Molecular Phylogenetics: Concepts for a Newcomer.
Ajawatanawong, Pravech
Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.
Molecular Phylogenetics: Mathematical Framework and Unsolved Problems
Xia, Xuhua
Phylogenetic relationship is essential in dating evolutionary events, reconstructing ancestral genes, predicting sites that are important to natural selection, and, ultimately, understanding genomic evolution. Three categories of phylogenetic methods are currently used: the distance-based, the maximum parsimony, and the maximum likelihood method. Here, I present the mathematical framework of these methods and their rationales, provide computational details for each of them, illustrate analytically and numerically the potential biases inherent in these methods, and outline computational challenges and unresolved problems. This is followed by a brief discussion of the Bayesian approach that has been recently used in molecular phylogenetics.
TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics
Directory of Open Access Journals (Sweden)
von Haeseler Arndt
2004-06-01
Full Text Available Abstract Background Most analysis programs for inferring molecular phylogenies are difficult to use, in particular for researchers with little programming experience. Results TREEFINDER is an easy-to-use integrative platform-independent analysis environment for molecular phylogenetics. In this paper the main features of TREEFINDER (version of April 2004 are described. TREEFINDER is written in ANSI C and Java and implements powerful statistical approaches for inferring gene tree and related analyzes. In addition, it provides a user-friendly graphical interface and a phylogenetic programming language. Conclusions TREEFINDER is a versatile framework for analyzing phylogenetic data across different platforms that is suited both for exploratory as well as advanced studies.
Molecular phylogenetics and historical biogeography of Rhinolophus bats.
Stoffberg, Samantha; Jacobs, David S; Mackie, Iain J; Matthee, Conrad A
2010-01-01
The phylogenetic relationships within the horseshoe bats (genus Rhinolophus) are poorly resolved, particularly at deeper levels within the tree. We present a better-resolved phylogenetic hypothesis for 30 rhinolophid species based on parsimony and Bayesian analyses of the mitochondrial cytochrome b gene and three nuclear introns (TG, THY and PRKC1). Strong support was found for the existence of two geographic clades within the monophyletic Rhinolophidae: an African group and an Oriental assemblage. The relaxed Bayesian clock method indicated that the two rhinolophid clades diverged approximately 35 million years ago and results from Dispersal Vicariance (DIVA) analysis suggest that the horseshoe bats arose in Asia and subsequently dispersed into Europe and Africa.
Molecular characterization and phylogenetic relationships among ...
African Journals Online (AJOL)
Molecular characterization and phylogenetic relationships among and within species of Phalaenopsis (Epidendroideae: Orchidaceae) based on RAPD analysis. ... Ph. parishii, Ph. labbi nepal, Ph. speciosa, Ph. lobbi yellow, Ph. venosa, Ph. hieroglyphica, and Ph. maculata; the third group consisted of Ph. minho princess, ...
Molecular phylogenetics of mastodon and Tyrannosaurus rex.
Organ, Chris L; Schweitzer, Mary H; Zheng, Wenxia; Freimark, Lisa M; Cantley, Lewis C; Asara, John M
2008-04-25
We report a molecular phylogeny for a nonavian dinosaur, extending our knowledge of trait evolution within nonavian dinosaurs into the macromolecular level of biological organization. Fragments of collagen alpha1(I) and alpha2(I) proteins extracted from fossil bones of Tyrannosaurus rex and Mammut americanum (mastodon) were analyzed with a variety of phylogenetic methods. Despite missing sequence data, the mastodon groups with elephant and the T. rex groups with birds, consistent with predictions based on genetic and morphological data for mastodon and on morphological data for T. rex. Our findings suggest that molecular data from long-extinct organisms may have the potential for resolving relationships at critical areas in the vertebrate evolutionary tree that have, so far, been phylogenetically intractable.
Applying phylogenetic analysis to viral livestock diseases: moving beyond molecular typing.
Olvera, Alex; Busquets, Núria; Cortey, Marti; de Deus, Nilsa; Ganges, Llilianne; Núñez, José Ignacio; Peralta, Bibiana; Toskano, Jennifer; Dolz, Roser
2010-05-01
Changes in livestock production systems in recent years have altered the presentation of many diseases resulting in the need for more sophisticated control measures. At the same time, new molecular assays have been developed to support the diagnosis of animal viral disease. Nucleotide sequences generated by these diagnostic techniques can be used in phylogenetic analysis to infer phenotypes by sequence homology and to perform molecular epidemiology studies. In this review, some key elements of phylogenetic analysis are highlighted, such as the selection of the appropriate neutral phylogenetic marker, the proper phylogenetic method and different techniques to test the reliability of the resulting tree. Examples are given of current and future applications of phylogenetic reconstructions in viral livestock diseases. Copyright 2009 Elsevier Ltd. All rights reserved.
Phylogenetic molecular function annotation
International Nuclear Information System (INIS)
Engelhardt, Barbara E; Jordan, Michael I; Repo, Susanna T; Brenner, Steven E
2009-01-01
It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic approach for predicting molecular function (sometimes called 'phylogenomics') is an effective means to predict protein molecular function. These methods incorporate functional evidence from all members of a family that have functional characterizations using the evolutionary history of the protein family to make robust predictions for the uncharacterized proteins. However, they are often difficult to apply on a genome-wide scale because of the time-consuming step of reconstructing the phylogenies of each protein to be annotated. Our automated approach for function annotation using phylogeny, the SIFTER (Statistical Inference of Function Through Evolutionary Relationships) methodology, uses a statistical graphical model to compute the probabilities of molecular functions for unannotated proteins. Our benchmark tests showed that SIFTER provides accurate functional predictions on various protein families, outperforming other available methods.
A phylogenetic study of Boletus section Boletus in Europe
Beugelsdijk, D.C.M.; Linde, van der S.; Zuccarello, G.C.; Bakker, den H.C.
2008-01-01
A phylogenetic study of the species in Boletus sect. Boletus was undertaken using the molecular markers ITS1-5.8S-ITS2 and Gap dh. Four well-supported lineages, one comprising Boletus edulis s.l., the others referring to B. aereus, B. reticulatus and B. pinophilus have been distinguished. The ML and
Molecular identification and phylogenetic study of Demodex caprae.
Zhao, Ya-E; Cheng, Juan; Hu, Li; Ma, Jun-Xian
2014-10-01
The DNA barcode has been widely used in species identification and phylogenetic analysis since 2003, but there have been no reports in Demodex. In this study, to obtain an appropriate DNA barcode for Demodex, molecular identification of Demodex caprae based on mitochondrial cox1 was conducted. Firstly, individual adults and eggs of D. caprae were obtained for genomic DNA (gDNA) extraction; Secondly, mitochondrial cox1 fragment was amplified, cloned, and sequenced; Thirdly, cox1 fragments of D. caprae were aligned with those of other Demodex retrieved from GenBank; Finally, the intra- and inter-specific divergences were computed and the phylogenetic trees were reconstructed to analyze phylogenetic relationship in Demodex. Results obtained from seven 429-bp fragments of D. caprae showed that sequence identities were above 99.1% among three adults and four eggs. The intraspecific divergences in D. caprae, Demodex folliculorum, Demodex brevis, and Demodex canis were 0.0-0.9, 0.5-0.9, 0.0-0.2, and 0.0-0.5%, respectively, while the interspecific divergences between D. caprae and D. folliculorum, D. canis, and D. brevis were 20.3-20.9, 21.8-23.0, and 25.0-25.3, respectively. The interspecific divergences were 10 times higher than intraspecific ones, indicating considerable barcoding gap. Furthermore, the phylogenetic trees showed that four Demodex species gathered separately, representing independent species; and Demodex folliculorum gathered with canine Demodex, D. caprae, and D. brevis in sequence. In conclusion, the selected 429-bp mitochondrial cox1 gene is an appropriate DNA barcode for molecular classification, identification, and phylogenetic analysis of Demodex. D. caprae is an independent species and D. folliculorum is closer to D. canis than to D. caprae or D. brevis.
Molecular Epidemiology of Canine Parvovirus, Europe
Desario, Costantina; Addie, Diane D.; Martella, Vito; Vieira, Maria João; Elia, Gabriella; Zicola, Angelique; Davis, Christopher; Thompson, Gertrude; Thiry, Ethienne; Truyen, Uwe; Buonavoglia, Canio
2007-01-01
Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed that the new variant CPV-2c is widespread in Europe and that the viruses are distributed in different countries. PMID:17953097
Skaljac, Marisa; Kanakala, Surapathrudu; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad
2017-01-01
Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts dete...
Molecular phylogenetics of porcini mushrooms (Boletus section Boletus).
Dentinger, Bryn T M; Ammirati, Joseph F; Both, Ernst E; Desjardin, Dennis E; Halling, Roy E; Henkel, Terry W; Moreau, Pierre-Arthur; Nagasawa, Eiji; Soytong, Kasem; Taylor, Andy F; Watling, Roy; Moncalvo, Jean-Marc; McLaughlin, David J
2010-12-01
Porcini (Boletus section Boletus: Boletaceae: Boletineae: Boletales) are a conspicuous group of wild, edible mushrooms characterized by fleshy fruiting bodies with a poroid hymenophore that is "stuffed" with white hyphae when young. Their reported distribution is with ectomycorrhizal plants throughout the Northern Hemisphere. Little progress has been made on the systematics of this group using modern molecular phylogenetic tools because sampling has been limited primarily to European species and the genes employed were insufficient to resolve the phylogeny. We examined the evolutionary history of porcini by using a global geographic sampling of most known species, new discoveries from little explored areas, and multiple genes. We used 78 sequences from the fast-evolving nuclear internal transcribed spacers and are able to recognize 18 reciprocally monophyletic species. To address whether or not porcini form a monophyletic group, we compiled a broadly sampled dataset of 41 taxa, including other members of the Boletineae, and used separate and combined phylogenetic analysis of sequences from the nuclear large subunit ribosomal DNA, the largest subunit of RNA polymerase II, and the mitochondrial ATPase subunit six gene. Contrary to previous studies, our separate and combined phylogenetic analyses support the monophyly of porcini. We also report the discovery of two taxa that expand the known distribution of porcini to Australia and Thailand and have ancient phylogenetic connections to the rest of the group. A relaxed molecular clock analysis with these new taxa dates the origin of porcini to between 42 and 54 million years ago, coinciding with the initial diversification of angiosperms, during the Eocene epoch when the climate was warm and humid. These results reveal an unexpected diversity, distribution, and ancient origin of a group of commercially valuable mushrooms that may provide an economic incentive for conservation and support the hypothesis of a tropical
Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R
2014-01-01
Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.
phylo-node: A molecular phylogenetic toolkit using Node.js.
O'Halloran, Damien M
2017-01-01
Node.js is an open-source and cross-platform environment that provides a JavaScript codebase for back-end server-side applications. JavaScript has been used to develop very fast and user-friendly front-end tools for bioinformatic and phylogenetic analyses. However, no such toolkits are available using Node.js to conduct comprehensive molecular phylogenetic analysis. To address this problem, I have developed, phylo-node, which was developed using Node.js and provides a stable and scalable toolkit that allows the user to perform diverse molecular and phylogenetic tasks. phylo-node can execute the analysis and process the resulting outputs from a suite of software options that provides tools for read processing and genome alignment, sequence retrieval, multiple sequence alignment, primer design, evolutionary modeling, and phylogeny reconstruction. Furthermore, phylo-node enables the user to deploy server dependent applications, and also provides simple integration and interoperation with other Node modules and languages using Node inheritance patterns, and a customized piping module to support the production of diverse pipelines. phylo-node is open-source and freely available to all users without sign-up or login requirements. All source code and user guidelines are openly available at the GitHub repository: https://github.com/dohalloran/phylo-node.
Molecular evidence on the evolutionary and biogeographical patterns of European cyprinids.
Zardoya, R; Doadrio, I
1999-08-01
The phylogenetic relationships of 106 European cyprinid taxa were determined based on the complete nucleotide sequence (1140 bp) of the mitochondrial cytochrome b gene. The molecular phylogeny was used (1) to revise the current systematics of European cyprinids, (2) to establish the phylogenetic utility of traditional morphological characters that are widely used in Cyprinidae systematics, and (3) to discuss alternative hypotheses on the biogeography of the family in Europe. The age of the major lineages within European cyprinids was tentatively estimated with a molecular clock and showed full agreement with the fossil record of the group. Moreover, the results provided unambiguous evidence for a close phylogenetic affinity of some Caucasian and Greek endemic cyprinid taxa (e.g., B. capito and B. brachycephalus and Leuciscus keadicus, Barbus graecus, and B. albanicus, respectively) to Iberian and North African, but not Central European, cyprinids. The existence of such unexpected phylogenetic relationships refutes the classical hypothesis on the biogeography of European cyprinids, which assumes a dispersal of the cyprinid fauna from central Europe to southern Europe and northern Africa during the Miocene (and, hence, predicts a close phylogenetic relationship of all Caucasian, Greek, Iberian, and North African cyprinids to central European taxa). Instead, the existence of a Mediterranean realm independent of the central European route seems plausible based on the molecular evidence. It is likely that the new biogeographical scenario proposed here might apply to other primary freshwater European animals with low dispersal abilities, including fish, amphibians, and invertebrates.
Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards.
Erens, Jesse; Miralles, Aurélien; Glaw, Frank; Chatrou, Lars W; Vences, Miguel
2017-02-01
Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the subfamily Scincinae based on an extended molecular dataset comprising 8060bp from three mitochondrial and nine nuclear loci. Our analysis also increases taxon sampling of the genus Amphiglossus by including 16 out of 25 nominal species. Additionally, we examined whether the molecular phylogenetic patterns coincide with morphological differentiation in the species currently assigned to this genus. Various methods of inference recover a mostly strongly supported phylogeny with three main clades of Amphiglossus. However, relationships among these three clades and the limb-reduced genera Grandidierina, Voeltzkowia and Pygomeles remain uncertain. Supported by a variety of morphological differences (predominantly related to the degree of body elongation), but considering the remaining phylogenetic uncertainty, we propose a redefinition of Amphiglossus into three different genera (Amphiglossus sensu stricto, Flexiseps new genus, and Brachyseps new genus) to remove the non-monophyly of Amphiglossus sensu lato and to facilitate future studies on this fascinating group of lizards. Copyright © 2016 Elsevier Inc. All rights reserved.
Molecular and phylogenetic analysis of HIV-1 variants circulating in Italy
Directory of Open Access Journals (Sweden)
Sbreglia Costanza
2008-10-01
Full Text Available Abstract Objective The continuous identification of HIV-1 non-B subtypes and recombinant forms in Italy indicates the need of constant molecular epidemiology survey of genetic forms circulating and transmitted in the resident population. Methods The distribution of HIV-1 subtypes has been evaluated in 25 seropositive individuals residing in Italy, most of whom were infected through a sexual route during the 1995–2005 period. Each sample has been characterized by detailed molecular and phylogenetic analyses. Results 18 of the 25 samples were positive at HIV-1 PCR amplification. Three samples showed a nucleotide divergence compatible with a non-B subtype classification. The phylogenetic analysis, performed on both HIV-1 env and gag regions, confirms the molecular sub-typing prediction, given that 1 sample falls into the C subtype and 2 into the G subtype. The B subtype isolates show high levels of intra-subtype nucleotide divergence, compatible with a long-lasting epidemic and a progressive HIV-1 molecular diversification. Conclusion The Italian HIV-1 epidemic is still mostly attributable to the B subtype, regardless the transmission route, which shows an increasing nucleotide heterogeneity. Heterosexual transmission and the interracial blending, however, are slowly introducing novel HIV-1 subtypes. Therefore, a molecular monitoring is needed to follow the constant evolution of the HIV-1 epidemic.
Phylogenetic Framework and Molecular Signatures for the Main Clades of the Phylum Actinobacteria
Gao, Beile
2012-01-01
Summary: The phylum Actinobacteria harbors many important human pathogens and also provides one of the richest sources of natural products, including numerous antibiotics and other compounds of biotechnological interest. Thus, a reliable phylogeny of this large phylum and the means to accurately identify its different constituent groups are of much interest. Detailed phylogenetic and comparative analyses of >150 actinobacterial genomes reported here form the basis for achieving these objectives. In phylogenetic trees based upon 35 conserved proteins, most of the main groups of Actinobacteria as well as a number of their superageneric clades are resolved. We also describe large numbers of molecular markers consisting of conserved signature indels in protein sequences and whole proteins that are specific for either all Actinobacteria or their different clades (viz., orders, families, genera, and subgenera) at various taxonomic levels. These signatures independently support the existence of different phylogenetic clades, and based upon them, it is now possible to delimit the phylum Actinobacteria (excluding Coriobacteriia) and most of its major groups in clear molecular terms. The species distribution patterns of these markers also provide important information regarding the interrelationships among different main orders of Actinobacteria. The identified molecular markers, in addition to enabling the development of a stable and reliable phylogenetic framework for this phylum, also provide novel and powerful means for the identification of different groups of Actinobacteria in diverse environments. Genetic and biochemical studies on these Actinobacteria-specific markers should lead to the discovery of novel biochemical and/or other properties that are unique to different groups of Actinobacteria. PMID:22390973
Martínez-Aquino, Andrés; Vidal-Martínez, Victor M; Aguirre-Macedo, M Leopoldina
2017-01-01
The phylogenetic position of three taxa from two trematode genera, belonging to the subfamily Acanthostominae (Opisthorchioidea: Cryptogonimidae), were analysed using partial 28S ribosomal DNA (Domains 1-2) and internal transcribed spacers (ITS1-5.8S-ITS2). Bayesian inference and Maximum likelihood analyses of combined 28S rDNA and ITS1 + 5.8S + ITS2 sequences indicated the monophyly of the genus Acanthostomum ( A. cf. americanum and A. burminis ) and paraphyly of the Acanthostominae . These phylogenetic relationships were consistent in analyses of 28S alone and concatenated 28S + ITS1 + 5.8S + ITS2 sequences analyses. Based on molecular phylogenetic analyses, the subfamily Acanthostominae is therefore a paraphyletic taxon, in contrast with previous classifications based on morphological data. Phylogenetic patterns of host specificity inferred from adult stages of other cryptogonimid taxa are also well supported. However, analyses using additional genera and species are necessary to support the phylogenetic inferences from this study. Our molecular phylogenetic reconstruction linked two larval stages of A. cf. americanum cercariae and metacercariae. Here, we present the evolutionary and ecological implications of parasitic infections in freshwater and brackish environments.
Directory of Open Access Journals (Sweden)
Andrés Martínez-Aquino
2017-12-01
Full Text Available The phylogenetic position of three taxa from two trematode genera, belonging to the subfamily Acanthostominae (Opisthorchioidea: Cryptogonimidae, were analysed using partial 28S ribosomal DNA (Domains 1–2 and internal transcribed spacers (ITS1–5.8S–ITS2. Bayesian inference and Maximum likelihood analyses of combined 28S rDNA and ITS1 + 5.8S + ITS2 sequences indicated the monophyly of the genus Acanthostomum (A. cf. americanum and A. burminis and paraphyly of the Acanthostominae. These phylogenetic relationships were consistent in analyses of 28S alone and concatenated 28S + ITS1 + 5.8S + ITS2 sequences analyses. Based on molecular phylogenetic analyses, the subfamily Acanthostominae is therefore a paraphyletic taxon, in contrast with previous classifications based on morphological data. Phylogenetic patterns of host specificity inferred from adult stages of other cryptogonimid taxa are also well supported. However, analyses using additional genera and species are necessary to support the phylogenetic inferences from this study. Our molecular phylogenetic reconstruction linked two larval stages of A. cf. americanum cercariae and metacercariae. Here, we present the evolutionary and ecological implications of parasitic infections in freshwater and brackish environments.
Unparalleled rates of species diversification in Europe
Valente, Luis M.; Savolainen, Vincent; Vargas, Pablo
2010-01-01
The most rapid species radiations have been reported from ‘evolutionary laboratories’, such as the Andes and the Cape of South Africa, leading to the prevailing view that diversification elsewhere has not been as dramatic. However, few studies have explicitly assessed rates of diversification in northern regions such as Europe. Here, we show that carnations (Dianthus, Caryophyllaceae), a well-known group of plants from temperate Eurasia, have diversified at the most rapid rate ever reported in plants or terrestrial vertebrates. Using phylogenetic methods, we found that the majority of species of carnations belong to a lineage that is remarkably species-rich in Europe, and arose at the rate of 2.2–7.6 species per million years. Unlike most previous studies that have inferred rates of diversification in young diverse groups, we use a conservative approach throughout that explicitly incorporates the uncertainties associated with phylogenetic inference, molecular dating and incomplete taxon sampling. We detected a shift in diversification rates of carnations coinciding with a period of increase in climatic aridity in the Pleistocene, suggesting a link between climate and biodiversity. This explosive radiation suggests that Europe, the continent with the world's best-studied flora, has been underestimated as a cradle of recent and rapid speciation. PMID:20106850
PAL: an object-oriented programming library for molecular evolution and phylogenetics.
Drummond, A; Strimmer, K
2001-07-01
Phylogenetic Analysis Library (PAL) is a collection of Java classes for use in molecular evolution and phylogenetics. PAL provides a modular environment for the rapid construction of both special-purpose and general analysis programs. PAL version 1.1 consists of 145 public classes or interfaces in 13 packages, including classes for models of character evolution, maximum-likelihood estimation, and the coalescent, with a total of more than 27000 lines of code. The PAL project is set up as a collaborative project to facilitate contributions from other researchers. AVAILIABILTY: The program is free and is available at http://www.pal-project.org. It requires Java 1.1 or later. PAL is licensed under the GNU General Public License.
Hornok, Sándor; Szőke, Krisztina; Görföl, Tamás; Földvári, Gábor; Tu, Vuong Tan; Takács, Nóra; Kontschán, Jenő; Sándor, Attila D; Estók, Péter; Epis, Sara; Boldogh, Sándor; Kováts, Dávid; Wang, Yuanzhi
2017-05-01
Argas vespertilionis is a geographically widespread haematophagous ectoparasite species of bats in the Old World, with a suspected role in the transmission of Babesia vesperuginis. The aims of the present study were (1) to molecularly screen A. vespertilionis larvae (collected in Europe, Africa and Asia) for the presence of piroplasms, and (2) to analyze mitochondrial markers of A. vespertilionis larvae from Central Asia (Xinjiang Province, Northwestern China) in a phylogeographical context. Out of the 193 DNA extracts from 321 A. vespertilionis larvae, 12 contained piroplasm DNA (10 from Hungary, two from China). Sequencing showed the exclusive presence of B. vesperuginis, with 100% sequence identity between samples from Hungary and China. In addition, A. vespertilionis cytochrome oxidase c subunit 1 (cox1) and 16S rRNA gene sequences had 99.1-99.2 and 99.5-100% similarities, respectively, between Hungary and China. Accordingly, in the phylogenetic analyses A. vespertilionis from China clustered with haplotypes from Europe, and (with high support) outside the group formed by haplotypes from Southeast Asia. This is the first molecular evidence on the occurrence of B. vesperuginis in Asia. Bat ticks from hosts in Vespertilionidae contained only the DNA of B. vesperuginis (in contrast with what was reported on bat ticks from Rhinolophidae and Miniopteridae). Molecular taxonomic analyses of A. vespertilionis and B. vesperuginis suggest a genetic link of bat parasites between Central Europe and Central Asia, which is epidemiologically relevant in the context of any pathogens associated with bats.
DEFF Research Database (Denmark)
Søchting, Ulrik; Lutzoni, François
2003-01-01
A molecular phylogenetic analysis of rDNA was performed for seven Caloplaca, seven Xanthoria, one Fulgensia and five outgroup species. Phylogenetic hypotheses are constructed based on nuclear small and large subunit rDNA, separately and in combination. Three strongly supported major monophyletic ...
Phylogenetic Analysis Using Protein Mass Spectrometry.
Ma, Shiyong; Downard, Kevin M; Wong, Jason W H
2017-01-01
Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.
Shah, M A; Ali, M A; Al-Hemaid, F M; Reshi, Z A
2014-09-12
Myriophyllum aquaticum (Vell.) Verdc. (family Haloragaceae) is one of the most invasive and destructive South American aquatic plant species and is present in a wide range of geographic regions, including the Kashmir Himalaya. Confusion regarding the taxonomic delimitation of M. aquaticum in the Himalayan region impedes effective and targeted management. Hence, our goal was improve the identification of M. aquaticum for exclusive delimitation from other related species in the study region using a molecular phylogenetic approach. A maximum parsimony tree recovered from phylogenetic analyses of the internal transcribed spacer sequences of nuclear ribosomal DNA was used to authenticate the identification of M. aquaticum. The results of this study can be used for targeted management of this tropical invader into the temperate Kashmir Himalaya.
Craig, Matthew T,
2005-01-01
The processes that shape present day distributions of marine organisms have remained a central topic in evolutionary biology, conservation biology, and ecology. In this thesis, genetic data from mitochondrial and nuclear genes were used to create a phylogenetic hypothesis for the groupers of the subfamily Epinephelinae as a means of evaluating the current taxonomy of the group and the geography of speciation in marine organisms. The molecular phylogenetic hypothesis presented in Chap...
A phylogenetic study of Boletus section Boletus in Europe.
Beugelsdijk, D C M; van der Linde, S; Zuccarello, G C; den Bakker, H C; Draisma, S G A; Noordeloos, M E
2008-06-01
A phylogenetic study of the species in Boletus sect. Boletus was undertaken using the molecular markers ITS1-5.8S-ITS2 and GAPDH. Four well-supported lineages, one comprising Boletus edulis s.l., the others referring to B. aereus, B. reticulatus and B. pinophilus have been distinguished. The ML and MP trees of ITS showed remarkably low resolution within the B. edulis clade, and confirmed earlier published results, despite the use of samples from a wider geographical area and different hosts. The results of GAPDH demonstrate clearly that this low resolution must be ascribed to a low genetic variability with the B. edulis clade, and make clear that morphological and ecological characters have been overestimated within this species complex. Boletus edulis is therefore defined as a variable species with a wide morphological, ecological and geographic range, and includes several specific and subspecific taxa described in the literature (e.g. B. betulicola, B. persoonii, B. quercicola and B. venturii). Three other European species (B. aereus, B. pinophilus and B. reticulatus) are well delimited species based on morphology and our genetic data.
Vďačný, Peter
2017-10-01
The very diverse and comparatively complex morphology of ciliates has given rise to numerous taxonomic concepts. However, the information content of the utilized molecular markers has seldom been explored prior to phylogenetic analyses and taxonomic decisions. Likewise, robust testing of morphological homology statements and the apomorphic nature of diagnostic characters of ciliate taxa is rarely carried out. Four phylogenetic techniques that may help address these issues are reviewed. (1) Split spectrum analysis serves to determine the exact number and quality of nucleotide positions supporting individual nodes in phylogenetic trees and to discern long-branch artifacts that cause spurious phylogenies. (2) Network analysis can depict all possible evolutionary trajectories inferable from the dataset and locate and measure the conflict between them. (3) A priori likelihood mapping tests the suitability of data for reconstruction of a well resolved tree, visualizes the tree-likeness of quartets, and assesses the support of an internal branch of a given tree topology. (4) Reconstruction of ancestral morphologies can be applied for analyzing homology and apomorphy statements without circular reasoning. Since these phylogenetic tools are rarely used, their principles and interpretation are introduced and exemplified using various groups of ciliates. Finally, environmental sequencing data are discussed in this light. Copyright © 2017 The Author. Published by Elsevier GmbH.. All rights reserved.
Skaljac, Marisa; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad
2017-01-01
Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia), which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar) Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium) known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies. PMID:29053633
Directory of Open Access Journals (Sweden)
Marisa Skaljac
2017-10-01
Full Text Available Bemisia tabaci (Gennadius, Trialeurodes vaporariorum (Westwood, and Siphoninus phillyreae (Haliday are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia, which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies.
Sánchez, Rubén; Serra, François; Tárraga, Joaquín; Medina, Ignacio; Carbonell, José; Pulido, Luis; de María, Alejandro; Capella-Gutíerrez, Salvador; Huerta-Cepas, Jaime; Gabaldón, Toni; Dopazo, Joaquín; Dopazo, Hernán
2011-07-01
Phylemon 2.0 is a new release of the suite of web tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing. It has been designed as a response to the increasing demand of molecular sequence analyses for experts and non-expert users. Phylemon 2.0 has several unique features that differentiates it from other similar web resources: (i) it offers an integrated environment that enables evolutionary analyses, format conversion, file storage and edition of results; (ii) it suggests further analyses, thereby guiding the users through the web server; and (iii) it allows users to design and save phylogenetic pipelines to be used over multiple genes (phylogenomics). Altogether, Phylemon 2.0 integrates a suite of 30 tools covering sequence alignment reconstruction and trimming; tree reconstruction, visualization and manipulation; and evolutionary hypotheses testing.
Sánchez, Rubén; Serra, François; Tárraga, Joaquín; Medina, Ignacio; Carbonell, José; Pulido, Luis; de María, Alejandro; Capella-Gutíerrez, Salvador; Huerta-Cepas, Jaime; Gabaldón, Toni; Dopazo, Joaquín; Dopazo, Hernán
2011-01-01
Phylemon 2.0 is a new release of the suite of web tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing. It has been designed as a response to the increasing demand of molecular sequence analyses for experts and non-expert users. Phylemon 2.0 has several unique features that differentiates it from other similar web resources: (i) it offers an integrated environment that enables evolutionary analyses, format conversion, file storage and edition of results; (ii) it suggests further analyses, thereby guiding the users through the web server; and (iii) it allows users to design and save phylogenetic pipelines to be used over multiple genes (phylogenomics). Altogether, Phylemon 2.0 integrates a suite of 30 tools covering sequence alignment reconstruction and trimming; tree reconstruction, visualization and manipulation; and evolutionary hypotheses testing. PMID:21646336
Directory of Open Access Journals (Sweden)
Kean Chong Lim
Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.
Weisrock, David W; Macey, J Robert; Matsui, Masafumi; Mulcahy, Daniel G; Papenfuss, Theodore J
2013-01-01
The salamander family Hynobiidae contains over 50 species and has been the subject of a number of molecular phylogenetic investigations aimed at reconstructing branches across the entire family. In general, studies using the greatest amount of sequence data have used reduced taxon sampling, while the study with the greatest taxon sampling has used a limited sequence data set. Here, we provide insights into the phylogenetic history of the Hynobiidae using both dense taxon sampling and a large mitochondrial DNA sequence data set. We report exclusive new mitochondrial DNA data of 2566 aligned bases (with 151 excluded sites, of included sites 1157 are variable with 957 parsimony informative). This is sampled from two genic regions encoding a 12S-16S region (the 3' end of 12S rRNA, tRNA(VAI), and the 5' end of 16S rRNA), and a ND2-COI region (ND2, tRNA(Trp), tRNA(Ala), tRNA(Asn), the origin for light strand replication--O(L), tRNA(Cys), tRNAT(Tyr), and the 5' end of COI). Analyses using parsimony, Bayesian, and maximum likelihood optimality criteria produce similar phylogenetic trees, with discordant branches generally receiving low levels of branch support. Monophyly of the Hynobiidae is strongly supported across all analyses, as is the sister relationship and deep divergence between the genus Onychodactylus with all remaining hynobiids. Within this latter grouping our phylogenetic results identify six clades that are relatively divergent from one another, but for which there is minimal support for their phylogenetic placement. This includes the genus Batrachuperus, the genus Hynobius, the genus Pachyhynobius, the genus Salamandrella, a clade containing the genera Ranodon and Paradactylodon, and a clade containing the genera Liua and Pseudohynobius. This latter clade receives low bootstrap support in the parsimony analysis, but is consistent across all three analytical methods. Our results also clarify a number of well-supported relationships within the larger
Phylogenetic and recombination analysis of tomato spotted wilt virus.
Directory of Open Access Journals (Sweden)
Sen Lian
Full Text Available Tomato spotted wilt virus (TSWV severely damages and reduces the yield of many economically important plants worldwide. In this study, we determined the whole-genome sequences of 10 TSWV isolates recently identified from various regions and hosts in Korea. Phylogenetic analysis of these 10 isolates as well as the three previously sequenced isolates indicated that the 13 Korean TSWV isolates could be divided into two groups reflecting either two different origins or divergences of Korean TSWV isolates. In addition, the complete nucleotide sequences for the 13 Korean TSWV isolates along with previously sequenced TSWV RNA segments from Korea and other countries were subjected to phylogenetic and recombination analysis. The phylogenetic analysis indicated that both the RNA L and RNA M segments of most Korean isolates might have originated in Western Europe and North America but that the RNA S segments for all Korean isolates might have originated in China and Japan. Recombination analysis identified a total of 12 recombination events among all isolates and segments and five recombination events among the 13 Korea isolates; among the five recombinants from Korea, three contained the whole RNA L segment, suggesting reassortment rather than recombination. Our analyses provide evidence that both recombination and reassortment have contributed to the molecular diversity of TSWV.
Klopfstein, Seraina; Kropf, Christian; Quicke, Donald L J
2010-03-01
How to quantify the phylogenetic information content of a data set is a longstanding question in phylogenetics, influencing both the assessment of data quality in completed studies and the planning of future phylogenetic projects. Recently, a method has been developed that profiles the phylogenetic informativeness (PI) of a data set through time by linking its site-specific rates of change to its power to resolve relationships at different timescales. Here, we evaluate the performance of this method in the case of 2 standard genetic markers for phylogenetic reconstruction, 28S ribosomal RNA and cytochrome oxidase subunit 1 (CO1) mitochondrial DNA, with maximum parsimony, maximum likelihood, and Bayesian analyses of relationships within a group of parasitoid wasps (Hymenoptera: Ichneumonidae, Diplazontinae). Retrieving PI profiles of the 2 genes from our own and from 3 additional data sets, we find that the method repeatedly overestimates the performance of the more quickly evolving CO1 compared with 28S. We explore possible reasons for this bias, including phylogenetic uncertainty, violation of the molecular clock assumption, model misspecification, and nonstationary nucleotide composition. As none of these provides a sufficient explanation of the observed discrepancy, we use simulated data sets, based on an idealized setting, to show that the optimum evolutionary rate decreases with increasing number of taxa. We suggest that this relationship could explain why the formula derived from the 4-taxon case overrates the performance of higher versus lower rates of evolution in our case and that caution should be taken when the method is applied to data sets including more than 4 taxa.
Atopkin, D M; Besprozvannykh, V V; Yu Beloded, A; Ngo, H D; Ha, N V; Tang, N V
2017-12-01
Adult Aphanurus mugilis Tang, 1981 worms were detected in the intestine of Moolgarda engeli in the shallow waters off Cat Ba Island, Vietnam. Tang (1981) first described this species in Mugil cephalus off China. The worms in Vietnamese mullet were identical to Chinese specimens in a number of morphometric characteristics, with the exception of body and ovary size. In the present study, morphological characteristics, and the first molecular data for A. mugilis are provided. Additionally, molecular phylogenetic analysis of the family Hemiuridae was performed. The results of our molecular phylogenetic study indicate that the presence or absence of an ecsoma was not associated with molecular data for hemiurid subfamilies differentiation. The basal position of Bunocotylinae on the molecular-based phylogenetic tree indicated a primordial nature of ecsoma of hemiurid trematodes. Considerable molecular differentiation of Bunocotylinae from other hemiurids indicated the possibility of the recognition of the family Bunocotylidae Dollfus, 1950. Assuming that Machidatrema chilostoma is considered within the Bunocotylinae, the paraphyly of the Lecithasterinae was supported. Copyright © 2017 Elsevier B.V. All rights reserved.
A phylogenetic Kalman filter for ancestral trait reconstruction using molecular data.
Lartillot, Nicolas
2014-02-15
Correlation between life history or ecological traits and genomic features such as nucleotide or amino acid composition can be used for reconstructing the evolutionary history of the traits of interest along phylogenies. Thus far, however, such ancestral reconstructions have been done using simple linear regression approaches that do not account for phylogenetic inertia. These reconstructions could instead be seen as a genuine comparative regression problem, such as formalized by classical generalized least-square comparative methods, in which the trait of interest and the molecular predictor are represented as correlated Brownian characters coevolving along the phylogeny. Here, a Bayesian sampler is introduced, representing an alternative and more efficient algorithmic solution to this comparative regression problem, compared with currently existing generalized least-square approaches. Technically, ancestral trait reconstruction based on a molecular predictor is shown to be formally equivalent to a phylogenetic Kalman filter problem, for which backward and forward recursions are developed and implemented in the context of a Markov chain Monte Carlo sampler. The comparative regression method results in more accurate reconstructions and a more faithful representation of uncertainty, compared with simple linear regression. Application to the reconstruction of the evolution of optimal growth temperature in Archaea, using GC composition in ribosomal RNA stems and amino acid composition of a sample of protein-coding genes, confirms previous findings, in particular, pointing to a hyperthermophilic ancestor for the kingdom. The program is freely available at www.phylobayes.org.
Chakraborty, Chiranjib; Bandyopadhyay, Sanghamitra; Doss, C George Priya; Agoramoorthy, Govindasamy
2015-04-01
Maturity onset diabetes of the young (MODY) is a metabolic and genetic disorder. It is different from type 1 and type 2 diabetes with low occurrence level (1-2%) among all diabetes. This disorder is a consequence of β-cell dysfunction. Till date, 11 subtypes of MODY have been identified, and all of them can cause gene mutations. However, very little is known about the gene mapping, molecular phylogenetics, and co-expression among MODY genes and networking between cascades. This study has used latest servers and software such as VarioWatch, ClustalW, MUSCLE, G Blocks, Phylogeny.fr, iTOL, WebLogo, STRING, and KEGG PATHWAY to perform comprehensive analyses of gene mapping, multiple sequences alignment, molecular phylogenetics, protein-protein network design, co-expression analysis of MODY genes, and pathway development. The MODY genes are located in chromosomes-2, 7, 8, 9, 11, 12, 13, 17, and 20. Highly aligned block shows Pro, Gly, Leu, Arg, and Pro residues are highly aligned in the positions of 296, 386, 437, 455, 456 and 598, respectively. Alignment scores inform us that HNF1A and HNF1B proteins have shown high sequence similarity among MODY proteins. Protein-protein network design shows that HNF1A, HNF1B, HNF4A, NEUROD1, PDX1, PAX4, INS, and GCK are strongly connected, and the co-expression analyses between MODY genes also show distinct association between HNF1A and HNF4A genes. This study has used latest tools of bioinformatics to develop a rapid method to assess the evolutionary relationship, the network development, and the associations among eleven MODY genes and cascades. The prediction of sequence conservation, molecular phylogenetics, protein-protein network and the association between the MODY cascades enhances opportunities to get more insights into the less-known MODY disease.
Directory of Open Access Journals (Sweden)
Buonaguro FM
2006-09-01
Full Text Available Abstract Genetic and phylogenetic information on the HIV-1 epidemic in Middle-East Countries, and in particular in Iran, are extremely limited. By March 2004, the Iranian Ministry of Health officially reported a cumulative number of 6'532 HIV positive individuals and 214 AIDS cases in the Iranian HIV-1 epidemic. The intra-venous drug users (IDUs represent the group at highest risk for HIV-1 infection in Iran, accounting for almost 63% of all HIV-infected population. In this regards, a molecular phylogenetic study has been performed on a sentinel cohort of HIV-1 seropositive IDUs enrolled at the end of 2005 at the University of Mashhad, the largest city North East of Tehran. The study has been performed on both gag and env subgenomic regions amplified by Polymerase Chain Reaction (PCR from peripheral blood mononuclear cells (PBMCs and characterized by direct DNA sequence analysis. The results reported here show that the HIV-1 subtype A is circulating in this IDUs sentinel cohort. Moreover, the single phylogenetic cluster as well as the intra-group low nucleotide divergence is indicative of a recent outbreak. Unexpectedly, the Iranian samples appear to be phylogenetically derived from African Sub-Saharan subtype A viruses, raising stirring speculations on HIV-1 introduction into the IDUs epidemic in Mashhad. This sentinel study could represent the starting point for a wider molecular survey of the HIV-1 epidemics in Iran to evaluate in detail the distribution of genetic subtypes and possible natural drug-resistant variants, which are extremely helpful information to design diagnostic and therapeutic strategies.
Doanh, Pham Ngoc; Shinohara, Akio; Horii, Yoichiro; Habe, Shigehisa; Nawa, Yukifumi
2009-04-01
Paragonimus westermani is the most well-known species among the genus Paragonimus. It is widely distributed in Asia with considerable genetic diversity to form P. westermani species complex. While P. westermani distributed in Japan, Korea, China, and Taiwan are genetically homogeneous to form the East Asia group, those found in other geographic areas are heterogeneous and would be divided into several groups. Recent discoveries of P. westermani in India and Sri Lanka highlighted new insights on molecular phylogenetic relationship of geographic isolates of this species complex. Since Vietnam is located at the east end of Southeast Asia, the intermediate position between South and East Asia, it is of interest to see whether P. westermani is distributed in this country. Here, we report that P. westermani metacercariae were found in mountainous crabs, Potamiscus sp., collected in Quangtri province in the central Vietnam. Adult worms were successfully obtained by experimental infection in cats. Molecular phylogenetic analyses revealed that P. westermani of Vietnamese isolates have high similarities with those of East Asia group.
Molecular Phylogenetic: Organism Taxonomy Method Based on Evolution History
Directory of Open Access Journals (Sweden)
N.L.P Indi Dharmayanti
2011-03-01
Full Text Available Phylogenetic is described as taxonomy classification of an organism based on its evolution history namely its phylogeny and as a part of systematic science that has objective to determine phylogeny of organism according to its characteristic. Phylogenetic analysis from amino acid and protein usually became important area in sequence analysis. Phylogenetic analysis can be used to follow the rapid change of a species such as virus. The phylogenetic evolution tree is a two dimensional of a species graphic that shows relationship among organisms or particularly among their gene sequences. The sequence separation are referred as taxa (singular taxon that is defined as phylogenetically distinct units on the tree. The tree consists of outer branches or leaves that represents taxa and nodes and branch represent correlation among taxa. When the nucleotide sequence from two different organism are similar, they were inferred to be descended from common ancestor. There were three methods which were used in phylogenetic, namely (1 Maximum parsimony, (2 Distance, and (3 Maximum likehoood. Those methods generally are applied to construct the evolutionary tree or the best tree for determine sequence variation in group. Every method is usually used for different analysis and data.
BIMLR: a method for constructing rooted phylogenetic networks from rooted phylogenetic trees.
Wang, Juan; Guo, Maozu; Xing, Linlin; Che, Kai; Liu, Xiaoyan; Wang, Chunyu
2013-09-15
Rooted phylogenetic trees constructed from different datasets (e.g. from different genes) are often conflicting with one another, i.e. they cannot be integrated into a single phylogenetic tree. Phylogenetic networks have become an important tool in molecular evolution, and rooted phylogenetic networks are able to represent conflicting rooted phylogenetic trees. Hence, the development of appropriate methods to compute rooted phylogenetic networks from rooted phylogenetic trees has attracted considerable research interest of late. The CASS algorithm proposed by van Iersel et al. is able to construct much simpler networks than other available methods, but it is extremely slow, and the networks it constructs are dependent on the order of the input data. Here, we introduce an improved CASS algorithm, BIMLR. We show that BIMLR is faster than CASS and less dependent on the input data order. Moreover, BIMLR is able to construct much simpler networks than almost all other methods. BIMLR is available at http://nclab.hit.edu.cn/wangjuan/BIMLR/. © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Fernando H.A. Farache
2017-01-01
Full Text Available Sycophaginae is a group of non-pollinating fig wasps considered closely related to the fig pollinators (Agaoninae, Tetrapusiinae, and Kradibiinae in the most recent phylogenetic analyses. They occur in all tropical regions and are associated with Ficus subgenera Urostigma and Sycomorus. There are six described genera of Sycophaginae, and two are native and confined to the Neotropics, namely Idarnes Walker, 1843 and Anidarnes Bouček, 1993. Genus Idarnes is divided into three morphologically distinct groups that were proven to be monophyletic by recent molecular phylogenetic analyses. In this paper we reviewed the Idarnes incertus species-group and provide detailed morphological descriptions and illustrations for the species belonging to this group. Three previously described species were redescribed: I. brasiliensis (Mayr, 1906 comb. nov., I. hansoni Bouček, 1993, and I. incertus (Ashmead, 1900. Seventeen new species are described by Farache and Rasplus: I. amacayacuensis sp. n., I. amazonicus sp. n., I. americanae sp. n., I. badiovertex sp. n., I. brevis sp. n., I. brunneus sp. n., I. comptoni sp. n., I. cremersiae sp. n., I. dimorphicus sp. n., I. flavicrus sp. n., I. flaviventris sp. n., I. gibberosus sp. n., I. gordhi sp. n., I. maximus sp. n., I. nigriventris sp. n., I. pseudoflavus sp. n. and I. ramirezi sp. n. We provided keys for the identification of the species as well as for recognising the different species-groups of Idarnes and a closely related genus (Sycophaga Westwood, 1840. Additionally, phylogenetic relationships among 13 species of the I. incertus species-group were inferred using four molecular markers and discussed in the light of Ficus taxonomy and host specificity.
Andre, Thiago; Specht, Chelsea; Salzman, Shayla; Palma-Silva, Clarisse [UNESP; Wendt, Tania
2015-01-01
While most species within the genus Chamaecostus (Costaceae) are well defined, the broad geographic range and long list of synonyms associated with Chamaecostus subsessilis led us to believe there may be some cryptic species within the complex. We thus investigate the phylogenetic relationships of species in the Chamaecostus lineage and specifically test the monophyly and diversity of the Chamaecostus subsessilis species complex from a population perspective by analyzing molecular sequence da...
Phylogenetic Signal in AFLP Data Sets
Koopman, W.J.M.
2005-01-01
AFLP markers provide a potential source of phylogenetic information for molecular systematic studies. However, there are properties of restriction fragment data that limit phylogenetic interpretation of AFLPs. These are (a) possible nonindependence of fragments, (b) problems of homology assignment
International Nuclear Information System (INIS)
Sarwar, S.; Khalid, N.; Dentinger, B.M.
2016-01-01
Fleshy pored mushrooms is the name given to boletes due to their porous hymenium and fleshy nature. These are ectomycorrhizal basidiomycetes found in all continents except Antarctica. These mushrooms are important economically due to their edibility and medicinal value. This research work highlights the diversity of boletes in Pakistan and their correct identification by using molecular phylogenetic techniques. Western Himalayan range (WHR) of Pakistan is considered as diversity rich area. During present investigation regarding diversity of boletes in these areas, two bolete taxa viz. Hortiboletus rubellus and Neoboletus luridiformis were found under conifers. These mushrooms were collected and analyzed morphologically as well as phylogenetically by using Internal Transcribed Spacer (ITS) region of nrDNA sequences, and compared with their allies. All description and comparison with related taxa is provided in detail. These boletes are first time analyzed using molecular method from Pakistan. (author)
Molecular characterization and phylogenetic analysis of Fasciola hepatica from Peru.
Ichikawa-Seki, Madoka; Ortiz, Pedro; Cabrera, Maria; Hobán, Cristian; Itagaki, Tadashi
2016-06-01
The causative agent of fasciolosis in South America is thought to be Fasciola hepatica. In this study, Fasciola flukes from Peru were analyzed to investigate their genetic structure and phylogenetic relationships with those from other countries. Fasciola flukes were collected from the three definitive host species: cattle, sheep, and pigs. They were identified as F. hepatica because mature sperms were observed in their seminal vesicles, and also they displayed Fh type, which has an identical fragment pattern to F. hepatica in the nuclear internal transcribed spacer 1. Eight haplotypes were obtained from the mitochondrial NADH dehydrogenase subunit 1 (nad1) sequences of Peruvian F. hepatica; however, no special difference in genetic structure was observed between the three host species. Its extremely low genetic diversity suggests that the Peruvian population was introduced from other regions. Nad1 haplotypes identical to those of Peruvian F. hepatica were detected in China, Uruguay, Italy, Iran, and Australia. Our results indicate that F. hepatica rapidly expanded its range due to human migration. Future studies are required to elucidate dispersal route of F. hepatica from Europe, its probable origin, to other areas, including Peru. Copyright © 2015. Published by Elsevier Ireland Ltd.
Directory of Open Access Journals (Sweden)
Bertoni Giuseppe
2011-06-01
Full Text Available Abstract Background Small Ruminant Lentiviruses (SRLV are widespread in Canadian sheep and goats and represent an important health issue in these animals. There is however no data about the genetic diversity of Caprine Arthritis Encephalitis Virus (CAEV or Maedi Visna Virus (MVV in this country. Findings We performed a molecular and phylogenetic analysis of sheep and goat lentiviruses from a small geographic area in Canada using long sequences from the gag region of 30 infected sheep and 36 infected goats originating from 14 different flocks. Pairwise DNA distance and phylogenetic analyses revealed that all SRLV sequences obtained from sheep clustered tightly with prototypical Maedi visna sequences from America. Similarly, all SRLV strains obtained from goats clustered tightly with prototypical US CAEV-Cork strain. Conclusions The data reported in this study suggests that Canadian and US SRLV strains share common origins. In addition, the molecular data failed to bring to light any evidence of past cross species transmission between sheep and goats, which is consistent with the type of farming practiced in this part of the country where single species flocks predominate and where opportunities of cross species transmissions are proportionately low.
Phylogenetic classification of bony fishes.
Betancur-R, Ricardo; Wiley, Edward O; Arratia, Gloria; Acero, Arturo; Bailly, Nicolas; Miya, Masaki; Lecointre, Guillaume; Ortí, Guillermo
2017-07-06
Fish classifications, as those of most other taxonomic groups, are being transformed drastically as new molecular phylogenies provide support for natural groups that were unanticipated by previous studies. A brief review of the main criteria used by ichthyologists to define their classifications during the last 50 years, however, reveals slow progress towards using an explicit phylogenetic framework. Instead, the trend has been to rely, in varying degrees, on deep-rooted anatomical concepts and authority, often mixing taxa with explicit phylogenetic support with arbitrary groupings. Two leading sources in ichthyology frequently used for fish classifications (JS Nelson's volumes of Fishes of the World and W. Eschmeyer's Catalog of Fishes) fail to adopt a global phylogenetic framework despite much recent progress made towards the resolution of the fish Tree of Life. The first explicit phylogenetic classification of bony fishes was published in 2013, based on a comprehensive molecular phylogeny ( www.deepfin.org ). We here update the first version of that classification by incorporating the most recent phylogenetic results. The updated classification presented here is based on phylogenies inferred using molecular and genomic data for nearly 2000 fishes. A total of 72 orders (and 79 suborders) are recognized in this version, compared with 66 orders in version 1. The phylogeny resolves placement of 410 families, or ~80% of the total of 514 families of bony fishes currently recognized. The ordinal status of 30 percomorph families included in this study, however, remains uncertain (incertae sedis in the series Carangaria, Ovalentaria, or Eupercaria). Comments to support taxonomic decisions and comparisons with conflicting taxonomic groups proposed by others are presented. We also highlight cases were morphological support exist for the groups being classified. This version of the phylogenetic classification of bony fishes is substantially improved, providing resolution
Zelck, Ulrike E; Bialek, Ralf; Weiss, Michael
2011-04-01
We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed.
Li, Xi; Jang, Tae-Soo; Temsch, Eva M; Kato, Hidetoshi; Takayama, Koji; Schneeweiss, Gerald M
2017-03-01
Molecular phylogenetic studies have greatly improved our understanding of phylogenetic relationships of non-photosynthetic parasitic broomrapes (Orobanche and related genera, Orobanchaceae), but a few genera have remained unstudied. One of those is Platypholis, whose sole species, Platypholis boninsimae, is restricted to the Bonin-Islands (Ogasawara Islands) about 1000 km southeast of Japan. Based on overall morphological similarity, Platypholis has been merged with Orobanche, but this hypothesis has never been tested with molecular data. Employing maximum likelihood and Bayesian analyses on a family-wide data set (two plastid markers, matK and rps2, and three nuclear markers, ITS, phyA and phyB) as well as on an ITS data set focusing on Orobanche s. str., it is shown that P. boninsimae Maxim. is phylogenetically closely linked to or even nested within Orobanche s. str. This position is supported both by morphological evidence and by the newly obtained chromosome number of 2n = 38, which is characteristic for the genus Orobanche s. str.
The long and winding road of molecular data in phylogenetic analysis.
Suárez-Díaz, Edna
2014-01-01
The use of molecules and reactions as evidence, markers and/or traits for evolutionary processes has a history more than a century long. Molecules have been used in studies of intra-specific variation and studies of similarity among species that do not necessarily result in the analysis of phylogenetic relations. Promoters of the use of molecular data have sustained the need for quantification as the main argument to make use of them. Moreover, quantification has allowed intensive statistical analysis, as a condition and a product of increasing automation. All of these analyses are subject to the methodological anxiety characteristic of a community in search of objectivity (Suárez-Díaz and Anaya-Munoz, Stud Hist Philos Biol Biomed Sci 39:451–458, 2008). It is in this context that scientists compared and evaluated protein and nucleic acid sequence data with other types of molecular data – including immunological, electrophoretic and hybridization data. This paper argues that by looking at longterm historical processes, such as the use of molecular evidence in evolutionary biology, we gain valuable insights into the history of science. In that sense, it accompanies a growing concern among historians for big-pictures of science that incorporate the fruitful historical research on local cases of the last decades.
Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael
2011-01-01
We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085
Directory of Open Access Journals (Sweden)
Giovanni Cattoli
Full Text Available Highly pathogenic avian influenza virus A/H5N1 was first officially reported in Africa in early 2006. Since the first outbreak in Nigeria, this virus spread rapidly to other African countries. From its emergence to early 2008, 11 African countries experienced A/H5N1 outbreaks in poultry and human cases were also reported in three of these countries. At present, little is known of the epidemiology and molecular evolution of A/H5N1 viruses in Africa. We have generated 494 full gene sequences from 67 African isolates and applied molecular analysis tools to a total of 1,152 A/H5N1 sequences obtained from viruses isolated in Africa, Europe and the Middle East between 2006 and early 2008. Detailed phylogenetic analyses of the 8 gene viral segments confirmed that 3 distinct sublineages were introduced, which have persisted and spread across the continent over this 2-year period. Additionally, our molecular epidemiological studies highlighted the association between genetic clustering and area of origin in a majority of cases. Molecular signatures unique to strains isolated in selected areas also gave us a clearer picture of the spread of A/H5N1 viruses across the continent. Mutations described as typical of human influenza viruses in the genes coding for internal proteins or associated with host adaptation and increased resistance to antiviral drugs have also been detected in the genes coding for transmembrane proteins. These findings raise concern for the possible human health risk presented by viruses with these genetic properties and highlight the need for increased efforts to monitor the evolution of A/H5N1 viruses across the African continent. They further stress how imperative it is to implement sustainable control strategies to improve animal and public health at a global level.
Tang, Chin Cheung; Thomas, Daniel C; Saunders, Richard M K
2015-09-01
Data is presented in support of a phylogenetic reconstruction of the species-rich early-divergent angiosperm genus Goniothalamus (Annonaceae) (Tang et al., Mol. Phylogenetic Evol., 2015) [1], inferred using chloroplast DNA (cpDNA) sequences. The data includes a list of primers for amplification and sequencing for nine cpDNA regions: atpB-rbcL, matK, ndhF, psbA-trnH, psbM-trnD, rbcL, trnL-F, trnS-G, and ycf1, the voucher information and molecular data (GenBank accession numbers) of 67 ingroup Goniothalamus accessions and 14 outgroup accessions selected from across the tribe Annoneae, and aligned data matrices for each gene region. We also present our Bayesian phylogenetic reconstructions for Goniothalamus, with information on previous infrageneric classifications superimposed to enable an evaluation of monophyly, together with a taxon-character data matrix (with 15 morphological characters scored for 66 Goniothalamus species and seven other species from the tribe Annoneae that are shown to be phylogenetically correlated).
Directory of Open Access Journals (Sweden)
Chin Cheung Tang
2015-09-01
Full Text Available Data is presented in support of a phylogenetic reconstruction of the species-rich early-divergent angiosperm genus Goniothalamus (Annonaceae (Tang et al., Mol. Phylogenetic Evol., 2015 [1], inferred using chloroplast DNA (cpDNA sequences. The data includes a list of primers for amplification and sequencing for nine cpDNA regions: atpB-rbcL, matK, ndhF, psbA-trnH, psbM-trnD, rbcL, trnL-F, trnS-G, and ycf1, the voucher information and molecular data (GenBank accession numbers of 67 ingroup Goniothalamus accessions and 14 outgroup accessions selected from across the tribe Annoneae, and aligned data matrices for each gene region. We also present our Bayesian phylogenetic reconstructions for Goniothalamus, with information on previous infrageneric classifications superimposed to enable an evaluation of monophyly, together with a taxon-character data matrix (with 15 morphological characters scored for 66 Goniothalamus species and seven other species from the tribe Annoneae that are shown to be phylogenetically correlated.
She, C-W; Jiang, X-H; Ou, L-J; Liu, J; Long, K-L; Zhang, L-H; Duan, W-T; Zhao, W; Hu, J-C
2015-01-01
The genomic organisation of the seven cultivated Vigna species, V. unguiculata, V. subterranea, V. angularis, V. umbellata, V. radiata, V. mungo and V. aconitifolia, was determined using sequential combined PI and DAPI (CPD) staining and dual-colour fluorescence in situ hybridisation (FISH) with 5S and 45S rDNA probes. For phylogenetic analyses, comparative genomic in situ hybridisation (cGISH) onto somatic chromosomes and sequence analysis of the internal transcribed spacer (ITS) of 45S rDNA were used. Quantitative karyotypes were established using chromosome measurements, fluorochrome bands and rDNA FISH signals. All species had symmetrical karyotypes composed of only metacentric or metacentric and submetacentric chromosomes. Distinct heterochromatin differentiation was revealed by CPD staining and DAPI counterstaining after FISH. The rDNA sites among all species differed in their number, location and size. cGISH of V. umbellata genomic DNA to the chromosomes of all species produced strong signals in all centromeric regions of V. umbellata and V. angularis, weak signals in all pericentromeric regions of V. aconitifolia, and CPD-banded proximal regions of V. mungo var. mungo. Molecular phylogenetic trees showed that V. angularis and V. umbellata were the closest relatives, and V. mungo and V. aconitifolia were relatively closely related; these species formed a group that was separated from another group comprising V. radiata, V. unguiculata ssp. sesquipedalis and V. subterranea. This result was consistent with the phylogenetic relationships inferred from the heterochromatin and cGISH patterns; thus, fluorochrome banding and cGISH are efficient tools for the phylogenetic analysis of Vigna species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
Dornburg, Alex; Friedman, Matt; Near, Thomas J
2015-08-01
Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright
Haklová, B; Majláthová, V; Majláth, I; Harris, D J; Petrilla, V; Litschka-Koen, T; Oros, M; Peťko, B
2014-03-01
The blood parasites from the genus Hepatozoon Miller, 1908 (Apicomplexa: Adeleida: Hepatozoidae) represent the most common intracellular protozoan parasites found in snakes. In the present study, we examined 209 individuals of snakes, from different zoogeographical regions (Africa, America, Asia and Europe), for the occurrence of blood parasites using both molecular and microscopic examination methods, and assess phylogenetic relationships of all Hepatozoon parasites from snakes for the first time. In total, 178 blood smears obtained from 209 individuals, representing 40 species, were examined, from which Hepatozoon unicellular parasites were found in 26 samples (14·6% prevalence). Out of 180 samples tested by molecular method polymerase chain reaction (PCR), the presence of parasites was observed in 21 individuals (prevalence 11·6%): 14 snakes from Africa belonging to six genera (Dendroaspis, Dispholidus, Mehelya, Naja, Philothamnus and Python), five snakes from Asia from the genus Morelia and two snakes from America, from two genera (Coluber and Corallus). The intensity of infection varied from one to 1433 infected cells per 10 000 erythrocytes. Results of phylogenetic analyses (Bayesian and Maximum Likelihood) revealed the existence of five haplotypes divided into four main lineages. The present data also indicate neither geographical pattern of studied Hepatozoon sp., nor congruency in the host association.
Tissier, Jérémy; Becker, Damien; Codrea, Vlad; Costeur, Loïc; Fărcaş, Cristina; Solomon, Alexandru; Venczel, Marton; Maridet, Olivier
2018-01-01
Amynodontidae is a family of Rhinocerotoidea (Mammalia, Perissodactyla) known from the late Early Eocene to the latest Oligocene, in North America and Eurasia. European Amynodontidae are very rare, and all remains belong almost exclusively to a single post-Grande Coupure genus from the Oligocene, Cadurcotherium. The "Grande Coupure" defines an extinctions and dispersal-generated originations event in Europe that is nearly contemporaneous with the Eocene-Oligocene transition. Perissodactyls are one of the major groups affected by this event: Palaeotheriidae went almost extinct during this crisis, whereas Rhinocerotidae appeared for the first time in Europe. Study of fossiliferous Eastern-European localities from this age is crucial for the understanding of this crisis. We report here three new localities of Amynodontidae in Eastern Europe. Two of them are dated from the Eocene (Morlaca, Romania; Dorog, Hungary), whereas the other is either Late Eocene or Early Oligocene (Dobârca, Romania). The skull from this latter locality belongs unexpectedly to the same individual as a previously described mandible attributed to "Cadurcodon" zimborensis. As a result, this specimen can be allocated to its proper locality, Dobârca, and is assigned to a new genus, Sellamynodon gen. nov. It is characterised by an extraordinary growth of the nuchal crest, a unique character among amynodontids. Along with this remarkable material from Dobârca, two specimens from another Romanian locality, Morlaca, have been recently discovered and are dated from the Late Eocene. They belong, as well as new material from Dorog (Middle Eocene, Hungary), to the genus Amynodontopsis, also found in North America. The new Hungarian material represents the earliest occurrence of Amynodontidae in Europe. New phylogenetic hypotheses of Rhinocerotoidea are proposed, including the new material presented here, and show that Amynodontidae may be closer to the polyphyletic family 'Hyracodontidae' than to
Global patterns of amphibian phylogenetic diversity
DEFF Research Database (Denmark)
Fritz, Susanne; Rahbek, Carsten
2012-01-01
Aim Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location Global; equal-area grid cells of approximately 10,000 km2. Methods We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...
Directory of Open Access Journals (Sweden)
Gábor Sramkó
2016-12-01
Full Text Available The genus Elatine contains ca 25 species, all of which are small, herbaceous annuals distributed in ephemeral waters on both hemispheres. However, due to a high degree of morphological variability (as a consequence of their amphibious life-style, the taxonomy of this genus remains controversial. Thus, to fill this gap in knowledge, we present a detailed molecular phylogenetic study of this genus based on nuclear (rITS and plastid (accD-psaI, psbJ-petA, ycf6-psbM-trnD sequences using 27 samples from 13 species. On the basis of this phylogenetic analysis, we provide a solid phylogenetic background for the modern taxonomy of the European members of the genus. Traditionally accepted sections of this tree (i.e., Crypta and Elatinella were found to be monophyletic; only E. borchoni—found to be a basal member of the genus—has to be excluded from the latter lineage to achieve monophyly. A number of taxonomic conclusions can also be drawn: E. hexandra, a high-ploid species, is most likely a stabilised hybrid between the main sections; E. campylosperma merits full species status based on both molecular and morphological evidence; E. gussonei is a more widespread and genetically diverse species with two main lineages; and the presence of the Asian E. ambigua in the European flora is questionable. The main lineages recovered in this analysis are also supported by a number of synapomorphic morphological characters as well as uniform chromosome counts. Based on all the evidence presented here, two new subsections within Elatinella are described: subsection Hydropipera consisting of the temperate species of the section, and subsection Macropodae including the Mediterranean species of the section.
Hennicke, Florian; Cheikh-Ali, Zakaria; Liebisch, Tim; Maciá-Vicente, Jose G; Bode, Helge B; Piepenbring, Meike
2016-07-01
In China and other countries of East Asia, so-called Ling-zhi or Reishi mushrooms are used in traditional medicine since several centuries. Although the common practice to apply the originally European name 'Ganoderma lucidum' to these fungi has been questioned by several taxonomists, this is still generally done in recent publications and with commercially cultivated strains. In the present study, two commercially sold strains of 'G. lucidum', M9720 and M9724 from the company Mycelia bvba (Belgium), are compared for their fruiting body (basidiocarp) morphology combined with molecular phylogenetic analyses, and for their secondary metabolite profile employing an ultra-performance liquid chromatography-electrospray ionization mass spectrometry (UPLC-ESIMS) in combination with a high resolution electrospray ionization mass spectrometry (HR-ESI-MS). According to basidiocarp morphology, the strain M9720 was identified as G. lucidum s.str. whereas M9724 was determined as Ganoderma lingzhi. In molecular phylogenetic analyses, the M9720 ITS and beta-tubulin sequences grouped with sequences of G. lucidum s.str. from Europe whereas those from M9724 clustered with sequences of G. lingzhi from East Asia. We show that an ethanol extract of ground basidiocarps from G. lucidum (M9720) contains much less triterpenic acids than found in the extract of G. lingzhi (M9724). The high amount of triterpenic acids accounts for the bitter taste of the basidiocarps of G. lingzhi (M9724) and of its ethanol extract. Apparently, triterpenic acids of G. lucidum s.str. are analyzed here for the first time. These results demonstrate the importance of taxonomy for commercial use of fungi. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Molecular epidemiology of HIV-1 infection in Europe: An overview.
Beloukas, Apostolos; Psarris, Alexandros; Giannelou, Polina; Kostaki, Evangelia; Hatzakis, Angelos; Paraskevis, Dimitrios
2016-12-01
Human Immunodeficiency Virus type 1 (HIV-1) is characterised by vast genetic diversity. Globally circulating HIV-1 viruses are classified into distinct phylogenetic strains (subtypes, sub-subtypes) and several recombinant forms. Here we describe the characteristics and evolution of European HIV-1 epidemic over time through a review of published literature and updated queries of existing HIV-1 sequence databases. HIV-1 in Western and Central Europe was introduced in the early-1980s in the form of subtype B, which is still the predominant clade. However, in Eastern Europe (Former Soviet Union (FSU) countries and Russia) the predominant strain, introduced into Ukraine in the mid-1990s, is subtype A (A FSU ) with transmission mostly occurring in People Who Inject Drugs (PWID). In recent years, the epidemic is evolving towards a complex tapestry with an increase in the prevalence of non-B subtypes and recombinants in Western and Central Europe. Non-B epidemics are mainly associated with immigrants, heterosexuals and females but more recently, non-B clades have also spread amongst groups where non-B strains were previously absent - non-immigrant European populations and amongst men having sex with men (MSM). In some countries, non-B clades have spread amongst the native population, for example subtype G in Portugal and subtype A in Greece, Albania and Cyprus. Romania provides a unique case where sub-subtype F1 has predominated throughout the epidemic. In contrast, HIV-1 epidemic in FSU countries remains more homogeneous with A FSU clade predominating in all countries. The differences between the evolution of the Western epidemic and the Eastern epidemic may be attributable to differences in transmission risk behaviours, lifestyle and the patterns of human mobility. The study of HIV-1 epidemic diversity provides a useful tool by which we can understand the history of the pandemic in addition to allowing us to monitor the spread and growth of the epidemic over time
Virulence, serotype and phylogenetic groups of diarrhoeagenic ...
African Journals Online (AJOL)
Dr DADIE Thomas
2014-02-17
Feb 17, 2014 ... The virulence, serotype and phylogenetic traits of diarrhoeagenic Escherichia coli were detected in 502 strains isolated during digestive infections. Molecular detection of the target virulence genes, rfb gene of operon O and phylogenetic grouping genes Chua, yjaA and TSPE4.C2 was performed.
Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.
Gaston, Jordan R; Roberts, Sally A; Humphreys, Tricia L
2015-01-01
Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU) that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA), serum resistance protein (dsrA), and a collagen adhesin (ncaA) contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.
Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.
Directory of Open Access Journals (Sweden)
Jordan R Gaston
Full Text Available Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA, serum resistance protein (dsrA, and a collagen adhesin (ncaA contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.
Phylogenetic relationships of African sunbird-like warblers: Moho ...
African Journals Online (AJOL)
Phylogenetic relationships of African sunbird-like warblers: Moho ( Hypergerus atriceps ), Green Hylia ( Hylia prasina ) and Tit-hylia ( Pholidornis rushiae ) ... different points in avian evolution reduces the phylogenetic signal in molecular sequence data, making difficult the reconstruction of relationships among taxa resulting ...
Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A
2017-03-01
Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.
Zheng, Xiaoyan; Hu, Chunyun; Spooner, David; Liu, Jing; Cao, Jiashu; Teng, Yuanwen
2011-09-14
The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae) of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS) revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG) are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh) were selected to investigate their molecular evolution and phylogenetic utility. DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Our study represents the first phylogenetic analyses based on LCNGs in Pyrus. Ancient and recent duplications lead
Directory of Open Access Journals (Sweden)
Cao Jiashu
2011-09-01
Full Text Available Abstract Background The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh were selected to investigate their molecular evolution and phylogenetic utility. Results DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Conclusions Our study represents the first phylogenetic analyses based
Lavoué, Sébastien; Sullivan, John P
2004-10-01
Fishes of the Superorder Osteoglossomorpha (the "bonytongues") constitute a morphologically heterogeneous group of basal teleosts, including highly derived subgroups such as African electric fishes, the African butterfly fish, and Old World knifefishes. Lack of consensus among hypotheses of osteoglossomorph relationships advanced during the past 30 years may be due in part to the difficulty of identifying shared derived characters among the morphologically differentiated extant families of this group. In this study, we present a novel phylogenetic hypothesis for this group, based on the analysis of more than 4000 characters from five molecular markers (the mitochondrial cytochrome b, 12S and 16S rRNA genes, and the nuclear genes RAG2 and MLL). Our taxonomic sampling includes one representative of each extant non-mormyrid osteoglossomorph genus, one representative for the monophyletic family Mormyridae, and four outgroup taxa within the basal Teleostei. Maximum parsimony analysis of combined and equally weighted characters from the five molecular markers and Bayesian analysis provide a single, well-supported, hypothesis of osteoglossomorph interrelationships and show the group to be monophyletic. The tree topology is the following: (Hiodon alosoides, (Pantodon buchholzi, (((Osteoglossum bicirrhosum, Scleropages sp.), (Arapaima gigas, Heterotis niloticus)), ((Gymnarchus niloticus, Ivindomyrus opdenboschi), ((Notopterus notopterus, Chitala ornata), (Xenomystus nigri, Papyrocranus afer)))))). We compare our results with previously published phylogenetic hypotheses based on morpho-anatomical data. Additionally, we explore the consequences of the long terminal branch length for the taxon Pantodon buchholzi in our phylogenetic reconstruction and we use the obtained phylogenetic tree to reconstruct the evolutionary history of electroreception in the Notopteroidei.
Nunes, Marcio R T; Contreras-Gutierrez, María Angélica; Guzman, Hilda; Martins, Livia C; Barbirato, Mayla Feitoza; Savit, Chelsea; Balta, Victoria; Uribe, Sandra; Vivero, Rafael; Suaza, Juan David; Oliveira, Hamilton; Nunes Neto, Joaquin P; Carvalho, Valeria L; da Silva, Sandro Patroca; Cardoso, Jedson F; de Oliveira, Rodrigo Santo; da Silva Lemos, Poliana; Wood, Thomas G; Widen, Steven G; Vasconcelos, Pedro F C; Fish, Durland; Vasilakis, Nikos; Tesh, Robert B
2017-04-01
The recently described taxon Negevirus is comprised of a diverse group of insect-specific viruses isolated from mosquitoes and phlebotomine sandflies. In this study, a comprehensive genetic characterization, molecular, epidemiological and evolutionary analyses were conducted on nearly full-length sequences of 91 new negevirus isolates obtained in Brazil, Colombia, Peru, Panama, USA and Nepal. We demonstrated that these arthropod restricted viruses are clustered in two major phylogenetic groups with origins related to three plant virus genera (Cilevirus, Higrevirus and Blunevirus). Molecular analyses demonstrated that specific host correlations are not present with most negeviruses; instead, high genetic variability, wide host-range, and cross-species transmission were noted. The data presented here also revealed the existence of five novel insect-specific viruses falling into two arthropod-restrictive virus taxa, previously proposed as distinct genera, designated Nelorpivirus and Sandewavirus. Our results provide a better understanding of the molecular epidemiology, evolution, taxonomy and stability of this group of insect-restricted viruses. Copyright © 2017 Elsevier Inc. All rights reserved.
Costa-Rezende, D.H.; Robledo, G.L.; Góes-Neto, A.; Reck, M.A.; Crespo, E.; Drechsler-Santos, E.R.
2017-01-01
Ganodermataceae is a remarkable group of polypore fungi, mainly characterized by particular doublewalled basidiospores with a coloured endosporium ornamented with columns or crests, and a hyaline smooth exosporium. In order to establish an integrative morphological and molecular phylogenetic
Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne
2012-01-01
The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell
Directory of Open Access Journals (Sweden)
Shuai Wang
Full Text Available Individual genes or regions are still commonly used to estimate the phylogenetic relationships among viral isolates. The genomic regions that can faithfully provide assessments consistent with those predicted with full-length genome sequences would be preferable to serve as good candidates of the phylogenetic markers for molecular epidemiological studies of many viruses. Here we employed a statistical method to evaluate the evolutionary relationships between individual viral genes and full-length genomes without tree construction as a way to determine which gene can match the genome well in phylogenetic analyses. This method was performed by calculation of linear correlations between the genetic distance matrices of aligned individual gene sequences and aligned genome sequences. We applied this method to the phylogenetic analyses of porcine circovirus 2 (PCV2, measles virus (MV, hepatitis E virus (HEV and Japanese encephalitis virus (JEV. Phylogenetic trees were constructed for comparisons and the possible factors affecting the method accuracy were also discussed in the calculations. The results revealed that this method could produce results consistent with those of previous studies about the proper consensus sequences that could be successfully used as phylogenetic markers. And our results also suggested that these evolutionary correlations could provide useful information for identifying genes that could be used effectively to infer the genetic relationships.
Ortí, G; Meyer, A
1996-04-01
The rate and pattern of DNA evolution of ependymin, a single-copy gene coding for a highly expressed glycoprotein in the brain matrix of teleost fishes, is characterized and its phylogenetic utility for fish systematics is assessed. DNA sequences were determined from catfish, electric fish, and characiforms and compared with published ependymin sequences from cyprinids, salmon, pike, and herring. Among these groups, ependymin amino acid sequences were highly divergent (up to 60% sequence difference), but had surprisingly similar hydropathy profiles and invariant glycosylation sites, suggesting that functional properties of the proteins are conserved. Comparison of base composition at third codon positions and introns revealed AT-rich introns and GC-rich third codon positions, suggesting that the biased codon usage observed might not be due to mutational bias. Phylogenetic information content of third codon positions was surprisingly high and sufficient to recover the most basal nodes of the tree, in spite of the observation that pairwise distances (at third codon positions) were well above the presumed saturation level. This finding can be explained by the high proportion of phylogenetically informative nonsynonymous changes at third codon positions among these highly divergent proteins. Ependymin DNA sequences have established the first molecular evidence for the monophyly of a group containing salmonids and esociforms. In addition, ependymin suggests a sister group relationship of electric fish (Gymnotiformes) and Characiformes, constituting a significant departure from currently accepted classifications. However, relationships among characiform lineages were not completely resolved by ependymin sequences in spite of seemingly appropriate levels of variation among taxa and considerably low levels of homoplasy in the data (consistency index = 0.7). If the diversification of Characiformes took place in an "explosive" manner, over a relatively short period of time
O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.
2012-01-01
We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the
Zhang, Zhenjia; Wang, Deya; Yu, Chengming; Wang, Zenghui; Dong, Jiahong; Shi, Kerong; Yuan, Xuefeng
2016-01-14
Destructive diseases caused by Tomato spotted wilt virus (TSWV) have been reported associated with many important plants worldwide. Recently, TSWV was reported to infect different hosts in China. It is of value to clone TSWV isolates from different hosts and examine diversity and evolution among different TSWV isolates in China as well as worldwide. RT-PCR was used to clone the full-length genome (L, M and S segments) of three new isolates of TSWV that infected different hosts (tobacco, red pepper and green pepper) in China. Identity of nucleotide and amino acid sequences among TSWV isolates were analyzed by DNAMAN. MEGA 5.0 was used to construct phylogenetic trees. RDP4 was used to detect recombination events during evolution of these isolates. Whole-genome sequences of three new TSWV isolates in China were determined. Together with other available isolates, 29 RNA L, 62 RNA M and 66 RNA S of TSWV isolates were analyzed for molecular diversity, phylogenetic and recombination events. This analysis revealed that the entire TSWV genome, especially the M and S RNAs, had major variations in genomic size that mainly involve the A-U rich intergenic region (IGR). Phylogenetic analyses on TSWV isolates worldwide revealed evidence for frequent reassortments in the evolution of tripartite negative-sense RNA genome. Significant numbers of recombination events with apparent 5' regional preference were detected among TSWV isolates worldwide. Moreover, TSWV isolates with similar recombination events usually had closer relationships in phylogenetic trees. All five Chinese TSWV isolates including three TSWV isolates of this study and previously reported two isolates can be divided into two groups with different origins based on molecular diversity and phylogenetic analysis. During their evolution, both reassortment and recombination played roles. These results suggest that recombination could be an important mechanism in the evolution of multipartite RNA viruses, even negative
Adamowicz, Sarah J; Petrusek, Adam; Colbourne, John K; Hebert, Paul D N; Witt, Jonathan D S
2009-03-01
Molecular studies have enlightened our understanding of freshwater zooplankton biogeography, yet questions remain regarding the scale and commonality of geographic speciation. Here, we present a mtDNA-based phylogenetic hypothesis for 92 Daphnia species from all seven continents, with a focus on North and South America, Europe, and Australia, and use it to explore the frequency, scale, and geographical orientation of allopatric divergence events. Allopatric speciation can conservatively account for at least 42% of cladogenetic events among the species included in our study; most of these involve intercontinental splits. Closely related species pairs are concentrated in the circumarctic region and between northern and southern continents, aligned with bird migration routes, suggesting recent dispersal. By contrast, deeper phylogenetic patterns are consistent with vicariance scenarios linked to continental fragmentation. The possible reasons for the puzzling persistence of these ancient patterns in light of the eroding force of dispersal are considered. Our results demonstrate the high frequency and complex pattern of allopatric speciation in this ancient, passively dispersed genus.
Incidence, Diversity, and Molecular Epidemiology of Sapoviruses in Swine across Europe
DEFF Research Database (Denmark)
Reuter, G.; Zimsek-Mijovski, J.; Poljsak-Prijatelj, M.
2010-01-01
report on the incidence, genetic diversity and molecular epidemiology of sapoviruses detected in domestic pigs in a comprehensive study conducted in six European countries (Denmark, Finland, Hungary, Italy, Slovenia and Spain) between 2004 and 2007. A total of 1,050 swine fecal samples from 88 pig farms......) to human sapovirus strains. Sapoviruses are commonly circulating and endemic agents in swine herds throughout Europe. Highly heterogenous and potential new genogroups of sapoviruses were found in pigs; however, no "human-like" sapoviruses were detected....
Phylogenetic reconstruction methods: an overview.
De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre
2014-01-01
Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.
2013-01-01
Background Current biodiversity patterns are considered largely the result of past climatic and tectonic changes. In an integrative approach, we combine taxonomic and phylogenetic hypotheses to analyze temporal and geographic diversification of epigean (Carychium) and subterranean (Zospeum) evolutionary lineages in Carychiidae (Eupulmonata, Ellobioidea). We explicitly test three hypotheses: 1) morphospecies encompass unrecognized evolutionary lineages, 2) limited dispersal results in a close genetic relationship of geographical proximally distributed taxa and 3) major climatic and tectonic events had an impact on lineage diversification within Carychiidae. Results Initial morphospecies assignments were investigated by different molecular delimitation approaches (threshold, ABGD, GMYC and SP). Despite a conservative delimitation strategy, carychiid morphospecies comprise a great number of unrecognized evolutionary lineages. We attribute this phenomenon to historic underestimation of morphological stasis and phenotypic variability amongst lineages. The first molecular phylogenetic hypothesis for the Carychiidae (based on COI, 16S and H3) reveals Carychium and Zospeum to be reciprocally monophyletic. Geographical proximally distributed lineages are often closely related. The temporal diversification of Carychiidae is best described by a constant rate model of diversification. The evolution of Carychiidae is characterized by relatively few (long distance) colonization events. We find support for an Asian origin of Carychium. Zospeum may have arrived in Europe before extant members of Carychium. Distantly related Carychium clades inhabit a wide spectrum of the available bioclimatic niche and demonstrate considerable niche overlap. Conclusions Carychiid taxonomy is in dire need of revision. An inferred wide distribution and variable phenotype suggest underestimated diversity in Zospeum. Several Carychium morphospecies are results of past taxonomic lumping. By collecting
Directory of Open Access Journals (Sweden)
Sánchez Juan A
2007-06-01
Full Text Available Abstract Background Most phylogenetic studies using current methods have focused on primary DNA sequence information. However, RNA secondary structures are particularly useful in systematics because they include characteristics, not found in the primary sequence, that give "morphological" information. Despite the number of recent molecular studies on octocorals, there is no consensus opinion about a region that carries enough phylogenetic resolution to solve intrageneric or close species relationships. Moreover, intrageneric morphological information by itself does not always produce accurate phylogenies; intra-species comparisons can reveal greater differences than intra-generic ones. The search for new phylogenetic approaches, such as by RNA secondary structure analysis, is therefore a priority in octocoral research. Results Initially, twelve predicted RNA secondary structures were reconstructed to provide the basic information for phylogenetic analyses; they accorded with the 6 helicoidal ring model, also present in other groups of corals and eukaryotes. We obtained three similar topologies for nine species of the Caribbean gorgonian genus Eunicea (candelabrum corals with two sister taxa as outgroups (genera Plexaura and Pseudoplexaura on the basis of molecular morphometrics of ITS2 RNA secondary structures only, traditional primary sequence analyses and maximum likelihood, and a Bayesian analysis of the combined data. The latter approach allowed us to include both primary sequence and RNA molecular morphometrics; each data partition was allowed to have a different evolution rate. In addition, each helix was partitioned as if it had evolved at a distinct rate. Plexaura flexuosa was found to group within Eunicea; this was best supported by both the molecular morphometrics and combined analyses. We suggest Eunicea flexuosa (Lamouroux, 1821 comb. nov., and we present a new species description including Scanning Electron Microscopy (SEM images of
Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina
2014-02-01
Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.
Phylogenetic species delimitation for crayfishes of the genus Pacifastacus.
Larson, Eric R; Castelin, Magalie; Williams, Bronwyn W; Olden, Julian D; Abbott, Cathryn L
2016-01-01
Molecular genetic approaches are playing an increasing role in conservation science by identifying biodiversity that may not be evident by morphology-based taxonomy and systematics. So-called cryptic species are particularly prevalent in freshwater environments, where isolation of dispersal-limited species, such as crayfishes, within dendritic river networks often gives rise to high intra- and inter-specific genetic divergence. We apply here a multi-gene molecular approach to investigate relationships among extant species of the crayfish genus Pacifastacus, representing the first comprehensive phylogenetic study of this taxonomic group. Importantly, Pacifastacus includes both the widely invasive signal crayfish Pacifastacus leniusculus, as well as several species of conservation concern like the Shasta crayfish Pacifastacus fortis. Our analysis used 83 individuals sampled across the four extant Pacifastacus species (omitting the extinct Pacifastacus nigrescens), representing the known taxonomic diversity and geographic distributions within this genus as comprehensively as possible. We reconstructed phylogenetic trees from mitochondrial (16S, COI) and nuclear genes (GAPDH), both separately and using a combined or concatenated dataset, and performed several species delimitation analyses (PTP, ABGD, GMYC) on the COI phylogeny to propose Primary Species Hypotheses (PSHs) within the genus. All phylogenies recovered the genus Pacifastacus as monophyletic, within which we identified a range of six to 21 PSHs; more abundant PSHs delimitations from GMYC and ABGD were always nested within PSHs delimited by the more conservative PTP method. Pacifastacus leniusculus included the majority of PSHs and was not monophyletic relative to the other Pacifastacus species considered. Several of these highly distinct P. leniusculus PSHs likely require urgent conservation attention. Our results identify research needs and conservation priorities for Pacifastacus crayfishes in western
treespace: Statistical exploration of landscapes of phylogenetic trees.
Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline
2017-11-01
The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.
Next generation diagnostic molecular pathology: critical appraisal of quality assurance in Europe.
Dubbink, Hendrikus J; Deans, Zandra C; Tops, Bastiaan B J; van Kemenade, Folkert J; Koljenović, S; van Krieken, Han J M; Blokx, Willeke A M; Dinjens, Winand N M; Groenen, Patricia J T A
2014-06-01
Tumor evaluation in pathology is more and more based on a combination of traditional histopathology and molecular analysis. Due to the rapid development of new cancer treatments that specifically target aberrant proteins present in tumor cells, treatment decisions are increasingly based on the molecular features of the tumor. Not only the number of patients eligible for targeted precision medicine, but also the number of molecular targets per patient and tumor type is rising. Diagnostic molecular pathology, the discipline that determines the molecular aberrations present in tumors for diagnostic, prognostic or predictive purposes, is faced with true challenges. The laboratories have to meet the need of comprehensive molecular testing using only limited amount of tumor tissue, mostly fixed in formalin and embedded in paraffin (FFPE), in short turnaround time. Choices must be made for analytical methods that provide accurate, reliable and cost-effective results. Validation of the test procedures and results is essential. In addition, participation and good performance in internal (IQA) and external quality assurance (EQA) schemes is mandatory. In this review, we critically evaluate the validation procedure for comprehensive molecular tests as well as the organization of quality assurance and assessment of competence of diagnostic molecular pathology laboratories within Europe. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Stewart Alan V
2010-10-01
phylogenetic analysis of the Festuca genus to include representatives of each tall fescue morphotype, and to use low copy nuclear gene-derived sequences to identify putative progenitors of the polyploid species. The demonstration of distinct tall fescue lineages has implications for both taxonomy and molecular breeding strategies, and may facilitate the generation of morphotype and/or sub-genome-specific molecular markers.
Phylogenetics of neotropical Platymiscium (Leguminosae
DEFF Research Database (Denmark)
Saslis-Lagoudakis, C. Haris; Chase, Mark W; Robinson, Daniel N
2008-01-01
Platymiscium is a neotropical legume genus of forest trees in the Pterocarpus clade of the pantropical "dalbergioid" clade. It comprises 19 species (29 taxa), distributed from Mexico to southern Brazil. This study presents a molecular phylogenetic analysis of Platymiscium and allies inferred from...
A molecular phylogenetic analysis of the Scarabaeinae (dung beetles).
Monaghan, Michael T; Inward, Daegan J G; Hunt, Toby; Vogler, Alfried P
2007-11-01
The dung beetles (Scarabaeinae) include ca. 5000 species and exhibit a diverse array of morphologies and behaviors. This variation presumably reflects the adaptation to a diversity of food types and the different strategies used to avoid competition for vertebrate dung, which is the primary breeding environment for most species. The current classification gives great weight to the major behavioral types, separating the ball rollers and the tunnelers, but existing phylogenetic studies have been based on limited taxonomic or biogeographic sampling and have been contradictory. Here, we present a molecular phylogenetic analysis of 214 species of Scarabaeinae, representing all 12 traditionally recognized tribes and six biogeographical regions, using partial gene sequences from one nuclear (28S) and two mitochondrial (cox1, rrnL) genes. Length variation in 28S (588-621 bp) and rrnL (514-523 bp) was subjected to a thorough evaluation of alternative alignments, gap-coding methods, and tree searches using model-based (Bayesian and likelihood), maximum parsimony, and direct optimization analyses. The small-bodied, non-dung-feeding Sarophorus+Coptorhina were basal in all reconstructions. These were closely related to rolling Odontoloma+Dicranocara, suggesting an early acquisition of rolling behavior. Smaller tribes and most genera were monophyletic, while Canthonini and Dichotomiini each consisted of multiple paraphyletic lineages at hierarchical levels equivalent to the smaller tribes. Plasticity of rolling and tunneling was evidenced by a lack of monophyly (S-H test, p > 0.05) and several reversals within clades. The majority of previously unrecognized clades were geographical, including the well-supported Neotropical Phanaeini+Eucraniini, and a large Australian clade of rollers as well as tunneling Coptodactyla and Demarziella. Only three lineages, Gymnopleurini, Copris+Microcopris and Onthophagus, were widespread and therefore appear to be dispersive at a global scale. A
Lorén, J. Gaspar; Farfán, Maribel; Fusté, M. Carmen
2014-01-01
Several approaches have been developed to estimate both the relative and absolute rates of speciation and extinction within clades based on molecular phylogenetic reconstructions of evolutionary relationships, according to an underlying model of diversification. However, the macroevolutionary models established for eukaryotes have scarcely been used with prokaryotes. We have investigated the rate and pattern of cladogenesis in the genus Aeromonas (γ-Proteobacteria, Proteobacteria, Bacteria) using the sequences of five housekeeping genes and an uncorrelated relaxed-clock approach. To our knowledge, until now this analysis has never been applied to all the species described in a bacterial genus and thus opens up the possibility of establishing models of speciation from sequence data commonly used in phylogenetic studies of prokaryotes. Our results suggest that the genus Aeromonas began to diverge between 248 and 266 million years ago, exhibiting a constant divergence rate through the Phanerozoic, which could be described as a pure birth process. PMID:24586399
Silvestre, Bruna T; Silveira, Júlia A G; Meneses, Rodrigo M; Facury-Filho, Elias J; Carvalho, Antônio U; Ribeiro, Múcio F B
2016-02-01
Bovine anaplasmosis is a disease caused by the intraerythrocytic rickettsia species Anaplasma marginale and results in great economic losses in tropical and subtropical regions. Vertical transmission is an important phenomenon that contributes to the persistence of different strains of the agent within the same herd. The identification of new strains and genetic characterization studies are essential to understanding their epidemiology and virulence and for vaccine development. The aim of this study was to perform molecular and phylogenetic characterizations of a new vertically transmitted strain from A. marginale and to evaluate its virulence by experimental inoculation of rickettsia-free calves. Thirty newborn Holstein calves were subjected to molecular tests for the detection of A. marginale, Babesia bovis and Babesia bigemina. Calves positive for A. marginale (n=3) were splenectomized and monitored for the clinical manifestations of anaplasmosis. Blood samples from one of the calves that presented rickettsemia of 42.8% and spontaneous recovery of clinical parameters were used for molecular and phylogenetic characterization (msp1a gene), and inoculum production was used for the evaluation of virulence. This strain was identified as UFMG3. Three tandem repeat forms (13 and MGI19) were identified from the analysis of the msp1a gene, in which the form MGI19 appeared twice. Analysis of these repeats revealed the presence of the sequences QASTSS and SSASGQQQESS and of aspartic acid (D) at position 20 of both repeats. Phylogenetic analysis showed a close relationship among the UFMG3, MGI19 and UFMG2 strains. For virulence evaluation, six Holstein calves were inoculated intravenously with 2×10(7)A. marginale UFMG3-infected erythrocytes. The calves showed maximum rickettsemia of 5.1%, a moderate decrease in packed cell volume and spontaneous recovery of clinical parameters without the need for treatment. The results of experimental inoculation suggest that the strain A
A taxonomic and phylogenetic re-appraisal of the genus Curvularia
Species of Curvularia are important plant and human pathogens worldwide. In this study, the genus Curvularia is re-assessed based on molecular phylogenetic analysis and morphological observations of available isolates and specimens. A multi-gene phylogenetic tree inferred from ITS, TEF and GPDH gene...
Dreyfusia nordmannianae in Northern and Central Europe
DEFF Research Database (Denmark)
Ravn, Hans Peter; Havill, N.P.; Akbulut, S.
2013-01-01
The silver fir woolly adelgid, Dreyfusia nordmannianae, is the most severe pest occurring on Abies nordmanniana in Central and Northern Europe. The adelgid is particularly damaging to trees in Christmas tree plantations. Dreyfusia nordmannianae is native to the Caucasus region and alien to Europe...... were examined for phylogenetic structure. There was no evidence of differentiation, suggesting that these Dreyfusia species have recently diverged or require taxonomic revision. All existing published and unpublished reports on natural enemies of D. nordmannianae in its place of origin were reviewed...
Directory of Open Access Journals (Sweden)
M.O.Baba Sheikh
2017-09-01
Full Text Available Canine parvovirus (CPV remains the most significant viral cause of haemorrhagic enteritis and bloody diarrhoea in puppies over the age of 12 weeks. The objective of the present study was to detect and genotype CPV-2 by polymerase chain reaction (PCR and to perform phylogenetic analysis using partial VP2 gene sequences. We analysed eight faecal samples of unvaccinated dogs with signs of vomiting and bloody diarrhoea during the period from December 2013 to May 2014 in different locations in Sulaimani, Kurdistan, Iraq. After PCR detection, we found that all viral sequences in our study were CPV-2b variants, which differed genetically by 0.8% to 3.6% from five commercially available vaccines. Alignment between eight nucleotides of field virus sequences showed 95% to 99.5% similarity. The phylogenetic analysis for the 8 field sequences formed two distinct clusters with two sequences belonging to strains from China and Thailand and the other six – with a strain from Egypt. Molecular characterisation and CPV typing are crucial in epidemiological studies for future prevention and control of the disease.
Molecular biogeography of Europe: Pleistocene cycles and postglacial trends
Directory of Open Access Journals (Sweden)
Schmitt Thomas
2007-04-01
Full Text Available Abstract The climatic cycles with subsequent glacial and intergalcial periods have had a great impact on the distribution and evolution of species. Using genetic analytical tools considerably increased our understanding of these processes. In this review I therefore give an overview of the molecular biogeography of Europe. For means of simplification, I distinguish between three major biogeographical entities: (i "Mediterranean" with Mediterranean differentiation and dispersal centres, (ii "Continental" with extra-Mediterranean centres and (iii "Alpine" and/or "Arctic" with recent alpine and/or arctic distribution patterns. These different molecular biogeographical patterns are presented using actual examples. Many "Mediterranean" species are differentiated into three major European genetic lineages, which are due to glacial isolation in the three major Mediterranean peninsulas. Postglacial expansion in this group of species is mostly influenced by the barriers of the Pyrenees and the Alps with four resulting main patterns of postglacial range expansions. However, some cases are known with less than one genetic lineage per Mediterranean peninsula on the one hand, and others with a considerable genetic substructure within each of the Mediterranean peninsulas, Asia Minor and the Maghreb. These structures within the Mediterranean sub-centres are often rather strong and in several cases even predate the Pleistocene. For the "Continental" species, it could be shown that the formerly supposed postglacial spread from eastern Palearctic expansion centres is mostly not applicable. Quite the contrary, most of these species apparently had extra-Mediterranean centres of survival in Europe with special importance of the perialpine regions, the Carpathian Basin and parts of the Balkan Peninsula. In the group of "Alpine" and/or "Arctic" species, several molecular biogeographical patterns have been found, which support and improve the postulates based on
Towards an integrated phylogenetic classification of the Tremellomycetes.
Liu, X-Z; Wang, Q-M; Göker, M; Groenewald, M; Kachalkin, A V; Lumbsch, H T; Millanes, A M; Wedin, M; Yurkov, A M; Boekhout, T; Bai, F-Y
2015-06-01
Families and genera assigned to Tremellomycetes have been mainly circumscribed by morphology and for the yeasts also by biochemical and physiological characteristics. This phenotype-based classification is largely in conflict with molecular phylogenetic analyses. Here a phylogenetic classification framework for the Tremellomycetes is proposed based on the results of phylogenetic analyses from a seven-genes dataset covering the majority of tremellomycetous yeasts and closely related filamentous taxa. Circumscriptions of the taxonomic units at the order, family and genus levels recognised were quantitatively assessed using the phylogenetic rank boundary optimisation (PRBO) and modified general mixed Yule coalescent (GMYC) tests. In addition, a comprehensive phylogenetic analysis on an expanded LSU rRNA (D1/D2 domains) gene sequence dataset covering as many as available teleomorphic and filamentous taxa within Tremellomycetes was performed to investigate the relationships between yeasts and filamentous taxa and to examine the stability of undersampled clades. Based on the results inferred from molecular data and morphological and physiochemical features, we propose an updated classification for the Tremellomycetes. We accept five orders, 17 families and 54 genera, including seven new families and 18 new genera. In addition, seven families and 17 genera are emended and one new species name and 185 new combinations are proposed. We propose to use the term pro tempore or pro tem. in abbreviation to indicate the species names that are temporarily maintained.
Hamšíková, Zuzana; Silaghi, Cornelia; Rudolf, Ivo; Venclíková, Kristýna; Mahríková, Lenka; Slovák, Mirko; Mendel, Jan; Blažejová, Hana; Berthová, Lenka; Kocianová, Elena; Hubálek, Zdeněk; Schnittger, Leonhard; Kazimírová, Mária
2016-10-01
By amplification and sequencing of 18S rRNA gene fragments, Hepatozoon spp. DNA was detected in 0.08 % (4/5057) and 0.04 % (1/2473) of questing Ixodes ricinus ticks from Slovakia and Czech Republic, respectively. Hepatozoon spp. DNA was also detected in spleen and/or lungs of 4.45 % (27/606) of rodents from Slovakia. Prevalence of infection was significantly higher in Myodes glareolus (11.45 %) than in Apodemus spp. (0.28 %) (P Hepatozoon spp. gene amplicons from I. ricinus showed 100 % identity with Hepatozoon canis isolates from red foxes or dogs in Europe. Phylogenetic analysis showed that at least two H. canis 18S rRNA genotypes exist in Slovakia of which one was identified also in the Czech Republic. The finding of H. canis in questing I. ricinus suggests the geographical spread of the parasite and a potential role of other ticks as its vectors in areas where Rhipicephalus sanguineus is not endemic. Sequencing of 18S rRNA gene amplicons from M. glareolus revealed the presence of two closely related genetic variants, Hepatozoon sp. SK1 and Hepatozoon sp. SK2, showing 99-100 % identity with isolates from M. glareolus from other European countries. Phylogenetic analysis demonstrates that 18S rRNA variants SK1 and SK2 correspond to previously described genotypes UR1 and UR2 of H. erhardovae, respectively. The isolate from Apodemus flavicollis (Hepatozoon sp. SK3b) was 99 % identical with isolates from reptiles in Africa and Asia. Further studies are necessary to identify the taxonomic status of Hepatozoon spp. parasitizing rodents in Europe and the host-parasite interactions in natural foci.
Mapping Phylogenetic Trees to Reveal Distinct Patterns of Evolution.
Kendall, Michelle; Colijn, Caroline
2016-10-01
Evolutionary relationships are frequently described by phylogenetic trees, but a central barrier in many fields is the difficulty of interpreting data containing conflicting phylogenetic signals. We present a metric-based method for comparing trees which extracts distinct alternative evolutionary relationships embedded in data. We demonstrate detection and resolution of phylogenetic uncertainty in a recent study of anole lizards, leading to alternate hypotheses about their evolutionary relationships. We use our approach to compare trees derived from different genes of Ebolavirus and find that the VP30 gene has a distinct phylogenetic signature composed of three alternatives that differ in the deep branching structure. phylogenetics, evolution, tree metrics, genetics, sequencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Molecular Epidemiology of Bat Lyssaviruses in Europe
McElhinney, L.M.; Marston, D.A.; Leech, S.; Freuling, C.; Poel, van der W.H.M.; Echevarria, J.; Vazquez-Moron, S.; Horton, D.L.; Müller, T.; Fooks, A.R.
2013-01-01
Bat rabies cases in Europe are principally attributed to two lyssaviruses, namely European bat lyssavirus type 1 (EBLV-1) and European bat lyssavirus type 2 (EBLV-2). Between 1977 and 2011, 961 cases of bat rabies were reported to Rabies Bulletin Europe, with the vast majority (>97%) being
Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide
2014-08-01
Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
IVANKA TENEVA
2012-01-01
Full Text Available Traditionally, the taxonomy of the genus Nostoc is based on morphological and physiological characters. The extreme morphological variability of the Nostoc species, due to their life cycle and environmental conditions, hampers the correct identification of the individual species. This is also one of the reasons for the disputed taxonomic positions and relationships between the genera Anabaena–Aphanizomenon as well as between Anabaena–Nostoc. Therefore, it is necessary to use additional markers for development of a polyphasic classification system of order Nostocales. In light of this, we here present the first molecular and phy-logenetic characterization of two species of the genus Nostoc (Nostoc linckia and Nostoc punctiforme based on the cpcB-IGS-cpcA locus of the phycocyanin oper-on. The phylogenetic position of these two species within order Nostocales as well as within division Cyanobacteria has been determined. Our results indicate that genus Nostoc is heterogeneous. Analysis of the IGS region between cpcB and cpcA showed that Nostoc and Anabaena are distinct genera. Reported molecular and phylogenetic data will be useful to solve other problematic points in the tax-onomy of genera Aphanizomenon, Anabaena and Nostoc.
Yubuki, Naoji; Leander, Brian S; Silberman, Jeffrey D
2010-04-01
A novel free free-living phagotrophic flagellate, Rictus lutensis gen. et sp. nov., with two heterodynamic flagella, a permanent cytostome and a cytopharynx was isolated from muddy, low oxygen coastal sediments in Cape Cod, MA, USA. We cultivated and characterized this flagellate with transmission electron microscopy, scanning electron microscopy and molecular phylogenetic analyses inferred from small subunit (SSU) rDNA sequences. These data demonstrated that this organism has the key ultrastructural characters of the Bicosoecida, including similar transitional zones and a similar overall flagellar apparatus consisting of an x fiber and an L-shape microtubular root 2 involved in food capture. Although the molecular phylogenetic analyses were concordant with the ultrastructural data in placing R. lutensis with the bicosoecid clade, the internal position of this relatively divergent sequence within the clade was not resolved. Therefore, we interpret R. lutensis gen. et sp. nov. as a novel bicosoecid incertae sedis. Copyright 2009 Elsevier GmbH. All rights reserved.
Phylogenetic Analysis of Phytophthora Species Based on Mitochondrial and Nuclear DNA Sequences
Kroon, L.P.N.M.; Bakker, F.T.; Bosch, van den G.B.M.; Bonants, P.J.M.; Flier, W.G.
2004-01-01
A molecular phylogenetic analysis of the genus Phytophthora was performed, 113 isolates from 48 Phytophthora species were included in this analysis. Phylogenetic analyses were performed on regions of mitochondrial (cytochrome c oxidase subunit 1; NADH dehydrogenase subunit 1) and nuclear gene
Gabrielli, S; Galuppi, R; Fraulo, M; Savini, F; Morandi, B; Cancrini, G; Poglayen, G
2016-07-01
The genus Micipsella comprises three species of filariae to date identified in lagomorphs only, whereas the other genera belonging to the subfamily Splendidofilariinae are described as parasites of birds, reptiles and mammals. In the present study seven specimens of Micipsella numidica (Seurat, 1917), collected from the hare Lepus europaeus in Italy, were characterized genetically by molecular amplification of the mitochondrial genes (12S rDNA; cox1) and the 5S rDNA gene spacer region. Phylogenetic trees inferred using available sequences from filariae and those identified in this study evidenced a close relationship between M. numidica and Splendidofilariinae of other mammals and reptiles (Rumenfilaria andersoni and Madathamugadia hiepei). The present findings, apart from adding new data about the hosts in Italy, support the taxonomic position of M. numidica and highlight the substantial biological and molecular differences existing between Splendidofilariinae and other Onchocercidae. The study also contributes to our knowledge of the molecular/genetic diagnosis of filarial parasites of veterinary and medical concern in any vertebrate or invertebrate host.
Functional & phylogenetic diversity of copepod communities
Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.
2016-02-01
The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.
Alfonso-Morales, Abdulahi; Rios, Liliam; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Ganges, Llilianne; Díaz de Arce, Heidy; Majó, Natàlia; Núñez, José I; Pérez, Lester J
2015-01-01
Infectious bursal disease (IBD) is a highly contagious and acute viral disease, which has caused high mortality rates in birds and considerable economic losses in different parts of the world for more than two decades and it still represents a considerable threat to poultry. The current study was designed to rigorously measure the reliability of a phylogenetic marker included into segment B. This marker can facilitate molecular epidemiology studies, incorporating this segment of the viral genome, to better explain the links between emergence, spreading and maintenance of the very virulent IBD virus (vvIBDV) strains worldwide. Sequences of the segment B gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank Database; Cuban sequences were obtained in the current work. A phylogenetic marker named B-marker was assessed by different phylogenetic principles such as saturation of substitution, phylogenetic noise and high consistency. This last parameter is based on the ability of B-marker to reconstruct the same topology as the complete segment B of the viral genome. From the results obtained from B-marker, demographic history for both main lineages of IBDV regarding segment B was performed by Bayesian skyline plot analysis. Phylogenetic analysis for both segments of IBDV genome was also performed, revealing the presence of a natural reassortant strain with segment A from vvIBDV strains and segment B from non-vvIBDV strains within Cuban IBDV population. This study contributes to a better understanding of the emergence of vvIBDV strains, describing molecular epidemiology of IBDV using the state-of-the-art methodology concerning phylogenetic reconstruction. This study also revealed the presence of a novel natural reassorted strain as possible manifest of change in the genetic structure and stability of the vvIBDV strains. Therefore, it highlights the need to obtain information about both genome segments of IBDV for molecular
One tree to link them all: a phylogenetic dataset for the European tetrapoda.
Roquet, Cristina; Lavergne, Sébastien; Thuiller, Wilfried
2014-08-08
Since the ever-increasing availability of phylogenetic informative data, the last decade has seen an upsurge of ecological studies incorporating information on evolutionary relationships among species. However, detailed species-level phylogenies are still lacking for many large groups and regions, which are necessary for comprehensive large-scale eco-phylogenetic analyses. Here, we provide a dataset of 100 dated phylogenetic trees for all European tetrapods based on a mixture of supermatrix and supertree approaches. Phylogenetic inference was performed separately for each of the main Tetrapoda groups of Europe except mammals (i.e. amphibians, birds, squamates and turtles) by means of maximum likelihood (ML) analyses of supermatrix applying a tree constraint at the family (amphibians and squamates) or order (birds and turtles) levels based on consensus knowledge. For each group, we inferred 100 ML trees to be able to provide a phylogenetic dataset that accounts for phylogenetic uncertainty, and assessed node support with bootstrap analyses. Each tree was dated using penalized-likelihood and fossil calibration. The trees obtained were well-supported by existing knowledge and previous phylogenetic studies. For mammals, we modified the most complete supertree dataset available on the literature to include a recent update of the Carnivora clade. As a final step, we merged the phylogenetic trees of all groups to obtain a set of 100 phylogenetic trees for all European Tetrapoda species for which data was available (91%). We provide this phylogenetic dataset (100 chronograms) for the purpose of comparative analyses, macro-ecological or community ecology studies aiming to incorporate phylogenetic information while accounting for phylogenetic uncertainty.
Wei, Kai-Fa; Chen, Juan; Chen, Yan-Feng; Wu, Ling-Juan; Xie, Dao-Xin
2012-04-01
The WRKY transcription factors function in plant growth and development, and response to the biotic and abiotic stresses. Although many studies have focused on the functional identification of the WRKY transcription factors, much less is known about molecular phylogenetic and global expression analysis of the complete WRKY family in maize. In this study, we identified 136 WRKY proteins coded by 119 genes in the B73 inbred line from the complete genome and named them in an orderly manner. Then, a comprehensive phylogenetic analysis of five species was performed to explore the origin and evolutionary patterns of these WRKY genes, and the result showed that gene duplication is the major driving force for the origin of new groups and subgroups and functional divergence during evolution. Chromosomal location analysis of maize WRKY genes indicated that 20 gene clusters are distributed unevenly in the genome. Microarray-based expression analysis has revealed that 131 WRKY transcripts encoded by 116 genes may participate in the regulation of maize growth and development. Among them, 102 transcripts are stably expressed with a coefficient of variation (CV) value of WRKY genes with the CV value of >15% are further analysed to discover new organ- or tissue-specific genes. In addition, microarray analyses of transcriptional responses to drought stress and fungal infection showed that maize WRKY proteins are involved in stress responses. All these results contribute to a deep probing into the roles of WRKY transcription factors in maize growth and development and stress tolerance.
Dumas, Pascaline; Barbut, Jérôme; Le Ru, Bruno; Silvain, Jean-François; Clamens, Anne-Laure; d’Alençon, Emmanuelle; Kergoat, Gael J.
2015-01-01
Nowadays molecular species delimitation methods promote the identification of species boundaries within complex taxonomic groups by adopting innovative species concepts and theories (e.g. branching patterns, coalescence). As some of them can efficiently deal with large single-locus datasets, they could speed up the process of species discovery compared to more time consuming molecular methods, and benefit from the existence of large public datasets; these methods can also particularly favour scientific research and actions dealing with threatened or economically important taxa. In this study we aim to investigate and clarify the status of economically important moths species belonging to the genus Spodoptera (Lepidoptera, Noctuidae), a complex group in which previous phylogenetic analyses and integrative approaches already suggested the possible occurrence of cryptic species and taxonomic ambiguities. In this work, the effectiveness of innovative (and faster) species delimitation approaches to infer putative species boundaries has been successfully tested in Spodoptera, by processing the most comprehensive dataset (in terms of number of species and specimens) ever achieved; results are congruent and reliable, irrespective of the set of parameters and phylogenetic models applied. Our analyses confirm the existence of three potential new species clusters (for S. exigua (Hübner, 1808), S. frugiperda (J.E. Smith, 1797) and S. mauritia (Boisduval, 1833)) and support the synonymy of S. marima (Schaus, 1904) with S. ornithogalli (Guenée, 1852). They also highlight the ambiguity of the status of S. cosmiodes (Walker, 1858) and S. descoinsi Lalanne-Cassou & Silvain, 1994. This case study highlights the interest of molecular species delimitation methods as valuable tools for species discovery and to emphasize taxonomic ambiguities. PMID:25853412
Directory of Open Access Journals (Sweden)
Pascaline Dumas
Full Text Available Nowadays molecular species delimitation methods promote the identification of species boundaries within complex taxonomic groups by adopting innovative species concepts and theories (e.g. branching patterns, coalescence. As some of them can efficiently deal with large single-locus datasets, they could speed up the process of species discovery compared to more time consuming molecular methods, and benefit from the existence of large public datasets; these methods can also particularly favour scientific research and actions dealing with threatened or economically important taxa. In this study we aim to investigate and clarify the status of economically important moths species belonging to the genus Spodoptera (Lepidoptera, Noctuidae, a complex group in which previous phylogenetic analyses and integrative approaches already suggested the possible occurrence of cryptic species and taxonomic ambiguities. In this work, the effectiveness of innovative (and faster species delimitation approaches to infer putative species boundaries has been successfully tested in Spodoptera, by processing the most comprehensive dataset (in terms of number of species and specimens ever achieved; results are congruent and reliable, irrespective of the set of parameters and phylogenetic models applied. Our analyses confirm the existence of three potential new species clusters (for S. exigua (Hübner, 1808, S. frugiperda (J.E. Smith, 1797 and S. mauritia (Boisduval, 1833 and support the synonymy of S. marima (Schaus, 1904 with S. ornithogalli (Guenée, 1852. They also highlight the ambiguity of the status of S. cosmiodes (Walker, 1858 and S. descoinsi Lalanne-Cassou & Silvain, 1994. This case study highlights the interest of molecular species delimitation methods as valuable tools for species discovery and to emphasize taxonomic ambiguities.
Directory of Open Access Journals (Sweden)
Lidia Yakovchenko
2016-06-01
Full Text Available Candelariella placodizans is newly reported from China. It was collected on exposed rocks with mosses on the alpine areas of Taiwan and Yunnan Province, China at elevation between 3200-4400 m. Molecular phylogenetic analyses based on ITS rDNA sequences were also performed to confirm the monophyly of the Chinese populations with respect to already existing sequences of the species, and then further to examine their relationships to other members of the genus. An identification key to all 14 known taxa of Candelariella in China is provided.
Phylogenetic relationship among Kenyan sorghum germplasms ...
African Journals Online (AJOL)
Mr Kiboi
phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.
Genomic repeat abundances contain phylogenetic signal
Czech Academy of Sciences Publication Activity Database
Dodsworth, S.; Chase, M.W.; Kelly, L.J.; Leitch, I.J.; Macas, Jiří; Novák, Petr; Piednoël, M.; Weiß-Schneeweiss, H.; Leitch, A.R.
2015-01-01
Roč. 64, č. 1 (2015), s. 112-126 ISSN 1063-5157 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Repetitive DNA * continuous characters * genomics * next-generation sequencing * phylogenetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.225, year: 2015
Phylogenetic diversity and biodiversity indices on phylogenetic networks.
Wicke, Kristina; Fischer, Mareike
2018-04-01
In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.
Evidence of two distinct phylogenetic lineages of dog rabies virus circulating in Cambodia.
Mey, Channa; Metlin, Artem; Duong, Veasna; Ong, Sivuth; In, Sotheary; Horwood, Paul F; Reynes, Jean-Marc; Bourhy, Hervé; Tarantola, Arnaud; Buchy, Philippe
2016-03-01
This first extensive retrospective study of the molecular epidemiology of dog rabies in Cambodia included 149 rabies virus (RABV) entire nucleoprotein sequences obtained from 1998-2011. The sequences were analyzed in conjunction with RABVs from other Asian countries. Phylogenetic reconstruction confirmed the South-East Asian phylogenetic clade comprising viruses from Cambodia, Vietnam, Thailand, Laos and Myanmar. The present study represents the first attempt to classify the phylogenetic lineages inside this clade, resulting in the confirmation that all the Cambodian viruses belonged to the South-East Asian (SEA) clade. Three distinct phylogenetic lineages in the region were established with the majority of viruses from Cambodia closely related to viruses from Thailand, Laos and Vietnam, forming the geographically widespread phylogenetic lineage SEA1. A South-East Asian lineage SEA2 comprised two viruses from Cambodia was identified, which shared a common ancestor with RABVs originating from Laos. Viruses from Myanmar formed separate phylogenetic lineages within the major SEA clade. Bayesian molecular clock analysis suggested that the time to most recent common ancestor (TMRCA) of all Cambodian RABVs dated to around 1950. The TMRCA of the Cambodian SEA1 lineage was around 1964 and that of the SEA2 lineage was around 1953. The results identified three phylogenetically distinct and geographically separated lineages inside the earlier identified major SEA clade, covering at least five countries in the region. A greater understanding of the molecular epidemiology of rabies in South-East Asia is an important step to monitor progress on the efforts to control canine rabies in the region. Copyright © 2015 Elsevier B.V. All rights reserved.
A RAD-based phylogenetics for Orestias fishes from Lake Titicaca.
Takahashi, Tetsumi; Moreno, Edmundo
2015-12-01
The fish genus Orestias is endemic to the Andes highlands, and Lake Titicaca is the centre of the species diversity of the genus. Previous phylogenetic studies based on a single locus of mitochondrial and nuclear DNA strongly support the monophyly of a group composed of many of species endemic to the Lake Titicaca basin (the Lake Titicaca radiation), but the relationships among the species in the radiation remain unclear. Recently, restriction site-associated DNA (RAD) sequencing, which can produce a vast number of short sequences from various loci of nuclear DNA, has emerged as a useful way to resolve complex phylogenetic problems. To propose a new phylogenetic hypothesis of Orestias fishes of the Lake Titicaca radiation, we conducted a cluster analysis based on morphological similarities among fish samples and a molecular phylogenetic analysis based on RAD sequencing. From a morphological cluster analysis, we recognised four species groups in the radiation, and three of the four groups were resolved as monophyletic groups in maximum-likelihood trees based on RAD sequencing data. The other morphology-based group was not resolved as a monophyletic group in molecular phylogenies, and some members of the group were diverged from its sister group close to the root of the Lake Titicaca radiation. The evolution of these fishes is discussed from the phylogenetic relationships. Copyright © 2015 Elsevier Inc. All rights reserved.
Durand, J-D; Shen, K-N; Chen, W-J; Jamandre, B W; Blel, H; Diop, K; Nirchio, M; Garcia de León, F J; Whitfield, A K; Chang, C-W; Borsa, P
2012-07-01
The family Mugilidae comprises mainly coastal marine species that are widely distributed in all tropical, subtropical and temperate seas. Mugilid species are generally considered to be ecologically important and they are a major food resource for human populations in certain parts of the world. The taxonomy and systematics of the Mugilidae are still much debated and based primarily on morphological characters. In this study, we provide the first comprehensive molecular systematic account of the Mugilidae using phylogenetic analyses of nucleotide sequence variation at three mitochondrial loci (16S rRNA, cytochrome oxidase I, and cytochrome b) for 257 individuals from 55 currently recognized species. The study covers all 20 mugilid genera currently recognized as being valid. The family comprises seven major lineages that radiated early on from the ancestor to all current forms. All genera that were represented by two species or more, except Cestraeus, turned out to be paraphyletic or polyphyletic. Thus, the present phylogenetic results generally disagree with the current taxonomy at the genus level and imply that the anatomical characters used for the systematics of the Mugilidae may be poorly informative phylogenetically. The present results should provide a sound basis for a taxonomic revision of the mugilid genera. A proportion of the species with large distribution ranges (including Moolgarda seheli, Mugil cephalus and M. curema) appear to consist of cryptic species, thus warranting further taxonomic and genetic work at the infra-generic level. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Tamara Salloum
2016-06-01
Two molecular typing methods of 39 FFPE Leishmania isolates were used: the ITS1-PCR RFLP and the nested ITS1-5.8S rDNA gene amplification followed by sequencing and phylogenetic analysis. The efficiency of these two techniques in Leishmania identification was compared and the phylogenetic relationships among these isolates were illustrated based on the neighbor-joining (NJ method. The results were statistically correlated with the parasitic index (PI. The DNA storage in formalin-fixed paraffin embedded (FFPE tissues was assessed as well. The parasites identified were all L. tropica as determined by both techniques. ITS1-5.8S rDNA gene based typing proved to be more sensitive in the detection of parasites (positive in 69.2% of the isolates as opposed to the ITS1-PCR RFLP method that was successful in identifying L. tropica in only 43.6% of the isolates. Sequencing and phylogenetic analysis revealed high levels of heterogeneity. A statistically significant correlation was observed between PI and the results of the nested ITS1-5.8S rDNA gene PCR. Genotyping at the species level is essential for monitoring the relative frequency of CL in the Mediterranean area that is correlated to three different Leishmania species (Leishmania infantum, Leishmania major and L. tropica, each characterized by distinct epidemiological features. The obtained results highlight the need to find a universally accepted diagnostic tool for Leishmania typing.
Directory of Open Access Journals (Sweden)
Yuan Xu
Full Text Available A new species of Primulaceae, Primula undulifolia, is described from the hilly area of Hunan province in south-central China. Its morphology and distributional range suggest that it is allied to P. kwangtungensis, both adapted to subtropical climate, having contiguous distribution and similar habitat, growing on shady and moist cliffs. Petioles, scapes and pedicels of them are densely covered with rusty multicellular hairs, but the new species can be easily distinguished by its smaller flowers and narrowly oblong leaves with undulate margins. Molecular phylogenetic analysis based on four DNA markers (ITS, matK, trnL-F and rps16 confirmed the new species as an independent lineage and constitutes a main clade together with P. kwangtungensis, P. kweichouensis, P. wangii and P. hunanensis of Primula sect. Carolinella.
Directory of Open Access Journals (Sweden)
Abdulahi Alfonso-Morales
Full Text Available Infectious bursal disease (IBD is a highly contagious and acute viral disease, which has caused high mortality rates in birds and considerable economic losses in different parts of the world for more than two decades and it still represents a considerable threat to poultry. The current study was designed to rigorously measure the reliability of a phylogenetic marker included into segment B. This marker can facilitate molecular epidemiology studies, incorporating this segment of the viral genome, to better explain the links between emergence, spreading and maintenance of the very virulent IBD virus (vvIBDV strains worldwide.Sequences of the segment B gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank Database; Cuban sequences were obtained in the current work. A phylogenetic marker named B-marker was assessed by different phylogenetic principles such as saturation of substitution, phylogenetic noise and high consistency. This last parameter is based on the ability of B-marker to reconstruct the same topology as the complete segment B of the viral genome. From the results obtained from B-marker, demographic history for both main lineages of IBDV regarding segment B was performed by Bayesian skyline plot analysis. Phylogenetic analysis for both segments of IBDV genome was also performed, revealing the presence of a natural reassortant strain with segment A from vvIBDV strains and segment B from non-vvIBDV strains within Cuban IBDV population.This study contributes to a better understanding of the emergence of vvIBDV strains, describing molecular epidemiology of IBDV using the state-of-the-art methodology concerning phylogenetic reconstruction. This study also revealed the presence of a novel natural reassorted strain as possible manifest of change in the genetic structure and stability of the vvIBDV strains. Therefore, it highlights the need to obtain information about both genome segments of IBDV for
Phylogenetic systematics of the genus Echinococcus (Cestoda: Taeniidae).
Nakao, Minoru; Lavikainen, Antti; Yanagida, Tetsuya; Ito, Akira
2013-11-01
Echinococcosis is a serious helminthic zoonosis in humans, livestock and wildlife. The pathogenic organisms are members of the genus Echinococcus (Cestoda: Taeniidae). Life cycles of Echinococcus spp. are consistently dependent on predator-prey association between two obligate mammalian hosts. Carnivores (canids and felids) serve as definitive hosts for adult tapeworms and their herbivore prey (ungulates, rodents and lagomorphs) as intermediate hosts for metacestode larvae. Humans are involved as an accidental host for metacestode infections. The metacestodes develop in various internal organs, particularly in liver and lungs. Each metacestode of Echinococcus spp. has an organotropism and a characteristic form known as an unilocular (cystic), alveolar or polycystic hydatid. Recent molecular phylogenetic studies have demonstrated that the type species, Echinococcus granulosus, causing cystic echinococcosis is a cryptic species complex. Therefore, the orthodox taxonomy of Echinococcus established from morphological criteria has been revised from the standpoint of phylogenetic systematics. Nine valid species including newly resurrected taxa are recognised as a result of the revision. This review summarises the recent advances in the phylogenetic systematics of Echinococcus, together with the historical backgrounds and molecular epidemiological aspects of each species. A new phylogenetic tree inferred from the mitochondrial genomes of all valid Echinococcus spp. is also presented. The taxonomic nomenclature for Echinococcus oligarthrus is shown to be incorrect and this name should be replaced with Echinococcus oligarthra. Copyright © 2013 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Langkjær, Rikke Breinhold; Vigre, Håkan; Enemark, Heidi L.
2007-01-01
The genetic diversity of Cryptosporidium spp. and Giardia duodenalis from dairy cattle and pigs in Denmark was determined in the present study. Faecal samples from 1237 pigs and 1150 cattle originating from 50 sow herds and 50 dairy herds, respectively, were analysed for the presence of the two...... parasites by immunofluorescence microscopy. A large proportion of the (oo)cyst containing samples were selected for molecular characterization. Sequencing and phylogenetic analysis of the 18S rDNA locus and/or the HSP70 gene of 183 pig and 154 cattle isolates of Cryptosporidium revealed the presence of C....... suis, pig genotype II, C. parvum (cattle genotype), C. bovis, Cryptosporidium deer-like genotype and a novel C. suis-like genotype. For both cattle and pigs, a host age-related change in distribution of species/genotypes was observed. The zoonotic C. parvum (cattle genotype) was most prevalent in young...
Phylogenetic placement of two species known only from resting spores
DEFF Research Database (Denmark)
Hajek, Ann E; Gryganskyi, Andrii; Bittner, Tonya
2016-01-01
resting spores, Zoophthora independentia, infecting Tipula (Lunatipula) submaculata in New York State, is now described as a new species and Tarichium porteri, described in 1942, which infects Tipula (Triplicitipula) colei in Tennessee, is transferred to the genus Zoophthora. We have shown that use......Molecular methods were used to determine the generic placement of two species of Entomophthorales known only from resting spores. Historically, these species would belong in the form-genus Tarichium, but this classification provides no information about phylogenetic relationships. Using DNA from...... of molecular methods can assist with determination of the phylogenetic relations of specimens within the form-genus Tarichium for an already described species and a new species for which only resting spores are available....
PhyDesign: an online application for profiling phylogenetic informativeness
Directory of Open Access Journals (Sweden)
Townsend Jeffrey P
2011-05-01
Full Text Available Abstract Background The rapid increase in number of sequenced genomes for species across of the tree of life is revealing a diverse suite of orthologous genes that could potentially be employed to inform molecular phylogenetic studies that encompass broader taxonomic sampling. Optimal usage of this diversity of loci requires user-friendly tools to facilitate widespread cost-effective locus prioritization for phylogenetic sampling. The Townsend (2007 phylogenetic informativeness provides a unique empirical metric for guiding marker selection. However, no software or automated methodology to evaluate sequence alignments and estimate the phylogenetic informativeness metric has been available. Results Here, we present PhyDesign, a platform-independent online application that implements the Townsend (2007 phylogenetic informativeness analysis, providing a quantitative prediction of the utility of loci to solve specific phylogenetic questions. An easy-to-use interface facilitates uploading of alignments and ultrametric trees to calculate and depict profiles of informativeness over specified time ranges, and provides rankings of locus prioritization for epochs of interest. Conclusions By providing these profiles, PhyDesign facilitates locus prioritization increasing the efficiency of sequencing for phylogenetic purposes compared to traditional studies with more laborious and low capacity screening methods, as well as increasing the accuracy of phylogenetic studies. Together with a manual and sample files, the application is freely accessible at http://phydesign.townsend.yale.edu.
The limitations of ontogenetic data in phylogenetic analyses
Koenemann, Stefan; Schram, Frederick R.
2002-01-01
The analysis of consecutive ontogenetic stages, or events, introduces a new class of data to phylogenetic systematics that are distinctly different from traditional morphological characters and molecular sequence data. Ontogenetic event sequences are distinguished by varying degrees of both a
Szabó, Róbert; Radosa, Lukáš; Ličková, Martina; Sláviková, Monika; Heroldová, Marta; Stanko, Michal; Pejčoch, Milan; Osterberg, Anja; Laenen, Lies; Schex, Susanne; Ulrich, Rainer G; Essbauer, Sandra; Maes, Piet; Klempa, Boris
2017-12-01
Puumala virus (PUUV), carried by bank voles (Myodes glareolus), is the medically most important hantavirus in Central and Western Europe. In this study, a total of 523 bank voles (408 from Germany, 72 from Slovakia, and 43 from Czech Republic) collected between the years 2007-2012 were analyzed for the presence of hantavirus RNA. Partial PUUV genome segment sequences were obtained from 51 voles. Phylogenetic analyses of all three genome segments showed that the newfound strains cluster with other Central and Western European PUUV strains. The new sequences from Šumava (Bohemian Forest), Czech Republic, are most closely related to the strains from the neighboring Bavarian Forest, a known hantavirus disease outbreak region. Interestingly, the Slovak strains clustered with the sequences from Bohemian and Bavarian Forests only in the M but not S segment analyses. This well-supported topological incongruence suggests a segment reassortment event or, as we analyzed only partial sequences, homologous recombination. Our data highlight the necessity of sequencing all three hantavirus genome segments and of a broader bank vole screening not only in recognized endemic foci but also in regions with no reported human hantavirus disease cases.
Inferring phylogenetic trees from the knowledge of rare evolutionary events.
Hellmuth, Marc; Hernandez-Rosales, Maribel; Long, Yangjing; Stadler, Peter F
2018-06-01
Rare events have played an increasing role in molecular phylogenetics as potentially homoplasy-poor characters. In this contribution we analyze the phylogenetic information content from a combinatorial point of view by considering the binary relation on the set of taxa defined by the existence of a single event separating two taxa. We show that the graph-representation of this relation must be a tree. Moreover, we characterize completely the relationship between the tree of such relations and the underlying phylogenetic tree. With directed operations such as tandem-duplication-random-loss events in mind we demonstrate how non-symmetric information constrains the position of the root in the partially reconstructed phylogeny.
Unrealistic phylogenetic trees may improve phylogenetic footprinting.
Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo
2017-06-01
The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.
Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards
Erens, Jesse; Miralles, A.; Glaw, F.; Chatrou, L.W.; Vences, M.
2017-01-01
Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the
Weeks, Andrea; Simpson, Beryl B
2007-01-01
Expansion of the arid zone of sub-Saharan tropical Africa during the Miocene is posited as a significant contributing factor in the evolution of contemporary African flora. Nevertheless, few molecular phylogenetic studies have tested this hypothesis using reconstructed historical biogeographies of plants within this zone. Here, we present a molecular phylogeny of Commiphora, a predominantly tropical African, arid-adapted tree genus, in order to test the monophyly of its taxonomic sections and identify clades that will help direct future study of this species-rich and geographically widespread taxon. We then use multiple fossil calibrations of Commiphora phylogeny to determine the timing of well-supported diversification events within the genus and interpret these age estimates to determine the relative contribution of vicariance and dispersal in the expansion of Commiphora's geographic range. We find that Commiphora is sister to Vietnamese Bursera tonkinensis and that its crown group radiation corresponds with the onset of the Miocene.
Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert
2016-01-01
We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.
Directory of Open Access Journals (Sweden)
Marie Pagès
Full Text Available BACKGROUND: The lava mouse, Malpaisomys insularis, was endemic to the Eastern Canary islands and became extinct at the beginning of the 14(th century when the Europeans reached the archipelago. Studies to determine Malpaisomys' phylogenetic affinities, based on morphological characters, remained inconclusive because morphological changes experienced by this insular rodent make phylogenetic investigations a real challenge. Over 20 years since its first description, Malpaisomys' phylogenetic position remains enigmatic. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we resolved this issue using molecular characters. Mitochondrial and nuclear markers were successfully amplified from subfossils of three lava mouse samples. Molecular phylogenetic reconstructions revealed, without any ambiguity, unsuspected relationships between Malpaisomys and extant mice (genus Mus, Murinae. Moreover, through molecular dating we estimated the origin of the Malpaisomys/mouse clade at 6.9 Ma, corresponding to the maximal age at which the archipelago was colonised by the Malpaisomys ancestor via natural rafting. CONCLUSION/SIGNIFICANCE: This study reconsiders the derived morphological characters of Malpaisomys in light of this unexpected molecular finding. To reconcile molecular and morphological data, we propose to consider Malpaisomys insularis as an insular lineage of mouse.
Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J
2018-05-01
Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.
Phylogenetic Analysis of Petunia sensu Jussieu (Solanaceae) using Chloroplast DNA RFLP
ANDO, TOSHIO; KOKUBUN, HISASHI; WATANABE, HITOSHI; TANAKA, NORIO; YUKAWA, TOMOHISA; HASHIMOTO, GORO; MARCHESI, EDUARDO; SUÁREZ, ENRIQUE; BASUALDO, ISABEL L.
2005-01-01
• Background and Aims The phylogenetic relationships of Petunia sensu Jussieu (Petunia sensu Wijsman plus Calibrachoa) are unclear. This study aimed to resolve this uncertainty using molecular evidence.
Nelson, Leigh A; Lambkin, Christine L; Batterham, Philip; Wallman, James F; Dowton, Mark; Whiting, Michael F; Yeates, David K; Cameron, Stephen L
2012-12-15
Members of the Calliphoridae (blowflies) are significant for medical and veterinary management, due to the ability of some species to consume living flesh as larvae, and for forensic investigations due to the ability of others to develop in corpses. Due to the difficulty of accurately identifying larval blowflies to species there is a need for DNA-based diagnostics for this family, however the widely used DNA-barcoding marker, cox1, has been shown to fail for several groups within this family. Additionally, many phylogenetic relationships within the Calliphoridae are still unresolved, particularly deeper level relationships. Sequencing whole mt genomes has been demonstrated both as an effective method for identifying the most informative diagnostic markers and for resolving phylogenetic relationships. Twenty-seven complete, or nearly so, mt genomes were sequenced representing 13 species, seven genera and four calliphorid subfamilies and a member of the related family Tachinidae. PCR and sequencing primers developed for sequencing one calliphorid species could be reused to sequence related species within the same superfamily with success rates ranging from 61% to 100%, demonstrating the speed and efficiency with which an mt genome dataset can be assembled. Comparison of molecular divergences for each of the 13 protein-coding genes and 2 ribosomal RNA genes, at a range of taxonomic scales identified novel targets for developing as diagnostic markers which were 117-200% more variable than the markers which have been used previously in calliphorids. Phylogenetic analysis of whole mt genome sequences resulted in much stronger support for family and subfamily-level relationships. The Calliphoridae are polyphyletic, with the Polleninae more closely related to the Tachinidae, and the Sarcophagidae are the sister group of the remaining calliphorids. Within the Calliphoridae, there was strong support for the monophyly of the Chrysomyinae and Luciliinae and for the sister
Welzen, van P.C.; Pruesapan, K.; Telford, I.R.H.; Esser, H.-J.; Bruhl, J.J.
2014-01-01
Previous molecular phylogenetic studies indicated expansion of Breynia with inclusion of Sauropus s.str. (excluding Synostemon). The present study adds qualitative and quantitative morphological characters to molecular data to find more resolution and/or higher support for the subgroups within
2011-01-01
Background Copepods are highly diverse and abundant, resulting in extensive ecological radiation in marine ecosystems. Calanus sinicus dominates continental shelf waters in the northwest Pacific Ocean and plays an important role in the local ecosystem by linking primary production to higher trophic levels. A lack of effective molecular markers has hindered phylogenetic and population genetic studies concerning copepods. As they are genome-level informative, mitochondrial DNA sequences can be used as markers for population genetic studies and phylogenetic studies. Results The mitochondrial genome of C. sinicus is distinct from other arthropods owing to the concurrence of multiple non-coding regions and a reshuffled gene arrangement. Further particularities in the mitogenome of C. sinicus include low A + T-content, symmetrical nucleotide composition between strands, abbreviated stop codons for several PCGs and extended lengths of the genes atp6 and atp8 relative to other copepods. The monophyletic Copepoda should be placed within the Vericrustacea. The close affinity between Cyclopoida and Poecilostomatoida suggests reassigning the latter as subordinate to the former. Monophyly of Maxillopoda is rejected. Within the alignment of 11 C. sinicus mitogenomes, there are 397 variable sites harbouring three 'hotspot' variable sites and three microsatellite loci. Conclusion The occurrence of the circular subgenomic fragment during laboratory assays suggests that special caution should be taken when sequencing mitogenomes using long PCR. Such a phenomenon may provide additional evidence of mitochondrial DNA recombination, which appears to have been a prerequisite for shaping the present mitochondrial profile of C. sinicus during its evolution. The lack of synapomorphic gene arrangements among copepods has cast doubt on the utility of gene order as a useful molecular marker for deep phylogenetic analysis. However, mitochondrial genomic sequences have been valuable markers for
Marine turtle mitogenome phylogenetics and evolution
DEFF Research Database (Denmark)
Duchene, Sebastián; Frey, Amy; Alfaro-Núñez, Luis Alonso
2012-01-01
The sea turtles are a group of cretaceous origin containing seven recognized living species: leatherback, hawksbill, Kemp's ridley, olive ridley, loggerhead, green, and flatback. The leatherback is the single member of the Dermochelidae family, whereas all other sea turtles belong in Cheloniidae...... distributions, shedding light on complex migration patterns and possible geographic or climatic events as driving forces of sea-turtle distribution. We have sequenced complete mitogenomes for all sea-turtle species, including samples from their geographic range extremes, and performed phylogenetic analyses...... to assess sea-turtle evolution with a large molecular dataset. We found variation in the length of the ATP8 gene and a highly variable site in ND4 near a proton translocation channel in the resulting protein. Complete mitogenomes show strong support and resolution for phylogenetic relationships among all...
Directory of Open Access Journals (Sweden)
Raghunath Satpathy
2016-01-01
Full Text Available 2-Haloalkanoic acid dehalogenase enzymes have broad range of applications, starting from bioremediation to chemical synthesis of useful compounds that are widely distributed in fungi and bacteria. In the present study, a total of 81 full-length protein sequences of 2-haloalkanoic acid dehalogenase from bacteria and fungi were retrieved from NCBI database. Sequence analysis such as multiple sequence alignment (MSA, conserved motif identification, computation of amino acid composition, and phylogenetic tree construction were performed on these primary sequences. From MSA analysis, it was observed that the sequences share conserved lysine (K and aspartate (D residues in them. Also, phylogenetic tree indicated a subcluster comprised of both fungal and bacterial species. Due to nonavailability of experimental 3D structure for fungal 2-haloalkanoic acid dehalogenase in the PDB, molecular modelling study was performed for both fungal and bacterial sources of enzymes present in the subcluster. Further structural analysis revealed a common evolutionary topology shared between both fungal and bacterial enzymes. Studies on the buried amino acids showed highly conserved Leu and Ser in the core, despite variation in their amino acid percentage. Additionally, a surface exposed tryptophan was conserved in all of these selected models.
The power and pitfalls of HIV phylogenetics in public health.
Brooks, James I; Sandstrom, Paul A
2013-07-25
Phylogenetics is the application of comparative studies of genetic sequences in order to infer evolutionary relationships among organisms. This tool can be used as a form of molecular epidemiology to enhance traditional population-level communicable disease surveillance. Phylogenetic study has resulted in new paradigms being created in the field of communicable diseases and this commentary aims to provide the reader with an explanation of how phylogenetics can be used in tracking infectious diseases. Special emphasis will be placed upon the application of phylogenetics as a tool to help elucidate HIV transmission patterns and the limitations to these methods when applied to forensic analysis. Understanding infectious disease epidemiology in order to prevent new transmissions is the sine qua non of public health. However, with increasing epidemiological resolution, there may be an associated potential loss of privacy to the individual. It is within this context that we aim to promote the discussion on how to use phylogenetics to achieve important public health goals, while at the same time protecting the rights of the individual.
Blair, Christopher; Méndez de la Cruz, Fausto R; Law, Christopher; Murphy, Robert W
2015-03-01
Methods and approaches for accurate species delimitation continue to be a highly controversial subject in the systematics community. Inaccurate assessment of species' limits precludes accurate inference of historical evolutionary processes. Recent evidence suggests that multilocus coalescent methods show promise in delimiting species in cryptic clades. We combine multilocus sequence data with coalescence-based phylogenetics in a hypothesis-testing framework to assess species limits and elucidate the timing of diversification in leaf-toed geckos (Phyllodactylus) of Mexico's dry forests. Tropical deciduous forests (TDF) of the Neotropics are among the planet's most diverse ecosystems. However, in comparison to moist tropical forests, little is known about the mode and tempo of biotic evolution throughout this threatened biome. We find increased speciation and substantial, cryptic molecular diversity originating following the formation of Mexican TDF 30-20million years ago due to orogenesis of the Sierra Madre Occidental and Mexican Volcanic Belt. Phylogenetic results suggest that the Mexican Volcanic Belt, the Rio Fuerte, and Isthmus of Tehuantepec may be important biogeographic barriers. Single- and multilocus coalescent analyses suggest that nearly every sampling locality may be a distinct species. These results suggest unprecedented levels of diversity, a complex evolutionary history, and that the formation and expansion of TDF vegetation in the Miocene may have influenced subsequent cladogenesis of leaf-toed geckos throughout western Mexico. Copyright © 2015 Elsevier Inc. All rights reserved.
Guan, Guiquan; Liu, Junlong; Liu, Aihong; Li, Youquan; Niu, Qingli; Gao, Jinliang; Luo, Jianxun; Chauvin, Alain; Yin, Hong; Moreau, Emmanuelle
2015-09-01
Heat shock protein 90 (HSP90) is a key component of the molecular chaperone complex essential for activating many signalling proteins involved in the development and progression of pathogenic cellular transformation. A Hsp90 gene (BQHsp90) was cloned and characterized from Babesia sp. BQ1 (Lintan), an ovine Babesia isolate belonging to Babesia motasi-like group, by screening a cDNA expression library and performing rapid amplification of cDNA ends. The full-length cDNA of BQHsp90 is 2399 bp with an open reading frame of 2154 bp encoding a predicted 83 kDa polypeptide with 717 amino acid residues. It shows significant homology and similar structural characteristics to Hsp90 of other apicomplex organisms. Phylogenetic analysis, based on the HSP90 amino acid sequences, showed that the Babesia genus is clearly separated from other apicomplexa genera. Five Chinese ovine Babesia isolates were divided into 2 phylogenetic clusters, namely Babesia sp. Xinjiang (previously designated a new species) cluster and B. motasi-like cluster which could be further divided into 2 subclusters (Babesia sp. BQ1 (Lintan)/Babesia sp. Tianzhu and Babesia sp. BQ1 (Ningxian)/Babesia sp. Hebei). Finally, the antigenicity of rBQHSP90 protein from prokaryotic expression was also evaluated using western blot and enzyme-linked immunosorbent assay (ELISA).
Directory of Open Access Journals (Sweden)
Belle Christina C.
2017-01-01
Full Text Available The Oriental Weatherfish is considered a globally invasive fish species. In Europe, several reported feral populations of Oriental Weatherfish display an overlapping distribution range with native weatherfish Misgurnus fossilis, a declining species of international conservation and aquatic management concern. Morphologically distinguishing the different weatherfish species can be difficult, as their coloration is highly variable, many species reveal high phenotypic plasticity, and morphological traits like coloration might be not obvious or might be degraded during field sampling and after preservation. Herein, we analysed suspicious weatherfish specimens from southern Germany, demonstrating the usefulness of molecular genetic species identifications in this genus. We present the first molecular genetic species record of Misgurnus anguillicaudatus in Central Europe, and confirm the range expansion of Oriental Weatherfish into the river Inn catchment in southern Germany. As accurate species identification is crucial both in the context of monitoring and conserving native endangered species, and in early detection and prevention of biological invasion, we suggest the standard use of genetic species identification if morphological traits are not obvious.
Soft-tissue anatomy of the extant hominoids: a review and phylogenetic analysis
Gibbs, S; Collard, M; Wood, B
2002-01-01
This paper reports the results of a literature search for information about the soft-tissue anatomy of the extant non-human hominoid genera, Pan, Gorilla, Pongo and Hylobates, together with the results of a phylogenetic analysis of these data plus comparable data for Homo. Information on the four extant non-human hominoid genera was located for 240 out of the 1783 soft-tissue structures listed in the Nomina Anatomica. Numerically these data are biased so that information about some systems (e.g. muscles) and some regions (e.g. the forelimb) are over-represented, whereas other systems and regions (e.g. the veins and the lymphatics of the vascular system, the head region) are either under-represented or not represented at all. Screening to ensure that the data were suitable for use in a phylogenetic analysis reduced the number of eligible soft-tissue structures to 171. These data, together with comparable data for modern humans, were converted into discontinuous character states suitable for phylogenetic analysis and then used to construct a taxon-by-character matrix. This matrix was used in two tests of the hypothesis that soft-tissue characters can be relied upon to reconstruct hominoid phylogenetic relationships. In the first, parsimony analysis was used to identify cladograms requiring the smallest number of character state changes. In the second, the phylogenetic bootstrap was used to determine the confidence intervals of the most parsimonious clades. The parsimony analysis yielded a single most parsimonious cladogram that matched the molecular cladogram. Similarly the bootstrap analysis yielded clades that were compatible with the molecular cladogram; a (Homo, Pan) clade was supported by 95% of the replicates, and a (Gorilla, Pan, Homo) clade by 96%. These are the first hominoid morphological data to provide statistically significant support for the clades favoured by the molecular evidence. PMID:11833653
Molecular epidemiology of H9N2 influenza viruses in Northern Europe.
Lindh, Erika; Ek-Kommonen, Christine; Väänänen, Veli-Matti; Vaheri, Antti; Vapalahti, Olli; Huovilainen, Anita
2014-08-27
Low pathogenic avian influenza viruses are maintained in wild bird populations throughout the world. Avian influenza viruses are characterized by their efficient ability to reassort and adapt, which enables them to cross the species barrier and enhances their zoonotic potential. Influenza viruses of the H9N2 subtype appear endemic among poultry in Eurasia. They usually exist as low-pathogenic strains and circulate between wild bird populations, poultry and birds sold at live bird markets. Direct transmission of H9N2 viruses, with receptor specificities similar to human influenza strains, to pigs and humans has been reported on several occasions. H9N2 virus was first encountered in Finland in 2009, during routine screening of hunted wild waterfowl. The next year, H9N2 influenza viruses were isolated from wild birds on four occasions, including once from a farmed mallard. We have investigated the relationship between the reared and wild bird isolates by sequencing the hemagglutinin and the neuraminidase genes of the Finnish H9N2 viruses. Nucleotide sequence comparison and phylogenetic analyses indicate that H9N2 was transmitted from wild birds to reared birds in 2010, and that highly identical strains have been circulating in Europe during the last few years. Copyright © 2014 Elsevier B.V. All rights reserved.
Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.
Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M
2012-02-01
The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-10-01
Full Text Available Abstract Background Cichlid fishes in Lake Tanganyika exhibit remarkable diversity in their feeding habits. Among them, seven species in the genus Perissodus are known for their unique feeding habit of scale eating with specialized feeding morphology and behaviour. Although the origin of the scale-eating habit has long been questioned, its evolutionary process is still unknown. In the present study, we conducted interspecific phylogenetic analyses for all nine known species in the tribe Perissodini (seven Perissodus and two Haplotaxodon species using amplified fragment length polymorphism (AFLP analyses of the nuclear DNA. On the basis of the resultant phylogenetic frameworks, the evolution of their feeding habits was traced using data from analyses of stomach contents, habitat depths, and observations of oral jaw tooth morphology. Results AFLP analyses resolved the phylogenetic relationships of the Perissodini, strongly supporting monophyly for each species. The character reconstruction of feeding ecology based on the AFLP tree suggested that scale eating evolved from general carnivorous feeding to highly specialized scale eating. Furthermore, scale eating is suggested to have evolved in deepwater habitats in the lake. Oral jaw tooth shape was also estimated to have diverged in step with specialization for scale eating. Conclusion The present evolutionary analyses of feeding ecology and morphology based on the obtained phylogenetic tree demonstrate for the first time the evolutionary process leading from generalised to highly specialized scale eating, with diversification in feeding morphology and behaviour among species.
Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia
Jaklitsch, W.M.; Voglmayr, H.
2015-01-01
The first large-scale survey of sexual and asexual Trichoderma morphs collected from plant and fungal materials conducted in Southern Europe and Macaronesia including a few collections from French islands east of Africa yielded more than 650 specimens identified to the species level. Routine sequencing of tef1 revealed a genetic variation among these isolates that exceeds previous experience and ca. 90 species were recognized, of which 74 are named and 17 species newly described. Aphysiostroma stercorarium is combined in Trichoderma. For the first time a sexual morph is described for T. hamatum. The hitherto most complete phylogenetic tree is presented for the entire genus Trichoderma, based on rpb2 sequences. For the first time also a genus-wide phylogenetic tree based on acl1 sequences is shown. Detailed phylogenetic analyses using tef1 sequences are presented in four separate trees representing major clades of Trichoderma. Discussions involve species composition of clades and ecological and biogeographic considerations including distribution of species. PMID:26955191
Directory of Open Access Journals (Sweden)
Serge Alain Sadeuh-Mba
2017-10-01
Full Text Available Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5-100% nucleotide (nt and 98.3-100% amino-acid (aa identities to each other while, the 5 studied Africa-2 isolates shared 99.4-99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment
Sadeuh-Mba, Serge Alain; Momo, Jean Blaise; Besong, Laura; Loul, Sévérin; Njouom, Richard
2017-10-01
Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV) has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N) gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5-100% nucleotide (nt) and 98.3-100% amino-acid (aa) identities to each other while, the 5 studied Africa-2 isolates shared 99.4-99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment of the enzootic
Directory of Open Access Journals (Sweden)
LANGKAH SEMBIRING
2009-09-01
Full Text Available Intrageneric diversity of 556 streptomycetes isolated from the rhizosphere of tropical legume was determined by using molecular taxonomic method based on 16S rDNA. A total of 46 isolates were taken to represent 37 colour groups of the isolates. 16S rDNA were amplified and subsequently sequenced and the sequences data were aligned with streptomycete sequences retrieved from the ribosomal data base project (RDP data. Phylogenetic trees were generated by using the PHYLIP software package and the matrix of nucleotide similarity and nucleotide difference were generated by using PHYDIT software. The results confirmed and extended the value of 16S rDNA sequencing in streptomycete systematic. The 16S rDNA sequence data showed that most of the tested colour group representatives formed new centers of taxonomic variation within the genus Streptomyces. The generic assignment of these organisms was underpinned by 16S rDNA sequence data which also suggested that most of the strains represented new centers of taxonomic variation. The taxonomic data indicate that diverse populations of streptomycetes are associated with the roots of tropical legume (P. falcataria. Therefore, the combination of selective isolation and molecular taxonomic procedures used in this study provide a powerful way of uncovering new centers of taxonomic variation within the genus Streptomyces.
Phylogenetic relationships of Chaetomium isolates based on the ...
African Journals Online (AJOL)
Molecular characterization of 18 Chaetomium isolates collected from India based on the internal transcribed spacer (ITS) region of the rRNA gene sequences was done. Phylogenetic analysis of full length ITS region showed that Chaetomium globosum isolates, Cg1, Cg2, Cg6, Cg11 and Cg15, Chaetomium spp. isolates, ...
Feng, Shangguo; Jiang, Yan; Wang, Shang; Jiang, Mengying; Chen, Zhe; Ying, Qicai; Wang, Huizhong
2015-09-11
The over-collection and habitat destruction of natural Dendrobium populations for their commercial medicinal value has led to these plants being under severe threat of extinction. In addition, many Dendrobium plants are similarly shaped and easily confused during the absence of flowering stages. In the present study, we examined the application of the ITS2 region in barcoding and phylogenetic analyses of Dendrobium species (Orchidaceae). For barcoding, ITS2 regions of 43 samples in Dendrobium were amplified. In combination with sequences from GenBank, the sequences were aligned using Clustal W and genetic distances were computed using MEGA V5.1. The success rate of PCR amplification and sequencing was 100%. There was a significant divergence between the inter- and intra-specific genetic distances of ITS2 regions, while the presence of a barcoding gap was obvious. Based on the BLAST1, nearest distance and TaxonGAP methods, our results showed that the ITS2 regions could successfully identify the species of most Dendrobium samples examined; Second, we used ITS2 as a DNA marker to infer phylogenetic relationships of 64 Dendrobium species. The results showed that cluster analysis using the ITS2 region mainly supported the relationship between the species of Dendrobium established by traditional morphological methods and many previous molecular analyses. To sum up, the ITS2 region can not only be used as an efficient barcode to identify Dendrobium species, but also has the potential to contribute to the phylogenetic analysis of the genus Dendrobium.
Directory of Open Access Journals (Sweden)
Shangguo Feng
2015-09-01
Full Text Available The over-collection and habitat destruction of natural Dendrobium populations for their commercial medicinal value has led to these plants being under severe threat of extinction. In addition, many Dendrobium plants are similarly shaped and easily confused during the absence of flowering stages. In the present study, we examined the application of the ITS2 region in barcoding and phylogenetic analyses of Dendrobium species (Orchidaceae. For barcoding, ITS2 regions of 43 samples in Dendrobium were amplified. In combination with sequences from GenBank, the sequences were aligned using Clustal W and genetic distances were computed using MEGA V5.1. The success rate of PCR amplification and sequencing was 100%. There was a significant divergence between the inter- and intra-specific genetic distances of ITS2 regions, while the presence of a barcoding gap was obvious. Based on the BLAST1, nearest distance and TaxonGAP methods, our results showed that the ITS2 regions could successfully identify the species of most Dendrobium samples examined; Second, we used ITS2 as a DNA marker to infer phylogenetic relationships of 64 Dendrobium species. The results showed that cluster analysis using the ITS2 region mainly supported the relationship between the species of Dendrobium established by traditional morphological methods and many previous molecular analyses. To sum up, the ITS2 region can not only be used as an efficient barcode to identify Dendrobium species, but also has the potential to contribute to the phylogenetic analysis of the genus Dendrobium.
Phylogenetic placement of the Dominican Republic endemic genus Sarcopilea (Urticaceae)
Czech Academy of Sciences Publication Activity Database
Jestrow, B.; Valdés, James J.; Rodríguez, F. J.; Francisco-Ortega, J.
2012-01-01
Roč. 61, č. 3 (2012), s. 592-600 ISSN 0040-0262 Institutional support: RVO:60077344 Keywords : CAM * Caribbean Islands * cystoliths * epistomatic * hyperstomatic * hydathodes * phylogenetics * Pilea * Sarcopilea * succulent * Urticaceae Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.782, year: 2012
DEFF Research Database (Denmark)
Lambkin, Christine L.; Sinclair, Bradley J.; Pape, Thomas
2013-01-01
Members of the megadiverse insect order Diptera (flies) have successfully colonized all continents and nearly all habitats. There are more than 154 000 described fly species, representing 1012% of animal species. Elucidating the phylogenetic relationships of such a large component of global...... biodiversity is challenging, but significant advances have been made in the last few decades. Since Hennig first discussed the monophyly of major groupings, Diptera has attracted much study, but most researchers have used non-numerical qualitative methods to assess morphological data. More recently......, quantitative phylogenetic methods have been used on both morphological and molecular data. All previous quantitative morphological studies addressed narrower phylogenetic problems, often below the suborder or infraorder level. Here we present the first numerical analysis of phylogenetic relationships...
Assessment of Molecular Modeling & Simulation
Energy Technology Data Exchange (ETDEWEB)
None
2002-01-03
This report reviews the development and applications of molecular and materials modeling in Europe and Japan in comparison to those in the United States. Topics covered include computational quantum chemistry, molecular simulations by molecular dynamics and Monte Carlo methods, mesoscale modeling of material domains, molecular-structure/macroscale property correlations like QSARs and QSPRs, and related information technologies like informatics and special-purpose molecular-modeling computers. The panel's findings include the following: The United States leads this field in many scientific areas. However, Canada has particular strengths in DFT methods and homogeneous catalysis; Europe in heterogeneous catalysis, mesoscale, and materials modeling; and Japan in materials modeling and special-purpose computing. Major government-industry initiatives are underway in Europe and Japan, notably in multi-scale materials modeling and in development of chemistry-capable ab-initio molecular dynamics codes.
Rampersad, Sephra N; Hosein, Fazeeda N; Carrington, Christine Vf
2014-01-01
The Colletotrichum gloeosporioides species complex is among the most destructive fungal plant pathogens in the world, however, identification of isolates of quarantine importance to the intra-specific level is confounded by a number of factors that affect phylogenetic reconstruction. Information bias and quality parameters were investigated to determine whether nucleotide sequence alignments and phylogenetic trees accurately reflect the genetic diversity and phylogenetic relatedness of individuals. Sequence exploration of GAPDH, ACT, TUB2 and ITS markers indicated that the query sequences had different patterns of nucleotide substitution but were without evidence of base substitution saturation. Regions of high entropy were much more dispersed in the ACT and GAPDH marker alignments than for the ITS and TUB2 markers. A discernible bimodal gap in the genetic distance frequency histograms was produced for the ACT and GAPDH markers which indicated successful separation of intra- and inter-specific sequences in the data set. Overall, analyses indicated clear differences in the ability of these markers to phylogenetically separate individuals to the intra-specific level which coincided with information bias.
Phylogenetic analysis of the genus Hordeum using repetitive DNA sequences
DEFF Research Database (Denmark)
Svitashev, S.; Bryngelsson, T.; Vershinin, A.
1994-01-01
A set of six cloned barley (Hordeum vulgare) repetitive DNA sequences was used for the analysis of phylogenetic relationships among 31 species (46 taxa) of the genus Hordeum, using molecular hybridization techniques. In situ hybridization experiments showed dispersed organization of the sequences...
Directory of Open Access Journals (Sweden)
Astrid Schuster
Full Text Available Reconciling the fossil record with molecular phylogenies to enhance the understanding of animal evolution is a challenging task, especially for taxa with a mostly poor fossil record, such as sponges (Porifera. 'Lithistida', a polyphyletic group of recent and fossil sponges, are an exception as they provide the richest fossil record among demosponges. Lithistids, currently encompassing 13 families, 41 genera and >300 recent species, are defined by the common possession of peculiar siliceous spicules (desmas that characteristically form rigid articulated skeletons. Their phylogenetic relationships are to a large extent unresolved and there has been no (taxonomically comprehensive analysis to formally reallocate lithistid taxa to their closest relatives. This study, based on the most comprehensive molecular and morphological investigation of 'lithistid' demosponges to date, corroborates some previous weakly-supported hypotheses, and provides novel insights into the evolutionary relationships of the previous 'order Lithistida'. Based on molecular data (partial mtDNA CO1 and 28S rDNA sequences, we show that 8 out of 13 'Lithistida' families belong to the order Astrophorida, whereas Scleritodermidae and Siphonidiidae form a separate monophyletic clade within Tetractinellida. Most lithistid astrophorids are dispersed between different clades of the Astrophorida and we propose to formally reallocate them, respectively. Corallistidae, Theonellidae and Phymatellidae are monophyletic, whereas the families Pleromidae and Scleritodermidae are polyphyletic. Family Desmanthidae is polyphyletic and groups within Halichondriidae--we formally propose a reallocation. The sister group relationship of the family Vetulinidae to Spongillida is confirmed and we propose here for the first time to include Vetulina into a new Order Sphaerocladina. Megascleres and microscleres possibly evolved and/or were lost several times independently in different 'lithistid' taxa, and
PhyloSift: phylogenetic analysis of genomes and metagenomes.
Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A
2014-01-01
Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).
PhyloSift: phylogenetic analysis of genomes and metagenomes
Directory of Open Access Journals (Sweden)
Aaron E. Darling
2014-01-01
Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.
Phylogenetic comparative methods on phylogenetic networks with reticulations.
Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile
2018-04-25
The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.
De Palma, Adriana; Kuhlmann, Michael; Bugter, Rob; Ferrier, Simon; Hoskins, Andrew J; Potts, Simon G; Roberts, Stuart P M; Schweiger, Oliver; Purvis, Andy
2017-12-01
Agricultural intensification and urbanization are important drivers of biodiversity change in Europe. Different aspects of bee community diversity vary in their sensitivity to these pressures, as well as independently influencing ecosystem service provision (pollination). To obtain a more comprehensive understanding of human impacts on bee diversity across Europe, we assess multiple, complementary indices of diversity. One Thousand four hundred and forty six sites across Europe. We collated data on bee occurrence and abundance from the published literature and supplemented them with the PREDICTS database. Using Rao's Quadratic Entropy, we assessed how species, functional and phylogenetic diversity of 1,446 bee communities respond to land-use characteristics including land-use class, cropland intensity, human population density and distance to roads. We combined these models with statistically downscaled estimates of land use in 2005 to estimate and map-at a scale of approximately 1 km 2 -the losses in diversity relative to semi-natural/natural baseline (the predicted diversity of an uninhabited grid square, consisting only of semi-natural/natural vegetation). We show that-relative to the predicted local diversity in uninhabited semi-natural/natural habitat-half of all EU27 countries have lost over 10% of their average local species diversity and two-thirds of countries have lost over 5% of their average local functional and phylogenetic diversity. All diversity measures were generally lower in pasture and higher-intensity cropland than in semi-natural/natural vegetation, but facets of diversity showed less consistent responses to human population density. These differences have led to marked spatial mismatches in losses: losses in phylogenetic diversity were in some areas almost 20 percentage points (pp.) more severe than losses in species diversity, but in other areas losses were almost 40 pp. less severe. These results highlight the importance of exploring
Sazmand, Alireza; Eigner, Barbara; Mirzaei, Mohammad; Hekmatimoghaddam, Seyedhossein; Harl, Josef; Duscher, Georg Gerhard; Fuehrer, Hans-Peter; Joachim, Anja
2016-04-01
Despite the economic importance of camels, the parasites that affect them have not received adequate attention so far and molecular studies are scarce compared to other livestock. In this study, we characterized peripheral blood microfilariae in 200 healthy one-humped camels (Camelus dromedarius) from south-east Iran by microscopy and molecular tools to receive a more detailed insight into prevalence and species that affect them. Moreover, adult specimens of the filarial nematode Dipetalonema evansi were collected from the carcass of an infected animal. Microscopic examination was performed on Giemsa-stained blood smears, and blood was also spotted on Whatman FTA(®) cards for DNA analysis. Genomic DNA was extracted, and PCR was carried out for the detection of filaroid helminths, followed by sequence analysis of positive samples. Four samples were positive for microfilariae by microscopy, while 16 animals (8 %) were positive by PCR. Sequence analysis revealed D. evansi in all cases. Phylogenetic analysis of a cytochrome C oxidase subunit I (COI) sequence of filaroid nematodes showed that most species in a single genus cluster in the same clade; however, D. evansi and D. gracile are not monophyletic and branch rather at the base of the tree. Further studies on the life cycle of D. evansi, specifically the identification of intermediate host(s), have become feasible with the provision of the first specific COI sequences in this study.
Purschke, Oliver; Michalski, Stefan G; Bruelheide, Helge; Durka, Walter
2017-12-01
Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic turnover across phylogenetic scales, accounting for covariation with environmental differences. We compared phylogenetic turnover, at the species- and individual-level, within and between five successional stages, representing woody plant communities in a subtropical forest chronosequence. We decomposed turnover at different phylogenetic depths and assessed its covariation with between-plot abiotic differences. Phylogenetic turnover between stages was low relative to species turnover and was not explained by abiotic differences. However, within the late-successional stages, there was high presence-/absence-based turnover (clustering) that occurred deep in the phylogeny and covaried with environmental differentiation. Our results support a deterministic model of community assembly where (i) phylogenetic composition is constrained through successional time, but (ii) toward late succession, species sorting into preferred habitats according to niche traits that are conserved deep in phylogeny, becomes increasingly important.
Whelan, Simon
2007-10-01
Phylogenetic tree estimation plays a critical role in a wide variety of molecular studies, including molecular systematics, phylogenetics, and comparative genomics. Finding the optimal tree relating a set of sequences using score-based (optimality criterion) methods, such as maximum likelihood and maximum parsimony, may require all possible trees to be considered, which is not feasible even for modest numbers of sequences. In practice, trees are estimated using heuristics that represent a trade-off between topological accuracy and speed. I present a series of novel algorithms suitable for score-based phylogenetic tree reconstruction that demonstrably improve the accuracy of tree estimates while maintaining high computational speeds. The heuristics function by allowing the efficient exploration of large numbers of trees through novel hill-climbing and resampling strategies. These heuristics, and other computational approximations, are implemented for maximum likelihood estimation of trees in the program Leaphy, and its performance is compared to other popular phylogenetic programs. Trees are estimated from 4059 different protein alignments using a selection of phylogenetic programs and the likelihoods of the tree estimates are compared. Trees estimated using Leaphy are found to have equal to or better likelihoods than trees estimated using other phylogenetic programs in 4004 (98.6%) families and provide a unique best tree that no other program found in 1102 (27.1%) families. The improvement is particularly marked for larger families (80 to 100 sequences), where Leaphy finds a unique best tree in 81.7% of families.
Directory of Open Access Journals (Sweden)
Sharad Tiwari
2013-01-01
Full Text Available Plant seeds that have high phytate content are used as animal feed. Phytases, enzymes that catalyze the breakdown of phytate into inorganic phosphorus and myoinositol phosphate derivatives, have been intensively studied in recent years and gained immense attention because of their application in reducing phytate content in animal feed and food for human consumption, thus indirectly lowering environmental pollution caused by undigested phytate. This review is focused on summarising the current knowledge on recent developments of fungal and yeast phytases. Comparative account on diverse sources and physiological roles, molecular characteristics and regulation mechanisms of phytases are discussed. Phylogenetic relationship of phytases from different classes of fungi is studied in details. It is inferred on the basis of phylogeny that phytases from Ascomycetes and Basidiomycetes differ in the amino acid sequences, therefore they fall in separate clade in the tree. The prospective biotechnological applications of microbial phytases such as animal feed additives, probiotics, pharmaceuticals, as well as in aquaculture, food industry, paper manufacturing, development of transgenic plants and animals with special reference to its use as biofertilizers are also emphasised in this review.
Jouladeh Roudbar,Arash; Eagderi,Soheil; Esmaeili,Hamid Reza; Coad,Brian; Bogutskaya,Nina
2016-01-01
Abstract The molecular status of nine species of the genus Alburnoides from different river drainages in Iran and additionally by seven species from Europe was assessed. mtDNA COI gene sequences from freshly collected specimens and available NCBI data revealed four major phylogenetic lineages. Based on the results, a distinct taxon from the Cheshmeh Ali (Ali Spring), a Damghan River tributary in the endorheic Dasht-e Kavir basin, northern Iran, which is the closest sister to Alburnoides namak...
The rhabdoviruses: biodiversity, phylogenetics, and evolution.
Kuzmin, I V; Novella, I S; Dietzgen, R G; Padhi, A; Rupprecht, C E
2009-07-01
Rhabdoviruses (family Rhabdoviridae) include a diversity of important pathogens of animals and plants. They share morphology and genome organization. The understanding of rhabdovirus phylogeny, ecology and evolution has progressed greatly during the last 30 years, due to enhanced surveillance and improved methodologies of molecular characterization. Along with six established genera, several phylogenetic groups at different levels were described within the Rhabdoviridae. However, comparative relationships between viral phylogeny and taxonomy remains incomplete, with multiple representatives awaiting further genetic characterization. The same is true for rhabdovirus evolution. To date, rather simplistic molecular clock models only partially describe the evolutionary dynamics of postulated viral lineages. Ongoing progress in viral evolutionary and ecological investigations will provide the platform for future studies of this diverse family.
Shen, Xing-Xing; Salichos, Leonidas; Rokas, Antonis
2016-09-02
Molecular phylogenetic inference is inherently dependent on choices in both methodology and data. Many insightful studies have shown how choices in methodology, such as the model of sequence evolution or optimality criterion used, can strongly influence inference. In contrast, much less is known about the impact of choices in the properties of the data, typically genes, on phylogenetic inference. We investigated the relationships between 52 gene properties (24 sequence-based, 19 function-based, and 9 tree-based) with each other and with three measures of phylogenetic signal in two assembled data sets of 2,832 yeast and 2,002 mammalian genes. We found that most gene properties, such as evolutionary rate (measured through the percent average of pairwise identity across taxa) and total tree length, were highly correlated with each other. Similarly, several gene properties, such as gene alignment length, Guanine-Cytosine content, and the proportion of tree distance on internal branches divided by relative composition variability (treeness/RCV), were strongly correlated with phylogenetic signal. Analysis of partial correlations between gene properties and phylogenetic signal in which gene evolutionary rate and alignment length were simultaneously controlled, showed similar patterns of correlations, albeit weaker in strength. Examination of the relative importance of each gene property on phylogenetic signal identified gene alignment length, alongside with number of parsimony-informative sites and variable sites, as the most important predictors. Interestingly, the subsets of gene properties that optimally predicted phylogenetic signal differed considerably across our three phylogenetic measures and two data sets; however, gene alignment length and RCV were consistently included as predictors of all three phylogenetic measures in both yeasts and mammals. These results suggest that a handful of sequence-based gene properties are reliable predictors of phylogenetic signal
Eder, Wolfgang; Ives Torres-Silva, Ana; Hohenegger, Johann
2017-04-01
Phylogenetic analysis and trees based on molecular data are broadly applied and used to infer genetical and biogeographic relationship in recent larger foraminifera. Molecular phylogenetic is intensively used within recent nummulitids, however for fossil representatives these trees are only of minor informational value. Hence, within paleontological studies a phylogenetic approach through morphometric analysis is of much higher value. To tackle phylogenetic relationships within the nummulitid family, a much higher number of morphological character must be measured than are commonly used in biometric studies, where mostly parameters describing embryonic size (e.g., proloculus diameter, deuteroloculus diameter) and/or the marginal spiral (e.g., spiral diagrams, spiral indices) are studied. For this purpose 11 growth-independent and/or growth-invariant characters have been used to describe the morphological variability of equatorial thin sections of seven Carribbean nummulitid taxa (Nummulites striatoreticulatus, N. macgillavry, Palaeonummulites willcoxi, P.floridensis, P. soldadensis, P.trinitatensis and P.ocalanus) and one outgroup taxon (Ranikothalia bermudezi). Using these characters, phylogenetic trees were calculated using a restricted maximum likelihood algorithm (REML), and results are cross-checked by ordination and cluster analysis. Square-change parsimony method has been run to reconstruct ancestral states, as well as to simulate the evolution of the chosen characters along the calculated phylogenetic tree and, independent - contrast analysis was used to estimate confidence intervals. Based on these simulations, phylogenetic tendencies of certain characters proposed for nummulitids (e.g., Cope's rule or nepionic acceleration) can be tested, whether these tendencies are valid for the whole family or only for certain clades. At least, within the Carribean nummulitids, phylogenetic trends along some growth-independent characters of the embryo (e.g., first
TreeScaper: Visualizing and Extracting Phylogenetic Signal from Sets of Trees.
Huang, Wen; Zhou, Guifang; Marchand, Melissa; Ash, Jeremy R; Morris, David; Van Dooren, Paul; Brown, Jeremy M; Gallivan, Kyle A; Wilgenbusch, Jim C
2016-12-01
Modern phylogenomic analyses often result in large collections of phylogenetic trees representing uncertainty in individual gene trees, variation across genes, or both. Extracting phylogenetic signal from these tree sets can be challenging, as they are difficult to visualize, explore, and quantify. To overcome some of these challenges, we have developed TreeScaper, an application for tree set visualization as well as the identification of distinct phylogenetic signals. GUI and command-line versions of TreeScaper and a manual with tutorials can be downloaded from https://github.com/whuang08/TreeScaper/releases TreeScaper is distributed under the GNU General Public License. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
PyElph - a software tool for gel images analysis and phylogenetics
Directory of Open Access Journals (Sweden)
Pavel Ana Brânduşa
2012-01-01
Full Text Available Abstract Background This paper presents PyElph, a software tool which automatically extracts data from gel images, computes the molecular weights of the analyzed molecules or fragments, compares DNA patterns which result from experiments with molecular genetic markers and, also, generates phylogenetic trees computed by five clustering methods, using the information extracted from the analyzed gel image. The software can be successfully used for population genetics, phylogenetics, taxonomic studies and other applications which require gel image analysis. Researchers and students working in molecular biology and genetics would benefit greatly from the proposed software because it is free, open source, easy to use, has a friendly Graphical User Interface and does not depend on specific image acquisition devices like other commercial programs with similar functionalities do. Results PyElph software tool is entirely implemented in Python which is a very popular programming language among the bioinformatics community. It provides a very friendly Graphical User Interface which was designed in six steps that gradually lead to the results. The user is guided through the following steps: image loading and preparation, lane detection, band detection, molecular weights computation based on a molecular weight marker, band matching and finally, the computation and visualization of phylogenetic trees. A strong point of the software is the visualization component for the processed data. The Graphical User Interface provides operations for image manipulation and highlights lanes, bands and band matching in the analyzed gel image. All the data and images generated in each step can be saved. The software has been tested on several DNA patterns obtained from experiments with different genetic markers. Examples of genetic markers which can be analyzed using PyElph are RFLP (Restriction Fragment Length Polymorphism, AFLP (Amplified Fragment Length Polymorphism, RAPD
Rüping, Boris; Ernst, Antonia M; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A
2010-10-08
The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome. The unexpected
Arnan, Xavier; Cerdá, Xim; Retana, Javier
2015-01-01
We analyze the relative contribution of environmental and spatial variables to the alpha and beta components of taxonomic (TD), phylogenetic (PD), and functional (FD) diversity in ant communities found along different climate and anthropogenic disturbance gradients across western and central Europe, in order to assess the mechanisms structuring ant biodiversity. To this aim we calculated alpha and beta TD, PD, and FD for 349 ant communities, which included a total of 155 ant species; we examined 10 functional traits and phylogenetic relatedness. Variation partitioning was used to examine how much variation in ant diversity was explained by environmental and spatial variables. Autocorrelation in diversity measures and each trait's phylogenetic signal were also analyzed. We found strong autocorrelation in diversity measures. Both environmental and spatial variables significantly contributed to variation in TD, PD, and FD at both alpha and beta scales; spatial structure had the larger influence. The different facets of diversity showed similar patterns along environmental gradients. Environment explained a much larger percentage of variation in FD than in TD or PD. All traits demonstrated strong phylogenetic signals. Our results indicate that environmental filtering and dispersal limitations structure all types of diversity in ant communities. Strong dispersal limitations appear to have led to clustering of TD, PD, and FD in western and central Europe, probably because different historical and evolutionary processes generated different pools of species. Remarkably, these three facets of diversity showed parallel patterns along environmental gradients. Trait-mediated species sorting and niche conservatism appear to structure ant diversity, as evidenced by the fact that more variation was explained for FD and that all traits had strong phylogenetic signals. Since environmental variables explained much more variation in FD than in PD, functional diversity should be a
de Melo, Maíra Espíndola Silva; Cabral, Adriane Borges; Maciel, Maria Amélia Vieira; da Silveira, Vera Magalhães; de Souza Lopes, Ana Catarina
2011-05-01
The objectives of this study were to determine the distribution of phylogenetic groups among Klebsiella pneumoniae isolates from Recife, Brazil and to assess the relationship between the groups and the isolation sites and resistance profile. Ninety four isolates of K. pneumoniae from hospital or community infections and from normal microbiota were analyzed by gyrA PCR-RFLP, antibiotic susceptibility, and adonitol fermentation. The results revealed the distinction of three phylogenetic groups, as it has also been reported in Europe, showing that these clusters are highly conserved within K. pneumoniae. Group KpI was dominantly represented by hospital and community isolates while groups KpII and KpIII displayed mainly normal microbiota isolates. The resistance to third generation cephalosporins, aztreonam, imipenem, amoxicillin/clavulanic acid, and streptomycin was only observed in KpI. The percentage of resistance was higher in KpI, followed by KpII and KpIII. The differences in the distribution of K. pneumoniae phylogenetic groups observed in this study suggest distinctive clinical and epidemiological characteristics among the three groups, which is important to understand the epidemiology of infections caused by this organism. This is the first study in Brazil on K. pneumoniae isolates from normal microbiota and community infections regarding the distribution of phylogenetic groups based on the gyrA gene.
Molecular evidence for deep phylogenetic divergence in Mandrillus sphinx.
Telfer, P T; Souquière, S; Clifford, S L; Abernethy, K A; Bruford, M W; Disotell, T R; Sterner, K N; Roques, P; Marx, P A; Wickings, E J
2003-07-01
Mandrills (Mandrillus sphinx) are forest primates indigenous to western central Africa. Phylogenetic analysis of 267 base pairs (bp) of the cytochrome b gene from 53 mandrills of known and 17 of unknown provenance revealed two phylogeographical groups, with haplotypes differentiated by 2.6% comprising seven synonymous transitions. The distribution of the haplotypes suggests that the Ogooué River, Gabon, which bisects their range, separates mandrill populations in Cameroon and northern Gabon from those in southern Gabon. The haplotype distribution is also concordant with that of two known mandrill simian immunodeficiency viruses, suggesting that these two mandrill phylogroups have followed different evolutionary trajectories since separation.
Corduneanu, Alexandra; Hrazdilová, Kristýna; Sándor, Attila D; Matei, Ioana Adriana; Ionică, Angela Monica; Barti, Levente; Ciocănău, Marius-Alexandru; Măntoiu, Dragoş Ștefan; Coroiu, Ioan; Hornok, Sándor; Fuehrer, Hans-Peter; Leitner, Natascha; Bagó, Zoltán; Stefke, Katharina; Modrý, David; Mihalca, Andrei Daniel
2017-12-06
Babesia spp. are hemoparasites which infect the red blood cells of a large variety of mammals. In bats, the only known species of the genus is Babesia vesperuginis. However, except a few old reports, the host range and geographical distribution of this bat parasite have been poorly studied. This study aimed to investigate the presence of piroplasms in tissues of bats collected in four different countries from eastern and central Europe: Austria, Czech Republic, Hungary and Romania. A total of 461 bat carcasses (24 species) were collected between 2001 and 2016 from caves, mines and buildings. PCR was performed using specific primers targeting a portion of the 18S rDNA nuclear gene and cytochrome c oxidase subunit 1 mitochondrial gene, followed by sequencing. The results of this study show for the first time the presence of B. vesperuginis in bats in central and eastern Europe. The phylogenetic analysis of the 18S rDNA nuclear gene revealed no variability between the sequences and the phylogenetic analysis of the cox1 mitochondrial gene proved that B. vesperuginis could be divided into two subclades. Our study showed a broad geographical distribution of B. vesperuginis in European bats, reporting its presence in five new host species (M. cf. alcathoe, M. bechsteinii, M. myotis, Pi. nathusii and V. murinus) and three new countries.
Coalescent methods for estimating phylogenetic trees.
Liu, Liang; Yu, Lili; Kubatko, Laura; Pearl, Dennis K; Edwards, Scott V
2009-10-01
We review recent models to estimate phylogenetic trees under the multispecies coalescent. Although the distinction between gene trees and species trees has come to the fore of phylogenetics, only recently have methods been developed that explicitly estimate species trees. Of the several factors that can cause gene tree heterogeneity and discordance with the species tree, deep coalescence due to random genetic drift in branches of the species tree has been modeled most thoroughly. Bayesian approaches to estimating species trees utilizes two likelihood functions, one of which has been widely used in traditional phylogenetics and involves the model of nucleotide substitution, and the second of which is less familiar to phylogeneticists and involves the probability distribution of gene trees given a species tree. Other recent parametric and nonparametric methods for estimating species trees involve parsimony criteria, summary statistics, supertree and consensus methods. Species tree approaches are an appropriate goal for systematics, appear to work well in some cases where concatenation can be misleading, and suggest that sampling many independent loci will be paramount. Such methods can also be challenging to implement because of the complexity of the models and computational time. In addition, further elaboration of the simplest of coalescent models will be required to incorporate commonly known issues such as deviation from the molecular clock, gene flow and other genetic forces.
Deragon, Jean-Marc; Zhang, Xiaoyu
2006-12-01
Short interspersed elements (SINEs) are a class of dispersed mobile sequences that use RNA as an intermediate in an amplification process called retroposition. The presence-absence of a SINE at a given locus has been used as a meaningful classification criterion to evaluate phylogenetic relations among species. We review here recent developments in the characterisation of plant SINEs and their use as molecular makers to retrace phylogenetic relations among wild and cultivated Oryza and Brassica species. In Brassicaceae, further use of SINE markers is limited by our partial knowledge of endogenous SINE families (their origin and evolution histories) and by the absence of a clear classification. To solve this problem, phylogenetic relations among all known Brassicaceae SINEs were analyzed and a new classification, grouping SINEs in 15 different families, is proposed. The relative age and size of each Brassicaceae SINE family was evaluated and new phylogenetically supported subfamilies were described. We also present evidence suggesting that new potentially active SINEs recently emerged in Brassica oleracea from the shuffling of preexisting SINE portions. Finally, the comparative evolution history of SINE families present in Arabidopsis thaliana and Brassica oleracea revealed that SINEs were in general more active in the Brassica lineage. The importance of these new data for the use of Brassicaceae SINEs as molecular markers in future applications is discussed.
BLAST-EXPLORER helps you building datasets for phylogenetic analysis
Directory of Open Access Journals (Sweden)
Claverie Jean-Michel
2010-01-01
Full Text Available Abstract Background The right sampling of homologous sequences for phylogenetic or molecular evolution analyses is a crucial step, the quality of which can have a significant impact on the final interpretation of the study. There is no single way for constructing datasets suitable for phylogenetic analysis, because this task intimately depends on the scientific question we want to address, Moreover, database mining softwares such as BLAST which are routinely used for searching homologous sequences are not specifically optimized for this task. Results To fill this gap, we designed BLAST-Explorer, an original and friendly web-based application that combines a BLAST search with a suite of tools that allows interactive, phylogenetic-oriented exploration of the BLAST results and flexible selection of homologous sequences among the BLAST hits. Once the selection of the BLAST hits is done using BLAST-Explorer, the corresponding sequence can be imported locally for external analysis or passed to the phylogenetic tree reconstruction pipelines available on the Phylogeny.fr platform. Conclusions BLAST-Explorer provides a simple, intuitive and interactive graphical representation of the BLAST results and allows selection and retrieving of the BLAST hit sequences based a wide range of criterions. Although BLAST-Explorer primarily aims at helping the construction of sequence datasets for further phylogenetic study, it can also be used as a standard BLAST server with enriched output. BLAST-Explorer is available at http://www.phylogeny.fr
Molecular phylogenetic trees - On the validity of the Goodman-Moore augmentation algorithm
Holmquist, R.
1979-01-01
A response is made to the reply of Nei and Tateno (1979) to the letter of Holmquist (1978) supporting the validity of the augmentation algorithm of Moore (1977) in reconstructions of nucleotide substitutions by means of the maximum parsimony principle. It is argued that the overestimation of the augmented numbers of nucleotide substitutions (augmented distances) found by Tateno and Nei (1978) is due to an unrepresentative data sample and that it is only necessary that evolution be stochastically uniform in different regions of the phylogenetic network for the augmentation method to be useful. The importance of the average value of the true distance over all links is explained, and the relative variances of the true and augmented distances are calculated to be almost identical. The effects of topological changes in the phylogenetic tree on the augmented distance and the question of the correctness of ancestral sequences inferred by the method of parsimony are also clarified.
Directory of Open Access Journals (Sweden)
Oliver Voigt
Full Text Available Calcareous sponges (Phylum Porifera, Class Calcarea are known to be taxonomically difficult. Previous molecular studies have revealed many discrepancies between classically recognized taxa and the observed relationships at the order, family and genus levels; these inconsistencies question underlying hypotheses regarding the evolution of certain morphological characters. Therefore, we extended the available taxa and character set by sequencing the complete small subunit (SSU rDNA and the almost complete large subunit (LSU rDNA of additional key species and complemented this dataset by substantially increasing the length of available LSU sequences. Phylogenetic analyses provided new hypotheses about the relationships of Calcarea and about the evolution of certain morphological characters. We tested our phylogeny against competing phylogenetic hypotheses presented by previous classification systems. Our data reject the current order-level classification by again finding non-monophyletic Leucosolenida, Clathrinida and Murrayonida. In the subclass Calcinea, we recovered a clade that includes all species with a cortex, which is largely consistent with the previously proposed order Leucettida. Other orders that had been rejected in the current system were not found, but could not be rejected in our tests either. We found several additional families and genera polyphyletic: the families Leucascidae and Leucaltidae and the genus Leucetta in Calcinea, and in Calcaronea the family Amphoriscidae and the genus Ute. Our phylogeny also provided support for the vaguely suspected close relationship of several members of Grantiidae with giantortical diactines to members of Heteropiidae. Similarly, our analyses revealed several unexpected affinities, such as a sister group relationship between Leucettusa (Leucaltidae and Leucettidae and between Leucascandra (Jenkinidae and Sycon carteri (Sycettidae. According to our results, the taxonomy of Calcarea is in
Liao, Peng; Guo, Li; Wen, Yongjun; Yang, Yangling; Cheng, Shipeng
2015-01-01
In the present study, the genotype of two Canine distemper virus (CDV) strains, namely, ZJJ-SD and ZJJ-LN, were investigated, based on the whole hemagglutinin (HA) gene. The CDV strains were obtained from two foxes in Shandong Province and Liaoning Province in 2011. Phylogenetic analyses were carried out for 260 CDV strains worldwide, and a statistical analysis was performed in the amino acid substitutions at positions 530 and 549 of the HA protein. Phylogenetic analyses revealed that the two strains, ZJJ-SD and ZJJ-LN, belonged to the CDV Asia I lineage. Site 530 of HA protein was found to be relatively conserved within CDV lineages in different host species by combining the genetic sequence data with the published data from 260 CDV strains worldwide. The data analysis showed a bias toward the predicted substitution Y549H for the non-dog strains in Asia I and Europe lineages. The ratio of site 549 genetic drift in the HA gene were significantly different between dogs and non-dogs in the two lineages. The strain ZJJ-SD, from wild canid, has an Y549H substitution. It is one of three Y549H substitution for wild canids in Asia I lineages. Site 530 of HA protein was not immediately relative to CDV genetic drift from dogs to non-dogs. Statistical analysis indicated that non-dog strains have a high probability to contain Y549H than dog strains in Asia I and Europe lineages. Thus, site 549 is considered important in genetic drift from dogs to non-dogs, at least in Asia I and Europe lineages.
Singasa, Kanokwan; Songserm, Taweesak; Lertwatcharasarakul, Preeda; Arunvipas, Pipat
2017-10-01
Bovine coronavirus (BCoV) is involved mainly in enteric infections in cattle. This study reports the first molecular detection of BCoV in a diarrhea outbreak in dairy cows in the Central Region, Thailand. BCoV was molecularly detected from bloody diarrheic cattle feces by using nested PCR. Agarose gel electrophoresis of three diarrheic fecal samples yielded from the 25 samples desired amplicons that were 488 base pairs and sequencing substantiated that have BCoV. The sequence alignment indicated that nucleotide and amino acid sequences, the three TWD isolated in Thailand, were more quite homologous to each other (amino acid at position 39 of TWD1, TWD3 was proline, but TWD2 was serine) and closely related to OK-0514-3strain (virulent respiratory strain; RBCoV).The amino acid sequencing identities among TWD1, TWD2,TWD3, and OK-0514-3 strain were 96.0 to 96.6%, those at which T3I, H65N, D87G, H127Y, andQ136R were changed. In addition, the phylogenetic tree of the hypervariable region S1subunit spike glycoprotein BCoV gene was composed of three major clades by using the 54 sequences generated and showed that the evolutionally distance, TWD1, TWD2, and TWD3 were the isolated group together and most similar to OK-0514-3 strain (98.2 to 98.5% similarity). Further study will develop ELISA assay for serologic detection of winter dysentery disease.
Liu, Di; Zhang, Xiang-Bin; Yan, Zhuan-Qiang; Chen, Feng; Ji, Jun; Qin, Jian-Ping; Li, Hai-Yan; Lu, Jun-Peng; Xue, Yu; Liu, Jia-Jia; Xie, Qing-Mei; Ma, Jing-Yun; Xue, Chun-Yi; Bee, Ying-Zuo
2013-06-01
Infectious bursal disease virus (IBDV) is a double-stranded RNA virus that causes immunosuppressive disease in young chickens. Thousands of cases of IBDV infection are reported each year in South China, and these infections can result in considerable economic losses to the poultry industry. To monitor variations of the virus during the outbreaks, 30 IBDVs were identified from vaccinated chicken flocks from nine provinces in South China in 2011. VP2 fragments from different virus strains were sequenced and analyzed by comparison with the published sequences of IBDV strains from China and around the world. Phylogenetic analysis of hypervariable regions of the VP2 (vVP2) gene showed that 29 of the isolates were very virulent (vv) IBDVs, and were closely related to vvIBDV strains from Europe and Asia. Alignment analysis of the deduced amino acid (aa) sequences of vVP2 showed the 29 vv isolates had high uniformity, indicated low variability and slow evolution of the virus. The non-vvIBDV isolate JX2-11 was associated with higher than expected mortality, and had high deduced aa sequence similarity (99.2 %) with the attenuated vaccine strain B87 (BJ). The present study has demonstrated the continued circulation of IBDV strains in South China, and emphasizes the importance of reinforcing IBDV surveillance.
Groth, J G
1998-12-01
The complete mitochondrial cytochrome b genes of 53 genera of oscine passerine birds representing the major groups of finches and some allies were compared. Phylogenetic trees resulting from three levels of character partition removal (no data removed, transitions at third positions of codons removed, and all transitions removed [transversion parsimony]) were generally concordant, and all supported several basic statements regarding relationships of finches and finch-like birds, including: (1) larks (Alaudidae) show no close relationship to any finch group; (2) Peucedramus (olive warbler) is phylogenetically far removed from true wood warblers; (3) a clade consisting of fringillids, passerids, motacillids, and emberizids is supported, and this clade is characterized by evolution of a vestigial 10th wing primary; and (4) Hawaiian honeycreepers are derived from within the cardueline finches. Excluding transition substitutions at third positions of codons resulted in phylogenetic trees similar to, but with greater bootstrap nodal support than, trees derived using either all data (equally weighted) or transversion parsimony. Relative to the shortest trees obtained using all data, the topologies obtained after elimination of third-position transitions showed only slight increases in realized treelength and homoplasy. These increases were negligable compared to increases in overall nodal support; therefore, this partition removal scheme may enhance recovery of deep phylogenetic signal in protein-coding DNA datasets. Copyright 1998 Academic Press.
On the origin of the treponematoses: a phylogenetic approach.
Directory of Open Access Journals (Sweden)
Kristin N Harper
2008-01-01
Full Text Available Since the first recorded epidemic of syphilis in 1495, controversy has surrounded the origins of the bacterium Treponema pallidum subsp. pallidum and its relationship to the pathogens responsible for the other treponemal diseases: yaws, endemic syphilis, and pinta. Some researchers have argued that the syphilis-causing bacterium, or its progenitor, was brought from the New World to Europe by Christopher Columbus and his men, while others maintain that the treponematoses, including syphilis, have a much longer history on the European continent.We applied phylogenetics to this problem, using data from 21 genetic regions examined in 26 geographically disparate strains of pathogenic Treponema. Of all the strains examined, the venereal syphilis-causing strains originated most recently and were more closely related to yaws-causing strains from South America than to other non-venereal strains. Old World yaws-causing strains occupied a basal position on the tree, indicating that they arose first in human history, and a simian strain of T. pallidum was found to be indistinguishable from them.Our results lend support to the Columbian theory of syphilis's origin while suggesting that the non-sexually transmitted subspecies arose earlier in the Old World. This study represents the first attempt to address the problem of the origin of syphilis using molecular genetics, as well as the first source of information regarding the genetic make-up of non-venereal strains from the Western hemisphere.
Liu, An; Yi, Zhenzhen; Lin, Xiaofeng; Hu, Xiaozhong; Al-Farraj, Saleh A.; Al-Rasheid, Khaled A. S.
2015-08-01
Prostomates and haptorians are two basal groups of ciliates with limited morphological characteristics available for taxonomy. Morphologically, the structures used to identify prostomates and haptorians are similar or even identical, which generate heavy taxonomic and phylogenetic confusion. In present work, phylogenetic positions lineage of two rare genera, Plagiopogon and Askenasia, were investigated. Three genes including small subunit ribosomal RNA gene (hereafter SSU rDNA), internal transcribed spacer region (ITS region), and large subunit ribosomal RNA gene (LSU rDNA) were analyzed, 10 new sequences five species each. Our findings included 1) class Prostomatea and order Haptorida are multiphyletic; 2) it may not be appropriate to place order Cyclotrichiida in subclass Haptoria, and the systematic lineage of order Cyclotrichiida needs to be verified further; 3) genus Plagiopogon branches consistently within a clade covering most prostomes and is basal of clade Colepidae, implying its close lineage to Prostomatea; and 4) Askenasia is phylogenetically distant from the subclass Haptoria but close to classes Prostomatea, Plagiopylea and Oligohymenophorea. We supposed that the toxicyst of Askenasia may be close to taxa of prostomes instead of haptorians, and the dorsal brush is a more typical morphological characteristics of haptorians than toxicysts.
Schuster, Astrid; Erpenbeck, Dirk; Pisera, Andrzej; Hooper, John; Bryce, Monika; Fromont, Jane; Wörheide, Gert
2015-01-01
Reconciling the fossil record with molecular phylogenies to enhance the understanding of animal evolution is a challenging task, especially for taxa with a mostly poor fossil record, such as sponges (Porifera). ‘Lithistida’, a polyphyletic group of recent and fossil sponges, are an exception as they provide the richest fossil record among demosponges. Lithistids, currently encompassing 13 families, 41 genera and >300 recent species, are defined by the common possession of peculiar siliceous spicules (desmas) that characteristically form rigid articulated skeletons. Their phylogenetic relationships are to a large extent unresolved and there has been no (taxonomically) comprehensive analysis to formally reallocate lithistid taxa to their closest relatives. This study, based on the most comprehensive molecular and morphological investigation of ‘lithistid’ demosponges to date, corroborates some previous weakly-supported hypotheses, and provides novel insights into the evolutionary relationships of the previous ‘order Lithistida’. Based on molecular data (partial mtDNA CO1 and 28S rDNA sequences), we show that 8 out of 13 ‘Lithistida’ families belong to the order Astrophorida, whereas Scleritodermidae and Siphonidiidae form a separate monophyletic clade within Tetractinellida. Most lithistid astrophorids are dispersed between different clades of the Astrophorida and we propose to formally reallocate them, respectively. Corallistidae, Theonellidae and Phymatellidae are monophyletic, whereas the families Pleromidae and Scleritodermidae are polyphyletic. Family Desmanthidae is polyphyletic and groups within Halichondriidae – we formally propose a reallocation. The sister group relationship of the family Vetulinidae to Spongillida is confirmed and we propose here for the first time to include Vetulina into a new Order Sphaerocladina. Megascleres and microscleres possibly evolved and/or were lost several times independently in different
Detection of Horizontal Gene Transfers from Phylogenetic Comparisons
Pylro, Victor Satler; Vespoli, Luciano de Souza; Duarte, Gabriela Frois; Yotoko, Karla Suemy Clemente
2012-01-01
Bacterial phylogenies have become one of the most important challenges for microbial ecology. This field started in the mid-1970s with the aim of using the sequence of the small subunit ribosomal RNA (16S) tool to infer bacterial phylogenies. Phylogenetic hypotheses based on other sequences usually give conflicting topologies that reveal different evolutionary histories, which in some cases may be the result of horizontal gene transfer events. Currently, one of the major goals of molecular biology is to understand the role that horizontal gene transfer plays in species adaptation and evolution. In this work, we compared the phylogenetic tree based on 16S with the tree based on dszC, a gene involved in the cleavage of carbon-sulfur bonds. Bacteria of several genera perform this survival task when living in environments lacking free mineral sulfur. The biochemical pathway of the desulphurization process was extensively studied due to its economic importance, since this step is expensive and indispensable in fuel production. Our results clearly show that horizontal gene transfer events could be detected using common phylogenetic methods with gene sequences obtained from public sequence databases. PMID:22675653
Phylogenetic signal dissection identifies the root of starfishes.
Directory of Open Access Journals (Sweden)
Roberto Feuda
Full Text Available Relationships within the class Asteroidea have remained controversial for almost 100 years and, despite many attempts to resolve this problem using molecular data, no consensus has yet emerged. Using two nuclear genes and a taxon sampling covering the major asteroid clades we show that non-phylogenetic signal created by three factors--Long Branch Attraction, compositional heterogeneity and the use of poorly fitting models of evolution--have confounded accurate estimation of phylogenetic relationships. To overcome the effect of this non-phylogenetic signal we analyse the data using non-homogeneous models, site stripping and the creation of subpartitions aimed to reduce or amplify the systematic error, and calculate Bayes Factor support for a selection of previously suggested topological arrangements of asteroid orders. We show that most of the previous alternative hypotheses are not supported in the most reliable data partitions, including the previously suggested placement of either Forcipulatida or Paxillosida as sister group to the other major branches. The best-supported solution places Velatida as the sister group to other asteroids, and the implications of this finding for the morphological evolution of asteroids are presented.
Rebelo, Hugo; Froufe, Elsa; Brito, José C; Russo, Danilo; Cistrone, Luca; Ferrand, Nuno; Jones, Gareth
2012-06-01
The barbastelle (Barbastella barbastellus) is a rare forest bat with a wide distribution in Europe. Here, we combine results from the analysis of two mtDNA fragments with species distribution modelling to determine glacial refugia and postglacial colonization routes. We also investigated whether niche conservatism occurs in this species. Glacial refugia were identified in the three southern European peninsulas: Iberia, Italy and the Balkans. These latter two refugia played a major role in the postglacial colonization process, with their populations expanding to England and central Europe, respectively. Palaeo-distribution models predicted that suitable climatic conditions existed in the inferred refugia during the last glacial maximum (LGM). Nevertheless, the overlap between the current and the LGM distributions was almost inexistent in Italy and in the Balkans, meaning that B. barbastellus populations were forced to shift range between glacial and interglacial periods, a process that probably caused some local extinctions. In contrast, Iberian populations showed a 'refugia within refugium' pattern, with two unconnected areas containing stable populations (populations that subsisted during both glacial and interglacial phases). Moreover, the match between LGM models and the refugial areas determined by molecular analysis supported the hypothesis of niche conservatism in B. barbastellus. We argue that geographic patterns of genetic structuring, altogether with the modelling results, indicate the existence of four management units for conservation: Morocco, Iberia, Italy and UK, and Balkans and central Europe. In addition, all countries sampled possessed unique gene pools, thus stressing the need for the conservation of local populations. © 2012 Blackwell Publishing Ltd.
Human, Brett A; Owen, E Patricia; Compagno, Leonard J V; Harley, Eric H
2006-05-01
A molecular phylogenetic investigation was conducted to examine phylogenetic relationships between various members of the catsharks (Chondrichthyes; Carcharhiniformes; Scyliorhinidae), and is the largest chondrichthyan data set yet analysed, consisting of nearly 130,000 nucleotides. Three mitochondrial DNA genes were used to construct the phylogenies, cytochrome b, NADH-2, and NADH-4, with 41 sequences from 18 taxa being novel. These sequences were either used separately or combined into a single data set, and phylogenies were constructed using various methods, however, only the Bayesian inference tree derived from the cytochrome b data set was resolved sufficiently for phylogenetic inferences to be made. Interestingly, the family Scyliorhinidae was not supported by the results and was found to be paraphyletic. The Scyliorhininae and Pentanchinae were supported, whereas the Pentanchini clade was present, but not well supported. The Halaelurini hypothesis was supported with Holohalaelurus identified as the basal genus of that clade, and Haploblepharus edwardsii identified as the basal taxon for that genus. Elsewhere within the Chondrichthyes, the Carcharhiniformes and the Lamniformes were found to be monophyletic, and the Heterodontiformes was placed within the Squalimorphs. The placement of the skates and rays in these analyses support the Batoidea as being sister to the Elasmobranchii.
Bayesian phylogenetic estimation of fossil ages.
Drummond, Alexei J; Stadler, Tanja
2016-07-19
Recent advances have allowed for both morphological fossil evidence and molecular sequences to be integrated into a single combined inference of divergence dates under the rule of Bayesian probability. In particular, the fossilized birth-death tree prior and the Lewis-Mk model of discrete morphological evolution allow for the estimation of both divergence times and phylogenetic relationships between fossil and extant taxa. We exploit this statistical framework to investigate the internal consistency of these models by producing phylogenetic estimates of the age of each fossil in turn, within two rich and well-characterized datasets of fossil and extant species (penguins and canids). We find that the estimation accuracy of fossil ages is generally high with credible intervals seldom excluding the true age and median relative error in the two datasets of 5.7% and 13.2%, respectively. The median relative standard error (RSD) was 9.2% and 7.2%, respectively, suggesting good precision, although with some outliers. In fact, in the two datasets we analyse, the phylogenetic estimate of fossil age is on average less than 2 Myr from the mid-point age of the geological strata from which it was excavated. The high level of internal consistency found in our analyses suggests that the Bayesian statistical model employed is an adequate fit for both the geological and morphological data, and provides evidence from real data that the framework used can accurately model the evolution of discrete morphological traits coded from fossil and extant taxa. We anticipate that this approach will have diverse applications beyond divergence time dating, including dating fossils that are temporally unconstrained, testing of the 'morphological clock', and for uncovering potential model misspecification and/or data errors when controversial phylogenetic hypotheses are obtained based on combined divergence dating analyses.This article is part of the themed issue 'Dating species divergences using
Molecular and phylogenetic evidence of chikungunya virus circulating in Assam, India
Directory of Open Access Journals (Sweden)
Prafulla Dutta
2017-01-01
Full Text Available Purpose: Northeast Region of India possesses an abundant number of Aedes mosquitoes, the common vector for Dengue and Chikungunya (CHIK. Dengue is reported every year from Assam, but active surveillance for CHIK virus (CHIKV infection is lacking in this part of India. Therefore, this present study has been undertaken to detect any CHIKV infection during a dengue outbreak in Assam. Materials and Methods: A total of 42 dengue negative samples collected from Guwahati were screened for the presence of CHIK IgM antibodies. Further, all the samples were processed for CHIKV RNA detection by reverse transcriptase-polymerase chain reaction (RT-PCR. Phylogenetic analysis was done by Maximum Likelihood method using Kimura-2 parameter model. Results: No IgM positivity was found in the processed samples; however, 7 samples were positive for CHIKV by RT-PCR. Phylogenetic analysis revealed that the circulating CHIKV belonged to Eastern, Central and Southern African genotype. Sequence analysis showed two uniform nucleotide substitutions and very less amino acid substitution. Conclusion: Silent existence of CHIKV beside dengue is reported from this study. Therefore, CHIKV diagnosis should be included as a regular practice for active surveillance of the disease and its accomplishment before commencing an outbreak.
Directory of Open Access Journals (Sweden)
Faruku Bande
2014-01-01
Full Text Available A nested PCR assay was used to determine the viral RNA and proviral DNA status of naturally infected cats. Selected samples that were FeLV-positive by PCR were subjected to sequencing, phylogenetic analysis, and motifs search. Of the 39 samples that were positive for FeLV p27 antigen, 87.2% (34/39 were confirmed positive with nested PCR. FeLV proviral DNA was detected in 38 (97.3% of p27-antigen negative samples. Malaysian FeLV isolates are found to be highly similar with a homology of 91% to 100%. Phylogenetic analysis revealed that Malaysian FeLV isolates divided into two clusters, with a majority (86.2% sharing similarity with FeLV-K01803 and fewer isolates (13.8% with FeLV-GM1 strain. Different enhancer motifs including NF-GMa, Krox-20/WT1I-del2, BAF1, AP-2, TBP, TFIIF-beta, TRF, and TFIID are found to occur either in single, duplicate, triplicate, or sets of 5 in different positions within the U3-LTR-gag region. The present result confirms the occurrence of FeLV viral RNA and provirus DNA in naturally infected cats. Malaysian FeLV isolates are highly similar, and a majority of them are closely related to a UK isolate. This study provides the first molecular based information on FeLV in Malaysia. Additionally, different enhancer motifs likely associated with FeLV related pathogenesis have been identified.
Directory of Open Access Journals (Sweden)
Anna Claudia Baumel Mongruel
2017-08-01
Full Text Available Abstract Wild animals play an important role in carrying vectors that may potentially transmit pathogens. Several reports highlighted the participation of wild animals on the Anaplasma phagocytophilum cycle, including as hosts of the agent. The aim of this study was to report the molecular detection of an agent phylogenetically related to A. phagocytophilum isolated from a wild bird in the Midwest of the state of Paraná, Brazil. Fifteen blood samples were collected from eleven different bird species in the Guarapuava region. One sample collected from a Penelope obscura bird was positive in nested PCR targeting the 16S rRNA gene of Anaplasma spp. The phylogenetic tree based on the Maximum Likelihood analysis showed that the sequence obtained was placed in the same clade with A. phagocytophilum isolated from domestic cats in Brazil. The present study reports the first molecular detection of a phylogenetically related A. phagocytophilum bacterium in a bird from Paraná State.
Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.
Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R
2013-01-01
The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.
Directory of Open Access Journals (Sweden)
Donald Davesne
2016-11-01
Full Text Available Acanthomorpha (spiny-rayed fishes is a clade of teleosts that includes more than 15 000 extant species. Their deep phylogenetic intrarelationships, first reconstructed using morphological characters, have been extensively revised with molecular data. Moreover, the deep branches of the acanthomorph tree are still largely unresolved, with strong disagreement between studies. Here, we review the historical propositions for acanthomorph deep intrarelationships and attempt to resolve their earliest branching patterns using a new morphological data matrix compiling and revising characters from previous studies. The taxon sampling we use constitutes a first attempt to test all previous hypotheses (molecular and morphological alike with morphological data only. Our sampling also includes Late Cretaceous fossil taxa, which yield new character state combinations that are absent in extant taxa. Analysis of the complete morphological data matrix yields a new topology that shows remarkable congruence with the well-supported molecular results. Lampridiformes (oarfishes and allies are the sister to all other acanthomorphs. Gadiformes (cods and allies and Zeiformes (dories form a clade with Percopsiformes (trout-perches and the enigmatic Polymixia (beardfish and Stylephorus (tube-eye. Ophidiiformes (cusk-eels and allies and Batrachoidiformes (toadfishes are nested within Percomorpha, the clade that includes most of modern acanthomorph diversity. These results provide morphological synapomorphies and independent corroboration of clades previously only recovered from molecular data, thereby suggesting the emergence of a congruent picture of acanthomorph deep intrarelationships. Fossil taxa play a critical role in achieving this congruence, since a very different topology is found when they are excluded from the analysis.
Purschke, Oliver; Michalski, Stefan G.; Bruelheide, Helge; Durka, Walter
2017-01-01
Abstract Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic ...
Phylogenetic mixtures and linear invariants for equal input models.
Casanellas, Marta; Steel, Mike
2017-04-01
The reconstruction of phylogenetic trees from molecular sequence data relies on modelling site substitutions by a Markov process, or a mixture of such processes. In general, allowing mixed processes can result in different tree topologies becoming indistinguishable from the data, even for infinitely long sequences. However, when the underlying Markov process supports linear phylogenetic invariants, then provided these are sufficiently informative, the identifiability of the tree topology can be restored. In this paper, we investigate a class of processes that support linear invariants once the stationary distribution is fixed, the 'equal input model'. This model generalizes the 'Felsenstein 1981' model (and thereby the Jukes-Cantor model) from four states to an arbitrary number of states (finite or infinite), and it can also be described by a 'random cluster' process. We describe the structure and dimension of the vector spaces of phylogenetic mixtures and of linear invariants for any fixed phylogenetic tree (and for all trees-the so called 'model invariants'), on any number n of leaves. We also provide a precise description of the space of mixtures and linear invariants for the special case of [Formula: see text] leaves. By combining techniques from discrete random processes and (multi-) linear algebra, our results build on a classic result that was first established by James Lake (Mol Biol Evol 4:167-191, 1987).
Larridon, Isabel; Bauters, Kenneth; Semmouri, Ilias; Viljoen, Jan-Adriaan; Prychid, Christina J; Muasya, A Muthama; Bruhl, Jeremy J; Wilson, Karen L; Senterre, Bruno; Goetghebeur, Paul
2018-04-19
We investigated the monophyly of Costularia (25 species), a genus of tribe Schoeneae (Cyperaceae) that illustrates a remarkable distribution pattern from southeastern Africa, over Madagascar, the Mascarenes and Seychelles, to Malesia and New Caledonia. A further species, Tetraria borneensis, has been suggested to belong to Costularia. Relationships and divergence times were inferred using an existing four marker phylogeny of Cyperaceae tribe Schoeneae expanded with newly generated sequence data mainly for Costularia s.l. species. Phylogenetic reconstruction was executed using Bayesian inference and maximum likelihood approaches. Divergence times were estimated using a relaxed molecular clock model, calibrated with fossil data. Based on our results, Tetraria borneensis is not related to the species of Costularia. Costularia s.l. is composed of four distinct evolutionary lineages. Two lineages, one including the type species, are part of the Oreobolus clade, i.e. a much reduced genus Costularia restricted to southeastern Africa, Madagascar, the Mascarenes and Seychelles, and a small endemic genus from New Caledonia for which a new genus Chamaedendron is erected based on Costularia subgenus Chamaedendron. The other two lineages are part of the Tricostularia clade, i.e. a separate single-species lineage from the Seychelles for which a new genus (Xyroschoenus) is described, and Costularia subgenus Lophoschoenus. For the latter, more research is needed to test whether they are congeneric with the species placed in the reticulate-sheathed Tetraria clade. Copyright © 2018 Elsevier Inc. All rights reserved.
Phylogeographic history of grey wolves in Europe
Directory of Open Access Journals (Sweden)
Dykyy Ihor
2010-04-01
Full Text Available Abstract Background While it is generally accepted that patterns of intra-specific genetic differentiation are substantially affected by glacial history, population genetic processes occurring during Pleistocene glaciations are still poorly understood. In this study, we address the question of the genetic consequences of Pleistocene glaciations for European grey wolves. Combining our data with data from published studies, we analysed phylogenetic relationships and geographic distribution of mitochondrial DNA haplotypes for 947 contemporary European wolves. We also compared the contemporary wolf sequences with published sequences of 24 ancient European wolves. Results We found that haplotypes representing two haplogroups, 1 and 2, overlap geographically, but substantially differ in frequency between populations from south-western and eastern Europe. A comparison between haplotypes from Europe and other continents showed that both haplogroups are spread throughout Eurasia, while only haplogroup 1 occurs in contemporary North American wolves. All ancient wolf samples from western Europe that dated from between 44,000 and 1,200 years B.P. belonged to haplogroup 2, suggesting the long-term predominance of this haplogroup in this region. Moreover, a comparison of current and past frequencies and distributions of the two haplogroups in Europe suggested that haplogroup 2 became outnumbered by haplogroup 1 during the last several thousand years. Conclusions Parallel haplogroup replacement, with haplogroup 2 being totally replaced by haplogroup 1, has been reported for North American grey wolves. Taking into account the similarity of diets reported for the late Pleistocene wolves from Europe and North America, the correspondence between these haplogroup frequency changes may suggest that they were associated with ecological changes occurring after the Last Glacial Maximum.
Hanke, Dennis; Pohlmann, Anne; Sauter-Louis, Carola; Höper, Dirk; Stadler, Julia; Ritzmann, Mathias; Steinrigl, Adi; Schwarz, Bernd-Andreas; Akimkin, Valerij; Fux, Robert; Blome, Sandra; Beer, Martin
2017-07-06
Porcine epidemic diarrhea (PED) is an acute and highly contagious enteric disease of swine caused by the eponymous virus (PEDV) which belongs to the genus Alphacoronavirus within the Coronaviridae virus family. Following the disastrous outbreaks in Asia and the United States, PEDV has been detected also in Europe. In order to better understand the overall situation, the molecular epidemiology, and factors that might influence the most variable disease impact; 40 samples from swine feces were collected from different PED outbreaks in Germany and other European countries and sequenced by shot-gun next-generation sequencing. A total of 38 new PEDV complete coding sequences were generated. When compared on a global scale, all investigated sequences from Central and South-Eastern Europe formed a rather homogeneous PEDV S INDEL cluster, suggesting a recent re-introduction. However, in-detail analyses revealed two new clusters and putative ancestor strains. Based on the available background data, correlations between clusters and location, farm type or clinical presentation could not be established. Additionally, the impact of secondary infections was explored using the metagenomic data sets. While several coinfections were observed, no correlation was found with disease courses. However, in addition to the PEDV genomes, ten complete viral coding sequences from nine different data sets were reconstructed each representing new virus strains. In detail, three pasivirus A strains, two astroviruses, a porcine sapelovirus, a kobuvirus, a porcine torovirus, a posavirus, and an enterobacteria phage were almost fully sequenced.
Directory of Open Access Journals (Sweden)
Dennis Hanke
2017-07-01
Full Text Available Porcine epidemic diarrhea (PED is an acute and highly contagious enteric disease of swine caused by the eponymous virus (PEDV which belongs to the genus Alphacoronavirus within the Coronaviridae virus family. Following the disastrous outbreaks in Asia and the United States, PEDV has been detected also in Europe. In order to better understand the overall situation, the molecular epidemiology, and factors that might influence the most variable disease impact; 40 samples from swine feces were collected from different PED outbreaks in Germany and other European countries and sequenced by shot-gun next-generation sequencing. A total of 38 new PEDV complete coding sequences were generated. When compared on a global scale, all investigated sequences from Central and South-Eastern Europe formed a rather homogeneous PEDV S INDEL cluster, suggesting a recent re-introduction. However, in-detail analyses revealed two new clusters and putative ancestor strains. Based on the available background data, correlations between clusters and location, farm type or clinical presentation could not be established. Additionally, the impact of secondary infections was explored using the metagenomic data sets. While several coinfections were observed, no correlation was found with disease courses. However, in addition to the PEDV genomes, ten complete viral coding sequences from nine different data sets were reconstructed each representing new virus strains. In detail, three pasivirus A strains, two astroviruses, a porcine sapelovirus, a kobuvirus, a porcine torovirus, a posavirus, and an enterobacteria phage were almost fully sequenced.
Hilu, Khidir W; Black, Chelsea M; Oza, Dipan
2014-01-01
Rate of substitution of genomic regions is among the most debated intrinsic features that impact phylogenetic informativeness. However, this variable is also coupled with rates of nonsynonymous substitutions that underscore the nature and degree of selection on the selected genes. To empirically address these variables, we constructed four completely overlapping data sets of plastid matK, atpB, rbcL, and mitochondrial matR genes and used the rosid lineage (angiosperms) as a working platform. The genes differ in combinations of overall rates of nucleotide and amino acid substitutions. Tree robustness, homoplasy, accuracy in contrast to a reference tree, and phylogenetic informativeness are evaluated. The rapidly evolving/unconstrained matK faired best, whereas remaining genes varied in degrees of contribution to rosid phylogenetics across the lineage's 108 million years evolutionary history. Phylogenetic accuracy was low with the slowly evolving/unconstrained matR despite least amount of homoplasy. Third codon positions contributed the highest amount of parsimony informative sites, resolution and informativeness, but magnitude varied with gene mode of evolution. These findings are in clear contrast with the views that rapidly evolving regions and the 3rd codon position have inevitable negative impact on phylogenetic reconstruction at deep historic level due to accumulation of multiple hits and subsequent elevation in homoplasy and saturation. Relaxed evolutionary constraint in rapidly evolving genes distributes substitutions across codon positions, an evolutionary mode expected to reduce the frequency of multiple hits. These findings should be tested at deeper evolutionary histories.
Hepatitis a virus genotypes and strains from an endemic area of Europe, Bulgaria 2012-2014.
Bruni, Roberto; Taffon, Stefania; Equestre, Michele; Cella, Eleonora; Lo Presti, Alessandra; Costantino, Angela; Chionne, Paola; Madonna, Elisabetta; Golkocheva-Markova, Elitsa; Bankova, Diljana; Ciccozzi, Massimo; Teoharov, Pavel; Ciccaglione, Anna Rita
2017-07-14
Hepatitis A virus (HAV) infection is endemic in Eastern European and Balkan region countries. In 2012, Bulgaria showed the highest rate (67.13 cases per 100,000) in Europe. Nevertheless, HAV genotypes and strains circulating in this country have never been described. The present study reports the molecular characterization of HAV from 105 patients from Bulgaria. Anti-HAV IgM positive serum samples collected in 2012-2014 from different towns and villages in Bulgaria were analysed by nested RT-PCR, sequencing of the VP1/2A region and phylogenetic analysis; the results were analysed together with patient and geographical data. Phylogenetic analysis revealed two main sequence groups corresponding to the IA (78/105, 74%) and IB (27/105, 26%) sub-genotypes. In the IA group, a major and a minor cluster were observed (62 and 16 sequences, respectively). Most sequences from the major cluster (44/62, 71%) belonged to either of two strains, termed "strain 1" and "strain 2", differing only for a single specific nucleotide; the remaining sequences (18/62, 29%) showed few (1 to 4) nucleotide variations respect to strain 1 and 2. Strain 2 is identical to the strain previously responsible for an outbreak in the Czech Republic in 2008 and a large multi-country European outbreak caused by contaminated mixed frozen berries in 2013. Most sequences of the IA minor cluster and the IB group were detected in large/medium centers (LMCs). Overall, sequences from the IA major cluster were more frequent in small centers (SCs), but strain 1 and strain 2 showed an opposite relative frequency in SCs and LMCs (strain 1 more frequent in SCs, strain 2 in LMCs). Genotype IA predominated in Bulgaria in 2012-2014 and phylogenetic analysis identified a major cluster of highly related or identical IA sequences, representing 59% of the analysed cases; these isolates were mostly detected in SCs, in which HAV shows higher endemicity than in LMCs. The distribution of viral sequences suggests the existence
The phylogenetic diversity of true morels (Morchella) in China was estimated by initially analyzing nuclear ribosomal internal transcribed spacer (ITS) rDNA sequences from 361 specimens collected in 21 provinces during the 2003-2011 growing seasons, together with six collections obtained on loan fro...
Directory of Open Access Journals (Sweden)
Vidal-Russell Romina
2004-10-01
Full Text Available Abstract Background The phylogenetic relationships among the holoparasites of Rafflesiales have remained enigmatic for over a century. Recent molecular phylogenetic studies using the mitochondrial matR gene placed Rafflesia, Rhizanthes and Sapria (Rafflesiaceae s. str. in the angiosperm order Malpighiales and Mitrastema (Mitrastemonaceae in Ericales. These phylogenetic studies did not, however, sample two additional groups traditionally classified within Rafflesiales (Apodantheaceae and Cytinaceae. Here we provide molecular phylogenetic evidence using DNA sequence data from mitochondrial and nuclear genes for representatives of all genera in Rafflesiales. Results Our analyses indicate that the phylogenetic affinities of the large-flowered clade and Mitrastema, ascertained using mitochondrial matR, are congruent with results from nuclear SSU rDNA when these data are analyzed using maximum likelihood and Bayesian methods. The relationship of Cytinaceae to Malvales was recovered in all analyses. Relationships between Apodanthaceae and photosynthetic angiosperms varied depending upon the data partition: Malvales (3-gene, Cucurbitales (matR or Fabales (atp1. The latter incongruencies suggest that horizontal gene transfer (HGT may be affecting the mitochondrial gene topologies. The lack of association between Mitrastema and Ericales using atp1 is suggestive of HGT, but greater sampling within eudicots is needed to test this hypothesis further. Conclusions Rafflesiales are not monophyletic but composed of three or four independent lineages (families: Rafflesiaceae, Mitrastemonaceae, Apodanthaceae and Cytinaceae. Long-branch attraction appears to be misleading parsimony analyses of nuclear small-subunit rDNA data, but model-based methods (maximum likelihood and Bayesian analyses recover a topology that is congruent with the mitochondrial matR gene tree, thus providing compelling evidence for organismal relationships. Horizontal gene transfer appears to
Hekimoğlu, Olcay; Sağlam, İsmail K; Özer, Nurdan; Estrada-Peña, Agustin
2016-07-01
The Rhipicephalus sanguineus complex is a group of closely related tick species distributed all around the world. In this study, using mitochondrial 16S ribosomal DNA, new specimens of R sanguineus sensu lato from Turkey and Rhipicephalus camicasi from Kenya, were evaluated together with available sequences of this complex in GenBank. Our objectives were to delimit the complex, re-evaluate its global phylogeny and develop a reconstruction of its biogeographic history. Given Turkey's geographical location and its neighboring status within Africa, Asia and Europe, molecular information of R. sanguineus s.l. species from this region could have important implications both on a regional and global scale. Phylogenetic trees obtained with three methods (Bayesian, Maximum Likelihood and Maximum Parsimony) were highly similar and consensus trees gave the same branching patterns and similar node support values. A total of four different clades with up to 9 Operational Taxonomic Units formed strong monophyletic groups. Biogeographic reconstructions demonstrated the importance of populations in Middle East (Turkey) in the spread of the group from Europe to Africa and Asia. Data supported previous conclusions on the existence of two species of R. sanguineus s.l. in South America and the strong molecular similarity between R. camicasi and the so-called tropical lineage of R. sanguineus s.l. These results point to the need of a re-evaluation of most specimens designated as R. sanguineus s.l. in East Europe, Middle East, Africa and Asia after an adequate re-description of this taxon. Copyright © 2016 Elsevier GmbH. All rights reserved.
Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences
Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi
2015-01-01
Background Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Methods Ecdysozoan phylogeny was reconstruct...
Hill, Kathy B R; Marshall, David C; Moulds, Maxwell S; Simon, Chris
2015-07-10
North America has a diverse cicada fauna with multiple genera from all three Cicadidae subfamilies, yet molecular phylogenetic analyses have been completed only for the well-studied periodical cicadas (Magicicada Davis). The genus Tibicen Latreille, a large group of charismatic species, is in need of such work because morphological patterns suggest multiple groups with complicated relationships to other genera in the tribe Cryptotympanini. In this paper we present a molecular phylogenetic analysis, based on mitochondrial and nuclear DNA, of 35 of the 38 extant USA species and subspecies of the genus Tibicen together with their North American tribal allies (Cornuplura Davis, Cacama Davis), selected Tibicen species from Eurasia, and representatives of other Eurasian and Pacific cryptotympanine genera. This tree shows that Tibicen contains several well-supported clades, one predominating in eastern and central North America and related to Cryptotympana Stål and Raiateana Boulard, another in western North America related to Cacama and Cornuplura, and at least two clades in Eurasia. We also present a morphological cladistic analysis of Tibicen and its close allies based on 27 characters. Character states identified in the cladistic analysis define three new genera, two for North American taxa (Hadoa gen. n. and Neotibicen gen. n.) including several Mexican species, and one for Asian species (Subsolanus gen. n.). Using relaxed molecular clocks and literature-derived mtDNA rate estimates, we estimate the timeframe of diversification of Tibicen clades and find that intergeneric divergence has occurred since the late Eocene, with most extant species within the former Tibicen originating after the mid-Miocene. We review patterns of ecology, behavior, and geography among Tibicen clades in light of the phylogenetic results and note that the study of these insects is still in its early stages. Some Mexican species formerly placed in Tibicen are here transferred to Diceroprocta
Dennis, Ann M.; Herbeck, Joshua T.; Brown, Andrew Leigh; Kellam, Paul; de Oliveira, Tulio; Pillay, Deenan; Fraser, Christophe; Cohen, Myron S.
2014-01-01
Efficient and effective HIV prevention measures for generalized epidemics in sub-Saharan Africa have not yet been validated at the population-level. Design and impact evaluation of such measures requires fine-scale understanding of local HIV transmission dynamics. The novel tools of HIV phylogenetics and molecular epidemiology may elucidate these transmission dynamics. Such methods have been incorporated into studies of concentrated HIV epidemics to identify proximate and determinant traits associated with ongoing transmission. However, applying similar phylogenetic analyses to generalized epidemics, including the design and evaluation of prevention trials, presents additional challenges. Here we review the scope of these methods and present examples of their use in concentrated epidemics in the context of prevention. Next, we describe the current uses for phylogenetics in generalized epidemics, and discuss their promise for elucidating transmission patterns and informing prevention trials. Finally, we review logistic and technical challenges inherent to large-scale molecular epidemiological studies of generalized epidemics, and suggest potential solutions. PMID:24977473
TreeCluster: Massively scalable transmission clustering using phylogenetic trees
Moshiri, Alexander
2018-01-01
Background: The ability to infer transmission clusters from molecular data is critical to designing and evaluating viral control strategies. Viral sequencing datasets are growing rapidly, but standard methods of transmission cluster inference do not scale well beyond thousands of sequences. Results: I present TreeCluster, a cross-platform tool that performs transmission cluster inference on a given phylogenetic tree orders of magnitude faster than existing inference methods and supports multi...
A phylogenetic blueprint for a modern whale.
Gatesy, John; Geisler, Jonathan H; Chang, Joseph; Buell, Carl; Berta, Annalisa; Meredith, Robert W; Springer, Mark S; McGowen, Michael R
2013-02-01
The emergence of Cetacea in the Paleogene represents one of the most profound macroevolutionary transitions within Mammalia. The move from a terrestrial habitat to a committed aquatic lifestyle engendered wholesale changes in anatomy, physiology, and behavior. The results of this remarkable transformation are extant whales that include the largest, biggest brained, fastest swimming, loudest, deepest diving mammals, some of which can detect prey with a sophisticated echolocation system (Odontoceti - toothed whales), and others that batch feed using racks of baleen (Mysticeti - baleen whales). A broad-scale reconstruction of the evolutionary remodeling that culminated in extant cetaceans has not yet been based on integration of genomic and paleontological information. Here, we first place Cetacea relative to extant mammalian diversity, and assess the distribution of support among molecular datasets for relationships within Artiodactyla (even-toed ungulates, including Cetacea). We then merge trees derived from three large concatenations of molecular and fossil data to yield a composite hypothesis that encompasses many critical events in the evolutionary history of Cetacea. By combining diverse evidence, we infer a phylogenetic blueprint that outlines the stepwise evolutionary development of modern whales. This hypothesis represents a starting point for more detailed, comprehensive phylogenetic reconstructions in the future, and also highlights the synergistic interaction between modern (genomic) and traditional (morphological+paleontological) approaches that ultimately must be exploited to provide a rich understanding of evolutionary history across the entire tree of Life. Copyright © 2012 Elsevier Inc. All rights reserved.
Najm, Nour-Addeen; Meyer-Kayser, Elisabeth; Hoffmann, Lothar; Pfister, Kurt; Silaghi, Cornelia
2014-07-01
In this study, the prevalence of Hepatozoon spp. in red foxes (Vulpes vulpes) and their ticks from Germany, as well as molecular characterizations and phylogenetic relationship to other Hepatozoon spp. were investigated. DNA extracts of 261 spleen samples and 1,953 ticks were examined for the presence of Hepatozoon spp. by a conventional polymerase chain reaction (PCR) targeting the 18S rRNA gene. The ticks included four tick species: Ixodes ricinus, Ixodes canisuga, Ixodes hexagonus and Dermacentor reticulatus. A total of 118/261 foxes (45.2%) and 148/1,953 ticks (7.5%) were Hepatozoon PCR-positive. Amplicons from 36 positive foxes and 41 positive ticks were sequenced. All sequences obtained from foxes and 39/41 from ticks had a 99% similarity to Hepatozoon canis, whereas two ticks' sequences had a 99% identity to Hepatozoon sp. The obtained Hepatozoon sequences in this study were phylogenetically related to other Hepatozoon sequences detected in other countries, which may represent strain variants. The high prevalence of H. canis DNA in red foxes in this study supports the suggested role of those animals in distribution of this parasite. Furthermore, detection of DNA of H. canis in foxes and all examined tick species collected from those foxes allows speculating about previously undescribed potential vectors for H. canis and suggests a potential role of the red fox in its natural endemic cycles.
Graf, Daniel L; Jones, Hugh; Geneva, Anthony J; Pfeiffer, John M; Klunzinger, Michael W
2015-04-01
The freshwater mussel family Hyriidae (Mollusca: Bivalvia: Unionida) has a disjunct trans-Pacific distribution in Australasia and South America. Previous phylogenetic analyses have estimated the evolutionary relationships of the family and the major infra-familial taxa (Velesunioninae and Hyriinae: Hyridellini in Australia; Hyriinae: Hyriini, Castaliini, and Rhipidodontini in South America), but taxon and character sampling have been too incomplete to support a predictive classification or allow testing of biogeographical hypotheses. We sampled 30 freshwater mussel individuals representing the aforementioned hyriid taxa, as well as outgroup species representing the five other freshwater mussel families and their marine sister group (order Trigoniida). Our ingroup included representatives of all Australian genera. Phylogenetic relationships were estimated from three gene fragments (nuclear 28S, COI and 16S mtDNA) using maximum parsimony, maximum likelihood, and Bayesian inference, and we applied a Bayesian relaxed clock model calibrated with fossil dates to estimate node ages. Our analyses found good support for monophyly of the Hyriidae and the subfamilies and tribes, as well as the paraphyly of the Australasian taxa (Velesunioninae, (Hyridellini, (Rhipidodontini, (Castaliini, Hyriini)))). The Hyriidae was recovered as sister to a clade comprised of all other Recent freshwater mussel families. Our molecular date estimation supported Cretaceous origins of the major hyriid clades, pre-dating the Tertiary isolation of South America from Antarctica/Australia. We hypothesize that early diversification of the Hyriidae was driven by terrestrial barriers on Gondwana rather than marine barriers following disintegration of the super-continent. Copyright © 2015 Elsevier Inc. All rights reserved.
Novel insect-specific flavivirus isolated from northern Europe
Huhtamo, Eili; Moureau, Gregory; Cook, Shelley; Julkunen, Ora; Putkuri, Niina; Kurkela, Satu; Uzcátegui, Nathalie Y.; Harbach, Ralph E.; Gould, Ernest A.; Vapalahti, Olli; de Lamballerie, Xavier
2012-01-01
Mosquitoes collected in Finland were screened for flaviviral RNA leading to the discovery and isolation of a novel flavivirus designated Hanko virus (HANKV). Virus characterization, including phylogenetic analysis of the complete coding sequence, confirmed HANKV as a member of the “insect-specific” flavivirus (ISF) group. HANKV is the first member of this group isolated from northern Europe, and therefore the first northern European ISF for which the complete coding sequence has been determined. HANKV was not transcribed as DNA in mosquito cell culture, which appears atypical for an ISF. HANKV shared highest sequence homology with the partial NS5 sequence available for the recently discovered Spanish Ochlerotatus flavivirus (SOcFV). Retrospective analysis of mitochondrial sequences from the virus-positive mosquito pool suggested an Ochlerotatus mosquito species as the most likely host for HANKV. HANKV and SOcFV may therefore represent a novel group of Ochlerotatus-hosted insect-specific flaviviruses in Europe and further afield. PMID:22999256
Some limitations of public sequence data for phylogenetic inference (in plants).
Hinchliff, Cody E; Smith, Stephen Andrew
2014-01-01
The GenBank database contains essentially all of the nucleotide sequence data generated for published molecular systematic studies, but for the majority of taxa these data remain sparse. GenBank has value for phylogenetic methods that leverage data-mining and rapidly improving computational methods, but the limits imposed by the sparse structure of the data are not well understood. Here we present a tree representing 13,093 land plant genera--an estimated 80% of extant plant diversity--to illustrate the potential of public sequence data for broad phylogenetic inference in plants, and we explore the limits to inference imposed by the structure of these data using theoretical foundations from phylogenetic data decisiveness. We find that despite very high levels of missing data (over 96%), the present data retain the potential to inform over 86.3% of all possible phylogenetic relationships. Most of these relationships, however, are informed by small amounts of data--approximately half are informed by fewer than four loci, and more than 99% are informed by fewer than fifteen. We also apply an information theoretic measure of branch support to assess the strength of phylogenetic signal in the data, revealing many poorly supported branches concentrated near the tips of the tree, where data are sparse and the limiting effects of this sparseness are stronger. We argue that limits to phylogenetic inference and signal imposed by low data coverage may pose significant challenges for comprehensive phylogenetic inference at the species level. Computational requirements provide additional limits for large reconstructions, but these may be overcome by methodological advances, whereas insufficient data coverage can only be remedied by additional sampling effort. We conclude that public databases have exceptional value for modern systematics and evolutionary biology, and that a continued emphasis on expanding taxonomic and genomic coverage will play a critical role in developing
Beiko, Robert G; Ragan, Mark A
2009-01-01
Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.
Directory of Open Access Journals (Sweden)
André Luiz Netto-Ferreira
Full Text Available Erythrocharax altipinnis is described from the Serra do Cachimbo, Pará, Brazil. The new taxon is distinguished from all of the Characidae genera by having the pelvic bones firmly attached through the isquiatic processes; a nearly triangular hiatus in the musculature covering the anterior chamber of the swim bladder between the first and second pleural ribs (pseudotympanum; the pedunculate, notably expanded and distally compressed teeth in both jaws; circumorbital series represented by antorbital and four infraorbital bones with laterosensory canals not enclosed; a single tooth row in the premaxillary with the teeth perfectly aligned and similar in shape and cusp number; the first three branched dorsal-fin rays distinctly elongate in males; a bright red adipose and caudal fins in life; a conspicuous dark midlateral stripe extending from the opercle to the tip of the median caudal-fin rays; and by the absence of a humeral spot. The phylogenetic position of the new taxon is discussed using morphological and molecular datasets, with conflicting results of both approaches discussed. Additionally, a summarized discussion on the current problems in the Characidae taxonomy is presented and the principal biases in the morphological dataset are also discussed.
McInerney, Caitríona E; Maurice, Louise; Robertson, Anne L; Knight, Lee R F D; Arnscheidt, Jörg; Venditti, Chris; Dooley, James S G; Mathers, Thomas; Matthijs, Severine; Eriksson, Karin; Proudlove, Graham S; Hänfling, Bernd
2014-03-01
Global climate changes during the Cenozoic (65.5-0 Ma) caused major biological range shifts and extinctions. In northern Europe, for example, a pattern of few endemics and the dominance of wide-ranging species is thought to have been determined by the Pleistocene (2.59-0.01 Ma) glaciations. This study, in contrast, reveals an ancient subsurface fauna endemic to Britain and Ireland. Using a Bayesian phylogenetic approach, we found that two species of stygobitic invertebrates (genus Niphargus) have not only survived the entire Pleistocene in refugia but have persisted for at least 19.5 million years. Other Niphargus species form distinct cryptic taxa that diverged from their nearest continental relative between 5.6 and 1.0 Ma. The study also reveals an unusual biogeographical pattern in the Niphargus genus. It originated in north-west Europe approximately 87 Ma and underwent a gradual range expansion. Phylogenetic diversity and species age are highest in north-west Europe, suggesting resilience to extreme climate change and strongly contrasting the patterns seen in surface fauna. However, species diversity is highest in south-east Europe, indicating that once the genus spread to these areas (approximately 25 Ma), geomorphological and climatic conditions enabled much higher diversification. Our study highlights that groundwater ecosystems provide an important contribution to biodiversity and offers insight into the interactions between biological and climatic processes. © 2014 John Wiley & Sons Ltd.
High-resolution molecular epidemiology and evolutionary history of HIV-1 subtypes in Albania.
Directory of Open Access Journals (Sweden)
Marco Salemi
2008-01-01
Full Text Available HIV-1 epidemic in Western Europe is largely due to subtype B. Little is known about the HIV-1 in Eastern Europe, but a few studies have shown that non-B subtypes are quite common. In Albania, where a recent study estimated a ten-fold increase of AIDS incidence during the last six years, subtype A and B account for 90% of the know infections.We investigated the demographic history of HIV-1 subtype A and B in Albania by using a statistical framework based on coalescent theory and phylogeography. High-resolution phylogenetic and molecular clock analysis showed a limited introduction to the Balkan country of subtype A during the late 1980s followed by an epidemic outburst in the early 1990 s. In contrast, subtype B was apparently introduced multiple times between the mid-1970s and mid-1980s. Both subtypes are growing exponentially, although the HIV-1A epidemic displays a faster growth rate, and a significantly higher basic reproductive number R(0. HIV-1A gene flow occurs primarily from the capital Tirane, in the center of the country, to the periphery, while HIV-1B flow is characterized by a balanced exchange between center and periphery. Finally, we calculated that the actual number of infections in Albania is at least two orders of magnitude higher than previously thought.Our analysis demonstrates the power of recently developed computational tools to investigate molecular epidemiology of pathogens, and emphasize the complex factors involved in the establishment of HIV-1 epidemics. We suggest that a significant correlation exists between HIV-1 exponential spread and the socio-political changes occurred during the Balkan wars. The fast growth of a relatively new non-B epidemic in the Balkans may have significant consequences for the evolution of HIV-1 epidemiology in neighboring countries in Eastern and Western Europe.
Voglmayr, Hermann; Montes-Borrego, Miguel; Landa, Blanca B.
2014-01-01
Based on sequence data from ITS rDNA, cox1 and cox2, six Peronospora species are recognised as phylogenetically distinct on various Papaver species. The host ranges of the four already described species P. arborescens, P. argemones, P. cristata and P. meconopsidis are clarified. Based on sequence data and morphology, two new species, P. apula and P. somniferi, are described from Papaver apulum and P. somniferum, respectively. The second Peronospora species parasitizing Papaver somniferum, that was only recently recorded as Peronospora cristata from Tasmania, is shown to represent a distinct taxon, P. meconopsidis, originally described from Meconopsis cambrica. It is shown that P. meconopsidis on Papaver somniferum is also present and widespread in Europe and Asia, but has been overlooked due to confusion with P. somniferi and due to less prominent, localized disease symptoms. Oospores are reported for the first time for P. meconopsidis from Asian collections on Papaver somniferum. Morphological descriptions, illustrations and a key are provided for all described Peronospora species on Papaver. cox1 and cox2 sequence data are confirmed as equally good barcoding loci for reliable Peronospora species identification, whereas ITS rDNA does sometimes not resolve species boundaries. Molecular phylogenetic data reveal high host specificity of Peronospora on Papaver, which has the important phytopathological implication that wild Papaver spp. cannot play any role as primary inoculum source for downy mildew epidemics in cultivated opium poppy crops. PMID:24806292
Molecular phylogenetics of emydine turtles: taxonomic revision and the evolution of shell kinesis.
Feldman, Chris R; Parham, James Ford
2002-03-01
The 10 extant species of emydine turtles represent an array of morphological and ecological forms recognizable and popular among scientists and hobbyists. Nevertheless, the phylogenetic affinities of most emydines remain contentious. Here, we examine the evolutionary relationships of emydine turtles using 2092 bp of DNA encoding the mitochondrial genes cyt b, ND4, and adjacent tRNAs. These data contain 339 parsimony informative characters that we use to erect hypotheses of relationships for the Emydinae. Both maximum parsimony and maximum likelihood methods yield a monophyletic Emydinae in which all but three nodes are well resolved. Emys orbicularis, Emydoidea blandingii, and Clemmys marmorata form a monophyletic clade, as do the species of Terrapene. Clemmys muhlenbergii and Clemmys insculpta form a third monophyletic group that may be sister to all other emydines. Clemmys guttata is problematic and probably related to Terrapene. Based on this phylogeny, and previous molecular work on the group, we suggest the following taxonomic revisions: (1) Clemmys should be restricted to a single species, C. guttata. (2) Calemys should be resurrected for C. muhlenbergii and C. insculpta. (3) Emys should be expanded to include three species: E. orbicularis, E. blandingii, and E. marmorata. Furthermore, our analyses show that neither kinetic-shelled nor akinetic-shelled emydines form monophyletic groups. Therefore, shell kinesis was either independently gained in Emys and Terrapene or secondarily lost in E. marmorata and C. guttata. Parsimony, paleontological evidence, and the multiple origins of shell kinesis in related turtle lineages (especially geoemydines) support the independent origin of plastral kinesis.
Hornok, Sándor; Trauttwein, Klaudia; Takács, Nóra; Hodžić, Adnan; Duscher, Georg Gerhard; Kontschán, Jenő
2017-01-01
The European badger (Meles meles) is a widespread mammal in most countries of the European continent, with increasingly recognized veterinary/medical importance owing to its preferred habitats (including pastures and urban environments), broad spectrum of food items, and role as a game hunting target. However, ticks and tick-borne pathogens associated with badgers are only partly known, and most of them have not yet been analysed with molecular biological methods The aim of this study was to perform molecular taxonomic analysis of ticks collected from a road-killed European badger, as well as to molecularly investigate its ticks and blood sample for the presence of Anaplasmataceae and piroplasms. Ticks from the badger were morphologically identified as females of Ixodes rugicollis. Based on its cytochrome oxidase subunit I (COI) and 16S rRNA sequences, I. rugicollis phylogenetically clustered together with I. lividus and I. arboricola, i.e. other members of the subgenus Pholeoixodes. The blood sample of the badger contained the DNA of Candidatus Neoehrlichia sp. (FU98) recently identified in red fox in Austria and the Czech Republic. This genotype is most closely related to Ca. N. lotoris (from raccoons in North America), and has lower sequence identity with the I. ricinus-transmitted zoonotic agent, Ca. N. mikurensis found in Eurasia. In the blood of the badger and in one female I. rugicollis, the DNA of a new Babesia genotype was also present, which differed from a piroplasm detected in M. meles in Spain, and clustered phylogenetically in the B. microti clade. Phylogenetic analysis of I. rugicollis (based on two genetic markers) confirms its status in subgenus Pholeoixodes. Ca. Neoehrlichia sp. (FU98) was identified for the first time in M. meles and in Hungary. In addition, a molecularly previously not yet characterized Babesia genotype occurs in badgers in Central Europe. Copyright © 2016 Elsevier GmbH. All rights reserved.
Nonbinary Tree-Based Phylogenetic Networks.
Jetten, Laura; van Iersel, Leo
2018-01-01
Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.
Phylogenetic radiation of the greenbottle flies (Diptera, Calliphoridae, Luciliinae)
Williams, Kirstin A.; Lamb, Jennifer; Villet, Martin H.
2016-01-01
Abstract The subfamily Luciliinae is diverse and geographically widespread. Its four currently recognised genera (Dyscritomyia Grimshaw, 1901, Hemipyrellia Townsend, 1918, Hypopygiopsis Townsend 1916 and Lucilia Robineau-Desvoidy, 1830) contain species that range from saprophages to obligate parasites, but their pattern of phylogenetic diversification is unclear. The 28S rRNA, COI and Period genes of 14 species of Lucilia and Hemipyrellia were partially sequenced and analysed together with sequences of 11 further species from public databases. The molecular data confirmed molecular paraphyly in three species-pairs in Lucilia that hamper barcode identifications of those six species. Lucilia sericata and Lucilia cuprina were confirmed as mutual sister species. The placements of Dyscritomyia and Hypopygiopsis were ambiguous, since both made Lucilia paraphyletic in some analyses. Recognising Hemipyrellia as a genus consistently left Lucilia s.l. paraphyletic, and the occasionally-recognised (sub)genus Phaenicia was consistently paraphyletic, so these taxa should be synonymised with Lucilia to maintain monophyly. Analysis of a matrix of 14 morphological characters scored for adults of all genera and for most of the species included in the molecular analysis confirmed several of these findings. The different degrees of parasitism were phylogenetically clustered within this genus but did not form a graded series of evolutionary stages, and there was no particular relationship between feeding habits and biogeography. Because of the ubiquity of hybridization, introgression and incomplete lineage sorting in blow flies, we recommend that using a combination of mitochondrial and nuclear markers should be a procedural standard for medico-criminal forensic identifications of insects. PMID:27103874
Overview of HIV molecular epidemiology among People who Inject Drugs in Europe and Asia
Nikolopoulos, Georgios K.; Kostaki, Evangelia-Georgia; Paraskevis, Dimitrios
2016-01-01
HIV strains continuously evolve, tend to recombine and new circulating variants are being discovered. Novel strains complicate efforts to develop a vaccine against HIV and may exhibit higher transmission efficiency and virulence, and elevated resistance to antiretroviral agents. The United Nations Joint Programme on HIV/AIDS (UNAIDS) set an ambitious goal to end HIV as a public health threat by 2030 through comprehensive strategies that include epidemiological input as the first step of the process. In this context, molecular epidemiology becomes invaluable as it captures trends in HIV evolution rates that shape epidemiological pictures across several geographical areas. This review briefly summarizes the molecular epidemiology of HIV among people who inject drugs (PWID) in Europe and Asia. Following high transmission rates of subtype G and CRF14_BG among PWID in Portugal and Spain, two European countries, Greece and Romania, experienced recent HIV outbreaks in PWID that consisted of multiple transmission clusters including subtypes B, A, F1 and recombinants CRF14_BG and CRF35_AD. The latter was first identified in Afghanistan. Russia, Ukraine and other Former Soviet Union (FSU) states are still facing the devastating effects of epidemics in PWID produced by AFSU (also known as IDU-A), BFSU (known as IDU-B), and CRF03_AB. In Asia, CRF01_AE and subtype B (Western B and Thai B) travelled from PWID in Thailand to neighboring countries. Recombination hotspots in South China, Northern Myanmar, and Malaysia have been generating several intersubtype and inter-CRF recombinants (e.g. CRF07_BC, CRF08_BC, CRF33_01B etc.) increasing the complexity of HIV molecular patterns. PMID:27287560
Directory of Open Access Journals (Sweden)
Topik Hidayat
2016-04-01
Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.
Clusters of Multidrug-Resistant Mycobacterium tuberculosis Cases, Europe
Kremer, Kristin; Heersma, Herre; Van Soolingen, Dick
2009-01-01
Molecular surveillance of multidrug-resistant tuberculosis (MDR TB) was implemented in Europe as case reporting in 2005. For all new MDR TB cases detected from January 2003 through June 2007, countries reported case-based epidemiologic data and DNA fingerprint patterns of MDR TB strains when available. International clusters were detected and analyzed. From 2003 through mid-2007 in Europe, 2,494 cases of MDR TB were reported from 24 European countries. Epidemiologic and molecular data were linked for 593 (39%) cases, and 672 insertion sequence 6110 DNA fingerprint patterns were reported from 19 countries. Of these patterns, 288 (43%) belonged to 18 European clusters; 7 clusters (242/288 cases, 84%) were characterized by strains of the Beijing genotype family, including the largest cluster (175/288 cases, 61%). Both clustering and the Beijing genotype were associated with strains originating in eastern European countries. Molecular cluster detection contributes to identification of transmission profile, risk factors, and control measures. PMID:19624920
Frías-López, Cristina; Sánchez-Herrero, José F; Guirao-Rico, Sara; Mora, Elisa; Arnedo, Miquel A; Sánchez-Gracia, Alejandro; Rozas, Julio
2016-12-15
The development of molecular markers is one of the most important challenges in phylogenetic and genome wide population genetics studies, especially in studies with non-model organisms. A highly promising approach for obtaining suitable markers is the utilization of genomic partitioning strategies for the simultaneous discovery and genotyping of a large number of markers. Unfortunately, not all markers obtained from these strategies provide enough information for solving multiple evolutionary questions at a reasonable taxonomic resolution. We have developed Development Of Molecular markers In Non-model Organisms (DOMINO), a bioinformatics tool for informative marker development from both next generation sequencing (NGS) data and pre-computed sequence alignments. The application implements popular NGS tools with new utilities in a highly versatile pipeline specifically designed to discover or select personalized markers at different levels of taxonomic resolution. These markers can be directly used to study the taxa surveyed for their design, utilized for further downstream PCR amplification in a broader set taxonomic scope, or exploited as suitable templates to bait design for target DNA enrichment techniques. We conducted an exhaustive evaluation of the performance of DOMINO via computer simulations and illustrate its utility to find informative markers in an empirical dataset. DOMINO is freely available from www.ub.edu/softevol/domino CONTACT: elsanchez@ub.edu or jrozas@ub.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
CLAUDIO CORREA
2006-12-01
Full Text Available Most Chilean amphibians belong to the subfamily Telmatobiinae (Anura, Leptodactylidae. Several phylogenetic studies of Leptodactylidae and Telmatobiinae, based principally on morphological characters, have implicitly suggested closer relationships of some species of the Telmatobiinae with members of other subfamilies of leptodactylids, including the leptodactyline genus Pleurodema which is present in Chile. Furthermore, a growing number of molecular studies suggest a non monophyletic status for Telmatobiinae, although none of these studies have investigated the phylogenetic relationships of this subfamily. We compared partial sequences of the ribosomal mitochondrial genes 12S and 16S to determine the phylogenetic relationships of Chilean leptodactylids and its position within the modern anurans (Neobatrachia. We included 22 species from nine of the 10 genera of telmatobiines present in Chile (Alsodes, Atelognathus, Batrachyla, Caudiverbera, Eupsophus, Hylorina, Insuetophrynus, Telmatobufo and Telmatobius, two species of the genus Pleurodema, and one species of Rhinodermatidae, which is considered a leptodactylid derivative family by some authors. We also included 51 species representing most of the families that compose Neobatrachia. Phylogenetic reconstructions were performed using the methods of maximum parsimony, maximum likelihood and Bayesian inference. The topologies obtained in all the analyses indicate that Telmatobiinae is a polyphyletic assemblage, composed by species belonging to Hyloidea (most of the genera and species more related to Australasian taxa (the clade Caudiverbera + Telmatobufo, defined as the tribe Calyptocephalellini. These molecular data support groups based on other kinds of evidence (Caudiverbera + Telmatobufo, Alsodes + Eupsophus and Batrachyla + Hylorina and raise new phylogenetic hypotheses for several genera of telmatobiines (Atelognathus with Batrachyla and Hylorina, Insuetophrynus + Rhinoderma. The phylogenetic
Molecular epidemiology of Mycobacterium tuberculosis complex in Brussels, 2010-2013.
Directory of Open Access Journals (Sweden)
Christelle Vluggen
Full Text Available The tuberculosis (TB incidence rate in Brussels-Capital Region is 3-fold higher than in Belgium as a whole. Eight years after the realization of initial prospective population-based molecular epidemiology investigations in this Region, a similar study over the period 2010-2013 was conducted. TB strains isolated from 945 patients were submitted to genotyping by standardized 24-locus-MIRU-VNTR typing and spoligotyping. The phylogenetic analysis showed that the LAM (16.7% and Haarlem (15.7% branches are the two most prevalent TB lineages circulating in Brussels. Analysis of the MDR subgroup showed an association with Beijing strains (39.9% and patients native of Eastern Europe (40.7%. Genotyping detected 113 clusters involving 321 patients, giving a recent transmission index of 22.9%. Molecular-guided epidemiological investigations and routine surveillance activities revealed family transmission or social contact for patients distributed over 34 clusters. Most of the patients were foreign-born (75.7%. However, cluster analysis revealed only limited trans-national transmission. Comparison with the previous study shows a stable epidemiological situation except for the mean age difference between Belgian-born and foreign-born patients which has disappeared. This study confirms that molecular epidemiology has become an important determinant for TB control programs. However, sufficient financial means need to be available to perform all required epidemiological investigations.
Yamasaki, Masahiro; Tsuboi, Yoshihiro; Taniyama, Yusuke; Uchida, Naohiro; Sato, Reeko; Nakamura, Kensuke; Ohta, Hiroshi; Takiguchi, Mitsuyoshi
2016-09-01
The Babesia gibsoni heat shock protein 90 (BgHSP90) gene was cloned and sequenced. The length of the gene was 2,610 bp with two introns. This gene was amplified from cDNA corresponding to full length coding sequence (CDS) with an open reading frame of 2,148 bp. A phylogenetic analysis of the CDS of HSP90 gene showed that B. gibsoni was most closely related to B. bovis and Babesia sp. BQ1/Lintan and lies within a phylogenetic cluster of protozoa. Moreover, mRNA transcription profile for BgHSP90 exposed to high temperature were examined by quantitative real-time reverse transcription-polymerase chain reaction. BgHSP90 levels were elevated when the parasites were incubated at 43°C for 1 hr.
Takamiya, Tomoko; Wongsawad, Pheravut; Sathapattayanon, Apirada; Tajima, Natsuko; Suzuki, Shunichiro; Kitamura, Saki; Shioda, Nao; Handa, Takashi; Kitanaka, Susumu; Iijima, Hiroshi; Yukawa, Tomohisa
2014-01-01
It is always difficult to construct coherent classification systems for plant lineages having diverse morphological characters. The genus Dendrobium, one of the largest genera in the Orchidaceae, includes ∼1100 species, and enormous morphological diversification has hindered the establishment of consistent classification systems covering all major groups of this genus. Given the particular importance of species in Dendrobium section Dendrobium and allied groups as floriculture and crude drug genetic resources, there is an urgent need to establish a stable classification system. To clarify phylogenetic relationships in Dendrobium section Dendrobium and allied groups, we analysed the macromolecular characters of the group. Phylogenetic analyses of 210 taxa of Dendrobium were conducted on DNA sequences of internal transcribed spacer (ITS) regions of 18S–26S nuclear ribosomal DNA and the maturase-coding gene (matK) located in an intron of the plastid gene trnK using maximum parsimony and Bayesian methods. The parsimony and Bayesian analyses revealed 13 distinct clades in the group comprising section Dendrobium and its allied groups. Results also showed paraphyly or polyphyly of sections Amblyanthus, Aporum, Breviflores, Calcarifera, Crumenata, Dendrobium, Densiflora, Distichophyllae, Dolichocentrum, Holochrysa, Oxyglossum and Pedilonum. On the other hand, the monophyly of section Stachyobium was well supported. It was found that many of the morphological characters that have been believed to reflect phylogenetic relationships are, in fact, the result of convergence. As such, many of the sections that have been recognized up to this point were found to not be monophyletic, so recircumscription of sections is required. PMID:25107672
Transforming phylogenetic networks: Moving beyond tree space
Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang
2016-01-01
Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...
Phylogenetic Origins of Brain Organisers
Directory of Open Access Journals (Sweden)
Ellen Robertshaw
2012-01-01
Full Text Available The regionalisation of the nervous system begins early in embryogenesis, concomitant with the establishment of the anteroposterior (AP and dorsoventral (DV body axes. The molecular mechanisms that drive axis induction appear to be conserved throughout the animal kingdom and may be phylogenetically older than the emergence of bilateral symmetry. As a result of this process, groups of patterning genes that are equally well conserved are expressed at specific AP and DV coordinates of the embryo. In the emerging nervous system of vertebrate embryos, this initial pattern is refined by local signalling centres, secondary organisers, that regulate patterning, proliferation, and axonal pathfinding in adjacent neuroepithelium. The main secondary organisers for the AP neuraxis are the midbrain-hindbrain boundary, zona limitans intrathalamica, and anterior neural ridge and for the DV neuraxis the notochord, floor plate, and roof plate. A search for homologous secondary organisers in nonvertebrate lineages has led to controversy over their phylogenetic origins. Based on a recent study in hemichordates, it has been suggested that the AP secondary organisers evolved at the base of the deuterostome superphylum, earlier than previously thought. According to this view, the lack of signalling centres in some deuterostome lineages is likely to reflect a secondary loss due to adaptive processes. We propose that the relative evolutionary flexibility of secondary organisers has contributed to a broader morphological complexity of nervous systems in different clades.
Zhou, Tai-Cheng; Sha, Tao; Irwin, David M; Zhang, Ya-Ping
2015-01-01
Pavo cristatus, known as the Indian peafowl, is endemic to India and Sri Lanka and has been domesticated for its ornamental and food value. However, its phylogenetic status is still debated. Here, to clarify the phylogenetic status of P. cristatus within Phasianidae, we analyzed its mitochondrial genome (mtDNA). The complete mitochondrial DNA (mtDNA) genome was determined using 34 pairs of primers. Our data show that the mtDNA genome of P. cristatus is 16,686 bp in length. Molecular phylogenetic analyses of P. cristatus was performed along with 22 complete mtDNA genomes belonging to other species in Phasianidae using Bayesian and maximum likelihood methods, where Aythya americana and Anas platyrhynchos were used as outgroups. Our results show that P. critatus has its closest genetic affinity with Pavo muticus and belongs to clade that contains Gallus, Bambusicola and Francolinus.
Epidemiology of taeniosis/cysticercosis in Europe, a systematic review: Western Europe.
Laranjo-González, Minerva; Devleesschauwer, Brecht; Trevisan, Chiara; Allepuz, Alberto; Sotiraki, Smaragda; Abraham, Annette; Afonso, Mariana Boaventura; Blocher, Joachim; Cardoso, Luís; Correia da Costa, José Manuel; Dorny, Pierre; Gabriël, Sarah; Gomes, Jacinto; Gómez-Morales, María Ángeles; Jokelainen, Pikka; Kaminski, Miriam; Krt, Brane; Magnussen, Pascal; Robertson, Lucy J; Schmidt, Veronika; Schmutzhard, Erich; Smit, G Suzanne A; Šoba, Barbara; Stensvold, Christen Rune; Starič, Jože; Troell, Karin; Rataj, Aleksandra Vergles; Vieira-Pinto, Madalena; Vilhena, Manuela; Wardrop, Nicola Ann; Winkler, Andrea S; Dermauw, Veronique
2017-07-21
Taenia solium and Taenia saginata are zoonotic parasites of public health importance. Data on their occurrence in humans and animals in western Europe are incomplete and fragmented. In this study, we aimed to update the current knowledge on the epidemiology of these parasites in this region. We conducted a systematic review of scientific and grey literature published from 1990 to 2015 on the epidemiology of T. saginata and T. solium in humans and animals. Additionally, data about disease occurrence were actively sought by contacting local experts in the different countries. Taeniosis cases were found in twelve out of eighteen countries in western Europe. No cases were identified in Iceland, Ireland, Luxembourg, Norway, Sweden and Switzerland. For Denmark, Netherlands, Portugal, Slovenia, Spain and the UK, annual taeniosis cases were reported and the number of detected cases per year ranged between 1 and 114. Detected prevalences ranged from 0.05 to 0.27%, whereas estimated prevalences ranged from 0.02 to 0.67%. Most taeniosis cases were reported as Taenia spp. or T. saginata, although T. solium was reported in Denmark, France, Italy, Spain, Slovenia, Portugal and the UK. Human cysticercosis cases were reported in all western European countries except for Iceland, with the highest number originating from Portugal and Spain. Most human cysticercosis cases were suspected to have acquired the infection outside western Europe. Cases of T. solium in pigs were found in Austria and Portugal, but only the two cases from Portugal were confirmed with molecular methods. Germany, Spain and Slovenia reported porcine cysticercosis, but made no Taenia species distinction. Bovine cysticercosis was detected in all countries except for Iceland, with a prevalence based on meat inspection of 0.0002-7.82%. Detection and reporting of taeniosis in western Europe should be improved. The existence of T. solium tapeworm carriers, of suspected autochthonous cases of human cysticercosis and
Directory of Open Access Journals (Sweden)
Mingsheng Yang
2015-03-01
Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.
Illera, Juan Carlos; Rando, Juan Carlos; Richardson, David S.; Emerson, Brent C.
2012-09-01
Understanding the age, origins and extinction of oceanic island biota has captivated the interest of evolutionary biologists since Darwin and Wallace. Because oceanic islands are discrete entities of small geographical size but with considerable habitat diversity, they provide ideal templates within which to study evolutionary processes. The peripheral North Atlantic islands, collectively referred to as Macaronesia, are considered a hot spot of biodiversity due to the fact that they contain a large proportion of endemic taxa (ca 25%). Recent molecular studies are providing insight into the patterns of colonization and radiation within the extant avifauna, while paleontological studies have described many extinct avian species, sometimes identifying the causes and chronology of extinction. The aim of this review is to develop an understanding of the evolutionary and biogeographic history of the macaronesian avifauna, combining information from phylogenetic and paleontological studies. We then compare patterns for Macaronesia with those of other oceanic archipelagos to evaluate to what extent patterns may be generalised across regions. Phylogenetic analyses have confirmed the close relationships between endemic macaronesian avifauna and the closest mainland areas (Europe and Africa), however, in contrast to other archipelagos of a similar age, we show that most extant birds appear to have colonized macaronesian archipelagos relatively recently, within the last four million years, despite some islands being approximately 30 million years old. Fossil records support the idea that higher species richness previously existed, with recent dating on bone collagen of selected extinct species suggesting that their extinction coincided with the arrival of aboriginal people ca 2500 years ago in the Canary Islands, or the arrival of Europeans across all the macaronesian islands in the 14th century. It is plausible that these human mediated extinctions may have selectively acted
Koletić, Nikola; Novosel, Maja; Rajević, Nives; Franjević, Damjan
2015-01-01
Bryozoans are aquatic invertebrates that inhabit all types of aquatic ecosystems. They are small animals that form large colonies by asexual budding. Colonies can reach the size of several tens of centimeters, while individual units within a colony are the size of a few millimeters. Each individual within a colony works as a separate zooid and is genetically identical to each other individual within the same colony. Most freshwater species of bryozoans belong to the Phylactolaemata class, while several species that tolerate brackish water belong to the Gymnolaemata class. Tissue samples for this study were collected in the rivers of Adriatic and Danube basin and in the wetland areas in the continental part of Croatia (Europe). Freshwater and brackish taxons of bryozoans were genetically analyzed for the purpose of creating phylogenetic relationships between freshwater and brackish taxons of the Phylactolaemata and Gymnolaemata classes and determining the role of brackish species in colonizing freshwater and marine ecosystems. Phylogenetic relationships inferred on the genes for 18S rRNA, 28S rRNA, COI, and ITS2 region confirmed Phylactolaemata bryozoans as radix bryozoan group. Phylogenetic analysis proved Phylactolaemata bryozoan's close relations with taxons from Phoronida phylum as well as the separation of the Lophopodidae family from other families within the Plumatellida genus. Comparative analysis of existing knowledge about the phylogeny of bryozoans and the expansion of known evolutionary hypotheses is proposed with the model of settlement of marine and freshwater ecosystems by the bryozoans group during their evolutionary past. In this case study, brackish bryozoan taxons represent a link for this ecological phylogenetic hypothesis. Comparison of brackish bryozoan species Lophopus crystallinus and Conopeum seurati confirmed a dual colonization of freshwater ecosystems throughout evolution of this group of animals.
Maier, Caroline Alexandra
2001-01-01
Presents an activity in which students seek answers to questions about evolutionary relationships by using genetic databases and bioinformatics software. Students build genetic distance matrices and phylogenetic trees based on molecular sequence data using web-based resources. Provides a flowchart of steps involved in accessing, retrieving, and…
Molecular phylogenetics, vocalizations, and species limits in Celeus woodpeckers (Aves: Picidae).
Benz, Brett W; Robbins, Mark B
2011-10-01
Species limits and the evolutionary mechanisms that have shaped diversification of woodpeckers and allies (Picidae) remain obscure, as inter and intraspecific phylogenetic relationships have yet to be comprehensively resolved for most genera. Herein, we analyzed 5020 base pairs of nucleotide sequence data from the mitochondrial and nuclear genomes to reconstruct the evolutionary history of Celeus woodpeckers. Broad geographic sampling was employed to assess species limits in phenotypically variable lineages and provide a first look at the evolution of song and plumage traits in this poorly known Neotropical genus. Our results strongly support the monophyly of Celeus and reveal several novel relationships across a shallow phylogenetic topology. We confirm the close sister relationship between Celeus spectabilis and the enigmatic Celeus obrieni, both of which form a clade with Celeus flavus. The Mesoamerican Celeus castaneus was placed as sister to a Celeus undatus-grammicus lineage, with the species status of the latter drawn into question given the lack of substantial genetic, morphological, and vocal variation in these taxa. We recovered paraphyly in Celeus elegans; however, this result appears to be the consequence of mitochondrial introgression from Celeus lugubris considering the monophyly of elegans at the ß-FIBI7 locus. A second instance of paraphyly was observed in Celeus flavescens with deep genetic splits and substantial phenotypic variation indicating the presence of two distinct species in this broadly distributed lineage. As such, we advocate elevation of Celeus flavescens ochraceus to species status. Our analysis of Celeus vocalizations and plumage characters demonstrates a pattern of lability consistent with a relatively recent origin of the genus and potentially rapid speciation history. Copyright © 2011 Elsevier Inc. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Kolanowska, Marta; Grochocka, E.; Konowalik, K.
2017-01-01
Roč. 5, may (2017), č. článku e3328. ISSN 2167-8359 R&D Projects: GA ČR GB14-36098G Institutional support: RVO:86652079 Keywords : campylocentrum orchidaceae * molecular phylogenetics * environmental niches * costa-rica * diversity * models * speciation * ecology * pollination * divergence * Angraecinae * Ecological niche modeling * Orchidaceae * Phylogenetic niche conservatism * Angraecum * Campylocentrum * Dendrophylax Subject RIV: EH - Ecology, Behaviour OBOR OECD: Biodiversity conservation Impact factor: 2.177, year: 2016
Directory of Open Access Journals (Sweden)
Brink Matilda
2012-02-01
Full Text Available Abstract Background Torque teno sus virus 1 (TTSuV1 and 2 (TTSuV2 are small, single-stranded circular DNA viruses belonging to the Anelloviridae family. Available studies clearly show that both viruses are widely distributed in the pig populations in America, Europe and Asia, although the impact of the infection is still unclear. Currently, the situation in domestic pig populations on the African continent is not known. Therefore, the aim of this study was to investigate the possible presence of the two viruses in domestic pigs in Uganda, and describe the phylogenetic relationships to those in the rest of the world. Results Ninety-five serum samples from six districts in Uganda were used, and PCR using TTSuV1 and 2 specific primers for the UTR region was run for viral nucleic acid detection. The positive samples were sequenced, and phylogenetic analyses performed in order to compare the Ugandan sequences with sequences from other parts of the world. The prevalence of TTSuV1 and 2 in the selected domestic pigs were estimated at 16.8% and 48.4% respectively, with co-infection found in 13.7%. The sequence identity was 90-100% between the Ugandan TTSuV1; and 63-100% between the Ugandan TTSuV2 sequences. Conclusion This is the first report on the presence of TTSuV1 and 2 in domestic pigs in Uganda. These results highlight the importance of screening for emerging viruses given the globalisation of human activities.
Bias in phylogenetic reconstruction of vertebrate rhodopsin sequences.
Chang, B S; Campbell, D L
2000-08-01
Two spurious nodes were found in phylogenetic analyses of vertebrate rhodopsin sequences in comparison with well-established vertebrate relationships. These spurious reconstructions were well supported in bootstrap analyses and occurred independently of the method of phylogenetic analysis used (parsimony, distance, or likelihood). Use of this data set of vertebrate rhodopsin sequences allowed us to exploit established vertebrate relationships, as well as the considerable amount known about the molecular evolution of this gene, in order to identify important factors contributing to the spurious reconstructions. Simulation studies using parametric bootstrapping indicate that it is unlikely that the spurious nodes in the parsimony analyses are due to long branches or other topological effects. Rather, they appear to be due to base compositional bias at third positions, codon bias, and convergent evolution at nucleotide positions encoding the hydrophobic residues isoleucine, leucine, and valine. LogDet distance methods, as well as maximum-likelihood methods which allow for nonstationary changes in base composition, reduce but do not entirely eliminate support for the spurious resolutions. Inclusion of five additional rhodopsin sequences in the phylogenetic analyses largely corrected one of the spurious reconstructions while leaving the other unaffected. The additional sequences not only were more proximal to the corrected node, but were also found to have intermediate levels of base composition and codon bias as compared with neighboring sequences on the tree. This study shows that the spurious reconstructions can be corrected either by excluding third positions, as well as those encoding the amino acids Ile, Val, and Leu (which may not be ideal, as these sites can contain useful phylogenetic signal for other parts of the tree), or by the addition of sequences that reduce problems associated with convergent evolution.
Czech Academy of Sciences Publication Activity Database
Bohlen, Jörg; Šlechtová, Vendula; Bogutskaya, N. G.; Freyhof, J.
2006-01-01
Roč. 40, 3 (2006), s. 856-865 ISSN 1055-7903 R&D Projects: GA AV ČR IAA600450508; GA MŠk LC06073; GA MŽP SM/6/3/05 Institutional research plan: CEZ:AV0Z50450515 Keywords : Acheilognatinae * biogeography * freshwater fishes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.528, year: 2006
Pan, Ting Shuang; Nie, Pin
2013-07-01
Acanthocephalans are a small group of obligate endoparasites. They and rotifers are recently placed in a group called Syndermata. However, phylogenetic relationships within classes of acanthocephalans, and between them and rotifers, have not been well resolved, possibly due to the lack of molecular data suitable for such analysis. In this study, the mitochondrial (mt) genome was sequenced from Pallisentis celatus (Van Cleave, 1928), an acanthocephalan in the class Eoacanthocephala, an intestinal parasite of rice-field eel, Monopterus albus (Zuiew, 1793), in China. The complete mt genome sequence of P. celatus is 13 855 bp long, containing 36 genes including 12 protein-coding genes, 22 transfer RNAs (tRNAs) and 2 ribosomal RNAs (rRNAs) as reported for other acanthocephalan species. All genes are encoded on the same strand and in the same direction. Phylogenetic analysis indicated that acanthocephalans are closely related with a clade containing bdelloids, which then correlates with the clade containing monogononts. The class Eoacanthocephala, containing P. celatus and Paratenuisentis ambiguus (Van Cleave, 1921) was closely related to the Palaeacanthocephala. It is thus indicated that acanthocephalans may be just clustered among groups of rotifers. However, the resolving of phylogenetic relationship among all classes of acanthocephalans and between them and rotifers may require further sampling and more molecular data.
On Nakhleh's metric for reduced phylogenetic networks
Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro
2009-01-01
We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...
Transforming phylogenetic networks: Moving beyond tree space.
Huber, Katharina T; Moulton, Vincent; Wu, Taoyang
2016-09-07
Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.
A phylogenetic delimitation of the "Sphagnum subsecundum complex" (Sphagnaceae, Bryophyta).
Shaw, A Jonathan; Boles, Sandra; Shaw, Blanka
2008-06-01
A seemingly obvious but sometimes overlooked premise of any evolutionary analysis is delineating the group of taxa under study. This is especially problematic in some bryophyte groups because of morphological simplicity and convergence. This research applies information from nucleotide sequences for eight plastid and nuclear loci to delineate a group of northern hemisphere peat moss species, the so-called Sphagnum subsecundum complex, which includes species known to be gametophytically haploid or diploid (i.e., sporophytically diploid-tetraploid). Despite the fact that S. subsecundum and several species in the complex have been attributed disjunct ranges that include all major continents, phylogenetic analyses suggest that the group is actually restricted to Europe and eastern North America. Plants from western North America, from California to Alaska, which are morphologically similar to species of the S. subsecundum complex in eastern N. America and Europe, actually belong to a different deep clade within Sphagnum section Subsecunda. One species often considered part of the S. subsecundum complex, S. contortum, likely has a reticulate history involving species in the two deepest clades within section Subsecunda. Nucleotide sequences have a strong geographic structure across the section Subsecunda, but shallow tip clades suggest repeated long-distance dispersal in the section as well.
Functional and phylogenetic ecology in R
Swenson, Nathan G
2014-01-01
Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...
Phylogenetic estimates of diversification rate are affected by molecular rate variation.
Duchêne, D A; Hua, X; Bromham, L
2017-10-01
Molecular phylogenies are increasingly being used to investigate the patterns and mechanisms of macroevolution. In particular, node heights in a phylogeny can be used to detect changes in rates of diversification over time. Such analyses rest on the assumption that node heights in a phylogeny represent the timing of diversification events, which in turn rests on the assumption that evolutionary time can be accurately predicted from DNA sequence divergence. But there are many influences on the rate of molecular evolution, which might also influence node heights in molecular phylogenies, and thus affect estimates of diversification rate. In particular, a growing number of studies have revealed an association between the net diversification rate estimated from phylogenies and the rate of molecular evolution. Such an association might, by influencing the relative position of node heights, systematically bias estimates of diversification time. We simulated the evolution of DNA sequences under several scenarios where rates of diversification and molecular evolution vary through time, including models where diversification and molecular evolutionary rates are linked. We show that commonly used methods, including metric-based, likelihood and Bayesian approaches, can have a low power to identify changes in diversification rate when molecular substitution rates vary. Furthermore, the association between the rates of speciation and molecular evolution rate can cause the signature of a slowdown or speedup in speciation rates to be lost or misidentified. These results suggest that the multiple sources of variation in molecular evolutionary rates need to be considered when inferring macroevolutionary processes from phylogenies. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.
Ocampo, Gilberto; Columbus, J Travis
2012-04-01
Portulaca is the only genus in Portulacaceae and has ca. 100 species distributed worldwide, mainly in the tropics and subtropics. Molecular data place the genus as one of the closest relatives of Cactaceae, but phylogenetic relationships within Portulaca are barely known. This study samples 59 species of Portulaca, 10 infraspecific taxa, and three cultivars, including multiple samples of widespread species. The sampled taxa represent all subgenera in the classifications of von Poellnitz (1934), Legrand (1958), and Geesink (1969) and come from around the world. Nuclear ITS and chloroplast ndhF, trnT-psbD intergenic spacer, and ndhA intron DNA sequences were analyzed using maximum likelihood and Bayesian methods to produce a hypothesis of relationships within Portulaca. Divergence times were estimated using Hawaiian endemics for calibration, and biogeographical patterns were examined using a Bayes-DIVA approach. In addition, the evolution of chromosome numbers in the genus was investigated using probabilistic models. The analyses strongly support the monophyly of Portulaca, with an age of the most recent common ancestor (MRCA) of 23 Myr. Within Portulaca are two major lineages: the OL clade (comprising opposite-leaved species) distributed in Africa, Asia, and Australia, and the AL clade (comprising alternate to subopposite-leaved species), which is more widespread and originated in the New World. Sedopsis, a genus sometimes recognized as distinct from Portulaca based on a long corolla tube, is nested within the OL clade and does not merit taxonomic recognition. Samples of Portulaca grandiflora, Portulaca halimoides, and Portulaca oleracea were found to be non-monophyletic. It is hypothesized that the ancestral distribution area of Portulaca included southern hemisphere continents and Asia. The OL clade remained restricted to the Old World (except Portulaca quadrifida, a pantropical weed), while the AL clade, with a South American origin, was able to disperse multiple
Host-range phylogenetic grouping of capripoxviruses. Genetic typing of CaPVs
International Nuclear Information System (INIS)
Le Goff, C.; Chadeyras, A.; Libeau, G.; Albina, E.; Fakhfakh, E.; Hammami, S.; Elexpeter Aba Adulugba; Diallo, A.
2005-01-01
Because of their close relationship, specific identification of the CaPVs genus inside the Poxviridae family relies mainly on molecular tools rather than on classical serology. We describe the suitability of the G protein-coupled chemokine receptor (GPCR), for host range phylogenetic grouping. The analysis of 26 CaPVs shows 3 tight genetic clusters consisting of goatpox virus (GPV), lumpy skin disease virus (LSDV), and sheeppox virus (SPV). (author)
A format for phylogenetic placements.
Directory of Open Access Journals (Sweden)
Frederick A Matsen
Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.
Phylogenetic inertia and Darwin's higher law.
Shanahan, Timothy
2011-03-01
The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.
Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.
Wolf, P
1997-10-01
Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.
Directory of Open Access Journals (Sweden)
Giovan F Gómez
Full Text Available Phylogenetic analysis of partial mitochondrial cytochrome oxidase c subunit I (COI and nuclear internal transcribed spacer 2 (ITS2 sequences were used to evaluate initial identification and to investigate phylogenetic relationships of seven Anopheles morphospecies of the Arribalzagia Series from Colombia. Phylogenetic trees recovered highly supported clades for An. punctimaculas.s., An. calderoni, An. malefactor s.l., An. neomaculipalpus, An. apicimacula s.l., An. mattogrossensis and An. peryassui. This study provides the first molecular confirmation of An. malefactorfrom Colombia and discovered conflicting patterns of divergence for the molecular markers among specimens from northeast and northern Colombia suggesting the presence of two previously unrecognized Molecular Operational Taxonomic Units (MOTUs. Furthermore, two highly differentiated An. apicimacula MOTUs previously found in Panama were detected. Overall, the combined molecular dataset facilitated the detection of known and new Colombian evolutionary lineages, and constitutes the baseline for future research on their bionomics, ecology and potential role as malaria vectors.
Directory of Open Access Journals (Sweden)
Mariwan M M Al-Bajalan
2018-03-01
Full Text Available Cutaneous leishmaniasis (CL is a neglected worldwide, zoonotic, vector-borne, tropical disease that is a threat to public health. This threat may spread from endemic to non-endemic areas. Current research has exploited epidemiological, molecular and phylogenetical studies to determine the danger of an outbreak of CL in the borderline area between northern and central Iraq from 2014-2017.For the first time, using sequence analysis of the cytochrome b gene, the occurrence of CL in the borderline area between northern and central Iraq was confirmed to be due to Leishmania major. The phylogenetic analysis indicated that it was closely related to the L. major MRHO/IR/75/ER strain in Iran.In conclusion, the genotype confirmation of the L. major strain will improve our understanding of the epidemiology of the disease. This is important for facilitating control programs to prevent the further spread of CL. Furthermore, this area could be considered as a model for further research on the risk of global CL epidemics in other non-endemic countries where both reservoir hosts and sandfly vectors are present.
Acosta, Igor da Cunha Lima; da Costa, Andrea Pereira; Nunes, Pablo Henrique; Gondim, Maria Fernanda Naegeli; Gatti, Andressa; Rossi, João Luiz; Gennari, Solange Maria; Marcili, Arlei
2013-12-11
The Lowland tapir (Tapirus terrestris) is the largest Brazilian mammal and despite being distributed in various Brazilian biomes, it is seriously endangered in the Atlantic Rainforest. These hosts were never evaluated for the presence of Trypanosoma parasites. The Lowland tapirs were captured in the Brazilian southeastern Atlantic Rainforest, Espírito Santo state. Trypanosomes were isolated by hemoculture, and the molecular phylogeny based on small subunit rDNA (SSU rDNA) and glycosomal-3-phosphate dehydrogenase (gGAPDH) gene sequences and the ultrastructural features seen via light microscopy and scanning and transmission electron microscopy are described. Phylogenetic trees using combined SSU rDNA and gGAPDH data sets clustered the trypanosomes of Lowland tapirs, which were highly divergent from other trypanosome species. The phylogenetic position and morphological discontinuities, mainly in epimastigote culture forms, made it possible to classify the trypanosomes from Lowland tapirs as a separate species. The isolated trypanosomes from Tapirus terrestris are a new species, Trypanosoma terrestris sp. n., and were positioned in a new Trypanosoma clade, named T. terrestris clade.
Al-Bajalan, Mariwan M M; Al-Jaf, Sirwan M A; Niranji, Sherko S; Abdulkareem, Dler R; Al-Kayali, Khudhair K; Kato, Hirotomo
2018-03-01
Cutaneous leishmaniasis (CL) is a neglected worldwide, zoonotic, vector-borne, tropical disease that is a threat to public health. This threat may spread from endemic to non-endemic areas. Current research has exploited epidemiological, molecular and phylogenetical studies to determine the danger of an outbreak of CL in the borderline area between northern and central Iraq from 2014-2017. For the first time, using sequence analysis of the cytochrome b gene, the occurrence of CL in the borderline area between northern and central Iraq was confirmed to be due to Leishmania major. The phylogenetic analysis indicated that it was closely related to the L. major MRHO/IR/75/ER strain in Iran. In conclusion, the genotype confirmation of the L. major strain will improve our understanding of the epidemiology of the disease. This is important for facilitating control programs to prevent the further spread of CL. Furthermore, this area could be considered as a model for further research on the risk of global CL epidemics in other non-endemic countries where both reservoir hosts and sandfly vectors are present.
The transposition distance for phylogenetic trees
Rossello, Francesc; Valiente, Gabriel
2006-01-01
The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...
Phylogenetic Trees From Sequences
Ryvkin, Paul; Wang, Li-San
In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.
The phylogenetic likelihood library.
Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A
2015-03-01
We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.
Directory of Open Access Journals (Sweden)
Jianguo Zhou
2018-02-01
Full Text Available Papaver rhoeas L. and P. orientale L., which belong to the family Papaveraceae, are used as ornamental and medicinal plants. The chloroplast genome has been used for molecular markers, evolutionary biology, and barcoding identification. In this study, the complete chloroplast genome sequences of P. rhoeas and P. orientale are reported. Results show that the complete chloroplast genomes of P. rhoeas and P. orientale have typical quadripartite structures, which are comprised of circular 152,905 and 152,799-bp-long molecules, respectively. A total of 130 genes were identified in each genome, including 85 protein-coding genes, 37 tRNA genes, and 8 rRNA genes. Sequence divergence analysis of four species from Papaveraceae indicated that the most divergent regions are found in the non-coding spacers with minimal differences among three Papaver species. These differences include the ycf1 gene and intergenic regions, such as rpoB-trnC, trnD-trnT, petA-psbJ, psbE-petL, and ccsA-ndhD. These regions are hypervariable regions, which can be used as specific DNA barcodes. This finding suggested that the chloroplast genome could be used as a powerful tool to resolve the phylogenetic positions and relationships of Papaveraceae. These results offer valuable information for future research in the identification of Papaver species and will benefit further investigations of these species.
Aspergillus niger contains the cryptic phylogenetic species A. awamori.
Perrone, Giancarlo; Stea, Gaetano; Epifani, Filomena; Varga, János; Frisvad, Jens C; Samson, Robert A
2011-11-01
Aspergillus section Nigri is an important group of species for food and medical mycology, and biotechnology. The Aspergillus niger 'aggregate' represents its most complicated taxonomic subgroup containing eight morphologically indistinguishable taxa: A. niger, Aspergillus tubingensis, Aspergillus acidus, Aspergillus brasiliensis, Aspergillus costaricaensis, Aspergillus lacticoffeatus, Aspergillus piperis, and Aspergillus vadensis. Aspergillus awamori, first described by Nakazawa, has been compared taxonomically with other black aspergilli and recently it has been treated as a synonym of A. niger. Phylogenetic analyses of sequences generated from portions of three genes coding for the proteins β-tubulin (benA), calmodulin (CaM), and the translation elongation factor-1 alpha (TEF-1α) of a population of A. niger strains isolated from grapes in Europe revealed the presence of a cryptic phylogenetic species within this population, A. awamori. Morphological, physiological, ecological and chemical data overlap occurred between A. niger and the cryptic A. awamori, however the splitting of these two species was also supported by AFLP analysis of the full genome. Isolates in both phylospecies can produce the mycotoxins ochratoxin A and fumonisin B₂, and they also share the production of pyranonigrin A, tensidol B, funalenone, malformins, and naphtho-γ-pyrones. In addition, sequence analysis of four putative A. awamori strains from Japan, used in the koji industrial fermentation, revealed that none of these strains belong to the A. awamori phylospecies. Copyright © 2011 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Locating a tree in a phylogenetic network
Iersel, van L.J.J.; Semple, C.; Steel, M.A.
2010-01-01
Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster
Braga, Ísis Assis; de Souza Ramos, Dirceu Guilherme; Marcili, Arlei; Melo, Andréia Lima Tomé; Taques, Isis Indaiara Gonçalves Granjeiro; Amude, Alexandre Mendes; Chitarra, Cristiane Silva; Nakazato, Luciano; Dutra, Valéria; de Campos Pacheco, Richard; Aguiar, Daniel Moura
2016-07-01
Some tick-borne pathogens that infect domestic cats have been considered emergent in veterinary medicine. Occurrences of Hepatozoon spp., Babesia spp. and Cytauxzoon spp. have been described in several regions of Brazil. This paper offers a comprehensive analysis of the 18S rRNA gene of a Hepatozoon sp. strain detected in domestic cats in the metropolitan area of Cuiabá, in Midwestern Brazil. Based on a molecular analysis, we detected the presence of Hepatozoon species circulating among cats in this region. The aforementioned strain is closely related to other isolates of H. felis detected in wild felids. Moreover, a phylogenetic analysis indicates that this genotype is grouped into a clade of 18S rRNA sequences previously described for the genus Hepatozoon in wild felids around the world. Hepatozoon felis strains detected in cats from Spain and Israel showed, respectively, 98% and 97% identity to our sequence and are clustered on a separate branch of the phylogenetic tree. This finding suggests a high diversity of Hepatozoon genotypes occurring in cats in Europe and South America. None of the analyzed cats were positive for Babesia spp. or Cytauxzoon spp. by PCR analysis. Copyright © 2016 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Saito Shigeru
2010-05-01
Full Text Available Abstract Background Plant circadian clocks regulate many photoperiodic and diurnal responses that are conserved among plant species. The plant circadian clock system has been uncovered in the model plant, Arabidopsis thaliana, using genetics and systems biology approaches. However, it is still not clear how the clock system had been organized in the evolutionary history of plants. We recently revealed the molecular phylogeny of LHY/CCA1 genes, one of the essential components of the clock system. The aims of this study are to reconstruct the phylogenetic relationships of angiosperm clock-associated PRR genes, the partner of the LHY/CCA1 genes, and to clarify the evolutionary history of the plant clock system in angiosperm lineages. Results In the present study, to investigate the molecular phylogeny of PRR genes, we performed two approaches: reconstruction of phylogenetic trees and examination of syntenic relationships. Phylogenetic analyses revealed that PRR genes had diverged into three clades prior to the speciation of monocots and eudicots. Furthermore, copy numbers of PRR genes have been independently increased in monocots and eudicots as a result of ancient chromosomal duplication events. Conclusions Based on the molecular phylogenies of both PRR genes and LHY/CCA1 genes, we inferred the evolutionary process of the plant clock system in angiosperms. This scenario provides evolutionary information that a common ancestor of monocots and eudicots had retained the basic components required for reconstructing a clock system and that the plant circadian clock may have become a more elaborate mechanism after the speciation of monocots and eudicots because of the gene expansion that resulted from polyploidy events.
Lv, Changda; Li, Qi; Kong, Lingfeng
2018-01-01
Mitochondrial genomes have proved to be a powerful tool in resolving phylogenetic relationship. In order to understand the mitogenome characteristics and phylogenetic position of the genus Dosinia, we sequenced the complete mitochondrial genomes of Dosinia altior and Dosinia troscheli (Bivalvia: Veneridae), compared them with that of Dosinia japonica and established a phylogenetic tree for Veneridae. The mitogenomes of D. altior (17,536 bp) and D. troscheli (17,229 bp) are the two smallest in Veneridae, which include 13 protein-coding genes, 2 ribosomal RNA genes, 22 tRNA genes, and non-coding regions. The mitogenomes of the Dosinia species are similar in size, gene content, AT content, AT- and GC- skews, and gene arrangement. The phylogenetic relationships of family Veneridae were established based on 12 concatenated protein-coding genes using maximum likelihood and Bayesian analyses, which supported that Dosininae and Meretricinae have a closer relationship, with Tapetinae being the sister taxon. The information obtained in this study will contribute to further understanding of the molecular features of bivalve mitogenomes and the evolutionary history of the genus Dosinia.
Complex phylogenetic placement of ilex species (aquifoliaceae): a case study of molecular phylogeny
International Nuclear Information System (INIS)
Yi, F.; Sun, L.; Xiao, P.G.; Hao, D.C.
2017-01-01
To investigate the phylogenetic relationships among Ilex species distributed in China, we analyzed two alignments including 4,698 characters corresponding to six plastid sequences (matK, rbcL, atpB-rbcL, trnL-F, psbA-trnH, and rpl32-trnL) and 1,748 characters corresponding to two nuclear sequences (ITS and nepGS). Using different partitioning strategies and approaches (i.e., Bayesian inference, maximum likelihood, and maximum parsimony) for phylogeny reconstruction, different topologies and clade supports were determined. A total of 18 Ilex species was divided into two major groups (group I and II) in both plastid and nuclear phylogenies with some incongruences. Potential hybridization events may account, in part, for those phylogenetic uncertainties. The analyses, together with previously identified sequences, indicated that all 18 species were recovered within Eurasia or Asia/North America groups based on plastid data. Meanwhile, the species in group II in the nuclear phylogeny were placed in the Aquifolium clade, as inferred from traditional classification, whereas the species in group I belonged to several other clades. The divergence time of most of the 18 Ilex species was estimated to be not more than 10 million years ago. Based on the results of this study, we concluded that paleogeographical events and past climate changes during the same period might have played important roles in these diversifications. (author)
Molecular phylogenetic implications in Brassica napus based on ...
Indian Academy of Sciences (India)
Brassica napus L. (canola, rapeseed) is one of the most important oil crops in many countries (Abdelmigid 2012;. Fayyaz et al. 2014), and thought to have originated from a cross where the maternal donor was closely related to two diploid species, B. oleracea (CC, 2n = 18) and B. rapa (AA, 2n = 20). Here, molecular ...
Locating a tree in a phylogenetic network
van Iersel, Leo; Semple, Charles; Steel, Mike
2010-01-01
Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...
Nonbinary tree-based phylogenetic networks
Jetten, Laura; van Iersel, Leo
2016-01-01
Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and st...
Encoding phylogenetic trees in terms of weighted quartets.
Grünewald, Stefan; Huber, Katharina T; Moulton, Vincent; Semple, Charles
2008-04-01
One of the main problems in phylogenetics is to develop systematic methods for constructing evolutionary or phylogenetic trees. For a set of species X, an edge-weighted phylogenetic X-tree or phylogenetic tree is a (graph theoretical) tree with leaf set X and no degree 2 vertices, together with a map assigning a non-negative length to each edge of the tree. Within phylogenetics, several methods have been proposed for constructing such trees that work by trying to piece together quartet trees on X, i.e. phylogenetic trees each having four leaves in X. Hence, it is of interest to characterise when a collection of quartet trees corresponds to a (unique) phylogenetic tree. Recently, Dress and Erdös provided such a characterisation for binary phylogenetic trees, that is, phylogenetic trees all of whose internal vertices have degree 3. Here we provide a new characterisation for arbitrary phylogenetic trees.
Directory of Open Access Journals (Sweden)
Rodrigo Almeida Guimarães
2015-10-01
Full Text Available Neonatal diarrhea determines significant changes in feed conversion, causing productivity loss in caprine herds. The antimicrobial resistance in bacteria is characterized as an important public health issue; therefore, Escherichia coli may be characterized as an important pathogen due to expressing virulence mechanisms responsible for significant clinical conditions in humans and animals. The present study evaluated the presence of E. coli among 117 caprine fecal samples and analyzed the isolates for antimicrobial resistance. Suggestive colonies were submitted to biochemical screening followed by genotypic group determination and phylogenetic analysis; further, the samples were submitted to antimicrobials susceptibility test. E. coli, Salmonella spp, Shigella sonnei and Enterobacter aerogenes were identified. E. coli isolates were phylogenetically classified as B2 (9/39, D (19/39, B1 (7/39 e A (4/29 groups. The analysis of the isolates also revealed the presence of K99 (04/39 and Stx (02/39 virulence factors. Antimicrobial susceptibility test revealed sensitive isolates to Chloramphenicol, Streptomycin, Amoxicillin and Ciprofloxacin, being all resistant to Lincomycin, Vancomycin and Penicillin. The results support the need of establishing restricted protocols for antimicrobial use, a fundamental procedure for health improvement in Brazilian caprine herds.
Directory of Open Access Journals (Sweden)
Lajos VÖRÖS
2009-08-01
Full Text Available The photoautotrophic picoplankton (PPP of ten shallow, hyposaline soda lakes located in three different geographical regions in the Carpathian Basin (Central Europe was characterized. These lakes, which frequently dry out completely, are extremely rich in PPP. Epifluorescence microscopy was applied to determine picocyanobacterial and picoeukaryotic cell abundance and PCR-based molecular techniques (denaturing gradient gel electrophoresis and cloning with phylospecies delineation to identify the members of PPP. Most of these lakes were eu- and hypertrophic with varying contribution of picocyanobacteria to the total PPP cell number. We found an unusually high PPP abundance with peaks of 8.16 × 106 cells mL-1 for picoeukaryotes and 1.78 × 107 cells mL-1 for picocyanobacteria. The majority of the retrieved PPP sequences belonged to picocyanobacteria (nonmarine Synechococcus/ Cyanobium, while others showed similarity to eukaryotic algal plastids (close to Trebouxiophycean isolates. Molecular analysis revealed significant genetic diversity in the PPP fraction of these lakes and showed that the closest relatives of our picocyanobacterial clones were recovered from different habitats, indicating seemingly no correlation between the 'saline' ecotypes and their phylogenetic position. Our results also confirmed that PPP might exploit different aquatic ecosystems and be successful even in the case of abrupt changes of environmental parameters (in our case, salinity. According to our knowledge, this is the first survey focusing on the identification of the PPP community members in turbid and alkaline lakes with extraordinarily high picoplankton productivity.
Urantowka, Adam Dawid; Kroczak, Aleksandra; Mackiewicz, Paweł
2017-07-14
Conures are a morphologically diverse group of Neotropical parrots classified as members of the tribe Arini, which has recently been subjected to a taxonomic revision. The previously broadly defined Aratinga genus of this tribe has been split into the 'true' Aratinga and three additional genera, Eupsittula, Psittacara and Thectocercus. Popular markers used in the reconstruction of the parrots' phylogenies derive from mitochondrial DNA. However, current phylogenetic analyses seem to indicate conflicting relationships between Aratinga and other conures, and also among other Arini members. Therefore, it is not clear if the mtDNA phylogenies can reliably define the species tree. The inconsistencies may result from the variable evolution rate of the markers used or their weak phylogenetic signal. To resolve these controversies and to assess to what extent the phylogenetic relationships in the tribe Arini can be inferred from mitochondrial genomes, we compared representative Arini mitogenomes as well as examined the usefulness of the individual mitochondrial markers and the efficiency of various phylogenetic methods. Single molecular markers produced inconsistent tree topologies, while different methods offered various topologies even for the same marker. A significant disagreement in these tree topologies occurred for cytb, nd2 and nd6 genes, which are commonly used in parrot phylogenies. The strongest phylogenetic signal was found in the control region and RNA genes. However, these markers cannot be used alone in inferring Arini phylogenies because they do not provide fully resolved trees. The most reliable phylogeny of the parrots under study is obtained only on the concatenated set of all mitochondrial markers. The analyses established significantly resolved relationships within the former Aratinga representatives and the main genera of the tribe Arini. Such mtDNA phylogeny can be in agreement with the species tree, owing to its match with synapomorphic features in
Bringing molecules back into molecular evolution.
Directory of Open Access Journals (Sweden)
Claus O Wilke
Full Text Available Much molecular-evolution research is concerned with sequence analysis. Yet these sequences represent real, three-dimensional molecules with complex structure and function. Here I highlight a growing trend in the field to incorporate molecular structure and function into computational molecular-evolution work. I consider three focus areas: reconstruction and analysis of past evolutionary events, such as phylogenetic inference or methods to infer selection pressures; development of toy models and simulations to identify fundamental principles of molecular evolution; and atom-level, highly realistic computational modeling of molecular structure and function aimed at making predictions about possible future evolutionary events.
Jafar Bekloo, Ahmad; Ramzgouyan, Maryam Roya; Shirian, Sadegh; Faghihi, Faezeh; Bakhshi, Hassan; Naseri, Fatemeh; Sedaghat, Mehdi; Telmadarraiy, Zakkyeh
2018-05-01
Anaplasma/Ehrlichia species are tick-transmitted pathogens that cause infections in humans and numerous domestic and wild animal species. There is no information available on the molecular characteristics and phylogenetic position of Anaplasma/Ehrlichia spp. isolated from tick species from different geographic locations in Iran. The aim of this study was to determine the prevalence, molecular characteristics, and phylogenetic relationship of both Anaplasma spp. and Ehrlichia spp. in tick species isolated from different domestic animals from two different geographical locations of Iran. A total of 930 ticks were collected from 93 cattle, 250 sheep, and 587 goats inhabiting the study areas. The collected ticks were then investigated for the presence of Anaplasma/Ehrlichia spp. using nested PCR based on the 16S rRNA gene, followed by sequencing. Sequence analysis was done based on the data published in the GenBank on Anaplasma/Ehrlichia spp. isolates using bioinformatic tools such as the standard nucleotide BLAST. Genome of Anaplasma or Ehrlichia spp. was detected in 14 ticks collected in Heris, including 5 Dermacentor marginatus, 1 Haemaphysalis erinacei, 3 Hyalomma anatolicum, and 4 Rhipicephalus sanguineus, also in 29 ticks collected in Chabahar, including 14 R. sanguineus, 8 D. marginatus, 3 Hyalomma Anatolicum, and 4 Hyalomma dromedarii. Partial analysis of the 16S rRNA gene sequence of positive samples collected from goats and sheep showed that they were infected with Anaplasma/Ehrlichia spp. that were 94-98% identical to ovine Anaplasma and 91-96% identical to Neoehrlichia and Ehrlichia spp. The various ticks identified in this study suggest the possible emergence of tick-borne diseases in animals and humans in these regions. R. sanguineus and D. marginatus seem to be predominant vectors responsible for anaplasmosis in these regions. Partial sequence analysis of the 16S rRNA gene showed that A. ovis is genetically polymorphic in these regions. Furthermore, an
Martucci, Maria Elvira Poleti; Loeuille, Benoit; Pirani, José Rubens; Gobbo-Neto, Leonardo
2018-01-01
Members of the subtribe Lychnophorinae occur mostly within the Cerrado domain of the Brazilian Central Plateau. The relationships between its 11 genera, as well as between Lychnophorinae and other subtribes belonging to the tribe Vernonieae, have recently been investigated upon a phylogeny based on molecular and morphological data. We report the use of a comprehensive untargeted metabolomics approach, combining HPLC-MS and GC-MS data, followed by multivariate analyses aiming to assess the congruence between metabolomics data and the phylogenetic hypothesis, as well as its potential as a chemotaxonomic tool. We analyzed 78 species by UHPLC-MS and GC-MS in both positive and negative ionization modes. The metabolic profiles obtained for these species were treated in MetAlign and in MSClust and the matrices generated were used in SIMCA for hierarchical cluster analyses, principal component analyses and orthogonal partial least square discriminant analysis. The results showed that metabolomic analyses are mostly congruent with the phylogenetic hypothesis especially at lower taxonomic levels (Lychnophora or Eremanthus). Our results confirm that data generated using metabolomics provide evidence for chemotaxonomical studies, especially for phylogenetic inference of the Lychnophorinae subtribe and insight into the evolution of the secondary metabolites of this group.
Tree-Based Unrooted Phylogenetic Networks.
Francis, A; Huber, K T; Moulton, V
2018-02-01
Phylogenetic networks are a generalization of phylogenetic trees that are used to represent non-tree-like evolutionary histories that arise in organisms such as plants and bacteria, or uncertainty in evolutionary histories. An unrooted phylogenetic network on a non-empty, finite set X of taxa, or network, is a connected, simple graph in which every vertex has degree 1 or 3 and whose leaf set is X. It is called a phylogenetic tree if the underlying graph is a tree. In this paper we consider properties of tree-based networks, that is, networks that can be constructed by adding edges into a phylogenetic tree. We show that although they have some properties in common with their rooted analogues which have recently drawn much attention in the literature, they have some striking differences in terms of both their structural and computational properties. We expect that our results could eventually have applications to, for example, detecting horizontal gene transfer or hybridization which are important factors in the evolution of many organisms.
A remarkable new species of Liparis (Orchidaceae from China and its phylogenetic implications.
Directory of Open Access Journals (Sweden)
Lin Li
Full Text Available In the present study, we formally describe Liparis pingxiangensis as a new species from Guangxi, China on the basis of morphological and molecular phylogenetic analyses. It is easily distinguished from closely related species by strongly curved column without column wings, and broadly rhombic-elliptic lip with 2 uncinate calli at the base. In particular, it differs most markedly from its congeners in possessing two pollinia attached by long and prominent caudicles (not stipes, to a distinct sticky disc. This type of pollinarium, as far as we know, is not found in any other species of Liparis, and is also unique among the orchids with waxy pollinia. We then proceeded to a phylogenetic analysis to ascertain the systematic position of this enigmatic species. Molecular study based on nuclear ribosomal ITS and plastid matK DNA sequence data supports L. pingxiangensis as a distinct species, which forms an independent lineage sister to L. nervosa and its allies (93% BS, 1.00 BPP. In the light of previous work, the findings have important implications for a better understanding of the well-supported pattern mainly based on vegetative features in Malaxideae.
Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd
2017-01-26
The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consisting of N. ampullaria, N. mirabilis, N. gracilis and N. rafflesiana, and another containing both intermediately distributed species (N. albomarginata and N. benstonei) and four highland species (N. sanguinea, N. macfarlanei, N. ramispina and N. alba). The trnL intron and ITS sequences proved to provide phylogenetic informative characters for deriving a phylogeny of Nepenthes species in Peninsular Malaysia. To our knowledge, this is the first molecular phylogenetic study of Nepenthes species occurring along an altitudinal gradient in Peninsular Malaysia.
PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis
Benavente, Ernest D
2015-05-13
Background Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights into the genomic variation underlying intra- and inter-strain diversity, thereby assisting with the classification and molecular barcoding of the bacteria. One roadblock to strain investigation is the lack of user-interactive solutions to interrogate and visualise variation within a phylogenetic tree setting. Results We have developed a web-based tool called PhyTB (http://pathogenseq.lshtm.ac.uk/phytblive/index.php webcite) to assist phylogenetic tree visualisation and identification of M. tuberculosis clade-informative polymorphism. Variant Call Format files can be uploaded to determine a sample position within the tree. A map view summarises the geographical distribution of alleles and strain-types. The utility of the PhyTB is demonstrated on sequence data from 1,601 M. tuberculosis isolates. Conclusion PhyTB contextualises M. tuberculosis genomic variation within epidemiological, geographical and phylogenic settings. Further tool utility is possible by incorporating large variants and phenotypic data (e.g. drug-resistance profiles), and an assessment of genotype-phenotype associations. Source code is available to develop similar websites for other organisms (http://sourceforge.net/projects/phylotrack webcite).
Karanovic, Tomislav; Kim, Kichoon
2014-11-01
Cuticular organs have not been described systematically in harpacticoids until recently, and they haven ever been used as characters for reconstructing phylogenetic relationships in any crustacean group. We survey cuticular pores and sensilla on somites in ten Miraciidae species, belonging to six genera, from Korea, Australia, and Russia. Nine species belong to the subfamily Stenheliinae, while the outgroup belongs to the subfamily Diosaccinae. We aim to compare phylogenetic trees reconstructed for these harpactioids based on: 1) cuticular organs (with 76 characters scored, 71% of them phylogenetically informative); 2) traditionally used macro-morphological characters (66 scored, 77% of them informative);and 3) mtCOI DNA data. All analyses suggest that cuticular organs are useful characters for harpacticoid species delineation, although not as sensitive as some fast-evolving molecular markers. Reconstructed cladograms based on all three datasets show very high bootstrap values for clades representing distinct genera, suggesting that cuticular organs are suitable characters for studying phylogenetic relationships. Bootstrap values for the more basal nodes differ among the different cladograms,as do the sister-group relationships they suggest, indicating that cuticular organs probably have different evolutionary constraints from macro-morphological characters. Cuticular organs could be quite useful in the study of old museum specimens and fossil crustaceans.
Liu, Jingjing; Wu, Weixiang; Chen, Chongjun; Sun, Faqian; Chen, Yingxu
2011-09-01
In order to obtain insight into the prokaryotic diversity and community in leachate sediment, a culture-independent DNA-based molecular phylogenetic approach was performed with archaeal and bacterial 16S rRNA gene clone libraries derived from leachate sediment of an aged landfill. A total of 59 archaeal and 283 bacterial rDNA phylotypes were identified in 425 archaeal and 375 bacterial analyzed clones. All archaeal clones distributed within two archaeal phyla of the Euryarchaeota and Crenarchaeota, and well-defined methanogen lineages, especially Methanosaeta spp., are the most numerically dominant species of the archaeal community. Phylogenetic analysis of the bacterial library revealed a variety of pollutant-degrading and biotransforming microorganisms, including 18 distinct phyla. A substantial fraction of bacterial clones showed low levels of similarity with any previously documented sequences and thus might be taxonomically new. Chemical characteristics and phylogenetic inferences indicated that (1) ammonium-utilizing bacteria might form consortia to alleviate or avoid the negative influence of high ammonium concentration on other microorganisms, and (2) members of the Crenarchaeota found in the sediment might be involved in ammonium oxidation. This study is the first to report the composition of the microbial assemblages and phylogenetic characteristics of prokaryotic populations extant in leachate sediment. Additional work on microbial activity and contaminant biodegradation remains to be explored.
Directory of Open Access Journals (Sweden)
Patricia Mingo-Casas
2018-04-01
Full Text Available Previous studies have shown that EBLV-1 strains exclusively hosted by Eptesicus isabellinus bats in the Iberian Peninsula cluster in a specific monophyletic group that is related to the EBLV-1b lineage found in the rest of Europe. More recently, enhanced passive surveillance has allowed the detection of the first EBLV-1 strains associated to Eptesicus serotinus south of the Pyrenees. The aim of this study is the reconstruction of the EBLV-1 phylogeny and phylodynamics in the Iberian Peninsula in the context of the European continent. We have sequenced 23 EBLV-1 strains detected on nine E. serotinus and 14 E. isabellinus. Phylogenetic analyses were performed on the first 400-bp-5' fragment of the Nucleoprotein (N gene together with other 162 sequences from Europe. Besides, fragments of the variable region of the phosphoprotein (P gene and the glycoprotein-polymerase (G-L intergenic region were studied on Spanish samples. Phylogenies show that two of the new EBLV-1a strains from Iberian E. serotinus clustered together with French strains from the North of the Pyrenees, suggesting a recent expansion southwards of this subtype. The remaining seven Iberian strains from E. serotinus grouped, instead, within the cluster linked, so far, to E. isabellinus, indicating that spatial distribution prevails over species specificity in explaining rabies distribution and supporting interspecific transmission. The structure found within the Iberian Peninsula for EBLV-1b is in concordance with that described previously for E. isabellinus. Finally, we have found that the current EBLV-1 European strains could have emerged only 175 years ago according to our evolutionary dynamics analyses.
Mingo-Casas, Patricia; Sandonís, Virginia; Obón, Elena; Berciano, José M; Vázquez-Morón, Sonia; Juste, Javier; Echevarría, Juan E
2018-04-01
Previous studies have shown that EBLV-1 strains exclusively hosted by Eptesicus isabellinus bats in the Iberian Peninsula cluster in a specific monophyletic group that is related to the EBLV-1b lineage found in the rest of Europe. More recently, enhanced passive surveillance has allowed the detection of the first EBLV-1 strains associated to Eptesicus serotinus south of the Pyrenees. The aim of this study is the reconstruction of the EBLV-1 phylogeny and phylodynamics in the Iberian Peninsula in the context of the European continent. We have sequenced 23 EBLV-1 strains detected on nine E. serotinus and 14 E. isabellinus. Phylogenetic analyses were performed on the first 400-bp-5' fragment of the Nucleoprotein (N) gene together with other 162 sequences from Europe. Besides, fragments of the variable region of the phosphoprotein (P) gene and the glycoprotein-polymerase (G-L) intergenic region were studied on Spanish samples. Phylogenies show that two of the new EBLV-1a strains from Iberian E. serotinus clustered together with French strains from the North of the Pyrenees, suggesting a recent expansion southwards of this subtype. The remaining seven Iberian strains from E. serotinus grouped, instead, within the cluster linked, so far, to E. isabellinus, indicating that spatial distribution prevails over species specificity in explaining rabies distribution and supporting interspecific transmission. The structure found within the Iberian Peninsula for EBLV-1b is in concordance with that described previously for E. isabellinus. Finally, we have found that the current EBLV-1 European strains could have emerged only 175 years ago according to our evolutionary dynamics analyses.
Nodal distances for rooted phylogenetic trees.
Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel
2010-08-01
Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).
Zhang, Peng
2012-01-01
Background Universal nuclear protein-coding locus (NPCL) markers that are applicable across diverse taxa and show good phylogenetic discrimination have broad applications in molecular phylogenetic studies. For example, RAG1, a representative NPCL marker, has been successfully used to make phylogenetic inferences within all major osteichthyan groups. However, such markers with broad working range and high phylogenetic performance are still scarce. It is necessary to develop more universal NPCL markers comparable to RAG1 for osteichthyan phylogenetics. Methodology/Principal Findings We developed three long universal NPCL markers (>1.6 kb each) based on single-copy nuclear genes (KIAA1239, SACS and TTN) that possess large exons and exhibit the appropriate evolutionary rates. We then compared their phylogenetic utilities with that of the reference marker RAG1 in 47 jawed vertebrate species. In comparison with RAG1, each of the three long universal markers yielded similar topologies and branch supports, all in congruence with the currently accepted osteichthyan phylogeny. To compare their phylogenetic performance visually, we also estimated the phylogenetic informativeness (PI) profile for each of the four long universal NPCL markers. The PI curves indicated that SACS performed best over the whole timescale, while RAG1, KIAA1239 and TTN exhibited similar phylogenetic performances. In addition, we compared the success of nested PCR and standard PCR when amplifying NPCL marker fragments. The amplification success rate and efficiency of the nested PCR were overwhelmingly higher than those of standard PCR. Conclusions/Significance Our work clearly demonstrates the superiority of nested PCR over the conventional PCR in phylogenetic studies and develops three long universal NPCL markers (KIAA1239, SACS and TTN) with the nested PCR strategy. The three markers exhibit high phylogenetic utilities in osteichthyan phylogenetics and can be widely used as pilot genes for
Directory of Open Access Journals (Sweden)
Karla Vittori
2008-12-01
Full Text Available We propose a new distance algorithm for phylogenetic estimation based on Ant Colony Optimization (ACO, named Ant-Based Phylogenetic Reconstruction (ABPR. ABPR joins two taxa iteratively based on evolutionary distance among sequences, while also accounting for the quality of the phylogenetic tree built according to the total length of the tree. Similar to optimization algorithms for phylogenetic estimation, the algorithm allows exploration of a larger set of nearly optimal solutions. We applied the algorithm to four empirical data sets of mitochondrial DNA ranging from 12 to 186 sequences, and from 898 to 16,608 base pairs, and covering taxonomic levels from populations to orders. We show that ABPR performs better than the commonly used Neighbor-Joining algorithm, except when sequences are too closely related (e.g., population-level sequences. The phylogenetic relationships recovered at and above species level by ABPR agree with conventional views. However, like other algorithms of phylogenetic estimation, the proposed algorithm failed to recover expected relationships when distances are too similar or when rates of evolution are very variable, leading to the problem of long-branch attraction. ABPR, as well as other ACO-based algorithms, is emerging as a fast and accurate alternative method of phylogenetic estimation for large data sets.
Kay, Richard F
2015-01-01
Molecular data have converged on a consensus about the genus-level phylogeny of extant platyrrhine monkeys, but for most extinct taxa and certainly for those older than the Pleistocene we must rely upon morphological evidence from fossils. This raises the question as to how well anatomical data mirror molecular phylogenies and how best to deal with discrepancies between the molecular and morphological data as we seek to extend our phylogenies to the placement of fossil taxa. Here I present parsimony-based phylogenetic analyses of extant and fossil platyrrhines based on an anatomical dataset of 399 dental characters and osteological features of the cranium and postcranium. I sample 16 extant taxa (one from each platyrrhine genus) and 20 extinct taxa of platyrrhines. The tree structure is constrained with a "molecular scaffold" of extant species as implemented in maximum parsimony using PAUP with the molecular-based 'backbone' approach. The data set encompasses most of the known extinct species of platyrrhines, ranging in age from latest Oligocene (∼26 Ma) to the Recent. The tree is rooted with extant catarrhines, and Late Eocene and Early Oligocene African anthropoids. Among the more interesting patterns to emerge are: (1) known early platyrrhines from the Late Oligocene through Early Miocene (26-16.5Ma) represent only stem platyrrhine taxa; (2) representatives of the three living platyrrhine families first occur between 15.7 Ma and 13.5 Ma; and (3) recently extinct primates from the Greater Antilles (Cuba, Jamaica, Hispaniola) are sister to the clade of extant platyrrhines and may have diverged in the Early Miocene. It is probable that the crown platyrrhine clade did not originate before about 20-24 Ma, a conclusion consistent with the phylogenetic analysis of fossil taxa presented here and with recent molecular clock estimates. The following biogeographic scenario is consistent with the phylogenetic findings and climatic and geologic evidence: Tropical South
Edwards, Ceiridwen J.; Soulsbury, Carl D.; Statham, Mark J.; Ho, Simon Y. W.; Wall, Dave; Dolf, Gaudenz; Iossa, Graziella; Baker, Phillip J.; Harris, Stephen; Sacks, Benjamin N.; Bradley, Daniel G.
2012-12-01
Quaternary climatic fluctuations have had profound effects on the phylogeographic structure of many species. Classically, species were thought to have become isolated in peninsular refugia, but there is limited evidence that large, non-polar species survived outside traditional refugial areas. We examined the phylogeographic structure of the red fox (Vulpes vulpes), a species that shows high ecological adaptability in the western Palaearctic region. We compared mitochondrial DNA sequences (cytochrome b and control region) from 399 modern and 31 ancient individuals from across Europe. Our objective was to test whether red foxes colonised the British Isles from mainland Europe in the late Pleistocene, or whether there is evidence that they persisted in the region through the Last Glacial Maximum. We found red foxes to show a high degree of phylogeographic structuring across Europe and, consistent with palaeontological and ancient DNA evidence, confirmed via phylogenetic indicators that red foxes were persistent in areas outside peninsular refugia during the last ice age. Bayesian analyses and tests of neutrality indicated population expansion. We conclude that there is evidence that red foxes from the British Isles derived from central European populations that became isolated after the closure of the landbridge with Europe.
On Tree-Based Phylogenetic Networks.
Zhang, Louxin
2016-07-01
A large class of phylogenetic networks can be obtained from trees by the addition of horizontal edges between the tree edges. These networks are called tree-based networks. We present a simple necessary and sufficient condition for tree-based networks and prove that a universal tree-based network exists for any number of taxa that contains as its base every phylogenetic tree on the same set of taxa. This answers two problems posted by Francis and Steel recently. A byproduct is a computer program for generating random binary phylogenetic networks under the uniform distribution model.
DEFF Research Database (Denmark)
Turcinaviciene, Jorga; Rakauskas, Rimantas; Pedersen, Bo Vest
2006-01-01
Phylogenetic relationships among Palaearctic Ribes and/or Onagraceae inhabiting Aphis species from five countries were examined using mitochondrial gene cytochrome oxidase I (CO-I) and nuclear gene elongation factor 1 a (EF-1a) sequences. There was no major conflict between the trees obtained fro...
Lammers, Fritjof; Gallus, Susanne; Janke, Axel; Nilsson, Maria A
2017-10-01
Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Noguera-Savelli, Eliana; Jáuregui, Damelis
2011-09-01
Brassavola inhabits a wide altitude range and habitat types from Northern Mexico to Northern Argentina. Classification schemes in plants have normally used vegetative and floral characters, but when species are very similar, as in this genus, conflicts arise in species delimitation, and alternative methods should be applied. In this study we explored the taxonomic and phylogenetic value of the anatomical structure of leaves in Brassavola; as ingroup, seven species of Brassavola were considered, and as an outgroup Guarianthe skinneri, Laelia anceps, Rhyncholaelia digbyana and Rhyncholaelia glauca were evaluated. Leaf anatomical characters were studied in freehand cross sections of the middle portion with a light microscope. Ten vegetative anatomical characters were selected and coded for the phylogenetic analysis. Phylogenetic reconstruction was carried out under maximum parsimony using the program NONA through WinClada. Overall, Brassavola species reveal a wide variety of anatomical characters, many of them associated with xeromorphic plants: thick cuticle, hypodermis and cells of the mesophyll with spiral thickenings in the secondary wall. Moreover, mesophyll is either homogeneous or heterogeneous, often with extravascular bundles of fibers near the epidermis at both terete and flat leaves. All vascular bundles are collateral, arranged in more than one row in the mesophyll. The phylogenetic analysis did not resolve internal relationships of the genus; we obtained a polytomy, indicating that the anatomical characters by themselves have little phylogenetic value in Brassavola. We concluded that few anatomical characters are phylogenetically important; however, they would provide more support to elucidate the phylogenetic relantionships in the Orchidaceae and other plant groups if they are used in conjunction with morphological and/or molecular characters.
Phylogenetic relationships between the red-tide dinoflagellate Gymnodinium breve and other members of the genera Gymnodinium and Gyrodinium have not been studied at the molecular level. G. breve is most noted for its production of brevetoxin, which has been linked to extensive f...
Phylogenetic diversity and relationships among species of genus ...
African Journals Online (AJOL)
Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...
Martínez-DE LA Puente, J; Navarro, J; Ferraguti, M; Soriguer, R; Figuerola, J
2017-12-01
Culicoides (Diptera: Ceratopogonidae) are vectors of pathogens that affect wildlife, livestock and, occasionally, humans. Culicoides imicola (Kieffer, 1913) is considered to be the main vector of the pathogens that cause bluetongue disease (BT) and African horse sickness (AHS) in southern Europe. The study of blood-feeding patterns in Culicoides is an essential step towards understanding the epidemiology of these pathogens. Molecular tools that increase the accuracy and sensitivity of traditional methods have been developed to identify the hosts of potential insect vectors. However, to the present group's knowledge, molecular studies that identify the hosts of C. imicola in Europe are lacking. The present study genetically characterizes the barcoding region of C. imicola trapped on farms in southern Spain and identifies its vertebrate hosts in the area. The report also reviews available information on the blood-feeding patterns of C. imicola worldwide. Culicoides imicola from Spain feed on blood of six mammals that include species known to be hosts of the BT and AHS viruses. This study provides evidence of the importance of livestock as sources of bloodmeals for C. imicola and the relevance of this species in the transmission of BT and AHS viruses in Europe. © 2017 The Royal Entomological Society.
Bakker, Frederik Theodoor
1995-01-01
In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be
Molecular phylogenetic identification of Fasciola flukes in Nepal.
Shoriki, Takuya; Ichikawa-Seki, Madoka; Devkota, Bhuminand; Rana, Hari B; Devkota, Shiva P; Humagain, Sudeep K; Itagaki, Tadashi
2014-12-01
Eighty-one Fasciola flukes collected from 8 districts in Nepal were analyzed for their species identification on the basis of their spermatogenic status and nuclear ribosomal internal transcribed spacer 1 (ITS1) and for their phylogenetic relation with Fasciola flukes from other Asian countries on the basis of the mitochondrial NADH dehydrogenase subunit 1 (nad1) gene. Sixty-one flukes (75.3%) were aspermic Fasciola sp., and 20 flukes (24.7%) were identified as Fasciola gigantica. All of the aspermic flukes displayed the Fh/Fg type in ITS1, which was predominant in aspermic Fasciola sp. from China, and most (60 flukes) displayed the Fsp-ND1-N1 haplotype in the nad1, which had an identical nucleotide sequence to the major haplotype (Fg-C2) of the aspermic flukes from China. These results suggest that aspermic Fasciola sp. was introduced into Nepal from China. Furthermore, the results of the diversity indices, neutrality indices, and median-joining network analysis with reference haplotypes from Asian countries suggest that aspermic Fasciola sp. rapidly expanded its distribution. In contrasts, F. gigantica displayed 10 nad1 haplotypes, which showed higher population diversity indices than the haplotypes of aspermic flukes, indicating that the F. gigantica population was clearly distributed in Nepal earlier than the aspermic Fasciola population. Although the F. gigantica haplotypes from Nepal formed a star-like phylogeny consisting of a main founder haplotype (Fg-ND1-N1), together with some F. gigantica haplotypes from Myanmar and Thailand, the Nepal population differed genetically from F. gigantica populations of neighboring countries as each country had distinct founder haplotype(s). Copyright © 2014 Elsevier Inc. All rights reserved.
PHYTOCHEMICAL AND PHYLOGENETIC ANALYSIS OF Spondias(Anacardiaceae
Directory of Open Access Journals (Sweden)
Cristiane Pereira
2015-07-01
Full Text Available This paper describes the correlation between the phenolic composition and the molecular phylogenetic reconstruction of five Spondias species (Anacardiaceae. Two of these species (S. venulosa and Spondias sp. occur in rainforest areas and the other three are widely distributed in Brazil (S. dulcis, S.mombin, and S. purpurea. The flavonoid enriched fraction of the S. venulosa leaf extract also underwent a chemical study. The results indicate that the presence of flavonol 3-O-glycosides are a synapomorphic character of the studied American Spondias and the production of rhamnetin 3-O-rutinoside is a synapomorphy of the Atlantic forest species. This is the first report of flavonoids in S. venulosa, an endemic species from the Brazilian Atlantic rainforest.
Directory of Open Access Journals (Sweden)
Shahzad Shaukat
Full Text Available Pakistan and Afghanistan share a long uncontrolled border with extensive population movement on both sides. Wild poliovirus transmission has never been interrupted in this block due to war against terrorism, poor public health infrastructure, misconceptions about polio vaccines and inadequate immunization activities. All these issues complicate the eradication operations and reinforce the complexity of wiping out poliomyelitis from this region. This study illustrates the origins and routes of cross-border wild poliovirus type 1 (WPV1 transmission during 2010-2012 between Pakistan and Afghanistan. Sequence analyses were conducted based on complete VP1 capsid protein sequences for WPV1 study strains to determine the origin of poliovirus genetic lineages and their evolutionary relationships. Phylogenetic tree was constructed from VP1 gene sequences applying Maximum Likelihood method using Kimura 2- parameter model in MEGA program v 5.0. A total of 72 (14.3% out of 502 wild-type 1 polioviruses were found circulating in border areas of both countries during 2010-2012. Molecular phylogenetic analysis classified these strains in to two sub-genotypes with four clusters and 18 lineages. Genetic data confirmed that the most of WPV1 lineages (12; 66.6% were transmitted from Pakistan to Afghanistan. However, the genetic diversity was significantly reduced during 2012 as most of the lineages were completely eliminated. In conclusion, Pakistan-Afghanistan block has emerged as a single poliovirus reservoir sharing the multiple poliovirus lineages due to uncontrolled movement of people across the borders between two countries. If it is neglected, it can jeopardize the extensive global efforts done so-far to eradicate the poliovirus infection. Our data will be helpful to devise the preventive strategies for effective control of wild poliovirus transmission in this region.
Nonbinary Tree-Based Phylogenetic Networks
Jetten, L.; van Iersel, L.J.J.
2018-01-01
Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example
The present study was conducted to better understand how the phylogenetic diversity of true morels (Morchella) in Turkey compares with species found in other regions of the world. The current research builds on our recently published survey of 10 Turkish provinces and another of the world in which D...
Calongea, a new genus of truffles in the Pezizaceae (Pezizales)
Rosanne A. Healy; Gregory Bonito; James M. Trappe
2009-01-01
Phylogenetic analysis of the ITS and LSU rDNA of Pachyphloeus species from Europe and North America revealed a new truffle genus. These molecular analyses plus sequences downloaded from a BLAST search in GenBank indicated that Pachyphloeus prieguensis is within the Pezizaceae but well outside of the genus Pachyphloeus...
Ultrafast Approximation for Phylogenetic Bootstrap
Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt
Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and
Molecular phylogenetic analysis of Fasciola flukes from eastern India.
Hayashi, Kei; Ichikawa-Seki, Madoka; Mohanta, Uday Kumar; Singh, T Shantikumar; Shoriki, Takuya; Sugiyama, Hiromu; Itagaki, Tadashi
2015-10-01
Fasciola flukes from eastern India were characterized on the basis of spermatogenesis status and nuclear ITS1. Both Fasciola gigantica and aspermic Fasciola flukes were detected in Imphal, Kohima, and Gantoku districts. The sequences of mitochondrial nad1 were analyzed to infer their phylogenetical relationship with neighboring countries. The haplotypes of aspermic Fasciola flukes were identical or showed a single nucleotide substitution compared to those from populations in the neighboring countries, corroborating the previous reports that categorized them in the same lineage. However, the prevalence of aspermic Fasciola flukes in eastern India was lower than those in the neighboring countries, suggesting that they have not dispersed throughout eastern India. In contrast, F. gigantica was predominant and well diversified, and the species was thought to be distributed in the area for a longer time than the aspermic Fasciola flukes. Fasciola gigantica populations from eastern India were categorized into two distinct haplogroups A and B. The level of their genetic diversity suggests that populations belonging to haplogroup A have dispersed from the west side of the Indian subcontinent to eastern India with the artificial movement of domestic cattle, Bos indicus, whereas populations belonging to haplogroup B might have spread from Myanmar to eastern India with domestic buffaloes, Bubalus bubalis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Huang, Jian-Xiong; Zhang, Jian; Shen, Yong; Lian, Ju-yu; Cao, Hong-lin; Ye, Wan-hui; Wu, Lin-fang; Bin, Yue
2014-01-01
Ecologists have been monitoring community dynamics with the purpose of understanding the rates and causes of community change. However, there is a lack of monitoring of community dynamics from the perspective of phylogeny. We attempted to understand temporal phylogenetic turnover in a 50 ha tropical forest (Barro Colorado Island, BCI) and a 20 ha subtropical forest (Dinghushan in southern China, DHS). To obtain temporal phylogenetic turnover under random conditions, two null models were used. The first shuffled names of species that are widely used in community phylogenetic analyses. The second simulated demographic processes with careful consideration on the variation in dispersal ability among species and the variations in mortality both among species and among size classes. With the two models, we tested the relationships between temporal phylogenetic turnover and phylogenetic similarity at different spatial scales in the two forests. Results were more consistent with previous findings using the second null model suggesting that the second null model is more appropriate for our purposes. With the second null model, a significantly positive relationship was detected between phylogenetic turnover and phylogenetic similarity in BCI at a 10 m×10 m scale, potentially indicating phylogenetic density dependence. This relationship in DHS was significantly negative at three of five spatial scales. This could indicate abiotic filtering processes for community assembly. Using variation partitioning, we found phylogenetic similarity contributed to variation in temporal phylogenetic turnover in the DHS plot but not in BCI plot. The mechanisms for community assembly in BCI and DHS vary from phylogenetic perspective. Only the second null model detected this difference indicating the importance of choosing a proper null model.
Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact
Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.
2014-01-01
The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300
Borovička, J.; Oborník, M.; Stříbrný, J.; Noordeloos, M.E.; Parra Sánchez, L.A.; Gryndler, M.
2015-01-01
Five Psilocybe species with unresolved systematic position (P. atrobrunnea, P. laetissima, P. medullosa, P. pelliculosa, and P. silvatica) were investigated using four molecular markers (EF1-α, ITS, LSU, and IGS). Phylogenetic analysis revealed that with the exception of P. laetissima, which is now
Undergraduate Students’ Difficulties in Reading and Constructing Phylogenetic Tree
Sa'adah, S.; Tapilouw, F. S.; Hidayat, T.
2017-02-01
Representation is a very important communication tool to communicate scientific concepts. Biologists produce phylogenetic representation to express their understanding of evolutionary relationships. The phylogenetic tree is visual representation depict a hypothesis about the evolutionary relationship and widely used in the biological sciences. Phylogenetic tree currently growing for many disciplines in biology. Consequently, learning about phylogenetic tree become an important part of biological education and an interesting area for biology education research. However, research showed many students often struggle with interpreting the information that phylogenetic trees depict. The purpose of this study was to investigate undergraduate students’ difficulties in reading and constructing a phylogenetic tree. The method of this study is a descriptive method. In this study, we used questionnaires, interviews, multiple choice and open-ended questions, reflective journals and observations. The findings showed students experiencing difficulties, especially in constructing a phylogenetic tree. The students’ responds indicated that main reasons for difficulties in constructing a phylogenetic tree are difficult to placing taxa in a phylogenetic tree based on the data provided so that the phylogenetic tree constructed does not describe the actual evolutionary relationship (incorrect relatedness). Students also have difficulties in determining the sister group, character synapomorphy, autapomorphy from data provided (character table) and comparing among phylogenetic tree. According to them building the phylogenetic tree is more difficult than reading the phylogenetic tree. Finding this studies provide information to undergraduate instructor and students to overcome learning difficulties of reading and constructing phylogenetic tree.
Phylogenetic structure in tropical hummingbird communities
DEFF Research Database (Denmark)
Graham, Catherine H; Parra, Juan L; Rahbek, Carsten
2009-01-01
How biotic interactions, current and historical environment, and biogeographic barriers determine community structure is a fundamental question in ecology and evolution, especially in diverse tropical regions. To evaluate patterns of local and regional diversity, we quantified the phylogenetic...... composition of 189 hummingbird communities in Ecuador. We assessed how species and phylogenetic composition changed along environmental gradients and across biogeographic barriers. We show that humid, low-elevation communities are phylogenetically overdispersed (coexistence of distant relatives), a pattern...... that is consistent with the idea that competition influences the local composition of hummingbirds. At higher elevations communities are phylogenetically clustered (coexistence of close relatives), consistent with the expectation of environmental filtering, which may result from the challenge of sustaining...
Constructing phylogenetic trees using interacting pathways.
Wan, Peng; Che, Dongsheng
2013-01-01
Phylogenetic trees are used to represent evolutionary relationships among biological species or organisms. The construction of phylogenetic trees is based on the similarities or differences of their physical or genetic features. Traditional approaches of constructing phylogenetic trees mainly focus on physical features. The recent advancement of high-throughput technologies has led to accumulation of huge amounts of biological data, which in turn changed the way of biological studies in various aspects. In this paper, we report our approach of building phylogenetic trees using the information of interacting pathways. We have applied hierarchical clustering on two domains of organisms-eukaryotes and prokaryotes. Our preliminary results have shown the effectiveness of using the interacting pathways in revealing evolutionary relationships.
Angelone-Alasaad, Samer; Jowers, Michael J; Panadero, Rosario; Pérez-Creo, Ana; Pajares, Gerardo; Díez-Baños, Pablo; Soriguer, Ramón C; Morrondo, Patrocinio
2016-09-29
Filarioid nematode parasites are major health hazards with important medical, veterinary and economic implications. Recently, they have been considered as indicators of climate change. In this paper, we report the first record of Setaria tundra in roe deer from the Iberian Peninsula. Adult S. tundra were collected from the peritoneal cavity during the post-mortem examination of a 2 year-old male roe deer, which belonged to a private fenced estate in La Alcarria (Guadalajara, Spain). Since 2012, the area has suffered a high roe deer decline rate (75 %), for unknown reasons. Aiming to support the morphological identification and to determine the phylogenetic position of S. tundra recovered from the roe deer, a fragment of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene from the two morphologically identified parasites was amplified, sequenced and compared with corresponding sequences of other filarioid nematode species. Phylogenetic analyses revealed that the isolate of S. tundra recovered was basal to all other formely reported Setaria tundra sequences. The presence of all other haplotypes in Northern Europe may be indicative of a South to North outbreak in Europe. This is the first report of S. tundra in roe deer from the Iberian Peninsula, with interesting phylogenetic results, which may have further implications in the epidemiological and genetic studies of these filarioid parasites. More studies are needed to explore the reasons and dynamics behind the rapid host/geographic expansion of the filarioid parasites in Europe.
Directory of Open Access Journals (Sweden)
Maria Elvira Poleti Martucci
Full Text Available Members of the subtribe Lychnophorinae occur mostly within the Cerrado domain of the Brazilian Central Plateau. The relationships between its 11 genera, as well as between Lychnophorinae and other subtribes belonging to the tribe Vernonieae, have recently been investigated upon a phylogeny based on molecular and morphological data. We report the use of a comprehensive untargeted metabolomics approach, combining HPLC-MS and GC-MS data, followed by multivariate analyses aiming to assess the congruence between metabolomics data and the phylogenetic hypothesis, as well as its potential as a chemotaxonomic tool. We analyzed 78 species by UHPLC-MS and GC-MS in both positive and negative ionization modes. The metabolic profiles obtained for these species were treated in MetAlign and in MSClust and the matrices generated were used in SIMCA for hierarchical cluster analyses, principal component analyses and orthogonal partial least square discriminant analysis. The results showed that metabolomic analyses are mostly congruent with the phylogenetic hypothesis especially at lower taxonomic levels (Lychnophora or Eremanthus. Our results confirm that data generated using metabolomics provide evidence for chemotaxonomical studies, especially for phylogenetic inference of the Lychnophorinae subtribe and insight into the evolution of the secondary metabolites of this group.
Inferring Phylogenetic Networks Using PhyloNet.
Wen, Dingqiao; Yu, Yun; Zhu, Jiafan; Nakhleh, Luay
2018-07-01
PhyloNet was released in 2008 as a software package for representing and analyzing phylogenetic networks. At the time of its release, the main functionalities in PhyloNet consisted of measures for comparing network topologies and a single heuristic for reconciling gene trees with a species tree. Since then, PhyloNet has grown significantly. The software package now includes a wide array of methods for inferring phylogenetic networks from data sets of unlinked loci while accounting for both reticulation (e.g., hybridization) and incomplete lineage sorting. In particular, PhyloNet now allows for maximum parsimony, maximum likelihood, and Bayesian inference of phylogenetic networks from gene tree estimates. Furthermore, Bayesian inference directly from sequence data (sequence alignments or biallelic markers) is implemented. Maximum parsimony is based on an extension of the "minimizing deep coalescences" criterion to phylogenetic networks, whereas maximum likelihood and Bayesian inference are based on the multispecies network coalescent. All methods allow for multiple individuals per species. As computing the likelihood of a phylogenetic network is computationally hard, PhyloNet allows for evaluation and inference of networks using a pseudolikelihood measure. PhyloNet summarizes the results of the various analyzes and generates phylogenetic networks in the extended Newick format that is readily viewable by existing visualization software.
Figueroa, Diego F.; Baco, Amy R.
2014-01-01
In the past decade, molecular phylogenetic analyses of octocorals have shown that the current morphological taxonomic classification of these organisms needs to be revised. The latest phylogenetic analyses show that most octocorals can be divided into three main clades. One of these clades contains the families Coralliidae and Paragorgiidae. These families share several taxonomically important characters and it has been suggested that they may not be monophyletic; with the possibility of the Coralliidae being a derived branch of the Paragorgiidae. Uncertainty exists not only in the relationship of these two families, but also in the classification of the two genera that make up the Coralliidae, Corallium and Paracorallium. Molecular analyses suggest that the genus Corallium is paraphyletic, and it can be divided into two main clades, with the Paracorallium as members of one of these clades. In this study we sequenced the whole mitochondrial genome of five species of Paragorgia and of five species of Corallium to use in a phylogenetic analysis to achieve two main objectives; the first to elucidate the phylogenetic relationship between the Paragorgiidae and Coralliidae and the second to determine whether the genera Corallium and Paracorallium are monophyletic. Our results show that other members of the Coralliidae share the two novel mitochondrial gene arrangements found in a previous study in Corallium konojoi and Paracorallium japonicum; and that the Corallium konojoi arrangement is also found in the Paragorgiidae. Our phylogenetic reconstruction based on all the protein coding genes and ribosomal RNAs of the mitochondrial genome suggest that the Coralliidae are not a derived branch of the Paragorgiidae, but rather a monophyletic sister branch to the Paragorgiidae. While our manuscript was in review a study was published using morphological data and several fragments from mitochondrial genes to redefine the taxonomy of the Coralliidae. Paracorallium was subsumed
Directory of Open Access Journals (Sweden)
Abdulahi Alfonso-Morales
Full Text Available Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV; it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV strains.Sequences of the hyper-variable region of the VP2 (HVR-VP2 gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST, Bayesian Tip-association Significance testing (BaTS and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium in 1987, Africa (Egypt around 1990, East Asia (China and Japan in 1993, the Caribbean Region (Cuba by 1995 and South America (Brazil around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection.To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide.
Alfonso-Morales, Abdulahi; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Majó, Natàlia; Ganges, Llilianne; Pérez, Lester J
2013-01-01
Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV); it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV) strains. Sequences of the hyper-variable region of the VP2 (HVR-VP2) gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST), Bayesian Tip-association Significance testing (BaTS) and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD) software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium) in 1987, Africa (Egypt) around 1990, East Asia (China and Japan) in 1993, the Caribbean Region (Cuba) by 1995 and South America (Brazil) around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection. To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide.
The space of ultrametric phylogenetic trees.
Gavryushkin, Alex; Drummond, Alexei J
2016-08-21
The reliability of a phylogenetic inference method from genomic sequence data is ensured by its statistical consistency. Bayesian inference methods produce a sample of phylogenetic trees from the posterior distribution given sequence data. Hence the question of statistical consistency of such methods is equivalent to the consistency of the summary of the sample. More generally, statistical consistency is ensured by the tree space used to analyse the sample. In this paper, we consider two standard parameterisations of phylogenetic time-trees used in evolutionary models: inter-coalescent interval lengths and absolute times of divergence events. For each of these parameterisations we introduce a natural metric space on ultrametric phylogenetic trees. We compare the introduced spaces with existing models of tree space and formulate several formal requirements that a metric space on phylogenetic trees must possess in order to be a satisfactory space for statistical analysis, and justify them. We show that only a few known constructions of the space of phylogenetic trees satisfy these requirements. However, our results suggest that these basic requirements are not enough to distinguish between the two metric spaces we introduce and that the choice between metric spaces requires additional properties to be considered. Particularly, that the summary tree minimising the square distance to the trees from the sample might be different for different parameterisations. This suggests that further fundamental insight is needed into the problem of statistical consistency of phylogenetic inference methods. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Sun, Miao-Miao; Han, Liang; Zhang, Fu-Kai; Zhou, Dong-Hui; Wang, Shu-Qing; Ma, Jun; Zhu, Xing-Quan; Liu, Guo-Hua
2018-01-01
Marshallagia marshalli (Nematoda: Trichostrongylidae) infection can lead to serious parasitic gastroenteritis in sheep, goat, and wild ruminant, causing significant socioeconomic losses worldwide. Up to now, the study concerning the molecular biology of M. marshalli is limited. Herein, we sequenced the complete mitochondrial (mt) genome of M. marshalli and examined its phylogenetic relationship with selected members of the superfamily Trichostrongyloidea using Bayesian inference (BI) based on concatenated mt amino acid sequence datasets. The complete mt genome sequence of M. marshalli is 13,891 bp, including 12 protein-coding genes, 22 transfer RNA genes, and 2 ribosomal RNA genes. All protein-coding genes are transcribed in the same direction. Phylogenetic analyses based on concatenated amino acid sequences of the 12 protein-coding genes supported the monophylies of the families Haemonchidae, Molineidae, and Dictyocaulidae with strong statistical support, but rejected the monophyly of the family Trichostrongylidae. The determination of the complete mt genome sequence of M. marshalli provides novel genetic markers for studying the systematics, population genetics, and molecular epidemiology of M. marshalli and its congeners.
Current Understanding of Ecdysozoa and its Internal Phylogenetic Relationships.
Giribet, Gonzalo; Edgecombe, Gregory D
2017-09-01
Twenty years after its proposal, the monophyly of molting protostomes-Ecdysozoa-is a well-corroborated hypothesis, but the interrelationships of its major subclades are more ambiguous than is commonly appreciated. Morphological and molecular support for arthropods, onychophorans and tardigrades as a clade (Panarthropoda) continues to be challenged by a grouping of tardigrades with Nematoida in some molecular analyses, although onychophorans are consistently recovered as the sister group of arthropods. The status of Cycloneuralia and Scalidophora, each proposed by morphologists in the 1990s and widely employed in textbooks, is in flux: Cycloneuralia is typically non-monophyletic in molecular analyses, and Scalidophora is either contradicted or incompletely tested because of limited genomic and transcriptomic data for Loricifera, Kinorhyncha, and Priapulida. However, novel genomic data across Ecdysozoa should soon be available to tackle these difficult phylogenetic questions. The Cambrian fossil record indicates crown-group members of various ecdysozoan phyla as well as stem-group taxa that assist with reconstructing the most recent common ancestor of panarthropods and cycloneuralians. © The Author 2017. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.
phangorn: phylogenetic analysis in R.
Schliep, Klaus Peter
2011-02-15
phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.
Energy Technology Data Exchange (ETDEWEB)
Terence L. Marsh
2004-05-26
The goals of this study were: (1) survey the microbial community in soil samples from a site contaminated with heavy metals using new rapid molecular techniques that are culture-independent; (2) identify phylogenetic signatures of microbial populations that correlate with metal ion contamination; and (3) cultivate these diagnostic strains using traditional as well as novel cultivation techniques in order to identify organisms that may be of value in site evaluation/management or bioremediation.
Undergraduate Students’ Initial Ability in Understanding Phylogenetic Tree
Sa'adah, S.; Hidayat, T.; Sudargo, Fransisca
2017-04-01
The Phylogenetic tree is a visual representation depicts a hypothesis about the evolutionary relationship among taxa. Evolutionary experts use this representation to evaluate the evidence for evolution. The phylogenetic tree is currently growing for many disciplines in biology. Consequently, learning about the phylogenetic tree has become an important part of biological education and an interesting area of biology education research. Skill to understanding and reasoning of the phylogenetic tree, (called tree thinking) is an important skill for biology students. However, research showed many students have difficulty in interpreting, constructing, and comparing among the phylogenetic tree, as well as experiencing a misconception in the understanding of the phylogenetic tree. Students are often not taught how to reason about evolutionary relationship depicted in the diagram. Students are also not provided with information about the underlying theory and process of phylogenetic. This study aims to investigate the initial ability of undergraduate students in understanding and reasoning of the phylogenetic tree. The research method is the descriptive method. Students are given multiple choice questions and an essay that representative by tree thinking elements. Each correct answer made percentages. Each student is also given questionnaires. The results showed that the undergraduate students’ initial ability in understanding and reasoning phylogenetic tree is low. Many students are not able to answer questions about the phylogenetic tree. Only 19 % undergraduate student who answered correctly on indicator evaluate the evolutionary relationship among taxa, 25% undergraduate student who answered correctly on indicator applying concepts of the clade, 17% undergraduate student who answered correctly on indicator determines the character evolution, and only a few undergraduate student who can construct the phylogenetic tree.
Improved Maximum Parsimony Models for Phylogenetic Networks.
Van Iersel, Leo; Jones, Mark; Scornavacca, Celine
2018-05-01
Phylogenetic networks are well suited to represent evolutionary histories comprising reticulate evolution. Several methods aiming at reconstructing explicit phylogenetic networks have been developed in the last two decades. In this article, we propose a new definition of maximum parsimony for phylogenetic networks that permits to model biological scenarios that cannot be modeled by the definitions currently present in the literature (namely, the "hardwired" and "softwired" parsimony). Building on this new definition, we provide several algorithmic results that lay the foundations for new parsimony-based methods for phylogenetic network reconstruction.
Molecular phylogeny of Eriocaulon (Eriocaulaceae)
DEFF Research Database (Denmark)
Ito, Yu; Tanaka, Norio; Barfod, Anders
Eriocaulon is a genus of about 400 species of monocotyledonous flowering plants in the family Eriocaulaceae. The genus is widely distributed in the world, with the centers of diversity in tropical regions, such as tropical Asia and tropical Africa. A previous molecular phylogeny implied an Africa...... the genus. In this talk, we provide preliminary results of our molecular phylogenetic analysis of the genus aiming to i) assess the biogeographic origin, ii) explore phylogenetic origins of submerged species, and iii) address the evolutionary role of polyploids.......Eriocaulon is a genus of about 400 species of monocotyledonous flowering plants in the family Eriocaulaceae. The genus is widely distributed in the world, with the centers of diversity in tropical regions, such as tropical Asia and tropical Africa. A previous molecular phylogeny implied an African...... origin for Eriocaulon as a sister relationship between the genus and an African endemic one was recovered. The species of Eriocaulon primarily grow in wetlands while some inhabit shallow rivers and streams with an apparent adaptive morphology of elongated submerged stems. Polyploidy is known from...
A program for verification of phylogenetic network models.
Gunawan, Andreas D M; Lu, Bingxin; Zhang, Louxin
2016-09-01
Genetic material is transferred in a non-reproductive manner across species more frequently than commonly thought, particularly in the bacteria kingdom. On one hand, extant genomes are thus more properly considered as a fusion product of both reproductive and non-reproductive genetic transfers. This has motivated researchers to adopt phylogenetic networks to study genome evolution. On the other hand, a gene's evolution is usually tree-like and has been studied for over half a century. Accordingly, the relationships between phylogenetic trees and networks are the basis for the reconstruction and verification of phylogenetic networks. One important problem in verifying a network model is determining whether or not certain existing phylogenetic trees are displayed in a phylogenetic network. This problem is formally called the tree containment problem. It is NP-complete even for binary phylogenetic networks. We design an exponential time but efficient method for determining whether or not a phylogenetic tree is displayed in an arbitrary phylogenetic network. It is developed on the basis of the so-called reticulation-visible property of phylogenetic networks. A C-program is available for download on http://www.math.nus.edu.sg/∼matzlx/tcp_package matzlx@nus.edu.sg Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Roos, Jonas; Aggarwal, Ramesh K; Janke, Axel
2007-11-01
The mitochondrial genomes of the dwarf crocodile, Osteolaemus tetraspis, and two species of dwarf caimans, the smooth-fronted caiman, Paleosuchus trigonatus, and Cuvier's dwarf caiman, Paleosuchus palpebrosus, were sequenced and included in a mitogenomic phylogenetic study. The phylogenetic analyses, which included a total of ten crocodylian species, yielded strong support to a basal split between Crocodylidae and Alligatoridae. Osteolaemus fell within the Crocodylidae as the sister group to Crocodylus. Gavialis and Tomistoma, which joined on a common branch, constituted a sister group to Crocodylus/Osteolaemus. This suggests that extant crocodylians are organized in two families: Alligatoridae and Crocodylidae. Within the Alligatoridae there was a basal split between Alligator and a branch that contained Paleosuchus and Caiman. The analyses also provided molecular estimates of various divergences applying recently established crocodylian and outgroup fossil calibration points. Molecular estimates based on amino acid data placed the divergence between Crocodylidae and Alligatoridae at 97-103 million years ago and that between Alligator and Caiman/Paleosuchus at 65-72 million years ago. Other crocodilian divergences were placed after the Cretaceous-Tertiary boundary. Thus, according to the molecular estimates, three extant crocodylian lineages have their roots in the Cretaceous. Considering the crocodylian diversification in the Cretaceous the molecular datings suggest that the extinction of the dinosaurs was also to some extent paralleled in the crocodylian evolution. However, for whatever reason, some crocodylian lineages survived into the Tertiary.
Woese, C. R.; Achenbach, L.; Rouviere, P.; Mandelco, L.
1991-01-01
A major and too little recognized source of artifact in phylogenetic analysis of molecular sequence data is compositional difference among sequences. The problem becomes particularly acute when alignments contain ribosomal RNAs from both mesophilic and thermophilic species. Among prokaryotes the latter are considerably higher in G + C content than the former, which often results in artificial clustering of thermophilic lineages and their being placed artificially deep in phylogenetic trees. In this communication we review archaeal phylogeny in the light of this consideration, focusing in particular on the phylogenetic position of the sulfate reducing species Archaeoglobus fulgidus, using both 16S rRNA and 23S rRNA sequences. The analysis shows clearly that the previously reported deep branching of the A. fulgidus lineage (very near the base of the euryarchaeal side of the archaeal tree) is incorrect, and that the lineage actually groups with a previously recognized unit that comprises the Methanomicrobiales and extreme halophiles.
Directory of Open Access Journals (Sweden)
Cronn Richard
2009-12-01
Full Text Available Abstract Background Molecular evolutionary studies share the common goal of elucidating historical relationships, and the common challenge of adequately sampling taxa and characters. Particularly at low taxonomic levels, recent divergence, rapid radiations, and conservative genome evolution yield limited sequence variation, and dense taxon sampling is often desirable. Recent advances in massively parallel sequencing make it possible to rapidly obtain large amounts of sequence data, and multiplexing makes extensive sampling of megabase sequences feasible. Is it possible to efficiently apply massively parallel sequencing to increase phylogenetic resolution at low taxonomic levels? Results We reconstruct the infrageneric phylogeny of Pinus from 37 nearly-complete chloroplast genomes (average 109 kilobases each of an approximately 120 kilobase genome generated using multiplexed massively parallel sequencing. 30/33 ingroup nodes resolved with ≥ 95% bootstrap support; this is a substantial improvement relative to prior studies, and shows massively parallel sequencing-based strategies can produce sufficient high quality sequence to reach support levels originally proposed for the phylogenetic bootstrap. Resampling simulations show that at least the entire plastome is necessary to fully resolve Pinus, particularly in rapidly radiating clades. Meta-analysis of 99 published infrageneric phylogenies shows that whole plastome analysis should provide similar gains across a range of plant genera. A disproportionate amount of phylogenetic information resides in two loci (ycf1, ycf2, highlighting their unusual evolutionary properties. Conclusion Plastome sequencing is now an efficient option for increasing phylogenetic resolution at lower taxonomic levels in plant phylogenetic and population genetic analyses. With continuing improvements in sequencing capacity, the strategies herein should revolutionize efforts requiring dense taxon and character sampling
Cadena, Edwin
2016-01-01
Abundant pan-trionychid (soft-shell) turtles specimens have been found in Eocene sequences of central Europe, particularly from two localities in Germany, the Messel Pit (a UNESCO World Natural Heritage Site) and Geiseltal, traditionally attributed to Trionyx messelianus or Rafetoides austriacus . Over the last two decades new specimens of this taxon from these two localities have been discovered and fully prepared. However, they have remained unstudied, as well as their phylogenetic position inside Pan-Trionychidae is unknown. Five new specimens of Palaeoamyda messeliana nov. comb. from Messel Pit and Geiseltal localities are fully described here. A revised diagnosis for the species is also presented here, together with its inclusion in a phylogenetic analysis of Pan-Trionychidae that shows that this species is sister to the extant Amyda cartilaginea , one of the most abundant pan-trionychid (soft-shell) turtles from Asia, both members of the clade Chitrini. The specimens described in here are among the best and most complete fossil pan-trionychid skeletons so far known.
International Nuclear Information System (INIS)
Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)
Directory of Open Access Journals (Sweden)
Luca Montana
Full Text Available The survival of isolated small populations is threatened by both demographic and genetic factors. Large carnivores declined for centuries in most of Europe due to habitat changes, overhunting of their natural prey and direct persecution. However, the current rewilding trends are driving many carnivore populations to expand again, possibly reverting the erosion of their genetic diversity. In this study we reassessed the extent and origin of the genetic variation of the Italian wolf population, which is expanding after centuries of decline and isolation. We genotyped wolves from Italy and other nine populations at four mtDNA regions (control-region, ATP6, COIII and ND4 and 39 autosomal microsatellites. Results of phylogenetic analyses and assignment procedures confirmed in the Italian wolves a second private mtDNA haplotype, which belongs to a haplogroup distributed mostly in southern Europe. Coalescent analyses showed that the unique mtDNA haplotypes in the Italian wolves likely originated during the late Pleistocene. ABC simulations concordantly showed that the extant wolf populations in Italy and in south-western Europe started to be isolated and declined right after the last glacial maximum. Thus, the standing genetic variation in the Italian wolves principally results from the historical isolation south of the Alps.
Energy Technology Data Exchange (ETDEWEB)
Weisrock, David W.; Papenfuss, Theodore J.; Macey, J. Robert; Litvinchuk, Spartak N.; Polymeni, Rosa; Ugurtas, Ismail H.; Zhao, Ermi; Larson, Allan
2005-08-08
Phylogenetic relationships among species of the salamanderfamily Salamandridae are investigated using nearly 3000 nucleotide basesof newly reported mitochondrial DNA sequence data from the mtDNA genicregion spanning the genes tRNALeu-COI. This study uses nearlycomprehensive species-level sampling to provide the first completephylogeny for the Salamandridae. Deep phylogenetic relationships amongthe three most divergent lineages in the family Salamandrina terdigitata,a clade comprising the "True" salamanders, and a clade comprising allnewts except S. terdigitata are difficult to resolve. However, mostrelationships within the latter two lineages are resolved with robustlevels of branch support. The genera Euproctus and Triturus arestatistically shown to be nonmonophyletic, instead each contains adiverse set of lineages positioned within the large newt clade. The genusParamesotriton is also resolve as a nonmonophyletic group, with the newlydescribed species P. laoensis constituting a divergent lineage placed ina sister position to clade containing all Pachytriton species and allremaining Paramesotriton species. Sequence divergences between P.laoensis and other Paramesotriton species are as great as those comparingP. laoensis and species of the genera Cynops and Pachytriton. Analyses oflineage diversification across the Salamandridae indicate that, despiteits exceptional diversity, lineage accumulation appears to have beenconstant across time, indicating that it does not represent a truespecies radiation.
Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori
2010-01-01
Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...
Njunji, Iva; Perreau, Michel; Hendriks, Kasper; Schilthuizen, Menno; Deharveng, Louis
2016-01-01
The subtribe Anthroherponina form an iconic group of obligate cave beetles, typical representatives of the Dinaric subterranean fauna, which is considered to be the richest in the world. Phylogenetic studies within this subtribe are scarce and based only on morphological characters, which, due to
Njunjić, I.; Perreau, M.; Hendriks, K.; Schilthuizen, M.; Deharveng, L.
2016-01-01
The subtribe Anthroherponina form an iconic group of obligate cave beetles, typical representatives of the Dinaric subterranean fauna, which is considered to be the richest in the world. Phylogenetic studies within this subtribe are scarce and based only on morphological characters, which, due to
Directory of Open Access Journals (Sweden)
Tartar Aurélien
2010-06-01
Full Text Available Abstract Background Glutamine synthetase (GS is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae, and additional green algal (Chlorophyceae and Prasinophytae and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB and eukaryotic (GSIIE GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT. Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida. However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting
Rearrangement moves on rooted phylogenetic networks.
Gambette, Philippe; van Iersel, Leo; Jones, Mark; Lafond, Manuel; Pardi, Fabio; Scornavacca, Celine
2017-08-01
Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide a solid basis for
Rearrangement moves on rooted phylogenetic networks.
Directory of Open Access Journals (Sweden)
Philippe Gambette
2017-08-01
Full Text Available Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide
Phylogenetic tests of distribution patterns in South Asia: towards
Indian Academy of Sciences (India)
The last four decades have seen an increasing integration of phylogenetics and biogeography. However, a dearth of phylogenetic studies has precluded such biogeographic analyses in South Asia until recently. Noting the increase in phylogenetic research and interest in phylogenetic biogeography in the region, we ...
Fourier transform inequalities for phylogenetic trees.
Matsen, Frederick A
2009-01-01
Phylogenetic invariants are not the only constraints on site-pattern frequency vectors for phylogenetic trees. A mutation matrix, by its definition, is the exponential of a matrix with non-negative off-diagonal entries; this positivity requirement implies non-trivial constraints on the site-pattern frequency vectors. We call these additional constraints "edge-parameter inequalities". In this paper, we first motivate the edge-parameter inequalities by considering a pathological site-pattern frequency vector corresponding to a quartet tree with a negative internal edge. This site-pattern frequency vector nevertheless satisfies all of the constraints described up to now in the literature. We next describe two complete sets of edge-parameter inequalities for the group-based models; these constraints are square-free monomial inequalities in the Fourier transformed coordinates. These inequalities, along with the phylogenetic invariants, form a complete description of the set of site-pattern frequency vectors corresponding to bona fide trees. Said in mathematical language, this paper explicitly presents two finite lists of inequalities in Fourier coordinates of the form "monomial < or = 1", each list characterizing the phylogenetically relevant semialgebraic subsets of the phylogenetic varieties.
Molecular identification of endophytic fungi from Aquilaria sinensis ...
African Journals Online (AJOL)
Molecular phylogenetic analysis demonstrated that Botryosphaeria, Colletotrichum gloeosporioides, Phomopsis and Cylindrocladium species are members of the agarwood-producing wounded tree, while Phoma, Mycosphaerella, Sagenomella, Alternaria and Ramichloridium species is able to colonize the non-resinous ...
Phylogenetic search through partial tree mixing
2012-01-01
Background Recent advances in sequencing technology have created large data sets upon which phylogenetic inference can be performed. Current research is limited by the prohibitive time necessary to perform tree search on a reasonable number of individuals. This research develops new phylogenetic algorithms that can operate on tens of thousands of species in a reasonable amount of time through several innovative search techniques. Results When compared to popular phylogenetic search algorithms, better trees are found much more quickly for large data sets. These algorithms are incorporated in the PSODA application available at http://dna.cs.byu.edu/psoda Conclusions The use of Partial Tree Mixing in a partition based tree space allows the algorithm to quickly converge on near optimal tree regions. These regions can then be searched in a methodical way to determine the overall optimal phylogenetic solution. PMID:23320449
Roukaerts, Inge D M; Theuns, Sebastiaan; Taffin, Elien R L; Daminet, Sylvie; Nauwynck, Hans J
2015-01-22
Feline immunodeficiency virus (FIV) is a major pathogen in feline populations worldwide, with seroprevalences up to 26%. Virus strains circulating in domestic cats are subdivided into different phylogenetic clades (A-E), based on the genetic diversity of the V3-V4 region of the env gene. In this report, a phylogenetic analysis of the V3-V4 env region, and a variable region in the gag gene was made for 36 FIV strains isolated in Belgium and The Netherlands. All newly generated gag sequences clustered together with previously known clade A FIV viruses, confirming the dominance of clade A viruses in Northern Europe. The same was true for the obtained env sequences, with only one sample of an unknown env subtype. Overall, the genetic diversity of FIV strains sequenced in this report was low. This indicates a relatively recent introduction of FIV in Belgium and The Netherlands. However, the sample with an unknown env subtype indicates that new introductions of FIV from unknown origin do occur and this will likely increase genetic variability in time. Copyright © 2014 Elsevier B.V. All rights reserved.
How does cognition evolve? Phylogenetic comparative psychology
Matthews, Luke J.; Hare, Brian A.; Nunn, Charles L.; Anderson, Rindy C.; Aureli, Filippo; Brannon, Elizabeth M.; Call, Josep; Drea, Christine M.; Emery, Nathan J.; Haun, Daniel B. M.; Herrmann, Esther; Jacobs, Lucia F.; Platt, Michael L.; Rosati, Alexandra G.; Sandel, Aaron A.; Schroepfer, Kara K.; Seed, Amanda M.; Tan, Jingzhi; van Schaik, Carel P.; Wobber, Victoria
2014-01-01
Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution. PMID:21927850
How does cognition evolve? Phylogenetic comparative psychology.
MacLean, Evan L; Matthews, Luke J; Hare, Brian A; Nunn, Charles L; Anderson, Rindy C; Aureli, Filippo; Brannon, Elizabeth M; Call, Josep; Drea, Christine M; Emery, Nathan J; Haun, Daniel B M; Herrmann, Esther; Jacobs, Lucia F; Platt, Michael L; Rosati, Alexandra G; Sandel, Aaron A; Schroepfer, Kara K; Seed, Amanda M; Tan, Jingzhi; van Schaik, Carel P; Wobber, Victoria
2012-03-01
Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution.
Directory of Open Access Journals (Sweden)
Juan Pablo Ramírez-Silva
2010-12-01
Full Text Available Although phylogenetic affinities of Mexican jackrabbits within the genus Lepus have been evaluated for a few species, no study has included all 5 species occurring in Mexico. In this study we assess the phylogenetic position of the Mexican species relative to other forms within the genus and evaluate evolutionary affinities among the Mexican forms. To do so, we analyzed 57 complete cytochrome b sequences belonging to the 5 Mexican jackrabbits and 18 species of Lepus distributed across Asia, Africa, Europe and America. We performed phylogenetic tree reconstruction with the neighbor-joining, maximum parsimony and maximum likelihood approaches. We also used a minimum spanning network to evaluate relationships among Mexican species. We found 5 main phylogenetic groups within Lepus, 4 of which corresponded to geographically well defined lineages. One group included L. americanus, 3 others corresponded to Mexican, African and European species, respectively. A fifth group included Asiatic, European and American forms. Our results suggest that Mexican species constitute a monophyletic entity that evolved independently of the other American species of Lepus. Within the Mexican forms, 2 main clades are apparent; 1 that includes L. alleni, L. callotis, and L. flavigularis, previously referred to as the white-sided jackrabbits, and a second one that groups together L. californicus and L. insularis, although L. californicus is a paraphyletic relative of L. insularis.Aunque la afinidad filogenética de las liebres mexicanas, dentro del género Lepus, ha sido evaluada para algunas especies, ningún estudio ha incluido las 5 especies que se presentan en México. En este trabajo estimamos la posición filogenética de las especies mexicanas de liebres en relación con otras formas dentro del género, y evaluamos las afinidades evolutivas entre ellas. Para ello analizamos 57 secuencias completas del citocromo b pertenecientes a las 5 especies mexicanas y 18
PhyloExplorer: a web server to validate, explore and query phylogenetic trees
Directory of Open Access Journals (Sweden)
Auberval Nicolas
2009-05-01
Full Text Available Abstract Background Many important problems in evolutionary biology require molecular phylogenies to be reconstructed. Phylogenetic trees must then be manipulated for subsequent inclusion in publications or analyses such as supertree inference and tree comparisons. However, no tool is currently available to facilitate the management of tree collections providing, for instance: standardisation of taxon names among trees with respect to a reference taxonomy; selection of relevant subsets of trees or sub-trees according to a taxonomic query; or simply computation of descriptive statistics on the collection. Moreover, although several databases of phylogenetic trees exist, there is currently no easy way to find trees that are both relevant and complementary to a given collection of trees. Results We propose a tool to facilitate assessment and management of phylogenetic tree collections. Given an input collection of rooted trees, PhyloExplorer provides facilities for obtaining statistics describing the collection, correcting invalid taxon names, extracting taxonomically relevant parts of the collection using a dedicated query language, and identifying related trees in the TreeBASE database. Conclusion PhyloExplorer is a simple and interactive website implemented through underlying Python libraries and MySQL databases. It is available at: http://www.ncbi.orthomam.univ-montp2.fr/phyloexplorer/ and the source code can be downloaded from: http://code.google.com/p/taxomanie/.
Rooting phylogenetic trees under the coalescent model using site pattern probabilities.
Tian, Yuan; Kubatko, Laura
2017-12-19
Phylogenetic tree inference is a fundamental tool to estimate ancestor-descendant relationships among different species. In phylogenetic studies, identification of the root - the most recent common ancestor of all sampled organisms - is essential for complete understanding of the evolutionary relationships. Rooted trees benefit most downstream application of phylogenies such as species classification or study of adaptation. Often, trees can be rooted by using outgroups, which are species that are known to be more distantly related to the sampled organisms than any other species in the phylogeny. However, outgroups are not always available in evolutionary research. In this study, we develop a new method for rooting species tree under the coalescent model, by developing a series of hypothesis tests for rooting quartet phylogenies using site pattern probabilities. The power of this method is examined by simulation studies and by application to an empirical North American rattlesnake data set. The method shows high accuracy across the simulation conditions considered, and performs well for the rattlesnake data. Thus, it provides a computationally efficient way to accurately root species-level phylogenies that incorporates the coalescent process. The method is robust to variation in substitution model, but is sensitive to the assumption of a molecular clock. Our study establishes a computationally practical method for rooting species trees that is more efficient than traditional methods. The method will benefit numerous evolutionary studies that require rooting a phylogenetic tree without having to specify outgroups.
Molecular phylogeny of Ranunculaceae based on internal ...
African Journals Online (AJOL)
The botanical family Ranunculaceae contains important medicinal plants. To obtain new evolutionary evidence regarding the systematic classification of Ranunculaceae plants, we used molecular phylogenies to test relationships based on the internal transcribed spacer region. The results of phylogenetic analysis of 92 ...
Phylogenetics links monster larva to deep-sea shrimp.
Bracken-Grissom, Heather D; Felder, Darryl L; Vollmer, Nicole L; Martin, Joel W; Crandall, Keith A
2012-10-01
Mid-water plankton collections commonly include bizarre and mysterious developmental stages that differ conspicuously from their adult counterparts in morphology and habitat. Unaware of the existence of planktonic larval stages, early zoologists often misidentified these unique morphologies as independent adult lineages. Many such mistakes have since been corrected by collecting larvae, raising them in the lab, and identifying the adult forms. However, challenges arise when the larva is remarkably rare in nature and relatively inaccessible due to its changing habitats over the course of ontogeny. The mid-water marine species Cerataspis monstrosa (Gray 1828) is an armored crustacean larva whose adult identity has remained a mystery for over 180 years. Our phylogenetic analyses, based in part on recent collections from the Gulf of Mexico, provide definitive evidence that the rare, yet broadly distributed larva, C. monstrosa, is an early developmental stage of the globally distributed deepwater aristeid shrimp, Plesiopenaeus armatus. Divergence estimates and phylogenetic relationships across five genes confirm the larva and adult are the same species. Our work demonstrates the diagnostic power of molecular systematics in instances where larval rearing seldom succeeds and morphology and habitat are not indicative of identity. Larval-adult linkages not only aid in our understanding of biodiversity, they provide insights into the life history, distribution, and ecology of an organism.
Bakker, Frederik Theodoor
1995-01-01
In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be paraphyletic with respect to Cladophora species and includes several genera shich werde traditionally ascribed to the Siphonocladales (Chapter 3). ... Zie: Summary/Samenvatting
Herbarium collection-based phylogenetics of the ragweeds (Ambrosia, Asteraceae).
Martin, Michael D; Quiroz-Claros, Elva; Brush, Grace S; Zimmer, Elizabeth A
2018-03-01
Ambrosia (Asteraceae) is a taxonomically difficult genus of weedy, wind-pollinated plants with an apparent center of diversity in the Sonoran Desert of North America. Determining Ambrosia's evolutionary relationships has been the subject of much interest, with numerous studies using morphological characters, cytology, comparative phytochemistry, and chloroplast restriction site variation to produce conflicting accounts the relationships between Ambrosia species, as well as the classification of their close relatives in Franseria and Hymenoclea. To resolve undetermined intra-generic relationships within Ambrosia, we used DNA extracted from tissues obtained from seed banks and herbarium collections to generate multi-locus genetic data representing nearly all putative species, including four from South America. We performed Bayesian and Maximum-Likelihood phylogenetic analyses of six chloroplast-genome and two nuclear-genome markers, enabling us to infer monophyly for the genus, resolve major infra-generic species clusters, as well as to resolve open questions about the evolutionary relationships of several Ambrosia species and former members of Franseria. We also provide molecular data supporting the hypothesis that A. sandersonii formed through the hybridization of A. eriocentra and A. salsola. The topology of our chloroplast DNA phylogeny is almost entirely congruent with the most recent molecular work based on chloroplast restriction site variation of a much more limited sampling of 14 North American species of Ambrosia, although our improved sampling of global Ambrosia diversity enables us to draw additional conclusions. As our study is the first direct DNA sequence-based phylogenetic analyses of Ambrosia, we analyze the data in relation to previous taxonomic studies and discuss several instances of chloroplast/nuclear incongruence that leave the precise geographic center of origin of Ambrosia in question. Copyright © 2017 Elsevier Inc. All rights reserved.
A Signal, from Human mtDNA, of Postglacial Recolonization in Europe
Torroni, Antonio; Bandelt, Hans-Jürgen; Macaulay, Vincent; Richards, Martin; Cruciani, Fulvio; Rengo, Chiara; Martinez-Cabrera, Vicente; Villems, Richard; Kivisild, Toomas; Metspalu, Ene; Parik, Jüri; Tolk, Helle-Viivi; Tambets, Kristiina; Forster, Peter; Karger, Bernd; Francalacci, Paolo; Rudan, Pavao; Janicijevic, Branka; Rickards, Olga; Savontaus, Marja-Liisa; Huoponen, Kirsi; Laitinen, Virpi; Koivumäki, Satu; Sykes, Bryan; Hickey, Eileen; Novelletto, Andrea; Moral, Pedro; Sellitto, Daniele; Coppa, Alfredo; Al-Zaheri, Nadia; Santachiara-Benerecetti, A. Silvana; Semino, Ornella; Scozzari, Rosaria
2001-01-01
Mitochondrial HVS-I sequences from 10,365 subjects belonging to 56 populations/geographical regions of western Eurasia and northern Africa were first surveyed for the presence of the T→C transition at nucleotide position 16298, a mutation which has previously been shown to characterize haplogroup V mtDNAs. All mtDNAs with this mutation were then screened for a number of diagnostic RFLP sites, revealing two major subsets of mtDNAs. One is haplogroup V proper, and the other has been termed “pre*V,” since it predates V phylogenetically. The rather uncommon pre*V tends to be scattered throughout Europe (and northwestern Africa), whereas V attains two peaks of frequency: one situated in southwestern Europe and one in the Saami of northern Scandinavia. Geographical distributions and ages support the scenario that pre*V originated in Europe before the Last Glacial Maximum (LGM), whereas the more recently derived haplogroup V arose in a southwestern European refugium soon after the LGM. The arrival of V in eastern/central Europe, however, occurred much later, possibly with (post-)Neolithic contacts. The distribution of haplogroup V mtDNAs in modern European populations would thus, at least in part, reflect the pattern of postglacial human recolonization from that refugium, affecting even the Saami. Overall, the present study shows that the dissection of mtDNA variation into small and well-defined evolutionary units is an essential step in the identification of spatial frequency patterns. Mass screening of a few markers identified using complete mtDNA sequences promises to be an efficient strategy for inferring features of human prehistory. PMID:11517423
Chauveau, Olivier; Eggers, Lilian; Raquin, Christian; Silvério, Adriano; Brown, Spencer; Couloux, Arnaud; Cruaud, Corine; Kaltchuk-Santos, Eliane; Yockteng, Roxana; Souza-Chies, Tatiana T.; Nadot, Sophie
2011-01-01
Background and Aims Sisyrinchium (Iridaceae: Iridoideae: Sisyrinchieae) is one of the largest, most widespread and most taxonomically complex genera in Iridaceae, with all species except one native to the American continent. Phylogenetic relationships within the genus were investigated and the evolution of oil-producing structures related to specialized oil-bee pollination examined. Methods Phylogenetic analyses based on eight molecular markers obtained from 101 Sisyrinchium accessions representing 85 species were conducted in the first extensive phylogenetic analysis of the genus. Total evidence analyses confirmed the monophyly of the genus and retrieved nine major clades weakly connected to the subdivisions previously recognized. The resulting phylogenetic hypothesis was used to reconstruct biogeographical patterns, and to trace the evolutionary origin of glandular trichomes present in the flowers of several species. Key Results and Conclusions Glandular trichomes evolved three times independently in the genus. In two cases, these glandular trichomes are oil-secreting, suggesting that the corresponding flowers might be pollinated by oil-bees. Biogeographical patterns indicate expansions from Central America and the northern Andes to the subandean ranges between Chile and Argentina and to the extended area of the Paraná river basin. The distribution of oil-flower species across the phylogenetic trees suggests that oil-producing trichomes may have played a key role in the diversification of the genus, a hypothesis that requires future testing. PMID:21527419
Yang, Huanhuan; Li, Teng; Dang, Kai; Bu, Wenjun
2018-04-18
Mitochondrial genome (mt-genome) data can potentially return artefactual relationships in the higher-level phylogenetic inference of insects due to the biases of accelerated substitution rates and compositional heterogeneity. Previous studies based on mt-genome data alone showed a paraphyly of Cimicomorpha (Insecta, Hemiptera) due to the positions of the families Tingidae and Reduviidae rather than the monophyly that was supported based on morphological characters, morphological and molecular combined data and large scale molecular datasets. Various strategies have been proposed to ameliorate the effects of potential mt-genome biases, including dense taxon sampling, removal of third codon positions or purine-pyrimidine coding and the use of site-heterogeneous models. In this study, we sequenced the mt-genomes of five additional Tingidae species and discussed the compositional and mutational rate heterogeneity in mt-genomes and its effect on the phylogenetic inferences of Cimicomorpha by implementing the bias-reduction strategies mentioned above. Heterogeneity in nucleotide composition and mutational biases were found in mt protein-coding genes, and the third codon exhibited high levels of saturation. Dense taxon sampling of Tingidae and Reduviidae and the other common strategies mentioned above were insufficient to recover the monophyly of the well-established group Cimicomorpha. When the sites with weak phylogenetic signals in the dataset were removed, the remaining dataset of mt-genomes can support the monophyly of Cimicomorpha; this support demonstrates that mt-genomes possess strong phylogenetic signals for the inference of higher-level phylogeny of this group. Comparison of the ratio of the removal of amino acids for each PCG showed that ATP8 has the highest ratio while CO1 has the lowest. This pattern is largely congruent with the evolutionary rate of 13 PCGs that ATP8 represents the highest evolutionary rate, whereas CO1 appears to be the lowest. Notably
Radka Muhlsteinova; Jeffrey R. Johansen; Nicole Pietrasiak; Michael P. Martin; Karina Osorio-Santos; Steven D. Warren
2014-01-01
Little is known about the taxonomic diversity of cyanobacteria in deserts, despite their important ecological roles in these ecosystems. In this study, cyanobacterial strains from the Atacama, Colorado, and Mojave Deserts were isolated and characterized using molecular, morphological, and ecological information. Phylogenetic placement of these strains was revealed...
Pirie, M.D.; Vargas, M.P.B.; Botermans, M.; Bakker, F.T.; Chatrou, L.W.
2007-01-01
The plastid trnL-F region has proved useful in molecular phylogenetic studies addressing diverse evolutionary questions from biogeographic history to character evolution in a broad range of plant groups. An important assumption for phylogenetic reconstruction is that data used in combined analyses
Phylogenetic Relationships and Evolutionary Patterns of the Order Collodaria (Radiolaria)
Ishitani, Yoshiyuki; Ujiié, Yurika; de Vargas, Colomban; Not, Fabrice; Takahashi, Kozo
2012-01-01
Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA) confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma) ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago). The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period. PMID:22567112
Phylogenetic relationships and evolutionary patterns of the order Collodaria (Radiolaria.
Directory of Open Access Journals (Sweden)
Yoshiyuki Ishitani
Full Text Available Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago. The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period.
Wongsawad, Chalobol; Wongsawad, Pheravut; Sukontason, Kom; Maneepitaksanti, Worawit; Nantarat, Nattawadee
2017-02-01
This study aimed to investigate the morphology and reconstruct the phylogenetic relationships of Centrocestus formosanus originating from 5 species of freshwater fish, i.e., Esomus metallicus, Puntius brevis, Anabas testudineus, Parambassis siamensis , and Carassius auratus , in Chiang Mai province, Thailand. Sequence-related amplified polymorphism (SRAP) and phylogeny based on internal transcribed spacer 2 (ITS2) and mitochondrial cytochrome c oxidase subunit 1 (CO1) were performed. The results showed similar morphologies of adult C. formosanus from day 5 after infection in chicks. C. formosanus originated from 4 species of freshwater fish had the same number of circumoral spines on the oral sucker, except for those from C. auratus which revealed 34 circumoral spines. The phylogenetic tree obtained from SRAP profile and the combination of ITS2 and CO1 sequence showed similar results that were correlated with the number of circumoral spines in adult worms. Genetic variability of C. formosanus also occurred in different species of freshwater fish hosts. However, more details of adult worm morphologies and more sensitive genetic markers are needed to confirm the species validity of C. formosanus with 34 circumoral spines originating from C. auratus in the future.
Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.
Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K
2014-09-01
Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes.
Nucleotide diversity and phylogenetic relationships among ...
Indian Academy of Sciences (India)
NIRAJ SINGH
for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.
The Nothoaspis amazoniensis Complete Mitogenome: A Comparative and Phylogenetic Analysis
Directory of Open Access Journals (Sweden)
Paulo H. C. Lima
2018-03-01
Full Text Available The molecular biology era, together with morphology, molecular phylogenetics, bioinformatics, and high-throughput sequencing technologies, improved the taxonomic identification of Argasidae family members, especially when considering specimens at different development stages, which remains a great difficulty for acarologists. These tools could provide important data and insights on the history and evolutionary relationships of argasids. To better understand these relationships, we sequenced and assembled the first complete mitochondrial genome of Nothoaspis amazoniensis. We used phylogenomics to identify the evolutionary history of this species of tick, comparing the data obtained with 26 complete mitochondrial sequences available in biological databases. The results demonstrated the absence of genetic rearrangements, high similarity and identity, and a close organizational link between the mitogenomes of N. amazoniensis and other argasids analyzed. In addition, the mitogenome had a monophyletic cladistic taxonomic arrangement, encompassed by representatives of the Afrotropical and Neotropical regions, with specific parasitism in bats, which may be indicative of an evolutionary process of cospeciation between vectors and the host.
dos Santos, Michelly da Silva; Tagliarini, Marcella Mergulhão; O´Brien, Patricia C. M.; Ferguson-Smith, Malcolm A.; de Oliveira, Edivaldo H. C.
2015-01-01
The sunbittern (Eurypyga helias) is a South American Gruiformes, the only member of Family Eurypigidae. In most phylogenetic proposals, it is placed in a more distant position than other families of the so-called “core Gruiformes”. Different studies based on molecular, morphological and biogeographical data suggest that the Eurypigidae is closely related to the kagu (Rhynochetos jubatus), the only species in Rynochetidae, another family not included in the core Gruiformes. Here, the karyotype of the sunbittern is described for the first time, by classical and molecular cytogenetics, using whole chromosome probes derived from Gallus gallus and Leucopternis albicollis. We found a diploid number of 80, with only one pair of biarmed autosomal macrochromosomes, similar to that observed in the kagu. Chromosome painting revealed that most syntenies found in the avian putative ancestral karyotype (PAK) were conserved in the sunbittern. However, PAK1, PAK2, and PAK5 corresponded to two chromosome pairs each. Probes derived from L. albicollis confirm that fissions in PAK1 and PAK2 were centric, whereas in PAK5 the fission is interstitial. In addition, there is fusion of segments homologous to PAK2q and PAK5. From a phylogenetic point of view, comparisons of our results with two other Gruiformes belonging to family Rallidae suggest that the PAK5q fission might be a synapomorphy for Gruiformes. Fissions in PAK1 and PAK2 are found only in Eurypigidae, and might also occur in Rynochetidae, in view of the similar chromosomal morphology between the sunbittern and the kagu. This suggests a close phylogenetic relationship between Eurypigidae and Rynochetidae, whose common ancestor was separated by the Gondwana vicariancy in South America and New Caledonia, respectively. PMID:26624624
A curated database of cyanobacterial strains relevant for modern taxonomy and phylogenetic studies.
Ramos, Vitor; Morais, João; Vasconcelos, Vitor M
2017-04-25
The dataset herein described lays the groundwork for an online database of relevant cyanobacterial strains, named CyanoType (http://lege.ciimar.up.pt/cyanotype). It is a database that includes categorized cyanobacterial strains useful for taxonomic, phylogenetic or genomic purposes, with associated information obtained by means of a literature-based curation. The dataset lists 371 strains and represents the first version of the database (CyanoType v.1). Information for each strain includes strain synonymy and/or co-identity, strain categorization, habitat, accession numbers for molecular data, taxonomy and nomenclature notes according to three different classification schemes, hierarchical automatic classification, phylogenetic placement according to a selection of relevant studies (including this), and important bibliographic references. The database will be updated periodically, namely by adding new strains meeting the criteria for inclusion and by revising and adding up-to-date metadata for strains already listed. A global 16S rDNA-based phylogeny is provided in order to assist users when choosing the appropriate strains for their studies.
Filloramo, Gina V; Saunders, Gary W
2016-06-01
Previous molecular assessments of the red algal order Rhodymeniales have confirmed its monophyly and distinguished the six currently recognized families (viz. Champiaceae, Faucheaceae, Fryeellaceae, Hymenocladiaceae, Lomentariaceae, and Rhodymeniaceae); however, relationships among most of these families have remained unresolved possibly as a result of substitution saturation at deeper phylogenetic nodes. The objective of the current study was to improve rhodymenialean systematics by increasing taxonomic representation and using a more robust multigene dataset of mitochondrial (COB, COI/COI-5P), nuclear (LSU, EF2) and plastid markers (psbA, rbcL). Additionally, we aimed to prevent phylogenetic inference problems associated with substitution saturation (particularly at the interfamilial nodes) by removing fast-evolving sites and analyzing a series of progressively more conservative alignments. The Rhodymeniales was resolved as two major lineages: (i) the Fryeellaceae as sister to the Faucheaceae and Lomentariaceae; and (ii) the Rhodymeniaceae allied to the Champiaceae and Hymenocladiaceae. Support at the interfamilial nodes was highest when 20% of variable sites were removed. Inclusion of Binghamiopsis, Chamaebotrys, and Minium, which were absent in previous phylogenetic investigations, established their phylogenetic affinities while assessment of two genera consistently polyphyletic in phylogenetic analyses, Erythrymenia and Lomentaria, resulted in the proposition of the novel genera Perbella and Fushitsunagia. The taxonomic position of Drouetia was reinvestigated with re-examination of holotype material of D. coalescens to clarify tetrasporangial development in this genus. In addition, we added three novel Australian species to Drouetia as a result of ongoing DNA barcoding assessments-D. aggregata sp. nov., D. scutellata sp. nov., and D. viridescens sp. nov. © 2016 Phycological Society of America.
Mohaseb, A.; Peigné, S.; Debue, K.; Orlando, L.; Mashkour, M.
2017-01-01
The Plio–Pleistocene evolution of Equus and the subsequent domestication of horses and donkeys remains poorly understood, due to the lack of phenotypic markers capable of tracing this evolutionary process in the palaeontological/archaeological record. Using images from 345 specimens, encompassing 15 extant taxa of equids, we quantified the occlusal enamel folding pattern in four mandibular cheek teeth with a single geometric morphometric protocol. We initially investigated the protocol accuracy by assigning each tooth to its correct anatomical position and taxonomic group. We then contrasted the phylogenetic signal present in each tooth shape with an exome-wide phylogeny from 10 extant equine species. We estimated the strength of the phylogenetic signal using a Brownian motion model of evolution with multivariate K statistic, and mapped the dental shape along the molecular phylogeny using an approach based on squared-change parsimony. We found clear evidence for the relevance of dental phenotypes to accurately discriminate all modern members of the genus Equus and capture their phylogenetic relationships. These results are valuable for both palaeontologists and zooarchaeologists exploring the spatial and temporal dynamics of the evolutionary history of the horse family, up to the latest domestication trajectories of horses and donkeys. PMID:28484618
Directory of Open Access Journals (Sweden)
Chou Jui-Yu
2015-01-01
Full Text Available Samples of the freshwater red algae, Bangiadulcis atropurpurea, collected from the mountain waterfalls and its close species, Bangia fuscopurpurea, collected from coasts, were phylogenetically analyzed. The sequences of the rbcL gene and RuBisCO spacer region of the freshwater Bangiadulcis atropurpurea species were identical or similar to those of B. atropurpurea from Japan, North America and Europe. This result indicated that the freshwater Bangiadulcis species from Taiwan shared a common ancestor with the three above-mentioned populations and formed a distinct clade from the marine Bangia species in the phylogenetic trees. It is suggested that all the previous records on marine Bangia species should be revised and the name B. fuscopurpurea be used for the marine species in Taiwan. In this study, the freshwater alga B. atropurpurea presents a new record in the algal flora of Taiwan. This finding is important for the protection of the biodiversity of red algal flora, and provides useful information on the ecological conservation of the species in Taiwan.
Marjanović, David; Witzmann, Florian
2015-01-01
We describe an Oligocene newt specimen from western Germany that has gone practically unnoticed in the literature despite having been housed in the Museum für Naturkunde (Berlin) for a century. It is referable to the coeval Chelotriton, but is unusually peramorphic; for many characters it is more peramorphic than all other caudates or even all other lissamphibians. Most noticeable are the position of the jaw joints far caudal to the occiput, the honeycombed sculpture on the maxilla, and the possible presence of a septomaxilla (which would be unique among salamandrids). Referral to a species would require a revision of the genus, but the specimen likely does not belong to the type species. A phylogenetic analysis of nonmolecular characters of Salamandridae, far larger than all predecessors, confirms the referral to Chelotriton. It further loosely associates the Oligocene Archaeotriton and the Miocene Carpathotriton with the extant Lissotriton, though the former may alternatively lie outside Pleurodelinae altogether. The Miocene? I. randeckensis may not belong to the extant Ichthyosaura. The Miocene "Triturus" roehrsi is found neither with the extant Ommatotriton nor with Lissotriton, but inside an Asian/aquatic clade or, when geographic distribution is included as a character, as the sister-group to all other European molgins. The main cause for discrepancies between the results and the molecular consensus is not heterochrony, but adaptations to a life in mountain streams; this is the most likely reason why the Paleocene Koalliella from western Europe forms the sister-group to some or all of the most aquatic extant newts in different analyses. We would like to urge neontologists working on salamandrids to pay renewed attention to the skeleton, not limited to the skull, as a source of diagnostic and phylogenetically informative characters.
Directory of Open Access Journals (Sweden)
David Marjanović
Full Text Available We describe an Oligocene newt specimen from western Germany that has gone practically unnoticed in the literature despite having been housed in the Museum für Naturkunde (Berlin for a century. It is referable to the coeval Chelotriton, but is unusually peramorphic; for many characters it is more peramorphic than all other caudates or even all other lissamphibians. Most noticeable are the position of the jaw joints far caudal to the occiput, the honeycombed sculpture on the maxilla, and the possible presence of a septomaxilla (which would be unique among salamandrids. Referral to a species would require a revision of the genus, but the specimen likely does not belong to the type species. A phylogenetic analysis of nonmolecular characters of Salamandridae, far larger than all predecessors, confirms the referral to Chelotriton. It further loosely associates the Oligocene Archaeotriton and the Miocene Carpathotriton with the extant Lissotriton, though the former may alternatively lie outside Pleurodelinae altogether. The Miocene? I. randeckensis may not belong to the extant Ichthyosaura. The Miocene "Triturus" roehrsi is found neither with the extant Ommatotriton nor with Lissotriton, but inside an Asian/aquatic clade or, when geographic distribution is included as a character, as the sister-group to all other European molgins. The main cause for discrepancies between the results and the molecular consensus is not heterochrony, but adaptations to a life in mountain streams; this is the most likely reason why the Paleocene Koalliella from western Europe forms the sister-group to some or all of the most aquatic extant newts in different analyses. We would like to urge neontologists working on salamandrids to pay renewed attention to the skeleton, not limited to the skull, as a source of diagnostic and phylogenetically informative characters.
Directory of Open Access Journals (Sweden)
Shaopeng Cui
2016-08-01
Full Text Available As the most widely distributed snake in Eurasia, the adder (Vipera berus has been extensively investigated in Europe but poorly understood in Asia. The Southern Altay Mountains represent the adder’s southern distribution limit in Central Asia, whereas its population status has never been assessed. We conducted, for the first time, field surveys for the adder at two areas of Southern Altay Mountains using a combination of line transects and random searches. We also described the morphological characteristics of the collected specimens and conducted analyses of external morphology and molecular phylogeny. The results showed that the adder distributed in both survey sites and we recorded a total of 34 sightings. In Kanas river valley, the estimated encounter rate over a total of 137 km transects was 0.15 ± 0.05 sightings/km. The occurrence of melanism was only 17%. The small size was typical for the adders in Southern Altay Mountains in contrast to other geographic populations of the nominate subspecies. A phylogenetic tree obtained by Bayesian Inference based on DNA sequences of the mitochondrial cytochrome b (1,023 bp grouped them within the Northern clade of the species but failed to separate them from the subspecies V. b. sachalinensis. Our discovery extends the distribution range of V. berus and provides a basis for further researches. We discuss the hypothesis that the adder expands its distribution border to the southwest along the mountains’ elevation gradient, but the population abundance declines gradually due to a drying climate.
Phylogenetic Position of Barbus lacerta Heckel, 1843
Directory of Open Access Journals (Sweden)
Mustafa Korkmaz
2015-11-01
As a result, five clades come out from phylogenetic reconstruction and in phylogenetic tree Barbus lacerta determined to be sister group of Barbus macedonicus, Barbus oligolepis and Barbus plebejus complex.
The phylogenetics of succession can guide restoration
DEFF Research Database (Denmark)
Shooner, Stephanie; Chisholm, Chelsea Lee; Davies, T. Jonathan
2015-01-01
Phylogenetic tools have increasingly been used in community ecology to describe the evolutionary relationships among co-occurring species. In studies of succession, such tools may allow us to identify the evolutionary lineages most suited for particular stages of succession and habitat...... rehabilitation. However, to date, these two applications have been largely separate. Here, we suggest that information on phylogenetic community structure might help to inform community restoration strategies following major disturbance. Our study examined phylogenetic patterns of succession based...... for species sorting along abiotic gradients (slope and aspect) on the mine sites that had been abandoned for the longest. Synthesis and applications. Understanding the trajectory of succession is critical for restoration efforts. Our results suggest that early colonizers represent a phylogenetically random...
DEFF Research Database (Denmark)
How has European identity been shaped through its colonial empires? Does this history of imperialism influence the conceptualisation of Europe in the contemporary globalised world? How has coloniality shaped geopolitical differences within Europe? What does this mean for the future of Europe......? Postcolonial Europe: Comparative Reflections after the Empires brings together scholars from across disciplines to rethink European colonialism in the light of its vanishing empires and the rise of new global power structures. Taking an interdisciplinary approach to the postcolonial European legacy the book...... argues that the commonly used nation-centric approach does not effectively capture the overlap between different colonial and postcolonial experiences across Europe....
Effects of Phylogenetic Tree Style on Student Comprehension
Dees, Jonathan Andrew
Phylogenetic trees are powerful tools of evolutionary biology that have become prominent across the life sciences. Consequently, learning to interpret and reason from phylogenetic trees is now an essential component of biology education. However, students often struggle to understand these diagrams, even after explicit instruction. One factor that has been observed to affect student understanding of phylogenetic trees is style (i.e., diagonal or bracket). The goal of this dissertation research was to systematically explore effects of style on student interpretations and construction of phylogenetic trees in the context of an introductory biology course. Before instruction, students were significantly more accurate with bracket phylogenetic trees for a variety of interpretation and construction tasks. Explicit instruction that balanced the use of diagonal and bracket phylogenetic trees mitigated some, but not all, style effects. After instruction, students were significantly more accurate for interpretation tasks involving taxa relatedness and construction exercises when using the bracket style. Based on this dissertation research and prior studies on style effects, I advocate for introductory biology instructors to use only the bracket style. Future research should examine causes of style effects and variables other than style to inform the development of research-based instruction that best supports student understanding of phylogenetic trees.
Bayesian models for comparative analysis integrating phylogenetic uncertainty
Directory of Open Access Journals (Sweden)
Villemereuil Pierre de
2012-06-01
Full Text Available Abstract Background Uncertainty in comparative analyses can come from at least two sources: a phylogenetic uncertainty in the tree topology or branch lengths, and b uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow and inflated significance in hypothesis testing (e.g. p-values will be too small. Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible
Bayesian models for comparative analysis integrating phylogenetic uncertainty
2012-01-01
Background Uncertainty in comparative analyses can come from at least two sources: a) phylogenetic uncertainty in the tree topology or branch lengths, and b) uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow) and inflated significance in hypothesis testing (e.g. p-values will be too small). Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible general purpose tool for
Hirata, Haruyuki; Ishinabe, Satoki; Jinnai, Michio; Asakawa, Mitsuhiko; Ishihara, Chiaki
2013-04-01
Babesiosis is a tick-borne protozoan disease affecting many mammalian species worldwide, caused by the intraerythrocytic multiplication of Babesia spp. The present study aimed to detect the presence of Babesia sp. in 13 American mink from Hokkaido, Japan. One of 13 animals was positive, as indicated by nested PCR targeting the 18S ribosomal RNA (SSU rDNA) and subunit 7 (eta) of the chaperonin-containing t-complex polypeptide 1 (CCT7) genes from species of Babesia and Theileria. Sequencing of the PCR product of SSU rDNA revealed 99% homology to the isolates of Babesia sp. SAP#131 found in raccoons in Hokkaido, whereas that of the CCT7 gene showed 80% homology to the isolates of Babesia gibsoni in dogs as determined by BLAST analysis. We refer to the cognate sequence as Babesia sp. NV-1. Phylogenetic analyses of SSU rDNA and CCT7 genes from Babesia sp. NV-1 revealed them to be most closely related to the Babesia sp. SAP#131 from a raccoon in Hokkaido and to canine B. gibsoni, respectively. Here, we provide the first molecular evidence of the Babesia sp. NV-1 parasite in feral American mink ( Neovison vison ) in Hokkaido, Japan.
DEFF Research Database (Denmark)
Asikainen, Kari; Hänninen, Tarja; Henttonen, Heikki
2000-01-01
Like other members of the genus Hantavirus in the family Bunyaviridae, Puumala virus (PUUV) is thought to be co-evolving with its natural host, the bank vole Clethrionomys glareolus. To gain insight into the evolutionary history of PUUV in northern Europe during the last post-glacial period, we h...
Nucleotide diversity and phylogenetic relationships among ...
Indian Academy of Sciences (India)
Navya
2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...
Point estimates in phylogenetic reconstructions
Benner, Philipp; Bacak, Miroslav; Bourguignon, Pierre-Yves
2013-01-01
Motivation: The construction of statistics for summarizing posterior samples returned by a Bayesian phylogenetic study has so far been hindered by the poor geometric insights available into the space of phylogenetic trees, and ad hoc methods such as the derivation of a consensus tree makeup for the ill-definition of the usual concepts of posterior mean, while bootstrap methods mitigate the absence of a sound concept of variance. Yielding satisfactory results with sufficiently concentrated pos...
Ingley, Spencer J; Reina, Ruth G; Bermingham, Eldredge; Johnson, Jerald B
2015-08-01
The livebearing fish genus Brachyrhaphis (Poeciliidae) has become an increasingly important model in evolution and ecology research, yet the phylogeny of this group is not well understood, nor has it been examined thoroughly using modern phylogenetic methods. Here, we present the first comprehensive phylogenetic analysis of Brachyrhaphis by using four molecular markers (3mtDNA, 1nucDNA) to infer relationships among species in this genus. We tested the validity of this genus as a monophyletic group using extensive outgroup sampling based on recent phylogenetic hypotheses of Poeciliidae. We also tested the validity of recently described species of Brachyrhaphis that are part of the B. episcopi complex in Panama. Finally, we examined the impact of historical events on diversification of Brachyrhaphis, and made predictions regarding the role of different ecological environments on evolutionary diversification where known historical events apparently fail to explain speciation. Based on our results, we reject the monophyly of Brachyrhaphis, and question the validity of two recently described species (B. hessfeldi and B. roswithae). Historical biogeography of Brachyrhaphis generally agrees with patterns found in other freshwater taxa in Lower Central America, which show that geological barriers frequently predict speciation. Specifically, we find evidence in support of an 'island' model of Lower Central American formation, which posits that the nascent isthmus was partitioned by several marine connections before linking North and South America. In some cases where historic events (e.g., vicariance) fail to explain allopatric species breaks in Brachyrhaphis, ecological processes (e.g., divergent predation environments) offer additional insight into our understanding of phylogenetic diversification in this group. Copyright © 2015 Elsevier Inc. All rights reserved.
Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.
Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F
2017-08-01
Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.
Samuels, Amy K; Weisrock, David W; Smith, Jeramiah J; France, Katherine J; Walker, John A; Putta, Srikrishna; Voss, S Randal
2005-04-11
salamander complex species also produced robustly supported trees. The D-loop, used in previous molecular phylogenetic studies of the complex, was found to contain a relatively low level of variation and we identified mitochondrial regions with higher rates of molecular evolution that are more useful in resolving relationships among species. Our results show the benefit of using complete genome mitochondrial information in studies of recently and rapidly diverged taxa.
High school students' learning and perceptions of phylogenetics of flowering plants.
Bokor, Julie R; Landis, Jacob B; Crippen, Kent J
2014-01-01
Basic phylogenetics and associated "tree thinking" are often minimized or excluded in formal school curricula. Informal settings provide an opportunity to extend the K-12 school curriculum, introducing learners to new ideas, piquing interest in science, and fostering scientific literacy. Similarly, university researchers participating in science, technology, engineering, and mathematics (STEM) outreach activities increase awareness of college and career options and highlight interdisciplinary fields of science research and augment the science curriculum. To aid in this effort, we designed a 6-h module in which students utilized 12 flowering plant species to generate morphological and molecular phylogenies using biological techniques and bioinformatics tools. The phylogenetics module was implemented with 83 high school students during a weeklong university STEM immersion program and aimed to increase student understanding of phylogenetics and coevolution of plants and pollinators. Student response reflected positive engagement and learning gains as evidenced through content assessments, program evaluation surveys, and program artifacts. We present the results of the first year of implementation and discuss modifications for future use in our immersion programs as well as in multiple course settings at the high school and undergraduate levels. © 2014 J. R. Bokor et al. CBE—Life Sciences Education © 2014 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Open Reading Frame Phylogenetic Analysis on the Cloud
Directory of Open Access Journals (Sweden)
Che-Lun Hung
2013-01-01
Full Text Available Phylogenetic analysis has become essential in researching the evolutionary relationships between viruses. These relationships are depicted on phylogenetic trees, in which viruses are grouped based on sequence similarity. Viral evolutionary relationships are identified from open reading frames rather than from complete sequences. Recently, cloud computing has become popular for developing internet-based bioinformatics tools. Biocloud is an efficient, scalable, and robust bioinformatics computing service. In this paper, we propose a cloud-based open reading frame phylogenetic analysis service. The proposed service integrates the Hadoop framework, virtualization technology, and phylogenetic analysis methods to provide a high-availability, large-scale bioservice. In a case study, we analyze the phylogenetic relationships among Norovirus. Evolutionary relationships are elucidated by aligning different open reading frame sequences. The proposed platform correctly identifies the evolutionary relationships between members of Norovirus.
Directory of Open Access Journals (Sweden)
Sonja Rueckert
Full Text Available Gregarines represent an important transition step from free-living predatory (colpodellids s.l. and/or photosynthetic (Chromera and Vitrella apicomplexan lineages to the most important pathogens, obligate intracellular parasites of humans and domestic animals such as coccidians and haemosporidians (Plasmodium, Toxoplasma, Eimeria, Babesia, etc.. While dozens of genomes of other apicomplexan groups are available, gregarines are barely entering the molecular age. Among the gregarines, archigregarines possess a unique mixture of ancestral (myzocytosis and derived (lack of apicoplast, presence of subpellicular microtubules features.In this study we revisited five of the early-described species of the genus Selenidium including the type species Selenidium pendula, with special focus on surface ultrastructure and molecular data. We were also able to describe three new species within this genus. All species were characterized at morphological (light and scanning electron microscopy data and molecular (SSU rDNA sequence data levels. Gregarine specimens were isolated from polychaete hosts collected from the English Channel near the Station Biologique de Roscoff, France: Selenidium pendula from Scolelepis squamata, S. hollandei and S. sabellariae from Sabellaria alveolata, S. sabellae from Sabella pavonina, Selenidium fallax from Cirriformia tentaculata, S. spiralis sp. n. and S. antevariabilis sp. n. from Amphitritides gracilis, and S. opheliae sp. n. from Ophelia roscoffensis. Molecular phylogenetic analyses of these data showed archigregarines clustering into five separate clades and support previous doubts about their monophyly.Our phylogenies using the extended gregarine sampling show that the archigregarines are indeed not monophyletic with one strongly supported clade of Selenidium sequences around the type species S. pendula. We suggest the revision of the whole archigregarine taxonomy with only the species within this clade remaining in the genus
Characterization of Escherichia coli Phylogenetic Groups ...
African Journals Online (AJOL)
Background: Escherichia coli strains mainly fall into four phylogenetic groups (A, B1, B2, and D) and that virulent extra‑intestinal strains mainly belong to groups B2 and D. Aim: The aim was to determine the association between phylogenetic groups of E. coli causing extraintestinal infections (ExPEC) regarding the site of ...
A molecular phylogeny of the stingless bee genus Melipona (Hymenoptera: Apidae).
Ramírez, Santiago R; Nieh, James C; Quental, Tiago B; Roubik, David W; Imperatriz-Fonseca, Vera L; Pierce, Naomi E
2010-08-01
Stingless bees (Meliponini) constitute a diverse group of highly eusocial insects that occur throughout tropical regions around the world. The meliponine genus Melipona is restricted to the New World tropics and has over 50 described species. Melipona, like Apis, possesses the remarkable ability to use representational communication to indicate the location of foraging patches. Although Melipona has been the subject of numerous behavioral, ecological, and genetic studies, the evolutionary history of this genus remains largely unexplored. Here, we implement a multigene phylogenetic approach based on nuclear, mitochondrial, and ribosomal loci, coupled with molecular clock methods, to elucidate the phylogenetic relationships and antiquity of subgenera and species of Melipona. Our phylogenetic analysis resolves the relationship among subgenera and tends to agree with morphology-based classification hypotheses. Our molecular clock analysis indicates that the genus Melipona shared a most recent common ancestor at least approximately 14-17 million years (My) ago. These results provide the groundwork for future comparative analyses aimed at understanding the evolution of complex communication mechanisms in eusocial Apidae. Copyright 2010 Elsevier Inc. All rights reserved.
Epigenetics Europe conference. Munich, Germany, 8-9 September 2011.
Jeltsch, Albert
2011-12-01
At the Epigenetics Europe conference in Munich, Germany, held on 8-9 September 2011, 19 speakers from different European countries were presenting novel data and concepts on molecular epigenetics. The talks were mainly focused on questions of the generation, maintenance, flexibility and erasure of DNA methylation patterns in context of other epigenetic signals like histone tail modifications and ncRNAs.
Visualizing phylogenetic tree landscapes.
Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A
2017-02-02
Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D
Huang, Danwei
2014-06-03
Recent advances in scleractinian systematics and taxonomy have been achieved through the integration of molecular and morphological data, as well as rigorous analysis using phylogenetic methods. In this study, we continue in our pursuit of a phylogenetic classification by examining the evolutionary relationships between the closely related reef coral genera Merulina, Goniastrea, Paraclavarina and Scapophyllia (Merulinidae). In particular, we address the extreme polyphyly of Favites and Goniastrea that was discovered a decade ago. We sampled 145 specimens belonging to 16 species from a wide geographic range in the Indo-Pacific, focusing especially on type localities, including the Red Sea, western Indian Ocean and central Pacific. Tree reconstructions based on both nuclear and mitochondrial markers reveal a novel lineage composed of three species previously placed in Favites and Goniastrea. Morphological analyses indicate that this clade, Paragoniastrea Huang, Benzoni & Budd, gen. n., has a unique combination of corallite and subcorallite features observable with scanning electron microscopy and thin sections. Molecular and morphological evidence furthermore indicates that the monotypic genus Paraclavarina is nested within Merulina, and the former is therefore synonymised. © 2014 Royal Swedish Academy of Sciences.
Carmo, Andreia Moreira Dos Santos; Suzuki, Rodrigo Buzinaro; Cabral, Aline Diniz; Costa, Renata Torres da; Massari, Gabriela Pena; Riquena, Michele Marcondes; Fracasso, Helio Augusto Alves; Eterovic, Andre; Marcili, Arlei; Sperança, Márcia Aparecida
2017-05-01
Dengue virus, represented by four distinct, genetically diverse serotypes, is the etiologic agent of asymptomatic to severe hemorrhagic diseases. The spatiotemporal dynamics of dengue serotypes and its association to specific diseases vary among the different regions worldwide. By 2007, and in São Paulo State, Brazil, dengue-case concentration in urban centers had changed to increased incidence in small- and medium-sized towns, the case of Marília. The aim of this article was to distinguish dengue serotypes circulating during the 2007 Marília outbreak and define their association to demographic and hematological patient profiles, as well as the phylogenetic relationships among the different viruses. PCR amplicons corresponding to the junction of capsid and dengue pre-membrane encoding genes, obtained from dengue serologically positive patients, were sequenced. Hematological and demographic data of patients with different Dengue serotypes were evaluated by univariate and bivariate statistics. Dengue PCR sequences were used in phylogenetic relationships analyzed for maximum parsimony. Molecular typing confirmed co-circulation of the dengue serotypes 1 (DENV1) and 3 (DENV3), which presented divergent correlation patterns with regard to hematological descriptors. The increase in atypical lymphocytes, a likely indication of virus load, could be significantly associated to a decrease in leukocyte counts in the DENV3 group and platelet in the DENV1. Phylogenetic reconstitution revealed the introduction of DENV1 from northern Brazil and local divergence of DENV3 by either microevolution or viral introduction from other geographical regions or both. Dengue dynamics showed regional molecular-epidemiologic specificity, which has important implications for introduction of vaccines, disease management, and transmission control. Copyright © 2017 Elsevier B.V. All rights reserved.
A Practical Algorithm for Reconstructing Level-1 Phylogenetic Networks
K.T. Huber; L.J.J. van Iersel (Leo); S.M. Kelk (Steven); R. Suchecki
2010-01-01
htmlabstractRecently much attention has been devoted to the construction of phylogenetic networks which generalize phylogenetic trees in order to accommodate complex evolutionary processes. Here we present an efficient, practical algorithm for reconstructing level-1 phylogenetic networks - a type of
A practical algorithm for reconstructing level-1 phylogenetic networks
Huber, K.T.; Iersel, van L.J.J.; Kelk, S.M.; Suchecki, R.
2011-01-01
Recently, much attention has been devoted to the construction of phylogenetic networks which generalize phylogenetic trees in order to accommodate complex evolutionary processes. Here, we present an efficient, practical algorithm for reconstructing level-1 phylogenetic networks-a type of network
Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick
2013-01-01
Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the
Directory of Open Access Journals (Sweden)
Edwin Cadena
2016-10-01
Full Text Available Background Abundant pan-trionychid (soft-shell turtles specimens have been found in Eocene sequences of central Europe, particularly from two localities in Germany, the Messel Pit (a UNESCO World Natural Heritage Site and Geiseltal, traditionally attributed to Trionyx messelianus or Rafetoides austriacus. Over the last two decades new specimens of this taxon from these two localities have been discovered and fully prepared. However, they have remained unstudied, as well as their phylogenetic position inside Pan-Trionychidae is unknown. Results Five new specimens of Palaeoamyda messeliana nov. comb. from Messel Pit and Geiseltal localities are fully described here. A revised diagnosis for the species is also presented here, together with its inclusion in a phylogenetic analysis of Pan-Trionychidae that shows that this species is sister to the extant Amyda cartilaginea, one of the most abundant pan-trionychid (soft-shell turtles from Asia, both members of the clade Chitrini. The specimens described in here are among the best and most complete fossil pan-trionychid skeletons so far known.
Folding and unfolding phylogenetic trees and networks.
Huber, Katharina T; Moulton, Vincent; Steel, Mike; Wu, Taoyang
2016-12-01
Phylogenetic networks are rooted, labelled directed acyclic graphswhich are commonly used to represent reticulate evolution. There is a close relationship between phylogenetic networks and multi-labelled trees (MUL-trees). Indeed, any phylogenetic network N can be "unfolded" to obtain a MUL-tree U(N) and, conversely, a MUL-tree T can in certain circumstances be "folded" to obtain aphylogenetic network F(T) that exhibits T. In this paper, we study properties of the operations U and F in more detail. In particular, we introduce the class of stable networks, phylogenetic networks N for which F(U(N)) is isomorphic to N, characterise such networks, and show that they are related to the well-known class of tree-sibling networks. We also explore how the concept of displaying a tree in a network N can be related to displaying the tree in the MUL-tree U(N). To do this, we develop aphylogenetic analogue of graph fibrations. This allows us to view U(N) as the analogue of the universal cover of a digraph, and to establish a close connection between displaying trees in U(N) and reconciling phylogenetic trees with networks.
Michalski, Michelle L; Bain, Odile; Fischer, Kerstin; Fischer, Peter U; Kumar, Sanjay; Foster, Jeremy M
2010-04-01
Dirofilaria ursi is a filarial nematode of American black bears (Ursus americanus Pallas, 1780) that is vectored by black flies (Simuliidae) in many parts of the United States. In northwestern Wisconsin, the prevalence of microfilaremic bears during the fall hunting season was 21% (n = 47). Unsheathed blood microfilariae from Wisconsin bears possess characters consistent with the original description of D. ursi, as do adult worms observed histologically and grossly. Immunohistochemistry was used to identify the Wolbachia endosymbiont in the hypodermis and lateral cords of an adult female D. ursi. Amplification of wsp, gatB, coxA, fbpA, and ftsZ bacterial sequences from parasite DNA confirmed the presence of Wolbachia, and molecular phylogenetic analysis of the Wolbachia ftsZ gene groups the endosymbiont with Wolbachia from D. immitis and D. repens. Phylogenetic analysis of D. ursi 5s rDNA sequence confirms the morphological observations grouping this parasite as a member of Dirofilaria, and within the Dirofilaria - Onchocerca clade of filarial nematodes. This is the first report of Wolbachia characterization and molecular phylogeny information for D. ursi.
Webster, Nicole B; Van Dooren, Tom J M; Schilthuizen, Menno
2012-06-01
The fascinating and often unlikely shell shapes in the terrestrial micromollusc family Diplommatinidae (Gastropoda: Caenogastropoda) provide a particularly attractive set of multiple morphological traits to investigate evolutionary patterns of shape variation. Here, a molecular phylogenetic reconstruction, based on five genes and 2700 bp, was undertaken for this family, integrated with ancestral state reconstruction and phylogenetic PCA of discrete and quantitative traits, respectively. We found strong support for the Diplommatininae as a monophyletic group, separating the Cochlostomatidae into a separate family. Five main clades appear within the Diplommatininae, corresponding with both coiling direction and biogeographic patterns. A Belau clade (A) with highly diverse (but always sinistral) morphology comprised Hungerfordia, Palaina, and some Diplommatina. Arinia (dextral) and Opisthostoma (sinistroid) are sister groups in clade B. Clade C and D solely contain sinistral Diplommatina that are robust and little ornamented (clade C) or slender and sculptured (clade D). Clade E is dextral but biogeographically diverse with species from all sampled regions save the Caroline Islands. Adelopoma, Diplommatina, Palaina, and Hungerfordia require revision to allow taxonomy to reflect phylogeny, whereas Opisthostoma is clearly monophyletic. Ancestral state reconstruction suggests a sinistral origin for the Diplommatinidae, with three reversals to dextrality. Copyright © 2012 Elsevier Inc. All rights reserved.
Molecular Diagnostics and Variability of Longidorid Nematodes
Directory of Open Access Journals (Sweden)
Francesca De Luca
2004-08-01
Full Text Available PCR-RFLP and sequencing approaches of ribosomal DNA are being used to study taxonomy, molecular identification and phylogeny of plant parasitic nematodes. In this paper, we discuss on the usefulness of ITS PCRRFLP analysis to differentiate among longidorid species. In addition, we examined how well ITS PCR-RFLP differentiated between longidorid species, and how well sequencing of two different ribosomal regions, the ITS containing region and D1-D2 domains of the 26S rDNA, were able to infer phylogenetic relationships among those same species. These methods and their advantages in identifying longidorids and establishing their phylogenetic relationships are examined and discussed.
Ma, Peng-Fei; Vorontsova, Maria S; Nanjarisoa, Olinirina Prisca; Razanatsoa, Jacqueline; Guo, Zhen-Hua; Haevermans, Thomas; Li, De-Zhu
2017-12-21
Heterogeneous rates of molecular evolution are universal across the tree of life, posing challenges for phylogenetic inference. The temperate woody bamboos (tribe Arundinarieae, Poaceae) are noted for their extremely slow molecular evolutionary rates, supposedly caused by their mysterious monocarpic reproduction. However, the correlation between substitution rates and flowering cycles has not been formally tested. Here we present 15 newly sequenced plastid genomes of temperate woody bamboos, including the first genomes ever sequenced from Madagascar representatives. A data matrix of 46 plastid genomes representing all 12 lineages of Arundinarieae was assembled for phylogenetic and molecular evolutionary analyses. We conducted phylogenetic analyses using different sequences (e.g., coding and noncoding) combined with different data partitioning schemes, revealing conflicting relationships involving internodes among several lineages. A great difference in branch lengths were observed among the major lineages, and topological inconsistency could be attributed to long-branch attraction (LBA). Using clock model-fitting by maximum likelihood and Bayesian approaches, we furthermore demonstrated extensive rate variation among these major lineages. Rate accelerations mainly occurred for the isolated lineages with limited species diversification, totaling 11 rate shifts during the tribe's evolution. Using linear regression analysis, we found a negative correlation between rates of molecular evolution and flowering cycles for Arundinarieae, notwithstanding that the correlation maybe insignificant when taking the phylogenetic structure into account. Using the temperate woody bamboos as an example, we found further evidence that rate heterogeneity is universal in plants, suggesting that this will pose a challenge for phylogenetic reconstruction of bamboos. The bamboos with longer flowering cycles tend to evolve more slowly than those with shorter flowering cycles, in accordance
Topological variation in single-gene phylogenetic trees
Castresana, Jose
2007-01-01
A recent large-scale phylogenomic study has shown the great degree of topological variation that can be found among eukaryotic phylogenetic trees constructed from single genes, highlighting the problems that can be associated with gene sampling in phylogenetic studies.
Phylogenetic relationships in Asarum: Effect of data partitioning and a revised classification.
Sinn, Brandon T; Kelly, Lawrence M; Freudenstein, John V
2015-05-01
Generic boundaries and infrageneric relationships among the charismatic temperate magnoliid Asarum sensu lato (Aristolochiaceae) have long been uncertain. Previous molecular phylogenetic analyses used either plastid or nuclear loci alone and varied greatly in their taxonomic implications for the genus. We analyzed additional molecular markers from the nuclear and plastid genomes, reevaluated the possibility of a derived loss of autonomous self-pollination, and investigated the topological effects of matrix-partitioning-scheme choice. We sequenced seven plastid regions and the nuclear ITS1-ITS2 region of 58 individuals representing all previously recognized Asarum s.l. segregate genera and the monotypic genus Saruma. Matrices were partitioned using common a priori partitioning schemes and PartitionFinder. Topologies that were recovered using a priori partitioning of matrices differed from those recovered using a PartitionFinder-selected scheme, and by analysis method. We recovered six monophyletic groups that we circumscribed into three subgenera and six sections. Putative fungal mimic characters served as synapomorphies only for subgenus Heterotropa. Subgenus Geotaenium, a new subgenus, was recovered as sister to the remainder of Asarum by ML analyses of highly partitioned datasets. Section Longistylis, also newly named, is sister to section Hexastylis. Our analyses do not unambiguously support a single origin for all fungal-mimicry characters. Topologies recovered through the analysis of PartitionFinder-optimized matrices can differ drastically from those inferred from a priori partitioned matrices, and by analytical method. We recommend that investigators evaluate the topological effects of matrix partitioning using multiple methods of phylogenetic reconstruction. © 2015 Botanical Society of America, Inc.
Directory of Open Access Journals (Sweden)
Lise Roy
2010-04-01
Full Text Available Molecular markers for cladistic analyses may perform differently according to the taxonomic group considered and the historical level under investigation. Here we evaluate the phylogenetic potential of five different markers for resolving evolutionary relationships within the ectoparasitic genus Dermanyssus at the species level, and their ability to address questions about the evolution of specialization. COI provided 9–18% divergence between species (up to 9% within species, 16S rRNA 10–16% (up to 4% within species, ITS1 and 2 2–9% (up to 1% within species and Tropomyosin intron n 8–20% (up to 6% within species. EF-1a revealed different non-orthologous copies withinindividuals of Dermanyssus and Ornithonyssus. Tropomyosin intron n was shown containing consistent phylogenetic signal at the specific level within Dermanyssus and represents a promising marker for future prospects in phylogenetics of Acari. Phylogenetic analyses revealed that the generalist condition is apomorphic and D. gallinae mightrepresent a complex of hybridized lineages. The split into hirsutus-group and gallinae-group in Dermanyssus does not seem to be appropriate based upon these results and D. longipes appears to be composed of two different entities.
Sequence comparison and phylogenetic analysis of core gene of ...
African Journals Online (AJOL)
Phylogenetic analysis suggests that our sequences are clustered with sequences reported from Japan. This is the first phylogenetic analysis of HCV core gene from Pakistani population. Our sequences and sequences from Japan are grouped into same cluster in the phylogenetic tree. Sequence comparison and ...
Chilton, Neil B; Huby-Chilton, Florence; Koehler, Anson V; Gasser, Robin B; Beveridge, Ian
2015-10-01
The phylogenetic relationships of the endemic (or largely endemic) Australasian trichostrongylin nematode families Herpetostrongylidae, Mackerrastrongylidae and Nicollinidae as well as endemic trichostrongylin nematodes currently placed in the families Trichostrongylidae and Molineidae were examined using the complete large subunit (28S) ribosomal RNA gene. The Herpetostrongylinae proved to be monophyletic. However, representatives of the Nicollinidae nested with the Herpetostrongylinae. The Mackerrastrongylidae was also a monophyletic group and included Peramelistrongylus, currently classified within the Trichostrongylidae. The Globocephaloidinae, currently considered to be a subfamily of the Herpetostrongylidae, was excluded from the family in the current analysis. Ollulanus and Libyostrongylus, included for the first time in a molecular phylogenetic analysis, were placed within the Trichostrongylidae. This study provided strong support for the Herpetostrongylidae (including within it the Nicollinidae, but excluding the Globocephaloidinae) and the Mackerrastrongylidae as monophyletic assemblages. Additional studies are required to resolve the relationships of the remaining endemic Australasian trichostrongylin genera.
Pavan-Kumar, A; Raman, Sudhanshu; Koringa, Prakash G; Patel, Namrata; Shah, Tejas; Singh, Rajeev K; Krishna, Gopal; Joshi, C G; Gireesh-Babu, P; Chaudhari, Aparna
2016-12-01
The mahseers (Tor, Neolissochilus and Naziritor) are an important group of fishes endemic to Asia with the conservation status of most species evaluated as threatened. Conservation plans to revive these declining wild populations are hindered by unstable taxonomy. Molecular phylogeny studies with mitochondrial genome have been successfully used to reconstruct the phylogenetic tree and to resolve taxonomic ambiguity. In the present study, complete mitochondrial genome of Tor tor has been sequenced using ion torrent next-generation sequencing platform with coverage of more than 1000 x. Comparative mitogenome analysis shows higher divergence value at ND1 gene than COI gene. Further, occurrence of a distinct genetic lineage of T. tor is revealed. The phylogenetic relationship among mahseer group has been defined as Neolissochilus hexagonolepis ((T. sinensis (T. putitora, T. tor), (T. khudree, T. tambroides)).
Keerthi, D; Aswati Nair, R; Prasath, D
2016-03-01
Zingiber zerumbet, a perennial rhizomatous herb exhibits remarkable disease resistance as well as a wide range of pharmacological activities. Towards characterizing the endophytic population of Z. zerumbet rhizomes, experiments were carried out during two different growing seasons viz., early-June of 2013 and late-July of 2014. A total of 34 endophytes were isolated and categorized into 11 morphologically distinct groups. Fungi were observed to predominate bacterial species with colonization frequency values ranging from 12.5 to 50%. Among the 11 endophyte groups isolated, molecular analyses based on ITS/16S rRNA gene sequences identified seven isolate groups as Fusarium solani, two as F. oxysporum and one as the bacterium Rhizobium spp. Phylogenetic tree clustered the ITS sequences from Z. zerumbet endophytes into distinct clades consistent with morphological and sequence analysis. Dual culture assays were carried out to determine antagonistic activity of the isolated endophytes against Pythium myriotylum, an economically significant soil-borne phytopathogen of cultivated ginger. Experiments revealed significant P. myriotylum growth inhibition by F. solani and F. oxysporum isolates with percentage of inhibition (PoI) ranging from 45.17 ± 0.29 to 62.2 ± 2.58 with F. oxysporum exhibiting higher PoI values against P. myriotylum. Using ZzEF8 metabolite extract, concentration-dependent P. myriotylum hyphal growth inhibition was observed following radial diffusion assays. These observations were confirmed by scanning electron microscopy analysis wherein exposure to ZzEF8 metabolite extract induced hyphal deformities. Results indicate Z. zerumbet endophytes as promising resources for biologically active compounds and as biocontrol agents for soft rot disease management caused by Pythium spp.
Bamorovat, Mehdi; Sharifi, Iraj; Mohammadi, Mohammad Ali; Eybpoosh, Sana; Nasibi, Saeid; Aflatoonian, Mohammad Reza; Khosravi, Ahmad
2018-03-01
The precise identification of the parasite species causing leishmaniasis is essential for selecting proper treatment modality. The present study aims to compare the nucleotide variations of the ITS1, 7SL RNA, and Hsp70 sequences between non-healed and healed anthroponotic cutaneous leishmaniasis (ACL) patients in major foci in Iran. A case-control study was carried out from September 2015 to October 2016 in the cities of Kerman and Bam, in the southeast of Iran. Randomly selected skin-scraping lesions of 40 patients (20 non-healed and 20 healed) were examined and the organisms were grown in a culture medium. Promastigotes were collected by centrifugation and kept for further molecular examinations. The extracted DNA was amplified and sequenced. After global sequence alignment with BioEdit software, maximum likelihood phylogenetic analysis was performed in PhyML for typing of Leishmania isolates. Nucleotide composition of each genetic region was also compared between non-healed and healed patients. Our results showed that all isolates belonged to the Leishmania tropica complex, with their genetic composition in the ITS1 region being different among non-healed and healed patients. 7SL RNA and Hsp70 regions were genetically identical between both groups. Variability in nucleotide patterns observed between both groups in the ITS1 region may serve to encourage future research on the function of these polymorphisms and may improve our understanding of the role of parasite genome properties on patients' response to Leishmania treatment. Our results also do not support future use of 7SL RNA and Hsp70 regions of the parasite for comparative genomic analyses. Copyright © 2018 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Spanggaard, Bettina; Skouboe, P.; Rossen, L.
1996-01-01
Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus Ichthyoph......Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus...... Ichthyophonus is not known. In the present study, a combination of molecular data, ultrastructure and biochemical characters were utilized to investigate the phylogeny of I. hoferi. The genomic DNA encoding the small subunit ribosomal RNA (18S rRNA) was amplified and sequenced. Comparisons with other eukaryotic...
Directory of Open Access Journals (Sweden)
Varpu Vahtera
Full Text Available Edentistoma octosulcatum Tömösváry, 1882, is a rare, superficially millipede-like centipede known only from Borneo and the Philippines. It is unique within the order Scolopendromorpha for its slow gait, robust tergites, and highly modified gizzard and mandible morphology. Not much is known about the biology of the species but it has been speculated to be arboreal with a possibly vegetarian diet. Until now its phylogenetic position within the subfamily Otostigminae has been based only on morphological characters, being variably ranked as a monotypic tribe (Arrhabdotini or classified with the Southeast Asian genus Sterropristes Attems, 1934. The first molecular data for E. octosulcatum sourced from a newly collected specimen from Sarawak were analysed with and without morphology. Parsimony analysis of 122 morphological characters together with two nuclear and two mitochondrial loci resolves Edentistoma as sister group to three Indo-Australian species of Rhysida, this clade in turn grouping with Ethmostigmus, whereas maximum likelihood and parsimony analyses of the molecular data on their own ally Edentistoma with species of Otostigmus. A position of Edentistoma within Otostigmini (rather than being its sister group as predicted by the Arrhabdotini hypothesis is consistently retrieved under different analytical conditions, but support values within the subfamily remain low for most nodes. The species exhibits strong pushing behaviour, suggestive of burrowing habits. Evidence against a suggested vegetarian diet is provided by observation of E. octosulcatum feeding on millipedes in the genus Trachelomegalus.
Predicting rates of interspecific interaction from phylogenetic trees.
Nuismer, Scott L; Harmon, Luke J
2015-01-01
Integrating phylogenetic information can potentially improve our ability to explain species' traits, patterns of community assembly, the network structure of communities, and ecosystem function. In this study, we use mathematical models to explore the ecological and evolutionary factors that modulate the explanatory power of phylogenetic information for communities of species that interact within a single trophic level. We find that phylogenetic relationships among species can influence trait evolution and rates of interaction among species, but only under particular models of species interaction. For example, when interactions within communities are mediated by a mechanism of phenotype matching, phylogenetic trees make specific predictions about trait evolution and rates of interaction. In contrast, if interactions within a community depend on a mechanism of phenotype differences, phylogenetic information has little, if any, predictive power for trait evolution and interaction rate. Together, these results make clear and testable predictions for when and how evolutionary history is expected to influence contemporary rates of species interaction. © 2014 John Wiley & Sons Ltd/CNRS.
Phylogenetic Structure of Foliar Spectral Traits in Tropical Forest Canopies
Directory of Open Access Journals (Sweden)
Kelly M. McManus
2016-02-01
Full Text Available The Spectranomics approach to tropical forest remote sensing has established a link between foliar reflectance spectra and the phylogenetic composition of tropical canopy tree communities vis-à-vis the taxonomic organization of biochemical trait variation. However, a direct relationship between phylogenetic affiliation and foliar reflectance spectra of species has not been established. We sought to develop this relationship by quantifying the extent to which underlying patterns of phylogenetic structure drive interspecific variation among foliar reflectance spectra within three Neotropical canopy tree communities with varying levels of soil fertility. We interpreted the resulting spectral patterns of phylogenetic signal in the context of foliar biochemical traits that may contribute to the spectral-phylogenetic link. We utilized a multi-model ensemble to elucidate trait-spectral relationships, and quantified phylogenetic signal for spectral wavelengths and traits using Pagel’s lambda statistic. Foliar reflectance spectra showed evidence of phylogenetic influence primarily within the visible and shortwave infrared spectral regions. These regions were also selected by the multi-model ensemble as those most important to the quantitative prediction of several foliar biochemical traits. Patterns of phylogenetic organization of spectra and traits varied across sites and with soil fertility, indicative of the complex interactions between the environmental and phylogenetic controls underlying patterns of biodiversity.
Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick
2013-01-01
Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will
Teaching the Process of Molecular Phylogeny and Systematics: A Multi-Part Inquiry-Based Exercise
Lents, Nathan H.; Cifuentes, Oscar E.; Carpi, Anthony
2010-01-01
Three approaches to molecular phylogenetics are demonstrated to biology students as they explore molecular data from "Homo sapiens" and four related primates. By analyzing DNA sequences, protein sequences, and chromosomal maps, students are repeatedly challenged to develop hypotheses regarding the ancestry of the five species. Although…
Maximizing the phylogenetic diversity of seed banks.
Griffiths, Kate E; Balding, Sharon T; Dickie, John B; Lewis, Gwilym P; Pearce, Tim R; Grenyer, Richard
2015-04-01
Ex situ conservation efforts such as those of zoos, botanical gardens, and seed banks will form a vital complement to in situ conservation actions over the coming decades. It is therefore necessary to pay the same attention to the biological diversity represented in ex situ conservation facilities as is often paid to protected-area networks. Building the phylogenetic diversity of ex situ collections will strengthen our capacity to respond to biodiversity loss. Since 2000, the Millennium Seed Bank Partnership has banked seed from 14% of the world's plant species. We assessed the taxonomic, geographic, and phylogenetic diversity of the Millennium Seed Bank collection of legumes (Leguminosae). We compared the collection with all known legume genera, their known geographic range (at country and regional levels), and a genus-level phylogeny of the legume family constructed for this study. Over half the phylogenetic diversity of legumes at the genus level was represented in the Millennium Seed Bank. However, pragmatic prioritization of species of economic importance and endangerment has led to the banking of a less-than-optimal phylogenetic diversity and prioritization of range-restricted species risks an underdispersed collection. The current state of the phylogenetic diversity of legumes in the Millennium Seed Bank could be substantially improved through the strategic banking of relatively few additional taxa. Our method draws on tools that are widely applied to in situ conservation planning, and it can be used to evaluate and improve the phylogenetic diversity of ex situ collections. © 2014 Society for Conservation Biology.
Directory of Open Access Journals (Sweden)
Gabriella Linc
Full Text Available This paper reports detailed FISH-based karyotypes for three diploid wheatgrass species Agropyron cristatum (L. Beauv., Thinopyrum bessarabicum (Savul.&Rayss A. Löve, Pseudoroegneria spicata (Pursh A. Löve, the supposed ancestors of hexaploid Thinopyrum intermedium (Host Barkworth & D.R.Dewey, compiled using DNA repeats and comparative genome analysis based on COS markers. Fluorescence in situ hybridization (FISH with repetitive DNA probes proved suitable for the identification of individual chromosomes in the diploid JJ, StSt and PP genomes. Of the seven microsatellite markers tested only the (GAAn trinucleotide sequence was appropriate for use as a single chromosome marker for the P. spicata AS chromosome. Based on COS marker analysis, the phylogenetic relationship between diploid wheatgrasses and the hexaploid bread wheat genomes was established. These findings confirmed that the J and E genomes are in neighbouring clusters.
Reconstructing phylogenetic networks using maximum parsimony.
Nakhleh, Luay; Jin, Guohua; Zhao, Fengmei; Mellor-Crummey, John
2005-01-01
Phylogenies - the evolutionary histories of groups of organisms - are one of the most widely used tools throughout the life sciences, as well as objects of research within systematics, evolutionary biology, epidemiology, etc. Almost every tool devised to date to reconstruct phylogenies produces trees; yet it is widely understood and accepted that trees oversimplify the evolutionary histories of many groups of organims, most prominently bacteria (because of horizontal gene transfer) and plants (because of hybrid speciation). Various methods and criteria have been introduced for phylogenetic tree reconstruction. Parsimony is one of the most widely used and studied criteria, and various accurate and efficient heuristics for reconstructing trees based on parsimony have been devised. Jotun Hein suggested a straightforward extension of the parsimony criterion to phylogenetic networks. In this paper we formalize this concept, and provide the first experimental study of the quality of parsimony as a criterion for constructing and evaluating phylogenetic networks. Our results show that, when extended to phylogenetic networks, the parsimony criterion produces promising results. In a great majority of the cases in our experiments, the parsimony criterion accurately predicts the numbers and placements of non-tree events.
Molecular genetic studies on some irradiated medicinal plants
Energy Technology Data Exchange (ETDEWEB)
Alam el-din, H.F.M
2007-07-01
This thesis aimed to study the molecular characterization , the phylogenetic relationships among the four mentha and the three ocimum species and to get some species-specific markers. twenty-one RAPD and 10 ISSR primers were used which showed high polymorphism among the species and detected 150 molecular markers for these genotypes (100 using RAPD and 50 by ISSR-analyses). detection of the phylogenetic relationships based on the three studied systems (RAPD,ISSR and their combined analyses ) indicated that these techniques succeeded in separating the seven species into two main clusters of the two mentha and ocimum genera. SDS-protein patterns characterized the seven genotypes based on presence/ absence and staining intensities of 14 polypeptide bands into two main groups.the effect of four doses of gamma irradiation on eight active components of volatile oils and SDS-protein pattern of stems of mentha viridis indicated that low levels of gamma irradiation could improve the value of some active components of medicinal plants such as menthol in mentha viridis.
Epidemiology of Breast Cancer in Europe and Africa
International Nuclear Information System (INIS)
Jnr, G. o. A.; Rahman, G. A.
2012-01-01
Breast cancer continues to remain the most lethal malignancy in women across the world. This study reviews some of the epidemiological similarities and differences in breast cancer between white European women and black African women with the aim of optimising care for women with breast malignancy across the world. The incidence of breast cancer is lower among African women than their European counterparts. Majority of women in Europe are postmenopausal when they present with breast cancer; however, the peak incidence among African women is in the premenopausal period. Ductal carcinoma is the commonest type of breast cancer among women in Africa and Europe. However, medullary and mucinous carcinomas are more common in Africa than in Europe. While European women usually present at an early stage especially with the advent of screening, African women generally present late for treatment resulting in lower survival rates. There should be more research at the molecular level among African women to identify genetic factors that may contribute to the risk of developing breast cancer. There should also be improvement in the health care system in Africa in order to optimise care for women with breast cancer.
Phylogenetic community structure: temporal variation in fish assemblage
Santorelli, Sergio; Magnusson, William; Ferreira, Efrem; Caramaschi, Erica; Zuanon, Jansen; Amadio, Sidnéia
2014-01-01
Hypotheses about phylogenetic relationships among species allow inferences about the mechanisms that affect species coexistence. Nevertheless, most studies assume that phylogenetic patterns identified are stable over time. We used data on monthly samples of fish from a single lake over 10 years to show that the structure in phylogenetic assemblages varies over time and conclusions depend heavily on the time scale investigated. The data set was organized in guild structures and temporal scales...
Zhang, Liangliang; Jiang, Jibao; Dong, Yan; Qiu, Jiangping
2015-12-15
Among oligochaetes, the Pheretima complex within the Megascolecidae is a major earthworm group. Recently, however, the systematics of the Pheretima complex based on morphology are challenged by molecular studies. Since little comparative analysis of earthworm complete mitochondrial genomes has been reported yet, we sequenced mitogenomes of four pheretimoid earthworm species to explore their phylogenetic relationships. The general earthworm genomic features are also found in four earthworms: all genes transcribed from the same strand, the same initiation codon ATG for each PCGs, and conserved structures of RNA genes. Interestingly we find an extra potential tRNA-leucine (CUN) in Amynthas longisiphonus. The earthworm mitochondrial ATP8 exhibits the highest evolutionary rate, while the gene CO1 evolves slowest. Phylogenetic analysis based on protein-coding genes (PCGs) strongly supports the monophyly of the Clitellata, Hirudinea, Oligochaeta, Megascolecidae and Pheretima complex. Our analysis, however, reveals non-monophyly within the genara Amynthas and Metaphire. Thus the generic divisions based on morphology in the Pheretima complex should be reconsidered. Copyright © 2015 Elsevier B.V. All rights reserved.
Duchêne, David; Duchêne, Sebastian; Ho, Simon Y W
2015-07-01
Phylogenetic estimation of evolutionary timescales has become routine in biology, forming the basis of a wide range of evolutionary and ecological studies. However, there are various sources of bias that can affect these estimates. We investigated whether tree imbalance, a property that is commonly observed in phylogenetic trees, can lead to reduced accuracy or precision of phylogenetic timescale estimates. We analysed simulated data sets with calibrations at internal nodes and at the tips, taking into consideration different calibration schemes and levels of tree imbalance. We also investigated the effect of tree imbalance on two empirical data sets: mitogenomes from primates and serial samples of the African swine fever virus. In analyses calibrated using dated, heterochronous tips, we found that tree imbalance had a detrimental impact on precision and produced a bias in which the overall timescale was underestimated. A pronounced effect was observed in analyses with shallow calibrations. The greatest decreases in accuracy usually occurred in the age estimates for medium and deep nodes of the tree. In contrast, analyses calibrated at internal nodes did not display a reduction in estimation accuracy or precision due to tree imbalance. Our results suggest that molecular-clock analyses can be improved by increasing taxon sampling, with the specific aims of including deeper calibrations, breaking up long branches and reducing tree imbalance. © 2014 John Wiley & Sons Ltd.
Hornok, Sándor; Szőke, Krisztina; Estók, Péter; Krawczyk, Aleksandra; Haarsma, Anne-Jifke; Kováts, Dávid; Boldogh, Sándor A; Morandini, Pál; Szekeres, Sándor; Takács, Nóra; Kontschán, Jenő; Meli, Marina L; Fernández de Mera, Isabel G; de la Fuente, José; Gyuranecz, Miklós; Sulyok, Kinga M; Weibel, Beatrice; Gönczi, Enikő; de Bruin, Arnout; Sprong, Hein; Hofmann-Lehmann, Regina
2018-02-28
In Europe, several species of bats, owls and kestrels exemplify highly urbanised, flying vertebrates, which may get close to humans or domestic animals. Bat droppings and bird pellets may have epidemiological, as well as diagnostic significance from the point of view of pathogens. In this work 221 bat faecal and 118 bird pellet samples were screened for a broad range of vector-borne bacteria using PCR-based methods. Rickettsia DNA was detected in 13 bat faecal DNA extracts, including the sequence of a rickettsial insect endosymbiont, a novel Rickettsia genotype and Rickettsia helvetica. Faecal samples of the pond bat (Myotis dasycneme) were positive for a Neorickettsia sp. and for haemoplasmas of the haemofelis group. In addition, two bird pellets (collected from a Long-eared Owl, Asio otus, and from a Common Kestrel, Falco tinnunculus) contained the DNA of a Rickettsia sp. and Anaplasma phagocytophilum, respectively. In both of these bird pellets the bones of Microtus arvalis were identified. All samples were negative for Borrelia burgdorferi s.l., Francisella tularensis, Coxiella burnetii and Chlamydiales. In conclusion, bats were shown to pass rickettsia and haemoplasma DNA in their faeces. Molecular evidence is provided for the presence of Neorickettsia sp. in bat faeces in Europe. In the evaluated regions bat faeces and owl/kestrel pellets do not appear to pose epidemiological risk from the point of view of F. tularensis, C. burnetii and Chlamydiales. Testing of bird pellets may provide an alternative approach to trapping for assessing the local occurrence of vector-borne bacteria in small mammals.
George, Jan-Peter; Konrad, Heino; Collin, Eric; Thevenet, Jean; Ballian, Dalibor; Idzojtic, Marilena; Kamm, Urs; Zhelev, Peter; Geburek, Thomas
2015-06-01
Sorbus domestica (Rosaceae) is one of the rarest deciduous tree species in Europe and is characterized by a scattered distribution. To date, no large-scale geographic studies on population genetics have been carried out. Therefore, the aims of this study were to infer levels of molecular diversity across the major part of the European distribution of S. domestica and to determine its population differentiation and structure. In addition, spatial genetic structure was examined together with the patterns of historic and recent gene flow between two adjacent populations. Leaf or cambium samples were collected from 17 populations covering major parts of the European native range from north-west France to south-east Bulgaria. Seven nuclear microsatellites and one chloroplast minisatellite were examined and analysed using a variety of methods. Allelic richness was unexpectedly high for both markers within populations (mean per locus: 3·868 for nSSR and 1·647 for chloroplast minisatellite). Moreover, there was no evidence of inbreeding (mean Fis = -0·047). The Italian Peninsula was characterized as a geographic region with comparatively high genetic diversity for both genomes. Overall population differentiation was moderate (FST = 0·138) and it was clear that populations formed three groups in Europe, namely France, Mediterranean/Balkan and Austria. Historic gene flow between two local Austrian populations was high and asymmetric, while recent gene flow seemed to be disrupted. It is concluded that molecular mechanisms such as self-incompatibility and high gene flow distances are responsible for the observed level of allelic richness as well as for population differentiation. However, human influence could have contributed to the present genetic pattern, especially in the Mediterranean region. Comparison of historic and recent gene flow may mirror the progress of habitat fragmentation in eastern Austria. © The Author 2015. Published by Oxford University Press
Directory of Open Access Journals (Sweden)
Daniel J G Lahr
Full Text Available Evolutionary relationships within Amoebozoa have been the subject of controversy for two reasons: 1 paucity of morphological characters in traditional surveys and 2 haphazard taxonomic sampling in modern molecular reconstructions. These along with other factors have prevented the erection of a definitive system that resolves confidently both higher and lower-level relationships. Additionally, the recent recognition that many protosteloid amoebae are in fact scattered throughout the Amoebozoa suggests that phylogenetic reconstructions have been excluding an extensive and integral group of organisms. Here we provide a comprehensive phylogenetic reconstruction based on 139 taxa using molecular information from both SSU-rDNA and actin genes. We provide molecular data for 13 of those taxa, 12 of which had not been previously characterized. We explored the dataset extensively by generating 18 alternative reconstructions that assess the effect of missing data, long-branched taxa, unstable taxa, fast evolving sites and inclusion of environmental sequences. We compared reconstructions with each other as well as against previously published phylogenies. Our analyses show that many of the morphologically established lower-level relationships (defined here as relationships roughly equivalent to Order level or below are congruent with molecular data. However, the data are insufficient to corroborate or reject the large majority of proposed higher-level relationships (above the Order-level, with the exception of Tubulinea, Archamoebae and Myxogastrea, which are consistently recovered. Moreover, contrary to previous expectations, the inclusion of available environmental sequences does not significantly improve the Amoebozoa reconstruction. This is probably because key amoebozoan taxa are not easily amplified by environmental sequencing methodology due to high rates of molecular evolution and regular occurrence of large indels and introns. Finally, in an effort
Lahr, Daniel J G; Grant, Jessica; Nguyen, Truc; Lin, Jian Hua; Katz, Laura A
2011-01-01
Evolutionary relationships within Amoebozoa have been the subject of controversy for two reasons: 1) paucity of morphological characters in traditional surveys and 2) haphazard taxonomic sampling in modern molecular reconstructions. These along with other factors have prevented the erection of a definitive system that resolves confidently both higher and lower-level relationships. Additionally, the recent recognition that many protosteloid amoebae are in fact scattered throughout the Amoebozoa suggests that phylogenetic reconstructions have been excluding an extensive and integral group of organisms. Here we provide a comprehensive phylogenetic reconstruction based on 139 taxa using molecular information from both SSU-rDNA and actin genes. We provide molecular data for 13 of those taxa, 12 of which had not been previously characterized. We explored the dataset extensively by generating 18 alternative reconstructions that assess the effect of missing data, long-branched taxa, unstable taxa, fast evolving sites and inclusion of environmental sequences. We compared reconstructions with each other as well as against previously published phylogenies. Our analyses show that many of the morphologically established lower-level relationships (defined here as relationships roughly equivalent to Order level or below) are congruent with molecular data. However, the data are insufficient to corroborate or reject the large majority of proposed higher-level relationships (above the Order-level), with the exception of Tubulinea, Archamoebae and Myxogastrea, which are consistently recovered. Moreover, contrary to previous expectations, the inclusion of available environmental sequences does not significantly improve the Amoebozoa reconstruction. This is probably because key amoebozoan taxa are not easily amplified by environmental sequencing methodology due to high rates of molecular evolution and regular occurrence of large indels and introns. Finally, in an effort to facilitate
Area Studies and Eastern Europe: How Eastern Europe Collapsed
Directory of Open Access Journals (Sweden)
Mirjana Kasapović
2007-01-01
Full Text Available In the first part, the author outlines the development of area studies in contemporary comparative politics, and points to their importance for the development of political science. In the second part, she examines the methodology – research design and methods – of regional comparatistics, paying particular attention to the problem of defining the region as a central category in this field of comparative politics. The third and central part is focused on the emergence of Eastern Europe as a historical-political and socio-cultural region in the course of history, especially after World War II, and on its dissolution in the processes of democratic transformation of communist regimes in the last two decades. The dissolution of Eastern Europe has resulted in restoration of a tripartite political geography in the area which it used to take up, made up of Central Europe, Southeast Europe and the proper Eastern Europe.
A phylogenetic analysis of Diurideae (Orchidaceae) based on plastid DNA sequence data.
Kores, P J; Molvray, M; Weston, P H; Hopper, S D; Brown, A P; Cameron, K M; Chase, M W
2001-10-01
DNA sequence data from plastid matK and trnL-F regions were used in phylogenetic analyses of Diurideae, which indicate that Diurideae are not monophyletic as currently delimited. However, if Chloraeinae and Pterostylidinae are excluded from Diurideae, the remaining subtribes form a well-supported, monophyletic group that is sister to a "spiranthid" clade. Chloraea, Gavilea, and Megastylis pro parte (Chloraeinae) are all placed among the spiranthid orchids and form a grade with Pterostylis leading to a monophyletic Cranichideae. Codonorchis, previously included among Chloraeinae, is sister to Orchideae. Within the more narrowly delimited Diurideae two major lineages are apparent. One includes Diuridinae, Cryptostylidinae, Thelymitrinae, and an expanded Drakaeinae; the other includes Caladeniinae s.s., Prasophyllinae, and Acianthinae. The achlorophyllous subtribe Rhizanthellinae is a member of Diurideae, but its placement is otherwise uncertain. The sequence-based trees indicate that some morphological characters used in previous classifications, such as subterranean storage organs, anther position, growth habit, fungal symbionts, and pollination syndromes have more complex evolutionary histories than previously hypothesized. Treatments based upon these characters have produced conflicting classifications, and molecular data offer a tool for reevaluating these phylogenetic hypotheses.
Evolution and maintenance of sexual size dimorphism: Aligning phylogenetic and experimental evidence
Directory of Open Access Journals (Sweden)
Matjaz eKuntner
2014-06-01
Full Text Available Integrating the insights derived from both phylogenetic and experimental approaches offers a more complete understanding of evolutionary patterns and processes, yet it is rarely a feature of investigations of the evolutionary significance of trait variation. We combine these approaches to reinterpret the patterns and processes in the evolution of female biased sexual size dimorphism in Nephilidae, a spider lineage characterized by the most extreme sexual size dimorphism among terrestrial animals. We use a molecular phylogeny to reconstruct the size evolution for each sex and reveal a case of sexually dimorphic gigantism: both sexes steadily outgrow their ancestral sizes, but the female and male slopes differ, and hence sexual size dimorphism steadily increases. A review of the experimental evidence reveals a predominant net selection for large size in both sexes, consistent with the phylogenetic pattern for females but not for males. Thus, while sexual size dimorphism in spiders most likely originates and is maintained by fecundity selection on females, it is unclear what selection pressures prevent males from becoming as large as females. This integrated approach highlights the dangers of inferring evolutionary significance from experimental studies that isolate the effects of single selection pressures.
["Long-branch Attraction" artifact in phylogenetic reconstruction].
Li, Yi-Wei; Yu, Li; Zhang, Ya-Ping
2007-06-01
Phylogenetic reconstruction among various organisms not only helps understand their evolutionary history but also reveal several fundamental evolutionary questions. Understanding of the evolutionary relationships among organisms establishes the foundation for the investigations of other biological disciplines. However, almost all the widely used phylogenetic methods have limitations which fail to eliminate systematic errors effectively, preventing the reconstruction of true organismal relationships. "Long-branch Attraction" (LBA) artifact is one of the most disturbing factors in phylogenetic reconstruction. In this review, the conception and analytic method as well as the avoidance strategy of LBA were summarized. In addition, several typical examples were provided. The approach to avoid and resolve LBA artifact has been discussed.
Lüssen, Arne; Falk, Thomas M; Villwock, Wolfgang
2003-10-01
Patterns of molecular genetic differentiation among taxa of the "agassii species complex" (Parenti, 1984) were analysed based on partial mtDNA control region sequences. Special attention has been paid to Chilean populations of Orestias agassii and species from isolated lakes of northern Chile, e.g., O. agassii, Orestias chungarensis, Orestias parinacotensis, Orestias laucaensis, and Orestias ascotanensis. Orestias tschudii, Orestias luteus, and Orestias ispi were analysed comparatively. Our findings support the utility of mtDNA control region sequences for phylogenetic studies within the "agassii species complex" and confirmed the monophyly of this particular lineage, excluding O. luteus. However, the monophyly of further morphologically defined lineages within the "agassii complex" appears doubtful. No support was found for the utility of these data sets for inferring phylogenetic relationships between more distantly related taxa originating from Lake Titicaca.
Herbei, Radu; Kubatko, Laura
2013-03-26
Markov chains are widely used for modeling in many areas of molecular biology and genetics. As the complexity of such models advances, it becomes increasingly important to assess the rate at which a Markov chain converges to its stationary distribution in order to carry out accurate inference. A common measure of convergence to the stationary distribution is the total variation distance, but this measure can be difficult to compute when the state space of the chain is large. We propose a Monte Carlo method to estimate the total variation distance that can be applied in this situation, and we demonstrate how the method can be efficiently implemented by taking advantage of GPU computing techniques. We apply the method to two Markov chains on the space of phylogenetic trees, and discuss the implications of our findings for the development of algorithms for phylogenetic inference.
Directory of Open Access Journals (Sweden)
Robert L Snyder
Full Text Available BACKGROUND: The katydid genus Neoconocephalus (25+ species has a prominent acoustic communication system and occurs in large parts of the Neotropics and Nearctic. This group has been subject of numerous behavioral, physiological, and evolutionary studies of its acoustic communication system. Two distinct life histories occur in this group: The tropical life history incorporates multiple generations/year and direct egg development without environmental triggers. Temperate life history is characterized by overwintering in the egg stage, cold trigger of egg development, and one generation/year. This study reconstructs the phylogenetic relationships within the genus to (1 determine the evolutionary history of the temperate life history, and (2 to support comparative studies of evolutionary and physiological problems in this genus. METHODOLOGY/PRINCIPAL FINDINGS: We used Amplified Fragment Length Polymorphisms (AFLP, and sequences of two nuclear loci and one mitochondrial locus to reconstruct phylogenetic relationships. The analysis included 17 ingroup and two outgroup species. AFLP and mitochondrial data provided resolution at the species level while the two nuclear loci revealed only deeper nodes. The data sets were combined in a super-matrix to estimate a total evidence tree. Seven of the temperate species form a monophyletic group; however, three more temperate species were placed as siblings of tropical species. CONCLUSIONS/SIGNIFICANCE: Our analyses support the reliability of the current taxonomic treatment of the Neoconocephalus fauna of Caribbean, Central, and North America. Ancestral state reconstruction of life history traits was not conclusive, however at least four transitions between life histories occurred among our sample of species. The proposed phylogeny will strengthen conclusions from comparative work in this group.
DEFF Research Database (Denmark)
Connolly, David; Mathiesen, Brian Vad; Lund, Henrik
2015-01-01
This document is a summary of the key technical inputs for the modelling of the heat strategy for Europe outlined in the latest Heat Roadmap Europe studies [1, 2]. These studies quantify the impact of alternative heating strategies for Europe in 2030 and 2050. The study is based on geographical...... information systems (GIS) and energy system analyses. In this report, the inputs for other modelling tools such as PRIMES are presented, in order to enable other researches to generate similar heating scenarios for Europe. Although Heat Roadmap Europe presents a complete heat strategy for Europe, which...... includes energy efficiency, individual heating units (such as boilers and heat pumps), and heat networks, the recommendations here are primarily relating to the potential and modelling of district heating. Although other solutions will play a significant role in decarbonising the heating and cooling sector...
Phylogenetically Acquired Representations and Evolutionary Algorithms.
Wozniak , Adrianna
2006-01-01
First, we explain why Genetic Algorithms (GAs), inspired by the Modern Synthesis, do not accurately model biological evolution, being rather an artificial version of artificial, rather than natural selection. Being focused on optimisation, we propose two improvements of GAs, with the aim to successfully generate adapted, desired behaviour. The first one concerns phylogenetic grounding of meaning, a way to avoid the Symbol Grounding Problem. We give a definition of Phylogenetically Acquired Re...
Yabsley, Michael J.; Work, Thierry M.; Rameyer, Robert A.
2006-01-01
The phylogenetic relationship of avian Babesia with other piroplasms remains unclear, mainly because of a lack of objective criteria such as molecular phylogenetics. In this study, our objective was to sequence the entire 18S, ITS-1, 5.8S, and ITS-2 regions of the rRNA gene and partial ß-tubulin gene of B. poelea, first described from brown boobies (Sula leucogaster) from the central Pacific, and compare them to those of other piroplasms. Phylogenetic analyses of the entire 18S rRNA gene sequence revealed that B. poelea belonged to the clade of piroplasms previously detected in humans, domestic dogs, and wild ungulates in the western United States. The entire ITS-1, 5.8S, ITS-2, and partial ß-tubulin gene sequence shared conserved regions with previously described Babesia and Theileria species. The intron of the ß-tubulin gene was 45 bp. This is the first molecular characterization of an avian piroplasm.
De Backer, M; Bonants, P; Pedley, K F; Maes, M; Roldan-Ruiz, I; Van Bockstaele, E; Heungens, K; van der Lee, T
2013-11-01
The obligate biotrophic pathogen Puccinia horiana is the causal agent of chrysanthemum white rust. Although P. horiana is a quarantine organism, it has been able to spread to most chrysanthemum-producing regions in the world since the 1960s; however, the transfer routes are largely obscure. An extremely low level of allelic diversity was observed in a geographically diverse set of eight isolates using complexity reduction of polymorphic sequences (CRoPS) technology. Only 184 of the 16,196 contigs (1.1%) showed one or more single-nucleotide polymorphisms (SNPs). Thirty-two SNPs and one simple-sequence repeat were translated into molecular markers and used to genotype 45 isolates originating from North and South America, Asia, and Europe. In most cases, phylogenetic clustering was related to geographic origin, indicating local establishment. The European isolates mostly grouped in two major populations that may relate to the two historic introductions previously reported. However, evidence of recent geographic transfer was also observed, including transfer events between Europe and South America and between Southeast Asia and Europe. In contrast with the presumed clonal propagation of this microcyclic rust, strong indications of marker recombination were observed, presumably as a result of anastomosis, karyogamy, and somatic meiosis. Recombination and transfer also explain the geographic dispersal of specific markers. A near-to-significant correlation between the genotypic data and previously obtained pathotype data was observed and one marker was associated with the most virulent pathotype group. In combination with a fast SNP detection method, the markers presented here will be helpful tools to further elucidate the transfer pathways and local survival of this pathogen.
Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L
2007-04-10
To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.
Tomasello, Salvatore; Heubl, Günther
2017-07-01
The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.
Molecular characterization of dengue viruses isolated from patients in Central Java, Indonesia.
Kusmintarsih, Endang S; Hayati, Rahma F; Turnip, Oktaviani N; Yohan, Benediktus; Suryaningsih, Suhestri; Pratiknyo, Hery; Denis, Dionisius; Sasmono, R Tedjo
2017-10-19
Dengue is hyper-endemic in Indonesia. Purwokerto city in Central Java province is routinely ravaged by the disease. Despite the endemicity of dengue in this city, there is still no data on the virological aspects of dengue in the city. We conducted a molecular surveillance study of the circulating dengue viruses (DENV) in Purwokerto city to gain information on the virus origin, serotype and genotype distribution, and phylogenetic characteristics of DENV. A cross-sectional dengue molecular surveillance study was conducted in Purwokerto. Sera were collected from dengue-suspected patients attending three hospitals in the city. Diagnosis was performed using dengue NS1 antigen and IgG/IgM antibodies detection. DENV serotyping was performed using Simplexa Dengue real-time RT-PCR. Sequencing was conducted to obtain full-length DENV Envelope (E) gene sequences, which were then used in phylogenetic and genotypic analyses. Patients' clinical and demographic data were collected and analyzed. A total of 105 dengue-suspected patients' sera were collected, in which 80 (76.2%) were positive for IgM and/or IgG, and 57 (54.2%) were confirmed as dengue by NS1 antigen and/or DENV RNA detection using RT-PCR. Serotyping was successful for 47 isolates. All four serotypes circulated in the area with DENV-3 as the predominant serotype. Phylogenetic analyses grouped the isolates into Genotype I for DENV-1, Cosmopolitan genotype for DENV-2, and Genotype I and II for DENV-3 and -4, respectively. The analyses also revealed the close relatedness of Purwokerto isolates to other DENV strains from Indonesia and neighboring countries. We reveal the molecular and virological characteristics of DENV in Purwokerto, Banyumas regency, Central Java. The genotype and phylogenetic analyses indicate the endemicity of the circulating DENV in the city. Our serotype and genotype data provide references for future dengue molecular epidemiology studies and disease management in the region. Copyright © 2017 The
Zheng, Xiaoyan; Cai, Danying; Potter, Daniel; Postman, Joseph; Liu, Jing; Teng, Yuanwen
2014-11-01
Reconstructing the phylogeny of Pyrus has been difficult due to the wide distribution of the genus and lack of informative data. In this study, we collected 110 accessions representing 25 Pyrus species and constructed both phylogenetic trees and phylogenetic networks based on multiple DNA sequence datasets. Phylogenetic trees based on both cpDNA and nuclear LFY2int2-N (LN) data resulted in poor resolution, especially, only five primary species were monophyletic in the LN tree. A phylogenetic network of LN suggested that reticulation caused by hybridization is one of the major evolutionary processes for Pyrus species. Polytomies of the gene trees and star-like structure of cpDNA networks suggested rapid radiation is another major evolutionary process, especially for the occidental species. Pyrus calleryana and P. regelii were the earliest diverged Pyrus species. Two North African species, P. cordata, P. spinosa and P. betulaefolia were descendent of primitive stock Pyrus species and still share some common molecular characters. Southwestern China, where a large number of P. pashia populations are found, is probably the most important diversification center of Pyrus. More accessions and nuclear genes are needed for further understanding the evolutionary histories of Pyrus. Copyright © 2014 Elsevier Inc. All rights reserved.
A program to compute the soft Robinson-Foulds distance between phylogenetic networks.
Lu, Bingxin; Zhang, Louxin; Leong, Hon Wai
2017-03-14
Over the past two decades, phylogenetic networks have been studied to model reticulate evolutionary events. The relationships among phylogenetic networks, phylogenetic trees and clusters serve as the basis for reconstruction and comparison of phylogenetic networks. To understand these relationships, two problems are raised: the tree containment problem, which asks whether a phylogenetic tree is displayed in a phylogenetic network, and the cluster containment problem, which asks whether a cluster is represented at a node in a phylogenetic network. Both the problems are NP-complete. A fast exponential-time algorithm for the cluster containment problem on arbitrary networks is developed and implemented in C. The resulting program is further extended into a computer program for fast computation of the Soft Robinson-Foulds distance between phylogenetic networks. Two computer programs are developed for facilitating reconstruction and validation of phylogenetic network models in evolutionary and comparative genomics. Our simulation tests indicated that they are fast enough for use in practice. Additionally, the distribution of the Soft Robinson-Foulds distance between phylogenetic networks is demonstrated to be unlikely normal by our simulation data.
Rosas-Valdez, Rogelio; Morrone, Juan J; García-Varela, Martín
2012-08-01
Species of Floridosentis (Acanthocephala) are common parasites of mullets (Mugil spp., Mugilidae) found in tropical marine and brackish water in the Americas. Floridosentis includes 2 species distributed in Mexico, i.e., Floridosentis pacifica, restricted to the Pacific Ocean near Salina Cruz, Oaxaca, and Floridosentis mugilis, distributed along the coast of the Pacific Ocean and the Gulf of Mexico. We sampled 18 populations of F. mugilis and F. pacifica (12 from the Pacific and 6 from the Gulf of Mexico) and sequenced a fragment of the rDNA large subunit to evaluate phylogenetic relationships of populations of Floridosentis spp. from Mexico. Species identification of museum specimens of F. mugilis from the Pacific Ocean was confirmed by examination of morphology traits. Phylogenetic trees inferred with maximum parsimony, maximum likelihood, and Bayesian inference indicate that Floridosentis is monophyletic comprising of 2 major well-supported clades, the first clade corresponding to F. mugilis from the Gulf of Mexico, and the second to F. pacifica from the Pacific Ocean. Genetic divergence between species ranged from 7.68 to 8.60%. Intraspecific divergence ranged from 0.14 to 0.86% for F. mugilis and from 1.72 to 4.49% for F. pacifica. Data obtained from diagnostic characters indicate that specimens from the Pacific Ocean in Mexico have differences in some traits among locations. These results are consistent with the phylogenetic hypothesis, indicating that F. pacifica is distributed in the Pacific Ocean in Mexico with 3 major lineages.
YBYRÁ facilitates comparison of large phylogenetic trees.
Machado, Denis Jacob
2015-07-01
The number and size of tree topologies that are being compared by phylogenetic systematists is increasing due to technological advancements in high-throughput DNA sequencing. However, we still lack tools to facilitate comparison among phylogenetic trees with a large number of terminals. The "YBYRÁ" project integrates software solutions for data analysis in phylogenetics. It comprises tools for (1) topological distance calculation based on the number of shared splits or clades, (2) sensitivity analysis and automatic generation of sensitivity plots and (3) clade diagnoses based on different categories of synapomorphies. YBYRÁ also provides (4) an original framework to facilitate the search for potential rogue taxa based on how much they affect average matching split distances (using MSdist). YBYRÁ facilitates comparison of large phylogenetic trees and outperforms competing software in terms of usability and time efficiency, specially for large data sets. The programs that comprises this toolkit are written in Python, hence they do not require installation and have minimum dependencies. The entire project is available under an open-source licence at http://www.ib.usp.br/grant/anfibios/researchSoftware.html .
Disentangling the phylogenetic and ecological components of spider phenotypic variation.
Gonçalves-Souza, Thiago; Diniz-Filho, José Alexandre Felizola; Romero, Gustavo Quevedo
2014-01-01
An understanding of how the degree of phylogenetic relatedness influences the ecological similarity among species is crucial to inferring the mechanisms governing the assembly of communities. We evaluated the relative importance of spider phylogenetic relationships and ecological niche (plant morphological variables) to the variation in spider body size and shape by comparing spiders at different scales: (i) between bromeliads and dicot plants (i.e., habitat scale) and (ii) among bromeliads with distinct architectural features (i.e., microhabitat scale). We partitioned the interspecific variation in body size and shape into phylogenetic (that express trait values as expected by phylogenetic relationships among species) and ecological components (that express trait values independent of phylogenetic relationships). At the habitat scale, bromeliad spiders were larger and flatter than spiders associated with the surrounding dicots. At this scale, plant morphology sorted out close related spiders. Our results showed that spider flatness is phylogenetically clustered at the habitat scale, whereas it is phylogenetically overdispersed at the microhabitat scale, although phylogenic signal is present in both scales. Taken together, these results suggest that whereas at the habitat scale selective colonization affect spider body size and shape, at fine scales both selective colonization and adaptive evolution determine spider body shape. By partitioning the phylogenetic and ecological components of phenotypic variation, we were able to disentangle the evolutionary history of distinct spider traits and show that plant architecture plays a role in the evolution of spider body size and shape. We also discussed the relevance in considering multiple scales when studying phylogenetic community structure.
Phylogenetic system and zoogeography of the Plecoptera.
Zwick, P
2000-01-01
Information about the phylogenetic relationships of Plecoptera is summarized. The few characters supporting monophyly of the order are outlined. Several characters of possible significance for the search for the closest relatives of the stoneflies are discussed, but the sister-group of the order remains unknown. Numerous characters supporting the presently recognized phylogenetic system of Plecoptera are presented, alternative classifications are discussed, and suggestions for future studies are made. Notes on zoogeography are appended. The order as such is old (Permian fossils), but phylogenetic relationships and global distribution patterns suggest that evolution of the extant suborders started with the breakup of Pangaea. There is evidence of extensive recent speciation in all parts of the world.
Directory of Open Access Journals (Sweden)
Panca J. Santoso
2013-07-01
Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.
Morimoto, Tomomi; Kojima, Yuriko; Yoshiyama, Mikio; Kimura, Kiyoshi; Yang, Bu; Kadowaki, Tatsuhiko
2012-07-01
Chronic bee paralysis virus (CBPV) infection causes chronic paralysis and loss of workers in honey bee colonies around the world. Although CBPV shows a worldwide distribution, it had not been molecularly detected in Japan. Our investigation of Apis mellifera and Apis cerana japonica colonies with RT-PCR has revealed CBPV infection in A. mellifera but not A. c. japonica colonies in Japan. The prevalence of CBPV is low compared with that of other viruses: deformed wing virus (DWV), black queen cell virus (BQCV), Israel acute paralysis virus (IAPV), and sac brood virus (SBV), previously reported in Japan. Because of its low prevalence (5.6%) in A. mellifera colonies, the incidence of colony losses by CBPV infection must be sporadic in Japan. The presence of the (-) strand RNA in dying workers suggests that CBPV infection and replication may contribute to their symptoms. Phylogenetic analysis demonstrates a geographic separation of Japanese isolates from European, Uruguayan, and mainland US isolates. The lack of major exchange of honey bees between Europe/mainland US and Japan for the recent 26 years (1985-2010) may have resulted in the geographic separation of Japanese CBPV isolates.
Cophenetic metrics for phylogenetic trees, after Sokal and Rohlf.
Cardona, Gabriel; Mir, Arnau; Rosselló, Francesc; Rotger, Lucía; Sánchez, David
2013-01-16
Phylogenetic tree comparison metrics are an important tool in the study of evolution, and hence the definition of such metrics is an interesting problem in phylogenetics. In a paper in Taxon fifty years ago, Sokal and Rohlf proposed to measure quantitatively the difference between a pair of phylogenetic trees by first encoding them by means of their half-matrices of cophenetic values, and then comparing these matrices. This idea has been used several times since then to define dissimilarity measures between phylogenetic trees but, to our knowledge, no proper metric on weighted phylogenetic trees with nested taxa based on this idea has been formally defined and studied yet. Actually, the cophenetic values of pairs of different taxa alone are not enough to single out phylogenetic trees with weighted arcs or nested taxa. For every (rooted) phylogenetic tree T, let its cophenetic vectorφ(T) consist of all pairs of cophenetic values between pairs of taxa in T and all depths of taxa in T. It turns out that these cophenetic vectors single out weighted phylogenetic trees with nested taxa. We then define a family of cophenetic metrics dφ,p by comparing these cophenetic vectors by means of Lp norms, and we study, either analytically or numerically, some of their basic properties: neighbors, diameter, distribution, and their rank correlation with each other and with other metrics. The cophenetic metrics can be safely used on weighted phylogenetic trees with nested taxa and no restriction on degrees, and they can be computed in O(n2) time, where n stands for the number of taxa. The metrics dφ,1 and dφ,2 have positive skewed distributions, and they show a low rank correlation with the Robinson-Foulds metric and the nodal metrics, and a very high correlation with each other and with the splitted nodal metrics. The diameter of dφ,p, for p⩾1 , is in O(n(p+2)/p), and thus for low p they are more discriminative, having a wider range of values.
Molecular epidemiology of human rhinoviruses
Savolainen-Kopra, Carita
2006-01-01
The first part of this work investigates the molecular epidemiology of a human enterovirus (HEV), echovirus 30 (E-30). This project is part of a series of studies performed in our research team analyzing the molecular epidemiology of HEV-B viruses. A total of 129 virus strains had been isolated in different parts of Europe. The sequence analysis was performed in three different genomic regions: 420 nucleotides (nt) in the VP4/VP2 capsid protein coding region, the entire VP1 capsid protein cod...
The best of both worlds: Phylogenetic eigenvector regression and mapping
Directory of Open Access Journals (Sweden)
José Alexandre Felizola Diniz Filho
2015-09-01
Full Text Available Eigenfunction analyses have been widely used to model patterns of autocorrelation in time, space and phylogeny. In a phylogenetic context, Diniz-Filho et al. (1998 proposed what they called Phylogenetic Eigenvector Regression (PVR, in which pairwise phylogenetic distances among species are submitted to a Principal Coordinate Analysis, and eigenvectors are then used as explanatory variables in regression, correlation or ANOVAs. More recently, a new approach called Phylogenetic Eigenvector Mapping (PEM was proposed, with the main advantage of explicitly incorporating a model-based warping in phylogenetic distance in which an Ornstein-Uhlenbeck (O-U process is fitted to data before eigenvector extraction. Here we compared PVR and PEM in respect to estimated phylogenetic signal, correlated evolution under alternative evolutionary models and phylogenetic imputation, using simulated data. Despite similarity between the two approaches, PEM has a slightly higher prediction ability and is more general than the original PVR. Even so, in a conceptual sense, PEM may provide a technique in the best of both worlds, combining the flexibility of data-driven and empirical eigenfunction analyses and the sounding insights provided by evolutionary models well known in comparative analyses.
Sun, Xiaomin; Zhao, Ruoping; Zhang, Ting; Gong, Jie; Jing, Meidong; Huang, Ling
2017-10-01
Coraciiformes comprises 209 species belonging to ten families with significant divergence on external morphologies and life styles. The phylogenetic placement of Coraciiformes was still in debate. Here, we determined the complete mitochondrial genomes (mitogenomes) of Crested Kingfisher (Ceryle rudis) and Black-capped Kingfisher (Halcyon pileata). The mitogenomes were 17,355 bp (C. rudis) and 17,612 bp (H. pileata) in length, and both of them contained 37 genes (two rRNA genes, 22 tRNA genes and 13 protein-coding genes) and one control region. The gene organizations and characters of two mitogenomes were similar with those of other mitogenomes in Coraciiformes, however the sizes and nucleotide composition of control regions in different mitogenomes were significantly different. Phylogenetic trees were constructed with both Bayesian and Maximum Likelihood methods based on mitogenome sequences from 11 families of six orders. The trees based on two different data sets supported the basal position of Psittacidae (Psittaciformes), the closest relationship between Cuculiformes (Cuculidae) and Trogoniformes (Trogonidae), and the close relationship between Coraciiformes and Piciformes. The phylogenetic placement of the clade including Cuculiformes and Trogoniformes has not been resolved in present study, which need further investigations with more molecular markers and species. The mitogenome sequences presented here provided valuable data for further taxonomic studies on Coraciiformes and other related groups.
Huo, Guangming; Jiang, Guofang; Sun, Zhengli; Liu, Dianfeng; Zhang, Yalin; Lu, Lin
2007-04-01
Sequences from the mitochondrial cytochrome b gene (Cyt b) were determined for 25 species from the superfamily Acridoidae and the homologous sequences of 19 species of grasshoppers were downloaded from the GenBank data library. The purpose was to develop a molecular phylogeny of the Acrypteridae, and to interpret the phylogenetic position of the family within the superfamily Acridoidea. Phylogeny was reconstructed by Maximum-parsimony (MP) and Bayesian criteria using Yunnanites coriacea and Tagasta marginella as outgroups. The alignment length of the fragments was 384 bp after excluding ambiguous sites, including 167 parsimony informative sites. In the fragments, the percentages of A + T and G + C were 70.7% and 29.3%, respectively. The monophyly of Arcypteridae is not supported by phylogenetic trees. Within the Arcypteridae, neither Arcypterinae nor Ceracrinae is supported as a monophyletic group. The current genus Chorthippus is not a monophyletic group, and should be a polyphyletic group. The present results are significantly different from the classification scheme of Arcypteridae, which is based on morphology.
Data supporting a molecular phylogeny of the hyper-diverse genus Brueelia
Directory of Open Access Journals (Sweden)
Sarah E. Bush
2015-12-01
Full Text Available Data is presented in support of a phylogenetic reconstruction of one of the largest, and most poorly understood, groups of lice: the Brueelia-complex (Bush et al., 2015 [1]. Presented data include the voucher information and molecular data (GenBank accession numbers of 333 ingroup taxa within the Brueelia-complex and 30 outgroup taxa selected from across the order Phthiraptera. Also included are phylogenetic reconstructions based on Bayesian inference analyses of combined COI and EF-1α sequences for Brueelia-complex species and outgroup taxa.
Kutschera, Verena E; Bidon, Tobias; Hailer, Frank; Rodi, Julia L; Fain, Steven R; Janke, Axel
2014-08-01
Ursine bears are a mammalian subfamily that comprises six morphologically and ecologically distinct extant species. Previous phylogenetic analyses of concatenated nuclear genes could not resolve all relationships among bears, and appeared to conflict with the mitochondrial phylogeny. Evolutionary processes such as incomplete lineage sorting and introgression can cause gene tree discordance and complicate phylogenetic inferences, but are not accounted for in phylogenetic analyses of concatenated data. We generated a high-resolution data set of autosomal introns from several individuals per species and of Y-chromosomal markers. Incorporating intraspecific variability in coalescence-based phylogenetic and gene flow estimation approaches, we traced the genealogical history of individual alleles. Considerable heterogeneity among nuclear loci and discordance between nuclear and mitochondrial phylogenies were found. A species tree with divergence time estimates indicated that ursine bears diversified within less than 2 My. Consistent with a complex branching order within a clade of Asian bear species, we identified unidirectional gene flow from Asian black into sloth bears. Moreover, gene flow detected from brown into American black bears can explain the conflicting placement of the American black bear in mitochondrial and nuclear phylogenies. These results highlight that both incomplete lineage sorting and introgression are prominent evolutionary forces even on time scales up to several million years. Complex evolutionary patterns are not adequately captured by strictly bifurcating models, and can only be fully understood when analyzing multiple independently inherited loci in a coalescence framework. Phylogenetic incongruence among gene trees hence needs to be recognized as a biologically meaningful signal. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Ting Guo
Full Text Available Fungal species of Armillaria, which can act as plant pathogens and/or symbionts of the Chinese traditional medicinal herb Gastrodia elata ("Tianma", are ecologically and economically important and have consequently attracted the attention of mycologists. However, their taxonomy has been highly dependent on morphological characterization and mating tests. In this study, we phylogenetically analyzed Chinese Armillaria samples using the sequences of the internal transcribed spacer region, translation elongation factor-1 alpha gene and beta-tubulin gene. Our data revealed at least 15 phylogenetic lineages of Armillaria from China, of which seven were newly discovered and two were recorded from China for the first time. Fourteen Chinese biological species of Armillaria, which were previously defined based on mating tests, could be assigned to the 15 phylogenetic lineages identified herein. Seven of the 15 phylogenetic lineages were found to be disjunctively distributed in different continents of the Northern Hemisphere, while eight were revealed to be endemic to certain continents. In addition, we found that seven phylogenetic lineages of Armillaria were used for the cultivation of Tianma, only two of which had been recorded to be associated with Tianma previously. We also illustrated that G. elata f. glauca ("Brown Tianma" and G. elata f. elata ("Red Tianma", two cultivars of Tianma grown in different regions of China, form symbiotic relationships with different phylogenetic lineages of Armillaria. These findings should aid the development of Tianma cultivation in China.
Phylogenetic relationships within and among Brassica species from ...
African Journals Online (AJOL)
Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...
Pereira, Tássia Tatiane Pontes; Dos Reis, Ana Caroline Coelho Corrêa; Cardoso, Danon Clemes; Cristiano, Maykon Passos
2018-01-01
Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known) and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known). The main exception is Acromyrmex striatus (Roger, 1863), which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH) with telomeric probes with (TTAGG) 6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus . Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.
Valcárcel, V; Guzmán, B; Medina, N G; Vargas, P; Wen, J
2017-06-22
Hedera (ivies) is one of the few temperate genera of the primarily tropical Asian Palmate group of the Araliaceae, which extends its range out of Asia to Europe and the Mediterranean basin. Phylogenetic and phylogeographic results suggested Asia as the center of origin and the western Mediterranean region as one of the secondary centers of diversification. The bird-dispersed fleshy fruits of ivies suggest frequent dispersal over long distances (e.g. Macaronesian archipelagos), although reducing the impact of geographic barriers to gene flow in mainland species. Genetic isolation associated with geographic barriers and independent polyploidization events have been postulated as the main driving forces of diversification. In this study we aim to evaluate past and present diversification patterns in Hedera within a geographic and temporal framework to clarify the biogeographic history of the genus. Phylogenetic (biogeographic, time divergence and diversification) and phylogeographic (coalescence) analyses using four DNA regions (nrITS, trnH-psbA, trnT-trnL, rpl32) revealed a complex spatial pattern of lineage divergence. Scarce geographic limitation to gene flow and limited diversification are observed during the early-mid Miocene, followed by a diversification rate increase related to geographic divergence from the Tortonian/Messinian. Genetic and palaeobotanical evidence points the origin of the Hedera clade in Asia, followed by a gradual E-W Asian extinction and the progressive E-W Mediterranean colonization. The temporal framework for the E Asia - W Mediterranean westward colonization herein reported is congruent with the fossil record. Subsequent range expansion in Europe and back colonization to Asia is also inferred. Uneven diversification among geographic areas occurred from the Tortonian/Messinian onwards with limited diversification in the newly colonized European and Asian regions. Eastern and western Mediterranean regions acted as refugia for Miocene and
Phylogenetic Inference of HIV Transmission Clusters
Directory of Open Access Journals (Sweden)
Vlad Novitsky
2017-10-01
Full Text Available Better understanding the structure and dynamics of HIV transmission networks is essential for designing the most efficient interventions to prevent new HIV transmissions, and ultimately for gaining control of the HIV epidemic. The inference of phylogenetic relationships and the interpretation of results rely on the definition of the HIV transmission cluster. The definition of the HIV cluster is complex and dependent on multiple factors, including the design of sampling, accuracy of sequencing, precision of sequence alignment, evolutionary models, the phylogenetic method of inference, and specified thresholds for cluster support. While the majority of studies focus on clusters, non-clustered cases could also be highly informative. A new dimension in the analysis of the global and local HIV epidemics is the concept of phylogenetically distinct HIV sub-epidemics. The identification of active HIV sub-epidemics reveals spreading viral lineages and may help in the design of targeted interventions.HIVclustering can also be affected by sampling density. Obtaining a proper sampling density may increase statistical power and reduce sampling bias, so sampling density should be taken into account in study design and in interpretation of phylogenetic results. Finally, recent advances in long-range genotyping may enable more accurate inference of HIV transmission networks. If performed in real time, it could both inform public-health strategies and be clinically relevant (e.g., drug-resistance testing.
Nguyen, Nhu H; Vellinga, Else C; Bruns, Thomas D; Kennedy, Peter G
The genus Suillus represents one of the most recognizable groups of mushrooms in conifer forests throughout the Northern Hemisphere. Although for decades the genus has been relatively well defined morphologically, previous molecular phylogenetic assessments have provided important yet preliminary insights into its evolutionary history. We present the first large-scale phylogenetic study of the boundaries of each species in the genus Suillus based on the most current internal transcribed spacer (ITS) barcode sequences available inPUBLIC databases, as well as sequencing of 224 vouchered specimens and cultures, 15 of which were type specimens from North America. We found that species boundaries delimited by morphological data are broadly congruent with those based on ITS sequences. However, some species appear to have been described several times under different names, several species groups cannot be resolved by ITS sequences alone, and undescribed taxa are apparent, especially in Asia. Therefore, we elevated S. tomentosus var. discolor to S. discolor; proposed synonymies of S. neoalbidipes with S. glandulosipes, S. borealis with S. brunnescens, Boletus serotinus and B. solidipes with Suillus elbensis, S. lactifluus with S. granulatus, S. himalayensis with S. americanus; and proposed usage of the names S. clintonianus in the place of the North American S. grevillei, S. weaverae for North American S. granulatus, S. ampliporus in the place of the North American S. cavipes, and S. elbensis in place of the North American S. viscidus. We showed that the majority of Suillus species have strong affinities for particular host genera. Although deep node support was low, geographic differentiation was apparent, with species from North America, Eurasia, and Asia often forming their own clades. Collectively, this comprehensive genus-level phylogenetic integration of currently available Suillus ITS molecular data and metadata will aid future taxonomic and ecological work on an
Grundmann, Hajo; Aanensen, David M; van den Wijngaard, Cees C; Spratt, Brian G; Harmsen, Dag; Friedrich, Alexander W; Tami, Adriana
Background: Staphylococcus aureus is one of the most important human pathogens and methicillin-resistant variants (MRSAs) are a major cause of hospital and community-acquired infection. We aimed to map the geographic distribution of the dominant clones that cause invasive infections in Europe.
Visualising very large phylogenetic trees in three dimensional hyperbolic space
Directory of Open Access Journals (Sweden)
Liberles David A
2004-04-01
Full Text Available Abstract Background Common existing phylogenetic tree visualisation tools are not able to display readable trees with more than a few thousand nodes. These existing methodologies are based in two dimensional space. Results We introduce the idea of visualising phylogenetic trees in three dimensional hyperbolic space with the Walrus graph visualisation tool and have developed a conversion tool that enables the conversion of standard phylogenetic tree formats to Walrus' format. With Walrus, it becomes possible to visualise and navigate phylogenetic trees with more than 100,000 nodes. Conclusion Walrus enables desktop visualisation of very large phylogenetic trees in 3 dimensional hyperbolic space. This application is potentially useful for visualisation of the tree of life and for functional genomics derivatives, like The Adaptive Evolution Database (TAED.
Lustig, Y; Kaufman, Z; Mannasse, B; Koren, R; Katz-Likvornik, S; Orshan, L; Glatman-Freedman, A; Mendelson, E
2017-12-01
West Nile Virus (WNV) is endemic in Israel and was responsible for several outbreaks in the past 16 years. The aim of the present study was to investigate the spatial distribution of WNV acute infections from an outbreak that occurred in 2015 in Israel and report the molecular and geographic characterization of WNV isolates from human cases and mosquito pools obtained during this outbreak. Using a geographical layer comprising 51 continuous areas of Israel, the number of WNV infection cases per 100 000 people in each area and the locations of WNV-infected mosquitoes in 2015 were analysed. Sequencing and phylogenetic analyses followed by geographic localization were performed on 13 WNV human isolates and 19 WNV-infected mosquito pools. Substantial geographical variation in the prevalence of acute WNV in patients in Israel was found and an overall correlation with WNV-infected mosquitoes. All human patients sequenced were infected only with the Mediterranean subtype of WNV Lineage 1 and resided primarily in the coastal regions in central Israel. In contrast, mosquitoes were infected with both the Mediterranean and Eastern European subtypes of WNV lineage 1; however, only the Mediterranean subtype was found in mosquitoes from the coastal region in central Israel. These results demonstrate differential geographic dispersion in Israel of the two WNV subtypes and may also point to a differential pattern of human infections. As a geographical bridge between Europe, Asia and Africa, analysis of WNV circulation in humans and mosquitoes in Israel provides information relevant to WNV infections in Eurasia. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
M.J.A. Alkhaled
2016-12-01
Full Text Available Theileriosis is parasitic infection causes by obligate intracellular protozoa of the genus Theileria. T. lestoquardi is the most virulent species in sheep and goats which causes a severe disease with a high morbidity and mortality rate. In this study the phylogenetic relationships between two local isolate of T. lestoquardi and nine T. lestoquardi global isolates as well as Babesia ovis out-group isolate were analyzed using the 18S rRNA gene sequence. The multiple sequence alignment analysis and neighbor joining phylogenetic tree analysis were performed by using ClustalW multiple sequence alignment online based analysis of 1098bp 18S rRNA gene was amplified by polymerase chain reaction. Phylogenetic analysis results of these gene sequences revealed that T. lestoquardi local isolates were closely related to T. lestoquardi Iran isolate (JQ917458.1 and two Iraq Kurdistan isolates (KC778786.1 and KC778785.1 more than other countries. This study represents the first report on the use of molecular phylogeny to classify T. lestoquardi obtained in Middle Region of Iraq.
Climate-driven extinctions shape the phylogenetic structure of temperate tree floras.
Eiserhardt, Wolf L; Borchsenius, Finn; Plum, Christoffer M; Ordonez, Alejandro; Svenning, Jens-Christian
2015-03-01
When taxa go extinct, unique evolutionary history is lost. If extinction is selective, and the intrinsic vulnerabilities of taxa show phylogenetic signal, more evolutionary history may be lost than expected under random extinction. Under what conditions this occurs is insufficiently known. We show that late Cenozoic climate change induced phylogenetically selective regional extinction of northern temperate trees because of phylogenetic signal in cold tolerance, leading to significantly and substantially larger than random losses of phylogenetic diversity (PD). The surviving floras in regions that experienced stronger extinction are phylogenetically more clustered, indicating that non-random losses of PD are of increasing concern with increasing extinction severity. Using simulations, we show that a simple threshold model of survival given a physiological trait with phylogenetic signal reproduces our findings. Our results send a strong warning that we may expect future assemblages to be phylogenetically and possibly functionally depauperate if anthropogenic climate change affects taxa similarly. © 2015 John Wiley & Sons Ltd/CNRS.
Turanov, S V; Kartavtsev, Yu Ph; Lee, Y H; Jeong, D
2017-07-01
The infraorder Zoarcales (Cottoidei), or eelpouts, includes about 400 species of coldwater fishes concentrated mainly in the North Pacific. To date, the molecular phylogenetic methods in combination with morphological data have significantly contributed to understanding the taxonomic composition of this group and made it possible to confirm/refute validity of some families of obscure origin. In spite of the growing amount of new data on taxonomy and evolution of eelpouts, a consideration of the original and independent data is obviously needed to verify the existing knowledge of this taxon. In this study, which is based on concatenated matrix of Co-1 and Cyt-b mitochondrial genes, as well as relying on the samples from seven families and 45 species of eelpouts, we have reconstructed the phylogeny, which is generally consistent with previous inferences. Despite the resolution of the original data matrix is low, we have demonstrated the monophyletic origin of the families Zoarcidae and Anarhichadidae, as well as Neozoarcidae, previously related to Stichaeidae and recently revised Eulophiidae. The polyphyletic patterns amongst some subfamilies in Stichaeidae have been confirmed, whereas Opisthocentrinae and Pholidae seem to constitute a valid family-level taxon. Our results provide new opportunities with respect to taxonomic relationships in the complex and diverse group of eelpouts , whose part in the tree of life is not covered by recently flourishing multilocus phylogeny of teleost fishes. In light of the data obtained, the necessity of more unified and reproducible approaches to resolve the issues of evolution and taxonomy of such a complex group as Zoarcales becomes more evident.
Increased phylogenetic resolution using target enrichment in Rubus
Phylogenetic analyses in Rubus L. have been challenging due to polyploidy, hybridization, and apomixis within the genus. Wide morphological diversity occurs within and between species, contributing to challenges at lower and higher systematic levels. Phylogenetic inferences to date have been based o...
Caira, Janine N; Jensen, Kirsten; Waeschenbach, Andrea; Olson, Peter D; Littlewood, D Timothy J
2014-01-01
Novel molecular data are presented to resolve the long-standing issue of the non-monophyly of the elasmobranch-hosted tapeworm order Tetraphyllidea relative to the other acetabulate eucestode orders. Bayesian inference analyses of various combinations of full ssrDNA, and full or partial lsrDNA (D1-D3), sequence data, which included 134 species representing 97 genera across the 15 eucestode orders, were conducted. New ssrDNA data were generated for 82 species, partial lsrDNA data for 53 species, and full lsrDNA data for 29 species. The monophyly of each of the elasmobranch-hosted orders Cathetocephalidea, Litobothriidea, Lecanicephalidea and Rhinebothriidea was confirmed, as was the non-monophyly of the Tetraphyllidea. Two relatively stable groups of tetraphyllidean taxa emerged and are hereby designated as new orders. The Onchoproteocephalidea n. ord. is established to recognise the integrated nature of one undescribed and 10 described genera of hook-bearing tetraphyllideans, previously placed in the family Onchobothriidae, with the members of the order Proteocephalidea. The Phyllobothriidea n. ord. is established for a subset of 12 non-hooked genera characterised by scoleces bearing four bothridia each with an anterior accessory sucker; most parasitise sharks and have been assigned to the Phyllobothriidae at one time or another. Tentative ordinal placements are suggested for eight additional genera; placements for the remaining tetraphyllidean genera have not yet emerged. We propose that these 17 genera remain in the "Tetraphyllidea". Among these, particularly labile across analyses were Anthobothrium, Megalonchos, Carpobothrium, Calliobothrium and Caulobothrium. The unique association of Chimaerocestus with holocephalans, rather than with elasmobranchs, appears to represent a host-switching event. Both of the non-elasmobranch hosted clades of acetabulate cestodes (i.e. Proteocephalidea and Cyclophyllidea and their kin) appear to have had their origins with
Garcia-Porta, J; Litvinchuk, S N; Crochet, P A; Romano, A; Geniez, P H; Lo-Valvo, M; Lymberakis, P; Carranza, S
2012-04-01
In most pan-Eurasiatic species complexes, two phenomena have been traditionally considered key processes of their cladogenesis and biogeography. First, it is hypothesized that the origin and development of the Central Asian Deserts generated a biogeographic barrier that fragmented past continuous distributions in Eastern and Western domains. Second, Pleistocene glaciations have been proposed as the main process driving the regional diversification within each of these domains. The European common toad and its closest relatives provide an interesting opportunity to examine the relative contributions of these paleogeographic and paleoclimatic events to the phylogeny and biogeography of a widespread Eurasiatic group. We investigate this issue by applying a multiproxy approach combining information from molecular phylogenies, a multiple correspondence analysis of allozyme data and species distribution models. Our study includes 304 specimens from 164 populations, covering most of the distributional range of the Bufo bufo species complex in the Western Palearctic. The phylogenies (ML and Bayesian analyses) were based on a total of 1988 bp of mitochondrial DNA encompassing three genes (tRNAval, 16S and ND1). A dataset with 173 species of the family Bufonidae was assembled to estimate the separation of the two pan-Eurasiatic species complexes of Bufo and to date the main biogeographic events within the Bufo bufo species complex. The allozyme study included sixteen protein systems, corresponding to 21 presumptive loci. Finally, the distribution models were based on maximum entropy. Our distribution models show that Eastern and Western species complexes are greatly isolated by the Central Asian Deserts, and our dating estimates place this divergence during the Middle Miocene, a moment in which different sources of evidence document a major upturn of the aridification rate of Central Asia. This climate-driven process likely separated the Eastern and Western species. At the
Interpreting the universal phylogenetic tree
Woese, C. R.
2000-01-01
The universal phylogenetic tree not only spans all extant life, but its root and earliest branchings represent stages in the evolutionary process before modern cell types had come into being. The evolution of the cell is an interplay between vertically derived and horizontally acquired variation. Primitive cellular entities were necessarily simpler and more modular in design than are modern cells. Consequently, horizontal gene transfer early on was pervasive, dominating the evolutionary dynamic. The root of the universal phylogenetic tree represents the first stage in cellular evolution when the evolving cell became sufficiently integrated and stable to the erosive effects of horizontal gene transfer that true organismal lineages could exist.
Whipps, Christopher M.; El-Matbouli, M.; Hedrick, R.P.; Blazer, V.; Kent, M.L.
2004-01-01
Molecular approaches for resolving relationships among the Myxozoa have relied mainly on small subunit (SSU) ribosomal DNA (rDNA) sequence analysis. This region of the gene is generally used for higher phylogenetic studies, and the conservative nature of this gene may make it inadequate for intraspecific comparisons. Previous intraspecific studies of Myxobolus cerebralis based on molecular analyses reported that the sequence of SSU rDNA and the internal transcribed spacer (ITS) were highly conserved in representatives of the parasite from North America and Europe. Considering that the ITS is usually a more variable region than the SSU, we reanalyzed available sequences on GenBank and obtained sequences from other M. cerebralis representatives from the states of California and West Virginia in the USA and from Germany and Russia. With the exception of 7 base pairs, most of the sequence designated as ITS-1 in GenBank was a highly conserved portion of the rDNA near the 3-prime end of the SSU region. Nonetheless, the additional ITS-1 sequences obtained from the available geographic representatives were well conserved. It is unlikely that we would have observed virtually identical ITS-1 sequences between European and American M. cerebralis samples had it spread naturally over time, particularly when compared to the variation seen between isolates of another myxozoan (Kudoa thyrsites) that has most likely spread naturally. These data further support the hypothesis that the current distribution of M. cerebralis in North America is a result of recent introductions followed by dispersal via anthropogenic means, largely through the stocking of infected trout for sport fishing.
DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.
Eernisse, D J
1992-04-01
DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.
Directory of Open Access Journals (Sweden)
Tássia Tatiane Pontes Pereira
2018-01-01
Full Text Available Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known. The main exception is Acromyrmex striatus (Roger, 1863, which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH with telomeric probes with (TTAGG6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus. Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.
Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region
Energy Technology Data Exchange (ETDEWEB)
Miyamoto, M.M.; Slightom, J.L.; Goodman, M.
1987-10-16
Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.
DEFF Research Database (Denmark)
For decades, the creationist movement was primarily situated in the United States. Then, in the 1970s, American creationists found their ideas welcomed abroad, first in Australia and New Zealand, then in Korea, India, South Africa, Brazil, and elsewhere—including Europe, where creationism plays...... the teaching of creationism as a scientific discipline on an equal footing with the theory of evolution." Creationism in Europe offers a discerning introduction to the cultural history of modern Europe, the variety of worldviews in Europe, and the interplay of science and religion in a global context...
Utilization of complete chloroplast genomes for phylogenetic studies
Ramlee, Shairul Izan Binti
2016-01-01
Chloroplast DNA sequence polymorphisms are a primary source of data in many plant phylogenetic studies. The chloroplast genome is relatively conserved in its evolution making it an ideal molecule to retain phylogenetic signals. The chloroplast genome is also largely, but not completely, free from
Estimating phylogenetic trees from genome-scale data.
Liu, Liang; Xi, Zhenxiang; Wu, Shaoyuan; Davis, Charles C; Edwards, Scott V
2015-12-01
The heterogeneity of signals in the genomes of diverse organisms poses challenges for traditional phylogenetic analysis. Phylogenetic methods known as "species tree" methods have been proposed to directly address one important source of gene tree heterogeneity, namely the incomplete lineage sorting that occurs when evolving lineages radiate rapidly, resulting in a diversity of gene trees from a single underlying species tree. Here we review theory and empirical examples that help clarify conflicts between species tree and concatenation methods, and misconceptions in the literature about the performance of species tree methods. Considering concatenation as a special case of the multispecies coalescent model helps explain differences in the behavior of the two methods on phylogenomic data sets. Recent work suggests that species tree methods are more robust than concatenation approaches to some of the classic challenges of phylogenetic analysis, including rapidly evolving sites in DNA sequences and long-branch attraction. We show that approaches, such as binning, designed to augment the signal in species tree analyses can distort the distribution of gene trees and are inconsistent. Computationally efficient species tree methods incorporating biological realism are a key to phylogenetic analysis of whole-genome data. © 2015 New York Academy of Sciences.
Phylo.io: Interactive Viewing and Comparison of Large Phylogenetic Trees on the Web.
Robinson, Oscar; Dylus, David; Dessimoz, Christophe
2016-08-01
Phylogenetic trees are pervasively used to depict evolutionary relationships. Increasingly, researchers need to visualize large trees and compare multiple large trees inferred for the same set of taxa (reflecting uncertainty in the tree inference or genuine discordance among the loci analyzed). Existing tree visualization tools are however not well suited to these tasks. In particular, side-by-side comparison of trees can prove challenging beyond a few dozen taxa. Here, we introduce Phylo.io, a web application to visualize and compare phylogenetic trees side-by-side. Its distinctive features are: highlighting of similarities and differences between two trees, automatic identification of the best matching rooting and leaf order, scalability to large trees, high usability, multiplatform support via standard HTML5 implementation, and possibility to store and share visualizations. The tool can be freely accessed at http://phylo.io and can easily be embedded in other web servers. The code for the associated JavaScript library is available at https://github.com/DessimozLab/phylo-io under an MIT open source license. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Duchêne, Sebastián; Geoghegan, Jemma L; Holmes, Edward C; Ho, Simon Y W
2016-11-15
In rapidly evolving pathogens, including viruses and some bacteria, genetic change can accumulate over short time-frames. Accordingly, their sampling times can be used to calibrate molecular clocks, allowing estimation of evolutionary rates. Methods for estimating rates from time-structured data vary in how they treat phylogenetic uncertainty and rate variation among lineages. We compiled 81 virus data sets and estimated nucleotide substitution rates using root-to-tip regression, least-squares dating and Bayesian inference. Although estimates from these three methods were often congruent, this largely relied on the choice of clock model. In particular, relaxed-clock models tended to produce higher rate estimates than methods that assume constant rates. Discrepancies in rate estimates were also associated with high among-lineage rate variation, and phylogenetic and temporal clustering. These results provide insights into the factors that affect the reliability of rate estimates from time-structured sequence data, emphasizing the importance of clock-model testing. sduchene@unimelb.edu.au or garzonsebastian@hotmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Monogenean anchor morphometry: systematic value, phylogenetic signal, and evolution
Soo, Oi Yoon Michelle; Tan, Wooi Boon; Lim, Lee Hong Susan
2016-01-01
Background. Anchors are one of the important attachment appendages for monogenean parasites. Common descent and evolutionary processes have left their mark on anchor morphometry, in the form of patterns of shape and size variation useful for systematic and evolutionary studies. When combined with morphological and molecular data, analysis of anchor morphometry can potentially answer a wide range of biological questions. Materials and Methods. We used data from anchor morphometry, body size and morphology of 13 Ligophorus (Monogenea: Ancyrocephalidae) species infecting two marine mugilid (Teleostei: Mugilidae) fish hosts: Moolgarda buchanani (Bleeker) and Liza subviridis (Valenciennes) from Malaysia. Anchor shape and size data (n = 530) were generated using methods of geometric morphometrics. We used 28S rRNA, 18S rRNA, and ITS1 sequence data to infer a maximum likelihood phylogeny. We discriminated species using principal component and cluster analysis of shape data. Adams’s Kmult was used to detect phylogenetic signal in anchor shape. Phylogeny-correlated size and shape changes were investigated using continuous character mapping and directional statistics, respectively. We assessed morphological constraints in anchor morphometry using phylogenetic regression of anchor shape against body size and anchor size. Anchor morphological integration was studied using partial least squares method. The association between copulatory organ morphology and anchor shape and size in phylomorphospace was used to test the Rohde-Hobbs hypothesis. We created monogeneaGM, a new R package that integrates analyses of monogenean anchor geometric morphometric data with morphological and phylogenetic data. Results. We discriminated 12 of the 13 Ligophorus species using anchor shape data. Significant phylogenetic signal was detected in anchor shape. Thus, we discovered new morphological characters based on anchor shaft shape, the length between the inner root point and the outer root
New weighting methods for phylogenetic tree reconstruction using multiple loci.
Misawa, Kazuharu; Tajima, Fumio
2012-08-01
Efficient determination of evolutionary distances is important for the correct reconstruction of phylogenetic trees. The performance of the pooled distance required for reconstructing a phylogenetic tree can be improved by applying large weights to appropriate distances for reconstructing phylogenetic trees and small weights to inappropriate distances. We developed two weighting methods, the modified Tajima-Takezaki method and the modified least-squares method, for reconstructing phylogenetic trees from multiple loci. By computer simulations, we found that both of the new methods were more efficient in reconstructing correct topologies than the no-weight method. Hence, we reconstructed hominoid phylogenetic trees from mitochondrial DNA using our new methods, and found that the levels of bootstrap support were significantly increased by the modified Tajima-Takezaki and by the modified least-squares method.