M; Schneider, O; Tejessy, W; Teubert, F; Tomalin, I R; Wachsmuth, H W; Wagner, A; Ajaltouni, Ziad J; Barrès, A; Boyer, C; Falvard, A; Ferdi, C; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Perret, P; Podlyski, F; Proriol, J; Rosnet, P; Rossignol, J M; Fearnley, Tom; Hansen, J D; Hansen, J R; Hansen, P H; Nilsson, B S; Rensch, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Vayaki, Anna; Blondel, A; Brient, J C; Machefert, F P; Rougé, A; Rumpf, M; Valassi, Andrea; Videau, H L; Boccali, T; Focardi, E; Parrini, G; Zachariadou, K; Cavanaugh, R J; Corden, M; Georgiopoulos, C H; Hühn, T; Jaffe, D E; Antonelli, A; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Casper, David William; Chiarella, V; Felici, G; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Curtis, L; Dorris, S J; Halley, A W; Knowles, I G; Lynch, J G; O'Shea, V; Raine, C; Scarr, J M; Smith, K; Teixeira-Dias, P; Thompson, A S; Thomson, E; Thomson, F; Turnbull, R M; Buchmüller, O L; Dhamotharan, S; Geweniger, C; Graefe, G; Hanke, P; Hansper, G; Hepp, V; Kluge, E E; Putzer, A; Sommer, J; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Goodsir, S M; Martin, E B; Morawitz, P; Moutoussi, A; Nash, J; Sedgbeer, J K; Spagnolo, P; Stacey, A M; Williams, M D; Ghete, V M; Girtler, P; Kuhn, D; Rudolph, G; Betteridge, A P; Bowdery, C K; Buck, P G; Colrain, P; Crawford, G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Sloan, Terence; Whelan, E P; Williams, M I; Giehl, I; Hoffmann, C; Jakobs, K; Kleinknecht, K; Quast, G; Renk, B; Rohne, E; Sander, H G; Van Gemmeren, P; Zeitnitz, C; Aubert, Jean-Jacques; Benchouk, C; Bonissent, A; Bujosa, G; Carr, J; Coyle, P; Diaconu, C A; Ealet, A; Fouchez, D; Konstantinidis, N P; Leroy, O; Motsch, F; Payre, P; Talby, M; Sadouki, A; Thulasidas, M; Tilquin, A; Trabelsi, K; Aleppo, M; Antonelli, M; Ragusa, F; Berlich, R; Blum, Walter; Büscher, V; Dietl, H; Ganis, G; Gotzhein, C; Kroha, H; Lütjens, G; Lutz, Gerhard; Männer, W; Moser, H G; Richter, R H; Rosado-Schlosser, A; Schael, S; Settles, Ronald; Seywerd, H C J; Saint-Denis, R; Stenzel, H; Wiedenmann, W; Wolf, G; Boucrot, J; Callot, O; Chen, S; Davier, M; Duflot, L; Grivaz, J F; Heusse, P; Höcker, A; Jacholkowska, A; Kim, D W; Le Diberder, F R; Lefrançois, J; Lutz, A M; Marumi, M; Schune, M H; Serin, L; Tournefier, E; Veillet, J J; Videau, I; Zerwas, D; Azzurri, P; Bagliesi, G; Bettarini, S; Bozzi, C; Calderini, G; Ciulli, V; Dell'Orso, R; Fantechi, R; Ferrante, I; Giassi, A; Gregorio, A; Ligabue, F; Lusiani, A; Marrocchesi, P S; Messineo, A; Palla, Fabrizio; Sanguinetti, G; Sciabà, A; Sguazzoni, G; Steinberger, Jack; Tenchini, Roberto; Vannini, C; Venturi, A; Verdini, P G; Blair, G A; Bryant, L M; Chambers, J T; Green, M G; Medcalf, T; Perrodo, P; Strong, J A; Von Wimmersperg-Töller, J H; Botterill, David R; Clifft, R W; Edgecock, T R; Haywood, S; Maley, P; Norton, P R; Thompson, J C; Wright, A E; Bloch-Devaux, B; Colas, P; Fabbro, B; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Rander, J; Renardy, J F; Rosowsky, A; Roussarie, A; Schwindling, J; Trabelsi, A; Vallage, B; Black, S N; Dann, J H; Kim, H Y; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Brew, C A J; Cartwright, S L; Combley, F; Kelly, M S; Lehto, M H; Reeve, J; Thompson, L F; Affholderbach, K; Böhrer, A; Brandt, S; Cowan, G D; Foss, J; Grupen, Claus; Smolik, L; Stephan, F; Apollonio, M; Bosisio, L; Della Marina, R; Giannini, G; Gobbo, B; Musolino, G; Pütz, J; Rothberg, J E; Wasserbaech, S R; Williams, R W; Armstrong, S R; Charles, E; Elmer, P; Ferguson, D P S; Gao, Y; González, S; Greening, T C; Hayes, O J; Hu, H; Jin, S; McNamara, P A; Nachtman, J M; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Walsh, J; Wu Sau Lan; Wu, X; Yamartino, J M; Zobernig, G

    1998-01-01

    The data recorded by the ALEPH detector at centre-of-mass energies of 161, 170, and 172 GeV are analysed for signals of chargino and neutralino production. No evidence of a signal is found, although candidate events consistent with the expectations from Standard Model processes are observed. Limits at 95% C.L. on the production cross sections are derived and bounds on the parameters of the Minimal Supersymmetric Standard Model are set. The lower limit on the mass of the lightest chargino is 85.5 GeV/c^2 for gaugino-like charginos (mu = -500 GeV/c^2), and 85.0 GeV/c^2 for Higgsino-like charginos (M_2 = 500 GeV/c^2), for heavy sneutrinos (M(snu) > 200 GeV/c^2) and tanb = sqrt(2). The effect of light sleptons on chargino and neutralino limits is investigated. The assumptions of a universal slepton mass and a universal gaugino mass are relaxed, allowing less model-dependent limits to be obtained.

  8. Is there a gender equity for women farmers? Reflections on public policy and social CONPES 161/2013.

    Directory of Open Access Journals (Sweden)

    Ximena Marin Hermann

    2013-12-01

    Full Text Available Domestic roles ( reproductive and productive Colombian rural women are different and are marked by the dynamics of their own territories , but also developed in the areas of public and private unevenly and unfairly compared to men rural sector. Considering the above, raises feminist economics "care economy" as an effort to validate and make visible the contribution of women to the economy. But this trend can go further, can contribute to the transformation of reproductive and productive roles, encouraging participation and democracy for women. Considering this, the equitable use of the time in the private ( family enters debate. Women no longer want and seek only equality in public but do not want to share your time at home on an unequal footing . Public policies are needed to contribute to these disparities disappear. To this extent it is possible to ask yourself the current Public Policy Of Gender Equity for Women ( SOCIAL CONPES 161/2013 , can guarantee the full enjoyment of the rights of Colombian women applying the principles of equality and non-discrimination? This reflection tries to do, from a gender perspective, an analytical reading of the impact of public policy on the transformation of the reality of the Colombian rural women.

  9. 16.1% Efficient Hysteresis-Free Mesostructured Perovskite Solar Cells Based on Synergistically Improved ZnO Nanorod Arrays

    KAUST Repository

    Mahmood, Khalid

    2015-06-01

    Significant efficiency improvements are reported in mesoscopic perovskite solar cells based on the development of a low-temperature solution-processed ZnO nanorod (NR) array exhibiting higher NR aspect ratio, enhanced electron density, and substantially reduced work function than conventional ZnO NRs. These features synergistically result in hysteresis-free, scan-independent, and stabilized devices with an efficiency of 16.1%. Electron-rich, nitrogen-doped ZnO (N:ZnO) NR-based electron transporting materials (ETMs) with enhanced electron mobility produced using ammonium acetate show consistently higher efficiencies by one to three power points than undoped ZnO NRs. Additionally, the preferential electrostatic interaction between the -nonpolar facets of N:ZnO and the conjugated polyelectrolyte polyethylenimine (PEI) has been relied on to promote the hydrothermal growth of high aspect ratio NR arrays and substantially improve the infiltration of the perovskite light absorber into the ETM. Using the same interactions, a conformal PEI coating on the electron-rich high aspect ratio N:ZnO NR arrays is -successfully applied, resulting in a favorable work function shift and altogether leading to the significant boost in efficiency from <10% up to >16%. These results largely surpass the state-of-the-art PCE of ZnO-based perovskite solar cells and highlight the benefits of synergistically combining mesoscale control with doping and surface modification. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Absence of Prenatal Forebrain Defects in the Dp(16)1Yey/+ Mouse Model of Down Syndrome.

    Science.gov (United States)

    Goodliffe, Joseph W; Olmos-Serrano, Jose Luis; Aziz, Nadine M; Pennings, Jeroen L A; Guedj, Faycal; Bianchi, Diana W; Haydar, Tarik F

    2016-03-09

    Studies in humans with Down syndrome (DS) show that alterations in fetal brain development are followed by postnatal deficits in neuronal numbers, synaptic plasticity, and cognitive and motor function. This same progression is replicated in several mouse models of DS. Dp(16)1Yey/+ (hereafter called Dp16) is a recently developed mouse model of DS in which the entire region of mouse chromosome 16 that is homologous to human chromosome 21 has been triplicated. As such, Dp16 mice may more closely reproduce neurodevelopmental changes occurring in humans with DS. Here, we present the first comprehensive cellular and behavioral study of the Dp16 forebrain from embryonic to adult stages. Unexpectedly, our results demonstrate that Dp16 mice do not have prenatal brain defects previously reported in human fetal neocortex and in the developing forebrains of other mouse models, including microcephaly, reduced neurogenesis, and abnormal cell proliferation. Nevertheless, we found impairments in postnatal developmental milestones, fewer inhibitory forebrain neurons, and deficits in motor and cognitive performance in Dp16 mice. Therefore, although this new model does not express prenatal morphological phenotypes associated with DS, abnormalities in the postnatal period appear sufficient to produce significant cognitive deficits in Dp16. Copyright © 2016 the authors 0270-6474/16/362926-19$15.00/0.

  11. Di-Jet Production in Photon-Photon Collisions at $\\sqrt{s}_{ee}$ = 161 and 172 GeV

    CERN Document Server

    Abbiendi, G.; Alexander, G.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Ashby, S.F.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barillari, T.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Behnke, T.; Bell, Kenneth Watson; Bella, G.; Bellerive, A.; Bentvelsen, S.; Bethke, S.; Betts, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bobinski, M.; Bock, P.; Bohme, J.; Bonacorsi, D.; Boutemeur, M.; Braibant, S.; Bright-Thomas, P.; Brigliadori, L.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Ciocca, C.; Clarke, P.E.L.; Clay, E.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Couyoumtzelis, C.; Coxe, R.L.; Cuffiani, M.; Dado, S.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; De Roeck, A.; Desch, K.; Dienes, B.; Dixit, M.S.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Estabrooks, P.G.; Etzion, E.; Evans, H.G.; Fabbri, F.; Fanti, M.; Faust, A.A.; Fiedler, F.; Fierro, M.; Fleck, I.; Folman, R.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Gaycken, G.; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Harder, K.; Hargrove, C.K.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Hocker, James Andrew; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Igo-Kemenes, P.; Imrie, D.C.; Ishii, K.; Jacob, F.R.; Jawahery, A.; Jeremie, H.; Jimack, M.; Jones, C.R.; Jovanovic, P.; Junk, T.R.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kowalewski, Robert V.; Kress, T.; Krieger, P.; von Krogh, J.; Kuhl, T.; Kyberd, P.; Lafferty, G.D.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Lawson, I.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lellouch, D.; Letts, J.; Levinson, L.; Liebisch, R.; List, B.; Littlewood, C.; Lloyd, A.W.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Lui, D.; Macchiolo, A.; Macpherson, A.; Mader, W.; Mannelli, M.; Marcellini, S.; Markopoulos, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Polok, J.; Przybycien, M.; Rembser, C.; Rick, H.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Roscoe, K.; Rossi, A.M.; Rozen, Y.; Runge, K.; Runolfsson, O.; Rust, D.R.; Sachs, K.; Saeki, T.; Sahr, O.; Sang, W.M.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schieck, J.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Sproston, M.; Stahl, A.; Stephens, K.; Steuerer, J.; Stoll, K.; Strom, David M.; Strohmer, R.; Surrow, B.; Talbot, S.D.; Tanaka, S.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Torrence, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Van Kooten, Rick J.; Vannerem, P.; Verzocchi, M.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilson, G.W.; Wilson, J.A.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.

    1999-01-01

    Di-jet production is studied in collisions of quasi-real photons radiated by the LEP beams at e+e- centre-of-mass energies 161 and 172 GeV. The jets are reconstructed using a cone jet finding algorithm. The angular distributions of direct and double-resolved processes are measured and compared to the predictions of leading order and next-to-leading order perturbative QCD. The jet energy profiles are also studied. The inclusive two-jet cross-section is measured as a function of transverse energy and rapidity and compared to next-to-leading order perturbative QCD calculations. The inclusive two-jet cross-section as a function of rapidity is compared to the prediction of the leading order Monte Carlo generators PYTHIA and PHOJET. The Monte Carlo predictions are calculated with different parametrisations of the parton distributions of the photon. The influence of the `underlying event' has been studied to reduce the model dependence of the predicted jet cross-sections from the Monte Carlo generators.

  12. Mental Status Test Scores are Inversely Correlated with Tremor Severity: A Study of 161 Elderly Essential Tremor Cases

    Directory of Open Access Journals (Sweden)

    Elan D. Louis

    2012-07-01

    Full Text Available Background: There is an increasing awareness that patients with essential tremor (ET may exhibit non-motor features, including cognitive dysfunction. Yet there are surprisingly few data in ET on the association, if any, between cognitive dysfunction and motor dysfunction (i.e., tremor severity. Establishing links between the cognitive and motor features of ET would imply that the two share a common underlying pathogenic process. Recent neuroimaging data support this notion.Methods: ET cases were enrolled in a clinical–pathological study at Columbia University Medical Center, New York. The Folstein Mini-Mental State Examination (FMMSE and Modified Mini Mental Status Examination (mMMSE were administered. Action tremor was rated with a total tremor score (TTS.Results: There were 161 ET cases (mean age 83.9±5.7 years, median FMMSE 28, median mMMSE 50. The FMMSE and mMMSE were inversely correlated with the TTS (r = −0.22, p = 0.005; and r = −0.17, p = 0.029. The association, while statistically significant, was modest in magnitude. In linear regression models that adjusted for age, gender, and education, the association between cognitive test scores and TTS remained robust (p<0.001. After excluding 68 (42.2% cases taking ET medications with potential cognitive side effects, results remained unchanged.Conclusions: Each of the two cognitive test scores was associated with tremor severity such that greater cognitive dysfunction occurred in cases with more marked tremor. These data support recent imaging data, which suggest that the cerebellar neurodegeneration underlying ET may be involved in the expression of cognitive symptoms in ET.

  13. Rates of intraoperative complications and conversion to laparotomy during laparoscopic ovariectomy performed by veterinary students: 161 cases (2010-2014).

    Science.gov (United States)

    Nylund, Adam M; Drury, Adam; Weir, Heather; Monnet, Eric

    2017-07-01

    OBJECTIVE To assess rates of intraoperative complications and conversion to laparotomy associated with supervised veterinary students performing laparoscopic ovariectomy in dogs. DESIGN Retrospective case series. ANIMALS 161 female shelter dogs for which elective laparoscopic ovariectomy had been performed by supervised senior (fourth-year) veterinary students from 2010 through 2014. PROCEDURES Medical records of all dogs were reviewed and data collected regarding duration of surgery, surgical complications and other characteristics, and whether conversion to laparotomy was required. RESULTS Laparoscopic ovariectomy was performed with a 2-cannula technique and a 10-mm vessel-sealing device for hemostasis in all dogs. A Veress needle was used for initial insufflation in 144 (89.4%) dogs; method of insufflation was not reported for the remaining 17 (10.6%) dogs. Mean ± SD duration of surgery was 114.90 ± 33.40 minutes. Surgical complications, all classified as minor blood loss, occurred in 24 (14.9%) dogs. These included splenic puncture during insertion of the Veress needle (n = 20 [12.4%]) and minor bleeding from the ovarian pedicle (4 [2.5%]). Splenic puncture required no intervention, and ovarian pedicle bleeding required application of the vessel-sealing device an additional time to control the bleeding. Two ovaries were dropped in the abdominal cavity at the time of removal. Both were retrieved without complication. Conversion to laparotomy was not required for any dog. All dogs were discharged from the hospital within 24 hours after surgery. CONCLUSIONS AND CLINICAL RELEVANCE Laparoscopic ovariectomy in dogs was performed safely by closely supervised novice surgeons, with only minor intraoperative complications encountered and no need for conversion to laparotomy.

  14. Palmitoleic acid isomer (C16:1delta6) in human skin sebum is effective against gram-positive bacteria.

    Science.gov (United States)

    Wille, J J; Kydonieus, A

    2003-01-01

    The percent lipid composition of pooled human sebum analyzed by thin-layer chromatography was: ceramides (13%), fatty acid (47%), cholesterol (7%), cholesterol esters (2%), squalene (11%), triglycerides (3%), and wax esters (17%). Total sebum lipids (2- 4 mg/ml), sonicated into bacterial culture medium, caused 4- to 5-fold log reduction in growth of gram-positive bacteria, Staphylococcus aureus, Streptococcus salivarius and the anaerobe Fusobacterium nucleatum, but was ineffective against most gram-negative bacteria. Fractionation of the sebum lipids showed that both saturated and unsaturated fatty acids contained the bulk of the antimicrobial activity. Lauric acid (C12:0) was the most active saturated fatty acid. The unsaturated fatty acid, palmitoleic acid (C16:1delta6, cPA) was both the most predominant monoene and the most active antimicrobial fatty acid. Purified cPA (>99%) yielded typical minimal inhibitory concentration (MIC) values of 10-20 microg/ml against gram-positive bacteria. Organically synthesized cPA isomer gave MIC values comparable to the natural material. Both natural and synthetic cPA were found to be the most active sebum lipid fraction in blocking the adherence of a pathogenic strain of Candida albicans to porcine stratum corneum. Ethanol in combination with cPA exerts a synergistic bactericidal activity against gram-negative pathogenic bacteria, including Pseudomonas aeruginosa, Propionibacterium acnes, Escherichia coli, and several methacillin-resistant strains of S. aureus. Palmitoleic acid may be useful in topical formulations for treatment of secondary gram-positive bacterial infections, as a gram-positive bacteria antimicrobial in wound dressings, and as a natural gram-positive antimicrobial preservative in skin and hair care products. Copyright 2003 S. Karger AG, Basel

  15. Epidemiologia e distribuição de lesões extrarrenais de uremia em 161 cães

    Directory of Open Access Journals (Sweden)

    Isadora P. Silveira

    2015-06-01

    Full Text Available Resumo: Com o objetivo de determinar a epidemiologia e as características morfológicas, incluindo a localização anatômica, das lesões extrarrenais de uremia, bem como determinar as principais lesões do sistema urinário associadas à ocorrência de uremia, foram revisados os protocolos de necropsias de cães realizadas no Laboratório de Patologia Veterinária da Universidade Federal de Santa Maria de janeiro de 1996 a dezembro de 2012 (17 anos. Nesse período foram necropsiados 4.201 cães, sendo que 161 (3,8% apresentaram lesões extrarrenais de uremia. Em 134 cães (83,2% foram descritos sinais clínicos associados à uremia. As lesões extrarrenais mais frequentes, em ordem decrescente, foram: gastrite ulcerativa e hemorrágica (56,5%, mineralização de tecidos moles (55,9%, edema pulmonar (47,2%, estomatite e/ou glossite ulcerativa (30,4%, endocardite/trombose atrial e aórtica (28,6%, hiperplasia das paratireoides (9,3%, osteodistrofia fibrosa (8,1%, anemia (6,2%, laringite ulcerativa (5%, enterite ulcerativa/hemorrágica (3,7%, esofagite fibrinonecrótica (1,9% e pericardite fibrinosa (1.9%. Na maioria dos casos as lesões extrarrenais de uremia foram decorrentes de azotemia prolongada por lesões renais graves, sendo as mais prevalentes a nefrite intersticial e a glomerulonefrite.

  16. Search for anomalous production of dilepton events with missing transverse momentum in $e^{+} e^{-}$ collisions at $\\sqrt{s}$ = 161 and 172 GeV

    CERN Document Server

    Ackerstaff, K.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Beeston, C.; Behnke, T.; Bell, A.N.; Bell, Kenneth Watson; Bella, G.; Bentvelsen, S.; Bethke, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bloomer, J.E.; Bobinski, M.; Bock, P.; Bonacorsi, D.; Boutemeur, M.; Bouwens, B.T.; Braibant, S.; Brigliadori, L.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Clarke, P.E.L.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Cuffiani, M.; Dado, S.; Dallapiccola, C.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; Desch, K.; Dienes, B.; Dixit, M.S.; do Couto e Silva, E.; Doucet, M.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Edwards, J.E.G.; Estabrooks, P.G.; Evans, H.G.; Evans, M.; Fabbri, F.; Fanti, M.; Faust, A.A.; Fiedler, F.; Fierro, M.; Fischer, H.M.; Fleck, I.; Folman, R.; Fong, D.G.; Foucher, M.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Geddes, N.I.; Geich-Gimbel, C.; Geralis, T.; Giacomelli, G.; Giacomelli, P.; Giacomelli, R.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Goodrick, M.J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hajdu, C.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Hargrove, C.K.; Hart, P.A.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Hutchcroft, D.E.; Igo-Kemenes, P.; Imrie, D.C.; Ingram, M.R.; Ishii, K.; Jawahery, A.; Jeffreys, P.W.; Jeremie, H.; Jimack, M.; Joly, A.; Jones, C.R.; Jones, G.; Jones, M.; Jost, U.; Jovanovic, P.; Junk, T.R.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Kirk, J.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kress, T.; Krieger, P.; von Krogh, J.; Kyberd, P.; Lafferty, G.D.; Lahmann, R.; Lai, W.P.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lefebvre, E.; Lellouch, D.; Letts, J.; Levinson, L.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Macchiolo, A.; Macpherson, A.; Mannelli, M.; Marcellini, S.; Markus, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mikenberg, G.; Miller, D.J.; Mincer, A.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Morii, M.; Muller, U.; Mihara, S.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oh, A.; Oldershaw, N.J.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Pearce, M.J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Poli, B.; Posthaus, A.; Rees, D.L.; Rigby, D.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Rooke, A.; Ros, E.; Rossi, A.M.; Routenburg, P.; Rozen, Y.; Runge, K.; Runolfsson, O.; Ruppel, U.; Rust, D.R.; Rylko, R.; Sachs, K.; Saeki, T.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schenk, P.; Schieck, J.; Schleper, P.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schroder, Matthias; Schultz-Coulon, H.C.; Schumacher, M.; Schwick, C.; Scott, W.G.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skillman, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Springer, Robert Wayne; Sproston, M.; Stephens, K.; Steuerer, J.; Stockhausen, B.; Stoll, K.; Strom, David M.; Szymanski, P.; Tafirout, R.; Talbot, S.D.; Tanaka, S.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Utzat, P.; Van Kooten, Rick J.; Verzocchi, M.; Vikas, P.; Vokurka, E.H.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilkens, B.; Wilson, G.W.; Wilson, J.A.; Wolf, G.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.

    1998-01-01

    Events containing a pair of charged leptons and significant missing transverse momentum are selected from a data sample corresponding to a total integrated luminosity of 20.6 pb^-1 at centre-of-mass energies of 161 GeV and 172 GeV. The observed number of events, four at 161 GeV and nine at 172 GeV, is consistent with the number expected from Standard Model processes, predominantly arising from W+W- production with each W decaying leptonically. This topology is also an experimental signature for the pair production of new particles that decay to a charged lepton accompanied by one or more invisible particles. Further event selection criteria are described that optimise the sensitivity to particular new physics channels. No evidence for new phenomena is observed and limits on the production of scalar charged lepton pairs and other new particles are presented.

  17. Clinical significance of pre-transplant circulating CD3(+) CD4(+) CD161(+) cell frequency on the occurrence of neutropenic infections after allogeneic stem cell transplantation.

    Science.gov (United States)

    Kim, Tae Woo; Lee, Sung-Eun; Lim, Ji-Young; Ryu, Da-Bin; Jeon, Young-Woo; Yoon, Jae-Ho; Cho, Byung-Sik; Eom, Ki-Seong; Kim, Yoo-Jin; Kim, Hee-Je; Lee, Seok; Cho, Seok-Goo; Kim, Dong-Wook; Lee, Jong Wook; Min, Woo-Sung; Min, Chang-Ki

    2017-02-01

    Few studies have been performed to identify factors that are associated with an increased risk of infections during the neutropenic period in patients undergoing allogeneic stem cell transplantation (allo-SCT). The aim of this study was to identify the host immune cells responsible for infections before engraftment. A total of 282 patients who underwent allo-SCT were enrolled. Peripheral blood samples were collected before conditioning therapy. Expression of CD161-expressing T cells, natural killer cells, and immature myeloid cells was analyzed by flow cytometry. Microbially and clinically defined infections and fevers of unknown origin as proposed by the Immunocompromised Host Society were included in this study. The median age was 45 years (range, 16-68 years). Patients had various hematologic disorders and were transplanted from human leukocyte antigen (HLA)-matched siblings, unrelated donors, and familial HLA-mismatched donors. In univariate analysis, younger age and a familial HLA-mismatched donor were risk factors for the occurrence of infections. After adjusting for potential variables in univariate analysis, multivariate analyses revealed that a lower frequency of CD3(+) CD4(+) CD161(+) cells was significantly associated with the occurrence of neutropenic infections. An age of 35 years or younger and allografting from familial HLA-mismatched donors showed a trend toward higher infection rates. Our data indicated that a lower frequency of CD3(+) CD4(+) CD161(+) T cells in peripheral blood before conditioning therapy was associated with a higher incidence of infection during the neutropenic period. These results suggest that recipient innate T cells with expression of C-type lectin CD161 can guard against infections before engraftment. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. May TLR4 Asp299Gly and IL17 His161Arg polymorphism be associated with progression of primary measles infection to subacute sclerosing panencephalitis?

    Science.gov (United States)

    Karakas-Celik, Sevim; Piskin, Ibrahim Etem; Keni, Mehmet Fatih; Calık, Mustafa; Iscan, Akın; Dursun, Ahmet

    2014-09-01

    SSPE is a progressive neurological disorder of children. Only some of the children who are infected with measles virus develop SSPE, which supports individual variation. TLR-2 and TLR-4 play an important role in innate immunity by recognizing envelope proteins of MV. Another important cytokine that plays an important role in orchestrating innate immune function is IL-17. The purpose of our study is to elucidate whether the TLR2, TLR4, IL17F and IL17A gene polymorphisms are susceptibility genes for the development of SSPE. Using the PCR-RFLP methods, the single nucleotide polymorphisms of TLR2 (Arg753Gln, Arg677Trp, -194 to -174 del), TLR4 (Asp299Gly and Thr399Ile) IL17F (His161Arg, Glu126Gly) and IL17A were studied in 54 patients with SSPE and 81 healthy controls. For Asp299Gly polymorphism of the TLR4 gene we found that there were no control individuals who were homozygous carriers of the Gly/Gly genotype, and the risk for SSPE increased at approximately 4.7 fold for the heterozygous carriers of the Asp/Gly genotype (OR 4.727, 95%-CI 1.192-18.742; P=0.01), when compared to healthy controls. Also our findings demonstrate that homozygosity for the Arg161 variant of the IL17F His161Arg polymorphism is inversely associated with development of SSPE (OR 0.114 95%-CI 0.026-0.494; P<0.001). In conclusion, it is suggested that variation in susceptibility to SSPE disease may be in part due to variations in TLR4 and IL17 function resulting from polymorphisms of TLR4 Asp299Gly and IL17F His161Arg. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Solution NMR Structure and Backbone Dynamics of the Partially Disordered Arabidopsis thaliana Phloem Protein 16-1, A Putative mRNA Transporter.

    Science.gov (United States)

    Sashi, Pulikallu; Singarapu, Kiran Kumar; Bhuyan, Abani K

    2018-01-10

    Although RNA-binding proteins in plant phloem are believed to carry out long-distance systemic transport of RNA in the phloem conduit, the structure of none of them is known. The Arabidopsis thaliana phloem protein 16-1 (AtPP16-1) is such a putative mRNA transporter whose structure and backbone dynamics have been studied at pH 4.1, 25oC, by high-resolution NMR spectroscopy. Results obtained using basic optical spectroscopic tools show that the protein is unstable with little secondary structure near the physiological pH of the phloem sap. Fluorescence-monitored titrations reveal that AtPP16-1 binds not only A. thaliana RNA (Kdiss ~ 67 nM) but also sheared DNA and model dodecamer DNA, albeit the affinity for DNA is ~15-fold less. In the solution structure of the protein secondary structural elements are formed of residues 3-9 (β1), 56-62 (β2), 133-135 (β3), and 96-110 (αα-helix). Most of the rest of the chain segments is disordered. The N-terminal disordered regions (residues 10-55) form a small lobe, which conjoins the rest of the molecule via a deep and large irregular cleft that could have functional implications. The average order parameter extracted by model-free analysis of 15N relaxation and {1H}-15N heteronuclear NOE data is 0.66, suggesting less restricted backbone motion. The average conformational entropy of the backbone NH vectors is -0.31 cal mol-1 K-1. These results also suggest structural disorder in AtPP16-1.

  20. The Effect of Problem Based Learning Strategic and Divergent Thinking Style on the Ability to Solve Environmental the Problems (An Experimental Study at SMP Negeri 161 Jakarta, 2015)

    OpenAIRE

    Gultom, Saurmaida

    2017-01-01

    The aim of the research is to identify the influence of learning strategic and divergent thinking style on the ability to solve the problems in environmental topic biology subject matter. This research was conducted in SMP Negeri 161 Jakarta. Experimental method with factorial 2 x 2 was applied on this research. The sampling objects were 60-second grade students. The two ways Varian analysis (ANAVA) was used in hypothesis test and continued by t-Dunnet test. The research conclusion were: 1) G...

  1. Abnormal CD161+ immune cells and retinoic acid receptor-related orphan receptor γt-mediate enhanced IL-17F expression in the setting of genetic hypertension.

    Science.gov (United States)

    Singh, Madhu V; Cicha, Michael Z; Kumar, Santosh; Meyerholz, David K; Irani, Kaikobad; Chapleau, Mark W; Abboud, François M

    2017-09-01

    Hypertension is considered an immunologic disorder. However, the role of the IL-17 family in genetic hypertension in the spontaneously hypertensive rat (SHR) has not been investigated. We tested the hypothesis that enhanced TH17 programming and IL-17 expression in abundant CD161+ immune cells in SHRs represent an abnormal proinflammatory adaptive immune response. Furthermore, we propose that this response is driven by the master regulator retinoic acid receptor-related orphan receptor γt (RORγt) and a nicotinic proinflammatory innate immune response. We measured expression of the CD161 surface marker on splenocytes in SHRs and normotensive control Wistar-Kyoto (WKY) rats from birth to adulthood. We compared expression of IL-17A and IL-17F in splenic cells under different conditions. We then determined the functional effect of these cytokines on vascular reactivity. Finally, we tested whether pharmacologic inhibition of RORγt can attenuate hypertension in SHRs. SHRs exhibited an abnormally large population of CD161+ cells at birth that increased with age, reaching more than 30% of the splenocyte population at 38 weeks. The SHR splenocytes constitutively expressed more RORγt than those of WKY rats and produced more IL-17F on induction. Exposure of WKY rat aortas to IL-17F impaired endothelium-dependent vascular relaxation, whereas IL-17A did not. Moreover, in vivo inhibition of RORγt by digoxin decreased systolic blood pressure in SHRs. SHRs have a markedly enhanced potential for RORγt-driven expression of proinflammatory and prohypertensive IL-17F in response to innate immune activation. Increased RORγt and IL-17F levels contribute to SHR hypertension and might be therapeutic targets. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  2. Space shuttle: Heat transfer rate measurements on Convair booster (B-15B-2) and North American Rockwell orbiter (161B) at nominal Mach number of 8

    Science.gov (United States)

    Warmbrod, J. D.; Martindale, W. R.; Matthews, R. K.

    1971-01-01

    Plotted and tabulated data from the thin-skin thermocouple phase of an experimental test program are presented. These data are representative of three events of simulated flight and are described as booster-orbiter ascent heating data, booster reentry heating data, and orbiter reentry heating data. The test was conducted in a 50-inch hypersonic tunnel b at a nominal Mach number of 8 and free-stream Reynolds number range of 700,000 to 3,700,000 per foot. The model employed was a 0.009 scale replica of the Convair B-15B-2 booster and North American Rockwell 161B orbiter.

  3. Photoluminescent study of Polycarbonate (PC) and Poly(9-vinylcarbazole) (PVK) doped films with europium complex; Estudo fotoluminescente de filmes de Policarbonato (PC) e Poli(9-vinilcarbazol) (PVK) dopados com complexo de europio

    Energy Technology Data Exchange (ETDEWEB)

    Forster, Pedro Lima

    2010-07-01

    Polymers doped with rare earth complexes are advantaged in film production for many applications in the luminescent field. In this study luminescent polymer obtained from polycarbonate (PC) and poly(9-vinylcarbazole) films doped with diaquatris(thenoyltrifluoroacetonate)europium(III) complex [Eu(tta){sub 3}(H{sub 2}0){sub 2}] were prepared and their calorimetric and luminescent properties in the solid state are reported. The thermal behavior was investigated by differential scanning calorimetry (OSC) and thermogravimetry analysis (TGA). Due of the addition of rare earth Eu(tta){sub 3}(H{sub 2}0){sub 2}] into PC and PVK matrices, changes were observed in the thermal behavior concerning the glass transition and thermal stability. Characteristic broadened narrow bands arising from the {sup 5}D{sub 0} -{yields} {sup 7}F{sub J} transitions (J = 0-4) of Eu{sup 3+} ion indicate the incorporation of the Eu{sup 3+} ions into those polymers. The luminescent films show enhancement emission intensity with an increase in the rare earth concentration in polymeric matrix accompanied by decrease in thermal stability. (author)

  4. Chemiluminescence Determination of Balofloxacin Based on Europium (III)-Sensitized KBrO{sub 3}-Na{sub 2}S{sub 2}O{sub 4} Reaction in Micellar Medium

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Fang; Qi, Yu; Xiong, Wei [Shihezi University, Shihezi (China)

    2012-01-15

    A novel chemiluminescence (CL) flow injection method for the determination of balofloxacin is described. The method is based on the weak CL signal arising from the reaction of KBrO{sub 3} with Na{sub 2}S{sub 2}O{sub 4} in acidic medium being significantly enhanced by balofloxacin in the presence of europium (III) ion and sodium dodecyl benzene sulfonate (SDBS). The experimental conditions that affected CL intensity were carefully optimized and the CL reaction mechanism was briefly discussed. Under the optimum conditions, the relative CL intensity was proportional to the concentration of balofloxacin in the range of 7.0 c 10{sup -11} to 3.0 x 10{sup -7} g mL{sup -1}. The detection limit was 2.7 x 10{sup -11} g mL{sup -1} and the relative standard deviation was 2.1% for 7.0 x 10{sup -10} g mL{sup -1} balofloxacin (n = 13). The proposed method was successfully applied to the determination of balofloxacin in pharmaceutical formulations and biological fluids.

  5. Search for the Standard Model Higgs Boson in $e^+ e^-$ Collisions at $\\sqrt{s}$ = 161-172 GeV

    CERN Document Server

    Ackerstaff, K; Allison, J; Altekamp, N; Anderson, K J; Anderson, S; Arcelli, S; Asai, S; Axen, D A; Azuelos, Georges; Ball, A H; Barberio, E; Barlow, R J; Bartoldus, R; Batley, J Richard; Baumann, S; Bechtluft, J; Beeston, C; Behnke, T; Bell, A N; Bell, K W; Bella, G; Bentvelsen, Stanislaus Cornelius Maria; Bethke, Siegfried; Biebel, O; Biguzzi, A; Bird, S D; Blobel, Volker; Bloodworth, Ian J; Bloomer, J E; Bobinski, M; Bock, P; Bonacorsi, D; Boutemeur, M; Bouwens, B T; Braibant, S; Brigliadori, L; Brown, R M; Burckhart, Helfried J; Burgard, C; Bürgin, R; Capiluppi, P; Carnegie, R K; Carter, A A; Carter, J R; Chang, C Y; Charlton, D G; Chrisman, D; Clarke, P E L; Cohen, I; Conboy, J E; Cooke, O C; Cuffiani, M; Dado, S; Dallapiccola, C; Dallavalle, G M; Davis, R; De Jong, S; del Pozo, L A; Desch, Klaus; Dienes, B; Dixit, M S; do Couto e Silva, E; Doucet, M; Duchovni, E; Duckeck, G; Duerdoth, I P; Eatough, D; Edwards, J E G; Estabrooks, P G; Evans, H G; Evans, M; Fabbri, Franco Luigi; Fanti, M; Faust, A A; Fiedler, F; Fierro, M; Fischer, H M; Fleck, I; Folman, R; Fong, D G; Foucher, M; Fürtjes, A; Futyan, D I; Gagnon, P; Gary, J W; Gascon, J; Gascon-Shotkin, S M; Geddes, N I; Geich-Gimbel, C; Geralis, T; Giacomelli, G; Giacomelli, P; Giacomelli, R; Gibson, V; Gibson, W R; Gingrich, D M; Glenzinski, D A; Goldberg, J; Goodrick, M J; Gorn, W; Grandi, C; Gross, E; Grunhaus, Jacob; Gruwé, M; Hajdu, C; Hanson, G G; Hansroul, M; Hapke, M; Hargrove, C K; Hart, P A; Hartmann, C; Hauschild, M; Hawkes, C M; Hawkings, R; Hemingway, Richard J; Herndon, M; Herten, G; Heuer, R D; Hildreth, M D; Hill, J C; Hillier, S J; Hobson, P R; Homer, R James; Honma, A K; Horváth, D; Hossain, K R; Howard, R; Hüntemeyer, P; Hutchcroft, D E; Igo-Kemenes, P; Imrie, D C; Ingram, M R; Ishii, K; Jawahery, A; Jeffreys, P W; Jeremie, H; Jimack, Martin Paul; Joly, A; Jones, C R; Jones, G; Jones, M; Jost, U; Jovanovic, P; Junk, T R; Karlen, D A; Kartvelishvili, V G; Kawagoe, K; Kawamoto, T; Kayal, P I; Keeler, Richard K; Kellogg, R G; Kennedy, B W; Kirk, J; Klier, A; Kluth, S; Kobayashi, T; Kobel, M; Koetke, D S; Kokott, T P; Kolrep, M; Komamiya, S; Kress, T; Krieger, P; Von Krogh, J; Kyberd, P; Lafferty, G D; Lahmann, R; Lai, W P; Lanske, D; Lauber, J; Lautenschlager, S R; Layter, J G; Lazic, D; Lee, A M; Lefebvre, E; Lellouch, Daniel; Letts, J; Levinson, L; Lloyd, S L; Loebinger, F K; Long, G D; Losty, Michael J; Ludwig, J; Macchiolo, A; MacPherson, A L; Mannelli, M; Marcellini, S; Markus, C; Martin, A J; Martin, J P; Martínez, G; Mashimo, T; Mättig, P; McDonald, W J; McKenna, J A; McKigney, E A; McMahon, T J; McPherson, R A; Meijers, F; Menke, S; Merritt, F S; Mes, H; Meyer, J; Michelini, Aldo; Mikenberg, G; Miller, D J; Mincer, A; Mir, R; Mohr, W; Montanari, A; Mori, T; Morii, M; Müller, U; Mihara, S; Nagai, K; Nakamura, I; Neal, H A; Nellen, B; Nisius, R; O'Neale, S W; Oakham, F G; Odorici, F; Ögren, H O; Oh, A; Oldershaw, N J; Oreglia, M J; Orito, S; Pálinkás, J; Pásztor, G; Pater, J R; Patrick, G N; Patt, J; Pearce, M J; Pérez-Ochoa, R; Petzold, S; Pfeifenschneider, P; Pilcher, J E; Pinfold, J L; Plane, D E; Poffenberger, P R; Poli, B; Posthaus, A; Rees, D L; Rigby, D; Robertson, S; Robins, S A; Rodning, N L; Roney, J M; Rooke, A M; Ros, E; Rossi, A M; Routenburg, P; Rozen, Y; Runge, K; Runólfsson, O; Ruppel, U; Rust, D R; Rylko, R; Sachs, K; Saeki, T; Sarkisyan-Grinbaum, E; Sbarra, C; Schaile, A D; Schaile, O; Scharf, F; Scharff-Hansen, P; Schenk, P; Schieck, J; Schleper, P; Schmitt, B; Schmitt, S; Schöning, A; Schröder, M; Schultz-Coulon, H C; Schumacher, M; Schwick, C; Scott, W G; Shears, T G; Shen, B C; Shepherd-Themistocleous, C H; Sherwood, P; Siroli, G P; Sittler, A; Skillman, A; Skuja, A; Smith, A M; Snow, G A; Sobie, Randall J; Söldner-Rembold, S; Springer, R W; Sproston, M; Stephens, K; Steuerer, J; Stockhausen, B; Stoll, K; Strom, D; Szymanski, P; Tafirout, R; Talbot, S D; Tanaka, S; Taras, P; Tarem, S; Teuscher, R; Thiergen, M; Thomson, M A; Von Törne, E; Towers, S; Trigger, I; Trócsányi, Z L; Tsur, E; Turcot, A S; Turner-Watson, M F; Utzat, P; Van Kooten, R; Verzocchi, M; Vikas, P; Vokurka, E H; Voss, H; Wäckerle, F; Wagner, A; Ward, C P; Ward, D R; Watkins, P M; Watson, A T; Watson, N K; Wells, P S; Wermes, N; White, J S; Wilkens, B; Wilson, G W; Wilson, J A; Wolf, G; Wyatt, T R; Yamashita, S; Yekutieli, G; Zacek, V; Zer-Zion, D

    1998-01-01

    This paper describes a search for the Standard Model Higgs boson using data from e^+e^- collisions collected at center-of-mass energies of 161, 170 and 172 GeV by the OPAL detector at LEP. The data collected at these energies correspond to integrated luminosities of 10.0, 1.0 and 9.4 pb^-1, respectively. The search is sensitive to the main final states from the process in which the Higgs boson is produced in association with a fermion anti-fermion pair, namely four jets, two jets with missing energy, and two jets produced together with a pair of electron, muon or tau leptons. One candidate event is observed, in agreement with the Standard Model background expectation. In combination with previous OPAL searches at center-of-mass energies close to the Z^0 resonance and the revised previous OPAL searches at 161 GeV, we derive a lower limit of 69.4 GeV for the mass of the Standard Model Higgs boson at the 95% confidence level.

  6. MicroRNA-15a and -16-1 act via MYB to elevate fetal hemoglobin expression in human trisomy 13.

    Science.gov (United States)

    Sankaran, Vijay G; Menne, Tobias F; Šćepanović, Danilo; Vergilio, Jo-Anne; Ji, Peng; Kim, Jinkuk; Thiru, Prathapan; Orkin, Stuart H; Lander, Eric S; Lodish, Harvey F

    2011-01-25

    Many human aneuploidy syndromes have unique phenotypic consequences, but in most instances it is unclear whether these phenotypes are attributable to alterations in the dosage of specific genes. In human trisomy 13, there is delayed switching and persistence of fetal hemoglobin (HbF) and elevation of embryonic hemoglobin in newborns. Using partial trisomy cases, we mapped this trait to chromosomal band 13q14; by examining the genes in this region, two microRNAs, miR-15a and -16-1, appear as top candidates for the elevated HbF levels. Indeed, increased expression of these microRNAs in primary human erythroid progenitor cells results in elevated fetal and embryonic hemoglobin gene expression. Moreover, we show that a direct target of these microRNAs, MYB, plays an important role in silencing the fetal and embryonic hemoglobin genes. Thus we demonstrate how the developmental regulation of a clinically important human trait can be better understood through the genetic and functional study of aneuploidy syndromes and suggest that miR-15a, -16-1, and MYB may be important therapeutic targets to increase HbF levels in patients with sickle cell disease and β-thalassemia.

  7. Identification of a recombinant inulin fructotransferase (difructose dianhydride III forming) from Arthrobacter sp. 161MFSha2.1 with high specific activity and remarkable thermostability.

    Science.gov (United States)

    Wang, Xiao; Yu, Shuhuai; Zhang, Tao; Jiang, Bo; Mu, Wanmeng

    2015-04-08

    Difructose dianhydride III (DFA III) is a functional carbohydrate produced from inulin by inulin fructotransferase (IFTase, EC 4.2.2.18). In this work, an IFTase gene from Arthrobacter sp. 161MFSha2.1 was cloned and expressed in Escherachia coli. The recombinant enzyme was purified by metal affinity chromatography. It showed significant inulin hydrolysis activity, and the produced main product from inulin was determined as DFA III by nuclear magnetic resonance analysis. The molecular mass of the purified protein was calculated to be 43 and 125 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and gel filtration, respectively, suggesting the native enzyme might be a homotrimer. The recombinant enzyme showed maximal activity as 2391 units/mg at pH 6.5 and 55 °C. It displayed the highest thermostability among previously reported IFTases (DFA III forming) and was stable up to 80 °C for 4 h of incubation. The smallest substrate was determined as nystose. The conversion ratio of inulin to DFA III reached 81% when 100 g/L inulin was catalyzed by 80 nM recombinant enzyme for 20 min at pH 6.5 and 55 °C. All of these data indicated that the IFTase (DFA III forming) from Arthrobacter sp. 161MFSha2.1 had great potential for industrial DFA III production.

  8. Search for Acoplanar Lepton Pair Events in $e^{+}e^{-}$ Collisions at $\\sqrt{s}$ = 161, 172 and 183 GeV

    CERN Document Server

    Abbiendi, G.; Alexander, G.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Ashby, S.F.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Behnke, T.; Bell, Kenneth Watson; Bella, G.; Bellerive, A.; Bentvelsen, S.; Bethke, S.; Betts, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bobinski, M.; Bock, P.; Bohme, J.; Bonacorsi, D.; Boutemeur, M.; Braibant, S.; Bright-Thomas, P.; Brigliadori, L.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Ciocca, C.; Clarke, P.E.L.; Clay, E.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Couyoumtzelis, C.; Coxe, R.L.; Cuffiani, M.; Dado, S.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; De Roeck, A.; Desch, K.; Dienes, B.; Dixit, M.S.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Estabrooks, P.G.; Etzion, E.; Evans, H.G.; Fabbri, F.; Fanti, M.; Faust, A.A.; Fiedler, F.; Fierro, M.; Fleck, I.; Folman, R.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Gaycken, G.; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Harder, K.; Hargrove, C.K.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Hocker, James Andrew; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Igo-Kemenes, P.; Imrie, D.C.; Ishii, K.; Jacob, F.R.; Jawahery, A.; Jeremie, H.; Jimack, M.; Jones, C.R.; Jovanovic, P.; Junk, T.R.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kowalewski, Robert V.; Kress, T.; Krieger, P.; von Krogh, J.; Kuhl, T.; Kyberd, P.; Lafferty, G.D.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Lawson, I.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lellouch, D.; Letts, J.; Levinson, L.; Liebisch, R.; List, B.; Littlewood, C.; Lloyd, A.W.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Lui, D.; Macchiolo, A.; Macpherson, A.; Mader, W.; Mannelli, M.; Marcellini, S.; Markopoulos, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Polok, J.; Przybycien, M.; Rembser, C.; Rick, H.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Roscoe, K.; Rossi, A.M.; Rozen, Y.; Runge, K.; Runolfsson, O.; Rust, D.R.; Sachs, K.; Saeki, T.; Sahr, O.; Sang, W.M.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schieck, J.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Sproston, M.; Stahl, A.; Stephens, K.; Steuerer, J.; Stoll, K.; Strom, David M.; Strohmer, R.; Surrow, B.; Talbot, S.D.; Tanaka, S.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Torrence, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Van Kooten, Rick J.; Vannerem, P.; Verzocchi, M.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilson, G.W.; Wilson, J.A.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.

    2000-01-01

    A selection of di-lepton events with significant missing transverse momentum has been performed using a total data sample of 77.0 pb-1 at e+e- centre-of-mass energies of 161 GeV, 172 GeV and 183 GeV. The observed numbers of events: four at 161 GeV, nine at 172 GeV, and 78 at 183 GeV, are consistent with the numbers expected from Standard Model processes, which arise predominantly from W+W- production with each W decaying leptonically. This topology is an experimental signature also for the pair production of new particles that decay to a charged lepton accompanied by one or more invisible particles. Further event selection criteria are described that optimise the sensitivity to particular new physics channels. No evidence for new phenomena is apparent and model independent limits on the production cross-section times branching ratio squared for various new physics processes are presented. Assuming a 100% branching ratio for the decay of a right-handed charged slepton to a charged lepton and the lightest neutr...

  9. Gold nanoparticle core-europium(iii) chelate fluorophore-doped silica shell hybrid nanocomposites for the lateral flow immunoassay of human thyroid stimulating hormone with a dual signal readout.

    Science.gov (United States)

    Preechakasedkit, Pattarachaya; Osada, Kota; Katayama, Yuta; Ruecha, Nipapan; Suzuki, Koji; Chailapakul, Orawon; Citterio, Daniel

    2018-01-21

    Hybrid nanocomposite particles composed of a gold core coated with a europium(iii)-chelate fluorophore-doped silica shell (AuNPs@SiO 2 -Eu 3+ ) have been synthesized and applied as antibody labels in lateral flow immunoassay (LFIA) devices for the determination of human thyroid stimulating hormone (hTSH). Labeling of monoclonal anti-hTSH antibodies with AuNPs@SiO 2 -Eu 3+ nanocomposites allows for both colorimetric and fluorometric observation of assay results on LFIA devices, relying on visible light absorption due to the localized surface plasmon resonance of the Au-core and the fluorescence emission of the Eu(iii)-chelate-modified shell under UV hand lamp irradiation (365 nm), respectively. The possibility for a dual signal readout provides an attractive alternative for LFIAs: instantaneous naked eye observation of the AuNP colorimetric signal as in conventional LFIAs for hypothyroidism detection, and more sensitive fluorescence detection to assess hyperthyroidism. The limits of detection (LOD) for naked eye observation of LFIA devices are 5 μIU mL -1 and 0.1 μIU mL -1 for the colorimetric and fluorimetric detection, respectively. Using the fluorescence detection scheme in combination with a smartphone and digital color analysis, a quantitative linear relationship between the red intensity and the logarithmic concentration of hTSH was observed (R 2 = 0.988) with an LOD of 0.02 μIU mL -1 . Finally, LFIA devices were effectively applied for detecting hTSH in spiked diluted human serum with recovery values between 100-116%.

  10. A europium- and terbium-coated magnetic nanocomposite as sorbent in dispersive solid phase extraction coupled with ultra-high performance liquid chromatography for antibiotic determination in meat samples.

    Science.gov (United States)

    Castillo-García, M L; Aguilar-Caballos, M P; Gómez-Hens, A

    2015-12-18

    A new magnetic dispersive solid-phase extraction approach based on Eu- and Tb-coated magnetic nanocomposites, combined with ultra-high performance liquid chromatography with fluorometric detection, is reported for the extraction and simultaneous determination of veterinary antibiotics. The method is aimed at monitoring of potential residues of three tetracyclines, namely oxytetracycline, tetracycline, chlortetracycline and three acidic quinolones, such as oxolinic acid, nalidixic acid and flumequine, chosen as model analytes, in animal muscle samples. The nanocomposites were obtained by synthesizing magnetic nanoparticles by a co-precipitation method and their coating with terbium and europium ions. The limits of detection obtained using standard solutions were: 1.0, 1.5, 3.8, 0.25, 0.7 and 1.2ngmL(-1), which corresponds to 3.3, 5.0, 12.7, 0.8, 2.3 and 4.0μgkg(-1) for oxytetracycline, tetracycline, chlortetracycline, oxolinic acid, nalidixic acid and flumequine, respectively, in meat samples. The precision values, obtained in the presence of the sample matrix, were in the ranges 0.12-2.0% and 2.6-15.4% for retention times and areas, respectively. The selectivity of the method was checked by assaying different veterinary drugs, finding that most of them did not interfere at the same concentration levels as that of analytes. A recovery study was performed in the presence of chicken and pork muscle samples, which provided values in the range of 61.5-102.6%. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Search for neutral and charged Higgs bosons in $e^+ e^-$ collisions at $\\sqrt{s}= 161 GeV$ and $172 GeV$

    CERN Document Server

    Abreu, P; Adye, T; Adzic, P; Ajinenko, I; Alekseev, G D; Alemany, R; Allport, P P; Almehed, S; Amaldi, Ugo; Amato, S; Andersson, P; Andreazza, A; Antilogus, P; Apel, W D; Arnoud, Y; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barbi, M S; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Bärring, O; Bates, M J; Battaglia, Marco; Baubillier, M; Baudot, J; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Benvenuti, Alberto C; Bérat, C; Berggren, M; Bertini, D; Bertrand, D; Besançon, M; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bizouard, M A; Bloch, D; Blume, M; Bonesini, M; Bonivento, W; Boonekamp, M; Booth, P S L; Borgland, A W; Borisov, G; Bosio, C; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Brown, R C A; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Cabrera, S; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Carena, F; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Chabaud, V; Charpentier, P; Chaussard, L; Checchia, P; Chelkov, G A; Chen, M; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Chudoba, J; Cindro, V; Collins, P; Colomer, M; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Cowell, J H; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; Dahm, J; D'Almagne, B; Damgaard, G; Dauncey, P D; Davenport, Martyn; Da Silva, W; Deghorain, A; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; Dijkstra, H; Di Ciaccio, Lucia; Di Diodato, A; Djannati, A; Dolbeau, J; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Durand, J D; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Elsing, M; Engel, J P; Erzen, B; Espirito-Santo, M C; Falk, E; Fanourakis, G K; Fassouliotis, D; Feindt, Michael; Fenyuk, A; Ferrari, P; Ferrer, A; Fichet, S; Filippas-Tassos, A; Firestone, A; Fischer, P A; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frodesen, A G; Frühwirth, R; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Gerdyukov, L N; Gokieli, R; Golob, B; Gonçalves, P; Gopal, Gian P; Gorn, L; Górski, M; Guz, Yu; Gracco, Valerio; Graziani, E; Green, C; Grefrath, A; Gris, P; Grosdidier, G; Grzelak, K; Günther, M; Guy, J; Hahn, F; Hahn, S; Hajduk, Z; Hallgren, A; Hamacher, K; Harris, F J; Hedberg, V; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Heuser, J M; Higón, E; Holmgren, S O; Holt, P J; Holthuizen, D J; Hoorelbeke, S; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, C; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, Christian; Juillot, P; Kaiser, M; Kapusta, F; Karafasoulis, K; Karvelas, E; Katsanevas, S; Katsoufis, E C; Keränen, R; Khokhlov, Yu A; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klapp, O; Klein, H; Kluit, P M; Knoblauch, D; Kokkinias, P; Koratzinos, M; Korcyl, K; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Krammer, Manfred; Kreuter, C; Kronkvist, I J; Krumshtein, Z; Krupinski, W; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Laktineh, I; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Laugier, J P; Lauhakangas, R; Leder, Gerhard; Ledroit, F; Lefébure, V; Legan, C K; Leisos, A; Leitner, R; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Lethuillier, M; Libby, J; Liko, D; Lipniacka, A; Lippi, I; Lörstad, B; Loken, J G; López, J M; Loukas, D; Lutz, P; Lyons, L; Naughton, J M; Maehlum, G; Mahon, J R; Maio, A; Malmgren, T G M; Malychev, V; Mandl, F; Marco, J; Marco, R P; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Masik, J; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; McPherson, G; Medbo, J; Meroni, C; Meyer, S; Meyer, W T; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Morettini, P; Müller, H; Münich, K; Mulders, M; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Myklebust, T; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Nawrocki, K; Negri, P; Némécek, S; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Nikolenko, M; Niss, P; Nomerotski, A; Normand, Ainsley; Nygren, A; Oberschulte-Beckmann, W; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Orazi, G; Ortuno, S; Österberg, K; Ouraou, A; Paganini, P; Paganoni, M; Paiano, S; Pain, R; Palka, H; Papadopoulou, T D; Papageorgiou, K; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Pegoraro, M; Peralta, L; Pernegger, H; Pernicka, Manfred; Perrotta, A; Petridou, C; Petrolini, A; Phillips, H T; Piana, G; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Podobrin, O; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Privitera, P; Pukhaeva, N; Pullia, Antonio; Radojicic, D; Ragazzi, S; Rahmani, H; Ratoff, P N; Read, A L; Reale, M; Rebecchi, P; Redaelli, N G; Regler, Meinhard; Reid, D; Reinhardt, R; Renton, P B; Resvanis, L K; Richard, F; Rídky, J; Rinaudo, G; Røhne, O M; Romero, A; Ronchese, P; Roos, L; Rosenberg, E I; Rosinsky, P; Roudeau, Patrick; Rovelli, T; Ruhlmann-Kleider, V; Ruiz, A; Rybicki, K; Saarikko, H; Sacquin, Yu; Sadovskii, A; Sajot, G; Salt, J; Sannino, M; Schneider, H; Schwickerath, U; Schyns, M A E; Sciolla, G; Scuri, F; Seager, P; Sedykh, Yu; Segar, A M; Seitz, A; Sekulin, R L; Serbelloni, L; Shellard, R C; Sheridan, A; Siegrist, P; Silvestre, R; Simonetto, F; Sissakian, A N; Skaali, T B; Smadja, G; Smirnova, O G; Smith, G R; Sokolov, A; Solovyanov, O; Sosnowski, R; Souza-Santos, D; Spassoff, Tz; Spiriti, E; Sponholz, P; Squarcia, S; Stampfer, D; Stanescu, C; Stanic, S; Stapnes, Steinar; Stavitski, I; Stevenson, K; Stocchi, A; Strauss, J; Strub, R; Stugu, B; Szczekowski, M; Szeptycka, M; Tabarelli de Fatis, T; Tavernet, J P; Chernyaev, E; Chikilev, O G; Tegenfeldt, F; Terranova, F; Thomas, J; Tilquin, A; Timmermans, J; Tkatchev, L G; Todorov, T; Todorova, S; Toet, D Z; Tomaradze, A G; Tomé, B; Tonazzo, A; Tortora, L; Tranströmer, G; Treille, D; Tristram, G; Trombini, A; Troncon, C; Tsirou, A L; Turluer, M L; Tyapkin, I A; Tyndel, M; Tzamarias, S; Überschär, B; Ullaland, O; Uvarov, V; Valenti, G; Vallazza, E; Van der Velde, C; van Apeldoorn, G W; van Dam, P; Van Doninck, W K; Van Eldik, J; Van Lysebetten, A; Vassilopoulos, N; Vegni, G; Ventura, L; Venus, W A; Verbeure, F; Verlato, M; Vertogradov, L S; Vilanova, D; Vincent, P; Vitale, L; Vlasov, E; Vodopyanov, A S; Vrba, V; Wahlen, H; Walck, C; Waldner, F; Weiser, C; Wetherell, Alan M; Wicke, D; Wickens, J H; Wielers, M; Wilkinson, G R; Williams, W S C; Winter, M; Witek, M; Wlodek, T; Yi, J; Yip, K; Yushchenko, O P; Zach, F; Zaitsev, A; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zevgolatakos, E; Zimin, N I; Zucchelli, G C; Zumerle, G

    1998-01-01

    A search for neutral and charged Higgs bosons has been performed in the data collected by the {\\sc DELPHI} detector at centre-of-mass energies of 161~GeV and 172~GeV. The analysis assumes either the pair-production of charged Higgs bosons, ${\\mathrm H}^{\\pm}$, or the production of the lightest neutral Higgs boson, h, with either a Z or a neutral pseudoscalar Higgs boson, A. All final state topologies expected from the decay of h and A %neutral Higgs particles into hadrons or a pair of $\\tau$ leptons, and from the decay of ${\\mathrm H}^{\\pm}$ %charged Higgs bosons into a pair of quarks or a $\\tau \

  12. Searches for supersymmetry in the photon(s) plus missing energy channels at $\\sqrt{s}$ = 161 GeV and 172 GeV

    CERN Document Server

    Barate, R.; Decamp, D.; Ghez, Philippe; Goy, C.; Lees, J.P.; Lucotte, A.; Minard, M.N.; Nief, J.Y.; Pietrzyk, B.; Casado, M.P.; Chmeissani, M.; Comas, P.; Crespo, J.M.; Delfino, M.; Fernandez, E.; Fernandez-Bosman, M.; Garrido, L.; Juste, A.; Martinez, M.; Merino, G.; Miquel, R.; Mir, L.M.; Padilla, C.; Park, I.C.; Pascual, A.; Perlas, J.A.; Riu, I.; Sanchez, F.; Colaleo, A.; Creanza, D.; de Palma, M.; Gelao, G.; Iaselli, G.; Maggi, G.; Maggi, M.; Marinelli, N.; Nuzzo, S.; Ranieri, A.; Raso, G.; Ruggieri, F.; Selvaggi, G.; Silvestris, L.; Tempesta, P.; Tricomi, A.; Zito, G.; Huang, X.; Lin, J.; Ouyang, Q.; Wang, T.; Xie, Y.; Xu, R.; Xue, S.; Zhang, J.; Zhang, L.; Zhao, W.; Abbaneo, D.; Alemany, R.; Bazarko, A.O.; Becker, U.; Bright-Thomas, P.; Cattaneo, M.; Cerutti, F.; Dissertori, G.; Drevermann, H.; Forty, R.W.; Frank, M.; Hagelberg, R.; Hansen, J.B.; Harvey, John; Janot, P.; Jost, B.; Kneringer, E.; Lehraus, I.; Mato, P.; Minten, A.; Moneta, L.; Pacheco, A.; Pusztaszeri, J.F.; Ranjard, F.; Rizzo, G.; Rolandi, Gigi; Rousseau, D.; Schlatter, D.; Schmitt, M.; Schneider, O.; Tejessy, W.; Teubert, F.; Tomalin, I.R.; Wachsmuth, H.; Wagner, A.; Ajaltouni, Z.; Barres, A.; Boyer, C.; Falvard, A.; Ferdi, C.; Gay, P.; Guicheney, C.; Henrard, P.; Jousset, J.; Michel, B.; Monteil, S.; Montret, J.C.; Pallin, D.; Perret, P.; Podlyski, F.; Proriol, J.; Rosnet, P.; Rossignol, J.M.; Fearnley, T.; Hansen, J.D.; Hansen, J.R.; Hansen, P.H.; Nilsson, B.S.; Rensch, B.; Waananen, A.; Daskalakis, G.; Kyriakis, A.; Markou, C.; Simopoulou, E.; Vayaki, A.; Blondel, A.; Brient, J.C.; Machefert, F.; Rouge, A.; Rumpf, M.; Valassi, A.; Videau, H.; Boccali, T.; Focardi, E.; Parrini, G.; Zachariadou, K.; Cavanaugh, R.; Corden, M.; Georgiopoulos, C.; Huehn, T.; Jaffe, D.E.; Antonelli, A.; Bencivenni, G.; Bologna, G.; Bossi, F.; Campana, P.; Capon, G.; Casper, D.; Chiarella, V.; Felici, G.; Laurelli, P.; Mannocchi, G.; Murtas, F.; Murtas, G.P.; Passalacqua, L.; Pepe-Altarelli, M.; Curtis, L.; Dorris, S.J.; Halley, A.W.; Knowles, I.G.; Lynch, J.G.; O'Shea, V.; Raine, C.; Scarr, J.M.; Smith, K.; Teixeira-Dias, P.; Thompson, A.S.; Thomson, Evelyn J.; Thomson, F.; Turnbull, R.M.; Buchmuller, O.; Dhamotharan, S.; Geweniger, C.; Graefe, G.; Hanke, P.; Hansper, G.; Hepp, V.; Kluge, E.E.; Putzer, A.; Sommer, J.; Tittel, K.; Werner, S.; Wunsch, M.; Beuselinck, R.; Binnie, D.M.; Cameron, W.; Dornan, P.J.; Girone, M.; Goodsir, S.; Martin, E.B.; Morawitz, P.; Moutoussi, A.; Nash, J.; Sedgbeer, J.K.; Spagnolo, P.; Stacey, A.M.; Williams, M.D.; Ghete, V.M.; Girtler, P.; Kuhn, D.; Rudolph, G.; Betteridge, A.P.; Bowdery, C.K.; Buck, P.G.; Colrain, P.; Crawford, G.; Finch, A.J.; Foster, F.; Hughes, G.; Jones, R.W.L.; Sloan, T.; Whelan, E.P.; Williams, M.I.; Giehl, I.; Hoffmann, C.; Jakobs, K.; Kleinknecht, K.; Quast, G.; Renk, B.; Rohne, E.; Sander, H.G.; van Gemmeren, P.; Zeitnitz, C.; Aubert, J.J.; Benchouk, C.; Bonissent, A.; Bujosa, G.; Carr, J.; Coyle, P.; Diaconu, C.; Ealet, A.; Fouchez, D.; Konstantinidis, N.; Leroy, O.; Motsch, F.; Payre, P.; Talby, M.; Sadouki, A.; Thulasidas, M.; Tilquin, A.; Trabelsi, K.; Aleppo, M.; Antonelli, M.; Ragusa, F.; Berlich, R.; Blum, W.; Buescher, Volker; Dietl, H.; Ganis, G.; Gotzhein, C.; Kroha, H.; Lutjens, G.; Lutz, G.; Manner, W.; Moser, H.G.; Richter, Robert, 1; Rosado-Schlosser, A.; Schael, S.; Settles, R.; Seywerd, H.; St. Denis, Richard Dante; Stenzel, H.; Wiedenmann, W.; Wolf, G.; Boucrot, J.; Callot, O.; Chen, S.; Cordier, A.; Davier, M.; Duflot, L.; Grivaz, J.F.; Heusse, Ph.; Hocker, Andreas; Jacholkowska, A.; Jacquet, M.; Kim, D.W.; Le Diberder, F.; Lefrancois, J.; Lutz, A.M.; Nikolic, Irina; Schune, M.H.; Serin, L.; Simion, S.; Tournefier, E.; Veillet, J.J.; Videau, I.; Zerwas, D.; Azzurri, P.; Bagliesi, Giuseppe; Bettarini, S.; Bozzi, C.; Calderini, G.; Ciulli, V.; Dell'Orso, R.; Fantechi, R.; Ferrante, I.; Giassi, A.; Gregorio, A.; Ligabue, F.; Lusiani, A.; Marrocchesi, P.S.; Messineo, A.; Palla, F.; Sanguinetti, G.; Sciaba, A.; Sguazzoni, G.; Steinberger, J.; Tenchini, R.; Vannini, C.; Venturi, A.; Verdini, P.G.; Blair, G.A.; Bryant, L.M.; Chambers, J.T.; Gao, Y.; Green, M.G.; Medcalf, T.; Perrodo, P.; Strong, J.A.; von Wimmersperg-Toeller, J.H.; Botterill, D.R.; Clifft, R.W.; Edgecock, T.R.; Haywood, S.; Maley, P.; Norton, P.R.; Thompson, J.C.; Wright, A.E.; Bloch-Devaux, Brigitte; Colas, P.; Fabbro, B.; Kozanecki, W.; Lancon, E.; Lemaire, M.C.; Locci, E.; Perez, P.; Rander, J.; Renardy, J.F.; Rosowsky, A.; Roussarie, A.; Schuller, J.P.; Schwindling, J.; Trabelsi, A.; Vallage, B.; Black, S.N.; Dann, J.H.; Kim, H.Y.; Litke, A.M.; McNeil, M.A.; Taylor, G.; Booth, C.N.; Boswell, R.; Brew, C.A.J.; Cartwright, S.; Combley, F.; Kelly, M.S.; Lehto, M.; Newton, W.M.; Reeve, J.; Thompson, L.F.; Affholderbach, K.; Boehrer, Armin; Brandt, S.; Cowan, G.; Foss, J.; Grupen, C.; Lutters, G.; Saraiva, P.; Smolik, L.; Stephan, F.; Apollonio, M.; Bosisio, L.; Della Marina, R.; Giannini, G.; Gobbo, B.; Musolino, G.; Putz, J.; Rothberg, J.; Wasserbaech, S.; Williams, R.W.; Armstrong, S.R.; Charles, E.; Elmer, P.; Ferguson, D.P.S.; Gonzalez, S.; Greening, T.C.; Hayes, O.J.; Hu, H.; Jin, S.; McNamara, P.A., III; Nachtman, J.M.; Nielsen, J.; Orejudos, W.; Pan, Y.B.; Saadi, Y.; Scott, I.J.; Walsh, J.; Wu, Sau Lan; Wu, X.; Yamartino, J.M.; Zobernig, G.

    1998-01-01

    Searches for supersymmetric particles in channels with one or more photons and missing energy have been performed with data collected by the ALEPH detector at LEP. The data consist of 11.1 \\pb\\ at $\\sqrt{s} = 161 ~\\, \\rm GeV$, 1.1 \\pb\\ at 170 \\gev\\ and 9.5 \\pb\\ at 172 GeV. The \\eenunu\\ cross se ction is measured. The data are in good agreement with predictions based on the Standard Model, and are used to set upper limits on the cross sections for anomalous photon production. These limits are compared to two different SUSY models and used to set limits on the neutralino mass. A limit of 71 \\gevsq\\ at 95\\% C.L. is set on the mass of the lightest neutralin o ($\\tau_{\\chi_{1}^{0}} \\leq $ 3 ns) for the gauge-mediated supersymmetry breaking and LNZ models.

  13. Ricerca di chargini a 130 GeV < $\\sqrt{s}$ < 161 GeV, con l'esperimento L3 al LEP

    CERN Document Server

    Giagu, S

    1997-01-01

    The subject of this work is the search for charginos with the L3 detector at LEP, using the data collected by L3 during the years 1995-1996 at center of mass energies $130 GeV < \\sqrt{s} < 161 GeV$. In the thesis are described the design and realization of a new Monte Carlo generator (DFGT) for chargiNO1production and decay at $e^+e^-$ colliders, which is based on the evaluation of the full matrix elements of the process, and the realization and the results of two analysis, one cuts based conventional analysis, and a new and more advanced one based on the EPDE multivariate method. The results of this search are also compared with the predictions of the CMSSM model to obtain esclusion limits on the model parameters space and mass limits on charginos.

  14. Influence of Europium Doping on Various Electrical Properties of Low-Temperature Sintered 0.5Ba0.90Ca0.10TiO3-0.5BaTi0.88Zr0.12O3-0.1%CuO- xEu Lead-Free Ceramics

    Science.gov (United States)

    Tian, Yongshang; Li, Shuiyun; Sun, Shulin; Gong, Yansheng; Li, Tiantian; Yu, Yongshang; Jing, Qiangshan

    2018-01-01

    0.5Ba0.90Ca0.10TiO3-0.5BaTi0.88Zr0.12O3-0.1%CuO- xEu (BCT-BZT-Cu- xEu; x = 0-0.90%) lead-free ceramics were sintered at 1220°C with as-synthesized nanoparticles by a modified Pechini method. The structural characteristics and electrical properties of the ceramics that were influenced by varying europium-doping were investigated. All the ceramics featured high densification (relative density: ˜ 96%). X-ray powder diffraction results indicated the samples possessed pure orthorhombic phase. The maximum relative permittivity ( ɛ r, 10869) was found at x around 0.30%. Europium ions could dope on different substitution sites in the ABO3 lattice, which evidently influenced electrical properties with various volumes of oxygen vacancy. Moreover, the formation mechanisms of oxygen vacancy and defect electron complexes were stated. The piezoelectric properties were impacted by defect electron complexes, internal stress, ionic electronegativity, etc. The optimal electrical properties, i.e., d 33 = 384 pC/N, Q m = 92, and k p = 0.36, were detected at x = 0.45%.

  15. Determination of the stability constants of lanthanum, praseodymium, europium, erbium and lutetium complexes with chloride ions; Determinacion de las constantes de estabilidad de los complejos de lantano, praseodimio, europio, erbio y lutecio con iones cloruro

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez R, E. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2008-07-01

    The stability constants of La{sup 3+}, Pr{sup 3+}, Eu{sup 3+}, Er{sup 3+} and Lu{sup 3+} chloride complexes were determined in perchloric acid media using a liquid-liquid extraction method. The dinonyl napthalene sulfonic acid in n-heptane was used as extractant. The lanthanide (Ln) concentrations were measured by a radiochemical (Eu and Lu) and a spectrophotometric (La, Pr, and Er) methods. In the last method, xylenol orange was used for the determinations at ph 6. The stability constants of lanthanum, praseodymium, erbium and lutetium chloride complexes were determined in 2, 3 and 4 M ionic strength and europium in 1, 2 and 3 M, at 303 K. The fitting of experimental data to the equations for the calculation of the stability constants, was carry out considering both one chemical species (LnCl{sup 2+}) or two chemical species (LnCl{sup 2+} and LnCl{sub 2}{sup +}). The Specific Ion Interaction Theory was applied to the values of log {beta}{sup I}{sub Ln},{sub Cl} and the first stability constants at zero ionic strength were calculated by extrapolation. The same theory could not be applied to the log {beta}{sup I}{sub Ln},{sub 2Cl}, due to its low abundance and the values determined for the stability constants were similar. The distribution diagrams of the chemical species were obtained using the program MEDUSA and considering log {beta}{sup I}{sub Ln},{sub CI}, log {beta}{sup I}{sub Ln},{sub 2CI} values obtained in this work and the hydrolysis constants taken from the literature. The lanthanide chloride complexes are present in solution at specific conditions of ionic strength, concentration and in the absence of hydrolysis. The log {beta}{sup I}{sub Ln},{sub Cl} data were related to the charge density and the corresponding equations were obtained. These equations could be used to determine the stability constants along the lanthanide series. (Author)

  16. Measurement of the Mass and Width of the W Boson in $e^{+}e^{-}$ Collisions at $\\sqrt{s}$ = 161 - 209 GeV

    CERN Document Server

    Abdallah, J.; Adam, W.; Adzic, P.; Albrecht, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P.P.; Amaldi, U.; Amapane, N.; Amato, Sandra F.; Anashkin, E.; Andreazza, A.; Andringa, Sofia; Anjos, N.; Antilogus, Pierre; Apel, W-D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, Jean-Eudes; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.J.; Baroncelli, Antonio; Battaglia, Marco; Baubillier, M.; Becks, K-H.; Begalli, M.; Behrmann, A.; Ben-Haim, Eli; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, Mikael; Bertrand, D.; Besancon, Marc; Besson, N.; Bloch, Daniel; Blom, M.; Bluj, Michal; Bonesini, Maurizio; Boonekamp, M.; Booth, PSL; Borisov, G.; Botner, Olga; Bouquet, B.; Bowcock, T.J.V.; Boyko, I.; Bracko, Marko; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J.M.; Buschbeck, B.; Buschmann, P.; Calvi, M.; Camporesi, Tiziano; Canale, V.; Carena, F.; Castro, Nuno Filipe; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Checchia, Paolo; Chierici, R.; Chliapnikov, P.; Chudoba, J.; Chung, Suh-Urk; Cieslik, K.; Collins, P.; Contri, Roberto; Cosme, G.; Cossutti, Fabio; Costa, M.J.; Crennell, D.; Cuevas, Javier; D'Hondt, J.; da Silva, T.; Da Silva, W.; Della Ricca, Giuseppe; De Angelis, Alessandro; De Boer, W.; De Clercq, C.; De Lotto, Barbara; De Maria, N.; De Min, A.; de Paula, L.; Di Ciaccio, L.; Di Simone, A.; Doroba, K.; Duperrin, A.; Eigen, G.; Ekelof, Tord; Ellert, Mattias; Elsing, M.; Espirito Santo, Maria Catarina; Fanourakis, George K.; Feindt, Michael; Fernandez, J.; Ferrer, Antonio; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, Miriam; Garcia, C.; Gavillet, Philippe; Gazis, Evangelos; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, Klaus; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, Vincent; Hennecke, M.; Herr, H.; Hoffman, J.; Holmgren, S-O.; Holt, P.J.; Houlden, M.A.; Jackson, John Neil; Jarlskog, Goran; Jarry, P.; Jeans, D.; Johansson, Erik Karl; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, Frederic; Katsanevas, S.; Katsoufis, E.; Kernel, Gabrijel; Kerzel, U.; King, B.T.; Kjaer, N.J.; Kluit, Peter; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, F.; Leinonen, L.; Leitner, R.; Lemonne, Jacques; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J.H.; Lopez, J.M.; Loukas, D.; Lutz, Pierre; Lyons, Louis; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J-C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; Nulty, R.Mc; Meroni, C.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Muller, Ulrich; Muenich, K.; Mulders, M.; Mundim Filho, Luiz Martins; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nicolaidou, R.; Oblakowska-Mucha, A.; Obraztsov, V.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J.P.; Palka, Henryk; Papadopoulou, Th.D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, Andrea; Petrolini, Alessandro; Piedra, Jonatan; Pieri, L.; Pierre, Francois; Pimenta, M.; Piotto, E.; Poireau, V.; Pol, M.E.; Polok, G.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Radojicic, D.; Rames, J.; Read, A.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, Peter; Richard, F.; Ridky, Jan; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, Paolo; Roudeau, P.; Rovelli, T.; Ruhlmann, Vanina; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Sander, C.; Savoy-Navarro, A.; Schwickerath, U.; Segar, A.; Sekulin, R.; Siebel, Martin; Simard, L.; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, Andrei Valerevich; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli de Fatis, T.; Taffard, A.C.; Tegenfeldt, F.; Thomas, J.; Timmermans, Jan; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, Petr; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, Clara; Turluer, M-L.; Tyapkin, I.A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, Giovanni; Van Dam, P.; Van Eldik, J.; van Remortel, N.; Van Vulpen, I.; Vegni, G.; Veloso, Filipe; Venus, W.; Verdier, Patrice; Verzi, V.; Vilanova, D.; Vitale, Lorenzo; Vrba, V.; Wahlen, H.; Washbrook, A.J.; Weiser, C.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, Danilo; Zhuravlov, V.; Zimine, N.I.; Zintchenko, Alexandre

    2008-01-01

    A measurement of the W boson mass and width has been performed by the DELPHI collaboration using the data collected during the full LEP2 programme (1996-2000). The data sample has an integrated luminosity of 660 pb^-1 and was collected over a range of centre-of-mass energies from 161 to 209 GeV. Results are obtained by applying the method of direct reconstruction of the mass of the W from its decay products in both the W+W- -> lvqq and W+W- -> qqqq channels. The W mass result for the combined data set is M_W = 80.336 +/- 0.055 (Stat.) +/- 0.028 (Syst.) +/- 0.025 (FSI) +/- 0.009 (LEP) GeV/c^2, where FSI represents the uncertainty due to final state interaction effects in the qqqq channel, and LEP represents that arising from the knowledge of the collision energy of the accelerator. The combined value for the W width is Gamma_W = 2.404 +/- 0.140 (Stat.) +/- 0.077 (Syst.) +/- 0.065 (FSI) GeV/c^2. These results supersede all values previously published by the DELPHI collaboration. This paper is dedicated to the m...

  17. Prognostic value of CT findings to predict survival outcomes in patients with pancreatic neuroendocrine neoplasms: a single institutional study of 161 patients

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Wook; Kim, Hyoung Jung; Kim, Kyung Won; Byun, Jae Ho; Kim, So Yeon [University of Ulsan College of Medicine, Department of Radiology and Research Institute of Radiology, Asan Medical Center, Seoul (Korea, Republic of); Song, Ki Byung [University of Ulsan College of Medicine, Department of Surgery, Asan Medical Center, Seoul (Korea, Republic of); Ramaiya, Nikhil H.; Tirumani, Sree Harsha [Harvard Medical School, Department of Imaging, Dana-Farber Cancer Institute, Brigham and Women' s Hospital, Boston, MA (United States); Hong, Seung-Mo [University of Ulsan College of Medicine, Department of Pathology, Asan Medical Center, Seoul (Korea, Republic of)

    2016-05-15

    To evaluate the prognostic value of CT to predict recurrence-free and overall survival in patients with pancreatic neuroendocrine neoplasms (PanNENs). Between January 2004 and December 2012, 161 consecutive patients who underwent preoperative triphasic CT and surgical resection with curative intent for PanNENs were identified. The tumour consistency, margin, presence of calcification, pancreatic duct dilatation, bile duct dilatation, vascular invasion, and hepatic metastases were evaluated. The tumour size, arterial enhancement ratio, and portal enhancement ratio were measured. The Cox proportional hazard model was used to determine the association between CT features and recurrence-free survival and overall survival. By multivariate analysis, tumour size (>3 cm) (hazard ratio, 3.314; p = 0.006), portal enhancement ratio (≤1.1) (hazard ratio, 2.718; p = 0.006), and hepatic metastases (hazard ratio, 4.374; p = 0.003) were independent significant variables for worse recurrence-free survival. Portal enhancement ratio (≤1.1) (hazard ratio, 5.951; p = 0.001) and hepatic metastases (hazard ratio, 4.122; p = 0.021) were independent significant variables for worse overall survival. Portal enhancement ratio (≤1.1) and hepatic metastases assessed on CT were common independent prognostic factors for worse recurrence-free survival and overall survival in patients with PanNENs. (orig.)

  18. An Intronic SINE insertion in FAM161A that causes exon-skipping is associated with progressive retinal atrophy in Tibetan Spaniels and Tibetan Terriers.

    Directory of Open Access Journals (Sweden)

    Louise M Downs

    Full Text Available Progressive retinal atrophy (PRA in dogs is characterised by the degeneration of the photoreceptor cells of the retina, resulting in vision loss and eventually complete blindness. The condition affects more than 100 dog breeds and is known to be genetically heterogeneous between breeds. Around 19 mutations have now been identified that are associated with PRA in around 49 breeds, but for the majority of breeds the mutation(s responsible have yet to be identified. Using genome-wide association with 22 Tibetan Spaniel PRA cases and 10 controls, we identified a novel PRA locus, PRA3, on CFA10 (p(raw = 2.01 × 10(-5, p(genome = 0.014, where a 3.8 Mb region was homozygous within 12 cases. Using targeted next generation sequencing, a short interspersed nuclear element insertion was identified near a splice acceptor site in an intron of a provocative gene, FAM161A. Analysis of mRNA from an affected dog revealed that the SINE causes exon skipping, resulting in a frame shift, leading to a downstream premature termination codon and possibly a truncated protein product. This mutation segregates with the disease in 22 out of 35 cases tested (63%. Of the PRA controls, none are homozygous for the mutation, 15% carry the mutation and 85% are homozygous wildtype. This mutation was also identified in Tibetan Terriers, although our results indicate that PRA is genetically heterogeneous in both Tibetan Spaniels and Tibetan Terriers.

  19. Antimicrobial activity in the egg wax of the tick Amblyomma hebraeum (Acari: Ixodidae) is associated with free fatty acids C16:1 and C18:2.

    Science.gov (United States)

    Yu, Zhijun; Thomson, Euan L S; Liu, Jingze; Dennis, Jonathan J; Jacobs, René L; Kaufman, W Reuben

    2012-12-01

    Untreated eggs of the tick Amblyomma hebraeum Koch (Acari: Ixodidae) exhibited antimicrobial activity (AMA) against Gram-negative but not Gram-positive bacteria; eggs denuded of wax by solvent extraction showed no AMA. The unfractionated egg wax extract, however, showed AMA against Gram-positive but not Gram-negative bacteria, as also shown by Arrieta et al. (Exp Appl Acarol 39: 297-313, 2006). In this study we partitioned the egg wax into various fractions, using a variety of techniques, analyzed their compositions, and tested them for AMA. The crude aqueous extract exhibited AMA. However, although more than 30 metabolites were identified in this extract by nuclear magnetic resonance analysis, none of them seemed likely to be responsible for the observed AMA. In the crude organic extract, cholesterol esters were the most abundant lipids, but were devoid of AMA. Fatty acids (FAs), with chain lengths between C13 and C26 were the next most abundant lipids. After lipid fractionation and gas chromatography/mass spectroscopy, free FAs, especially C16:1 and C18:2, accounted for most of the AMA in the organic extract. The material responsible for AMA in the crude aqueous extract remains unidentified. No AMA was detected in the intracellular contents of untreated eggs.

  20. The parable of the shrewd manager (Lk 16:1–8: A biography of Jesus and a lesson on mercy

    Directory of Open Access Journals (Sweden)

    Dieter H. Reinstorf

    2013-05-01

    Full Text Available Many scholars have regarded the parable of the shrewd manager (Lk 16:1–8 as the most puzzling of all parables as Jesus seems to use the unrighteous actions of a dishonest (worldly manager as a model for emulation by others. The unease associated with this understanding was managed in part by focusing almost exclusively on the ‘shrewdness’ of the dishonest manager. In this interpretation, it is not his unjust behaviour that is to be imitated but his wise and intelligent actions. This interpretation has led to a divergence of applications regarding the ‘property’ that was entrusted to him. The author, however, argues that, in the context of the historical Jesus, the entrusted property in the parable references first and foremost the Torah entrusted to God’s people and that the manager mirrors the life of Jesus, who was ‘accused’ by the religious leaders of being unjust. Despite being threatened, he continued unabatedly to scatter God’s mercy, epitomised by the reduction of debt and symbolising the dawning of God’s Kingdom. The manager is therefore not a negative figure but a positive (diaphorical example of what it means to be a faithful manager of God in the light of adversary and opposition.