WorldWideScience

Sample records for europe molecular phylogenetic

  1. Phylogenetic molecular function annotation

    International Nuclear Information System (INIS)

    Engelhardt, Barbara E; Jordan, Michael I; Repo, Susanna T; Brenner, Steven E

    2009-01-01

    It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic approach for predicting molecular function (sometimes called 'phylogenomics') is an effective means to predict protein molecular function. These methods incorporate functional evidence from all members of a family that have functional characterizations using the evolutionary history of the protein family to make robust predictions for the uncharacterized proteins. However, they are often difficult to apply on a genome-wide scale because of the time-consuming step of reconstructing the phylogenies of each protein to be annotated. Our automated approach for function annotation using phylogeny, the SIFTER (Statistical Inference of Function Through Evolutionary Relationships) methodology, uses a statistical graphical model to compute the probabilities of molecular functions for unannotated proteins. Our benchmark tests showed that SIFTER provides accurate functional predictions on various protein families, outperforming other available methods.

  2. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  3. Molecular Phylogenetics: Mathematical Framework and Unsolved Problems

    Science.gov (United States)

    Xia, Xuhua

    Phylogenetic relationship is essential in dating evolutionary events, reconstructing ancestral genes, predicting sites that are important to natural selection, and, ultimately, understanding genomic evolution. Three categories of phylogenetic methods are currently used: the distance-based, the maximum parsimony, and the maximum likelihood method. Here, I present the mathematical framework of these methods and their rationales, provide computational details for each of them, illustrate analytically and numerically the potential biases inherent in these methods, and outline computational challenges and unresolved problems. This is followed by a brief discussion of the Bayesian approach that has been recently used in molecular phylogenetics.

  4. Molecular characterization and phylogenetic relationships among ...

    African Journals Online (AJOL)

    Molecular characterization and phylogenetic relationships among and within species of Phalaenopsis (Epidendroideae: Orchidaceae) based on RAPD analysis. ... Ph. parishii, Ph. labbi nepal, Ph. speciosa, Ph. lobbi yellow, Ph. venosa, Ph. hieroglyphica, and Ph. maculata; the third group consisted of Ph. minho princess, ...

  5. A phylogenetic study of Boletus section Boletus in Europe

    NARCIS (Netherlands)

    Beugelsdijk, D.C.M.; Linde, van der S.; Zuccarello, G.C.; Bakker, den H.C.

    2008-01-01

    A phylogenetic study of the species in Boletus sect. Boletus was undertaken using the molecular markers ITS1-5.8S-ITS2 and Gap dh. Four well-supported lineages, one comprising Boletus edulis s.l., the others referring to B. aereus, B. reticulatus and B. pinophilus have been distinguished. The ML and

  6. Molecular phylogenetics of mastodon and Tyrannosaurus rex.

    Science.gov (United States)

    Organ, Chris L; Schweitzer, Mary H; Zheng, Wenxia; Freimark, Lisa M; Cantley, Lewis C; Asara, John M

    2008-04-25

    We report a molecular phylogeny for a nonavian dinosaur, extending our knowledge of trait evolution within nonavian dinosaurs into the macromolecular level of biological organization. Fragments of collagen alpha1(I) and alpha2(I) proteins extracted from fossil bones of Tyrannosaurus rex and Mammut americanum (mastodon) were analyzed with a variety of phylogenetic methods. Despite missing sequence data, the mastodon groups with elephant and the T. rex groups with birds, consistent with predictions based on genetic and morphological data for mastodon and on morphological data for T. rex. Our findings suggest that molecular data from long-extinct organisms may have the potential for resolving relationships at critical areas in the vertebrate evolutionary tree that have, so far, been phylogenetically intractable.

  7. A phylogenetic study of Boletus section Boletus in Europe.

    Science.gov (United States)

    Beugelsdijk, D C M; van der Linde, S; Zuccarello, G C; den Bakker, H C; Draisma, S G A; Noordeloos, M E

    2008-06-01

    A phylogenetic study of the species in Boletus sect. Boletus was undertaken using the molecular markers ITS1-5.8S-ITS2 and GAPDH. Four well-supported lineages, one comprising Boletus edulis s.l., the others referring to B. aereus, B. reticulatus and B. pinophilus have been distinguished. The ML and MP trees of ITS showed remarkably low resolution within the B. edulis clade, and confirmed earlier published results, despite the use of samples from a wider geographical area and different hosts. The results of GAPDH demonstrate clearly that this low resolution must be ascribed to a low genetic variability with the B. edulis clade, and make clear that morphological and ecological characters have been overestimated within this species complex. Boletus edulis is therefore defined as a variable species with a wide morphological, ecological and geographic range, and includes several specific and subspecific taxa described in the literature (e.g. B. betulicola, B. persoonii, B. quercicola and B. venturii). Three other European species (B. aereus, B. pinophilus and B. reticulatus) are well delimited species based on morphology and our genetic data.

  8. Molecular Epidemiology of Canine Parvovirus, Europe

    Science.gov (United States)

    Desario, Costantina; Addie, Diane D.; Martella, Vito; Vieira, Maria João; Elia, Gabriella; Zicola, Angelique; Davis, Christopher; Thompson, Gertrude; Thiry, Ethienne; Truyen, Uwe; Buonavoglia, Canio

    2007-01-01

    Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed that the new variant CPV-2c is widespread in Europe and that the viruses are distributed in different countries. PMID:17953097

  9. Molecular phylogenetics and historical biogeography of Rhinolophus bats.

    Science.gov (United States)

    Stoffberg, Samantha; Jacobs, David S; Mackie, Iain J; Matthee, Conrad A

    2010-01-01

    The phylogenetic relationships within the horseshoe bats (genus Rhinolophus) are poorly resolved, particularly at deeper levels within the tree. We present a better-resolved phylogenetic hypothesis for 30 rhinolophid species based on parsimony and Bayesian analyses of the mitochondrial cytochrome b gene and three nuclear introns (TG, THY and PRKC1). Strong support was found for the existence of two geographic clades within the monophyletic Rhinolophidae: an African group and an Oriental assemblage. The relaxed Bayesian clock method indicated that the two rhinolophid clades diverged approximately 35 million years ago and results from Dispersal Vicariance (DIVA) analysis suggest that the horseshoe bats arose in Asia and subsequently dispersed into Europe and Africa.

  10. TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics

    Directory of Open Access Journals (Sweden)

    von Haeseler Arndt

    2004-06-01

    Full Text Available Abstract Background Most analysis programs for inferring molecular phylogenies are difficult to use, in particular for researchers with little programming experience. Results TREEFINDER is an easy-to-use integrative platform-independent analysis environment for molecular phylogenetics. In this paper the main features of TREEFINDER (version of April 2004 are described. TREEFINDER is written in ANSI C and Java and implements powerful statistical approaches for inferring gene tree and related analyzes. In addition, it provides a user-friendly graphical interface and a phylogenetic programming language. Conclusions TREEFINDER is a versatile framework for analyzing phylogenetic data across different platforms that is suited both for exploratory as well as advanced studies.

  11. Molecular identification and phylogenetic study of Demodex caprae.

    Science.gov (United States)

    Zhao, Ya-E; Cheng, Juan; Hu, Li; Ma, Jun-Xian

    2014-10-01

    The DNA barcode has been widely used in species identification and phylogenetic analysis since 2003, but there have been no reports in Demodex. In this study, to obtain an appropriate DNA barcode for Demodex, molecular identification of Demodex caprae based on mitochondrial cox1 was conducted. Firstly, individual adults and eggs of D. caprae were obtained for genomic DNA (gDNA) extraction; Secondly, mitochondrial cox1 fragment was amplified, cloned, and sequenced; Thirdly, cox1 fragments of D. caprae were aligned with those of other Demodex retrieved from GenBank; Finally, the intra- and inter-specific divergences were computed and the phylogenetic trees were reconstructed to analyze phylogenetic relationship in Demodex. Results obtained from seven 429-bp fragments of D. caprae showed that sequence identities were above 99.1% among three adults and four eggs. The intraspecific divergences in D. caprae, Demodex folliculorum, Demodex brevis, and Demodex canis were 0.0-0.9, 0.5-0.9, 0.0-0.2, and 0.0-0.5%, respectively, while the interspecific divergences between D. caprae and D. folliculorum, D. canis, and D. brevis were 20.3-20.9, 21.8-23.0, and 25.0-25.3, respectively. The interspecific divergences were 10 times higher than intraspecific ones, indicating considerable barcoding gap. Furthermore, the phylogenetic trees showed that four Demodex species gathered separately, representing independent species; and Demodex folliculorum gathered with canine Demodex, D. caprae, and D. brevis in sequence. In conclusion, the selected 429-bp mitochondrial cox1 gene is an appropriate DNA barcode for molecular classification, identification, and phylogenetic analysis of Demodex. D. caprae is an independent species and D. folliculorum is closer to D. canis than to D. caprae or D. brevis.

  12. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    OpenAIRE

    Skaljac, Marisa; Kanakala, Surapathrudu; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad

    2017-01-01

    Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts dete...

  13. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards.

    Science.gov (United States)

    Erens, Jesse; Miralles, Aurélien; Glaw, Frank; Chatrou, Lars W; Vences, Miguel

    2017-02-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the subfamily Scincinae based on an extended molecular dataset comprising 8060bp from three mitochondrial and nine nuclear loci. Our analysis also increases taxon sampling of the genus Amphiglossus by including 16 out of 25 nominal species. Additionally, we examined whether the molecular phylogenetic patterns coincide with morphological differentiation in the species currently assigned to this genus. Various methods of inference recover a mostly strongly supported phylogeny with three main clades of Amphiglossus. However, relationships among these three clades and the limb-reduced genera Grandidierina, Voeltzkowia and Pygomeles remain uncertain. Supported by a variety of morphological differences (predominantly related to the degree of body elongation), but considering the remaining phylogenetic uncertainty, we propose a redefinition of Amphiglossus into three different genera (Amphiglossus sensu stricto, Flexiseps new genus, and Brachyseps new genus) to remove the non-monophyly of Amphiglossus sensu lato and to facilitate future studies on this fascinating group of lizards. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Molecular phylogenetics of porcini mushrooms (Boletus section Boletus).

    Science.gov (United States)

    Dentinger, Bryn T M; Ammirati, Joseph F; Both, Ernst E; Desjardin, Dennis E; Halling, Roy E; Henkel, Terry W; Moreau, Pierre-Arthur; Nagasawa, Eiji; Soytong, Kasem; Taylor, Andy F; Watling, Roy; Moncalvo, Jean-Marc; McLaughlin, David J

    2010-12-01

    Porcini (Boletus section Boletus: Boletaceae: Boletineae: Boletales) are a conspicuous group of wild, edible mushrooms characterized by fleshy fruiting bodies with a poroid hymenophore that is "stuffed" with white hyphae when young. Their reported distribution is with ectomycorrhizal plants throughout the Northern Hemisphere. Little progress has been made on the systematics of this group using modern molecular phylogenetic tools because sampling has been limited primarily to European species and the genes employed were insufficient to resolve the phylogeny. We examined the evolutionary history of porcini by using a global geographic sampling of most known species, new discoveries from little explored areas, and multiple genes. We used 78 sequences from the fast-evolving nuclear internal transcribed spacers and are able to recognize 18 reciprocally monophyletic species. To address whether or not porcini form a monophyletic group, we compiled a broadly sampled dataset of 41 taxa, including other members of the Boletineae, and used separate and combined phylogenetic analysis of sequences from the nuclear large subunit ribosomal DNA, the largest subunit of RNA polymerase II, and the mitochondrial ATPase subunit six gene. Contrary to previous studies, our separate and combined phylogenetic analyses support the monophyly of porcini. We also report the discovery of two taxa that expand the known distribution of porcini to Australia and Thailand and have ancient phylogenetic connections to the rest of the group. A relaxed molecular clock analysis with these new taxa dates the origin of porcini to between 42 and 54 million years ago, coinciding with the initial diversification of angiosperms, during the Eocene epoch when the climate was warm and humid. These results reveal an unexpected diversity, distribution, and ancient origin of a group of commercially valuable mushrooms that may provide an economic incentive for conservation and support the hypothesis of a tropical

  15. Molecular characterization and phylogenetic analysis of Fasciola hepatica from Peru.

    Science.gov (United States)

    Ichikawa-Seki, Madoka; Ortiz, Pedro; Cabrera, Maria; Hobán, Cristian; Itagaki, Tadashi

    2016-06-01

    The causative agent of fasciolosis in South America is thought to be Fasciola hepatica. In this study, Fasciola flukes from Peru were analyzed to investigate their genetic structure and phylogenetic relationships with those from other countries. Fasciola flukes were collected from the three definitive host species: cattle, sheep, and pigs. They were identified as F. hepatica because mature sperms were observed in their seminal vesicles, and also they displayed Fh type, which has an identical fragment pattern to F. hepatica in the nuclear internal transcribed spacer 1. Eight haplotypes were obtained from the mitochondrial NADH dehydrogenase subunit 1 (nad1) sequences of Peruvian F. hepatica; however, no special difference in genetic structure was observed between the three host species. Its extremely low genetic diversity suggests that the Peruvian population was introduced from other regions. Nad1 haplotypes identical to those of Peruvian F. hepatica were detected in China, Uruguay, Italy, Iran, and Australia. Our results indicate that F. hepatica rapidly expanded its range due to human migration. Future studies are required to elucidate dispersal route of F. hepatica from Europe, its probable origin, to other areas, including Peru. Copyright © 2015. Published by Elsevier Ireland Ltd.

  16. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    Science.gov (United States)

    Skaljac, Marisa; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad

    2017-01-01

    Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia), which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar) Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium) known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies. PMID:29053633

  17. Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

    Directory of Open Access Journals (Sweden)

    Marisa Skaljac

    2017-10-01

    Full Text Available Bemisia tabaci (Gennadius, Trialeurodes vaporariorum (Westwood, and Siphoninus phillyreae (Haliday are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia, which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies.

  18. Molecular Epidemiology of Bat Lyssaviruses in Europe

    NARCIS (Netherlands)

    McElhinney, L.M.; Marston, D.A.; Leech, S.; Freuling, C.; Poel, van der W.H.M.; Echevarria, J.; Vazquez-Moron, S.; Horton, D.L.; Müller, T.; Fooks, A.R.

    2013-01-01

    Bat rabies cases in Europe are principally attributed to two lyssaviruses, namely European bat lyssavirus type 1 (EBLV-1) and European bat lyssavirus type 2 (EBLV-2). Between 1977 and 2011, 961 cases of bat rabies were reported to Rabies Bulletin Europe, with the vast majority (>97%) being

  19. A molecular phylogenetic analysis of the Scarabaeinae (dung beetles).

    Science.gov (United States)

    Monaghan, Michael T; Inward, Daegan J G; Hunt, Toby; Vogler, Alfried P

    2007-11-01

    The dung beetles (Scarabaeinae) include ca. 5000 species and exhibit a diverse array of morphologies and behaviors. This variation presumably reflects the adaptation to a diversity of food types and the different strategies used to avoid competition for vertebrate dung, which is the primary breeding environment for most species. The current classification gives great weight to the major behavioral types, separating the ball rollers and the tunnelers, but existing phylogenetic studies have been based on limited taxonomic or biogeographic sampling and have been contradictory. Here, we present a molecular phylogenetic analysis of 214 species of Scarabaeinae, representing all 12 traditionally recognized tribes and six biogeographical regions, using partial gene sequences from one nuclear (28S) and two mitochondrial (cox1, rrnL) genes. Length variation in 28S (588-621 bp) and rrnL (514-523 bp) was subjected to a thorough evaluation of alternative alignments, gap-coding methods, and tree searches using model-based (Bayesian and likelihood), maximum parsimony, and direct optimization analyses. The small-bodied, non-dung-feeding Sarophorus+Coptorhina were basal in all reconstructions. These were closely related to rolling Odontoloma+Dicranocara, suggesting an early acquisition of rolling behavior. Smaller tribes and most genera were monophyletic, while Canthonini and Dichotomiini each consisted of multiple paraphyletic lineages at hierarchical levels equivalent to the smaller tribes. Plasticity of rolling and tunneling was evidenced by a lack of monophyly (S-H test, p > 0.05) and several reversals within clades. The majority of previously unrecognized clades were geographical, including the well-supported Neotropical Phanaeini+Eucraniini, and a large Australian clade of rollers as well as tunneling Coptodactyla and Demarziella. Only three lineages, Gymnopleurini, Copris+Microcopris and Onthophagus, were widespread and therefore appear to be dispersive at a global scale. A

  20. Molecular Phylogenetic: Organism Taxonomy Method Based on Evolution History

    Directory of Open Access Journals (Sweden)

    N.L.P Indi Dharmayanti

    2011-03-01

    Full Text Available Phylogenetic is described as taxonomy classification of an organism based on its evolution history namely its phylogeny and as a part of systematic science that has objective to determine phylogeny of organism according to its characteristic. Phylogenetic analysis from amino acid and protein usually became important area in sequence analysis. Phylogenetic analysis can be used to follow the rapid change of a species such as virus. The phylogenetic evolution tree is a two dimensional of a species graphic that shows relationship among organisms or particularly among their gene sequences. The sequence separation are referred as taxa (singular taxon that is defined as phylogenetically distinct units on the tree. The tree consists of outer branches or leaves that represents taxa and nodes and branch represent correlation among taxa. When the nucleotide sequence from two different organism are similar, they were inferred to be descended from common ancestor. There were three methods which were used in phylogenetic, namely (1 Maximum parsimony, (2 Distance, and (3 Maximum likehoood. Those methods generally are applied to construct the evolutionary tree or the best tree for determine sequence variation in group. Every method is usually used for different analysis and data.

  1. Applying phylogenetic analysis to viral livestock diseases: moving beyond molecular typing.

    Science.gov (United States)

    Olvera, Alex; Busquets, Núria; Cortey, Marti; de Deus, Nilsa; Ganges, Llilianne; Núñez, José Ignacio; Peralta, Bibiana; Toskano, Jennifer; Dolz, Roser

    2010-05-01

    Changes in livestock production systems in recent years have altered the presentation of many diseases resulting in the need for more sophisticated control measures. At the same time, new molecular assays have been developed to support the diagnosis of animal viral disease. Nucleotide sequences generated by these diagnostic techniques can be used in phylogenetic analysis to infer phenotypes by sequence homology and to perform molecular epidemiology studies. In this review, some key elements of phylogenetic analysis are highlighted, such as the selection of the appropriate neutral phylogenetic marker, the proper phylogenetic method and different techniques to test the reliability of the resulting tree. Examples are given of current and future applications of phylogenetic reconstructions in viral livestock diseases. Copyright 2009 Elsevier Ltd. All rights reserved.

  2. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards

    NARCIS (Netherlands)

    Erens, Jesse; Miralles, A.; Glaw, F.; Chatrou, L.W.; Vences, M.

    2017-01-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the

  3. Conformation of phylogenetic relationship of Penaeidae shrimp based on morphometric and molecular investigations.

    Science.gov (United States)

    Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R

    2014-01-01

    Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.

  4. Molecular Phylogenetics of the Serranid Subfamily Epinephelinae: Speciation and Biogeography in a Nearshore Marine Fish Clade

    OpenAIRE

    Craig, Matthew T,

    2005-01-01

    The processes that shape present day distributions of marine organisms have remained a central topic in evolutionary biology, conservation biology, and ecology. In this thesis, genetic data from mitochondrial and nuclear genes were used to create a phylogenetic hypothesis for the groupers of the subfamily Epinephelinae as a means of evaluating the current taxonomy of the group and the geography of speciation in marine organisms. The molecular phylogenetic hypothesis presented in Chap...

  5. Molecular evidence for deep phylogenetic divergence in Mandrillus sphinx.

    Science.gov (United States)

    Telfer, P T; Souquière, S; Clifford, S L; Abernethy, K A; Bruford, M W; Disotell, T R; Sterner, K N; Roques, P; Marx, P A; Wickings, E J

    2003-07-01

    Mandrills (Mandrillus sphinx) are forest primates indigenous to western central Africa. Phylogenetic analysis of 267 base pairs (bp) of the cytochrome b gene from 53 mandrills of known and 17 of unknown provenance revealed two phylogeographical groups, with haplotypes differentiated by 2.6% comprising seven synonymous transitions. The distribution of the haplotypes suggests that the Ogooué River, Gabon, which bisects their range, separates mandrill populations in Cameroon and northern Gabon from those in southern Gabon. The haplotype distribution is also concordant with that of two known mandrill simian immunodeficiency viruses, suggesting that these two mandrill phylogroups have followed different evolutionary trajectories since separation.

  6. Molecular phylogenetic analysis of Fasciola flukes from eastern India.

    Science.gov (United States)

    Hayashi, Kei; Ichikawa-Seki, Madoka; Mohanta, Uday Kumar; Singh, T Shantikumar; Shoriki, Takuya; Sugiyama, Hiromu; Itagaki, Tadashi

    2015-10-01

    Fasciola flukes from eastern India were characterized on the basis of spermatogenesis status and nuclear ITS1. Both Fasciola gigantica and aspermic Fasciola flukes were detected in Imphal, Kohima, and Gantoku districts. The sequences of mitochondrial nad1 were analyzed to infer their phylogenetical relationship with neighboring countries. The haplotypes of aspermic Fasciola flukes were identical or showed a single nucleotide substitution compared to those from populations in the neighboring countries, corroborating the previous reports that categorized them in the same lineage. However, the prevalence of aspermic Fasciola flukes in eastern India was lower than those in the neighboring countries, suggesting that they have not dispersed throughout eastern India. In contrast, F. gigantica was predominant and well diversified, and the species was thought to be distributed in the area for a longer time than the aspermic Fasciola flukes. Fasciola gigantica populations from eastern India were categorized into two distinct haplogroups A and B. The level of their genetic diversity suggests that populations belonging to haplogroup A have dispersed from the west side of the Indian subcontinent to eastern India with the artificial movement of domestic cattle, Bos indicus, whereas populations belonging to haplogroup B might have spread from Myanmar to eastern India with domestic buffaloes, Bubalus bubalis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Molecular phylogenetic implications in Brassica napus based on ...

    Indian Academy of Sciences (India)

    Brassica napus L. (canola, rapeseed) is one of the most important oil crops in many countries (Abdelmigid 2012;. Fayyaz et al. 2014), and thought to have originated from a cross where the maternal donor was closely related to two diploid species, B. oleracea (CC, 2n = 18) and B. rapa (AA, 2n = 20). Here, molecular ...

  8. Molecular phylogenetic identification of Fasciola flukes in Nepal.

    Science.gov (United States)

    Shoriki, Takuya; Ichikawa-Seki, Madoka; Devkota, Bhuminand; Rana, Hari B; Devkota, Shiva P; Humagain, Sudeep K; Itagaki, Tadashi

    2014-12-01

    Eighty-one Fasciola flukes collected from 8 districts in Nepal were analyzed for their species identification on the basis of their spermatogenic status and nuclear ribosomal internal transcribed spacer 1 (ITS1) and for their phylogenetic relation with Fasciola flukes from other Asian countries on the basis of the mitochondrial NADH dehydrogenase subunit 1 (nad1) gene. Sixty-one flukes (75.3%) were aspermic Fasciola sp., and 20 flukes (24.7%) were identified as Fasciola gigantica. All of the aspermic flukes displayed the Fh/Fg type in ITS1, which was predominant in aspermic Fasciola sp. from China, and most (60 flukes) displayed the Fsp-ND1-N1 haplotype in the nad1, which had an identical nucleotide sequence to the major haplotype (Fg-C2) of the aspermic flukes from China. These results suggest that aspermic Fasciola sp. was introduced into Nepal from China. Furthermore, the results of the diversity indices, neutrality indices, and median-joining network analysis with reference haplotypes from Asian countries suggest that aspermic Fasciola sp. rapidly expanded its distribution. In contrasts, F. gigantica displayed 10 nad1 haplotypes, which showed higher population diversity indices than the haplotypes of aspermic flukes, indicating that the F. gigantica population was clearly distributed in Nepal earlier than the aspermic Fasciola population. Although the F. gigantica haplotypes from Nepal formed a star-like phylogeny consisting of a main founder haplotype (Fg-ND1-N1), together with some F. gigantica haplotypes from Myanmar and Thailand, the Nepal population differed genetically from F. gigantica populations of neighboring countries as each country had distinct founder haplotype(s). Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Across Siberia and over Europe: Phylogenetic relationship of the freshwater fish genus Rhodeus in Europe and the phylogenetic position of R. sericeus from the River Amur.

    Czech Academy of Sciences Publication Activity Database

    Bohlen, Jörg; Šlechtová, Vendula; Bogutskaya, N. G.; Freyhof, J.

    2006-01-01

    Roč. 40, 3 (2006), s. 856-865 ISSN 1055-7903 R&D Projects: GA AV ČR IAA600450508; GA MŠk LC06073; GA MŽP SM/6/3/05 Institutional research plan: CEZ:AV0Z50450515 Keywords : Acheilognatinae * biogeography * freshwater fishes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.528, year: 2006

  10. Molecular characterization and phylogenetic analysis of Fasciola gigantica from Nigeria.

    Science.gov (United States)

    Ichikawa-Seki, Madoka; Tokashiki, Minami; Opara, Maxwell Nwachukwu; Iroh, Gabriel; Hayashi, Kei; Kumar, Uday Mohanta; Itagaki, Tadashi

    2017-02-01

    Fasciola gigantica is considered the major pathogen causing fasciolosis in Africa; however, molecular characterization of this fluke has not been adequately elucidated. It is important to scientifically elucidate the dispersal history of F. gigantica by analyzing its genetic diversity. Fasciola flukes from Nigeria were analyzed using nuclear and mitochondrial DNA markers. A total of 172 Fasciola flukes collected from cattle were identified as F. gigantica because they displayed the F. gigantica fragment pattern in multiplex PCR for the nuclear marker, phosphoenolpyruvate carboxykinase (pepck). In total, 70 haplotypes were detected from Nigerian F. gigantica on the basis of the concatenated sequence of mitochondrial NADH dehydrogenase subunit 1 (nad1) and cytochrome c oxidase 1 (cox1). The index of neutrality (Fu's Fs) suggests rapid expansion of the Nigerian F. gigantica population. Although four haplogroups, Nigeria 1A, 1B, 2A, and 2B, were detected from Nigerian F. gigantica, a climate-specific genetic structure was not observed among F. gigantica populations from three agro-climatic regions (Sahel, Savannah, and Forest). This is probably because of the frequent transportation of livestock from one part of the country to the other. Nigeria 1A and 1B had close relationships with the Egyptian population of F. gigantica, whereas Nigeria 2A and 2B were comparatively related to the Zambian population. No haplotype was shared among the three countries, and it therefore is difficult to estimate the dispersal route of F. gigantica within the African continent. Copyright © 2016. Published by Elsevier Ireland Ltd.

  11. New data on Amynodontidae (Mammalia, Perissodactyla) from Eastern Europe: Phylogenetic and palaeobiogeographic implications around the Eocene-Oligocene transition.

    Science.gov (United States)

    Tissier, Jérémy; Becker, Damien; Codrea, Vlad; Costeur, Loïc; Fărcaş, Cristina; Solomon, Alexandru; Venczel, Marton; Maridet, Olivier

    2018-01-01

    Amynodontidae is a family of Rhinocerotoidea (Mammalia, Perissodactyla) known from the late Early Eocene to the latest Oligocene, in North America and Eurasia. European Amynodontidae are very rare, and all remains belong almost exclusively to a single post-Grande Coupure genus from the Oligocene, Cadurcotherium. The "Grande Coupure" defines an extinctions and dispersal-generated originations event in Europe that is nearly contemporaneous with the Eocene-Oligocene transition. Perissodactyls are one of the major groups affected by this event: Palaeotheriidae went almost extinct during this crisis, whereas Rhinocerotidae appeared for the first time in Europe. Study of fossiliferous Eastern-European localities from this age is crucial for the understanding of this crisis. We report here three new localities of Amynodontidae in Eastern Europe. Two of them are dated from the Eocene (Morlaca, Romania; Dorog, Hungary), whereas the other is either Late Eocene or Early Oligocene (Dobârca, Romania). The skull from this latter locality belongs unexpectedly to the same individual as a previously described mandible attributed to "Cadurcodon" zimborensis. As a result, this specimen can be allocated to its proper locality, Dobârca, and is assigned to a new genus, Sellamynodon gen. nov. It is characterised by an extraordinary growth of the nuchal crest, a unique character among amynodontids. Along with this remarkable material from Dobârca, two specimens from another Romanian locality, Morlaca, have been recently discovered and are dated from the Late Eocene. They belong, as well as new material from Dorog (Middle Eocene, Hungary), to the genus Amynodontopsis, also found in North America. The new Hungarian material represents the earliest occurrence of Amynodontidae in Europe. New phylogenetic hypotheses of Rhinocerotoidea are proposed, including the new material presented here, and show that Amynodontidae may be closer to the polyphyletic family 'Hyracodontidae' than to

  12. Evolution of species diversity in the genus Chamaecostus (Costaceae): molecular phylogenetics and morphometric approaches

    OpenAIRE

    Andre, Thiago; Specht, Chelsea; Salzman, Shayla; Palma-Silva, Clarisse [UNESP; Wendt, Tania

    2015-01-01

    While most species within the genus Chamaecostus (Costaceae) are well defined, the broad geographic range and long list of synonyms associated with Chamaecostus subsessilis led us to believe there may be some cryptic species within the complex. We thus investigate the phylogenetic relationships of species in the Chamaecostus lineage and specifically test the monophyly and diversity of the Chamaecostus subsessilis species complex from a population perspective by analyzing molecular sequence da...

  13. An evaluation of phylogenetic informativeness profiles and the molecular phylogeny of diplazontinae (Hymenoptera, Ichneumonidae).

    Science.gov (United States)

    Klopfstein, Seraina; Kropf, Christian; Quicke, Donald L J

    2010-03-01

    How to quantify the phylogenetic information content of a data set is a longstanding question in phylogenetics, influencing both the assessment of data quality in completed studies and the planning of future phylogenetic projects. Recently, a method has been developed that profiles the phylogenetic informativeness (PI) of a data set through time by linking its site-specific rates of change to its power to resolve relationships at different timescales. Here, we evaluate the performance of this method in the case of 2 standard genetic markers for phylogenetic reconstruction, 28S ribosomal RNA and cytochrome oxidase subunit 1 (CO1) mitochondrial DNA, with maximum parsimony, maximum likelihood, and Bayesian analyses of relationships within a group of parasitoid wasps (Hymenoptera: Ichneumonidae, Diplazontinae). Retrieving PI profiles of the 2 genes from our own and from 3 additional data sets, we find that the method repeatedly overestimates the performance of the more quickly evolving CO1 compared with 28S. We explore possible reasons for this bias, including phylogenetic uncertainty, violation of the molecular clock assumption, model misspecification, and nonstationary nucleotide composition. As none of these provides a sufficient explanation of the observed discrepancy, we use simulated data sets, based on an idealized setting, to show that the optimum evolutionary rate decreases with increasing number of taxa. We suggest that this relationship could explain why the formula derived from the 4-taxon case overrates the performance of higher versus lower rates of evolution in our case and that caution should be taken when the method is applied to data sets including more than 4 taxa.

  14. Molecular phylogenetic study at the generic boundary between the lichen-forming fungi Caloplaca and Xanthoria (Ascomycota, Teloschistaceae)

    DEFF Research Database (Denmark)

    Søchting, Ulrik; Lutzoni, François

    2003-01-01

    A molecular phylogenetic analysis of rDNA was performed for seven Caloplaca, seven Xanthoria, one Fulgensia and five outgroup species. Phylogenetic hypotheses are constructed based on nuclear small and large subunit rDNA, separately and in combination. Three strongly supported major monophyletic ...

  15. Molecular epidemiology of HIV-1 infection in Europe: An overview.

    Science.gov (United States)

    Beloukas, Apostolos; Psarris, Alexandros; Giannelou, Polina; Kostaki, Evangelia; Hatzakis, Angelos; Paraskevis, Dimitrios

    2016-12-01

    Human Immunodeficiency Virus type 1 (HIV-1) is characterised by vast genetic diversity. Globally circulating HIV-1 viruses are classified into distinct phylogenetic strains (subtypes, sub-subtypes) and several recombinant forms. Here we describe the characteristics and evolution of European HIV-1 epidemic over time through a review of published literature and updated queries of existing HIV-1 sequence databases. HIV-1 in Western and Central Europe was introduced in the early-1980s in the form of subtype B, which is still the predominant clade. However, in Eastern Europe (Former Soviet Union (FSU) countries and Russia) the predominant strain, introduced into Ukraine in the mid-1990s, is subtype A (A FSU ) with transmission mostly occurring in People Who Inject Drugs (PWID). In recent years, the epidemic is evolving towards a complex tapestry with an increase in the prevalence of non-B subtypes and recombinants in Western and Central Europe. Non-B epidemics are mainly associated with immigrants, heterosexuals and females but more recently, non-B clades have also spread amongst groups where non-B strains were previously absent - non-immigrant European populations and amongst men having sex with men (MSM). In some countries, non-B clades have spread amongst the native population, for example subtype G in Portugal and subtype A in Greece, Albania and Cyprus. Romania provides a unique case where sub-subtype F1 has predominated throughout the epidemic. In contrast, HIV-1 epidemic in FSU countries remains more homogeneous with A FSU clade predominating in all countries. The differences between the evolution of the Western epidemic and the Eastern epidemic may be attributable to differences in transmission risk behaviours, lifestyle and the patterns of human mobility. The study of HIV-1 epidemic diversity provides a useful tool by which we can understand the history of the pandemic in addition to allowing us to monitor the spread and growth of the epidemic over time

  16. Molecular and phylogenetic analysis of HIV-1 variants circulating in Italy

    Directory of Open Access Journals (Sweden)

    Sbreglia Costanza

    2008-10-01

    Full Text Available Abstract Objective The continuous identification of HIV-1 non-B subtypes and recombinant forms in Italy indicates the need of constant molecular epidemiology survey of genetic forms circulating and transmitted in the resident population. Methods The distribution of HIV-1 subtypes has been evaluated in 25 seropositive individuals residing in Italy, most of whom were infected through a sexual route during the 1995–2005 period. Each sample has been characterized by detailed molecular and phylogenetic analyses. Results 18 of the 25 samples were positive at HIV-1 PCR amplification. Three samples showed a nucleotide divergence compatible with a non-B subtype classification. The phylogenetic analysis, performed on both HIV-1 env and gag regions, confirms the molecular sub-typing prediction, given that 1 sample falls into the C subtype and 2 into the G subtype. The B subtype isolates show high levels of intra-subtype nucleotide divergence, compatible with a long-lasting epidemic and a progressive HIV-1 molecular diversification. Conclusion The Italian HIV-1 epidemic is still mostly attributable to the B subtype, regardless the transmission route, which shows an increasing nucleotide heterogeneity. Heterosexual transmission and the interracial blending, however, are slowly introducing novel HIV-1 subtypes. Therefore, a molecular monitoring is needed to follow the constant evolution of the HIV-1 epidemic.

  17. Molecular phylogenetic reconstruction of the endemic Asian salamander family Hynobiidae (Amphibia, Caudata).

    Science.gov (United States)

    Weisrock, David W; Macey, J Robert; Matsui, Masafumi; Mulcahy, Daniel G; Papenfuss, Theodore J

    2013-01-01

    The salamander family Hynobiidae contains over 50 species and has been the subject of a number of molecular phylogenetic investigations aimed at reconstructing branches across the entire family. In general, studies using the greatest amount of sequence data have used reduced taxon sampling, while the study with the greatest taxon sampling has used a limited sequence data set. Here, we provide insights into the phylogenetic history of the Hynobiidae using both dense taxon sampling and a large mitochondrial DNA sequence data set. We report exclusive new mitochondrial DNA data of 2566 aligned bases (with 151 excluded sites, of included sites 1157 are variable with 957 parsimony informative). This is sampled from two genic regions encoding a 12S-16S region (the 3' end of 12S rRNA, tRNA(VAI), and the 5' end of 16S rRNA), and a ND2-COI region (ND2, tRNA(Trp), tRNA(Ala), tRNA(Asn), the origin for light strand replication--O(L), tRNA(Cys), tRNAT(Tyr), and the 5' end of COI). Analyses using parsimony, Bayesian, and maximum likelihood optimality criteria produce similar phylogenetic trees, with discordant branches generally receiving low levels of branch support. Monophyly of the Hynobiidae is strongly supported across all analyses, as is the sister relationship and deep divergence between the genus Onychodactylus with all remaining hynobiids. Within this latter grouping our phylogenetic results identify six clades that are relatively divergent from one another, but for which there is minimal support for their phylogenetic placement. This includes the genus Batrachuperus, the genus Hynobius, the genus Pachyhynobius, the genus Salamandrella, a clade containing the genera Ranodon and Paradactylodon, and a clade containing the genera Liua and Pseudohynobius. This latter clade receives low bootstrap support in the parsimony analysis, but is consistent across all three analytical methods. Our results also clarify a number of well-supported relationships within the larger

  18. Integrative taxonomy of ciliates: Assessment of molecular phylogenetic content and morphological homology testing.

    Science.gov (United States)

    Vďačný, Peter

    2017-10-01

    The very diverse and comparatively complex morphology of ciliates has given rise to numerous taxonomic concepts. However, the information content of the utilized molecular markers has seldom been explored prior to phylogenetic analyses and taxonomic decisions. Likewise, robust testing of morphological homology statements and the apomorphic nature of diagnostic characters of ciliate taxa is rarely carried out. Four phylogenetic techniques that may help address these issues are reviewed. (1) Split spectrum analysis serves to determine the exact number and quality of nucleotide positions supporting individual nodes in phylogenetic trees and to discern long-branch artifacts that cause spurious phylogenies. (2) Network analysis can depict all possible evolutionary trajectories inferable from the dataset and locate and measure the conflict between them. (3) A priori likelihood mapping tests the suitability of data for reconstruction of a well resolved tree, visualizes the tree-likeness of quartets, and assesses the support of an internal branch of a given tree topology. (4) Reconstruction of ancestral morphologies can be applied for analyzing homology and apomorphy statements without circular reasoning. Since these phylogenetic tools are rarely used, their principles and interpretation are introduced and exemplified using various groups of ciliates. Finally, environmental sequencing data are discussed in this light. Copyright © 2017 The Author. Published by Elsevier GmbH.. All rights reserved.

  19. Phylogenetic Framework and Molecular Signatures for the Main Clades of the Phylum Actinobacteria

    Science.gov (United States)

    Gao, Beile

    2012-01-01

    Summary: The phylum Actinobacteria harbors many important human pathogens and also provides one of the richest sources of natural products, including numerous antibiotics and other compounds of biotechnological interest. Thus, a reliable phylogeny of this large phylum and the means to accurately identify its different constituent groups are of much interest. Detailed phylogenetic and comparative analyses of >150 actinobacterial genomes reported here form the basis for achieving these objectives. In phylogenetic trees based upon 35 conserved proteins, most of the main groups of Actinobacteria as well as a number of their superageneric clades are resolved. We also describe large numbers of molecular markers consisting of conserved signature indels in protein sequences and whole proteins that are specific for either all Actinobacteria or their different clades (viz., orders, families, genera, and subgenera) at various taxonomic levels. These signatures independently support the existence of different phylogenetic clades, and based upon them, it is now possible to delimit the phylum Actinobacteria (excluding Coriobacteriia) and most of its major groups in clear molecular terms. The species distribution patterns of these markers also provide important information regarding the interrelationships among different main orders of Actinobacteria. The identified molecular markers, in addition to enabling the development of a stable and reliable phylogenetic framework for this phylum, also provide novel and powerful means for the identification of different groups of Actinobacteria in diverse environments. Genetic and biochemical studies on these Actinobacteria-specific markers should lead to the discovery of novel biochemical and/or other properties that are unique to different groups of Actinobacteria. PMID:22390973

  20. phylo-node: A molecular phylogenetic toolkit using Node.js.

    Science.gov (United States)

    O'Halloran, Damien M

    2017-01-01

    Node.js is an open-source and cross-platform environment that provides a JavaScript codebase for back-end server-side applications. JavaScript has been used to develop very fast and user-friendly front-end tools for bioinformatic and phylogenetic analyses. However, no such toolkits are available using Node.js to conduct comprehensive molecular phylogenetic analysis. To address this problem, I have developed, phylo-node, which was developed using Node.js and provides a stable and scalable toolkit that allows the user to perform diverse molecular and phylogenetic tasks. phylo-node can execute the analysis and process the resulting outputs from a suite of software options that provides tools for read processing and genome alignment, sequence retrieval, multiple sequence alignment, primer design, evolutionary modeling, and phylogeny reconstruction. Furthermore, phylo-node enables the user to deploy server dependent applications, and also provides simple integration and interoperation with other Node modules and languages using Node inheritance patterns, and a customized piping module to support the production of diverse pipelines. phylo-node is open-source and freely available to all users without sign-up or login requirements. All source code and user guidelines are openly available at the GitHub repository: https://github.com/dohalloran/phylo-node.

  1. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  2. Delimiting invasive Myriophyllum aquaticum in Kashmir Himalaya using a molecular phylogenetic approach.

    Science.gov (United States)

    Shah, M A; Ali, M A; Al-Hemaid, F M; Reshi, Z A

    2014-09-12

    Myriophyllum aquaticum (Vell.) Verdc. (family Haloragaceae) is one of the most invasive and destructive South American aquatic plant species and is present in a wide range of geographic regions, including the Kashmir Himalaya. Confusion regarding the taxonomic delimitation of M. aquaticum in the Himalayan region impedes effective and targeted management. Hence, our goal was improve the identification of M. aquaticum for exclusive delimitation from other related species in the study region using a molecular phylogenetic approach. A maximum parsimony tree recovered from phylogenetic analyses of the internal transcribed spacer sequences of nuclear ribosomal DNA was used to authenticate the identification of M. aquaticum. The results of this study can be used for targeted management of this tropical invader into the temperate Kashmir Himalaya.

  3. PAL: an object-oriented programming library for molecular evolution and phylogenetics.

    Science.gov (United States)

    Drummond, A; Strimmer, K

    2001-07-01

    Phylogenetic Analysis Library (PAL) is a collection of Java classes for use in molecular evolution and phylogenetics. PAL provides a modular environment for the rapid construction of both special-purpose and general analysis programs. PAL version 1.1 consists of 145 public classes or interfaces in 13 packages, including classes for models of character evolution, maximum-likelihood estimation, and the coalescent, with a total of more than 27000 lines of code. The PAL project is set up as a collaborative project to facilitate contributions from other researchers. AVAILIABILTY: The program is free and is available at http://www.pal-project.org. It requires Java 1.1 or later. PAL is licensed under the GNU General Public License.

  4. Molecular evolution of Adh and LEAFY and the phylogenetic utility of their introns in Pyrus (Rosaceae).

    Science.gov (United States)

    Zheng, Xiaoyan; Hu, Chunyun; Spooner, David; Liu, Jing; Cao, Jiashu; Teng, Yuanwen

    2011-09-14

    The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae) of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS) revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG) are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh) were selected to investigate their molecular evolution and phylogenetic utility. DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Our study represents the first phylogenetic analyses based on LCNGs in Pyrus. Ancient and recent duplications lead

  5. Molecular evolution of Adh and LEAFY and the phylogenetic utility of their introns in Pyrus (Rosaceae

    Directory of Open Access Journals (Sweden)

    Cao Jiashu

    2011-09-01

    Full Text Available Abstract Background The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh were selected to investigate their molecular evolution and phylogenetic utility. Results DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Conclusions Our study represents the first phylogenetic analyses based

  6. Exploring the Genomic Roadmap and Molecular Phylogenetics Associated with MODY Cascades Using Computational Biology.

    Science.gov (United States)

    Chakraborty, Chiranjib; Bandyopadhyay, Sanghamitra; Doss, C George Priya; Agoramoorthy, Govindasamy

    2015-04-01

    Maturity onset diabetes of the young (MODY) is a metabolic and genetic disorder. It is different from type 1 and type 2 diabetes with low occurrence level (1-2%) among all diabetes. This disorder is a consequence of β-cell dysfunction. Till date, 11 subtypes of MODY have been identified, and all of them can cause gene mutations. However, very little is known about the gene mapping, molecular phylogenetics, and co-expression among MODY genes and networking between cascades. This study has used latest servers and software such as VarioWatch, ClustalW, MUSCLE, G Blocks, Phylogeny.fr, iTOL, WebLogo, STRING, and KEGG PATHWAY to perform comprehensive analyses of gene mapping, multiple sequences alignment, molecular phylogenetics, protein-protein network design, co-expression analysis of MODY genes, and pathway development. The MODY genes are located in chromosomes-2, 7, 8, 9, 11, 12, 13, 17, and 20. Highly aligned block shows Pro, Gly, Leu, Arg, and Pro residues are highly aligned in the positions of 296, 386, 437, 455, 456 and 598, respectively. Alignment scores inform us that HNF1A and HNF1B proteins have shown high sequence similarity among MODY proteins. Protein-protein network design shows that HNF1A, HNF1B, HNF4A, NEUROD1, PDX1, PAX4, INS, and GCK are strongly connected, and the co-expression analyses between MODY genes also show distinct association between HNF1A and HNF4A genes. This study has used latest tools of bioinformatics to develop a rapid method to assess the evolutionary relationship, the network development, and the associations among eleven MODY genes and cascades. The prediction of sequence conservation, molecular phylogenetics, protein-protein network and the association between the MODY cascades enhances opportunities to get more insights into the less-known MODY disease.

  7. Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data.

    Science.gov (United States)

    Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina

    2014-02-01

    Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.

  8. Molecular cytogenetic characterisation and phylogenetic analysis of the seven cultivated Vigna species (Fabaceae).

    Science.gov (United States)

    She, C-W; Jiang, X-H; Ou, L-J; Liu, J; Long, K-L; Zhang, L-H; Duan, W-T; Zhao, W; Hu, J-C

    2015-01-01

    The genomic organisation of the seven cultivated Vigna species, V. unguiculata, V. subterranea, V. angularis, V. umbellata, V. radiata, V. mungo and V. aconitifolia, was determined using sequential combined PI and DAPI (CPD) staining and dual-colour fluorescence in situ hybridisation (FISH) with 5S and 45S rDNA probes. For phylogenetic analyses, comparative genomic in situ hybridisation (cGISH) onto somatic chromosomes and sequence analysis of the internal transcribed spacer (ITS) of 45S rDNA were used. Quantitative karyotypes were established using chromosome measurements, fluorochrome bands and rDNA FISH signals. All species had symmetrical karyotypes composed of only metacentric or metacentric and submetacentric chromosomes. Distinct heterochromatin differentiation was revealed by CPD staining and DAPI counterstaining after FISH. The rDNA sites among all species differed in their number, location and size. cGISH of V. umbellata genomic DNA to the chromosomes of all species produced strong signals in all centromeric regions of V. umbellata and V. angularis, weak signals in all pericentromeric regions of V. aconitifolia, and CPD-banded proximal regions of V. mungo var. mungo. Molecular phylogenetic trees showed that V. angularis and V. umbellata were the closest relatives, and V. mungo and V. aconitifolia were relatively closely related; these species formed a group that was separated from another group comprising V. radiata, V. unguiculata ssp. sesquipedalis and V. subterranea. This result was consistent with the phylogenetic relationships inferred from the heterochromatin and cGISH patterns; thus, fluorochrome banding and cGISH are efficient tools for the phylogenetic analysis of Vigna species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  9. Molecular biogeography of Europe: Pleistocene cycles and postglacial trends

    Directory of Open Access Journals (Sweden)

    Schmitt Thomas

    2007-04-01

    Full Text Available Abstract The climatic cycles with subsequent glacial and intergalcial periods have had a great impact on the distribution and evolution of species. Using genetic analytical tools considerably increased our understanding of these processes. In this review I therefore give an overview of the molecular biogeography of Europe. For means of simplification, I distinguish between three major biogeographical entities: (i "Mediterranean" with Mediterranean differentiation and dispersal centres, (ii "Continental" with extra-Mediterranean centres and (iii "Alpine" and/or "Arctic" with recent alpine and/or arctic distribution patterns. These different molecular biogeographical patterns are presented using actual examples. Many "Mediterranean" species are differentiated into three major European genetic lineages, which are due to glacial isolation in the three major Mediterranean peninsulas. Postglacial expansion in this group of species is mostly influenced by the barriers of the Pyrenees and the Alps with four resulting main patterns of postglacial range expansions. However, some cases are known with less than one genetic lineage per Mediterranean peninsula on the one hand, and others with a considerable genetic substructure within each of the Mediterranean peninsulas, Asia Minor and the Maghreb. These structures within the Mediterranean sub-centres are often rather strong and in several cases even predate the Pleistocene. For the "Continental" species, it could be shown that the formerly supposed postglacial spread from eastern Palearctic expansion centres is mostly not applicable. Quite the contrary, most of these species apparently had extra-Mediterranean centres of survival in Europe with special importance of the perialpine regions, the Carpathian Basin and parts of the Balkan Peninsula. In the group of "Alpine" and/or "Arctic" species, several molecular biogeographical patterns have been found, which support and improve the postulates based on

  10. Molecular phylogenetics, seed morphometrics, chromosome number evolution and systematics of European Elatine L. (Elatinaceae species

    Directory of Open Access Journals (Sweden)

    Gábor Sramkó

    2016-12-01

    Full Text Available The genus Elatine contains ca 25 species, all of which are small, herbaceous annuals distributed in ephemeral waters on both hemispheres. However, due to a high degree of morphological variability (as a consequence of their amphibious life-style, the taxonomy of this genus remains controversial. Thus, to fill this gap in knowledge, we present a detailed molecular phylogenetic study of this genus based on nuclear (rITS and plastid (accD-psaI, psbJ-petA, ycf6-psbM-trnD sequences using 27 samples from 13 species. On the basis of this phylogenetic analysis, we provide a solid phylogenetic background for the modern taxonomy of the European members of the genus. Traditionally accepted sections of this tree (i.e., Crypta and Elatinella were found to be monophyletic; only E. borchoni—found to be a basal member of the genus—has to be excluded from the latter lineage to achieve monophyly. A number of taxonomic conclusions can also be drawn: E. hexandra, a high-ploid species, is most likely a stabilised hybrid between the main sections; E. campylosperma merits full species status based on both molecular and morphological evidence; E. gussonei is a more widespread and genetically diverse species with two main lineages; and the presence of the Asian E. ambigua in the European flora is questionable. The main lineages recovered in this analysis are also supported by a number of synapomorphic morphological characters as well as uniform chromosome counts. Based on all the evidence presented here, two new subsections within Elatinella are described: subsection Hydropipera consisting of the temperate species of the section, and subsection Macropodae including the Mediterranean species of the section.

  11. Taxonomic revision and molecular phylogenetics of the Idarnes incertus species-group (Hymenoptera, Agaonidae, Sycophaginae

    Directory of Open Access Journals (Sweden)

    Fernando H.A. Farache

    2017-01-01

    Full Text Available Sycophaginae is a group of non-pollinating fig wasps considered closely related to the fig pollinators (Agaoninae, Tetrapusiinae, and Kradibiinae in the most recent phylogenetic analyses. They occur in all tropical regions and are associated with Ficus subgenera Urostigma and Sycomorus. There are six described genera of Sycophaginae, and two are native and confined to the Neotropics, namely Idarnes Walker, 1843 and Anidarnes Bouček, 1993. Genus Idarnes is divided into three morphologically distinct groups that were proven to be monophyletic by recent molecular phylogenetic analyses. In this paper we reviewed the Idarnes incertus species-group and provide detailed morphological descriptions and illustrations for the species belonging to this group. Three previously described species were redescribed: I. brasiliensis (Mayr, 1906 comb. nov., I. hansoni Bouček, 1993, and I. incertus (Ashmead, 1900. Seventeen new species are described by Farache and Rasplus: I. amacayacuensis sp. n., I. amazonicus sp. n., I. americanae sp. n., I. badiovertex sp. n., I. brevis sp. n., I. brunneus sp. n., I. comptoni sp. n., I. cremersiae sp. n., I. dimorphicus sp. n., I. flavicrus sp. n., I. flaviventris sp. n., I. gibberosus sp. n., I. gordhi sp. n., I. maximus sp. n., I. nigriventris sp. n., I. pseudoflavus sp. n. and I. ramirezi sp. n. We provided keys for the identification of the species as well as for recognising the different species-groups of Idarnes and a closely related genus (Sycophaga Westwood, 1840. Additionally, phylogenetic relationships among 13 species of the I. incertus species-group were inferred using four molecular markers and discussed in the light of Ficus taxonomy and host specificity.

  12. Discovery of Paragonimus westermani in Vietnam and its molecular phylogenetic status in P. westermani complex.

    Science.gov (United States)

    Doanh, Pham Ngoc; Shinohara, Akio; Horii, Yoichiro; Habe, Shigehisa; Nawa, Yukifumi

    2009-04-01

    Paragonimus westermani is the most well-known species among the genus Paragonimus. It is widely distributed in Asia with considerable genetic diversity to form P. westermani species complex. While P. westermani distributed in Japan, Korea, China, and Taiwan are genetically homogeneous to form the East Asia group, those found in other geographic areas are heterogeneous and would be divided into several groups. Recent discoveries of P. westermani in India and Sri Lanka highlighted new insights on molecular phylogenetic relationship of geographic isolates of this species complex. Since Vietnam is located at the east end of Southeast Asia, the intermediate position between South and East Asia, it is of interest to see whether P. westermani is distributed in this country. Here, we report that P. westermani metacercariae were found in mountainous crabs, Potamiscus sp., collected in Quangtri province in the central Vietnam. Adult worms were successfully obtained by experimental infection in cats. Molecular phylogenetic analyses revealed that P. westermani of Vietnamese isolates have high similarities with those of East Asia group.

  13. Molecular characterization and phylogenetic analysis of small ruminant lentiviruses isolated from Canadian sheep and goats

    Directory of Open Access Journals (Sweden)

    Bertoni Giuseppe

    2011-06-01

    Full Text Available Abstract Background Small Ruminant Lentiviruses (SRLV are widespread in Canadian sheep and goats and represent an important health issue in these animals. There is however no data about the genetic diversity of Caprine Arthritis Encephalitis Virus (CAEV or Maedi Visna Virus (MVV in this country. Findings We performed a molecular and phylogenetic analysis of sheep and goat lentiviruses from a small geographic area in Canada using long sequences from the gag region of 30 infected sheep and 36 infected goats originating from 14 different flocks. Pairwise DNA distance and phylogenetic analyses revealed that all SRLV sequences obtained from sheep clustered tightly with prototypical Maedi visna sequences from America. Similarly, all SRLV strains obtained from goats clustered tightly with prototypical US CAEV-Cork strain. Conclusions The data reported in this study suggests that Canadian and US SRLV strains share common origins. In addition, the molecular data failed to bring to light any evidence of past cross species transmission between sheep and goats, which is consistent with the type of farming practiced in this part of the country where single species flocks predominate and where opportunities of cross species transmissions are proportionately low.

  14. A phylogenetic Kalman filter for ancestral trait reconstruction using molecular data.

    Science.gov (United States)

    Lartillot, Nicolas

    2014-02-15

    Correlation between life history or ecological traits and genomic features such as nucleotide or amino acid composition can be used for reconstructing the evolutionary history of the traits of interest along phylogenies. Thus far, however, such ancestral reconstructions have been done using simple linear regression approaches that do not account for phylogenetic inertia. These reconstructions could instead be seen as a genuine comparative regression problem, such as formalized by classical generalized least-square comparative methods, in which the trait of interest and the molecular predictor are represented as correlated Brownian characters coevolving along the phylogeny. Here, a Bayesian sampler is introduced, representing an alternative and more efficient algorithmic solution to this comparative regression problem, compared with currently existing generalized least-square approaches. Technically, ancestral trait reconstruction based on a molecular predictor is shown to be formally equivalent to a phylogenetic Kalman filter problem, for which backward and forward recursions are developed and implemented in the context of a Markov chain Monte Carlo sampler. The comparative regression method results in more accurate reconstructions and a more faithful representation of uncertainty, compared with simple linear regression. Application to the reconstruction of the evolution of optimal growth temperature in Archaea, using GC composition in ribosomal RNA stems and amino acid composition of a sample of protein-coding genes, confirms previous findings, in particular, pointing to a hyperthermophilic ancestor for the kingdom. The program is freely available at www.phylobayes.org.

  15. Molecular evolution of ependymin and the phylogenetic resolution of early divergences among euteleost fishes.

    Science.gov (United States)

    Ortí, G; Meyer, A

    1996-04-01

    The rate and pattern of DNA evolution of ependymin, a single-copy gene coding for a highly expressed glycoprotein in the brain matrix of teleost fishes, is characterized and its phylogenetic utility for fish systematics is assessed. DNA sequences were determined from catfish, electric fish, and characiforms and compared with published ependymin sequences from cyprinids, salmon, pike, and herring. Among these groups, ependymin amino acid sequences were highly divergent (up to 60% sequence difference), but had surprisingly similar hydropathy profiles and invariant glycosylation sites, suggesting that functional properties of the proteins are conserved. Comparison of base composition at third codon positions and introns revealed AT-rich introns and GC-rich third codon positions, suggesting that the biased codon usage observed might not be due to mutational bias. Phylogenetic information content of third codon positions was surprisingly high and sufficient to recover the most basal nodes of the tree, in spite of the observation that pairwise distances (at third codon positions) were well above the presumed saturation level. This finding can be explained by the high proportion of phylogenetically informative nonsynonymous changes at third codon positions among these highly divergent proteins. Ependymin DNA sequences have established the first molecular evidence for the monophyly of a group containing salmonids and esociforms. In addition, ependymin suggests a sister group relationship of electric fish (Gymnotiformes) and Characiformes, constituting a significant departure from currently accepted classifications. However, relationships among characiform lineages were not completely resolved by ependymin sequences in spite of seemingly appropriate levels of variation among taxa and considerably low levels of homoplasy in the data (consistency index = 0.7). If the diversification of Characiformes took place in an "explosive" manner, over a relatively short period of time

  16. Molecular identification and phylogenetic analysis of Wuchereria bancrofti from human blood samples in Egypt.

    Science.gov (United States)

    Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A

    2017-03-01

    Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.

  17. Molecular phylogenetic and expression analysis of the complete WRKY transcription factor family in maize.

    Science.gov (United States)

    Wei, Kai-Fa; Chen, Juan; Chen, Yan-Feng; Wu, Ling-Juan; Xie, Dao-Xin

    2012-04-01

    The WRKY transcription factors function in plant growth and development, and response to the biotic and abiotic stresses. Although many studies have focused on the functional identification of the WRKY transcription factors, much less is known about molecular phylogenetic and global expression analysis of the complete WRKY family in maize. In this study, we identified 136 WRKY proteins coded by 119 genes in the B73 inbred line from the complete genome and named them in an orderly manner. Then, a comprehensive phylogenetic analysis of five species was performed to explore the origin and evolutionary patterns of these WRKY genes, and the result showed that gene duplication is the major driving force for the origin of new groups and subgroups and functional divergence during evolution. Chromosomal location analysis of maize WRKY genes indicated that 20 gene clusters are distributed unevenly in the genome. Microarray-based expression analysis has revealed that 131 WRKY transcripts encoded by 116 genes may participate in the regulation of maize growth and development. Among them, 102 transcripts are stably expressed with a coefficient of variation (CV) value of WRKY genes with the CV value of >15% are further analysed to discover new organ- or tissue-specific genes. In addition, microarray analyses of transcriptional responses to drought stress and fungal infection showed that maize WRKY proteins are involved in stress responses. All these results contribute to a deep probing into the roles of WRKY transcription factors in maize growth and development and stress tolerance.

  18. Molecular typing of canine parvovirus from Sulaimani, Iraq and phylogenetic analysis using partial VP2 gene

    Directory of Open Access Journals (Sweden)

    M.O.Baba Sheikh

    2017-09-01

    Full Text Available Canine parvovirus (CPV remains the most significant viral cause of haemorrhagic enteritis and bloody diarrhoea in puppies over the age of 12 weeks. The objective of the present study was to detect and genotype CPV-2 by polymerase chain reaction (PCR and to perform phylogenetic analysis using partial VP2 gene sequences. We analysed eight faecal samples of unvaccinated dogs with signs of vomiting and bloody diarrhoea during the period from December 2013 to May 2014 in different locations in Sulaimani, Kurdistan, Iraq. After PCR detection, we found that all viral sequences in our study were CPV-2b variants, which differed genetically by 0.8% to 3.6% from five commercially available vaccines. Alignment between eight nucleotides of field virus sequences showed 95% to 99.5% similarity. The phylogenetic analysis for the 8 field sequences formed two distinct clusters with two sequences belonging to strains from China and Thailand and the other six – with a strain from Egypt. Molecular characterisation and CPV typing are crucial in epidemiological studies for future prevention and control of the disease.

  19. Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.

    Science.gov (United States)

    Gaston, Jordan R; Roberts, Sally A; Humphreys, Tricia L

    2015-01-01

    Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU) that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA), serum resistance protein (dsrA), and a collagen adhesin (ncaA) contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.

  20. Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.

    Directory of Open Access Journals (Sweden)

    Jordan R Gaston

    Full Text Available Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA, serum resistance protein (dsrA, and a collagen adhesin (ncaA contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.

  1. A molecular phylogenetic appraisal of the acanthostomines Acanthostomum and Timoniella and their position within Cryptogonimidae (Trematoda: Opisthorchioidea).

    Science.gov (United States)

    Martínez-Aquino, Andrés; Vidal-Martínez, Victor M; Aguirre-Macedo, M Leopoldina

    2017-01-01

    The phylogenetic position of three taxa from two trematode genera, belonging to the subfamily Acanthostominae (Opisthorchioidea: Cryptogonimidae), were analysed using partial 28S ribosomal DNA (Domains 1-2) and internal transcribed spacers (ITS1-5.8S-ITS2). Bayesian inference and Maximum likelihood analyses of combined 28S rDNA and ITS1 + 5.8S + ITS2 sequences indicated the monophyly of the genus Acanthostomum ( A. cf. americanum and A. burminis ) and paraphyly of the Acanthostominae . These phylogenetic relationships were consistent in analyses of 28S alone and concatenated 28S + ITS1 + 5.8S + ITS2 sequences analyses. Based on molecular phylogenetic analyses, the subfamily Acanthostominae is therefore a paraphyletic taxon, in contrast with previous classifications based on morphological data. Phylogenetic patterns of host specificity inferred from adult stages of other cryptogonimid taxa are also well supported. However, analyses using additional genera and species are necessary to support the phylogenetic inferences from this study. Our molecular phylogenetic reconstruction linked two larval stages of A. cf. americanum cercariae and metacercariae. Here, we present the evolutionary and ecological implications of parasitic infections in freshwater and brackish environments.

  2. A molecular phylogenetic appraisal of the acanthostomines Acanthostomum and Timoniella and their position within Cryptogonimidae (Trematoda: Opisthorchioidea

    Directory of Open Access Journals (Sweden)

    Andrés Martínez-Aquino

    2017-12-01

    Full Text Available The phylogenetic position of three taxa from two trematode genera, belonging to the subfamily Acanthostominae (Opisthorchioidea: Cryptogonimidae, were analysed using partial 28S ribosomal DNA (Domains 1–2 and internal transcribed spacers (ITS1–5.8S–ITS2. Bayesian inference and Maximum likelihood analyses of combined 28S rDNA and ITS1 + 5.8S + ITS2 sequences indicated the monophyly of the genus Acanthostomum (A. cf. americanum and A. burminis and paraphyly of the Acanthostominae. These phylogenetic relationships were consistent in analyses of 28S alone and concatenated 28S + ITS1 + 5.8S + ITS2 sequences analyses. Based on molecular phylogenetic analyses, the subfamily Acanthostominae is therefore a paraphyletic taxon, in contrast with previous classifications based on morphological data. Phylogenetic patterns of host specificity inferred from adult stages of other cryptogonimid taxa are also well supported. However, analyses using additional genera and species are necessary to support the phylogenetic inferences from this study. Our molecular phylogenetic reconstruction linked two larval stages of A. cf. americanum cercariae and metacercariae. Here, we present the evolutionary and ecological implications of parasitic infections in freshwater and brackish environments.

  3. Morphological and Molecular Phylogenetic Data Reveal a New Species of Primula (Primulaceae from Hunan, China.

    Directory of Open Access Journals (Sweden)

    Yuan Xu

    Full Text Available A new species of Primulaceae, Primula undulifolia, is described from the hilly area of Hunan province in south-central China. Its morphology and distributional range suggest that it is allied to P. kwangtungensis, both adapted to subtropical climate, having contiguous distribution and similar habitat, growing on shady and moist cliffs. Petioles, scapes and pedicels of them are densely covered with rusty multicellular hairs, but the new species can be easily distinguished by its smaller flowers and narrowly oblong leaves with undulate margins. Molecular phylogenetic analysis based on four DNA markers (ITS, matK, trnL-F and rps16 confirmed the new species as an independent lineage and constitutes a main clade together with P. kwangtungensis, P. kweichouensis, P. wangii and P. hunanensis of Primula sect. Carolinella.

  4. Molecular and phylogenetic characterization of Cryptosporidium and Giardia from pigs and cattle in Denmark

    DEFF Research Database (Denmark)

    Langkjær, Rikke Breinhold; Vigre, Håkan; Enemark, Heidi L.

    2007-01-01

    The genetic diversity of Cryptosporidium spp. and Giardia duodenalis from dairy cattle and pigs in Denmark was determined in the present study. Faecal samples from 1237 pigs and 1150 cattle originating from 50 sow herds and 50 dairy herds, respectively, were analysed for the presence of the two...... parasites by immunofluorescence microscopy. A large proportion of the (oo)cyst containing samples were selected for molecular characterization. Sequencing and phylogenetic analysis of the 18S rDNA locus and/or the HSP70 gene of 183 pig and 154 cattle isolates of Cryptosporidium revealed the presence of C....... suis, pig genotype II, C. parvum (cattle genotype), C. bovis, Cryptosporidium deer-like genotype and a novel C. suis-like genotype. For both cattle and pigs, a host age-related change in distribution of species/genotypes was observed. The zoonotic C. parvum (cattle genotype) was most prevalent in young...

  5. Genetic characterization, molecular epidemiology, and phylogenetic relationships of insect-specific viruses in the taxon Negevirus.

    Science.gov (United States)

    Nunes, Marcio R T; Contreras-Gutierrez, María Angélica; Guzman, Hilda; Martins, Livia C; Barbirato, Mayla Feitoza; Savit, Chelsea; Balta, Victoria; Uribe, Sandra; Vivero, Rafael; Suaza, Juan David; Oliveira, Hamilton; Nunes Neto, Joaquin P; Carvalho, Valeria L; da Silva, Sandro Patroca; Cardoso, Jedson F; de Oliveira, Rodrigo Santo; da Silva Lemos, Poliana; Wood, Thomas G; Widen, Steven G; Vasconcelos, Pedro F C; Fish, Durland; Vasilakis, Nikos; Tesh, Robert B

    2017-04-01

    The recently described taxon Negevirus is comprised of a diverse group of insect-specific viruses isolated from mosquitoes and phlebotomine sandflies. In this study, a comprehensive genetic characterization, molecular, epidemiological and evolutionary analyses were conducted on nearly full-length sequences of 91 new negevirus isolates obtained in Brazil, Colombia, Peru, Panama, USA and Nepal. We demonstrated that these arthropod restricted viruses are clustered in two major phylogenetic groups with origins related to three plant virus genera (Cilevirus, Higrevirus and Blunevirus). Molecular analyses demonstrated that specific host correlations are not present with most negeviruses; instead, high genetic variability, wide host-range, and cross-species transmission were noted. The data presented here also revealed the existence of five novel insect-specific viruses falling into two arthropod-restrictive virus taxa, previously proposed as distinct genera, designated Nelorpivirus and Sandewavirus. Our results provide a better understanding of the molecular epidemiology, evolution, taxonomy and stability of this group of insect-restricted viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. The long and winding road of molecular data in phylogenetic analysis.

    Science.gov (United States)

    Suárez-Díaz, Edna

    2014-01-01

    The use of molecules and reactions as evidence, markers and/or traits for evolutionary processes has a history more than a century long. Molecules have been used in studies of intra-specific variation and studies of similarity among species that do not necessarily result in the analysis of phylogenetic relations. Promoters of the use of molecular data have sustained the need for quantification as the main argument to make use of them. Moreover, quantification has allowed intensive statistical analysis, as a condition and a product of increasing automation. All of these analyses are subject to the methodological anxiety characteristic of a community in search of objectivity (Suárez-Díaz and Anaya-Munoz, Stud Hist Philos Biol Biomed Sci 39:451–458, 2008). It is in this context that scientists compared and evaluated protein and nucleic acid sequence data with other types of molecular data – including immunological, electrophoretic and hybridization data. This paper argues that by looking at longterm historical processes, such as the use of molecular evidence in evolutionary biology, we gain valuable insights into the history of science. In that sense, it accompanies a growing concern among historians for big-pictures of science that incorporate the fruitful historical research on local cases of the last decades.

  7. Molecular phylogenetic analysis of Enterobius vermicularis and development of an 18S ribosomal DNA-targeted diagnostic PCR.

    Science.gov (United States)

    Zelck, Ulrike E; Bialek, Ralf; Weiss, Michael

    2011-04-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed.

  8. Molecular Phylogenetic Analysis of Enterobius vermicularis and Development of an 18S Ribosomal DNA-Targeted Diagnostic PCR▿

    Science.gov (United States)

    Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael

    2011-01-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085

  9. Molecular Phylogenetic Classification of Streptomycetes Isolated from the Rhizosphere of Tropical Legume (Paraserianthes falcataria (L. Nielsen

    Directory of Open Access Journals (Sweden)

    LANGKAH SEMBIRING

    2009-09-01

    Full Text Available Intrageneric diversity of 556 streptomycetes isolated from the rhizosphere of tropical legume was determined by using molecular taxonomic method based on 16S rDNA. A total of 46 isolates were taken to represent 37 colour groups of the isolates. 16S rDNA were amplified and subsequently sequenced and the sequences data were aligned with streptomycete sequences retrieved from the ribosomal data base project (RDP data. Phylogenetic trees were generated by using the PHYLIP software package and the matrix of nucleotide similarity and nucleotide difference were generated by using PHYDIT software. The results confirmed and extended the value of 16S rDNA sequencing in streptomycete systematic. The 16S rDNA sequence data showed that most of the tested colour group representatives formed new centers of taxonomic variation within the genus Streptomyces. The generic assignment of these organisms was underpinned by 16S rDNA sequence data which also suggested that most of the strains represented new centers of taxonomic variation. The taxonomic data indicate that diverse populations of streptomycetes are associated with the roots of tropical legume (P. falcataria. Therefore, the combination of selective isolation and molecular taxonomic procedures used in this study provide a powerful way of uncovering new centers of taxonomic variation within the genus Streptomyces.

  10. Molecular identification and phylogenetic analysis of Dipetalonema evansi (LEWIS, 1882) in camels (Camelus dromedarius) of Iran.

    Science.gov (United States)

    Sazmand, Alireza; Eigner, Barbara; Mirzaei, Mohammad; Hekmatimoghaddam, Seyedhossein; Harl, Josef; Duscher, Georg Gerhard; Fuehrer, Hans-Peter; Joachim, Anja

    2016-04-01

    Despite the economic importance of camels, the parasites that affect them have not received adequate attention so far and molecular studies are scarce compared to other livestock. In this study, we characterized peripheral blood microfilariae in 200 healthy one-humped camels (Camelus dromedarius) from south-east Iran by microscopy and molecular tools to receive a more detailed insight into prevalence and species that affect them. Moreover, adult specimens of the filarial nematode Dipetalonema evansi were collected from the carcass of an infected animal. Microscopic examination was performed on Giemsa-stained blood smears, and blood was also spotted on Whatman FTA(®) cards for DNA analysis. Genomic DNA was extracted, and PCR was carried out for the detection of filaroid helminths, followed by sequence analysis of positive samples. Four samples were positive for microfilariae by microscopy, while 16 animals (8 %) were positive by PCR. Sequence analysis revealed D. evansi in all cases. Phylogenetic analysis of a cytochrome C oxidase subunit I (COI) sequence of filaroid nematodes showed that most species in a single genus cluster in the same clade; however, D. evansi and D. gracile are not monophyletic and branch rather at the base of the tree. Further studies on the life cycle of D. evansi, specifically the identification of intermediate host(s), have become feasible with the provision of the first specific COI sequences in this study.

  11. Beyond barcoding: a mitochondrial genomics approach to molecular phylogenetics and diagnostics of blowflies (Diptera: Calliphoridae).

    Science.gov (United States)

    Nelson, Leigh A; Lambkin, Christine L; Batterham, Philip; Wallman, James F; Dowton, Mark; Whiting, Michael F; Yeates, David K; Cameron, Stephen L

    2012-12-15

    Members of the Calliphoridae (blowflies) are significant for medical and veterinary management, due to the ability of some species to consume living flesh as larvae, and for forensic investigations due to the ability of others to develop in corpses. Due to the difficulty of accurately identifying larval blowflies to species there is a need for DNA-based diagnostics for this family, however the widely used DNA-barcoding marker, cox1, has been shown to fail for several groups within this family. Additionally, many phylogenetic relationships within the Calliphoridae are still unresolved, particularly deeper level relationships. Sequencing whole mt genomes has been demonstrated both as an effective method for identifying the most informative diagnostic markers and for resolving phylogenetic relationships. Twenty-seven complete, or nearly so, mt genomes were sequenced representing 13 species, seven genera and four calliphorid subfamilies and a member of the related family Tachinidae. PCR and sequencing primers developed for sequencing one calliphorid species could be reused to sequence related species within the same superfamily with success rates ranging from 61% to 100%, demonstrating the speed and efficiency with which an mt genome dataset can be assembled. Comparison of molecular divergences for each of the 13 protein-coding genes and 2 ribosomal RNA genes, at a range of taxonomic scales identified novel targets for developing as diagnostic markers which were 117-200% more variable than the markers which have been used previously in calliphorids. Phylogenetic analysis of whole mt genome sequences resulted in much stronger support for family and subfamily-level relationships. The Calliphoridae are polyphyletic, with the Polleninae more closely related to the Tachinidae, and the Sarcophagidae are the sister group of the remaining calliphorids. Within the Calliphoridae, there was strong support for the monophyly of the Chrysomyinae and Luciliinae and for the sister

  12. Molecular phylogenetic evaluation of classification and scenarios of character evolution in calcareous sponges (Porifera, Class Calcarea.

    Directory of Open Access Journals (Sweden)

    Oliver Voigt

    Full Text Available Calcareous sponges (Phylum Porifera, Class Calcarea are known to be taxonomically difficult. Previous molecular studies have revealed many discrepancies between classically recognized taxa and the observed relationships at the order, family and genus levels; these inconsistencies question underlying hypotheses regarding the evolution of certain morphological characters. Therefore, we extended the available taxa and character set by sequencing the complete small subunit (SSU rDNA and the almost complete large subunit (LSU rDNA of additional key species and complemented this dataset by substantially increasing the length of available LSU sequences. Phylogenetic analyses provided new hypotheses about the relationships of Calcarea and about the evolution of certain morphological characters. We tested our phylogeny against competing phylogenetic hypotheses presented by previous classification systems. Our data reject the current order-level classification by again finding non-monophyletic Leucosolenida, Clathrinida and Murrayonida. In the subclass Calcinea, we recovered a clade that includes all species with a cortex, which is largely consistent with the previously proposed order Leucettida. Other orders that had been rejected in the current system were not found, but could not be rejected in our tests either. We found several additional families and genera polyphyletic: the families Leucascidae and Leucaltidae and the genus Leucetta in Calcinea, and in Calcaronea the family Amphoriscidae and the genus Ute. Our phylogeny also provided support for the vaguely suspected close relationship of several members of Grantiidae with giantortical diactines to members of Heteropiidae. Similarly, our analyses revealed several unexpected affinities, such as a sister group relationship between Leucettusa (Leucaltidae and Leucettidae and between Leucascandra (Jenkinidae and Sycon carteri (Sycettidae. According to our results, the taxonomy of Calcarea is in

  13. Deceptive Desmas: Molecular Phylogenetics Suggests a New Classification and Uncovers Convergent Evolution of Lithistid Demosponges

    Science.gov (United States)

    Schuster, Astrid; Erpenbeck, Dirk; Pisera, Andrzej; Hooper, John; Bryce, Monika; Fromont, Jane; Wörheide, Gert

    2015-01-01

    Reconciling the fossil record with molecular phylogenies to enhance the understanding of animal evolution is a challenging task, especially for taxa with a mostly poor fossil record, such as sponges (Porifera). ‘Lithistida’, a polyphyletic group of recent and fossil sponges, are an exception as they provide the richest fossil record among demosponges. Lithistids, currently encompassing 13 families, 41 genera and >300 recent species, are defined by the common possession of peculiar siliceous spicules (desmas) that characteristically form rigid articulated skeletons. Their phylogenetic relationships are to a large extent unresolved and there has been no (taxonomically) comprehensive analysis to formally reallocate lithistid taxa to their closest relatives. This study, based on the most comprehensive molecular and morphological investigation of ‘lithistid’ demosponges to date, corroborates some previous weakly-supported hypotheses, and provides novel insights into the evolutionary relationships of the previous ‘order Lithistida’. Based on molecular data (partial mtDNA CO1 and 28S rDNA sequences), we show that 8 out of 13 ‘Lithistida’ families belong to the order Astrophorida, whereas Scleritodermidae and Siphonidiidae form a separate monophyletic clade within Tetractinellida. Most lithistid astrophorids are dispersed between different clades of the Astrophorida and we propose to formally reallocate them, respectively. Corallistidae, Theonellidae and Phymatellidae are monophyletic, whereas the families Pleromidae and Scleritodermidae are polyphyletic. Family Desmanthidae is polyphyletic and groups within Halichondriidae – we formally propose a reallocation. The sister group relationship of the family Vetulinidae to Spongillida is confirmed and we propose here for the first time to include Vetulina into a new Order Sphaerocladina. Megascleres and microscleres possibly evolved and/or were lost several times independently in different

  14. Deceptive desmas: molecular phylogenetics suggests a new classification and uncovers convergent evolution of lithistid demosponges.

    Directory of Open Access Journals (Sweden)

    Astrid Schuster

    Full Text Available Reconciling the fossil record with molecular phylogenies to enhance the understanding of animal evolution is a challenging task, especially for taxa with a mostly poor fossil record, such as sponges (Porifera. 'Lithistida', a polyphyletic group of recent and fossil sponges, are an exception as they provide the richest fossil record among demosponges. Lithistids, currently encompassing 13 families, 41 genera and >300 recent species, are defined by the common possession of peculiar siliceous spicules (desmas that characteristically form rigid articulated skeletons. Their phylogenetic relationships are to a large extent unresolved and there has been no (taxonomically comprehensive analysis to formally reallocate lithistid taxa to their closest relatives. This study, based on the most comprehensive molecular and morphological investigation of 'lithistid' demosponges to date, corroborates some previous weakly-supported hypotheses, and provides novel insights into the evolutionary relationships of the previous 'order Lithistida'. Based on molecular data (partial mtDNA CO1 and 28S rDNA sequences, we show that 8 out of 13 'Lithistida' families belong to the order Astrophorida, whereas Scleritodermidae and Siphonidiidae form a separate monophyletic clade within Tetractinellida. Most lithistid astrophorids are dispersed between different clades of the Astrophorida and we propose to formally reallocate them, respectively. Corallistidae, Theonellidae and Phymatellidae are monophyletic, whereas the families Pleromidae and Scleritodermidae are polyphyletic. Family Desmanthidae is polyphyletic and groups within Halichondriidae--we formally propose a reallocation. The sister group relationship of the family Vetulinidae to Spongillida is confirmed and we propose here for the first time to include Vetulina into a new Order Sphaerocladina. Megascleres and microscleres possibly evolved and/or were lost several times independently in different 'lithistid' taxa, and

  15. Molecular phylogenetics of the genus Costularia (Schoeneae, Cyperaceae) reveals multiple distinct evolutionary lineages.

    Science.gov (United States)

    Larridon, Isabel; Bauters, Kenneth; Semmouri, Ilias; Viljoen, Jan-Adriaan; Prychid, Christina J; Muasya, A Muthama; Bruhl, Jeremy J; Wilson, Karen L; Senterre, Bruno; Goetghebeur, Paul

    2018-04-19

    We investigated the monophyly of Costularia (25 species), a genus of tribe Schoeneae (Cyperaceae) that illustrates a remarkable distribution pattern from southeastern Africa, over Madagascar, the Mascarenes and Seychelles, to Malesia and New Caledonia. A further species, Tetraria borneensis, has been suggested to belong to Costularia. Relationships and divergence times were inferred using an existing four marker phylogeny of Cyperaceae tribe Schoeneae expanded with newly generated sequence data mainly for Costularia s.l. species. Phylogenetic reconstruction was executed using Bayesian inference and maximum likelihood approaches. Divergence times were estimated using a relaxed molecular clock model, calibrated with fossil data. Based on our results, Tetraria borneensis is not related to the species of Costularia. Costularia s.l. is composed of four distinct evolutionary lineages. Two lineages, one including the type species, are part of the Oreobolus clade, i.e. a much reduced genus Costularia restricted to southeastern Africa, Madagascar, the Mascarenes and Seychelles, and a small endemic genus from New Caledonia for which a new genus Chamaedendron is erected based on Costularia subgenus Chamaedendron. The other two lineages are part of the Tricostularia clade, i.e. a separate single-species lineage from the Seychelles for which a new genus (Xyroschoenus) is described, and Costularia subgenus Lophoschoenus. For the latter, more research is needed to test whether they are congeneric with the species placed in the reticulate-sheathed Tetraria clade. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Molecular Characterization and Comparative Phylogenetic Analysis of Phytases from Fungi with Their Prospective Applications

    Directory of Open Access Journals (Sweden)

    Sharad Tiwari

    2013-01-01

    Full Text Available Plant seeds that have high phytate content are used as animal feed. Phytases, enzymes that catalyze the breakdown of phytate into inorganic phosphorus and myoinositol phosphate derivatives, have been intensively studied in recent years and gained immense attention because of their application in reducing phytate content in animal feed and food for human consumption, thus indirectly lowering environmental pollution caused by undigested phytate. This review is focused on summarising the current knowledge on recent developments of fungal and yeast phytases. Comparative account on diverse sources and physiological roles, molecular characteristics and regulation mechanisms of phytases are discussed. Phylogenetic relationship of phytases from different classes of fungi is studied in details. It is inferred on the basis of phylogeny that phytases from Ascomycetes and Basidiomycetes differ in the amino acid sequences, therefore they fall in separate clade in the tree. The prospective biotechnological applications of microbial phytases such as animal feed additives, probiotics, pharmaceuticals, as well as in aquaculture, food industry, paper manufacturing, development of transgenic plants and animals with special reference to its use as biofertilizers are also emphasised in this review.

  17. Complete Chloroplast Genomes of Papaver rhoeas and Papaver orientale: Molecular Structures, Comparative Analysis, and Phylogenetic Analysis

    Directory of Open Access Journals (Sweden)

    Jianguo Zhou

    2018-02-01

    Full Text Available Papaver rhoeas L. and P. orientale L., which belong to the family Papaveraceae, are used as ornamental and medicinal plants. The chloroplast genome has been used for molecular markers, evolutionary biology, and barcoding identification. In this study, the complete chloroplast genome sequences of P. rhoeas and P. orientale are reported. Results show that the complete chloroplast genomes of P. rhoeas and P. orientale have typical quadripartite structures, which are comprised of circular 152,905 and 152,799-bp-long molecules, respectively. A total of 130 genes were identified in each genome, including 85 protein-coding genes, 37 tRNA genes, and 8 rRNA genes. Sequence divergence analysis of four species from Papaveraceae indicated that the most divergent regions are found in the non-coding spacers with minimal differences among three Papaver species. These differences include the ycf1 gene and intergenic regions, such as rpoB-trnC, trnD-trnT, petA-psbJ, psbE-petL, and ccsA-ndhD. These regions are hypervariable regions, which can be used as specific DNA barcodes. This finding suggested that the chloroplast genome could be used as a powerful tool to resolve the phylogenetic positions and relationships of Papaveraceae. These results offer valuable information for future research in the identification of Papaver species and will benefit further investigations of these species.

  18. A new miniature characid (Ostariophysi: Characiformes: Characidae, with phylogenetic position inferred from morphological and molecular data.

    Directory of Open Access Journals (Sweden)

    André Luiz Netto-Ferreira

    Full Text Available Erythrocharax altipinnis is described from the Serra do Cachimbo, Pará, Brazil. The new taxon is distinguished from all of the Characidae genera by having the pelvic bones firmly attached through the isquiatic processes; a nearly triangular hiatus in the musculature covering the anterior chamber of the swim bladder between the first and second pleural ribs (pseudotympanum; the pedunculate, notably expanded and distally compressed teeth in both jaws; circumorbital series represented by antorbital and four infraorbital bones with laterosensory canals not enclosed; a single tooth row in the premaxillary with the teeth perfectly aligned and similar in shape and cusp number; the first three branched dorsal-fin rays distinctly elongate in males; a bright red adipose and caudal fins in life; a conspicuous dark midlateral stripe extending from the opercle to the tip of the median caudal-fin rays; and by the absence of a humeral spot. The phylogenetic position of the new taxon is discussed using morphological and molecular datasets, with conflicting results of both approaches discussed. Additionally, a summarized discussion on the current problems in the Characidae taxonomy is presented and the principal biases in the morphological dataset are also discussed.

  19. Molecular phylogenetics of emydine turtles: taxonomic revision and the evolution of shell kinesis.

    Science.gov (United States)

    Feldman, Chris R; Parham, James Ford

    2002-03-01

    The 10 extant species of emydine turtles represent an array of morphological and ecological forms recognizable and popular among scientists and hobbyists. Nevertheless, the phylogenetic affinities of most emydines remain contentious. Here, we examine the evolutionary relationships of emydine turtles using 2092 bp of DNA encoding the mitochondrial genes cyt b, ND4, and adjacent tRNAs. These data contain 339 parsimony informative characters that we use to erect hypotheses of relationships for the Emydinae. Both maximum parsimony and maximum likelihood methods yield a monophyletic Emydinae in which all but three nodes are well resolved. Emys orbicularis, Emydoidea blandingii, and Clemmys marmorata form a monophyletic clade, as do the species of Terrapene. Clemmys muhlenbergii and Clemmys insculpta form a third monophyletic group that may be sister to all other emydines. Clemmys guttata is problematic and probably related to Terrapene. Based on this phylogeny, and previous molecular work on the group, we suggest the following taxonomic revisions: (1) Clemmys should be restricted to a single species, C. guttata. (2) Calemys should be resurrected for C. muhlenbergii and C. insculpta. (3) Emys should be expanded to include three species: E. orbicularis, E. blandingii, and E. marmorata. Furthermore, our analyses show that neither kinetic-shelled nor akinetic-shelled emydines form monophyletic groups. Therefore, shell kinesis was either independently gained in Emys and Terrapene or secondarily lost in E. marmorata and C. guttata. Parsimony, paleontological evidence, and the multiple origins of shell kinesis in related turtle lineages (especially geoemydines) support the independent origin of plastral kinesis.

  20. Molecular and phylogenetic characterization of bovine coronavirus virus isolated from dairy cattle in Central Region, Thailand.

    Science.gov (United States)

    Singasa, Kanokwan; Songserm, Taweesak; Lertwatcharasarakul, Preeda; Arunvipas, Pipat

    2017-10-01

    Bovine coronavirus (BCoV) is involved mainly in enteric infections in cattle. This study reports the first molecular detection of BCoV in a diarrhea outbreak in dairy cows in the Central Region, Thailand. BCoV was molecularly detected from bloody diarrheic cattle feces by using nested PCR. Agarose gel electrophoresis of three diarrheic fecal samples yielded from the 25 samples desired amplicons that were 488 base pairs and sequencing substantiated that have BCoV. The sequence alignment indicated that nucleotide and amino acid sequences, the three TWD isolated in Thailand, were more quite homologous to each other (amino acid at position 39 of TWD1, TWD3 was proline, but TWD2 was serine) and closely related to OK-0514-3strain (virulent respiratory strain; RBCoV).The amino acid sequencing identities among TWD1, TWD2,TWD3, and OK-0514-3 strain were 96.0 to 96.6%, those at which T3I, H65N, D87G, H127Y, andQ136R were changed. In addition, the phylogenetic tree of the hypervariable region S1subunit spike glycoprotein BCoV gene was composed of three major clades by using the 54 sequences generated and showed that the evolutionally distance, TWD1, TWD2, and TWD3 were the isolated group together and most similar to OK-0514-3 strain (98.2 to 98.5% similarity). Further study will develop ELISA assay for serologic detection of winter dysentery disease.

  1. Phylemon 2.0: a suite of web-tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing.

    Science.gov (United States)

    Sánchez, Rubén; Serra, François; Tárraga, Joaquín; Medina, Ignacio; Carbonell, José; Pulido, Luis; de María, Alejandro; Capella-Gutíerrez, Salvador; Huerta-Cepas, Jaime; Gabaldón, Toni; Dopazo, Joaquín; Dopazo, Hernán

    2011-07-01

    Phylemon 2.0 is a new release of the suite of web tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing. It has been designed as a response to the increasing demand of molecular sequence analyses for experts and non-expert users. Phylemon 2.0 has several unique features that differentiates it from other similar web resources: (i) it offers an integrated environment that enables evolutionary analyses, format conversion, file storage and edition of results; (ii) it suggests further analyses, thereby guiding the users through the web server; and (iii) it allows users to design and save phylogenetic pipelines to be used over multiple genes (phylogenomics). Altogether, Phylemon 2.0 integrates a suite of 30 tools covering sequence alignment reconstruction and trimming; tree reconstruction, visualization and manipulation; and evolutionary hypotheses testing.

  2. Phylemon 2.0: a suite of web-tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing

    Science.gov (United States)

    Sánchez, Rubén; Serra, François; Tárraga, Joaquín; Medina, Ignacio; Carbonell, José; Pulido, Luis; de María, Alejandro; Capella-Gutíerrez, Salvador; Huerta-Cepas, Jaime; Gabaldón, Toni; Dopazo, Joaquín; Dopazo, Hernán

    2011-01-01

    Phylemon 2.0 is a new release of the suite of web tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing. It has been designed as a response to the increasing demand of molecular sequence analyses for experts and non-expert users. Phylemon 2.0 has several unique features that differentiates it from other similar web resources: (i) it offers an integrated environment that enables evolutionary analyses, format conversion, file storage and edition of results; (ii) it suggests further analyses, thereby guiding the users through the web server; and (iii) it allows users to design and save phylogenetic pipelines to be used over multiple genes (phylogenomics). Altogether, Phylemon 2.0 integrates a suite of 30 tools covering sequence alignment reconstruction and trimming; tree reconstruction, visualization and manipulation; and evolutionary hypotheses testing. PMID:21646336

  3. Molecular phylogenetic analysis of fleshy pored mushrooms: Neoboletus luridiformis and Hortiboletus rubellus from western Himalayan range of Pakistan

    International Nuclear Information System (INIS)

    Sarwar, S.; Khalid, N.; Dentinger, B.M.

    2016-01-01

    Fleshy pored mushrooms is the name given to boletes due to their porous hymenium and fleshy nature. These are ectomycorrhizal basidiomycetes found in all continents except Antarctica. These mushrooms are important economically due to their edibility and medicinal value. This research work highlights the diversity of boletes in Pakistan and their correct identification by using molecular phylogenetic techniques. Western Himalayan range (WHR) of Pakistan is considered as diversity rich area. During present investigation regarding diversity of boletes in these areas, two bolete taxa viz. Hortiboletus rubellus and Neoboletus luridiformis were found under conifers. These mushrooms were collected and analyzed morphologically as well as phylogenetically by using Internal Transcribed Spacer (ITS) region of nrDNA sequences, and compared with their allies. All description and comparison with related taxa is provided in detail. These boletes are first time analyzed using molecular method from Pakistan. (author)

  4. Multilocus phylogenetic analysis of true morels (Morchella) reveals high levels of endemics in Turkey relative ot other regions of Europe

    Science.gov (United States)

    The present study was conducted to better understand how the phylogenetic diversity of true morels (Morchella) in Turkey compares with species found in other regions of the world. The current research builds on our recently published survey of 10 Turkish provinces and another of the world in which D...

  5. Molecular investigations of the bat tick Argas vespertilionis (Ixodida: Argasidae) and Babesia vesperuginis (Apicomplexa: Piroplasmida) reflect "bat connection" between Central Europe and Central Asia.

    Science.gov (United States)

    Hornok, Sándor; Szőke, Krisztina; Görföl, Tamás; Földvári, Gábor; Tu, Vuong Tan; Takács, Nóra; Kontschán, Jenő; Sándor, Attila D; Estók, Péter; Epis, Sara; Boldogh, Sándor; Kováts, Dávid; Wang, Yuanzhi

    2017-05-01

    Argas vespertilionis is a geographically widespread haematophagous ectoparasite species of bats in the Old World, with a suspected role in the transmission of Babesia vesperuginis. The aims of the present study were (1) to molecularly screen A. vespertilionis larvae (collected in Europe, Africa and Asia) for the presence of piroplasms, and (2) to analyze mitochondrial markers of A. vespertilionis larvae from Central Asia (Xinjiang Province, Northwestern China) in a phylogeographical context. Out of the 193 DNA extracts from 321 A. vespertilionis larvae, 12 contained piroplasm DNA (10 from Hungary, two from China). Sequencing showed the exclusive presence of B. vesperuginis, with 100% sequence identity between samples from Hungary and China. In addition, A. vespertilionis cytochrome oxidase c subunit 1 (cox1) and 16S rRNA gene sequences had 99.1-99.2 and 99.5-100% similarities, respectively, between Hungary and China. Accordingly, in the phylogenetic analyses A. vespertilionis from China clustered with haplotypes from Europe, and (with high support) outside the group formed by haplotypes from Southeast Asia. This is the first molecular evidence on the occurrence of B. vesperuginis in Asia. Bat ticks from hosts in Vespertilionidae contained only the DNA of B. vesperuginis (in contrast with what was reported on bat ticks from Rhinolophidae and Miniopteridae). Molecular taxonomic analyses of A. vespertilionis and B. vesperuginis suggest a genetic link of bat parasites between Central Europe and Central Asia, which is epidemiologically relevant in the context of any pathogens associated with bats.

  6. Molecular and morphological data supporting phylogenetic reconstruction of the genus Goniothalamus (Annonaceae), including a reassessment of previous infrageneric classifications.

    Science.gov (United States)

    Tang, Chin Cheung; Thomas, Daniel C; Saunders, Richard M K

    2015-09-01

    Data is presented in support of a phylogenetic reconstruction of the species-rich early-divergent angiosperm genus Goniothalamus (Annonaceae) (Tang et al., Mol. Phylogenetic Evol., 2015) [1], inferred using chloroplast DNA (cpDNA) sequences. The data includes a list of primers for amplification and sequencing for nine cpDNA regions: atpB-rbcL, matK, ndhF, psbA-trnH, psbM-trnD, rbcL, trnL-F, trnS-G, and ycf1, the voucher information and molecular data (GenBank accession numbers) of 67 ingroup Goniothalamus accessions and 14 outgroup accessions selected from across the tribe Annoneae, and aligned data matrices for each gene region. We also present our Bayesian phylogenetic reconstructions for Goniothalamus, with information on previous infrageneric classifications superimposed to enable an evaluation of monophyly, together with a taxon-character data matrix (with 15 morphological characters scored for 66 Goniothalamus species and seven other species from the tribe Annoneae that are shown to be phylogenetically correlated).

  7. Molecular and morphological data supporting phylogenetic reconstruction of the genus Goniothalamus (Annonaceae, including a reassessment of previous infrageneric classifications

    Directory of Open Access Journals (Sweden)

    Chin Cheung Tang

    2015-09-01

    Full Text Available Data is presented in support of a phylogenetic reconstruction of the species-rich early-divergent angiosperm genus Goniothalamus (Annonaceae (Tang et al., Mol. Phylogenetic Evol., 2015 [1], inferred using chloroplast DNA (cpDNA sequences. The data includes a list of primers for amplification and sequencing for nine cpDNA regions: atpB-rbcL, matK, ndhF, psbA-trnH, psbM-trnD, rbcL, trnL-F, trnS-G, and ycf1, the voucher information and molecular data (GenBank accession numbers of 67 ingroup Goniothalamus accessions and 14 outgroup accessions selected from across the tribe Annoneae, and aligned data matrices for each gene region. We also present our Bayesian phylogenetic reconstructions for Goniothalamus, with information on previous infrageneric classifications superimposed to enable an evaluation of monophyly, together with a taxon-character data matrix (with 15 morphological characters scored for 66 Goniothalamus species and seven other species from the tribe Annoneae that are shown to be phylogenetically correlated.

  8. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST

    NARCIS (Netherlands)

    O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.

    2012-01-01

    We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the

  9. Morphological reassessment and molecular phylogenetic analyses of Amauroderma s.lat. raised new perspectives in the generic classification of the Ganodermataceae family

    NARCIS (Netherlands)

    Costa-Rezende, D.H.; Robledo, G.L.; Góes-Neto, A.; Reck, M.A.; Crespo, E.; Drechsler-Santos, E.R.

    2017-01-01

    Ganodermataceae is a remarkable group of polypore fungi, mainly characterized by particular doublewalled basidiospores with a coloured endosporium ornamented with columns or crests, and a hyaline smooth exosporium. In order to establish an integrative morphological and molecular phylogenetic

  10. Highly pathogenic avian influenza virus subtype H5N1 in Africa: a comprehensive phylogenetic analysis and molecular characterization of isolates.

    Directory of Open Access Journals (Sweden)

    Giovanni Cattoli

    Full Text Available Highly pathogenic avian influenza virus A/H5N1 was first officially reported in Africa in early 2006. Since the first outbreak in Nigeria, this virus spread rapidly to other African countries. From its emergence to early 2008, 11 African countries experienced A/H5N1 outbreaks in poultry and human cases were also reported in three of these countries. At present, little is known of the epidemiology and molecular evolution of A/H5N1 viruses in Africa. We have generated 494 full gene sequences from 67 African isolates and applied molecular analysis tools to a total of 1,152 A/H5N1 sequences obtained from viruses isolated in Africa, Europe and the Middle East between 2006 and early 2008. Detailed phylogenetic analyses of the 8 gene viral segments confirmed that 3 distinct sublineages were introduced, which have persisted and spread across the continent over this 2-year period. Additionally, our molecular epidemiological studies highlighted the association between genetic clustering and area of origin in a majority of cases. Molecular signatures unique to strains isolated in selected areas also gave us a clearer picture of the spread of A/H5N1 viruses across the continent. Mutations described as typical of human influenza viruses in the genes coding for internal proteins or associated with host adaptation and increased resistance to antiviral drugs have also been detected in the genes coding for transmembrane proteins. These findings raise concern for the possible human health risk presented by viruses with these genetic properties and highlight the need for increased efforts to monitor the evolution of A/H5N1 viruses across the African continent. They further stress how imperative it is to implement sustainable control strategies to improve animal and public health at a global level.

  11. Orders out of chaos--molecular phylogenetics reveals the complexity of shark and stingray tapeworm relationships.

    Science.gov (United States)

    Caira, Janine N; Jensen, Kirsten; Waeschenbach, Andrea; Olson, Peter D; Littlewood, D Timothy J

    2014-01-01

    Novel molecular data are presented to resolve the long-standing issue of the non-monophyly of the elasmobranch-hosted tapeworm order Tetraphyllidea relative to the other acetabulate eucestode orders. Bayesian inference analyses of various combinations of full ssrDNA, and full or partial lsrDNA (D1-D3), sequence data, which included 134 species representing 97 genera across the 15 eucestode orders, were conducted. New ssrDNA data were generated for 82 species, partial lsrDNA data for 53 species, and full lsrDNA data for 29 species. The monophyly of each of the elasmobranch-hosted orders Cathetocephalidea, Litobothriidea, Lecanicephalidea and Rhinebothriidea was confirmed, as was the non-monophyly of the Tetraphyllidea. Two relatively stable groups of tetraphyllidean taxa emerged and are hereby designated as new orders. The Onchoproteocephalidea n. ord. is established to recognise the integrated nature of one undescribed and 10 described genera of hook-bearing tetraphyllideans, previously placed in the family Onchobothriidae, with the members of the order Proteocephalidea. The Phyllobothriidea n. ord. is established for a subset of 12 non-hooked genera characterised by scoleces bearing four bothridia each with an anterior accessory sucker; most parasitise sharks and have been assigned to the Phyllobothriidae at one time or another. Tentative ordinal placements are suggested for eight additional genera; placements for the remaining tetraphyllidean genera have not yet emerged. We propose that these 17 genera remain in the "Tetraphyllidea". Among these, particularly labile across analyses were Anthobothrium, Megalonchos, Carpobothrium, Calliobothrium and Caulobothrium. The unique association of Chimaerocestus with holocephalans, rather than with elasmobranchs, appears to represent a host-switching event. Both of the non-elasmobranch hosted clades of acetabulate cestodes (i.e. Proteocephalidea and Cyclophyllidea and their kin) appear to have had their origins with

  12. Molecular phylogenetics and historical biogeography of the west-palearctic common toads (Bufo bufo species complex).

    Science.gov (United States)

    Garcia-Porta, J; Litvinchuk, S N; Crochet, P A; Romano, A; Geniez, P H; Lo-Valvo, M; Lymberakis, P; Carranza, S

    2012-04-01

    In most pan-Eurasiatic species complexes, two phenomena have been traditionally considered key processes of their cladogenesis and biogeography. First, it is hypothesized that the origin and development of the Central Asian Deserts generated a biogeographic barrier that fragmented past continuous distributions in Eastern and Western domains. Second, Pleistocene glaciations have been proposed as the main process driving the regional diversification within each of these domains. The European common toad and its closest relatives provide an interesting opportunity to examine the relative contributions of these paleogeographic and paleoclimatic events to the phylogeny and biogeography of a widespread Eurasiatic group. We investigate this issue by applying a multiproxy approach combining information from molecular phylogenies, a multiple correspondence analysis of allozyme data and species distribution models. Our study includes 304 specimens from 164 populations, covering most of the distributional range of the Bufo bufo species complex in the Western Palearctic. The phylogenies (ML and Bayesian analyses) were based on a total of 1988 bp of mitochondrial DNA encompassing three genes (tRNAval, 16S and ND1). A dataset with 173 species of the family Bufonidae was assembled to estimate the separation of the two pan-Eurasiatic species complexes of Bufo and to date the main biogeographic events within the Bufo bufo species complex. The allozyme study included sixteen protein systems, corresponding to 21 presumptive loci. Finally, the distribution models were based on maximum entropy. Our distribution models show that Eastern and Western species complexes are greatly isolated by the Central Asian Deserts, and our dating estimates place this divergence during the Middle Miocene, a moment in which different sources of evidence document a major upturn of the aridification rate of Central Asia. This climate-driven process likely separated the Eastern and Western species. At the

  13. Molecular phylogenetics, historical biogeography, and chromosome number evolution of Portulaca (Portulacaceae).

    Science.gov (United States)

    Ocampo, Gilberto; Columbus, J Travis

    2012-04-01

    Portulaca is the only genus in Portulacaceae and has ca. 100 species distributed worldwide, mainly in the tropics and subtropics. Molecular data place the genus as one of the closest relatives of Cactaceae, but phylogenetic relationships within Portulaca are barely known. This study samples 59 species of Portulaca, 10 infraspecific taxa, and three cultivars, including multiple samples of widespread species. The sampled taxa represent all subgenera in the classifications of von Poellnitz (1934), Legrand (1958), and Geesink (1969) and come from around the world. Nuclear ITS and chloroplast ndhF, trnT-psbD intergenic spacer, and ndhA intron DNA sequences were analyzed using maximum likelihood and Bayesian methods to produce a hypothesis of relationships within Portulaca. Divergence times were estimated using Hawaiian endemics for calibration, and biogeographical patterns were examined using a Bayes-DIVA approach. In addition, the evolution of chromosome numbers in the genus was investigated using probabilistic models. The analyses strongly support the monophyly of Portulaca, with an age of the most recent common ancestor (MRCA) of 23 Myr. Within Portulaca are two major lineages: the OL clade (comprising opposite-leaved species) distributed in Africa, Asia, and Australia, and the AL clade (comprising alternate to subopposite-leaved species), which is more widespread and originated in the New World. Sedopsis, a genus sometimes recognized as distinct from Portulaca based on a long corolla tube, is nested within the OL clade and does not merit taxonomic recognition. Samples of Portulaca grandiflora, Portulaca halimoides, and Portulaca oleracea were found to be non-monophyletic. It is hypothesized that the ancestral distribution area of Portulaca included southern hemisphere continents and Asia. The OL clade remained restricted to the Old World (except Portulaca quadrifida, a pantropical weed), while the AL clade, with a South American origin, was able to disperse multiple

  14. Molecular Phylogenetics and Temporal Diversification in the Genus Aeromonas Based on the Sequences of Five Housekeeping Genes

    Science.gov (United States)

    Lorén, J. Gaspar; Farfán, Maribel; Fusté, M. Carmen

    2014-01-01

    Several approaches have been developed to estimate both the relative and absolute rates of speciation and extinction within clades based on molecular phylogenetic reconstructions of evolutionary relationships, according to an underlying model of diversification. However, the macroevolutionary models established for eukaryotes have scarcely been used with prokaryotes. We have investigated the rate and pattern of cladogenesis in the genus Aeromonas (γ-Proteobacteria, Proteobacteria, Bacteria) using the sequences of five housekeeping genes and an uncorrelated relaxed-clock approach. To our knowledge, until now this analysis has never been applied to all the species described in a bacterial genus and thus opens up the possibility of establishing models of speciation from sequence data commonly used in phylogenetic studies of prokaryotes. Our results suggest that the genus Aeromonas began to diverge between 248 and 266 million years ago, exhibiting a constant divergence rate through the Phanerozoic, which could be described as a pure birth process. PMID:24586399

  15. Molecular and phylogenetic analysis of HIV-1 variants circulating among injecting drug users in Mashhad-Iran

    Directory of Open Access Journals (Sweden)

    Buonaguro FM

    2006-09-01

    Full Text Available Abstract Genetic and phylogenetic information on the HIV-1 epidemic in Middle-East Countries, and in particular in Iran, are extremely limited. By March 2004, the Iranian Ministry of Health officially reported a cumulative number of 6'532 HIV positive individuals and 214 AIDS cases in the Iranian HIV-1 epidemic. The intra-venous drug users (IDUs represent the group at highest risk for HIV-1 infection in Iran, accounting for almost 63% of all HIV-infected population. In this regards, a molecular phylogenetic study has been performed on a sentinel cohort of HIV-1 seropositive IDUs enrolled at the end of 2005 at the University of Mashhad, the largest city North East of Tehran. The study has been performed on both gag and env subgenomic regions amplified by Polymerase Chain Reaction (PCR from peripheral blood mononuclear cells (PBMCs and characterized by direct DNA sequence analysis. The results reported here show that the HIV-1 subtype A is circulating in this IDUs sentinel cohort. Moreover, the single phylogenetic cluster as well as the intra-group low nucleotide divergence is indicative of a recent outbreak. Unexpectedly, the Iranian samples appear to be phylogenetically derived from African Sub-Saharan subtype A viruses, raising stirring speculations on HIV-1 introduction into the IDUs epidemic in Mashhad. This sentinel study could represent the starting point for a wider molecular survey of the HIV-1 epidemics in Iran to evaluate in detail the distribution of genetic subtypes and possible natural drug-resistant variants, which are extremely helpful information to design diagnostic and therapeutic strategies.

  16. Europe

    OpenAIRE

    2015-01-01

    Voilà deux militants de la cause européenne qui plaident, chacun à sa manière, pour un sursaut afin que renaisse ce « désir d’Europe » qui nous fait tant défaut. « Il n’est pas trop tard, mais il est temps… », écrit P. COLLOWALD dans ses mémoires préfacées par Jacques Delors. Constatant que, « dans les jugements hâtifs de notre époque, on manque souvent de discernement, par ignorance et par manque de recul historique », cet ancien responsable de l’information à la Commission et au Parlement e...

  17. Phylogenetic relationships in the "grossulariae" species group of the genus Aphis (Hemiptera: Sternorrhyncha: Aphididae): Molecular evidence

    DEFF Research Database (Denmark)

    Turcinaviciene, Jorga; Rakauskas, Rimantas; Pedersen, Bo Vest

    2006-01-01

    Phylogenetic relationships among Palaearctic Ribes and/or Onagraceae inhabiting Aphis species from five countries were examined using mitochondrial gene cytochrome oxidase I (CO-I) and nuclear gene elongation factor 1 a (EF-1a) sequences. There was no major conflict between the trees obtained fro...

  18. Molecular phylogenetics of finches and sparrows: consequences of character state removal in cytochrome b sequences.

    Science.gov (United States)

    Groth, J G

    1998-12-01

    The complete mitochondrial cytochrome b genes of 53 genera of oscine passerine birds representing the major groups of finches and some allies were compared. Phylogenetic trees resulting from three levels of character partition removal (no data removed, transitions at third positions of codons removed, and all transitions removed [transversion parsimony]) were generally concordant, and all supported several basic statements regarding relationships of finches and finch-like birds, including: (1) larks (Alaudidae) show no close relationship to any finch group; (2) Peucedramus (olive warbler) is phylogenetically far removed from true wood warblers; (3) a clade consisting of fringillids, passerids, motacillids, and emberizids is supported, and this clade is characterized by evolution of a vestigial 10th wing primary; and (4) Hawaiian honeycreepers are derived from within the cardueline finches. Excluding transition substitutions at third positions of codons resulted in phylogenetic trees similar to, but with greater bootstrap nodal support than, trees derived using either all data (equally weighted) or transversion parsimony. Relative to the shortest trees obtained using all data, the topologies obtained after elimination of third-position transitions showed only slight increases in realized treelength and homoplasy. These increases were negligable compared to increases in overall nodal support; therefore, this partition removal scheme may enhance recovery of deep phylogenetic signal in protein-coding DNA datasets. Copyright 1998 Academic Press.

  19. Multigene molecular phylogenetics reveals true morels (Morchella) are especially species-rich in China

    Science.gov (United States)

    The phylogenetic diversity of true morels (Morchella) in China was estimated by initially analyzing nuclear ribosomal internal transcribed spacer (ITS) rDNA sequences from 361 specimens collected in 21 provinces during the 2003-2011 growing seasons, together with six collections obtained on loan fro...

  20. Evolution of feeding specialization in Tanganyikan scale-eating cichlids: a molecular phylogenetic approach

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-10-01

    Full Text Available Abstract Background Cichlid fishes in Lake Tanganyika exhibit remarkable diversity in their feeding habits. Among them, seven species in the genus Perissodus are known for their unique feeding habit of scale eating with specialized feeding morphology and behaviour. Although the origin of the scale-eating habit has long been questioned, its evolutionary process is still unknown. In the present study, we conducted interspecific phylogenetic analyses for all nine known species in the tribe Perissodini (seven Perissodus and two Haplotaxodon species using amplified fragment length polymorphism (AFLP analyses of the nuclear DNA. On the basis of the resultant phylogenetic frameworks, the evolution of their feeding habits was traced using data from analyses of stomach contents, habitat depths, and observations of oral jaw tooth morphology. Results AFLP analyses resolved the phylogenetic relationships of the Perissodini, strongly supporting monophyly for each species. The character reconstruction of feeding ecology based on the AFLP tree suggested that scale eating evolved from general carnivorous feeding to highly specialized scale eating. Furthermore, scale eating is suggested to have evolved in deepwater habitats in the lake. Oral jaw tooth shape was also estimated to have diverged in step with specialization for scale eating. Conclusion The present evolutionary analyses of feeding ecology and morphology based on the obtained phylogenetic tree demonstrate for the first time the evolutionary process leading from generalised to highly specialized scale eating, with diversification in feeding morphology and behaviour among species.

  1. Sequence exploration reveals information bias among molecular markers used in phylogenetic reconstruction for Colletotrichum species.

    Science.gov (United States)

    Rampersad, Sephra N; Hosein, Fazeeda N; Carrington, Christine Vf

    2014-01-01

    The Colletotrichum gloeosporioides species complex is among the most destructive fungal plant pathogens in the world, however, identification of isolates of quarantine importance to the intra-specific level is confounded by a number of factors that affect phylogenetic reconstruction. Information bias and quality parameters were investigated to determine whether nucleotide sequence alignments and phylogenetic trees accurately reflect the genetic diversity and phylogenetic relatedness of individuals. Sequence exploration of GAPDH, ACT, TUB2 and ITS markers indicated that the query sequences had different patterns of nucleotide substitution but were without evidence of base substitution saturation. Regions of high entropy were much more dispersed in the ACT and GAPDH marker alignments than for the ITS and TUB2 markers. A discernible bimodal gap in the genetic distance frequency histograms was produced for the ACT and GAPDH markers which indicated successful separation of intra- and inter-specific sequences in the data set. Overall, analyses indicated clear differences in the ability of these markers to phylogenetically separate individuals to the intra-specific level which coincided with information bias.

  2. Molecular detection and phylogenetic analysis of Hepatozoon spp. in questing Ixodes ricinus ticks and rodents from Slovakia and Czech Republic.

    Science.gov (United States)

    Hamšíková, Zuzana; Silaghi, Cornelia; Rudolf, Ivo; Venclíková, Kristýna; Mahríková, Lenka; Slovák, Mirko; Mendel, Jan; Blažejová, Hana; Berthová, Lenka; Kocianová, Elena; Hubálek, Zdeněk; Schnittger, Leonhard; Kazimírová, Mária

    2016-10-01

    By amplification and sequencing of 18S rRNA gene fragments, Hepatozoon spp. DNA was detected in 0.08 % (4/5057) and 0.04 % (1/2473) of questing Ixodes ricinus ticks from Slovakia and Czech Republic, respectively. Hepatozoon spp. DNA was also detected in spleen and/or lungs of 4.45 % (27/606) of rodents from Slovakia. Prevalence of infection was significantly higher in Myodes glareolus (11.45 %) than in Apodemus spp. (0.28 %) (P Hepatozoon spp. gene amplicons from I. ricinus showed 100 % identity with Hepatozoon canis isolates from red foxes or dogs in Europe. Phylogenetic analysis showed that at least two H. canis 18S rRNA genotypes exist in Slovakia of which one was identified also in the Czech Republic. The finding of H. canis in questing I. ricinus suggests the geographical spread of the parasite and a potential role of other ticks as its vectors in areas where Rhipicephalus sanguineus is not endemic. Sequencing of 18S rRNA gene amplicons from M. glareolus revealed the presence of two closely related genetic variants, Hepatozoon sp. SK1 and Hepatozoon sp. SK2, showing 99-100 % identity with isolates from M. glareolus from other European countries. Phylogenetic analysis demonstrates that 18S rRNA variants SK1 and SK2 correspond to previously described genotypes UR1 and UR2 of H. erhardovae, respectively. The isolate from Apodemus flavicollis (Hepatozoon sp. SK3b) was 99 % identical with isolates from reptiles in Africa and Asia. Further studies are necessary to identify the taxonomic status of Hepatozoon spp. parasitizing rodents in Europe and the host-parasite interactions in natural foci.

  3. Candelariella placodizans (Candelariaceae reported new to mainland China and Taiwan based on morphological, chemical and molecular phylogenetic analyses

    Directory of Open Access Journals (Sweden)

    Lidia Yakovchenko

    2016-06-01

    Full Text Available Candelariella placodizans is newly reported from China. It was collected on exposed rocks with mosses on the alpine areas of Taiwan and Yunnan Province, China at elevation between 3200-4400 m. Molecular phylogenetic analyses based on ITS rDNA sequences were also performed to confirm the monophyly of the Chinese populations with respect to already existing sequences of the species, and then further to examine their relationships to other members of the genus. An identification key to all 14 known taxa of Candelariella in China is provided.

  4. Molecular Identification of Dendrobium Species (Orchidaceae) Based on the DNA Barcode ITS2 Region and Its Application for Phylogenetic Study.

    Science.gov (United States)

    Feng, Shangguo; Jiang, Yan; Wang, Shang; Jiang, Mengying; Chen, Zhe; Ying, Qicai; Wang, Huizhong

    2015-09-11

    The over-collection and habitat destruction of natural Dendrobium populations for their commercial medicinal value has led to these plants being under severe threat of extinction. In addition, many Dendrobium plants are similarly shaped and easily confused during the absence of flowering stages. In the present study, we examined the application of the ITS2 region in barcoding and phylogenetic analyses of Dendrobium species (Orchidaceae). For barcoding, ITS2 regions of 43 samples in Dendrobium were amplified. In combination with sequences from GenBank, the sequences were aligned using Clustal W and genetic distances were computed using MEGA V5.1. The success rate of PCR amplification and sequencing was 100%. There was a significant divergence between the inter- and intra-specific genetic distances of ITS2 regions, while the presence of a barcoding gap was obvious. Based on the BLAST1, nearest distance and TaxonGAP methods, our results showed that the ITS2 regions could successfully identify the species of most Dendrobium samples examined; Second, we used ITS2 as a DNA marker to infer phylogenetic relationships of 64 Dendrobium species. The results showed that cluster analysis using the ITS2 region mainly supported the relationship between the species of Dendrobium established by traditional morphological methods and many previous molecular analyses. To sum up, the ITS2 region can not only be used as an efficient barcode to identify Dendrobium species, but also has the potential to contribute to the phylogenetic analysis of the genus Dendrobium.

  5. Detection, molecular typing and phylogenetic analysis of Leishmania isolated from cases of leishmaniasis among Syrian refugees in Lebanon

    Directory of Open Access Journals (Sweden)

    Tamara Salloum

    2016-06-01

    Two molecular typing methods of 39 FFPE Leishmania isolates were used: the ITS1-PCR RFLP and the nested ITS1-5.8S rDNA gene amplification followed by sequencing and phylogenetic analysis. The efficiency of these two techniques in Leishmania identification was compared and the phylogenetic relationships among these isolates were illustrated based on the neighbor-joining (NJ method. The results were statistically correlated with the parasitic index (PI. The DNA storage in formalin-fixed paraffin embedded (FFPE tissues was assessed as well. The parasites identified were all L. tropica as determined by both techniques. ITS1-5.8S rDNA gene based typing proved to be more sensitive in the detection of parasites (positive in 69.2% of the isolates as opposed to the ITS1-PCR RFLP method that was successful in identifying L. tropica in only 43.6% of the isolates. Sequencing and phylogenetic analysis revealed high levels of heterogeneity. A statistically significant correlation was observed between PI and the results of the nested ITS1-5.8S rDNA gene PCR. Genotyping at the species level is essential for monitoring the relative frequency of CL in the Mediterranean area that is correlated to three different Leishmania species (Leishmania infantum, Leishmania major and L. tropica, each characterized by distinct epidemiological features. The obtained results highlight the need to find a universally accepted diagnostic tool for Leishmania typing.

  6. Systematics of the grey mullets (Teleostei: Mugiliformes: Mugilidae): molecular phylogenetic evidence challenges two centuries of morphology-based taxonomy.

    Science.gov (United States)

    Durand, J-D; Shen, K-N; Chen, W-J; Jamandre, B W; Blel, H; Diop, K; Nirchio, M; Garcia de León, F J; Whitfield, A K; Chang, C-W; Borsa, P

    2012-07-01

    The family Mugilidae comprises mainly coastal marine species that are widely distributed in all tropical, subtropical and temperate seas. Mugilid species are generally considered to be ecologically important and they are a major food resource for human populations in certain parts of the world. The taxonomy and systematics of the Mugilidae are still much debated and based primarily on morphological characters. In this study, we provide the first comprehensive molecular systematic account of the Mugilidae using phylogenetic analyses of nucleotide sequence variation at three mitochondrial loci (16S rRNA, cytochrome oxidase I, and cytochrome b) for 257 individuals from 55 currently recognized species. The study covers all 20 mugilid genera currently recognized as being valid. The family comprises seven major lineages that radiated early on from the ancestor to all current forms. All genera that were represented by two species or more, except Cestraeus, turned out to be paraphyletic or polyphyletic. Thus, the present phylogenetic results generally disagree with the current taxonomy at the genus level and imply that the anatomical characters used for the systematics of the Mugilidae may be poorly informative phylogenetically. The present results should provide a sound basis for a taxonomic revision of the mugilid genera. A proportion of the species with large distribution ranges (including Moolgarda seheli, Mugil cephalus and M. curema) appear to consist of cryptic species, thus warranting further taxonomic and genetic work at the infra-generic level. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Molecular Identification of Dendrobium Species (Orchidaceae Based on the DNA Barcode ITS2 Region and Its Application for Phylogenetic Study

    Directory of Open Access Journals (Sweden)

    Shangguo Feng

    2015-09-01

    Full Text Available The over-collection and habitat destruction of natural Dendrobium populations for their commercial medicinal value has led to these plants being under severe threat of extinction. In addition, many Dendrobium plants are similarly shaped and easily confused during the absence of flowering stages. In the present study, we examined the application of the ITS2 region in barcoding and phylogenetic analyses of Dendrobium species (Orchidaceae. For barcoding, ITS2 regions of 43 samples in Dendrobium were amplified. In combination with sequences from GenBank, the sequences were aligned using Clustal W and genetic distances were computed using MEGA V5.1. The success rate of PCR amplification and sequencing was 100%. There was a significant divergence between the inter- and intra-specific genetic distances of ITS2 regions, while the presence of a barcoding gap was obvious. Based on the BLAST1, nearest distance and TaxonGAP methods, our results showed that the ITS2 regions could successfully identify the species of most Dendrobium samples examined; Second, we used ITS2 as a DNA marker to infer phylogenetic relationships of 64 Dendrobium species. The results showed that cluster analysis using the ITS2 region mainly supported the relationship between the species of Dendrobium established by traditional morphological methods and many previous molecular analyses. To sum up, the ITS2 region can not only be used as an efficient barcode to identify Dendrobium species, but also has the potential to contribute to the phylogenetic analysis of the genus Dendrobium.

  8. Molecular phylogenetic trees - On the validity of the Goodman-Moore augmentation algorithm

    Science.gov (United States)

    Holmquist, R.

    1979-01-01

    A response is made to the reply of Nei and Tateno (1979) to the letter of Holmquist (1978) supporting the validity of the augmentation algorithm of Moore (1977) in reconstructions of nucleotide substitutions by means of the maximum parsimony principle. It is argued that the overestimation of the augmented numbers of nucleotide substitutions (augmented distances) found by Tateno and Nei (1978) is due to an unrepresentative data sample and that it is only necessary that evolution be stochastically uniform in different regions of the phylogenetic network for the augmentation method to be useful. The importance of the average value of the true distance over all links is explained, and the relative variances of the true and augmented distances are calculated to be almost identical. The effects of topological changes in the phylogenetic tree on the augmented distance and the question of the correctness of ancestral sequences inferred by the method of parsimony are also clarified.

  9. Molecular cloning, phylogenetic analysis and heat shock response of Babesia gibsoni heat shock protein 90.

    Science.gov (United States)

    Yamasaki, Masahiro; Tsuboi, Yoshihiro; Taniyama, Yusuke; Uchida, Naohiro; Sato, Reeko; Nakamura, Kensuke; Ohta, Hiroshi; Takiguchi, Mitsuyoshi

    2016-09-01

    The Babesia gibsoni heat shock protein 90 (BgHSP90) gene was cloned and sequenced. The length of the gene was 2,610 bp with two introns. This gene was amplified from cDNA corresponding to full length coding sequence (CDS) with an open reading frame of 2,148 bp. A phylogenetic analysis of the CDS of HSP90 gene showed that B. gibsoni was most closely related to B. bovis and Babesia sp. BQ1/Lintan and lies within a phylogenetic cluster of protozoa. Moreover, mRNA transcription profile for BgHSP90 exposed to high temperature were examined by quantitative real-time reverse transcription-polymerase chain reaction. BgHSP90 levels were elevated when the parasites were incubated at 43°C for 1 hr.

  10. Molecular phylogenetic lineage of Plagiopogon and Askenasia (Protozoa, Ciliophora) revealed by their gene sequences

    Science.gov (United States)

    Liu, An; Yi, Zhenzhen; Lin, Xiaofeng; Hu, Xiaozhong; Al-Farraj, Saleh A.; Al-Rasheid, Khaled A. S.

    2015-08-01

    Prostomates and haptorians are two basal groups of ciliates with limited morphological characteristics available for taxonomy. Morphologically, the structures used to identify prostomates and haptorians are similar or even identical, which generate heavy taxonomic and phylogenetic confusion. In present work, phylogenetic positions lineage of two rare genera, Plagiopogon and Askenasia, were investigated. Three genes including small subunit ribosomal RNA gene (hereafter SSU rDNA), internal transcribed spacer region (ITS region), and large subunit ribosomal RNA gene (LSU rDNA) were analyzed, 10 new sequences five species each. Our findings included 1) class Prostomatea and order Haptorida are multiphyletic; 2) it may not be appropriate to place order Cyclotrichiida in subclass Haptoria, and the systematic lineage of order Cyclotrichiida needs to be verified further; 3) genus Plagiopogon branches consistently within a clade covering most prostomes and is basal of clade Colepidae, implying its close lineage to Prostomatea; and 4) Askenasia is phylogenetically distant from the subclass Haptoria but close to classes Prostomatea, Plagiopylea and Oligohymenophorea. We supposed that the toxicyst of Askenasia may be close to taxa of prostomes instead of haptorians, and the dorsal brush is a more typical morphological characteristics of haptorians than toxicysts.

  11. Molecular phylogenetics and character evolution of morphologically diverse groups, Dendrobium section Dendrobium and allies

    Science.gov (United States)

    Takamiya, Tomoko; Wongsawad, Pheravut; Sathapattayanon, Apirada; Tajima, Natsuko; Suzuki, Shunichiro; Kitamura, Saki; Shioda, Nao; Handa, Takashi; Kitanaka, Susumu; Iijima, Hiroshi; Yukawa, Tomohisa

    2014-01-01

    It is always difficult to construct coherent classification systems for plant lineages having diverse morphological characters. The genus Dendrobium, one of the largest genera in the Orchidaceae, includes ∼1100 species, and enormous morphological diversification has hindered the establishment of consistent classification systems covering all major groups of this genus. Given the particular importance of species in Dendrobium section Dendrobium and allied groups as floriculture and crude drug genetic resources, there is an urgent need to establish a stable classification system. To clarify phylogenetic relationships in Dendrobium section Dendrobium and allied groups, we analysed the macromolecular characters of the group. Phylogenetic analyses of 210 taxa of Dendrobium were conducted on DNA sequences of internal transcribed spacer (ITS) regions of 18S–26S nuclear ribosomal DNA and the maturase-coding gene (matK) located in an intron of the plastid gene trnK using maximum parsimony and Bayesian methods. The parsimony and Bayesian analyses revealed 13 distinct clades in the group comprising section Dendrobium and its allied groups. Results also showed paraphyly or polyphyly of sections Amblyanthus, Aporum, Breviflores, Calcarifera, Crumenata, Dendrobium, Densiflora, Distichophyllae, Dolichocentrum, Holochrysa, Oxyglossum and Pedilonum. On the other hand, the monophyly of section Stachyobium was well supported. It was found that many of the morphological characters that have been believed to reflect phylogenetic relationships are, in fact, the result of convergence. As such, many of the sections that have been recognized up to this point were found to not be monophyletic, so recircumscription of sections is required. PMID:25107672

  12. Molecular Phylogenetic Screening of Withania somnifera Relative From Indonesia Based on Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Topik Hidayat

    2016-04-01

    Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.

  13. Molecular evolution of Puumala hantavirus in Fennoscandia: phylogenetic analysis of strains from two recolonization routes

    DEFF Research Database (Denmark)

    Asikainen, Kari; Hänninen, Tarja; Henttonen, Heikki

    2000-01-01

    Like other members of the genus Hantavirus in the family Bunyaviridae, Puumala virus (PUUV) is thought to be co-evolving with its natural host, the bank vole Clethrionomys glareolus. To gain insight into the evolutionary history of PUUV in northern Europe during the last post-glacial period, we h...

  14. Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

    Science.gov (United States)

    Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

    2012-01-01

    The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

  15. Phylogenetic position and taxonomy of the enigmatic Orobanche krylowii (Orobanchaceae), a predominatly Asian species newly found in Albania (SE Europe).

    Science.gov (United States)

    Frajman, Božo; Carlón, Luis; Kosachev, Petr; Pedraja, Oscar Sánchez; Schneeweiss, Gerald M; Schönswetter, Peter

    2013-10-11

    We report on the occurrence of Orobanche krylowii in the Alpet Shqiptare (Prokletije, Albanian Alps) mountain range in northern Albania (Balkan Peninsula). The species was previously known only from eastern-most Europe (Volga-Kama River in Russia), more than 2500 km away, and from adjacent Siberia and Central Asia. We used morphological evidence as well as nuclear ribosomal ITS sequences to show that the Albanian population indeed belongs to O. krylowii and that its closest relative is the European O. lycoctoni , but not O. elatior as assumed in the past. Both Orobanche krylowii and O. lycoctoni parasitize Ranunculaceae ( Thalictrum spp. and Aconitum lycoctonum , respectively). We provide an identification key and a taxonomic treatment for O. krylowii , and suggest the IUCN category CE (critically endangered) for the highly disjunct Albanian population.

  16. Molecular phylogenetic analysis of Commiphora (Burseraceae) yields insight on the evolution and historical biogeography of an "impossible" genus.

    Science.gov (United States)

    Weeks, Andrea; Simpson, Beryl B

    2007-01-01

    Expansion of the arid zone of sub-Saharan tropical Africa during the Miocene is posited as a significant contributing factor in the evolution of contemporary African flora. Nevertheless, few molecular phylogenetic studies have tested this hypothesis using reconstructed historical biogeographies of plants within this zone. Here, we present a molecular phylogeny of Commiphora, a predominantly tropical African, arid-adapted tree genus, in order to test the monophyly of its taxonomic sections and identify clades that will help direct future study of this species-rich and geographically widespread taxon. We then use multiple fossil calibrations of Commiphora phylogeny to determine the timing of well-supported diversification events within the genus and interpret these age estimates to determine the relative contribution of vicariance and dispersal in the expansion of Commiphora's geographic range. We find that Commiphora is sister to Vietnamese Bursera tonkinensis and that its crown group radiation corresponds with the onset of the Miocene.

  17. Europe

    Energy Technology Data Exchange (ETDEWEB)

    Czvikovszky, T.; Dobó, J. [Research Institute for Plastics, Budapest (Hungary)

    1968-10-15

    The preparation of wood-plastic combinations can be regarded as a special field of graft-copolymerization. It is therefore quite understandable why this idea was first introduced by graft-copolymerization specialists. On the basis of the theory and technique of radiation-induced graft- copolymerization, which has been greatly developed since 1950, wood-plastic combinations appeared simultaneously in the United States of America and in Europe. As is known, intensive American research on wood-plastic combinations is based on four patents by Kenaga from 1958, which were published in 1963. The worldwide interest in the matter was initiated, however, by Karpov's paper of 1960 based on Soviet patents from 1958 and 1960.

  18. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    Science.gov (United States)

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  19. MOLECULAR-PHYLOGENETIC CHARACTERIZATION AND ANTIMICROBIAL RESISTANCE OF Escherichia coli ISOLATED FROM GOATS WITH DIARRHEA

    Directory of Open Access Journals (Sweden)

    Rodrigo Almeida Guimarães

    2015-10-01

    Full Text Available Neonatal diarrhea determines significant changes in feed conversion, causing productivity loss in caprine herds. The antimicrobial resistance in bacteria is characterized as an important public health issue; therefore, Escherichia coli may be characterized as an important pathogen due to expressing virulence mechanisms responsible for significant clinical conditions in humans and animals. The present study evaluated the presence of E. coli among 117 caprine fecal samples and analyzed the isolates for antimicrobial resistance. Suggestive colonies were submitted to biochemical screening followed by genotypic group determination and phylogenetic analysis; further, the samples were submitted to antimicrobials susceptibility test. E. coli, Salmonella spp, Shigella sonnei and Enterobacter aerogenes were identified. E. coli isolates were phylogenetically classified as B2 (9/39, D (19/39, B1 (7/39 e A (4/29 groups. The analysis of the isolates also revealed the presence of K99 (04/39 and Stx (02/39 virulence factors. Antimicrobial susceptibility test revealed sensitive isolates to Chloramphenicol, Streptomycin, Amoxicillin and Ciprofloxacin, being all resistant to Lincomycin, Vancomycin and Penicillin. The results support the need of establishing restricted protocols for antimicrobial use, a fundamental procedure for health improvement in Brazilian caprine herds.

  20. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  1. Molecular and phylogenetic evidence of chikungunya virus circulating in Assam, India

    Directory of Open Access Journals (Sweden)

    Prafulla Dutta

    2017-01-01

    Full Text Available Purpose: Northeast Region of India possesses an abundant number of Aedes mosquitoes, the common vector for Dengue and Chikungunya (CHIK. Dengue is reported every year from Assam, but active surveillance for CHIK virus (CHIKV infection is lacking in this part of India. Therefore, this present study has been undertaken to detect any CHIKV infection during a dengue outbreak in Assam. Materials and Methods: A total of 42 dengue negative samples collected from Guwahati were screened for the presence of CHIK IgM antibodies. Further, all the samples were processed for CHIKV RNA detection by reverse transcriptase-polymerase chain reaction (RT-PCR. Phylogenetic analysis was done by Maximum Likelihood method using Kimura-2 parameter model. Results: No IgM positivity was found in the processed samples; however, 7 samples were positive for CHIKV by RT-PCR. Phylogenetic analysis revealed that the circulating CHIKV belonged to Eastern, Central and Southern African genotype. Sequence analysis showed two uniform nucleotide substitutions and very less amino acid substitution. Conclusion: Silent existence of CHIKV beside dengue is reported from this study. Therefore, CHIKV diagnosis should be included as a regular practice for active surveillance of the disease and its accomplishment before commencing an outbreak.

  2. Molecular Phylogenetics of Centrocestus formosanus (Digenea: Heterophyidae) Originated from Freshwater Fish from Chiang Mai Province, Thailand.

    Science.gov (United States)

    Wongsawad, Chalobol; Wongsawad, Pheravut; Sukontason, Kom; Maneepitaksanti, Worawit; Nantarat, Nattawadee

    2017-02-01

    This study aimed to investigate the morphology and reconstruct the phylogenetic relationships of Centrocestus formosanus originating from 5 species of freshwater fish, i.e., Esomus metallicus, Puntius brevis, Anabas testudineus, Parambassis siamensis , and Carassius auratus , in Chiang Mai province, Thailand. Sequence-related amplified polymorphism (SRAP) and phylogeny based on internal transcribed spacer 2 (ITS2) and mitochondrial cytochrome c oxidase subunit 1 (CO1) were performed. The results showed similar morphologies of adult C. formosanus from day 5 after infection in chicks. C. formosanus originated from 4 species of freshwater fish had the same number of circumoral spines on the oral sucker, except for those from C. auratus which revealed 34 circumoral spines. The phylogenetic tree obtained from SRAP profile and the combination of ITS2 and CO1 sequence showed similar results that were correlated with the number of circumoral spines in adult worms. Genetic variability of C. formosanus also occurred in different species of freshwater fish hosts. However, more details of adult worm morphologies and more sensitive genetic markers are needed to confirm the species validity of C. formosanus with 34 circumoral spines originating from C. auratus in the future.

  3. Complex phylogenetic placement of ilex species (aquifoliaceae): a case study of molecular phylogeny

    International Nuclear Information System (INIS)

    Yi, F.; Sun, L.; Xiao, P.G.; Hao, D.C.

    2017-01-01

    To investigate the phylogenetic relationships among Ilex species distributed in China, we analyzed two alignments including 4,698 characters corresponding to six plastid sequences (matK, rbcL, atpB-rbcL, trnL-F, psbA-trnH, and rpl32-trnL) and 1,748 characters corresponding to two nuclear sequences (ITS and nepGS). Using different partitioning strategies and approaches (i.e., Bayesian inference, maximum likelihood, and maximum parsimony) for phylogeny reconstruction, different topologies and clade supports were determined. A total of 18 Ilex species was divided into two major groups (group I and II) in both plastid and nuclear phylogenies with some incongruences. Potential hybridization events may account, in part, for those phylogenetic uncertainties. The analyses, together with previously identified sequences, indicated that all 18 species were recovered within Eurasia or Asia/North America groups based on plastid data. Meanwhile, the species in group II in the nuclear phylogeny were placed in the Aquifolium clade, as inferred from traditional classification, whereas the species in group I belonged to several other clades. The divergence time of most of the 18 Ilex species was estimated to be not more than 10 million years ago. Based on the results of this study, we concluded that paleogeographical events and past climate changes during the same period might have played important roles in these diversifications. (author)

  4. A Molecular Assessment of Phylogenetic Relationships and LineageDiversification Within the Family Salamandridae (Amphibia, Caudata)

    Energy Technology Data Exchange (ETDEWEB)

    Weisrock, David W.; Papenfuss, Theodore J.; Macey, J. Robert; Litvinchuk, Spartak N.; Polymeni, Rosa; Ugurtas, Ismail H.; Zhao, Ermi; Larson, Allan

    2005-08-08

    Phylogenetic relationships among species of the salamanderfamily Salamandridae are investigated using nearly 3000 nucleotide basesof newly reported mitochondrial DNA sequence data from the mtDNA genicregion spanning the genes tRNALeu-COI. This study uses nearlycomprehensive species-level sampling to provide the first completephylogeny for the Salamandridae. Deep phylogenetic relationships amongthe three most divergent lineages in the family Salamandrina terdigitata,a clade comprising the "True" salamanders, and a clade comprising allnewts except S. terdigitata are difficult to resolve. However, mostrelationships within the latter two lineages are resolved with robustlevels of branch support. The genera Euproctus and Triturus arestatistically shown to be nonmonophyletic, instead each contains adiverse set of lineages positioned within the large newt clade. The genusParamesotriton is also resolve as a nonmonophyletic group, with the newlydescribed species P. laoensis constituting a divergent lineage placed ina sister position to clade containing all Pachytriton species and allremaining Paramesotriton species. Sequence divergences between P.laoensis and other Paramesotriton species are as great as those comparingP. laoensis and species of the genera Cynops and Pachytriton. Analyses oflineage diversification across the Salamandridae indicate that, despiteits exceptional diversity, lineage accumulation appears to have beenconstant across time, indicating that it does not represent a truespecies radiation.

  5. Phylogenetic Molecular Species Delimitations Unravel Potential New Species in the Pest Genus Spodoptera Guenée, 1852 (Lepidoptera, Noctuidae)

    Science.gov (United States)

    Dumas, Pascaline; Barbut, Jérôme; Le Ru, Bruno; Silvain, Jean-François; Clamens, Anne-Laure; d’Alençon, Emmanuelle; Kergoat, Gael J.

    2015-01-01

    Nowadays molecular species delimitation methods promote the identification of species boundaries within complex taxonomic groups by adopting innovative species concepts and theories (e.g. branching patterns, coalescence). As some of them can efficiently deal with large single-locus datasets, they could speed up the process of species discovery compared to more time consuming molecular methods, and benefit from the existence of large public datasets; these methods can also particularly favour scientific research and actions dealing with threatened or economically important taxa. In this study we aim to investigate and clarify the status of economically important moths species belonging to the genus Spodoptera (Lepidoptera, Noctuidae), a complex group in which previous phylogenetic analyses and integrative approaches already suggested the possible occurrence of cryptic species and taxonomic ambiguities. In this work, the effectiveness of innovative (and faster) species delimitation approaches to infer putative species boundaries has been successfully tested in Spodoptera, by processing the most comprehensive dataset (in terms of number of species and specimens) ever achieved; results are congruent and reliable, irrespective of the set of parameters and phylogenetic models applied. Our analyses confirm the existence of three potential new species clusters (for S. exigua (Hübner, 1808), S. frugiperda (J.E. Smith, 1797) and S. mauritia (Boisduval, 1833)) and support the synonymy of S. marima (Schaus, 1904) with S. ornithogalli (Guenée, 1852). They also highlight the ambiguity of the status of S. cosmiodes (Walker, 1858) and S. descoinsi Lalanne-Cassou & Silvain, 1994. This case study highlights the interest of molecular species delimitation methods as valuable tools for species discovery and to emphasize taxonomic ambiguities. PMID:25853412

  6. Phylogenetic molecular species delimitations unravel potential new species in the pest genus Spodoptera Guenée, 1852 (Lepidoptera, Noctuidae.

    Directory of Open Access Journals (Sweden)

    Pascaline Dumas

    Full Text Available Nowadays molecular species delimitation methods promote the identification of species boundaries within complex taxonomic groups by adopting innovative species concepts and theories (e.g. branching patterns, coalescence. As some of them can efficiently deal with large single-locus datasets, they could speed up the process of species discovery compared to more time consuming molecular methods, and benefit from the existence of large public datasets; these methods can also particularly favour scientific research and actions dealing with threatened or economically important taxa. In this study we aim to investigate and clarify the status of economically important moths species belonging to the genus Spodoptera (Lepidoptera, Noctuidae, a complex group in which previous phylogenetic analyses and integrative approaches already suggested the possible occurrence of cryptic species and taxonomic ambiguities. In this work, the effectiveness of innovative (and faster species delimitation approaches to infer putative species boundaries has been successfully tested in Spodoptera, by processing the most comprehensive dataset (in terms of number of species and specimens ever achieved; results are congruent and reliable, irrespective of the set of parameters and phylogenetic models applied. Our analyses confirm the existence of three potential new species clusters (for S. exigua (Hübner, 1808, S. frugiperda (J.E. Smith, 1797 and S. mauritia (Boisduval, 1833 and support the synonymy of S. marima (Schaus, 1904 with S. ornithogalli (Guenée, 1852. They also highlight the ambiguity of the status of S. cosmiodes (Walker, 1858 and S. descoinsi Lalanne-Cassou & Silvain, 1994. This case study highlights the interest of molecular species delimitation methods as valuable tools for species discovery and to emphasize taxonomic ambiguities.

  7. Next generation diagnostic molecular pathology: critical appraisal of quality assurance in Europe.

    Science.gov (United States)

    Dubbink, Hendrikus J; Deans, Zandra C; Tops, Bastiaan B J; van Kemenade, Folkert J; Koljenović, S; van Krieken, Han J M; Blokx, Willeke A M; Dinjens, Winand N M; Groenen, Patricia J T A

    2014-06-01

    Tumor evaluation in pathology is more and more based on a combination of traditional histopathology and molecular analysis. Due to the rapid development of new cancer treatments that specifically target aberrant proteins present in tumor cells, treatment decisions are increasingly based on the molecular features of the tumor. Not only the number of patients eligible for targeted precision medicine, but also the number of molecular targets per patient and tumor type is rising. Diagnostic molecular pathology, the discipline that determines the molecular aberrations present in tumors for diagnostic, prognostic or predictive purposes, is faced with true challenges. The laboratories have to meet the need of comprehensive molecular testing using only limited amount of tumor tissue, mostly fixed in formalin and embedded in paraffin (FFPE), in short turnaround time. Choices must be made for analytical methods that provide accurate, reliable and cost-effective results. Validation of the test procedures and results is essential. In addition, participation and good performance in internal (IQA) and external quality assurance (EQA) schemes is mandatory. In this review, we critically evaluate the validation procedure for comprehensive molecular tests as well as the organization of quality assurance and assessment of competence of diagnostic molecular pathology laboratories within Europe. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  8. Identification of a vertically transmitted strain from Anaplasma marginale (UFMG3): Molecular and phylogenetic characterization, and evaluation of virulence.

    Science.gov (United States)

    Silvestre, Bruna T; Silveira, Júlia A G; Meneses, Rodrigo M; Facury-Filho, Elias J; Carvalho, Antônio U; Ribeiro, Múcio F B

    2016-02-01

    Bovine anaplasmosis is a disease caused by the intraerythrocytic rickettsia species Anaplasma marginale and results in great economic losses in tropical and subtropical regions. Vertical transmission is an important phenomenon that contributes to the persistence of different strains of the agent within the same herd. The identification of new strains and genetic characterization studies are essential to understanding their epidemiology and virulence and for vaccine development. The aim of this study was to perform molecular and phylogenetic characterizations of a new vertically transmitted strain from A. marginale and to evaluate its virulence by experimental inoculation of rickettsia-free calves. Thirty newborn Holstein calves were subjected to molecular tests for the detection of A. marginale, Babesia bovis and Babesia bigemina. Calves positive for A. marginale (n=3) were splenectomized and monitored for the clinical manifestations of anaplasmosis. Blood samples from one of the calves that presented rickettsemia of 42.8% and spontaneous recovery of clinical parameters were used for molecular and phylogenetic characterization (msp1a gene), and inoculum production was used for the evaluation of virulence. This strain was identified as UFMG3. Three tandem repeat forms (13 and MGI19) were identified from the analysis of the msp1a gene, in which the form MGI19 appeared twice. Analysis of these repeats revealed the presence of the sequences QASTSS and SSASGQQQESS and of aspartic acid (D) at position 20 of both repeats. Phylogenetic analysis showed a close relationship among the UFMG3, MGI19 and UFMG2 strains. For virulence evaluation, six Holstein calves were inoculated intravenously with 2×10(7)A. marginale UFMG3-infected erythrocytes. The calves showed maximum rickettsemia of 5.1%, a moderate decrease in packed cell volume and spontaneous recovery of clinical parameters without the need for treatment. The results of experimental inoculation suggest that the strain A

  9. Phylogenetic analysis of Puumala virus strains from Central Europe highlights the need for a full-genome perspective on hantavirus evolution.

    Science.gov (United States)

    Szabó, Róbert; Radosa, Lukáš; Ličková, Martina; Sláviková, Monika; Heroldová, Marta; Stanko, Michal; Pejčoch, Milan; Osterberg, Anja; Laenen, Lies; Schex, Susanne; Ulrich, Rainer G; Essbauer, Sandra; Maes, Piet; Klempa, Boris

    2017-12-01

    Puumala virus (PUUV), carried by bank voles (Myodes glareolus), is the medically most important hantavirus in Central and Western Europe. In this study, a total of 523 bank voles (408 from Germany, 72 from Slovakia, and 43 from Czech Republic) collected between the years 2007-2012 were analyzed for the presence of hantavirus RNA. Partial PUUV genome segment sequences were obtained from 51 voles. Phylogenetic analyses of all three genome segments showed that the newfound strains cluster with other Central and Western European PUUV strains. The new sequences from Šumava (Bohemian Forest), Czech Republic, are most closely related to the strains from the neighboring Bavarian Forest, a known hantavirus disease outbreak region. Interestingly, the Slovak strains clustered with the sequences from Bohemian and Bavarian Forests only in the M but not S segment analyses. This well-supported topological incongruence suggests a segment reassortment event or, as we analyzed only partial sequences, homologous recombination. Our data highlight the necessity of sequencing all three hantavirus genome segments and of a broader bank vole screening not only in recognized endemic foci but also in regions with no reported human hantavirus disease cases.

  10. Phylogenetic estimates of diversification rate are affected by molecular rate variation.

    Science.gov (United States)

    Duchêne, D A; Hua, X; Bromham, L

    2017-10-01

    Molecular phylogenies are increasingly being used to investigate the patterns and mechanisms of macroevolution. In particular, node heights in a phylogeny can be used to detect changes in rates of diversification over time. Such analyses rest on the assumption that node heights in a phylogeny represent the timing of diversification events, which in turn rests on the assumption that evolutionary time can be accurately predicted from DNA sequence divergence. But there are many influences on the rate of molecular evolution, which might also influence node heights in molecular phylogenies, and thus affect estimates of diversification rate. In particular, a growing number of studies have revealed an association between the net diversification rate estimated from phylogenies and the rate of molecular evolution. Such an association might, by influencing the relative position of node heights, systematically bias estimates of diversification time. We simulated the evolution of DNA sequences under several scenarios where rates of diversification and molecular evolution vary through time, including models where diversification and molecular evolutionary rates are linked. We show that commonly used methods, including metric-based, likelihood and Bayesian approaches, can have a low power to identify changes in diversification rate when molecular substitution rates vary. Furthermore, the association between the rates of speciation and molecular evolution rate can cause the signature of a slowdown or speedup in speciation rates to be lost or misidentified. These results suggest that the multiple sources of variation in molecular evolutionary rates need to be considered when inferring macroevolutionary processes from phylogenies. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.

  11. Molecular cytogenetic (FISH and genome analysis of diploid wheatgrasses and their phylogenetic relationship.

    Directory of Open Access Journals (Sweden)

    Gabriella Linc

    Full Text Available This paper reports detailed FISH-based karyotypes for three diploid wheatgrass species Agropyron cristatum (L. Beauv., Thinopyrum bessarabicum (Savul.&Rayss A. Löve, Pseudoroegneria spicata (Pursh A. Löve, the supposed ancestors of hexaploid Thinopyrum intermedium (Host Barkworth & D.R.Dewey, compiled using DNA repeats and comparative genome analysis based on COS markers. Fluorescence in situ hybridization (FISH with repetitive DNA probes proved suitable for the identification of individual chromosomes in the diploid JJ, StSt and PP genomes. Of the seven microsatellite markers tested only the (GAAn trinucleotide sequence was appropriate for use as a single chromosome marker for the P. spicata AS chromosome. Based on COS marker analysis, the phylogenetic relationship between diploid wheatgrasses and the hexaploid bread wheat genomes was established. These findings confirmed that the J and E genomes are in neighbouring clusters.

  12. In Silico Phylogenetic Analysis and Molecular Modelling Study of 2-Haloalkanoic Acid Dehalogenase Enzymes from Bacterial and Fungal Origin

    Directory of Open Access Journals (Sweden)

    Raghunath Satpathy

    2016-01-01

    Full Text Available 2-Haloalkanoic acid dehalogenase enzymes have broad range of applications, starting from bioremediation to chemical synthesis of useful compounds that are widely distributed in fungi and bacteria. In the present study, a total of 81 full-length protein sequences of 2-haloalkanoic acid dehalogenase from bacteria and fungi were retrieved from NCBI database. Sequence analysis such as multiple sequence alignment (MSA, conserved motif identification, computation of amino acid composition, and phylogenetic tree construction were performed on these primary sequences. From MSA analysis, it was observed that the sequences share conserved lysine (K and aspartate (D residues in them. Also, phylogenetic tree indicated a subcluster comprised of both fungal and bacterial species. Due to nonavailability of experimental 3D structure for fungal 2-haloalkanoic acid dehalogenase in the PDB, molecular modelling study was performed for both fungal and bacterial sources of enzymes present in the subcluster. Further structural analysis revealed a common evolutionary topology shared between both fungal and bacterial enzymes. Studies on the buried amino acids showed highly conserved Leu and Ser in the core, despite variation in their amino acid percentage. Additionally, a surface exposed tryptophan was conserved in all of these selected models.

  13. Molecular phylogenetics and species delimitation of leaf-toed geckos (Phyllodactylidae: Phyllodactylus) throughout the Mexican tropical dry forest.

    Science.gov (United States)

    Blair, Christopher; Méndez de la Cruz, Fausto R; Law, Christopher; Murphy, Robert W

    2015-03-01

    Methods and approaches for accurate species delimitation continue to be a highly controversial subject in the systematics community. Inaccurate assessment of species' limits precludes accurate inference of historical evolutionary processes. Recent evidence suggests that multilocus coalescent methods show promise in delimiting species in cryptic clades. We combine multilocus sequence data with coalescence-based phylogenetics in a hypothesis-testing framework to assess species limits and elucidate the timing of diversification in leaf-toed geckos (Phyllodactylus) of Mexico's dry forests. Tropical deciduous forests (TDF) of the Neotropics are among the planet's most diverse ecosystems. However, in comparison to moist tropical forests, little is known about the mode and tempo of biotic evolution throughout this threatened biome. We find increased speciation and substantial, cryptic molecular diversity originating following the formation of Mexican TDF 30-20million years ago due to orogenesis of the Sierra Madre Occidental and Mexican Volcanic Belt. Phylogenetic results suggest that the Mexican Volcanic Belt, the Rio Fuerte, and Isthmus of Tehuantepec may be important biogeographic barriers. Single- and multilocus coalescent analyses suggest that nearly every sampling locality may be a distinct species. These results suggest unprecedented levels of diversity, a complex evolutionary history, and that the formation and expansion of TDF vegetation in the Miocene may have influenced subsequent cladogenesis of leaf-toed geckos throughout western Mexico. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. A member of the HSP90 family from ovine Babesia in China: molecular characterization, phylogenetic analysis and antigenicity.

    Science.gov (United States)

    Guan, Guiquan; Liu, Junlong; Liu, Aihong; Li, Youquan; Niu, Qingli; Gao, Jinliang; Luo, Jianxun; Chauvin, Alain; Yin, Hong; Moreau, Emmanuelle

    2015-09-01

    Heat shock protein 90 (HSP90) is a key component of the molecular chaperone complex essential for activating many signalling proteins involved in the development and progression of pathogenic cellular transformation. A Hsp90 gene (BQHsp90) was cloned and characterized from Babesia sp. BQ1 (Lintan), an ovine Babesia isolate belonging to Babesia motasi-like group, by screening a cDNA expression library and performing rapid amplification of cDNA ends. The full-length cDNA of BQHsp90 is 2399 bp with an open reading frame of 2154 bp encoding a predicted 83 kDa polypeptide with 717 amino acid residues. It shows significant homology and similar structural characteristics to Hsp90 of other apicomplex organisms. Phylogenetic analysis, based on the HSP90 amino acid sequences, showed that the Babesia genus is clearly separated from other apicomplexa genera. Five Chinese ovine Babesia isolates were divided into 2 phylogenetic clusters, namely Babesia sp. Xinjiang (previously designated a new species) cluster and B. motasi-like cluster which could be further divided into 2 subclusters (Babesia sp. BQ1 (Lintan)/Babesia sp. Tianzhu and Babesia sp. BQ1 (Ningxian)/Babesia sp. Hebei). Finally, the antigenicity of rBQHSP90 protein from prokaryotic expression was also evaluated using western blot and enzyme-linked immunosorbent assay (ELISA).

  15. Molecular Epidemiology and Phylogenetic Analyses of Influenza B Virus in Thailand during 2010 to 2014

    Science.gov (United States)

    Tewawong, Nipaporn; Suwannakarn, Kamol; Prachayangprecha, Slinporn; Korkong, Sumeth; Vichiwattana, Preeyaporn; Vongpunsawad, Sompong; Poovorawan, Yong

    2015-01-01

    Influenza B virus remains a major contributor to the seasonal influenza outbreak and its prevalence has increased worldwide. We investigated the epidemiology and analyzed the full genome sequences of influenza B virus strains in Thailand between 2010 and 2014. Samples from the upper respiratory tract were collected from patients diagnosed with influenza like-illness. All samples were screened for influenza A/B viruses by one-step multiplex real-time RT-PCR. The whole genome of 53 influenza B isolates were amplified, sequenced, and analyzed. From 14,418 respiratory samples collected during 2010 to 2014, a total of 3,050 tested positive for influenza virus. Approximately 3.27% (471/14,418) were influenza B virus samples. Fifty three isolates of influenza B virus were randomly chosen for detailed whole genome analysis. Phylogenetic analysis of the HA gene showed clusters in Victoria clades 1A, 1B, 3, 5 and Yamagata clades 2 and 3. Both B/Victoria and B/Yamagata lineages were found to co-circulate during this time. The NA sequences of all isolates belonged to lineage II and consisted of viruses from both HA Victoria and Yamagata lineages, reflecting possible reassortment of the HA and NA genes. No significant changes were seen in the NA protein. The phylogenetic trees generated through the analysis of the PB1 and PB2 genes closely resembled that of the HA gene, while trees generated from the analysis of the PA, NP, and M genes showed similar topology. The NS gene exhibited the pattern of genetic reassortment distinct from those of the PA, NP or M genes. Thus, antigenic drift and genetic reassortment among the influenza B virus strains were observed in the isolates examined. Our findings indicate that the co-circulation of two distinct lineages of influenza B viruses and the limitation of cross-protection of the current vaccine formulation provide support for quadrivalent influenza vaccine in this region. PMID:25602617

  16. Molecular phylogenetics of the genus Neoconocephalus (orthoptera, tettigoniidae and the evolution of temperate life histories.

    Directory of Open Access Journals (Sweden)

    Robert L Snyder

    Full Text Available BACKGROUND: The katydid genus Neoconocephalus (25+ species has a prominent acoustic communication system and occurs in large parts of the Neotropics and Nearctic. This group has been subject of numerous behavioral, physiological, and evolutionary studies of its acoustic communication system. Two distinct life histories occur in this group: The tropical life history incorporates multiple generations/year and direct egg development without environmental triggers. Temperate life history is characterized by overwintering in the egg stage, cold trigger of egg development, and one generation/year. This study reconstructs the phylogenetic relationships within the genus to (1 determine the evolutionary history of the temperate life history, and (2 to support comparative studies of evolutionary and physiological problems in this genus. METHODOLOGY/PRINCIPAL FINDINGS: We used Amplified Fragment Length Polymorphisms (AFLP, and sequences of two nuclear loci and one mitochondrial locus to reconstruct phylogenetic relationships. The analysis included 17 ingroup and two outgroup species. AFLP and mitochondrial data provided resolution at the species level while the two nuclear loci revealed only deeper nodes. The data sets were combined in a super-matrix to estimate a total evidence tree. Seven of the temperate species form a monophyletic group; however, three more temperate species were placed as siblings of tropical species. CONCLUSIONS/SIGNIFICANCE: Our analyses support the reliability of the current taxonomic treatment of the Neoconocephalus fauna of Caribbean, Central, and North America. Ancestral state reconstruction of life history traits was not conclusive, however at least four transitions between life histories occurred among our sample of species. The proposed phylogeny will strengthen conclusions from comparative work in this group.

  17. Molecular phylogenetics, vocalizations, and species limits in Celeus woodpeckers (Aves: Picidae).

    Science.gov (United States)

    Benz, Brett W; Robbins, Mark B

    2011-10-01

    Species limits and the evolutionary mechanisms that have shaped diversification of woodpeckers and allies (Picidae) remain obscure, as inter and intraspecific phylogenetic relationships have yet to be comprehensively resolved for most genera. Herein, we analyzed 5020 base pairs of nucleotide sequence data from the mitochondrial and nuclear genomes to reconstruct the evolutionary history of Celeus woodpeckers. Broad geographic sampling was employed to assess species limits in phenotypically variable lineages and provide a first look at the evolution of song and plumage traits in this poorly known Neotropical genus. Our results strongly support the monophyly of Celeus and reveal several novel relationships across a shallow phylogenetic topology. We confirm the close sister relationship between Celeus spectabilis and the enigmatic Celeus obrieni, both of which form a clade with Celeus flavus. The Mesoamerican Celeus castaneus was placed as sister to a Celeus undatus-grammicus lineage, with the species status of the latter drawn into question given the lack of substantial genetic, morphological, and vocal variation in these taxa. We recovered paraphyly in Celeus elegans; however, this result appears to be the consequence of mitochondrial introgression from Celeus lugubris considering the monophyly of elegans at the ß-FIBI7 locus. A second instance of paraphyly was observed in Celeus flavescens with deep genetic splits and substantial phenotypic variation indicating the presence of two distinct species in this broadly distributed lineage. As such, we advocate elevation of Celeus flavescens ochraceus to species status. Our analysis of Celeus vocalizations and plumage characters demonstrates a pattern of lability consistent with a relatively recent origin of the genus and potentially rapid speciation history. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Molecular characterization and phylogenetic analysis of infectious bursal disease viruses isolated from chicken in South China in 2011.

    Science.gov (United States)

    Liu, Di; Zhang, Xiang-Bin; Yan, Zhuan-Qiang; Chen, Feng; Ji, Jun; Qin, Jian-Ping; Li, Hai-Yan; Lu, Jun-Peng; Xue, Yu; Liu, Jia-Jia; Xie, Qing-Mei; Ma, Jing-Yun; Xue, Chun-Yi; Bee, Ying-Zuo

    2013-06-01

    Infectious bursal disease virus (IBDV) is a double-stranded RNA virus that causes immunosuppressive disease in young chickens. Thousands of cases of IBDV infection are reported each year in South China, and these infections can result in considerable economic losses to the poultry industry. To monitor variations of the virus during the outbreaks, 30 IBDVs were identified from vaccinated chicken flocks from nine provinces in South China in 2011. VP2 fragments from different virus strains were sequenced and analyzed by comparison with the published sequences of IBDV strains from China and around the world. Phylogenetic analysis of hypervariable regions of the VP2 (vVP2) gene showed that 29 of the isolates were very virulent (vv) IBDVs, and were closely related to vvIBDV strains from Europe and Asia. Alignment analysis of the deduced amino acid (aa) sequences of vVP2 showed the 29 vv isolates had high uniformity, indicated low variability and slow evolution of the virus. The non-vvIBDV isolate JX2-11 was associated with higher than expected mortality, and had high deduced aa sequence similarity (99.2 %) with the attenuated vaccine strain B87 (BJ). The present study has demonstrated the continued circulation of IBDV strains in South China, and emphasizes the importance of reinforcing IBDV surveillance.

  19. Molecular characterization and phylogenetic relatedness of dog-derived Rabies Viruses circulating in Cameroon between 2010 and 2016.

    Directory of Open Access Journals (Sweden)

    Serge Alain Sadeuh-Mba

    2017-10-01

    Full Text Available Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5-100% nucleotide (nt and 98.3-100% amino-acid (aa identities to each other while, the 5 studied Africa-2 isolates shared 99.4-99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment

  20. Molecular characterization and phylogenetic relatedness of dog-derived Rabies Viruses circulating in Cameroon between 2010 and 2016.

    Science.gov (United States)

    Sadeuh-Mba, Serge Alain; Momo, Jean Blaise; Besong, Laura; Loul, Sévérin; Njouom, Richard

    2017-10-01

    Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV) has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N) gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5-100% nucleotide (nt) and 98.3-100% amino-acid (aa) identities to each other while, the 5 studied Africa-2 isolates shared 99.4-99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment of the enzootic

  1. Molecular and phylogenetic analysis of the filarial nematode Micipsella numidica from the hare Lepus europaeus in Italy.

    Science.gov (United States)

    Gabrielli, S; Galuppi, R; Fraulo, M; Savini, F; Morandi, B; Cancrini, G; Poglayen, G

    2016-07-01

    The genus Micipsella comprises three species of filariae to date identified in lagomorphs only, whereas the other genera belonging to the subfamily Splendidofilariinae are described as parasites of birds, reptiles and mammals. In the present study seven specimens of Micipsella numidica (Seurat, 1917), collected from the hare Lepus europaeus in Italy, were characterized genetically by molecular amplification of the mitochondrial genes (12S rDNA; cox1) and the 5S rDNA gene spacer region. Phylogenetic trees inferred using available sequences from filariae and those identified in this study evidenced a close relationship between M. numidica and Splendidofilariinae of other mammals and reptiles (Rumenfilaria andersoni and Madathamugadia hiepei). The present findings, apart from adding new data about the hosts in Italy, support the taxonomic position of M. numidica and highlight the substantial biological and molecular differences existing between Splendidofilariinae and other Onchocercidae. The study also contributes to our knowledge of the molecular/genetic diagnosis of filarial parasites of veterinary and medical concern in any vertebrate or invertebrate host.

  2. Evolutionary history of tall fescue morphotypes inferred from molecular phylogenetics of the Lolium-Festuca species complex

    Directory of Open Access Journals (Sweden)

    Stewart Alan V

    2010-10-01

    phylogenetic analysis of the Festuca genus to include representatives of each tall fescue morphotype, and to use low copy nuclear gene-derived sequences to identify putative progenitors of the polyploid species. The demonstration of distinct tall fescue lineages has implications for both taxonomy and molecular breeding strategies, and may facilitate the generation of morphotype and/or sub-genome-specific molecular markers.

  3. Molecular diagnostics of aleutian mink disease virus: applied use of next generation sequencing and phylogenetics

    DEFF Research Database (Denmark)

    Hagberg, Emma Elisabeth

    based either on partial or entire genes, or on pure epidemiological data. Thus, when initiating this project, little was known about AMDV’s total genomic diversity and how the virus was spread between farms. Recent advances in the field of molecular diagnostics have made high throughput tools...... could contribute to the elucidation of AMDV transmission between farms and improve molecular diagnostics. During the first phase of this project a method for performing whole genome sequencing of AMDV was developed. This protocol enabled the sequencing of a large number of in vivo infectious AMDV......-estimates. Altogether, the work presented in this thesis provides a contribution to the molecular diagnostics of AMDV, enables us better to understand the virus’ evolutionary behaviour in the context of mink farming, and is anticipated to be of value for more accurately tracing back in time the emergence of future...

  4. Molecular and phylogenetic analysis of Anaplasma spp. in sheep and goats from six provinces of China.

    Science.gov (United States)

    Zhang, Yan; Lv, Yali; Zhang, Feifei; Zhang, Wenjing; Wang, Jinhong; Cui, Yanyan; Wang, Rongjun; Jian, Fuchun; Zhang, Longxian; Ning, Changshen

    2016-12-30

    Members of the genus Anaplasma are important emerging tick-borne pathogens in both humans and animals in tropical and subtropical areas. Here, we investigated the presence of Anaplasma spp. in 621 sheep and 710 goats from six provinces of China. Polymerase chain reaction (PCR) and DNA sequencing were conducted to determine the prevalence of Anaplasma (A.) phagocytophilum, A. ovis and A. bovis targeting the 16S ribosomal RNA or the major surface protein 4 gene. PCR revealed Anaplasma in 39.0% (240/621) of sheep and 45.5% (323/710) of goats. The most frequently detected species was A. ovis (88/621, 14.2% for sheep; 129/710, 18.2% for goats), followed by A. bovis (60/621, 9.7% for sheep; 74/710, 10.4% for goats) and A. phagocytophilum (33/621, 5.3% for sheep; 15/710, 2.1% for goats). Additionally, eight sheep and 20 goats were found to be infected with three pathogens simultaneously. DNA sequencing confirmed the presence of these three Anaplasma species in the investigated areas, and phylogenetic analysis indicated that there was geographic segregation to a certain extent, as well as a relationship between the host and cluster of A. ovis. The results of the present study provide valuable data that helps understand the epidemiology of anaplasmosis in ruminants from China.

  5. Molecular characterization and phylogenetic analysis of Fasciola gigantica from western Java, Indonesia.

    Science.gov (United States)

    Hayashi, Kei; Ichikawa-Seki, Madoka; Allamanda, Puttik; Wibowo, Putut Eko; Mohanta, Uday Kumar; Sodirun; Guswanto, Azirwan; Nishikawa, Yoshifumi

    2016-10-01

    Fasciola gigantica and aspermic (hybrid) Fasciola flukes are thought to be distributed in Southeast Asian countries. The objectives of this study were to investigate the distribution of these flukes from unidentified ruminants in western Java, Indonesia, and to determine their distribution history into the area. Sixty Fasciola flukes from western Java were identified as F. gigantica based on the nucleotide sequences of the nuclear phosphoenolpyruvate carboxykinase (pepck) and DNA polymerase delta (pold) genes. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial NADH dehydrogenase subunit 1 (nad1) gene, together with Fasciola flukes from other Asian countries. All but one F. gigantica fluke were classified in F. gigantica haplogroup C, which mainly contains nad1 haplotypes detected in flukes from Thailand, Vietnam, and China. A population genetic analysis suggested that haplogroup C spread from Thailand to the neighboring countries including Indonesia together with domestic ruminants, such as the swamp buffalo, Bubalus bubalis. The swamp buffalo is one of the important definitive hosts of Fasciola flukes in Indonesia, and is considered to have been domesticated in the north of Thailand. The remaining one fluke displayed a novel nad1 haplotype that has never been detected in the reference countries. Therefore, the origin of the fluke could not be established. No hybrid Fasciola flukes were detected in this study, in contrast to neighboring Asian countries. Copyright © 2016. Published by Elsevier Ireland Ltd.

  6. The age and evolution of sociality in Stegodyphus spiders: a molecular phylogenetic perspective

    DEFF Research Database (Denmark)

    Johannesen, Jes; Lubin, Yael; Smith, Deborah R.

    2007-01-01

    suggested to be unstable in evolutionary time, and hence sociality a rare phenomenon in spiders. Based on a partial molecular phylogeny of the genus Stegodyphus, we address the hypothesis that social spiders in this genus are evolutionary transient. We estimate the age of the three social species, test...

  7. Parasite histories and novel phylogenetic tools: alternative approaches to inferring parasite evolution from molecular markers

    Czech Academy of Sciences Publication Activity Database

    Hypša, Václav

    2006-01-01

    Roč. 36, č. 2 (2006), s. 141-155 ISSN 0020-7519 R&D Projects: GA ČR GA206/04/0520 Institutional research plan: CEZ:AV0Z60220518 Keywords : molecular phylogeny * parasite evolution Subject RIV: EE - Microbiology, Virology Impact factor: 3.337, year: 2006

  8. Incidence, Diversity, and Molecular Epidemiology of Sapoviruses in Swine across Europe

    DEFF Research Database (Denmark)

    Reuter, G.; Zimsek-Mijovski, J.; Poljsak-Prijatelj, M.

    2010-01-01

    report on the incidence, genetic diversity and molecular epidemiology of sapoviruses detected in domestic pigs in a comprehensive study conducted in six European countries (Denmark, Finland, Hungary, Italy, Slovenia and Spain) between 2004 and 2007. A total of 1,050 swine fecal samples from 88 pig farms......) to human sapovirus strains. Sapoviruses are commonly circulating and endemic agents in swine herds throughout Europe. Highly heterogenous and potential new genogroups of sapoviruses were found in pigs; however, no "human-like" sapoviruses were detected....

  9. Big and slow: phylogenetic estimates of molecular evolution in baleen whales (suborder mysticeti).

    Science.gov (United States)

    Jackson, J A; Baker, C S; Vant, M; Steel, D J; Medrano-González, L; Palumbi, S R

    2009-11-01

    Baleen whales are the largest animals that have ever lived. To develop an improved estimation of substitution rate for nuclear and mitochondrial DNA for this taxon, we implemented a relaxed-clock phylogenetic approach using three fossil calibration dates: the divergence between odontocetes and mysticetes approximately 34 million years ago (Ma), between the balaenids and balaenopterids approximately 28 Ma, and the time to most recent common ancestor within the Balaenopteridae approximately 12 Ma. We examined seven mitochondrial genomes, a large number of mitochondrial control region sequences (219 haplotypes for 465 bp) and nine nuclear introns representing five species of whales, within which multiple species-specific alleles were sequenced to account for within-species diversity (1-15 for each locus). The total data set represents >1.65 Mbp of mitogenome and nuclear genomic sequence. The estimated substitution rate for the humpback whale control region (3.9%/million years, My) was higher than previous estimates for baleen whales but slow relative to other mammal species with similar generation times (e.g., human-chimp mean rate > 20%/My). The mitogenomic third codon position rate was also slow relative to other mammals (mean estimate 1%/My compared with a mammalian average of 9.8%/My for the cytochrome b gene). The mean nuclear genomic substitution rate (0.05%/My) was substantially slower than average synonymous estimates for other mammals (0.21-0.37%/My across a range of studies). The nuclear and mitogenome rate estimates for baleen whales were thus roughly consistent with an 8- to 10-fold slowing due to a combination of large body size and long generation times. Surprisingly, despite the large data set of nuclear intron sequences, there was only weak and conflicting support for alternate hypotheses about the phylogeny of balaenopterid whales, suggesting that interspecies introgressions or a rapid radiation has obscured species relationships in the nuclear genome.

  10. Molecular differentiation and phylogenetic analysis of the Egyptian foot-and-mouth disease virus SAT2.

    Science.gov (United States)

    El-Shehawy, Laila I; Abu-Elnaga, Hany I; Rizk, Sonia A; Abd El-Kreem, Ahmed S; Mohamed, A A; Fawzy, Hossam G

    2014-03-01

    In February 2012, a massive new foot-and-mouth disease (FMD) outbreak struck Egypt. In this work, one-step RT-PCR assays were used for in-house detection and differentiation of foot-and-mouth disease virus (FMDV) in Egypt in this year using pan-serotypic and serotype-targeting sequence primers. FMDV SAT2 was the dominant virus in the examined isolates from the epidemic. The complete VP1 coding regions of two isolates were sequenced. The two isolates had 99.2 % sequence identity to most contemporary Egyptian SAT2 reference viruses, whereas they had 89.7-90.1 % identity to the SAT2/EGY/2/2012 isolate, which was collected from Alexandria, Egypt, and previously sequenced by WRLFMD. Phylogenetic analysis showed that Egypt had one topotype and two lineage of FMDV SAT2 in 2012. The Egyptian and the Palestinian 2012 strains were associated mainly with topotype VII, lineage SAT2/VII/Ghb-12, while the virus isolated from Alexandria Governorate belonged to the SAT2/VII/Alx-12 lineage. Topotype VII also comprised lineages that included strains isolated from Libya in 2012 and 2003. Furthermore, within the same topotype, the Egyptian SAT2/2012 isolates were related to strains from Saudi Arabia, Sudan, Eritrea, Cameroon and Nigeria. Nevertheless, more epidemiological work with neighboring countries is needed to prevent cross-border spread of disease and to reach a precise conclusion about the origin of the 2012 FMDV SAT2 emergency in the Middle East.

  11. Molecular characterization and phylogenetic analysis of Sugarcane yellow leaf virus isolates from China.

    Science.gov (United States)

    Gao, San-Ji; Lin, Yi-Hua; Pan, Yong-Bao; Damaj, Mona B; Wang, Qin-Nan; Mirkov, T Erik; Chen, Ru-Kai

    2012-10-01

    Sugarcane yellow leaf virus (SCYLV) (genus Polerovirus, family Luteoviridae), the causal agent of sugarcane yellow leaf disease (YLD), was first detected in China in 2006. To assess the distribution of SCYLV in the major sugarcane-growing Chinese provinces, leaf samples from 22 sugarcane clones (Saccharum spp. hybrid) showing YLD symptoms were collected and analyzed for infection by the virus using reverse transcription PCR (RT-PCR), quantitative RT-PCR, and immunological assays. A complete genomic sequence (5,879 nt) of the Chinese SCYLV isolate CHN-FJ1 and partial genomic sequences (2,915 nt) of 13 other Chinese SCYLV isolates from this study were amplified, cloned, and sequenced. The genomic sequence of the CHN-FJ1 isolate was found to share a high identity (98.4-99.1 %) with those of the Brazilian (BRA) genotype isolates and a low identity (86.5-86.9 %) with those of the CHN1 and Cuban (CUB) genotype isolates. The genetic diversity of these 14 Chinese SCYLV isolates was assessed along with that of 29 SCYLV isolates of worldwide origin reported in the GenBank database, based on the full or partial genomic sequence. Phylogenetic analysis demonstrated that all the 14 Chinese SCYLV isolates clustered into one large group with the BRA genotype and 12 other reported SCYLV isolates. In addition, five reported Chinese SCYLV isolates were grouped with the Peruvian (PER), CHN1 and CUB genotypes. We therefore speculated that at least four SCYLV genotypes, BRA, PER, CHN1, and CUB, are associated with YLD in China. Interestingly, a 39-nt deletion was detected in the sequence of the CHN-GD3 isolate, in the middle of the ORF1 region adjacent to the overlap between ORF1 and ORF2. This location is known to be one of the recombination breakpoints in the Luteoviridae family.

  12. Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Hrabcová, M.; Pecková, Hana; Patra, Sneha; Kodádková, Alena; Jurajda, Pavel; Tyml, Tomáš; Holzer, Astrid S.

    2014-01-01

    Roč. 44, č. 8 (2014), s. 565-577 ISSN 0020-7519 R&D Projects: GA ČR(CZ) GPP506/11/P724; GA ČR GBP505/12/G112; GA AV ČR(CZ) M200961205 Institutional support: RVO:60077344 ; RVO:68081766 Keywords : Buddenbrockia * Tetracapsuloides * diversity * phylogeny * Bryozoa * fish * cryptic * worm Subject RIV: EB - Genetics ; Molecular Biology; EG - Zoology (UBO-W) Impact factor: 3.872, year: 2014

  13. DOMINO: development of informative molecular markers for phylogenetic and genome-wide population genetic studies in non-model organisms.

    Science.gov (United States)

    Frías-López, Cristina; Sánchez-Herrero, José F; Guirao-Rico, Sara; Mora, Elisa; Arnedo, Miquel A; Sánchez-Gracia, Alejandro; Rozas, Julio

    2016-12-15

    The development of molecular markers is one of the most important challenges in phylogenetic and genome wide population genetics studies, especially in studies with non-model organisms. A highly promising approach for obtaining suitable markers is the utilization of genomic partitioning strategies for the simultaneous discovery and genotyping of a large number of markers. Unfortunately, not all markers obtained from these strategies provide enough information for solving multiple evolutionary questions at a reasonable taxonomic resolution. We have developed Development Of Molecular markers In Non-model Organisms (DOMINO), a bioinformatics tool for informative marker development from both next generation sequencing (NGS) data and pre-computed sequence alignments. The application implements popular NGS tools with new utilities in a highly versatile pipeline specifically designed to discover or select personalized markers at different levels of taxonomic resolution. These markers can be directly used to study the taxa surveyed for their design, utilized for further downstream PCR amplification in a broader set taxonomic scope, or exploited as suitable templates to bait design for target DNA enrichment techniques. We conducted an exhaustive evaluation of the performance of DOMINO via computer simulations and illustrate its utility to find informative markers in an empirical dataset. DOMINO is freely available from www.ub.edu/softevol/domino CONTACT: elsanchez@ub.edu or jrozas@ub.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Molecular phylogenetic analysis supports a Gondwanan origin of the Hyriidae (Mollusca: Bivalvia: Unionida) and the paraphyly of Australasian taxa.

    Science.gov (United States)

    Graf, Daniel L; Jones, Hugh; Geneva, Anthony J; Pfeiffer, John M; Klunzinger, Michael W

    2015-04-01

    The freshwater mussel family Hyriidae (Mollusca: Bivalvia: Unionida) has a disjunct trans-Pacific distribution in Australasia and South America. Previous phylogenetic analyses have estimated the evolutionary relationships of the family and the major infra-familial taxa (Velesunioninae and Hyriinae: Hyridellini in Australia; Hyriinae: Hyriini, Castaliini, and Rhipidodontini in South America), but taxon and character sampling have been too incomplete to support a predictive classification or allow testing of biogeographical hypotheses. We sampled 30 freshwater mussel individuals representing the aforementioned hyriid taxa, as well as outgroup species representing the five other freshwater mussel families and their marine sister group (order Trigoniida). Our ingroup included representatives of all Australian genera. Phylogenetic relationships were estimated from three gene fragments (nuclear 28S, COI and 16S mtDNA) using maximum parsimony, maximum likelihood, and Bayesian inference, and we applied a Bayesian relaxed clock model calibrated with fossil dates to estimate node ages. Our analyses found good support for monophyly of the Hyriidae and the subfamilies and tribes, as well as the paraphyly of the Australasian taxa (Velesunioninae, (Hyridellini, (Rhipidodontini, (Castaliini, Hyriini)))). The Hyriidae was recovered as sister to a clade comprised of all other Recent freshwater mussel families. Our molecular date estimation supported Cretaceous origins of the major hyriid clades, pre-dating the Tertiary isolation of South America from Antarctica/Australia. We hypothesize that early diversification of the Hyriidae was driven by terrestrial barriers on Gondwana rather than marine barriers following disintegration of the super-continent. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Molecular Detection, Phylogenetic Analysis, and Identification of Transcription Motifs in Feline Leukemia Virus from Naturally Infected Cats in Malaysia

    Directory of Open Access Journals (Sweden)

    Faruku Bande

    2014-01-01

    Full Text Available A nested PCR assay was used to determine the viral RNA and proviral DNA status of naturally infected cats. Selected samples that were FeLV-positive by PCR were subjected to sequencing, phylogenetic analysis, and motifs search. Of the 39 samples that were positive for FeLV p27 antigen, 87.2% (34/39 were confirmed positive with nested PCR. FeLV proviral DNA was detected in 38 (97.3% of p27-antigen negative samples. Malaysian FeLV isolates are found to be highly similar with a homology of 91% to 100%. Phylogenetic analysis revealed that Malaysian FeLV isolates divided into two clusters, with a majority (86.2% sharing similarity with FeLV-K01803 and fewer isolates (13.8% with FeLV-GM1 strain. Different enhancer motifs including NF-GMa, Krox-20/WT1I-del2, BAF1, AP-2, TBP, TFIIF-beta, TRF, and TFIID are found to occur either in single, duplicate, triplicate, or sets of 5 in different positions within the U3-LTR-gag region. The present result confirms the occurrence of FeLV viral RNA and provirus DNA in naturally infected cats. Malaysian FeLV isolates are highly similar, and a majority of them are closely related to a UK isolate. This study provides the first molecular based information on FeLV in Malaysia. Additionally, different enhancer motifs likely associated with FeLV related pathogenesis have been identified.

  16. Calculation of evolutionary correlation between individual genes and full-length genome: a method useful for choosing phylogenetic markers for molecular epidemiology.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Individual genes or regions are still commonly used to estimate the phylogenetic relationships among viral isolates. The genomic regions that can faithfully provide assessments consistent with those predicted with full-length genome sequences would be preferable to serve as good candidates of the phylogenetic markers for molecular epidemiological studies of many viruses. Here we employed a statistical method to evaluate the evolutionary relationships between individual viral genes and full-length genomes without tree construction as a way to determine which gene can match the genome well in phylogenetic analyses. This method was performed by calculation of linear correlations between the genetic distance matrices of aligned individual gene sequences and aligned genome sequences. We applied this method to the phylogenetic analyses of porcine circovirus 2 (PCV2, measles virus (MV, hepatitis E virus (HEV and Japanese encephalitis virus (JEV. Phylogenetic trees were constructed for comparisons and the possible factors affecting the method accuracy were also discussed in the calculations. The results revealed that this method could produce results consistent with those of previous studies about the proper consensus sequences that could be successfully used as phylogenetic markers. And our results also suggested that these evolutionary correlations could provide useful information for identifying genes that could be used effectively to infer the genetic relationships.

  17. Phylogenetic relationships of Hemiuridae (Digenea: Hemiuroidea) with new morphometric and molecular data of Aphanurus mugilis Tang, 1981 (Aphanurinae) from mullet fish of Vietnam.

    Science.gov (United States)

    Atopkin, D M; Besprozvannykh, V V; Yu Beloded, A; Ngo, H D; Ha, N V; Tang, N V

    2017-12-01

    Adult Aphanurus mugilis Tang, 1981 worms were detected in the intestine of Moolgarda engeli in the shallow waters off Cat Ba Island, Vietnam. Tang (1981) first described this species in Mugil cephalus off China. The worms in Vietnamese mullet were identical to Chinese specimens in a number of morphometric characteristics, with the exception of body and ovary size. In the present study, morphological characteristics, and the first molecular data for A. mugilis are provided. Additionally, molecular phylogenetic analysis of the family Hemiuridae was performed. The results of our molecular phylogenetic study indicate that the presence or absence of an ecsoma was not associated with molecular data for hemiurid subfamilies differentiation. The basal position of Bunocotylinae on the molecular-based phylogenetic tree indicated a primordial nature of ecsoma of hemiurid trematodes. Considerable molecular differentiation of Bunocotylinae from other hemiurids indicated the possibility of the recognition of the family Bunocotylidae Dollfus, 1950. Assuming that Machidatrema chilostoma is considered within the Bunocotylinae, the paraphyly of the Lecithasterinae was supported. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Phylogenetic reconstruction of Syntermitinae (Isoptera, Termitidae based on morphological and molecular data.

    Directory of Open Access Journals (Sweden)

    Mauricio M Rocha

    Full Text Available The subfamily Syntermitinae comprises a group of Neotropical termites with 18 genera and 101 species described. It has been considered a natural group, but relationships among the genera within the subfamily remain uncertain, and some genera appear to be non-monophyletic. Here, we provide a comprehensive phylogeny including six Neotropical species of Termitinae as outgroup, 42 Syntermitinae species as ingroup, 92 morphological characters (from external and internal anatomy of soldier and worker castes and 117 molecular sequences (109 obtained for this study and 8 from GenBank of 4 gene regions (41 and 22 from Cytochrome Oxidase I and II respectively, 19 from Cytochrome b, and 35 from 16S rDNA. Morphological and molecular data were analyzed in combination, with the Bayesian inference method, and the important aspects of termite biology, defense and feeding habits are discussed based on the resulting tree. Although useful for providing diagnostic characters, the morphology of the soldier caste reveals several cases of convergence; whereas the feeding habit shows indications of evolutionary significance.

  19. Phylogenetic Study of Haemonchus Species from Iran Based On Morpho-Molecular Characterization.

    Directory of Open Access Journals (Sweden)

    Behnam Meshgi

    2015-06-01

    Full Text Available Haemonchosis has a negative effect on the farming industry throughout the world, especially in the tropic and sub-tropic countries. The present study was carried out to differentiate Haemonchus species from its main hosts in Iran, including sheep, goat and camel.The identification took place based on the morphometrics of the spicules and molecular characters. Two hundred seventy adult male nematodes were collected from the abomasums of different ruminants (90 samples from each animal at the slaughterhouses from different localities in Iran. Samples were morphologically identified according to the spicules' morphometric measurements. In the section on molecular study, 10 samples of each Haemonchus isolates were genetically examined. A simple PCR-restriction fragment length polymorphism (PCR-RFLP assay of the second internal transcribed spacer of ribosomal DNA (ITS2-rDNA were described to confirm the PCR results.PCR-RFLP profile obtained from the restriction enzyme HPa1 in H. contortus and H. longistipes indicated 1 (278 bp and 2 (113 and 135 bp different fragments, respectively. The morphological parameters clearly distinguish H. contortus from H. longistipes. Moreover, regarding the ITS2-rDNA, sequences of 295 bp and 314 bp were obtained from H. contortus and H. longistipes, respectively.The genotypic results are in agreement with the phenotypic findings of both species.

  20. Phylogenetic reconstruction of Syntermitinae (Isoptera, Termitidae) based on morphological and molecular data.

    Science.gov (United States)

    Rocha, Mauricio M; Morales-Corrêa E Castro, Adriana C; Cuezzo, Carolina; Cancello, Eliana M

    2017-01-01

    The subfamily Syntermitinae comprises a group of Neotropical termites with 18 genera and 101 species described. It has been considered a natural group, but relationships among the genera within the subfamily remain uncertain, and some genera appear to be non-monophyletic. Here, we provide a comprehensive phylogeny including six Neotropical species of Termitinae as outgroup, 42 Syntermitinae species as ingroup, 92 morphological characters (from external and internal anatomy of soldier and worker castes) and 117 molecular sequences (109 obtained for this study and 8 from GenBank) of 4 gene regions (41 and 22 from Cytochrome Oxidase I and II respectively, 19 from Cytochrome b, and 35 from 16S rDNA). Morphological and molecular data were analyzed in combination, with the Bayesian inference method, and the important aspects of termite biology, defense and feeding habits are discussed based on the resulting tree. Although useful for providing diagnostic characters, the morphology of the soldier caste reveals several cases of convergence; whereas the feeding habit shows indications of evolutionary significance.

  1. Spatiotemporal Phylogenetic Analysis and Molecular Characterisation of Infectious Bursal Disease Viruses Based on the VP2 Hyper-Variable Region.

    Directory of Open Access Journals (Sweden)

    Abdulahi Alfonso-Morales

    Full Text Available Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV; it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV strains.Sequences of the hyper-variable region of the VP2 (HVR-VP2 gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST, Bayesian Tip-association Significance testing (BaTS and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium in 1987, Africa (Egypt around 1990, East Asia (China and Japan in 1993, the Caribbean Region (Cuba by 1995 and South America (Brazil around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection.To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide.

  2. Spatiotemporal Phylogenetic Analysis and Molecular Characterisation of Infectious Bursal Disease Viruses Based on the VP2 Hyper-Variable Region.

    Science.gov (United States)

    Alfonso-Morales, Abdulahi; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Majó, Natàlia; Ganges, Llilianne; Pérez, Lester J

    2013-01-01

    Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV); it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV) strains. Sequences of the hyper-variable region of the VP2 (HVR-VP2) gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST), Bayesian Tip-association Significance testing (BaTS) and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD) software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium) in 1987, Africa (Egypt) around 1990, East Asia (China and Japan) in 1993, the Caribbean Region (Cuba) by 1995 and South America (Brazil) around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection. To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide.

  3. Molecular epidemiology of H9N2 influenza viruses in Northern Europe.

    Science.gov (United States)

    Lindh, Erika; Ek-Kommonen, Christine; Väänänen, Veli-Matti; Vaheri, Antti; Vapalahti, Olli; Huovilainen, Anita

    2014-08-27

    Low pathogenic avian influenza viruses are maintained in wild bird populations throughout the world. Avian influenza viruses are characterized by their efficient ability to reassort and adapt, which enables them to cross the species barrier and enhances their zoonotic potential. Influenza viruses of the H9N2 subtype appear endemic among poultry in Eurasia. They usually exist as low-pathogenic strains and circulate between wild bird populations, poultry and birds sold at live bird markets. Direct transmission of H9N2 viruses, with receptor specificities similar to human influenza strains, to pigs and humans has been reported on several occasions. H9N2 virus was first encountered in Finland in 2009, during routine screening of hunted wild waterfowl. The next year, H9N2 influenza viruses were isolated from wild birds on four occasions, including once from a farmed mallard. We have investigated the relationship between the reared and wild bird isolates by sequencing the hemagglutinin and the neuraminidase genes of the Finnish H9N2 viruses. Nucleotide sequence comparison and phylogenetic analyses indicate that H9N2 was transmitted from wild birds to reared birds in 2010, and that highly identical strains have been circulating in Europe during the last few years. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Molecular phylogenetic study of a myrmecophyte symbiosis: did Leonardoxa/ ant associations diversify via cospeciation?

    Science.gov (United States)

    Chenuil, A; McKey, D B

    1996-10-01

    The Leonardoxa africana (Leguminosae: Caesalpinioideae) complex is a group of four closely related taxa (L1 to L4) exhibiting various grades of specificity and specialization in mutualistic associations with ants. Each of the two most specialized species, Leonardoxa taxon 3 (L3) and L. africana sensu stricto (L4), interacts with a specific species of formicine ant, respectively Aphomomyrmex after and Petalomyrmex phylax, which nests in specialized swollen twigs. These two monotypic genera are the sole African members of the tribe Myrmelachistini, and their occurrence in closely related plants suggested thehypothesis that the two associations L4/Petalomyrmex and L3/Aphomomyrmex are derived by cospeciation from an ancestral association. Phylogenies based on DNA sequences were reconstructed for the ants and compared with phylogenies available for the plants in order to test for this hypothesis of cospeciation. The resulting topologies suggest either that the association with myrmelachistine ants arose several times or that a plant species (L2) and an ant population split off from an ancestral association. Furthermore, dates of speciation events appear to differ between ants and corresponding plants. An estimate of at least 4 million years was obtained for the separation of Aphomomyrmex and Petalomyrmex, whereas biological, biogeographic, and molecular-genetic data suggest a much more recent divergence for the plants. Thus, we reject the hypothesis of cospeciation and conclude that Aphomomyrmex and Petalomyrmex independently colonized different taxa of Leonardoxa. This striking instance of parallel evolution supports the notion that specific ant-plant associations originated by ecological fitting of preadapted partners. We discuss alternative evolutionary scenarios that are consistent with molecular data.

  5. Molecular and phylogenetic characterization of the sieve element occlusion gene family in Fabaceae and non-Fabaceae plants.

    Science.gov (United States)

    Rüping, Boris; Ernst, Antonia M; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2010-10-08

    The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome. The unexpected

  6. Molecular characterization and phylogenetic analysis of Babesia sp. NV-1 detected from wild American Mink ( Neovison vison ) in Hokkaido, Japan.

    Science.gov (United States)

    Hirata, Haruyuki; Ishinabe, Satoki; Jinnai, Michio; Asakawa, Mitsuhiko; Ishihara, Chiaki

    2013-04-01

    Babesiosis is a tick-borne protozoan disease affecting many mammalian species worldwide, caused by the intraerythrocytic multiplication of Babesia spp. The present study aimed to detect the presence of Babesia sp. in 13 American mink from Hokkaido, Japan. One of 13 animals was positive, as indicated by nested PCR targeting the 18S ribosomal RNA (SSU rDNA) and subunit 7 (eta) of the chaperonin-containing t-complex polypeptide 1 (CCT7) genes from species of Babesia and Theileria. Sequencing of the PCR product of SSU rDNA revealed 99% homology to the isolates of Babesia sp. SAP#131 found in raccoons in Hokkaido, whereas that of the CCT7 gene showed 80% homology to the isolates of Babesia gibsoni in dogs as determined by BLAST analysis. We refer to the cognate sequence as Babesia sp. NV-1. Phylogenetic analyses of SSU rDNA and CCT7 genes from Babesia sp. NV-1 revealed them to be most closely related to the Babesia sp. SAP#131 from a raccoon in Hokkaido and to canine B. gibsoni, respectively. Here, we provide the first molecular evidence of the Babesia sp. NV-1 parasite in feral American mink ( Neovison vison ) in Hokkaido, Japan.

  7. Phylogenetic analysis of molecular and morphological data highlights uncertainty in the relationships of fossil and living species of Elopomorpha (Actinopterygii: Teleostei).

    Science.gov (United States)

    Dornburg, Alex; Friedman, Matt; Near, Thomas J

    2015-08-01

    Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright

  8. Phylogenetic and Molecular Evolutionary Analysis of Mitophagy Receptors under Hypoxic Conditions

    Directory of Open Access Journals (Sweden)

    Xiaomei Wu

    2017-07-01

    Full Text Available As animals evolved to use oxygen as the main strategy to produce ATP through the process of mitochondrial oxidative phosphorylation, the ability to adapt to fluctuating oxygen concentrations is a crucial component of evolutionary pressure. Three mitophagy receptors, FUNDC1, BNIP3 and NIX, induce the removal of dysfunctional mitochondria (mitophagy under prolonged hypoxic conditions in mammalian cells, to maintain oxygen homeostasis and prevent cell death. However, the evolutionary origins and structure-function relationships of these receptors remain poorly understood. Here, we found that FUN14 domain-containing proteins are present in archaeal, bacterial and eukaryotic genomes, while the family of BNIP3 domain-containing proteins evolved from early animals. We investigated conservation patterns of the critical amino acid residues of the human mitophagy receptors. These residues are involved in receptor regulation, mainly through phosphorylation, and in interaction with LC3 on the phagophore. Whereas FUNDC1 may be able to bind to LC3 under the control of post-translational regulations during the early evolution of vertebrates, BINP3 and NIX had already gained the ability for LC3 binding in early invertebrates. Moreover, FUNDC1 and BNIP3 each lack a layer of phosphorylation regulation in fishes that is conserved in land vertebrates. Molecular evolutionary analysis revealed that BNIP3 and NIX, as the targets of oxygen sensing HIF-1α, showed higher rates of substitution in fishes than in mammals. Conversely, FUNDC1 and its regulator MARCH5 showed higher rates of substitution in mammals. Thus, we postulate that the structural traces of mitophagy receptors in land vertebrates and fishes may reflect the process of vertebrate transition from water onto land, during which the changes in atmospheric oxygen concentrations acted as a selection force in vertebrate evolution. In conclusion, our study, combined with previous experimental results, shows that

  9. Postglacial colonization of Europe by the barbastelle bat: agreement between molecular data and past predictive modelling.

    Science.gov (United States)

    Rebelo, Hugo; Froufe, Elsa; Brito, José C; Russo, Danilo; Cistrone, Luca; Ferrand, Nuno; Jones, Gareth

    2012-06-01

    The barbastelle (Barbastella barbastellus) is a rare forest bat with a wide distribution in Europe. Here, we combine results from the analysis of two mtDNA fragments with species distribution modelling to determine glacial refugia and postglacial colonization routes. We also investigated whether niche conservatism occurs in this species. Glacial refugia were identified in the three southern European peninsulas: Iberia, Italy and the Balkans. These latter two refugia played a major role in the postglacial colonization process, with their populations expanding to England and central Europe, respectively. Palaeo-distribution models predicted that suitable climatic conditions existed in the inferred refugia during the last glacial maximum (LGM). Nevertheless, the overlap between the current and the LGM distributions was almost inexistent in Italy and in the Balkans, meaning that B. barbastellus populations were forced to shift range between glacial and interglacial periods, a process that probably caused some local extinctions. In contrast, Iberian populations showed a 'refugia within refugium' pattern, with two unconnected areas containing stable populations (populations that subsisted during both glacial and interglacial phases). Moreover, the match between LGM models and the refugial areas determined by molecular analysis supported the hypothesis of niche conservatism in B. barbastellus. We argue that geographic patterns of genetic structuring, altogether with the modelling results, indicate the existence of four management units for conservation: Morocco, Iberia, Italy and UK, and Balkans and central Europe. In addition, all countries sampled possessed unique gene pools, thus stressing the need for the conservation of local populations. © 2012 Blackwell Publishing Ltd.

  10. Distinguishing commercially grown Ganoderma lucidum from Ganoderma lingzhi from Europe and East Asia on the basis of morphology, molecular phylogeny, and triterpenic acid profiles.

    Science.gov (United States)

    Hennicke, Florian; Cheikh-Ali, Zakaria; Liebisch, Tim; Maciá-Vicente, Jose G; Bode, Helge B; Piepenbring, Meike

    2016-07-01

    In China and other countries of East Asia, so-called Ling-zhi or Reishi mushrooms are used in traditional medicine since several centuries. Although the common practice to apply the originally European name 'Ganoderma lucidum' to these fungi has been questioned by several taxonomists, this is still generally done in recent publications and with commercially cultivated strains. In the present study, two commercially sold strains of 'G. lucidum', M9720 and M9724 from the company Mycelia bvba (Belgium), are compared for their fruiting body (basidiocarp) morphology combined with molecular phylogenetic analyses, and for their secondary metabolite profile employing an ultra-performance liquid chromatography-electrospray ionization mass spectrometry (UPLC-ESIMS) in combination with a high resolution electrospray ionization mass spectrometry (HR-ESI-MS). According to basidiocarp morphology, the strain M9720 was identified as G. lucidum s.str. whereas M9724 was determined as Ganoderma lingzhi. In molecular phylogenetic analyses, the M9720 ITS and beta-tubulin sequences grouped with sequences of G. lucidum s.str. from Europe whereas those from M9724 clustered with sequences of G. lingzhi from East Asia. We show that an ethanol extract of ground basidiocarps from G. lucidum (M9720) contains much less triterpenic acids than found in the extract of G. lingzhi (M9724). The high amount of triterpenic acids accounts for the bitter taste of the basidiocarps of G. lingzhi (M9724) and of its ethanol extract. Apparently, triterpenic acids of G. lucidum s.str. are analyzed here for the first time. These results demonstrate the importance of taxonomy for commercial use of fungi. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Porcine Epidemic Diarrhea in Europe: In-Detail Analyses of Disease Dynamics and Molecular Epidemiology.

    Science.gov (United States)

    Hanke, Dennis; Pohlmann, Anne; Sauter-Louis, Carola; Höper, Dirk; Stadler, Julia; Ritzmann, Mathias; Steinrigl, Adi; Schwarz, Bernd-Andreas; Akimkin, Valerij; Fux, Robert; Blome, Sandra; Beer, Martin

    2017-07-06

    Porcine epidemic diarrhea (PED) is an acute and highly contagious enteric disease of swine caused by the eponymous virus (PEDV) which belongs to the genus Alphacoronavirus within the Coronaviridae virus family. Following the disastrous outbreaks in Asia and the United States, PEDV has been detected also in Europe. In order to better understand the overall situation, the molecular epidemiology, and factors that might influence the most variable disease impact; 40 samples from swine feces were collected from different PED outbreaks in Germany and other European countries and sequenced by shot-gun next-generation sequencing. A total of 38 new PEDV complete coding sequences were generated. When compared on a global scale, all investigated sequences from Central and South-Eastern Europe formed a rather homogeneous PEDV S INDEL cluster, suggesting a recent re-introduction. However, in-detail analyses revealed two new clusters and putative ancestor strains. Based on the available background data, correlations between clusters and location, farm type or clinical presentation could not be established. Additionally, the impact of secondary infections was explored using the metagenomic data sets. While several coinfections were observed, no correlation was found with disease courses. However, in addition to the PEDV genomes, ten complete viral coding sequences from nine different data sets were reconstructed each representing new virus strains. In detail, three pasivirus A strains, two astroviruses, a porcine sapelovirus, a kobuvirus, a porcine torovirus, a posavirus, and an enterobacteria phage were almost fully sequenced.

  12. Porcine Epidemic Diarrhea in Europe: In-Detail Analyses of Disease Dynamics and Molecular Epidemiology

    Directory of Open Access Journals (Sweden)

    Dennis Hanke

    2017-07-01

    Full Text Available Porcine epidemic diarrhea (PED is an acute and highly contagious enteric disease of swine caused by the eponymous virus (PEDV which belongs to the genus Alphacoronavirus within the Coronaviridae virus family. Following the disastrous outbreaks in Asia and the United States, PEDV has been detected also in Europe. In order to better understand the overall situation, the molecular epidemiology, and factors that might influence the most variable disease impact; 40 samples from swine feces were collected from different PED outbreaks in Germany and other European countries and sequenced by shot-gun next-generation sequencing. A total of 38 new PEDV complete coding sequences were generated. When compared on a global scale, all investigated sequences from Central and South-Eastern Europe formed a rather homogeneous PEDV S INDEL cluster, suggesting a recent re-introduction. However, in-detail analyses revealed two new clusters and putative ancestor strains. Based on the available background data, correlations between clusters and location, farm type or clinical presentation could not be established. Additionally, the impact of secondary infections was explored using the metagenomic data sets. While several coinfections were observed, no correlation was found with disease courses. However, in addition to the PEDV genomes, ten complete viral coding sequences from nine different data sets were reconstructed each representing new virus strains. In detail, three pasivirus A strains, two astroviruses, a porcine sapelovirus, a kobuvirus, a porcine torovirus, a posavirus, and an enterobacteria phage were almost fully sequenced.

  13. Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution

    Directory of Open Access Journals (Sweden)

    Tartar Aurélien

    2010-06-01

    Full Text Available Abstract Background Glutamine synthetase (GS is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae, and additional green algal (Chlorophyceae and Prasinophytae and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB and eukaryotic (GSIIE GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT. Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida. However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting

  14. Phylogenetic reconstruction using secondary structures of Internal Transcribed Spacer 2 (ITS2, rDNA: finding the molecular and morphological gap in Caribbean gorgonian corals

    Directory of Open Access Journals (Sweden)

    Sánchez Juan A

    2007-06-01

    Full Text Available Abstract Background Most phylogenetic studies using current methods have focused on primary DNA sequence information. However, RNA secondary structures are particularly useful in systematics because they include characteristics, not found in the primary sequence, that give "morphological" information. Despite the number of recent molecular studies on octocorals, there is no consensus opinion about a region that carries enough phylogenetic resolution to solve intrageneric or close species relationships. Moreover, intrageneric morphological information by itself does not always produce accurate phylogenies; intra-species comparisons can reveal greater differences than intra-generic ones. The search for new phylogenetic approaches, such as by RNA secondary structure analysis, is therefore a priority in octocoral research. Results Initially, twelve predicted RNA secondary structures were reconstructed to provide the basic information for phylogenetic analyses; they accorded with the 6 helicoidal ring model, also present in other groups of corals and eukaryotes. We obtained three similar topologies for nine species of the Caribbean gorgonian genus Eunicea (candelabrum corals with two sister taxa as outgroups (genera Plexaura and Pseudoplexaura on the basis of molecular morphometrics of ITS2 RNA secondary structures only, traditional primary sequence analyses and maximum likelihood, and a Bayesian analysis of the combined data. The latter approach allowed us to include both primary sequence and RNA molecular morphometrics; each data partition was allowed to have a different evolution rate. In addition, each helix was partitioned as if it had evolved at a distinct rate. Plexaura flexuosa was found to group within Eunicea; this was best supported by both the molecular morphometrics and combined analyses. We suggest Eunicea flexuosa (Lamouroux, 1821 comb. nov., and we present a new species description including Scanning Electron Microscopy (SEM images of

  15. Ultrastructure and molecular phylogenetic position of a novel phagotrophic stramenopile from low oxygen environments: Rictus lutensis gen. et sp. nov. (Bicosoecida, incertae sedis).

    Science.gov (United States)

    Yubuki, Naoji; Leander, Brian S; Silberman, Jeffrey D

    2010-04-01

    A novel free free-living phagotrophic flagellate, Rictus lutensis gen. et sp. nov., with two heterodynamic flagella, a permanent cytostome and a cytopharynx was isolated from muddy, low oxygen coastal sediments in Cape Cod, MA, USA. We cultivated and characterized this flagellate with transmission electron microscopy, scanning electron microscopy and molecular phylogenetic analyses inferred from small subunit (SSU) rDNA sequences. These data demonstrated that this organism has the key ultrastructural characters of the Bicosoecida, including similar transitional zones and a similar overall flagellar apparatus consisting of an x fiber and an L-shape microtubular root 2 involved in food capture. Although the molecular phylogenetic analyses were concordant with the ultrastructural data in placing R. lutensis with the bicosoecid clade, the internal position of this relatively divergent sequence within the clade was not resolved. Therefore, we interpret R. lutensis gen. et sp. nov. as a novel bicosoecid incertae sedis. Copyright 2009 Elsevier GmbH. All rights reserved.

  16. Molecular phylogenetics and anti-Pythium activity of endophytes from rhizomes of wild ginger congener, Zingiber zerumbet Smith.

    Science.gov (United States)

    Keerthi, D; Aswati Nair, R; Prasath, D

    2016-03-01

    Zingiber zerumbet, a perennial rhizomatous herb exhibits remarkable disease resistance as well as a wide range of pharmacological activities. Towards characterizing the endophytic population of Z. zerumbet rhizomes, experiments were carried out during two different growing seasons viz., early-June of 2013 and late-July of 2014. A total of 34 endophytes were isolated and categorized into 11 morphologically distinct groups. Fungi were observed to predominate bacterial species with colonization frequency values ranging from 12.5 to 50%. Among the 11 endophyte groups isolated, molecular analyses based on ITS/16S rRNA gene sequences identified seven isolate groups as Fusarium solani, two as F. oxysporum and one as the bacterium Rhizobium spp. Phylogenetic tree clustered the ITS sequences from Z. zerumbet endophytes into distinct clades consistent with morphological and sequence analysis. Dual culture assays were carried out to determine antagonistic activity of the isolated endophytes against Pythium myriotylum, an economically significant soil-borne phytopathogen of cultivated ginger. Experiments revealed significant P. myriotylum growth inhibition by F. solani and F. oxysporum isolates with percentage of inhibition (PoI) ranging from 45.17 ± 0.29 to 62.2 ± 2.58 with F. oxysporum exhibiting higher PoI values against P. myriotylum. Using ZzEF8 metabolite extract, concentration-dependent P. myriotylum hyphal growth inhibition was observed following radial diffusion assays. These observations were confirmed by scanning electron microscopy analysis wherein exposure to ZzEF8 metabolite extract induced hyphal deformities. Results indicate Z. zerumbet endophytes as promising resources for biologically active compounds and as biocontrol agents for soft rot disease management caused by Pythium spp.

  17. Phylogenetic analysis of canine distemper virus in South America clade 1 reveals unique molecular signatures of the local epidemic.

    Science.gov (United States)

    Fischer, Cristine D B; Gräf, Tiago; Ikuta, Nilo; Lehmann, Fernanda K M; Passos, Daniel T; Makiejczuk, Aline; Silveira, Marcos A T; Fonseca, André S K; Canal, Cláudio W; Lunge, Vagner R

    2016-07-01

    Canine distemper virus (CDV) is a highly contagious pathogen for domestic dogs and several wild carnivore species. In Brazil, natural infection of CDV in dogs is very high due to the large non-vaccinated dog population, a scenario that calls for new studies on the molecular epidemiology. This study investigates the phylodynamics and amino-acid signatures of CDV epidemic in South America by analyzing a large dataset compiled from publicly available sequences and also by collecting new samples from Brazil. A population of 175 dogs with canine distemper (CD) signs was sampled, from which 89 were positive for CDV, generating 42 new CDV sequences. Phylogenetic analysis of the new and publicly available sequences revealed that Brazilian sequences mainly clustered in South America 1 (SA1) clade, which has its origin estimated to the late 1980's. The reconstruction of the demographic history in SA1 clade showed an epidemic expanding until the recent years, doubling in size every nine years. SA1 clade epidemic distinguished from the world CDV epidemic by the emergence of the R580Q strain, a very rare and potentially detrimental substitution in the viral genome. The R580Q substitution was estimated to have happened in one single evolutionary step in the epidemic history in SA1 clade, emerging shortly after introduction to the continent. Moreover, a high prevalence (11.9%) of the Y549H mutation was observed among the domestic dogs sampled here. This finding was associated (p<0.05) with outcome-death and higher frequency in mixed-breed dogs, the later being an indicator of a continuous exchange of CDV strains circulating among wild carnivores and domestic dogs. The results reported here highlight the diversity of the worldwide CDV epidemic and reveal local features that can be valuable for combating the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Leishmania tropica isolates from non-healed and healed patients in Iran: A molecular typing and phylogenetic analysis.

    Science.gov (United States)

    Bamorovat, Mehdi; Sharifi, Iraj; Mohammadi, Mohammad Ali; Eybpoosh, Sana; Nasibi, Saeid; Aflatoonian, Mohammad Reza; Khosravi, Ahmad

    2018-03-01

    The precise identification of the parasite species causing leishmaniasis is essential for selecting proper treatment modality. The present study aims to compare the nucleotide variations of the ITS1, 7SL RNA, and Hsp70 sequences between non-healed and healed anthroponotic cutaneous leishmaniasis (ACL) patients in major foci in Iran. A case-control study was carried out from September 2015 to October 2016 in the cities of Kerman and Bam, in the southeast of Iran. Randomly selected skin-scraping lesions of 40 patients (20 non-healed and 20 healed) were examined and the organisms were grown in a culture medium. Promastigotes were collected by centrifugation and kept for further molecular examinations. The extracted DNA was amplified and sequenced. After global sequence alignment with BioEdit software, maximum likelihood phylogenetic analysis was performed in PhyML for typing of Leishmania isolates. Nucleotide composition of each genetic region was also compared between non-healed and healed patients. Our results showed that all isolates belonged to the Leishmania tropica complex, with their genetic composition in the ITS1 region being different among non-healed and healed patients. 7SL RNA and Hsp70 regions were genetically identical between both groups. Variability in nucleotide patterns observed between both groups in the ITS1 region may serve to encourage future research on the function of these polymorphisms and may improve our understanding of the role of parasite genome properties on patients' response to Leishmania treatment. Our results also do not support future use of 7SL RNA and Hsp70 regions of the parasite for comparative genomic analyses. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Molecular characterization and phylogenetic analysis of two novel regio-specific flavonoid prenyltransferases from Morus alba and Cudrania tricuspidata.

    Science.gov (United States)

    Wang, Ruishan; Chen, Ridao; Li, Jianhua; Liu, Xiao; Xie, Kebo; Chen, Dawei; Yin, Yunze; Tao, Xiaoyu; Xie, Dan; Zou, Jianhua; Yang, Lin; Dai, Jungui

    2014-12-26

    Prenylated flavonoids are attractive specialized metabolites with a wide range of biological activities and are distributed in several plant families. The prenylation catalyzed by prenyltransferases represents a Friedel-Crafts alkylation of the flavonoid skeleton in the biosynthesis of natural prenylated flavonoids and contributes to the structural diversity and biological activities of these compounds. To date, all identified plant flavonoid prenyltransferases (FPTs) have been identified in Leguminosae. In the present study two new FPTs, Morus alba isoliquiritigenin 3'-dimethylallyltransferase (MaIDT) and Cudrania tricuspidata isoliquiritigenin 3'-dimethylallyltransferase (CtIDT), were identified from moraceous plants M. alba and C. tricuspidata, respectively. MaIDT and CtIDT shared low levels of homology with the leguminous FPTs. MaIDT and CtIDT are predicted to be membrane-bound proteins with predicted transit peptides, seven transmembrane regions, and conserved functional domains that are similar to other homogentisate prenyltransferases. Recombinant MaIDT and CtIDT were able to regioselectively introduce dimethylallyl diphosphate into the A ring of three flavonoids with different skeleton types (chalcones, isoflavones, and flavones). Phylogenetic analysis revealed that MaIDT and CtIDT are distantly related to their homologs in Leguminosae, which suggests that FPTs in Moraceae and Leguminosae might have evolved independently. MaIDT and CtIDT represent the first two non-Leguminosae FPTs to be identified in plants and could thus lead to the identification of additional evolutionarily varied FPTs in other non-Leguminosae plants and could elucidate the biosyntheses of prenylated flavonoids in various plants. Furthermore, MaIDT and CtIDT might be used for regiospecific prenylation of flavonoids to produce bioactive compounds for potential therapeutic applications due to their high efficiency and catalytic promiscuity. © 2014 by The American Society for Biochemistry

  20. Molecular phylogenetic reconstruction and taxonomic investigation of eelpouts (Cottoidei: Zoarcales) based on Co-1 and Cyt-b mitochondrial genes.

    Science.gov (United States)

    Turanov, S V; Kartavtsev, Yu Ph; Lee, Y H; Jeong, D

    2017-07-01

    The infraorder Zoarcales (Cottoidei), or eelpouts, includes about 400 species of coldwater fishes concentrated mainly in the North Pacific. To date, the molecular phylogenetic methods in combination with morphological data have significantly contributed to understanding the taxonomic composition of this group and made it possible to confirm/refute validity of some families of obscure origin. In spite of the growing amount of new data on taxonomy and evolution of eelpouts, a consideration of the original and independent data is obviously needed to verify the existing knowledge of this taxon. In this study, which is based on concatenated matrix of Co-1 and Cyt-b mitochondrial genes, as well as relying on the samples from seven families and 45 species of eelpouts, we have reconstructed the phylogeny, which is generally consistent with previous inferences. Despite the resolution of the original data matrix is low, we have demonstrated the monophyletic origin of the families Zoarcidae and Anarhichadidae, as well as Neozoarcidae, previously related to Stichaeidae and recently revised Eulophiidae. The polyphyletic patterns amongst some subfamilies in Stichaeidae have been confirmed, whereas Opisthocentrinae and Pholidae seem to constitute a valid family-level taxon. Our results provide new opportunities with respect to taxonomic relationships in the complex and diverse group of eelpouts , whose part in the tree of life is not covered by recently flourishing multilocus phylogeny of teleost fishes. In light of the data obtained, the necessity of more unified and reproducible approaches to resolve the issues of evolution and taxonomy of such a complex group as Zoarcales becomes more evident.

  1. Identification of three new isolates of Tomato spotted wilt virus from different hosts in China: molecular diversity, phylogenetic and recombination analyses.

    Science.gov (United States)

    Zhang, Zhenjia; Wang, Deya; Yu, Chengming; Wang, Zenghui; Dong, Jiahong; Shi, Kerong; Yuan, Xuefeng

    2016-01-14

    Destructive diseases caused by Tomato spotted wilt virus (TSWV) have been reported associated with many important plants worldwide. Recently, TSWV was reported to infect different hosts in China. It is of value to clone TSWV isolates from different hosts and examine diversity and evolution among different TSWV isolates in China as well as worldwide. RT-PCR was used to clone the full-length genome (L, M and S segments) of three new isolates of TSWV that infected different hosts (tobacco, red pepper and green pepper) in China. Identity of nucleotide and amino acid sequences among TSWV isolates were analyzed by DNAMAN. MEGA 5.0 was used to construct phylogenetic trees. RDP4 was used to detect recombination events during evolution of these isolates. Whole-genome sequences of three new TSWV isolates in China were determined. Together with other available isolates, 29 RNA L, 62 RNA M and 66 RNA S of TSWV isolates were analyzed for molecular diversity, phylogenetic and recombination events. This analysis revealed that the entire TSWV genome, especially the M and S RNAs, had major variations in genomic size that mainly involve the A-U rich intergenic region (IGR). Phylogenetic analyses on TSWV isolates worldwide revealed evidence for frequent reassortments in the evolution of tripartite negative-sense RNA genome. Significant numbers of recombination events with apparent 5' regional preference were detected among TSWV isolates worldwide. Moreover, TSWV isolates with similar recombination events usually had closer relationships in phylogenetic trees. All five Chinese TSWV isolates including three TSWV isolates of this study and previously reported two isolates can be divided into two groups with different origins based on molecular diversity and phylogenetic analysis. During their evolution, both reassortment and recombination played roles. These results suggest that recombination could be an important mechanism in the evolution of multipartite RNA viruses, even negative

  2. Overview of HIV molecular epidemiology among People who Inject Drugs in Europe and Asia

    Science.gov (United States)

    Nikolopoulos, Georgios K.; Kostaki, Evangelia-Georgia; Paraskevis, Dimitrios

    2016-01-01

    HIV strains continuously evolve, tend to recombine and new circulating variants are being discovered. Novel strains complicate efforts to develop a vaccine against HIV and may exhibit higher transmission efficiency and virulence, and elevated resistance to antiretroviral agents. The United Nations Joint Programme on HIV/AIDS (UNAIDS) set an ambitious goal to end HIV as a public health threat by 2030 through comprehensive strategies that include epidemiological input as the first step of the process. In this context, molecular epidemiology becomes invaluable as it captures trends in HIV evolution rates that shape epidemiological pictures across several geographical areas. This review briefly summarizes the molecular epidemiology of HIV among people who inject drugs (PWID) in Europe and Asia. Following high transmission rates of subtype G and CRF14_BG among PWID in Portugal and Spain, two European countries, Greece and Romania, experienced recent HIV outbreaks in PWID that consisted of multiple transmission clusters including subtypes B, A, F1 and recombinants CRF14_BG and CRF35_AD. The latter was first identified in Afghanistan. Russia, Ukraine and other Former Soviet Union (FSU) states are still facing the devastating effects of epidemics in PWID produced by AFSU (also known as IDU-A), BFSU (known as IDU-B), and CRF03_AB. In Asia, CRF01_AE and subtype B (Western B and Thai B) travelled from PWID in Thailand to neighboring countries. Recombination hotspots in South China, Northern Myanmar, and Malaysia have been generating several intersubtype and inter-CRF recombinants (e.g. CRF07_BC, CRF08_BC, CRF33_01B etc.) increasing the complexity of HIV molecular patterns. PMID:27287560

  3. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  4. Molecular and karyological data confirm that the enigmatic genus Platypholis from Bonin-Islands (SE Japan) is phylogenetically nested within Orobanche (Orobanchaceae).

    Science.gov (United States)

    Li, Xi; Jang, Tae-Soo; Temsch, Eva M; Kato, Hidetoshi; Takayama, Koji; Schneeweiss, Gerald M

    2017-03-01

    Molecular phylogenetic studies have greatly improved our understanding of phylogenetic relationships of non-photosynthetic parasitic broomrapes (Orobanche and related genera, Orobanchaceae), but a few genera have remained unstudied. One of those is Platypholis, whose sole species, Platypholis boninsimae, is restricted to the Bonin-Islands (Ogasawara Islands) about 1000 km southeast of Japan. Based on overall morphological similarity, Platypholis has been merged with Orobanche, but this hypothesis has never been tested with molecular data. Employing maximum likelihood and Bayesian analyses on a family-wide data set (two plastid markers, matK and rps2, and three nuclear markers, ITS, phyA and phyB) as well as on an ITS data set focusing on Orobanche s. str., it is shown that P. boninsimae Maxim. is phylogenetically closely linked to or even nested within Orobanche s. str. This position is supported both by morphological evidence and by the newly obtained chromosome number of 2n = 38, which is characteristic for the genus Orobanche s. str.

  5. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    Science.gov (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. Molecular and phylogenetic characterization of two species of the genus Nostoc (Cyanobacteria based on the cpcB-IGS-cpcA locus of the phycocyanin operon

    Directory of Open Access Journals (Sweden)

    IVANKA TENEVA

    2012-01-01

    Full Text Available Traditionally, the taxonomy of the genus Nostoc is based on morphological and physiological characters. The extreme morphological variability of the Nostoc species, due to their life cycle and environmental conditions, hampers the correct identification of the individual species. This is also one of the reasons for the disputed taxonomic positions and relationships between the genera Anabaena–Aphanizomenon as well as between Anabaena–Nostoc. Therefore, it is necessary to use additional markers for development of a polyphasic classification system of order Nostocales. In light of this, we here present the first molecular and phy-logenetic characterization of two species of the genus Nostoc (Nostoc linckia and Nostoc punctiforme based on the cpcB-IGS-cpcA locus of the phycocyanin oper-on. The phylogenetic position of these two species within order Nostocales as well as within division Cyanobacteria has been determined. Our results indicate that genus Nostoc is heterogeneous. Analysis of the IGS region between cpcB and cpcA showed that Nostoc and Anabaena are distinct genera. Reported molecular and phylogenetic data will be useful to solve other problematic points in the tax-onomy of genera Aphanizomenon, Anabaena and Nostoc.

  7. Impact of gene molecular evolution on phylogenetic reconstruction: a case study in the rosids (Superorder Rosanae, Angiosperms).

    Science.gov (United States)

    Hilu, Khidir W; Black, Chelsea M; Oza, Dipan

    2014-01-01

    Rate of substitution of genomic regions is among the most debated intrinsic features that impact phylogenetic informativeness. However, this variable is also coupled with rates of nonsynonymous substitutions that underscore the nature and degree of selection on the selected genes. To empirically address these variables, we constructed four completely overlapping data sets of plastid matK, atpB, rbcL, and mitochondrial matR genes and used the rosid lineage (angiosperms) as a working platform. The genes differ in combinations of overall rates of nucleotide and amino acid substitutions. Tree robustness, homoplasy, accuracy in contrast to a reference tree, and phylogenetic informativeness are evaluated. The rapidly evolving/unconstrained matK faired best, whereas remaining genes varied in degrees of contribution to rosid phylogenetics across the lineage's 108 million years evolutionary history. Phylogenetic accuracy was low with the slowly evolving/unconstrained matR despite least amount of homoplasy. Third codon positions contributed the highest amount of parsimony informative sites, resolution and informativeness, but magnitude varied with gene mode of evolution. These findings are in clear contrast with the views that rapidly evolving regions and the 3rd codon position have inevitable negative impact on phylogenetic reconstruction at deep historic level due to accumulation of multiple hits and subsequent elevation in homoplasy and saturation. Relaxed evolutionary constraint in rapidly evolving genes distributes substitutions across codon positions, an evolutionary mode expected to reduce the frequency of multiple hits. These findings should be tested at deeper evolutionary histories.

  8. Distinctive mitochondrial genome of Calanoid copepod Calanus sinicus with multiple large non-coding regions and reshuffled gene order: Useful molecular markers for phylogenetic and population studies

    Science.gov (United States)

    2011-01-01

    Background Copepods are highly diverse and abundant, resulting in extensive ecological radiation in marine ecosystems. Calanus sinicus dominates continental shelf waters in the northwest Pacific Ocean and plays an important role in the local ecosystem by linking primary production to higher trophic levels. A lack of effective molecular markers has hindered phylogenetic and population genetic studies concerning copepods. As they are genome-level informative, mitochondrial DNA sequences can be used as markers for population genetic studies and phylogenetic studies. Results The mitochondrial genome of C. sinicus is distinct from other arthropods owing to the concurrence of multiple non-coding regions and a reshuffled gene arrangement. Further particularities in the mitogenome of C. sinicus include low A + T-content, symmetrical nucleotide composition between strands, abbreviated stop codons for several PCGs and extended lengths of the genes atp6 and atp8 relative to other copepods. The monophyletic Copepoda should be placed within the Vericrustacea. The close affinity between Cyclopoida and Poecilostomatoida suggests reassigning the latter as subordinate to the former. Monophyly of Maxillopoda is rejected. Within the alignment of 11 C. sinicus mitogenomes, there are 397 variable sites harbouring three 'hotspot' variable sites and three microsatellite loci. Conclusion The occurrence of the circular subgenomic fragment during laboratory assays suggests that special caution should be taken when sequencing mitogenomes using long PCR. Such a phenomenon may provide additional evidence of mitochondrial DNA recombination, which appears to have been a prerequisite for shaping the present mitochondrial profile of C. sinicus during its evolution. The lack of synapomorphic gene arrangements among copepods has cast doubt on the utility of gene order as a useful molecular marker for deep phylogenetic analysis. However, mitochondrial genomic sequences have been valuable markers for

  9. Simultaneous analysis of five molecular markers provides a well-supported phylogenetic hypothesis for the living bony-tongue fishes (Osteoglossomorpha: Teleostei).

    Science.gov (United States)

    Lavoué, Sébastien; Sullivan, John P

    2004-10-01

    Fishes of the Superorder Osteoglossomorpha (the "bonytongues") constitute a morphologically heterogeneous group of basal teleosts, including highly derived subgroups such as African electric fishes, the African butterfly fish, and Old World knifefishes. Lack of consensus among hypotheses of osteoglossomorph relationships advanced during the past 30 years may be due in part to the difficulty of identifying shared derived characters among the morphologically differentiated extant families of this group. In this study, we present a novel phylogenetic hypothesis for this group, based on the analysis of more than 4000 characters from five molecular markers (the mitochondrial cytochrome b, 12S and 16S rRNA genes, and the nuclear genes RAG2 and MLL). Our taxonomic sampling includes one representative of each extant non-mormyrid osteoglossomorph genus, one representative for the monophyletic family Mormyridae, and four outgroup taxa within the basal Teleostei. Maximum parsimony analysis of combined and equally weighted characters from the five molecular markers and Bayesian analysis provide a single, well-supported, hypothesis of osteoglossomorph interrelationships and show the group to be monophyletic. The tree topology is the following: (Hiodon alosoides, (Pantodon buchholzi, (((Osteoglossum bicirrhosum, Scleropages sp.), (Arapaima gigas, Heterotis niloticus)), ((Gymnarchus niloticus, Ivindomyrus opdenboschi), ((Notopterus notopterus, Chitala ornata), (Xenomystus nigri, Papyrocranus afer)))))). We compare our results with previously published phylogenetic hypotheses based on morpho-anatomical data. Additionally, we explore the consequences of the long terminal branch length for the taxon Pantodon buchholzi in our phylogenetic reconstruction and we use the obtained phylogenetic tree to reconstruct the evolutionary history of electroreception in the Notopteroidei.

  10. A molecular phylogenetic reappraisal of the Hysteriaceae, Mytilinidiaceae and Gloniaceae (Pleosporomycetidae, Dothideomycetes) with keys to world species

    Science.gov (United States)

    Boehm, E.W.A.; Mugambi, G.K.; Miller, A.N.; Huhndorf, S.M.; Marincowitz, S.; Spatafora, J.W.; Schoch, C.L.

    2009-01-01

    A reappraisal of the phylogenetic integrity of bitunicate ascomycete fungi belonging to or previously affiliated with the Hysteriaceae, Mytilinidiaceae, Gloniaceae and Patellariaceae is presented, based on an analysis of 121 isolates and four nuclear genes, the ribosomal large and small subunits, transcription elongation factor 1 and the second largest RNA polymerase II subunit. A geographically diverse and high density taxon sampling strategy was employed, including multiple isolates/species from the following genera: Anteaglonium (6/4), Encephalographa (1/1), Farlowiella (3/1), Gloniopsis (8/4), Glonium (4/2), Hysterium (12/5), Hysterobrevium (14/3), Hysterographium (2/1), Hysteropatella (2/2), Lophium (4/2), Mytilinidion (13/10), Oedohysterium (5/3), Ostreichnion (2/2), Patellaria (1/1), Psiloglonium (11/3), Quasiconcha (1/1), Rhytidhysteron (8/3), and 24 outgroup taxa. Sequence data indicate that although the Hysteriales are closely related to the Pleosporales, sufficient branch support exists for their separation into separate orders within the Pleosporomycetidae. The Mytilinidiales are more distantly related within the subclass and show a close association with the Gloniaceae. Although there are examples of concordance between morphological and molecular data, these are few. Molecular data instead support the premise of a large number of convergent evolutionary lineages, which do not correspond to previously held assumptions of synapomorphy relating to spore morphology. Thus, within the Hysteriaceae, the genera Gloniopsis, Glonium, Hysterium and Hysterographium are highly polyphyletic. This necessitated the transfer of two species of Hysterium to Oedohysterium gen. nov. (Od. insidens comb. nov. and Od. sinense comb. nov.), the description of a new species, Hysterium barrianum sp. nov., and the transfer of two species of Gloniopsis to Hysterobrevium gen. nov. (Hb. smilacis comb. nov. and Hb. constrictum comb. nov.). While Hysterographium, with the type Hg

  11. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  12. The cave beetle genus Anthroherpon is polyphyletic : molecular phylogenetics and description of Graciliella n. gen.(Leiodidae, Leptodirini)

    NARCIS (Netherlands)

    Njunji, Iva; Perreau, Michel; Hendriks, Kasper; Schilthuizen, Menno; Deharveng, Louis

    2016-01-01

    The subtribe Anthroherponina form an iconic group of obligate cave beetles, typical representatives of the Dinaric subterranean fauna, which is considered to be the richest in the world. Phylogenetic studies within this subtribe are scarce and based only on morphological characters, which, due to

  13. The cave beetle genus Anthroherpon is polyphyletic; molecular phylogenetics and description of Graciliella n. gen. (Leiodidae, Leptodirini)

    NARCIS (Netherlands)

    Njunjić, I.; Perreau, M.; Hendriks, K.; Schilthuizen, M.; Deharveng, L.

    2016-01-01

    The subtribe Anthroherponina form an iconic group of obligate cave beetles, typical representatives of the Dinaric subterranean fauna, which is considered to be the richest in the world. Phylogenetic studies within this subtribe are scarce and based only on morphological characters, which, due to

  14. Testing morphologically based phylogenetic theories within the cartilaginous fishes with molecular data, with special reference to the catshark family (Chondrichthyes; Scyliorhinidae) and the interrelationships within them.

    Science.gov (United States)

    Human, Brett A; Owen, E Patricia; Compagno, Leonard J V; Harley, Eric H

    2006-05-01

    A molecular phylogenetic investigation was conducted to examine phylogenetic relationships between various members of the catsharks (Chondrichthyes; Carcharhiniformes; Scyliorhinidae), and is the largest chondrichthyan data set yet analysed, consisting of nearly 130,000 nucleotides. Three mitochondrial DNA genes were used to construct the phylogenies, cytochrome b, NADH-2, and NADH-4, with 41 sequences from 18 taxa being novel. These sequences were either used separately or combined into a single data set, and phylogenies were constructed using various methods, however, only the Bayesian inference tree derived from the cytochrome b data set was resolved sufficiently for phylogenetic inferences to be made. Interestingly, the family Scyliorhinidae was not supported by the results and was found to be paraphyletic. The Scyliorhininae and Pentanchinae were supported, whereas the Pentanchini clade was present, but not well supported. The Halaelurini hypothesis was supported with Holohalaelurus identified as the basal genus of that clade, and Haploblepharus edwardsii identified as the basal taxon for that genus. Elsewhere within the Chondrichthyes, the Carcharhiniformes and the Lamniformes were found to be monophyletic, and the Heterodontiformes was placed within the Squalimorphs. The placement of the skates and rays in these analyses support the Batoidea as being sister to the Elasmobranchii.

  15. Targeted Enrichment of Large Gene Families for Phylogenetic Inference: Phylogeny and Molecular Evolution of Photosynthesis Genes in the Portullugo Clade (Caryophyllales).

    Science.gov (United States)

    Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J

    2018-05-01

    Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.

  16. Phylogenetic Signal in AFLP Data Sets

    NARCIS (Netherlands)

    Koopman, W.J.M.

    2005-01-01

    AFLP markers provide a potential source of phylogenetic information for molecular systematic studies. However, there are properties of restriction fragment data that limit phylogenetic interpretation of AFLPs. These are (a) possible nonindependence of fragments, (b) problems of homology assignment

  17. Molecular Phylogenetic Exploration of Bacterial Diversity in a Bakreshwar (India) Hot Spring and Culture of Shewanella-Related Thermophiles

    Science.gov (United States)

    Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata

    2003-01-01

    The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826

  18. Molecular detection and phylogenetic analysis of Hepatozoon spp. in questing Ixodes ricinus ticks and rodents from Slovakia and Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Hamšíková, Z.; Silaghi, C.; Rudolf, Ivo; Venclíková, Kristýna; Mahríková, L.; Slovák, M.; Mendel, Jan; Blažejová, Hana; Berthová, L.; Kocianová, E.; Hubálek, Zdeněk; Schnittger, L.; Kazimírová, M.

    2016-01-01

    Roč. 115, č. 10 (2016), s. 3897-3904 ISSN 0932-0113 EU Projects: European Commission(XE) 261504 - EDENEXT Institutional support: RVO:68081766 Keywords : Apicomplexa * Hepatozoon canis * Myodes glareolus * Apodemus spp. * Ticks * Central Europe Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.329, year: 2016

  19. Molecular Characterization and Phylogenetic Analysis of Listeria monocytogenes Isolated from Milk and Milk Products in Kaduna, Nigeria

    Directory of Open Access Journals (Sweden)

    U. B. Usman

    2016-01-01

    Full Text Available In this study, Listeria (L. monocytogenes isolated from milk and milk products in Kaduna, Nigeria, were subjected to a multiplex PCR assay to identify virulence-associated genes (such as prf A, inl A, hly A, act A, and iap. Of the 36 isolates, 9 (25% were positive for one or two virulence-associated genes. Based on the sample type, 6 (16.9% of the isolates that possessed virulence-associated genes were obtained from raw milk, 2 (3.2% from “Manshanu,” and 1 (2.8% from “Kindrimo.” Sequence and phylogenetic analysis based on the 16S rRNA revealed that Nigerian L. monocytogenes isolates (NGA 34A, NGA 35A, NGA 41A, and NGA 38A, when compared with reference L. monocytogenes, were grouped into two distinct clusters, A and B, with sequence (NGA 34A, NGA 35A, and NGA 41A phylogenetically closer to J1776; N1-011A; R2-502; J1816; and J2-031, whereas L. monocytogenes isolate (NGA 38A clustered with EDG; J1-220; J1926; J1817; and J2-1091. The separation of the Nigerian L. monocytogenes isolates into linage A (responsible for epidemic listeriosis and lineage B (responsible for sporadic cases of listeriosis is of public health concern and that local isolates might have potentials for human food borne listeriosis based on the virulence factors so far identified.

  20. Piscine reovirus: Genomic and molecular phylogenetic analysis from farmed and wild salmonids collected on the Canada/US Pacific Coast

    Science.gov (United States)

    Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul S.; Richmond, Zina; Purcell, Maureen K.; Johns, Robert; Johnson, Stewart C.; Sakasida, Sonja M.

    2015-01-01

    Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period.

  1. Phylogenetic Analysis and Molecular Characterization of Xanthium sibiricum Using DNA Barcoding, PCR-RFLP, and Specific Primers.

    Science.gov (United States)

    Tomasello, Salvatore; Heubl, Günther

    2017-07-01

    The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.

  2. First time molecular detection and phylogenetic relationships of torque teno sus virus 1 and 2 in domestic pigs in Uganda: further evidence for a global distribution

    Directory of Open Access Journals (Sweden)

    Brink Matilda

    2012-02-01

    Full Text Available Abstract Background Torque teno sus virus 1 (TTSuV1 and 2 (TTSuV2 are small, single-stranded circular DNA viruses belonging to the Anelloviridae family. Available studies clearly show that both viruses are widely distributed in the pig populations in America, Europe and Asia, although the impact of the infection is still unclear. Currently, the situation in domestic pig populations on the African continent is not known. Therefore, the aim of this study was to investigate the possible presence of the two viruses in domestic pigs in Uganda, and describe the phylogenetic relationships to those in the rest of the world. Results Ninety-five serum samples from six districts in Uganda were used, and PCR using TTSuV1 and 2 specific primers for the UTR region was run for viral nucleic acid detection. The positive samples were sequenced, and phylogenetic analyses performed in order to compare the Ugandan sequences with sequences from other parts of the world. The prevalence of TTSuV1 and 2 in the selected domestic pigs were estimated at 16.8% and 48.4% respectively, with co-infection found in 13.7%. The sequence identity was 90-100% between the Ugandan TTSuV1; and 63-100% between the Ugandan TTSuV2 sequences. Conclusion This is the first report on the presence of TTSuV1 and 2 in domestic pigs in Uganda. These results highlight the importance of screening for emerging viruses given the globalisation of human activities.

  3. Molecular characterization of Fasciola gigantica in Delhi, India and its phylogenetic relation to the species from South Asian countries.

    Science.gov (United States)

    Hayashi, Kei; Mohanta, Uday K; Neeraja, Tambireddy; Itagaki, Tadashi

    2016-10-01

    The aim of this study was to phylogenetically analyze Fasciola gigantica (F. gigantica) from mainland India and to reveal the expansion history of F. gigantica in the Indian subcontinent. We analyzed 40 Fasciola flukes that were collected from Delhi, in the Indian mainland, and identified them as F. gigantica by using nucleotide analyses of the nuclear phosphoenolpyruvate carboxykinase (pepck) and DNA polymerase delta (pold) genes. Based on the nucleotide sequence of mitochondrial NADH dehydrogenase subunit 1 (nad1) gene, the flukes had 18 haplotypes. The haplotypes were classified under haplogroup A, which is predominant in the F. gigantica of South Asia. The population genetics of haplogroup A revealed that Delhi population showed higher π value than eastern India population. These results suggest that F. gigantica of haplogroup A might have spread from the west to the east in India along with the artificial migration of the domestic Zebu cattle, Bos indicus.

  4. Hepatozoon canis in German red foxes (Vulpes vulpes) and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp.

    Science.gov (United States)

    Najm, Nour-Addeen; Meyer-Kayser, Elisabeth; Hoffmann, Lothar; Pfister, Kurt; Silaghi, Cornelia

    2014-07-01

    In this study, the prevalence of Hepatozoon spp. in red foxes (Vulpes vulpes) and their ticks from Germany, as well as molecular characterizations and phylogenetic relationship to other Hepatozoon spp. were investigated. DNA extracts of 261 spleen samples and 1,953 ticks were examined for the presence of Hepatozoon spp. by a conventional polymerase chain reaction (PCR) targeting the 18S rRNA gene. The ticks included four tick species: Ixodes ricinus, Ixodes canisuga, Ixodes hexagonus and Dermacentor reticulatus. A total of 118/261 foxes (45.2%) and 148/1,953 ticks (7.5%) were Hepatozoon PCR-positive. Amplicons from 36 positive foxes and 41 positive ticks were sequenced. All sequences obtained from foxes and 39/41 from ticks had a 99% similarity to Hepatozoon canis, whereas two ticks' sequences had a 99% identity to Hepatozoon sp. The obtained Hepatozoon sequences in this study were phylogenetically related to other Hepatozoon sequences detected in other countries, which may represent strain variants. The high prevalence of H. canis DNA in red foxes in this study supports the suggested role of those animals in distribution of this parasite. Furthermore, detection of DNA of H. canis in foxes and all examined tick species collected from those foxes allows speculating about previously undescribed potential vectors for H. canis and suggests a potential role of the red fox in its natural endemic cycles.

  5. Morphological and molecular characterization and phylogenetic relationships of a new species of trypanosome in Tapirus terrestris (lowland tapir), Trypanosoma terrestris sp. nov., from Atlantic Rainforest of southeastern Brazi.

    Science.gov (United States)

    Acosta, Igor da Cunha Lima; da Costa, Andrea Pereira; Nunes, Pablo Henrique; Gondim, Maria Fernanda Naegeli; Gatti, Andressa; Rossi, João Luiz; Gennari, Solange Maria; Marcili, Arlei

    2013-12-11

    The Lowland tapir (Tapirus terrestris) is the largest Brazilian mammal and despite being distributed in various Brazilian biomes, it is seriously endangered in the Atlantic Rainforest. These hosts were never evaluated for the presence of Trypanosoma parasites. The Lowland tapirs were captured in the Brazilian southeastern Atlantic Rainforest, Espírito Santo state. Trypanosomes were isolated by hemoculture, and the molecular phylogeny based on small subunit rDNA (SSU rDNA) and glycosomal-3-phosphate dehydrogenase (gGAPDH) gene sequences and the ultrastructural features seen via light microscopy and scanning and transmission electron microscopy are described. Phylogenetic trees using combined SSU rDNA and gGAPDH data sets clustered the trypanosomes of Lowland tapirs, which were highly divergent from other trypanosome species. The phylogenetic position and morphological discontinuities, mainly in epimastigote culture forms, made it possible to classify the trypanosomes from Lowland tapirs as a separate species. The isolated trypanosomes from Tapirus terrestris are a new species, Trypanosoma terrestris sp. n., and were positioned in a new Trypanosoma clade, named T. terrestris clade.

  6. Molecular phylogenetics and comparative modeling of HEN1, a methyltransferase involved in plant microRNA biogenesis

    Directory of Open Access Journals (Sweden)

    Obarska Agnieszka

    2006-01-01

    Full Text Available Abstract Background Recently, HEN1 protein from Arabidopsis thaliana was discovered as an essential enzyme in plant microRNA (miRNA biogenesis. HEN1 transfers a methyl group from S-adenosylmethionine to the 2'-OH or 3'-OH group of the last nucleotide of miRNA/miRNA* duplexes produced by the nuclease Dicer. Previously it was found that HEN1 possesses a Rossmann-fold methyltransferase (RFM domain and a long N-terminal extension including a putative double-stranded RNA-binding motif (DSRM. However, little is known about the details of the structure and the mechanism of action of this enzyme, and about its phylogenetic origin. Results Extensive database searches were carried out to identify orthologs and close paralogs of HEN1. Based on the multiple sequence alignment a phylogenetic tree of the HEN1 family was constructed. The fold-recognition approach was used to identify related methyltransferases with experimentally solved structures and to guide the homology modeling of the HEN1 catalytic domain. Additionally, we identified a La-like predicted RNA binding domain located C-terminally to the DSRM domain and a domain with a peptide prolyl cis/trans isomerase (PPIase fold, but without the conserved PPIase active site, located N-terminally to the catalytic domain. Conclusion The bioinformatics analysis revealed that the catalytic domain of HEN1 is not closely related to any known RNA:2'-OH methyltransferases (e.g. to the RrmJ/fibrillarin superfamily, but rather to small-molecule methyltransferases. The structural model was used as a platform to identify the putative active site and substrate-binding residues of HEN and to propose its mechanism of action.

  7. Molecular characterization and phylogenetic analysis of human influenza A viruses isolated in Iran during the 2014-2015 season.

    Science.gov (United States)

    Moasser, Elham; Behzadian, Farida; Moattari, Afagh; Fotouhi, Fatemeh; Rahimi, Amir; Zaraket, Hassan; Hosseini, Seyed Younes

    2017-07-01

    Influenza A viruses are an important cause of severe infectious diseases in humans and are characterized by their fast evolution rate. Global monitoring of these viruses is critical to detect newly emerging variants during annual epidemics. Here, we sought to genetically characterize influenza A/H1N1pdm09 and A/H3N2 viruses collected in Iran during the 2014-2015 influenza season. A total of 200 nasopharyngeal swabs were collected from patients with influenza-like illnesses. Swabs were screened for influenza A and B using real-time PCR. Furthermore, positive specimens with high virus load underwent virus isolation and genetic characterization of their hemagglutinin (HA) and M genes. Of the 200 specimens, 80 were influenza A-positive, including 44 A/H1N1pdm09 and 36 A/H3N2, while 18 were influenza B-positive. Phylogenetic analysis of the HA genes of the A/H1N1pdm09 viruses revealed the circulation of clade 6C, characterized by amino acid substitutions D97N, V234I and K283E. Analysis of the A/H3N2 viruses showed a genetic drift from the vaccine strain A/Texas/50/2012 with 5 mutations (T128A, R142G, N145S, P198S and S219F) belonging to the antigenic sites A, B, and D of the HA protein. The A/H3N2 viruses belonged to phylogenetic clades 3C.2 and 3C.3. The M gene trees of the Iranian A/H1N1pdm09 and A/H3N2 mirrored the clustering patterns of their corresponding HA trees. Our results reveal co-circulation of several influenza A virus strains in Iran during the 2014-2015 influenza season.

  8. Geographic distribution of Staphylococcus aureus causing invasive infections in Europe : A molecular-epidemiological analysis

    NARCIS (Netherlands)

    Grundmann, Hajo; Aanensen, David M; van den Wijngaard, Cees C; Spratt, Brian G; Harmsen, Dag; Friedrich, Alexander W; Tami, Adriana

    Background: Staphylococcus aureus is one of the most important human pathogens and methicillin-resistant variants (MRSAs) are a major cause of hospital and community-acquired infection. We aimed to map the geographic distribution of the dominant clones that cause invasive infections in Europe.

  9. Genetic species identification in weatherfish and first molecular confirmation of Oriental Weatherfish Misgurnus anguillicaudatus (Cantor, 1842 in Central Europe

    Directory of Open Access Journals (Sweden)

    Belle Christina C.

    2017-01-01

    Full Text Available The Oriental Weatherfish is considered a globally invasive fish species. In Europe, several reported feral populations of Oriental Weatherfish display an overlapping distribution range with native weatherfish Misgurnus fossilis, a declining species of international conservation and aquatic management concern. Morphologically distinguishing the different weatherfish species can be difficult, as their coloration is highly variable, many species reveal high phenotypic plasticity, and morphological traits like coloration might be not obvious or might be degraded during field sampling and after preservation. Herein, we analysed suspicious weatherfish specimens from southern Germany, demonstrating the usefulness of molecular genetic species identifications in this genus. We present the first molecular genetic species record of Misgurnus anguillicaudatus in Central Europe, and confirm the range expansion of Oriental Weatherfish into the river Inn catchment in southern Germany. As accurate species identification is crucial both in the context of monitoring and conserving native endangered species, and in early detection and prevention of biological invasion, we suggest the standard use of genetic species identification if morphological traits are not obvious.

  10. Molecular diagnosis and phylogenetic analysis of Babesia bigemina and Babesia bovis hemoparasites from cattle in South Africa

    Science.gov (United States)

    2013-01-01

    Background Babesia parasites, mainly Babesia bovis and B. bigemina, are tick-borne hemoparasites inducing bovine babesiosis in cattle globally. The clinical signs of the disease include, among others, anemia, fever and hemoglobinuria. Babesiosis is known to occur in tropical and subtropical regions of the world. In this study, we aim to provide information about the occurrence and phylogenetic relationship of B. bigemina and B. bovis species in cattle from different locations in nine provinces of South Africa. A total of 430 blood samples were randomly collected from apparently healthy cattle. These samples were genetically tested for Babesia parasitic infections using nested PCR assays with species-specific primers. Results Nested PCR assays with Group I primer sets revealed that the overall prevalence of B. bigemina and B. bovis in all bovine samples tested was 64.7% (95% CI = 60.0-69.0) and 35.1% (95% CI = 30.6-39.8), respectively. Only 117/430 (27.2%) animals had a mixed infection. The highest prevalence of 87.5% (95% CI = 77.2-93.5) for B. bigemina was recorded in the Free State province collection sites (Ficksburg, Philippolis and Botshabelo), while North West collection sites had the highest number of animals infected with B. bovis (65.5%; 95% CI = 52.7-76.4). Phylograms were inferred based on B. bigemina-specific gp45 and B. bovis-specific rap-1 nucleotide sequences obtained with Group II nested PCR primers. Phylogenetic analysis of gp45 sequences revealed significant differences in the genotypes of B. bigemina isolates investigated, including those of strains published in GenBank. On the other hand, a phylogeny based on B. bovis rap-1 sequences indicated a similar trend of clustering among the sequences of B. bovis isolates investigated in this study. Conclusion This study demonstrates the occurrence of Babesia parasites in cattle from different provinces of South Africa. It was also noted that the situation of Babesia parasitic infection

  11. Molecular diagnosis and phylogenetic analysis of Babesia bigemina and Babesia bovis hemoparasites from cattle in South Africa.

    Science.gov (United States)

    Mtshali, Moses Sibusiso; Mtshali, Phillip Senzo

    2013-08-08

    Babesia parasites, mainly Babesia bovis and B. bigemina, are tick-borne hemoparasites inducing bovine babesiosis in cattle globally. The clinical signs of the disease include, among others, anemia, fever and hemoglobinuria. Babesiosis is known to occur in tropical and subtropical regions of the world. In this study, we aim to provide information about the occurrence and phylogenetic relationship of B. bigemina and B. bovis species in cattle from different locations in nine provinces of South Africa. A total of 430 blood samples were randomly collected from apparently healthy cattle. These samples were genetically tested for Babesia parasitic infections using nested PCR assays with species-specific primers. Nested PCR assays with Group I primer sets revealed that the overall prevalence of B. bigemina and B. bovis in all bovine samples tested was 64.7% (95% CI = 60.0-69.0) and 35.1% (95% CI = 30.6-39.8), respectively. Only 117/430 (27.2%) animals had a mixed infection. The highest prevalence of 87.5% (95% CI = 77.2-93.5) for B. bigemina was recorded in the Free State province collection sites (Ficksburg, Philippolis and Botshabelo), while North West collection sites had the highest number of animals infected with B. bovis (65.5%; 95% CI = 52.7-76.4). Phylograms were inferred based on B. bigemina-specific gp45 and B. bovis-specific rap-1 nucleotide sequences obtained with Group II nested PCR primers. Phylogenetic analysis of gp45 sequences revealed significant differences in the genotypes of B. bigemina isolates investigated, including those of strains published in GenBank. On the other hand, a phylogeny based on B. bovis rap-1 sequences indicated a similar trend of clustering among the sequences of B. bovis isolates investigated in this study. This study demonstrates the occurrence of Babesia parasites in cattle from different provinces of South Africa. It was also noted that the situation of Babesia parasitic infection in cattle from certain areas

  12. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences.

    Science.gov (United States)

    Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan

    2005-10-10

    The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

  13. Pyruvate:Quinone Oxidoreductase in Corynebacterium glutamicum: Molecular Analysis of the pqo Gene, Significance of the Enzyme, and Phylogenetic Aspects

    Czech Academy of Sciences Publication Activity Database

    Schreiner, M. E.; Riedel, Ch.; Holátko, Jiří; Pátek, Miroslav; Eikmanns, B. J.

    2006-01-01

    Roč. 188, č. 4 (2006), s. 1341-1350 ISSN 0021-9193 R&D Projects: GA ČR GA525/04/0548 Institutional research plan: CEZ:AV0Z50200510 Keywords : corynebacterium glutamicum * pqo * molecular analysis Subject RIV: EE - Microbiology, Virology Impact factor: 3.993, year: 2006

  14. Peculiarities of inflorescences morphogenesis in model representatives of the Celastraceae R.Br. in context of molecular phylogenetic data

    Directory of Open Access Journals (Sweden)

    Ivan A. Savinov

    2014-04-01

    Full Text Available Peculiarities of laying and forming of inflorescences for model representatives of the Celastraceae are studied. Specific characters in rhythm development of generative elements for different taxa are determined. Morphological markers, which are coincided completely with molecular characters, are determined. They are evidenced on closely relation between next taxa: Celastrus and Tripterygium, Salacia and Sarawakodendron, Salacia and Brexia.

  15. The phylogenetic intrarelationships of spiny-rayed fishes (Acanthomorpha, Teleostei, Actinopterygii: fossil taxa increase the congruence of morphology with molecular data

    Directory of Open Access Journals (Sweden)

    Donald Davesne

    2016-11-01

    Full Text Available Acanthomorpha (spiny-rayed fishes is a clade of teleosts that includes more than 15 000 extant species. Their deep phylogenetic intrarelationships, first reconstructed using morphological characters, have been extensively revised with molecular data. Moreover, the deep branches of the acanthomorph tree are still largely unresolved, with strong disagreement between studies. Here, we review the historical propositions for acanthomorph deep intrarelationships and attempt to resolve their earliest branching patterns using a new morphological data matrix compiling and revising characters from previous studies. The taxon sampling we use constitutes a first attempt to test all previous hypotheses (molecular and morphological alike with morphological data only. Our sampling also includes Late Cretaceous fossil taxa, which yield new character state combinations that are absent in extant taxa. Analysis of the complete morphological data matrix yields a new topology that shows remarkable congruence with the well-supported molecular results. Lampridiformes (oarfishes and allies are the sister to all other acanthomorphs. Gadiformes (cods and allies and Zeiformes (dories form a clade with Percopsiformes (trout-perches and the enigmatic Polymixia (beardfish and Stylephorus (tube-eye. Ophidiiformes (cusk-eels and allies and Batrachoidiformes (toadfishes are nested within Percomorpha, the clade that includes most of modern acanthomorph diversity. These results provide morphological synapomorphies and independent corroboration of clades previously only recovered from molecular data, thereby suggesting the emergence of a congruent picture of acanthomorph deep intrarelationships. Fossil taxa play a critical role in achieving this congruence, since a very different topology is found when they are excluded from the analysis.

  16. Archigregarines of the English Channel revisited: New molecular data on Selenidium species including early described and new species and the uncertainties of phylogenetic relationships.

    Directory of Open Access Journals (Sweden)

    Sonja Rueckert

    Full Text Available Gregarines represent an important transition step from free-living predatory (colpodellids s.l. and/or photosynthetic (Chromera and Vitrella apicomplexan lineages to the most important pathogens, obligate intracellular parasites of humans and domestic animals such as coccidians and haemosporidians (Plasmodium, Toxoplasma, Eimeria, Babesia, etc.. While dozens of genomes of other apicomplexan groups are available, gregarines are barely entering the molecular age. Among the gregarines, archigregarines possess a unique mixture of ancestral (myzocytosis and derived (lack of apicoplast, presence of subpellicular microtubules features.In this study we revisited five of the early-described species of the genus Selenidium including the type species Selenidium pendula, with special focus on surface ultrastructure and molecular data. We were also able to describe three new species within this genus. All species were characterized at morphological (light and scanning electron microscopy data and molecular (SSU rDNA sequence data levels. Gregarine specimens were isolated from polychaete hosts collected from the English Channel near the Station Biologique de Roscoff, France: Selenidium pendula from Scolelepis squamata, S. hollandei and S. sabellariae from Sabellaria alveolata, S. sabellae from Sabella pavonina, Selenidium fallax from Cirriformia tentaculata, S. spiralis sp. n. and S. antevariabilis sp. n. from Amphitritides gracilis, and S. opheliae sp. n. from Ophelia roscoffensis. Molecular phylogenetic analyses of these data showed archigregarines clustering into five separate clades and support previous doubts about their monophyly.Our phylogenies using the extended gregarine sampling show that the archigregarines are indeed not monophyletic with one strongly supported clade of Selenidium sequences around the type species S. pendula. We suggest the revision of the whole archigregarine taxonomy with only the species within this clade remaining in the genus

  17. Circulation of different lineages of Dengue virus 2, genotype American/Asian in Brazil: dynamics and molecular and phylogenetic characterization.

    Directory of Open Access Journals (Sweden)

    Betânia Paiva Drumond

    Full Text Available The American/Asian genotype of Dengue virus type 2 (DENV-2 was introduced into the Americas in the 80's. Although there is no data showing when this genotype was first introduced into Brazil, it was first detected in Brazil in 1990. After which the virus spread throughout the country and major epidemics occurred in 1998, 2007/08 and 2010. In this study we sequenced 12 DENV-2 genomes obtained from serum samples of patients with dengue fever residing in São José do Rio Preto, São Paulo (SJRP/SP, Brazil, in 2008. The whole open reading frame or envelope sequences were used to perform phylogenetic, phylogeographic and evolutionary analyses. Isolates from SJRP/SP were grouped within one lineage (BR3 close to isolates from Rio de Janeiro, Brazil. Isolates from SJRP were probably introduced there at least in 2007, prior to its detection in the 2008 outbreak. DENV-2 circulation in Brazil is characterized by the introduction, displacement and circulation of three well-defined lineages in different times, most probably from the Caribbean. Thirty-seven unique amino acid substitutions were observed among the lineages, including seven amino acid differences in domains I to III of the envelope protein. Moreover, we dated here, for the first time, the introduction of American/Asian genotype into Brazil (lineage BR1 to 1988/89, followed by the introduction of lineages BR2 (1998-2000 and BR3 (2003-05. Our results show a delay between the introduction and detection of DENV-2 lineages in Brazil, reinforcing the importance and need for surveillance programs to detect and trace the evolution of these viruses. Additionally, Brazilian DENV-2 differed in genetic diversity, date of introduction and geographic origin and distribution in Brazil, and these are important factors for the evolution, dynamics and control of dengue.

  18. Molecular Characterization and Phylogenetic Analysis of Two Novel Regio-specific Flavonoid Prenyltransferases from Morus alba and Cudrania tricuspidata*

    Science.gov (United States)

    Wang, Ruishan; Chen, Ridao; Li, Jianhua; Liu, Xiao; Xie, Kebo; Chen, Dawei; Yin, Yunze; Tao, Xiaoyu; Xie, Dan; Zou, Jianhua; Yang, Lin; Dai, Jungui

    2014-01-01

    Prenylated flavonoids are attractive specialized metabolites with a wide range of biological activities and are distributed in several plant families. The prenylation catalyzed by prenyltransferases represents a Friedel-Crafts alkylation of the flavonoid skeleton in the biosynthesis of natural prenylated flavonoids and contributes to the structural diversity and biological activities of these compounds. To date, all identified plant flavonoid prenyltransferases (FPTs) have been identified in Leguminosae. In the present study two new FPTs, Morus alba isoliquiritigenin 3′-dimethylallyltransferase (MaIDT) and Cudrania tricuspidata isoliquiritigenin 3′-dimethylallyltransferase (CtIDT), were identified from moraceous plants M. alba and C. tricuspidata, respectively. MaIDT and CtIDT shared low levels of homology with the leguminous FPTs. MaIDT and CtIDT are predicted to be membrane-bound proteins with predicted transit peptides, seven transmembrane regions, and conserved functional domains that are similar to other homogentisate prenyltransferases. Recombinant MaIDT and CtIDT were able to regioselectively introduce dimethylallyl diphosphate into the A ring of three flavonoids with different skeleton types (chalcones, isoflavones, and flavones). Phylogenetic analysis revealed that MaIDT and CtIDT are distantly related to their homologs in Leguminosae, which suggests that FPTs in Moraceae and Leguminosae might have evolved independently. MaIDT and CtIDT represent the first two non-Leguminosae FPTs to be identified in plants and could thus lead to the identification of additional evolutionarily varied FPTs in other non-Leguminosae plants and could elucidate the biosyntheses of prenylated flavonoids in various plants. Furthermore, MaIDT and CtIDT might be used for regiospecific prenylation of flavonoids to produce bioactive compounds for potential therapeutic applications due to their high efficiency and catalytic promiscuity. PMID:25361766

  19. First molecular data and the phylogenetic position of the millipede-like centipede Edentistoma octosulcatum Tömösváry, 1882 (Chilopoda: Scolopendromorpha: Scolopendridae.

    Directory of Open Access Journals (Sweden)

    Varpu Vahtera

    Full Text Available Edentistoma octosulcatum Tömösváry, 1882, is a rare, superficially millipede-like centipede known only from Borneo and the Philippines. It is unique within the order Scolopendromorpha for its slow gait, robust tergites, and highly modified gizzard and mandible morphology. Not much is known about the biology of the species but it has been speculated to be arboreal with a possibly vegetarian diet. Until now its phylogenetic position within the subfamily Otostigminae has been based only on morphological characters, being variably ranked as a monotypic tribe (Arrhabdotini or classified with the Southeast Asian genus Sterropristes Attems, 1934. The first molecular data for E. octosulcatum sourced from a newly collected specimen from Sarawak were analysed with and without morphology. Parsimony analysis of 122 morphological characters together with two nuclear and two mitochondrial loci resolves Edentistoma as sister group to three Indo-Australian species of Rhysida, this clade in turn grouping with Ethmostigmus, whereas maximum likelihood and parsimony analyses of the molecular data on their own ally Edentistoma with species of Otostigmus. A position of Edentistoma within Otostigmini (rather than being its sister group as predicted by the Arrhabdotini hypothesis is consistently retrieved under different analytical conditions, but support values within the subfamily remain low for most nodes. The species exhibits strong pushing behaviour, suggestive of burrowing habits. Evidence against a suggested vegetarian diet is provided by observation of E. octosulcatum feeding on millipedes in the genus Trachelomegalus.

  20. Molecular characterization and phylogenetic relationship of wild type 1 poliovirus strains circulating across Pakistan and Afghanistan bordering areas during 2010-2012.

    Directory of Open Access Journals (Sweden)

    Shahzad Shaukat

    Full Text Available Pakistan and Afghanistan share a long uncontrolled border with extensive population movement on both sides. Wild poliovirus transmission has never been interrupted in this block due to war against terrorism, poor public health infrastructure, misconceptions about polio vaccines and inadequate immunization activities. All these issues complicate the eradication operations and reinforce the complexity of wiping out poliomyelitis from this region. This study illustrates the origins and routes of cross-border wild poliovirus type 1 (WPV1 transmission during 2010-2012 between Pakistan and Afghanistan. Sequence analyses were conducted based on complete VP1 capsid protein sequences for WPV1 study strains to determine the origin of poliovirus genetic lineages and their evolutionary relationships. Phylogenetic tree was constructed from VP1 gene sequences applying Maximum Likelihood method using Kimura 2- parameter model in MEGA program v 5.0. A total of 72 (14.3% out of 502 wild-type 1 polioviruses were found circulating in border areas of both countries during 2010-2012. Molecular phylogenetic analysis classified these strains in to two sub-genotypes with four clusters and 18 lineages. Genetic data confirmed that the most of WPV1 lineages (12; 66.6% were transmitted from Pakistan to Afghanistan. However, the genetic diversity was significantly reduced during 2012 as most of the lineages were completely eliminated. In conclusion, Pakistan-Afghanistan block has emerged as a single poliovirus reservoir sharing the multiple poliovirus lineages due to uncontrolled movement of people across the borders between two countries. If it is neglected, it can jeopardize the extensive global efforts done so-far to eradicate the poliovirus infection. Our data will be helpful to devise the preventive strategies for effective control of wild poliovirus transmission in this region.

  1. Molecular phylogenetic reconstruction and localization of the (TTAGGn telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863 suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera

    Directory of Open Access Journals (Sweden)

    Tássia Tatiane Pontes Pereira

    2018-01-01

    Full Text Available Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known. The main exception is Acromyrmex striatus (Roger, 1863, which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH with telomeric probes with (TTAGG6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus. Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  2. Evaluation of a Phylogenetic Marker Based on Genomic Segment B of Infectious Bursal Disease Virus: Facilitating a Feasible Incorporation of this Segment to the Molecular Epidemiology Studies for this Viral Agent.

    Directory of Open Access Journals (Sweden)

    Abdulahi Alfonso-Morales

    Full Text Available Infectious bursal disease (IBD is a highly contagious and acute viral disease, which has caused high mortality rates in birds and considerable economic losses in different parts of the world for more than two decades and it still represents a considerable threat to poultry. The current study was designed to rigorously measure the reliability of a phylogenetic marker included into segment B. This marker can facilitate molecular epidemiology studies, incorporating this segment of the viral genome, to better explain the links between emergence, spreading and maintenance of the very virulent IBD virus (vvIBDV strains worldwide.Sequences of the segment B gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank Database; Cuban sequences were obtained in the current work. A phylogenetic marker named B-marker was assessed by different phylogenetic principles such as saturation of substitution, phylogenetic noise and high consistency. This last parameter is based on the ability of B-marker to reconstruct the same topology as the complete segment B of the viral genome. From the results obtained from B-marker, demographic history for both main lineages of IBDV regarding segment B was performed by Bayesian skyline plot analysis. Phylogenetic analysis for both segments of IBDV genome was also performed, revealing the presence of a natural reassortant strain with segment A from vvIBDV strains and segment B from non-vvIBDV strains within Cuban IBDV population.This study contributes to a better understanding of the emergence of vvIBDV strains, describing molecular epidemiology of IBDV using the state-of-the-art methodology concerning phylogenetic reconstruction. This study also revealed the presence of a novel natural reassorted strain as possible manifest of change in the genetic structure and stability of the vvIBDV strains. Therefore, it highlights the need to obtain information about both genome segments of IBDV for

  3. Evaluation of a Phylogenetic Marker Based on Genomic Segment B of Infectious Bursal Disease Virus: Facilitating a Feasible Incorporation of this Segment to the Molecular Epidemiology Studies for this Viral Agent.

    Science.gov (United States)

    Alfonso-Morales, Abdulahi; Rios, Liliam; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Ganges, Llilianne; Díaz de Arce, Heidy; Majó, Natàlia; Núñez, José I; Pérez, Lester J

    2015-01-01

    Infectious bursal disease (IBD) is a highly contagious and acute viral disease, which has caused high mortality rates in birds and considerable economic losses in different parts of the world for more than two decades and it still represents a considerable threat to poultry. The current study was designed to rigorously measure the reliability of a phylogenetic marker included into segment B. This marker can facilitate molecular epidemiology studies, incorporating this segment of the viral genome, to better explain the links between emergence, spreading and maintenance of the very virulent IBD virus (vvIBDV) strains worldwide. Sequences of the segment B gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank Database; Cuban sequences were obtained in the current work. A phylogenetic marker named B-marker was assessed by different phylogenetic principles such as saturation of substitution, phylogenetic noise and high consistency. This last parameter is based on the ability of B-marker to reconstruct the same topology as the complete segment B of the viral genome. From the results obtained from B-marker, demographic history for both main lineages of IBDV regarding segment B was performed by Bayesian skyline plot analysis. Phylogenetic analysis for both segments of IBDV genome was also performed, revealing the presence of a natural reassortant strain with segment A from vvIBDV strains and segment B from non-vvIBDV strains within Cuban IBDV population. This study contributes to a better understanding of the emergence of vvIBDV strains, describing molecular epidemiology of IBDV using the state-of-the-art methodology concerning phylogenetic reconstruction. This study also revealed the presence of a novel natural reassorted strain as possible manifest of change in the genetic structure and stability of the vvIBDV strains. Therefore, it highlights the need to obtain information about both genome segments of IBDV for molecular

  4. Selective constraints, molecular recombination structure and phylogenetic reconstruction of isometric plant RNA viruses of the families Luteoviridae and Tymoviridae.

    Science.gov (United States)

    Boulila, Moncef

    2011-02-01

    In an effort to enhance the knowledge on molecular evolution of currently the known members of the families Luteoviridae and Tymoviridae, in-depth molecular investigations in the entire genome of 147 accessions retrieved from the international databases, were carried out. Two algorithms (RECCO and RDP version 3.31β) adapted to the mosaic structure of viruses were utilized. The recombination frequency along the sequences was dissected and demonstrated that the three virus genera of the family Luteoviridae comprise numerous members subjected to recombination. It has pointed out that the major viruses swapped a few but long genomic segments. In addition, in Barley yellow dwarf virus, heredity material might be exchanged between two different serotypes. Even more, putative recombination events occurred between two different genera. Based on Fisher's Exact Test of Neutrality, positive selection acting on protein expression was detected only in the poleroviruses Cereal yellow dwarf virus, Potato leafroll virus and Wheat yellow dwarf virus. In contrast, several components of the family Tymoviridae were highly recombinant. Genomic portion exchange arose in many positions consisting of short fragments. Furthermore, no positive selection was detected. The evolutionary history showed, in the Luteoviridae, that all screened isolates split into three clusters corresponding to the three virus genera forming this family. Moreover, in the serotype PAV of Barley yellow dwarf virus, two major clades corresponding to PAV-USA and PAV-China, were delineated. Similarly, in the Tymoviridae, all analyzed isolates fell into four groups corresponding to the three virus genera composing this family along with the unclassified Tymoviridae. Inferred phylogenies reshuffled the existing classification and showed that Wheat yellow dwarf virus-RPV was genetically closely related to Cereal yellow dwarf virus and the unclassified Tymoviridae Grapevine syrah virus-1 constituted an integral part of

  5. Molecular Characterization and Phylogenetic Analysis of Anaplasma spp. and Ehrlichia spp. Isolated from Various Ticks in Southeastern and Northwestern Regions of Iran.

    Science.gov (United States)

    Jafar Bekloo, Ahmad; Ramzgouyan, Maryam Roya; Shirian, Sadegh; Faghihi, Faezeh; Bakhshi, Hassan; Naseri, Fatemeh; Sedaghat, Mehdi; Telmadarraiy, Zakkyeh

    2018-05-01

    Anaplasma/Ehrlichia species are tick-transmitted pathogens that cause infections in humans and numerous domestic and wild animal species. There is no information available on the molecular characteristics and phylogenetic position of Anaplasma/Ehrlichia spp. isolated from tick species from different geographic locations in Iran. The aim of this study was to determine the prevalence, molecular characteristics, and phylogenetic relationship of both Anaplasma spp. and Ehrlichia spp. in tick species isolated from different domestic animals from two different geographical locations of Iran. A total of 930 ticks were collected from 93 cattle, 250 sheep, and 587 goats inhabiting the study areas. The collected ticks were then investigated for the presence of Anaplasma/Ehrlichia spp. using nested PCR based on the 16S rRNA gene, followed by sequencing. Sequence analysis was done based on the data published in the GenBank on Anaplasma/Ehrlichia spp. isolates using bioinformatic tools such as the standard nucleotide BLAST. Genome of Anaplasma or Ehrlichia spp. was detected in 14 ticks collected in Heris, including 5 Dermacentor marginatus, 1 Haemaphysalis erinacei, 3 Hyalomma anatolicum, and 4 Rhipicephalus sanguineus, also in 29 ticks collected in Chabahar, including 14 R. sanguineus, 8 D. marginatus, 3 Hyalomma Anatolicum, and 4 Hyalomma dromedarii. Partial analysis of the 16S rRNA gene sequence of positive samples collected from goats and sheep showed that they were infected with Anaplasma/Ehrlichia spp. that were 94-98% identical to ovine Anaplasma and 91-96% identical to Neoehrlichia and Ehrlichia spp. The various ticks identified in this study suggest the possible emergence of tick-borne diseases in animals and humans in these regions. R. sanguineus and D. marginatus seem to be predominant vectors responsible for anaplasmosis in these regions. Partial sequence analysis of the 16S rRNA gene showed that A. ovis is genetically polymorphic in these regions. Furthermore, an

  6. Molecular survey of arthropod-borne pathogens in sheep keds (Melophagus ovinus), Central Europe.

    Science.gov (United States)

    Rudolf, Ivo; Betášová, Lenka; Bischof, Vlastimil; Venclíková, Kristýna; Blažejová, Hana; Mendel, Jan; Hubálek, Zdeněk; Kosoy, Michael

    2016-10-01

    In the study, we screened a total of 399 adult sheep keds (Melophagus ovinus) for the presence of RNA and DNA specific for arboviral, bacterial, and protozoan vector-borne pathogens. All investigated keds were negative for flaviviruses, phleboviruses, bunyaviruses, Borrelia burgdorferi, Rickettsia spp., Anaplasma phagocytophilum, "Candidatus Neoehrlichia mikurensis," and Babesia spp. All ked pools were positive for Bartonella DNA. The sequencing of the amplified fragments of the gltA and 16S-23S rRNA demonstrated a 100 % homology with Bartonella melophagi previously isolated from a sheep ked and from human blood in the USA. The identification of B. melophagi in sheep keds in Central Europe highlights needs extending a list of hematophagous arthropods beyond ticks and mosquitoes for a search of emerging arthropod-borne pathogens.

  7. Geographic distribution of Staphylococcus aureus causing invasive infections in Europe: a molecular-epidemiological analysis.

    Directory of Open Access Journals (Sweden)

    Hajo Grundmann

    2010-01-01

    Full Text Available Staphylococcus aureus is one of the most important human pathogens and methicillin-resistant variants (MRSAs are a major cause of hospital and community-acquired infection. We aimed to map the geographic distribution of the dominant clones that cause invasive infections in Europe.In each country, staphylococcal reference laboratories secured the participation of a sufficient number of hospital laboratories to achieve national geo-demographic representation. Participating laboratories collected successive methicillin-susceptible (MSSA and MRSA isolates from patients with invasive S. aureus infection using an agreed protocol. All isolates were sent to the respective national reference laboratories and characterised by quality-controlled sequence typing of the variable region of the staphylococcal spa gene (spa typing, and data were uploaded to a central database. Relevant genetic and phenotypic information was assembled for interactive interrogation by a purpose-built Web-based mapping application. Between September 2006 and February 2007, 357 laboratories serving 450 hospitals in 26 countries collected 2,890 MSSA and MRSA isolates from patients with invasive S. aureus infection. A wide geographical distribution of spa types was found with some prevalent in all European countries. MSSA were more diverse than MRSA. Genetic diversity of MRSA differed considerably between countries with dominant MRSA spa types forming distinctive geographical clusters. We provide evidence that a network approach consisting of decentralised typing and visualisation of aggregated data using an interactive mapping tool can provide important information on the dynamics of MRSA populations such as early signalling of emerging strains, cross border spread, and importation by travel.In contrast to MSSA, MRSA spa types have a predominantly regional distribution in Europe. This finding is indicative of the selection and spread of a limited number of clones within health care

  8. Molecular characterization and phylogenetic analysis of highly pathogenic Vibrio alginolyticus strains isolated during mortality outbreaks in cultured Ruditapes decussatus juvenile.

    Science.gov (United States)

    Mechri, Badreddine; Monastiri, Abir; Medhioub, Amel; Medhioub, Mohamed Nejib; Aouni, Mahjoub

    2017-10-01

    In the summer of 2008 and 2009, a series of mortalities in growing out seeds of R. decussatus juveniles were occurred in the eastern Tunisian littoral. Nine predominant bacterial strains were isolated from dead and moribund juveniles and characterized as Vibrio alginolyticus. These isolates were subjected to biochemical and molecular characterization. All the Vibrio strains were tested for their susceptibility against the most widely used antibiotic in aquaculture as well as, the assessment of the presence of erythromycin (emrB) and tetracycline (tetS) resistance genes among the tested bacteria. The degree of genetic relatedness between V. alginolyticus strains was evaluated on the basis of the Entero-Bacterial Repetitive Intergenic Consensus (ERIC) and the Random Amplification of Polymorphic DNA-PCR (RAPD-PCR) approaches. We also looked for siderophore activity and the ability to grow under iron limitation. Furthermore, the pathogenic potential of the tested isolates was evaluated using R. decussatus larva and juveniles as infection models. On antimicrobial susceptibility test, Vibrio strains exhibited total resistance to at least four antibiotics. The MICs data revealed that flumequine and oxolinic acid were the most effective antibiotics to control the studied bacteria. Results also showed that studied antibiotics resistance genes were widely disseminated in the genome of V. alginolyticus strains. Both ERIC and RAPD-PCR fingerprinting showed the presence of genetic variation among Vibrio isolates. However, RAPD typing exhibited a higher discriminative potential than ERIC-PCR. Besides, we reported here for the first time the co-production of catechol and hydroxamte by V. alginolyticus species. The challenge experiment showed that most of Vibrio isolates caused high mortality rates for both larva and juveniles at 48-h post-exposure to a bacterial concentration of 10 6  CFU/ml. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. A large-scale, higher-level, molecular phylogenetic study of the insect order Lepidoptera (moths and butterflies.

    Directory of Open Access Journals (Sweden)

    Jerome C Regier

    Full Text Available Higher-level relationships within the Lepidoptera, and particularly within the species-rich subclade Ditrysia, are generally not well understood, although recent studies have yielded progress. We present the most comprehensive molecular analysis of lepidopteran phylogeny to date, focusing on relationships among superfamilies.483 taxa spanning 115 of 124 families were sampled for 19 protein-coding nuclear genes, from which maximum likelihood tree estimates and bootstrap percentages were obtained using GARLI. Assessment of heuristic search effectiveness showed that better trees and higher bootstrap percentages probably remain to be discovered even after 1000 or more search replicates, but further search proved impractical even with grid computing. Other analyses explored the effects of sampling nonsynonymous change only versus partitioned and unpartitioned total nucleotide change; deletion of rogue taxa; and compositional heterogeneity. Relationships among the non-ditrysian lineages previously inferred from morphology were largely confirmed, plus some new ones, with strong support. Robust support was also found for divergences among non-apoditrysian lineages of Ditrysia, but only rarely so within Apoditrysia. Paraphyly for Tineoidea is strongly supported by analysis of nonsynonymous-only signal; conflicting, strong support for tineoid monophyly when synonymous signal was added back is shown to result from compositional heterogeneity.Support for among-superfamily relationships outside the Apoditrysia is now generally strong. Comparable support is mostly lacking within Apoditrysia, but dramatically increased bootstrap percentages for some nodes after rogue taxon removal, and concordance with other evidence, strongly suggest that our picture of apoditrysian phylogeny is approximately correct. This study highlights the challenge of finding optimal topologies when analyzing hundreds of taxa. It also shows that some nodes get strong support only when

  10. Molecular and phylogenetic characterization of honey bee viruses, Nosema microsporidia, protozoan parasites, and parasitic mites in China.

    Science.gov (United States)

    Yang, Bu; Peng, Guangda; Li, Tianbang; Kadowaki, Tatsuhiko

    2013-02-01

    China has the largest number of managed honey bee colonies, which produce the highest quantity of honey and royal jelly in the world; however, the presence of honey bee pathogens and parasites has never been rigorously identified in Chinese apiaries. We thus conducted a molecular survey of honey bee RNA viruses, Nosema microsporidia, protozoan parasites, and tracheal mites associated with nonnative Apis mellifera ligustica and native Apis cerana cerana colonies in China. We found the presence of black queen cell virus (BQCV), chronic bee paralysis virus (CBPV), deformed wing virus (DWV), Israeli acute paralysis virus (IAPV), and sacbrood virus (SBV), but not that of acute bee paralysis virus (ABPV) or Kashmir bee virus (KBV). DWV was the most prevalent in the tested samples. Phylogenies of Chinese viral isolates demonstrated that genetically heterogeneous populations of BQCV, CBPV, DWV, and A. cerana-infecting SBV, and relatively homogenous populations of IAPV and A. meliifera-infecting new strain of SBV with single origins, are spread in Chinese apiaries. Similar to previous observations in many countries, Nosema ceranae, but not Nosema apis, was prevalent in the tested samples. Crithidia mellificae, but not Apicystis bombi was found in five samples, including one A. c. cerana colony, demonstrating that C. mellificae is capable of infecting multiple honey bee species. Based on kinetoplast-encoded cytochrome b sequences, the C. mellificae isolate from A. c. cerana represents a novel haplotype with 19 nucleotide differences from the Chinese and Japanese isolates from A. m. ligustica. This suggests that A. c. cerana is the native host for this specific haplotype. The tracheal mite, Acarapis woodi, was detected in one A. m. ligustica colony. Our results demonstrate that honey bee RNA viruses, N. ceranae, C. mellificae, and tracheal mites are present in Chinese apiaries, and some might be originated from native Asian honey bees.

  11. The role of fusion in ant chromosome evolution: insights from cytogenetic analysis using a molecular phylogenetic approach in the genus mycetophylax.

    Science.gov (United States)

    Cardoso, Danon Clemes; das Graças Pompolo, Silvia; Cristiano, Maykon Passos; Tavares, Mara Garcia

    2014-01-01

    Among insect taxa, ants exhibit one of the most variable chromosome numbers ranging from n = 1 to n = 60. This high karyotype diversity is suggested to be correlated to ants diversification. The karyotype evolution of ants is usually understood in terms of Robertsonian rearrangements towards an increase in chromosome numbers. The ant genus Mycetophylax is a small monogynous basal Attini ant (Formicidae: Myrmicinae), endemic to sand dunes along the Brazilian coastlines. A recent taxonomic revision validates three species, Mycetophylax morschi, M. conformis and M. simplex. In this paper, we cytogenetically characterized all species that belongs to the genus and analyzed the karyotypic evolution of Mycetophylax in the context of a molecular phylogeny and ancestral character state reconstruction. M. morschi showed a polymorphic number of chromosomes, with colonies showing 2n = 26 and 2n = 30 chromosomes. M. conformis presented a diploid chromosome number of 30 chromosomes, while M. simplex showed 36 chromosomes. The probabilistic models suggest that the ancestral haploid chromosome number of Mycetophylax was 17 (Likelihood framework) or 18 (Bayesian framework). The analysis also suggested that fusions were responsible for the evolutionary reduction in chromosome numbers of M. conformis and M. morschi karyotypes whereas fission may determines the M. simplex karyotype. These results obtained show the importance of fusions in chromosome changes towards a chromosome number reduction in Formicidae and how a phylogenetic background can be used to reconstruct hypotheses about chromosomes evolution.

  12. Molecular differentiation and phylogenetic relationships of three Angiostrongylus species and Angiostrongylus cantonensis geographical isolates based on a 66-kDa protein gene of A. cantonensis (Nematoda: Angiostrongylidae).

    Science.gov (United States)

    Eamsobhana, Praphathip; Lim, Phaik Eem; Zhang, Hongman; Gan, Xiaoxian; Yong, Hoi Sen

    2010-12-01

    The phylogenetic relationships and molecular differentiation of three species of angiostrongylid nematodes (Angiostrongylus cantonensis, Angiostrongylus costaricensis and Angiostrongylus malaysiensis) were studied using the AC primers for a 66-kDa protein gene of A. cantonensis. The AC primers successfully amplified the genomic DNA of these angiostrongylid nematodes. No amplification was detected for the DNA of Ascaris lumbricoides, Ascaris suum, Anisakis simplex, Gnathostoma spinigerum, Toxocara canis, and Trichinella spiralis. The maximum-parsimony (MP) consensus tree and the maximum-likelihood (ML) tree both showed that the Angiostrongylus taxa could be divided into two major clades - Clade 1 (A. costaricensis) and Clade 2 (A. cantonensis and A. malaysiensis) with a full support bootstrap value. A. costaricensis is the most distant taxon. A. cantonensis is a sister group to A. malaysiensis; these two taxa (species) are clearly separated. There is no clear distinction between the A. cantonensis samples from four different geographical localities (Thailand, China, Japan and Hawaii); only some of the samples are grouped ranging from no support or low support to moderate support of bootstrap values. The published nucleotide sequences of A. cantonensis adult-specific native 66kDa protein mRNA, clone L5-400 from Taiwan (U17585) appear to be very distant from the A. cantonensis samples from Thailand, China, Japan and Hawaii, with the uncorrected p-distance values ranging from 26.87% to 29.92%.

  13. Phylogenetic analysis, genetic diversity and relationships between the recently segregated species of Corynandra and Cleoserrata from the genus Cleome using DNA barcoding and molecular markers.

    Science.gov (United States)

    Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2016-01-01

    Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  14. Targeting N-Glycan Cryptic Sugar Moieties for Broad-Spectrum Virus Neutralization: Progress in Identifying Conserved Molecular Targets in Viruses of Distinct Phylogenetic Origins

    Directory of Open Access Journals (Sweden)

    Denong Wang

    2015-03-01

    Full Text Available Identifying molecular targets for eliciting broadly virus-neutralizing antibodies is one of the key steps toward development of vaccines against emerging viral pathogens. Owing to genomic and somatic diversities among viral species, identifying protein targets for broad-spectrum virus neutralization is highly challenging even for the same virus, such as HIV-1. However, viruses rely on host glycosylation machineries to synthesize and express glycans and, thereby, may display common carbohydrate moieties. Thus, exploring glycan-binding profiles of broad-spectrum virus-neutralizing agents may provide key information to uncover the carbohydrate-based virus-neutralizing epitopes. In this study, we characterized two broadly HIV-neutralizing agents, human monoclonal antibody 2G12 and Galanthus nivalis lectin (GNA, for their viral targeting activities. Although these agents were known to be specific for oligomannosyl antigens, they differ strikingly in virus-binding activities. The former is HIV-1 specific; the latter is broadly reactive and is able to neutralize viruses of distinct phylogenetic origins, such as HIV-1, severe acute respiratory syndrome coronavirus (SARS-CoV, and human cytomegalovirus (HCMV. In carbohydrate microarray analyses, we explored the molecular basis underlying the striking differences in the spectrum of anti-virus activities of the two probes. Unlike 2G12, which is strictly specific for the high-density Man9GlcNAc2Asn (Man9-clusters, GNA recognizes a number of N-glycan cryptic sugar moieties. These include not only the known oligomannosyl antigens but also previously unrecognized tri-antennary or multi-valent GlcNAc-terminating N-glycan epitopes (Tri/m-Gn. These findings highlight the potential of N-glycan cryptic sugar moieties as conserved targets for broad-spectrum virus neutralization and suggest the GNA-model of glycan-binding warrants focused investigation.

  15. Molecular phylogeography of tick-borne encephalitis virus in central Europe

    Czech Academy of Sciences Publication Activity Database

    Weidmann, M.; Frey, S.; Freire, C.C.M.; Essbauer, S.; Růžek, Daniel; Klempa, B.; Zubrikova, D.; Vogerl, M.; Pfeffer, M.; Hufert, F.T.; Zanotto, P. M. de A.; Dobler, G.

    2013-01-01

    Roč. 94, SEP 2013 (2013), s. 2129-2139 ISSN 0022-1317 R&D Projects: GA ČR GAP502/11/2116 Grant - others:GA MŠk(CZ) ED0006/01/01 Institutional support: RVO:60077344 Keywords : Ixodes ricinus ticks * Dermacentor reticulatus * purifying selection Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.529, year: 2013

  16. Time spans and spacers : Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    NARCIS (Netherlands)

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be

  17. Phylogenetic position of Mexican jackrabbits within the genus Lepus (Mammalia: Lagomorpha: a molecular perspective Posición filogenética de las liebres mexicanas dentro del género Lepus (Mammalia: Lagomorpha: una perspectiva molecular

    Directory of Open Access Journals (Sweden)

    Juan Pablo Ramírez-Silva

    2010-12-01

    Full Text Available Although phylogenetic affinities of Mexican jackrabbits within the genus Lepus have been evaluated for a few species, no study has included all 5 species occurring in Mexico. In this study we assess the phylogenetic position of the Mexican species relative to other forms within the genus and evaluate evolutionary affinities among the Mexican forms. To do so, we analyzed 57 complete cytochrome b sequences belonging to the 5 Mexican jackrabbits and 18 species of Lepus distributed across Asia, Africa, Europe and America. We performed phylogenetic tree reconstruction with the neighbor-joining, maximum parsimony and maximum likelihood approaches. We also used a minimum spanning network to evaluate relationships among Mexican species. We found 5 main phylogenetic groups within Lepus, 4 of which corresponded to geographically well defined lineages. One group included L. americanus, 3 others corresponded to Mexican, African and European species, respectively. A fifth group included Asiatic, European and American forms. Our results suggest that Mexican species constitute a monophyletic entity that evolved independently of the other American species of Lepus. Within the Mexican forms, 2 main clades are apparent; 1 that includes L. alleni, L. callotis, and L. flavigularis, previously referred to as the white-sided jackrabbits, and a second one that groups together L. californicus and L. insularis, although L. californicus is a paraphyletic relative of L. insularis.Aunque la afinidad filogenética de las liebres mexicanas, dentro del género Lepus, ha sido evaluada para algunas especies, ningún estudio ha incluido las 5 especies que se presentan en México. En este trabajo estimamos la posición filogenética de las especies mexicanas de liebres en relación con otras formas dentro del género, y evaluamos las afinidades evolutivas entre ellas. Para ello analizamos 57 secuencias completas del citocromo b pertenecientes a las 5 especies mexicanas y 18

  18. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  19. Phylogenetic classification of bony fishes.

    Science.gov (United States)

    Betancur-R, Ricardo; Wiley, Edward O; Arratia, Gloria; Acero, Arturo; Bailly, Nicolas; Miya, Masaki; Lecointre, Guillaume; Ortí, Guillermo

    2017-07-06

    Fish classifications, as those of most other taxonomic groups, are being transformed drastically as new molecular phylogenies provide support for natural groups that were unanticipated by previous studies. A brief review of the main criteria used by ichthyologists to define their classifications during the last 50 years, however, reveals slow progress towards using an explicit phylogenetic framework. Instead, the trend has been to rely, in varying degrees, on deep-rooted anatomical concepts and authority, often mixing taxa with explicit phylogenetic support with arbitrary groupings. Two leading sources in ichthyology frequently used for fish classifications (JS Nelson's volumes of Fishes of the World and W. Eschmeyer's Catalog of Fishes) fail to adopt a global phylogenetic framework despite much recent progress made towards the resolution of the fish Tree of Life. The first explicit phylogenetic classification of bony fishes was published in 2013, based on a comprehensive molecular phylogeny ( www.deepfin.org ). We here update the first version of that classification by incorporating the most recent phylogenetic results. The updated classification presented here is based on phylogenies inferred using molecular and genomic data for nearly 2000 fishes. A total of 72 orders (and 79 suborders) are recognized in this version, compared with 66 orders in version 1. The phylogeny resolves placement of 410 families, or ~80% of the total of 514 families of bony fishes currently recognized. The ordinal status of 30 percomorph families included in this study, however, remains uncertain (incertae sedis in the series Carangaria, Ovalentaria, or Eupercaria). Comments to support taxonomic decisions and comparisons with conflicting taxonomic groups proposed by others are presented. We also highlight cases were morphological support exist for the groups being classified. This version of the phylogenetic classification of bony fishes is substantially improved, providing resolution

  20. Unparalleled rates of species diversification in Europe

    Science.gov (United States)

    Valente, Luis M.; Savolainen, Vincent; Vargas, Pablo

    2010-01-01

    The most rapid species radiations have been reported from ‘evolutionary laboratories’, such as the Andes and the Cape of South Africa, leading to the prevailing view that diversification elsewhere has not been as dramatic. However, few studies have explicitly assessed rates of diversification in northern regions such as Europe. Here, we show that carnations (Dianthus, Caryophyllaceae), a well-known group of plants from temperate Eurasia, have diversified at the most rapid rate ever reported in plants or terrestrial vertebrates. Using phylogenetic methods, we found that the majority of species of carnations belong to a lineage that is remarkably species-rich in Europe, and arose at the rate of 2.2–7.6 species per million years. Unlike most previous studies that have inferred rates of diversification in young diverse groups, we use a conservative approach throughout that explicitly incorporates the uncertainties associated with phylogenetic inference, molecular dating and incomplete taxon sampling. We detected a shift in diversification rates of carnations coinciding with a period of increase in climatic aridity in the Pleistocene, suggesting a link between climate and biodiversity. This explosive radiation suggests that Europe, the continent with the world's best-studied flora, has been underestimated as a cradle of recent and rapid speciation. PMID:20106850

  1. Molecular phylogenetic analysis of Chinese indigenous blue-shelled chickens inferred from whole genomic region of the SLCO1B3 gene.

    Science.gov (United States)

    Dalirsefat, Seyed Benyamin; Dong, Xianggui; Deng, Xuemei

    2015-08-01

    In total, 246 individuals from 8 Chinese indigenous blue- and brown-shelled chicken populations (Yimeng Blue, Wulong Blue, Lindian Blue, Dongxiang Blue, Lushi Blue, Jingmen Blue, Dongxiang Brown, and Lushi Brown) were genotyped for 21 SNP markers from the SLCO1B3 gene to evaluate phylogenetic relationships. As a representative of nonblue-shelled breeds, White Leghorn was included in the study for reference. A high proportion of SNP polymorphism was observed in Chinese chicken populations, ranging from 89% in Jingmen Blue to 100% in most populations, with a mean of 95% across all populations. The White Leghorn breed showed the lowest polymorphism, accounting for 43% of total SNPs. The mean expected heterozygosity varied from 0.11 in Dongxiang Blue to 0.46 in Yimeng Blue. Analysis of molecular variation (AMOVA) for 2 groups of Chinese chickens based on eggshell color type revealed 52% within-group and 43% between-group variations of the total genetic variation. As expected, FST and Reynolds' genetic distance were greatest between White Leghorn and Chinese chicken populations, with average values of 0.40 and 0.55, respectively. The first and second principal coordinates explained approximately 92% of the total variation and supported the clustering of the populations according to their eggshell color type and historical origins. STRUCTURE analysis showed a considerable source of variation among populations for the clustering into blue-shelled and nonblue-shelled chicken populations. The low estimation of genetic differentiation (FST) between Chinese chicken populations is possibly due to a common historical origin and high gene flow. Remarkably similar population classifications were obtained with all methods used in the study. Aligning endogenous avian retroviral (EAV)-HP insertion sequences showed no difference among the blue-shelled chickens. © 2015 Poultry Science Association Inc.

  2. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  3. Glycoprotein-G-gene-based molecular and phylogenetic analysis of rabies viruses associated with a large outbreak of bovine rabies in southern Brazil.

    Science.gov (United States)

    Cargnelutti, Juliana F; de Quadros, João M; Martins, Mathias; Batista, Helena B C R; Weiblen, Rudi; Flores, Eduardo F

    2017-12-01

    A large outbreak of hematophagous-bat-associated bovine rabies has been occurring in Rio Grande do Sul (RS), the southernmost Brazilian state, since 2011, with official estimates exceeding 50,000 cattle deaths. The present article describes a genetic characterization of rabies virus (RABV) recovered from 59 affected cattle and two sheep, from 56 herds in 16 municipalities (2012-2016). Molecular analysis was performed using the nucleotide (nt) and predicted amino acid (aa) sequences of RABV glycoprotein G (G). A high level of nt and aa sequence identity was observed among the examined G sequences, ranging from 98.4 to 100%, and from 97.3 to 100%, respectively. Likewise, high levels of nt and aa sequence identity were observed with bovine (nt, 99.8%; aa, 99.8%) and hematophagous bat (nt, 99.5%; aa, 99.4%) RABV sequences from GenBank, and lower levels were observed with carnivore RABV sequences (nt, 92.8%; aa, 88.1%). Some random mutations were observed in the analyzed sequences, and a few consistent mutations were observed in some sequences belonging to cluster 2, subcluster 2b. The clustering of the sequences was observed in a phylogenetic tree, where two distinct clusters were evident. Cluster 1 comprised RABV sequences covering the entire study period (2012 to 2016), but subclusters corresponding to different years could be identified, indicating virus evolution and/or introduction of new viruses into the population. In some cases, viruses from the same location obtained within a short period grouped into different subclusters, suggesting co-circulation of viruses of different origins. Subcluster segregation was also observed in sequences obtained in the same region during different periods, indicating the involvement of different viruses in the cases at different times. In summary, our results indicate that the outbreaks occurring in RS (2012 to 2016) probably involved RABV of different origins, in addition to a possible evolution of RABV isolates within this

  4. Molecular diversity of bacterial endosymbionts associated with dagger nematodes of the genus Xiphinema (Nematoda: Longidoridae) reveals a high degree of phylogenetic congruence with their host.

    Science.gov (United States)

    Palomares-Rius, Juan E; Archidona-Yuste, Antonio; Cantalapiedra-Navarrete, Carolina; Prieto, Pilar; Castillo, Pablo

    2016-12-01

    Bacterial endosymbionts have been detected in some groups of plant-parasitic nematodes, but few cases have been reported compared to other groups in the phylum Nematoda, such as animal-parasitic or free-living nematodes. This study was performed on a wide variety of plant-parasitic nematode families and species from different host plants and nematode populations. A total of 124 nematode populations (previously identified morphologically and molecularly) were screened for the presence of potential bacterial endosymbionts using the partial 16S rRNA gene and fluorescence in situ hybridization (FISH) and confocal microscopy. Potential bacterial endosymbionts were only detected in nematode species belonging to the genus Xiphinema and specifically in the X. americanum group. Fifty-seven partial 16S rRNA sequences were obtained from bacterial endosymbionts in this study. One group of sequences was closely related to the genus 'Candidatus Xiphinematobacter' (19 bacterial endosymbiont sequences were associated with seven nematode host species, including two that have already been described and three unknown bacterial endosymbionts). The second bacterial endosymbiont group (38 bacterial endosymbiont sequences associated with six nematode species) was related to the family Burkholderiaceae, which includes fungal and soil-plant bacterial endosymbionts. These endosymbionts were reported for the first time in the phylum Nematoda. Our findings suggest that there is a highly specific symbiotic relationship between nematode host and bacterial endosymbionts. Overall, these results were corroborated by a phylogeny of nematode host and bacterial endosymbionts that suggested that there was a high degree of phylogenetic congruence and long-term evolutionary persistence between hosts and endosymbionts. © 2016 John Wiley & Sons Ltd.

  5. Quality assurance practices in Europe: a survey of molecular genetic testing laboratories

    Science.gov (United States)

    Berwouts, Sarah; Fanning, Katrina; Morris, Michael A; Barton, David E; Dequeker, Elisabeth

    2012-01-01

    In the 2000s, a number of initiatives were taken internationally to improve quality in genetic testing services. To contribute to and update the limited literature available related to this topic, we surveyed 910 human molecular genetic testing laboratories, of which 291 (32%) from 29 European countries responded. The majority of laboratories were in the public sector (81%), affiliated with a university hospital (60%). Only a minority of laboratories was accredited (23%), and 26% was certified. A total of 22% of laboratories did not participate in external quality assessment (EQA) and 28% did not use reference materials (RMs). The main motivations given for accreditation were to improve laboratory profile (85%) and national recognition (84%). Nearly all respondents (95%) would prefer working in an accredited laboratory. In accredited laboratories, participation in EQA (Pquality assurance (Pquality implementation score (QIS), we showed that accredited laboratories (average score 92) comply better than certified laboratories (average score 69, Pquality indicators. We conclude that quality practices vary widely in European genetic testing laboratories. This leads to a potentially dangerous situation in which the quality of genetic testing is not consistently assured. PMID:22739339

  6. Interordinal gene capture, the phylogenetic position of Steller's sea cow based on molecular and morphological data, and the macroevolutionary history of Sirenia.

    Science.gov (United States)

    Springer, Mark S; Signore, Anthony V; Paijmans, Johanna L A; Vélez-Juarbe, Jorge; Domning, Daryl P; Bauer, Cameron E; He, Kai; Crerar, Lorelei; Campos, Paula F; Murphy, William J; Meredith, Robert W; Gatesy, John; Willerslev, Eske; MacPhee, Ross D E; Hofreiter, Michael; Campbell, Kevin L

    2015-10-01

    The recently extinct (ca. 1768) Steller's sea cow (Hydrodamalis gigas) was a large, edentulous North Pacific sirenian. The phylogenetic affinities of this taxon to other members of this clade, living and extinct, are uncertain based on previous morphological and molecular studies. We employed hybridization capture methods and second generation sequencing technology to obtain >30kb of exon sequences from 26 nuclear genes for both H. gigas and Dugong dugon. We also obtained complete coding sequences for the tooth-related enamelin (ENAM) gene. Hybridization probes designed using dugong and manatee sequences were both highly effective in retrieving sequences from H. gigas (mean=98.8% coverage), as were more divergent probes for regions of ENAM (99.0% coverage) that were designed exclusively from a proboscidean (African elephant) and a hyracoid (Cape hyrax). New sequences were combined with available sequences for representatives of all other afrotherian orders. We also expanded a previously published morphological matrix for living and fossil Sirenia by adding both new taxa and nine new postcranial characters. Maximum likelihood and parsimony analyses of the molecular data provide robust support for an association of H. gigas and D. dugon to the exclusion of living trichechids (manatees). Parsimony analyses of the morphological data also support the inclusion of H. gigas in Dugongidae with D. dugon and fossil dugongids. Timetree analyses based on calibration density approaches with hard- and soft-bounded constraints suggest that H. gigas and D. dugon diverged in the Oligocene and that crown sirenians last shared a common ancestor in the Eocene. The coding sequence for the ENAM gene in H. gigas does not contain frameshift mutations or stop codons, but there is a transversion mutation (AG to CG) in the acceptor splice site of intron 2. This disruption in the edentulous Steller's sea cow is consistent with previous studies that have documented inactivating mutations in

  7. Time spans and spacers: Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    OpenAIRE

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be paraphyletic with respect to Cladophora species and includes several genera shich werde traditionally ascribed to the Siphonocladales (Chapter 3). ... Zie: Summary/Samenvatting

  8. Phylogenetics of neotropical Platymiscium (Leguminosae

    DEFF Research Database (Denmark)

    Saslis-Lagoudakis, C. Haris; Chase, Mark W; Robinson, Daniel N

    2008-01-01

    Platymiscium is a neotropical legume genus of forest trees in the Pterocarpus clade of the pantropical "dalbergioid" clade. It comprises 19 species (29 taxa), distributed from Mexico to southern Brazil. This study presents a molecular phylogenetic analysis of Platymiscium and allies inferred from...

  9. Virulence, serotype and phylogenetic groups of diarrhoeagenic ...

    African Journals Online (AJOL)

    Dr DADIE Thomas

    2014-02-17

    Feb 17, 2014 ... The virulence, serotype and phylogenetic traits of diarrhoeagenic Escherichia coli were detected in 502 strains isolated during digestive infections. Molecular detection of the target virulence genes, rfb gene of operon O and phylogenetic grouping genes Chua, yjaA and TSPE4.C2 was performed.

  10. Phylogenetic and recombination analysis of tomato spotted wilt virus.

    Directory of Open Access Journals (Sweden)

    Sen Lian

    Full Text Available Tomato spotted wilt virus (TSWV severely damages and reduces the yield of many economically important plants worldwide. In this study, we determined the whole-genome sequences of 10 TSWV isolates recently identified from various regions and hosts in Korea. Phylogenetic analysis of these 10 isolates as well as the three previously sequenced isolates indicated that the 13 Korean TSWV isolates could be divided into two groups reflecting either two different origins or divergences of Korean TSWV isolates. In addition, the complete nucleotide sequences for the 13 Korean TSWV isolates along with previously sequenced TSWV RNA segments from Korea and other countries were subjected to phylogenetic and recombination analysis. The phylogenetic analysis indicated that both the RNA L and RNA M segments of most Korean isolates might have originated in Western Europe and North America but that the RNA S segments for all Korean isolates might have originated in China and Japan. Recombination analysis identified a total of 12 recombination events among all isolates and segments and five recombination events among the 13 Korea isolates; among the five recombinants from Korea, three contained the whole RNA L segment, suggesting reassortment rather than recombination. Our analyses provide evidence that both recombination and reassortment have contributed to the molecular diversity of TSWV.

  11. Molecular Evolution and Phylogenetic Analysis of Eight COL Superfamily Genes in Group I Related to Photoperiodic Regulation of Flowering Time in Wild and Domesticated Cotton (Gossypium) Species

    Science.gov (United States)

    Zhang, Rui; Ding, Jian; Liu, Chunxiao; Cai, Caiping; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

    2015-01-01

    Flowering time is an important ecological trait that determines the transition from vegetative to reproductive growth. Flowering time in cotton is controlled by short-day photoperiods, with strict photoperiod sensitivity. As the CO-FT (CONSTANS-FLOWER LOCUS T) module regulates photoperiodic flowering in several plants, we selected eight CONSTANS genes (COL) in group I to detect their expression patterns in long-day and short-day conditions. Further, we individually cloned and sequenced their homologs from 25 different cotton accessions and one outgroup. Finally, we studied their structures, phylogenetic relationship, and molecular evolution in both coding region and three characteristic domains. All the eight COLs in group I show diurnal expression. In the orthologous and homeologous loci, each gene structure in different cotton species is highly conserved, while length variation has occurred due to insertions/deletions in intron and/or exon regions. Six genes, COL2 to COL5, COL7 and COL8, exhibit higher nucleotide diversity in the D-subgenome than in the A-subgenome. The Ks values of 98.37% in all allotetraploid cotton species examined were higher in the A-D and At-Dt comparison than in the A-At and D-Dt comparisons, and the Pearson’s correlation coefficient (r) of Ks between A vs. D and At vs. Dt also showed positive, high correlations, with a correlation coefficient of at least 0.797. The nucleotide polymorphism in wild species is significantly higher compared to G. hirsutum and G. barbadense, indicating a genetic bottleneck associated with the domesticated cotton species. Three characteristic domains in eight COLs exhibit different evolutionary rates, with the CCT domain highly conserved, while the B-box and Var domain much more variable in allotetraploid species. Taken together, COL1, COL2 and COL8 endured greater selective pressures during the domestication process. The study improves our understanding of the domestication-related genes/traits during cotton

  12. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  13. Molecular phylogenetics, diversification, and systematics of Tibicen Latreille 1825 and allied cicadas of the tribe Cryptotympanini, with three new genera and emphasis on species from the USA and Canada(Hemiptera: Auchenorrhyncha: Cicadidae).

    Science.gov (United States)

    Hill, Kathy B R; Marshall, David C; Moulds, Maxwell S; Simon, Chris

    2015-07-10

    North America has a diverse cicada fauna with multiple genera from all three Cicadidae subfamilies, yet molecular phylogenetic analyses have been completed only for the well-studied periodical cicadas (Magicicada Davis). The genus Tibicen Latreille, a large group of charismatic species, is in need of such work because morphological patterns suggest multiple groups with complicated relationships to other genera in the tribe Cryptotympanini. In this paper we present a molecular phylogenetic analysis, based on mitochondrial and nuclear DNA, of 35 of the 38 extant USA species and subspecies of the genus Tibicen together with their North American tribal allies (Cornuplura Davis, Cacama Davis), selected Tibicen species from Eurasia, and representatives of other Eurasian and Pacific cryptotympanine genera. This tree shows that Tibicen contains several well-supported clades, one predominating in eastern and central North America and related to Cryptotympana Stål and Raiateana Boulard, another in western North America related to Cacama and Cornuplura, and at least two clades in Eurasia. We also present a morphological cladistic analysis of Tibicen and its close allies based on 27 characters. Character states identified in the cladistic analysis define three new genera, two for North American taxa (Hadoa gen. n. and Neotibicen gen. n.) including several Mexican species, and one for Asian species (Subsolanus gen. n.). Using relaxed molecular clocks and literature-derived mtDNA rate estimates, we estimate the timeframe of diversification of Tibicen clades and find that intergeneric divergence has occurred since the late Eocene, with most extant species within the former Tibicen originating after the mid-Miocene. We review patterns of ecology, behavior, and geography among Tibicen clades in light of the phylogenetic results and note that the study of these insects is still in its early stages. Some Mexican species formerly placed in Tibicen are here transferred to Diceroprocta

  14. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  15. Molecular and phylogenetic analyses of Salmonella Gallinarum trace the origin and diversification of recent outbreaks of fowl typhoid in poultry farms.

    Science.gov (United States)

    De Carli, Silvia; Gräf, Tiago; Kipper, Diéssy; Lehmann, Fernanda Kieling Moreira; Zanetti, Nathalie; Siqueira, Franciele Maboni; Cibulski, Samuel; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

    2017-12-01

    Fowl typhoid (FT) and pullorum disease (PD) are two important poultry infections caused by Salmonella enterica subsp. enterica serotype Gallinarum (S. Gallinarum). S. Gallinarum strains are adapted to birds and classified into biovars Gallinarum (bvGA) and Pullorum (bvPU) as they are the causative agent of FT and PD, respectively. In Brazil, FT/PD outbreaks have been reported along the last 50 years, but there was a recent increase of FT field reports with the suspicion it could be due to virulence reversion of the attenuated live vaccine SG9R. In this study, we applied molecular biology assays and phylogenetic methods to detect and investigate S. Gallinarum isolates from commercial poultry flocks in order to understand the evolutionary history and origin of the recent FT outbreaks in Brazil. S. Gallinarum isolates were obtained from thirteen different poultry flocks with clinical signs of FT/PD from 2013 to 2015. These isolates were serotyped, tested with three specific PCR (for the detection of bvGA, bvPU and live vaccine strain SG9R) and submitted to sequencing of a variable genome region (ISR analysis). The complete genome of one bvGA strain (BR_RS12) was also compared to other S. Gallinarum complete genomes (including other two Brazilian ones: bvGA 287/91 and bvPU FCVA198). PCR detected all thirteen isolates as S. Gallinarum (eight bvGA and five bvPU), none positive for SG9R strain. ISR analysis revealed that all eight bvGA isolates showed exactly the same nucleotide sequences with 100% similarity to reference strains, while two patterns were observed for bvPU. Genome phylogeny demonstrated distinct clades for bvGA and bvPU, with the bvGA clade showing a clear subdivision including three genomes: SG9R vaccine, the respective SG9 parent strain and one SG9R revertant field isolate (MB4523). The evolutionary rate of the total S. Gallinarum genome was calculated at 6.15×10 -7 substitutions/site/year, with 2.8 observed substitutions per year per genome (1 SNP per

  16. The influence of molecular markers and methods on inferring the phylogenetic relationships between the representatives of the Arini (parrots, Psittaciformes), determined on the basis of their complete mitochondrial genomes.

    Science.gov (United States)

    Urantowka, Adam Dawid; Kroczak, Aleksandra; Mackiewicz, Paweł

    2017-07-14

    Conures are a morphologically diverse group of Neotropical parrots classified as members of the tribe Arini, which has recently been subjected to a taxonomic revision. The previously broadly defined Aratinga genus of this tribe has been split into the 'true' Aratinga and three additional genera, Eupsittula, Psittacara and Thectocercus. Popular markers used in the reconstruction of the parrots' phylogenies derive from mitochondrial DNA. However, current phylogenetic analyses seem to indicate conflicting relationships between Aratinga and other conures, and also among other Arini members. Therefore, it is not clear if the mtDNA phylogenies can reliably define the species tree. The inconsistencies may result from the variable evolution rate of the markers used or their weak phylogenetic signal. To resolve these controversies and to assess to what extent the phylogenetic relationships in the tribe Arini can be inferred from mitochondrial genomes, we compared representative Arini mitogenomes as well as examined the usefulness of the individual mitochondrial markers and the efficiency of various phylogenetic methods. Single molecular markers produced inconsistent tree topologies, while different methods offered various topologies even for the same marker. A significant disagreement in these tree topologies occurred for cytb, nd2 and nd6 genes, which are commonly used in parrot phylogenies. The strongest phylogenetic signal was found in the control region and RNA genes. However, these markers cannot be used alone in inferring Arini phylogenies because they do not provide fully resolved trees. The most reliable phylogeny of the parrots under study is obtained only on the concatenated set of all mitochondrial markers. The analyses established significantly resolved relationships within the former Aratinga representatives and the main genera of the tribe Arini. Such mtDNA phylogeny can be in agreement with the species tree, owing to its match with synapomorphic features in

  17. Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1.

    Science.gov (United States)

    Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi

    2016-12-01

    The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

  18. Molecular phylogenetics of Floridosentis ward, 1953 (Acanthocephala: Neoechinorhynchidae) parasites of mullets (Osteichthyes) from Mexico, using 28S rDNA sequences.

    Science.gov (United States)

    Rosas-Valdez, Rogelio; Morrone, Juan J; García-Varela, Martín

    2012-08-01

    Species of Floridosentis (Acanthocephala) are common parasites of mullets (Mugil spp., Mugilidae) found in tropical marine and brackish water in the Americas. Floridosentis includes 2 species distributed in Mexico, i.e., Floridosentis pacifica, restricted to the Pacific Ocean near Salina Cruz, Oaxaca, and Floridosentis mugilis, distributed along the coast of the Pacific Ocean and the Gulf of Mexico. We sampled 18 populations of F. mugilis and F. pacifica (12 from the Pacific and 6 from the Gulf of Mexico) and sequenced a fragment of the rDNA large subunit to evaluate phylogenetic relationships of populations of Floridosentis spp. from Mexico. Species identification of museum specimens of F. mugilis from the Pacific Ocean was confirmed by examination of morphology traits. Phylogenetic trees inferred with maximum parsimony, maximum likelihood, and Bayesian inference indicate that Floridosentis is monophyletic comprising of 2 major well-supported clades, the first clade corresponding to F. mugilis from the Gulf of Mexico, and the second to F. pacifica from the Pacific Ocean. Genetic divergence between species ranged from 7.68 to 8.60%. Intraspecific divergence ranged from 0.14 to 0.86% for F. mugilis and from 1.72 to 4.49% for F. pacifica. Data obtained from diagnostic characters indicate that specimens from the Pacific Ocean in Mexico have differences in some traits among locations. These results are consistent with the phylogenetic hypothesis, indicating that F. pacifica is distributed in the Pacific Ocean in Mexico with 3 major lineages.

  19. Molecular evidence on the evolutionary and biogeographical patterns of European cyprinids.

    Science.gov (United States)

    Zardoya, R; Doadrio, I

    1999-08-01

    The phylogenetic relationships of 106 European cyprinid taxa were determined based on the complete nucleotide sequence (1140 bp) of the mitochondrial cytochrome b gene. The molecular phylogeny was used (1) to revise the current systematics of European cyprinids, (2) to establish the phylogenetic utility of traditional morphological characters that are widely used in Cyprinidae systematics, and (3) to discuss alternative hypotheses on the biogeography of the family in Europe. The age of the major lineages within European cyprinids was tentatively estimated with a molecular clock and showed full agreement with the fossil record of the group. Moreover, the results provided unambiguous evidence for a close phylogenetic affinity of some Caucasian and Greek endemic cyprinid taxa (e.g., B. capito and B. brachycephalus and Leuciscus keadicus, Barbus graecus, and B. albanicus, respectively) to Iberian and North African, but not Central European, cyprinids. The existence of such unexpected phylogenetic relationships refutes the classical hypothesis on the biogeography of European cyprinids, which assumes a dispersal of the cyprinid fauna from central Europe to southern Europe and northern Africa during the Miocene (and, hence, predicts a close phylogenetic relationship of all Caucasian, Greek, Iberian, and North African cyprinids to central European taxa). Instead, the existence of a Mediterranean realm independent of the central European route seems plausible based on the molecular evidence. It is likely that the new biogeographical scenario proposed here might apply to other primary freshwater European animals with low dispersal abilities, including fish, amphibians, and invertebrates.

  20. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...

  1. First cases of European bat lyssavirus type 1 in Iberian serotine bats: Implications for the molecular epidemiology of bat rabies in Europe.

    Directory of Open Access Journals (Sweden)

    Patricia Mingo-Casas

    2018-04-01

    Full Text Available Previous studies have shown that EBLV-1 strains exclusively hosted by Eptesicus isabellinus bats in the Iberian Peninsula cluster in a specific monophyletic group that is related to the EBLV-1b lineage found in the rest of Europe. More recently, enhanced passive surveillance has allowed the detection of the first EBLV-1 strains associated to Eptesicus serotinus south of the Pyrenees. The aim of this study is the reconstruction of the EBLV-1 phylogeny and phylodynamics in the Iberian Peninsula in the context of the European continent. We have sequenced 23 EBLV-1 strains detected on nine E. serotinus and 14 E. isabellinus. Phylogenetic analyses were performed on the first 400-bp-5' fragment of the Nucleoprotein (N gene together with other 162 sequences from Europe. Besides, fragments of the variable region of the phosphoprotein (P gene and the glycoprotein-polymerase (G-L intergenic region were studied on Spanish samples. Phylogenies show that two of the new EBLV-1a strains from Iberian E. serotinus clustered together with French strains from the North of the Pyrenees, suggesting a recent expansion southwards of this subtype. The remaining seven Iberian strains from E. serotinus grouped, instead, within the cluster linked, so far, to E. isabellinus, indicating that spatial distribution prevails over species specificity in explaining rabies distribution and supporting interspecific transmission. The structure found within the Iberian Peninsula for EBLV-1b is in concordance with that described previously for E. isabellinus. Finally, we have found that the current EBLV-1 European strains could have emerged only 175 years ago according to our evolutionary dynamics analyses.

  2. First cases of European bat lyssavirus type 1 in Iberian serotine bats: Implications for the molecular epidemiology of bat rabies in Europe.

    Science.gov (United States)

    Mingo-Casas, Patricia; Sandonís, Virginia; Obón, Elena; Berciano, José M; Vázquez-Morón, Sonia; Juste, Javier; Echevarría, Juan E

    2018-04-01

    Previous studies have shown that EBLV-1 strains exclusively hosted by Eptesicus isabellinus bats in the Iberian Peninsula cluster in a specific monophyletic group that is related to the EBLV-1b lineage found in the rest of Europe. More recently, enhanced passive surveillance has allowed the detection of the first EBLV-1 strains associated to Eptesicus serotinus south of the Pyrenees. The aim of this study is the reconstruction of the EBLV-1 phylogeny and phylodynamics in the Iberian Peninsula in the context of the European continent. We have sequenced 23 EBLV-1 strains detected on nine E. serotinus and 14 E. isabellinus. Phylogenetic analyses were performed on the first 400-bp-5' fragment of the Nucleoprotein (N) gene together with other 162 sequences from Europe. Besides, fragments of the variable region of the phosphoprotein (P) gene and the glycoprotein-polymerase (G-L) intergenic region were studied on Spanish samples. Phylogenies show that two of the new EBLV-1a strains from Iberian E. serotinus clustered together with French strains from the North of the Pyrenees, suggesting a recent expansion southwards of this subtype. The remaining seven Iberian strains from E. serotinus grouped, instead, within the cluster linked, so far, to E. isabellinus, indicating that spatial distribution prevails over species specificity in explaining rabies distribution and supporting interspecific transmission. The structure found within the Iberian Peninsula for EBLV-1b is in concordance with that described previously for E. isabellinus. Finally, we have found that the current EBLV-1 European strains could have emerged only 175 years ago according to our evolutionary dynamics analyses.

  3. Antimicrobial resistance and molecular characterization of virulence genes, phylogenetic groups of Escherichia coli isolated from diarrheic and healthy camel-calves in Tunisia.

    Science.gov (United States)

    Bessalah, Salma; Fairbrother, John Morris; Salhi, Imed; Vanier, Ghyslaine; Khorchani, Touhami; Seddik, Mouldi Mabrouk; Hammadi, Mohamed

    2016-12-01

    This study was conducted to determine the prevalence of virulence genes, serogroups, antimicrobial resistance and phylogenetic groups of Escherichia coli strains isolated from diarrheic and healthy camel calves in Tunisia. From 120 fecal samples (62 healthy and 58 diarrheic camel calves aged less than 3 months), 70 E. coli isolates (53 from diarrheic herds and 17 from healthy herds) were examined by PCR for detection of the virulence genes associated with pathogenic E. coli in animals. A significantly greater frequency of the f17 gene was observed in individual camels and in herds with diarrhea, this gene being found in 44.7% and 41.5% of isolates from camels and herds with diarrhea versus 22.5% and 11.7% in camels (p=0.05) and herds without diarrhea (p=0.02). The aida, cnf1/2, f18, stx2 and paa genes were found only in isolates from camels with diarrhea, although at a low prevalence, 1.8%, 3.7%, 1.8%, 3.7% and 11.3%, respectively. Prevalence of afa8, cdtB, eae, east1, iroN, iss, kpsMTII, paa, sfa, tsh and papC genes did not differ significantly between herds with or without diarrhea. Genes coding for faeG, fanC, f41, estI, estII, CS31a and eltA were not detected in any isolates. All isolates were sensitive to amikacin, chloramphenicol, ciprofloxacin, gentamicin and ceftiofur and the highest frequency of resistance was observed to tetracycline, and ampicillin (52.8% and 37.1% respectively). The phylogenetic groups were identified by conventional triplex PCR. Results showed that E. coli strains segregated mainly in phylogenetic group B1, 52.8% in diarrheic herds and 52.9% in healthy herds. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. An outbreak of Leishmania major from an endemic to a non-endemic region posed a public health threat in Iraq from 2014-2017: Epidemiological, molecular and phylogenetic studies.

    Directory of Open Access Journals (Sweden)

    Mariwan M M Al-Bajalan

    2018-03-01

    Full Text Available Cutaneous leishmaniasis (CL is a neglected worldwide, zoonotic, vector-borne, tropical disease that is a threat to public health. This threat may spread from endemic to non-endemic areas. Current research has exploited epidemiological, molecular and phylogenetical studies to determine the danger of an outbreak of CL in the borderline area between northern and central Iraq from 2014-2017.For the first time, using sequence analysis of the cytochrome b gene, the occurrence of CL in the borderline area between northern and central Iraq was confirmed to be due to Leishmania major. The phylogenetic analysis indicated that it was closely related to the L. major MRHO/IR/75/ER strain in Iran.In conclusion, the genotype confirmation of the L. major strain will improve our understanding of the epidemiology of the disease. This is important for facilitating control programs to prevent the further spread of CL. Furthermore, this area could be considered as a model for further research on the risk of global CL epidemics in other non-endemic countries where both reservoir hosts and sandfly vectors are present.

  5. An outbreak of Leishmania major from an endemic to a non-endemic region posed a public health threat in Iraq from 2014-2017: Epidemiological, molecular and phylogenetic studies.

    Science.gov (United States)

    Al-Bajalan, Mariwan M M; Al-Jaf, Sirwan M A; Niranji, Sherko S; Abdulkareem, Dler R; Al-Kayali, Khudhair K; Kato, Hirotomo

    2018-03-01

    Cutaneous leishmaniasis (CL) is a neglected worldwide, zoonotic, vector-borne, tropical disease that is a threat to public health. This threat may spread from endemic to non-endemic areas. Current research has exploited epidemiological, molecular and phylogenetical studies to determine the danger of an outbreak of CL in the borderline area between northern and central Iraq from 2014-2017. For the first time, using sequence analysis of the cytochrome b gene, the occurrence of CL in the borderline area between northern and central Iraq was confirmed to be due to Leishmania major. The phylogenetic analysis indicated that it was closely related to the L. major MRHO/IR/75/ER strain in Iran. In conclusion, the genotype confirmation of the L. major strain will improve our understanding of the epidemiology of the disease. This is important for facilitating control programs to prevent the further spread of CL. Furthermore, this area could be considered as a model for further research on the risk of global CL epidemics in other non-endemic countries where both reservoir hosts and sandfly vectors are present.

  6. Avian influenza A (H9N2: computational molecular analysis and phylogenetic characterization of viral surface proteins isolated between 1997 and 2009 from the human population

    Directory of Open Access Journals (Sweden)

    Idrees Muhammad

    2010-11-01

    Full Text Available Abstract Background H9N2 avian influenza A viruses have become panzootic in Eurasia over the last decade and have caused several human infections in Asia since 1998. To study their evolution and zoonotic potential, we conducted an in silico analysis of H9N2 viruses that have infected humans between 1997 and 2009 and identified potential novel reassortments. Results A total of 22 hemagglutinin (HA and neuraminidase (NA nucleotide and deduced amino acid sequences were retrieved from the NCBI flu database. It was identified that mature peptide sequences of HA genes isolated from humans in 2009 had glutamine at position 226 (H3 of the receptor binding site, indicating a preference to bind to the human α (2-6 sialic acid receptors, which is different from previously isolated viruses and studies where the presence of leucine at the same position contributes to preference for human receptors and presence of glutamine towards avian receptors. Similarly, strains isolated in 2009 possessed new motif R-S-N-R in spite of typical R-S-S-R at the cleavage site of HA, which isn't reported before for H9N2 cases in humans. Other changes involved loss, addition, and variations in potential glycosylation sites as well as in predicted epitopes. The results of phylogenetic analysis indicated that HA and NA gene segments of H9N2 including those from current and proposed vaccine strains belong to two different Eurasian phylogenetic lineages confirming possible genetic reassortments. Conclusions These findings support the continuous evolution of avian H9N2 viruses towards human as host and are in favor of effective surveillance and better characterization studies to address this issue.

  7. The Complete Plastid Genome Sequence of Madagascar Periwinkle Catharanthus roseus (L.) G. Don: Plastid Genome Evolution, Molecular Marker Identification, and Phylogenetic Implications in Asterids

    Science.gov (United States)

    Ku, Chuan; Chung, Wan-Chia; Chen, Ling-Ling; Kuo, Chih-Horng

    2013-01-01

    The Madagascar periwinkle ( Catharanthus roseus in the family Apocynaceae) is an important medicinal plant and is the source of several widely marketed chemotherapeutic drugs. It is also commonly grown for its ornamental values and, due to ease of infection and distinctiveness of symptoms, is often used as the host for studies on phytoplasmas, an important group of uncultivated plant pathogens. To gain insights into the characteristics of apocynaceous plastid genomes (plastomes), we used a reference-assisted approach to assemble the complete plastome of C . roseus , which could be applied to other C . roseus -related studies. The C . roseus plastome is the second completely sequenced plastome in the asterid order Gentianales. We performed comparative analyses with two other representative sequences in the same order, including the complete plastome of Coffea arabica (from the basal Gentianales family Rubiaceae) and the nearly complete plastome of Asclepias syriaca (Apocynaceae). The results demonstrated considerable variations in gene content and plastome organization within Apocynaceae, including the presence/absence of three essential genes (i.e., accD, clpP, and ycf1) and large size changes in non-coding regions (e.g., rps2-rpoC2 and IRb-ndhF). To find plastome markers of potential utility for Catharanthus breeding and phylogenetic analyses, we identified 41 C . roseus -specific simple sequence repeats. Furthermore, five intergenic regions with high divergence between C . roseus and three other euasterids I taxa were identified as candidate markers. To resolve the euasterids I interordinal relationships, 82 plastome genes were used for phylogenetic inference. With the addition of representatives from Apocynaceae and sampling of most other asterid orders, a sister relationship between Gentianales and Solanales is supported. PMID:23825699

  8. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    Science.gov (United States)

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  9. Archigregarines of the English Channel revisited: New molecular data on Selenidium species including early described and new species and the uncertainties of phylogenetic relationships

    Czech Academy of Sciences Publication Activity Database

    Rueckert, S.; Horák, Aleš

    2017-01-01

    Roč. 12, č. 11 (2017), č. článku e0187430. E-ISSN 1932-6203 R&D Projects: GA ČR GA15-17643S EU Projects: European Commission(XE) 316304 - MODBIOLIN Institutional support: RVO:60077344 Keywords : gregarine parasites apicomplexa * sabellaria alveolata l * revised classification * sequence alignment * genome-sequence * ultrastructure * checklist * lecudina * sporozoa Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology Impact factor: 2.806, year: 2016

  10. Do freshwater fishes diversify faster than marine fishes? A test using state-dependent diversification analyses and molecular phylogenetics of new world silversides (atherinopsidae).

    Science.gov (United States)

    Bloom, Devin D; Weir, Jason T; Piller, Kyle R; Lovejoy, Nathan R

    2013-07-01

    Freshwater habitats make up only ∼0.01% of available aquatic habitat and yet harbor 40% of all fish species, whereas marine habitats comprise >99% of available aquatic habitat and have only 60% of fish species. One possible explanation for this pattern is that diversification rates are higher in freshwater habitats than in marine habitats. We investigated diversification in marine and freshwater lineages in the New World silverside fish clade Menidiinae (Teleostei, Atherinopsidae). Using a time-calibrated phylogeny and a state-dependent speciation-extinction framework, we determined the frequency and timing of habitat transitions in Menidiinae and tested for differences in diversification parameters between marine and freshwater lineages. We found that Menidiinae is an ancestrally marine lineage that independently colonized freshwater habitats four times followed by three reversals to the marine environment. Our state-dependent diversification analyses showed that freshwater lineages have higher speciation and extinction rates than marine lineages. Net diversification rates were higher (but not significant) in freshwater than marine environments. The marine lineage-through time (LTT) plot shows constant accumulation, suggesting that ecological limits to clade growth have not slowed diversification in marine lineages. Freshwater lineages exhibited an upturn near the recent in their LTT plot, which is consistent with our estimates of high background extinction rates. All sequence data are currently being archived on Genbank and phylogenetic trees archived on Treebase. © 2013 The Author(s). Evolution © 2013 The Society for the Study of Evolution.

  11. Biochemical and Molecular Phylogenetic Study of Agriculturally Useful Association of a Nitrogen-Fixing Cyanobacterium and Nodule Sinorhizobium with Medicago sativa L.

    Directory of Open Access Journals (Sweden)

    E. V. Karaushu

    2015-01-01

    Full Text Available Seed inoculation with bacterial consortium was found to increase legume yield, providing a higher growth than the standard nitrogen treatment methods. Alfalfa plants were inoculated by mono- and binary compositions of nitrogen-fixing microorganisms. Their physiological and biochemical properties were estimated. Inoculation by microbial consortium of Sinorhizobium meliloti T17 together with a new cyanobacterial isolate Nostoc PTV was more efficient than the single-rhizobium strain inoculation. This treatment provides an intensification of the processes of biological nitrogen fixation by rhizobia bacteria in the root nodules and an intensification of plant photosynthesis. Inoculation by bacterial consortium stimulates growth of plant mass and rhizogenesis and leads to increased productivity of alfalfa and to improving the amino acid composition of plant leaves. The full nucleotide sequence of the rRNA gene cluster and partial sequence of the dinitrogenase reductase (nifH gene of Nostoc PTV were deposited to GenBank (JQ259185.1, JQ259186.1. Comparison of these gene sequences of Nostoc PTV with all sequences present at the GenBank shows that this cyanobacterial strain does not have 100% identity with any organisms investigated previously. Phylogenetic analysis showed that this cyanobacterium clustered with high credibility values with Nostoc muscorum.

  12. Detection, molecular characterization and phylogenetic analysis of full-length equine infectious anemia (EIAV) gag genes isolated from Shackleford Banks wild horses.

    Science.gov (United States)

    Capomaccio, S; Willand, Z A; Cook, S J; Issel, C J; Santos, E M; Reis, J K P; Cook, R F

    2012-06-15

    The genetically distinct wild horse herds inhabiting Shackleford Banks, North Carolina are probably the direct descendents of Spanish stock abandoned after failed attempts to settle mid-Atlantic coastal regions of North America in the Sixteenth Century. In a 1996 island survey, 41% of the gathered horses were discovered seropositive for Equine Infectious Anemia Virus (EIAV) with additional cases identified in 1997 and 1998. As a result of their unique genetic heritage, EIAV seropositive individuals identified in the two latter surveys were transferred to a quarantine facility on the mainland. In September 2008 two of the horses SB1 and SB2 after 10 and 11 years in quarantine respectively, developed clinical signs of EIA. In the case of SB2 these were so severe that the only humane option was euthanasia. Although SB1, survived it experienced a second clinical episode one month later. In May 2009, a third horse in quarantine, SB3, developed extremely severe clinical EIA and was euthanized. This demonstrates naturally infected long-term inapparent carriers can experience recrudescence of very severe disease many years after initial exposure to EIAV. Phylogenetic analysis of complete EIAV gag gene sequences obtained from each of three Shackleford horses demonstrated they were infected with very closely related viruses. Although these were distinguishable from all other strains examined, they belong to a monophyletic group comprising almost exclusively of New World isolates that is distinct from a number of recently characterized Central European EIAV strains. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. High molecular diversity in the true service tree (Sorbus domestica) despite rareness: data from Europe with special reference to the Austrian occurrence.

    Science.gov (United States)

    George, Jan-Peter; Konrad, Heino; Collin, Eric; Thevenet, Jean; Ballian, Dalibor; Idzojtic, Marilena; Kamm, Urs; Zhelev, Peter; Geburek, Thomas

    2015-06-01

    Sorbus domestica (Rosaceae) is one of the rarest deciduous tree species in Europe and is characterized by a scattered distribution. To date, no large-scale geographic studies on population genetics have been carried out. Therefore, the aims of this study were to infer levels of molecular diversity across the major part of the European distribution of S. domestica and to determine its population differentiation and structure. In addition, spatial genetic structure was examined together with the patterns of historic and recent gene flow between two adjacent populations. Leaf or cambium samples were collected from 17 populations covering major parts of the European native range from north-west France to south-east Bulgaria. Seven nuclear microsatellites and one chloroplast minisatellite were examined and analysed using a variety of methods. Allelic richness was unexpectedly high for both markers within populations (mean per locus: 3·868 for nSSR and 1·647 for chloroplast minisatellite). Moreover, there was no evidence of inbreeding (mean Fis = -0·047). The Italian Peninsula was characterized as a geographic region with comparatively high genetic diversity for both genomes. Overall population differentiation was moderate (FST = 0·138) and it was clear that populations formed three groups in Europe, namely France, Mediterranean/Balkan and Austria. Historic gene flow between two local Austrian populations was high and asymmetric, while recent gene flow seemed to be disrupted. It is concluded that molecular mechanisms such as self-incompatibility and high gene flow distances are responsible for the observed level of allelic richness as well as for population differentiation. However, human influence could have contributed to the present genetic pattern, especially in the Mediterranean region. Comparison of historic and recent gene flow may mirror the progress of habitat fragmentation in eastern Austria. © The Author 2015. Published by Oxford University Press

  14. Molecular phylogenetic biodiversity assessment of arctic and boreal ectomycorrhizal Lactarius Pers. (Russulales; Basidiomycota) in Alaska, based on soil and sporocarp DNA

    Science.gov (United States)

    Jozsef Geml; Gary A. Laursen; Ina Timling; Jack M. McFarland; Michael G. Booth; Niall Lennon; Chad Nusbaum; D. Lee. Taylor

    2009-01-01

    Despite the critical roles fungi play in the functioning of ecosystems, especially as symbionts of plants and recyclers of organic matter, their biodiversity is poorly known in high-latitude regions. In this paper, we discuss the molecular diversity of one of the most diverse and abundant groups of ectomycorrhizal fungi: the genus Lactarius Pers....

  15. Phylogenetic relationships between pinworms (Nematoda: Enterobiinae) parasitising the critically endangered orang-utan, according to the characterisation of molecular genomic and mitochondrial markers

    Czech Academy of Sciences Publication Activity Database

    Foitová, I.; Civáňová, K.; Baruš, Vlastimil; Nurcahyo, W.

    2014-01-01

    Roč. 113, č. 7 (2014), s. 2455-2466 ISSN 0932-0113 Institutional support: RVO:68081766 Keywords : Molecular phylogeny * Cytochromoxidase 1 * 18S rDNA * ITS1 * Orang-utan pinworms * Pongo abelii Subject RIV: EG - Zoology Impact factor: 2.098, year: 2014

  16. What's next? Perspectives and future needs of cervical screening in Europe in the era of molecular testing and vaccination

    DEFF Research Database (Denmark)

    Lynge, Elsebeth; Antilla, Ahti; Arbyn, Marc

    2009-01-01

    controlled trials have found HPV-testing to increase the detection rate of cervical intraepithelial neoplasia grade 2+, CIN2+, compared with cytology. Two studies found a decreased detection rate of CIN3+ in the HPV-testing arm at the subsequent screening. Randomised controlled trials found that women......AIM: To outline the perspectives for future control of cervical cancer in Europe. METHODS: Review of current status for major cervical cancer control tools. The review was based on PubMed searches for cervical cancer prevention, Human Papillomavirus, HPV-test, HPV-vaccination, and treatment...... with large loop excision of the transformation zone, LLETZ. RESULTS: Recent studies suggest that condom use offers some but not complete protection against HPV-infection. High quality cytology screening with good population coverage reduces the incidence and mortality of cervical cancer. Randomised...

  17. A molecular phylogenetic study on South Korean Tettigonia species (Orthoptera: Tettigoniidae) using five genetic loci: The possibility of multiple allopatric speciation.

    Science.gov (United States)

    Kim, Tae-Kyu; Han, Taeman; Kim, Tae-Woo; Park, In Gyun; Kim, Seonghyun; Park, Haechul

    2016-03-15

    In Korea, members of the genus Tettigonia have been known as two species, T. ussuriana and T. dolichoptera dolichoptera. However, the taxonomic status of the Jeju Island population of T. ussuriana (JJ-TU) is in question, relative to the mainland population (ML-TU), because of their different body sizes and ratios of wing length. To clarify the relatedness of JJ-TU and ML-TU, we examined the genetic variation and phylogenetic relationships within and between T. ussuriana and related species collected in South Korea, using five genetic loci: three mitochondrial genes (cytochrome c oxidase subunit 1 [CO1], cytochrome c oxidase subunit 2 [CO2], NADH dehydrogenase 1 [ND1]) and two nuclear loci (second internal transcribed spacer [ITS2], and tubulin alpha-1 [TA1]). Unexpectedly, the JJ-TU population is explicitly sister to T. d. dolichoptera, with low genetic distance (0.76-1.22% in CO1), indicating no direct connection with the ML-TU population; this finding suggests a recent divergence involving rapid morphological change without gene flow between JJ-TU and mainland T. d. dolichoptera. The separation of these populations from their common ancestor was caused by geographical isolation during last glacial age. This finding indicates that the JJ-TU population should be elevated to the rank of subspecies, at the very least. Furthermore, the ML-TU population was also revealed to have four genetically divided groups (group A-D) from four localized populations, but no significant morphological differences exist among them. The genetic difference (range 3.19-4.10% in CO1) between group A + B and C + D was especially large, suggesting that cryptic speciation has widely occurred within the mainland areas, caused by allopatric isolations resulting from mountain barriers.

  18. Revision of torrent mites (Parasitengona, Torrenticolidae, Torrenticola of the United States and Canada: 90 descriptions, molecular phylogenetics, and a key to species

    Directory of Open Access Journals (Sweden)

    J. Ray Fisher

    2017-09-01

    Full Text Available The descriptive biology of torrent mites (Parasitengona: Torrenticolidae: Torrenticola of North America (north of Mexico is investigated using integrative methods. Material examined includes approximately 2,300 specimens from nearly 500 localities across the United States and Canada, and a few collections in Mexico and Central America. Species hypotheses are derived from a phylogenetic analysis of the barcoding region of cytochrome c oxidase subunit 1 (COI for 476 specimens and supported with morphology and biogeography. Relationships between species are examined with a combined analysis of COI and two expansion regions (D2–3 of the large ribosomal subunit (28S rDNA for 57 specimens. All previously described species from the US and Canada are examined. Our results indicate the need to synonymize four species: T. mercedensis (Marshall, 1943 is a junior synonym of T. sierrensis (Marshall, 1943; T. rectiforma Habeeb, 1974 is a junior synonym of T. ellipsoidalis (Marshall, 1943; T. neoconnexa Habeeb, 1957 is a junior synonym of T. magnexa Habeeb, 1955; and T. esbelta Cramer, 1992 is a junior synonym of T. boettgeri KO Viets, 1977. We describe 66 new species and re-describe all previously described regional species. Our findings indicate that total diversity of Torrenticola in the United States and Canada comprises 90 species, 57 known from the east and 33 from the west. We organize these species into four species complexes that include 13 identification groups. An additional 13 species do not fit within an identification group. The southern Appalachians are suspected to contain the highest concentration of remaining undescribed diversity. A key is provided to all known species in the US and Canada.

  19. Molecular phylogenetic and scanning electron microscopical analyses places the Choanephoraceae and the Gilbertellaceae in a monophyletic group within the Mucorales (Zygomycetes, Fungi).

    Science.gov (United States)

    Voigt, Kerstin; Olsson, L

    2008-09-01

    A multi-gene genealogy based on maximum parsimony and distance analyses of the exonic genes for actin (act) and translation elongation factor 1 alpha (tef), the nuclear genes for the small (18S) and large (28S) subunit ribosomal RNA (comprising 807, 1092, 1863, 389 characters, respectively) of all 50 genera of the Mucorales (Zygomycetes) suggests that the Choanephoraceae is a monophyletic group. The monotypic Gilbertellaceae appears in close phylogenetic relatedness to the Choanephoraceae. The monophyly of the Choanephoraceae has moderate to strong support (bootstrap proportions 67% and 96% in distance and maximum parsimony analyses, respectively), whereas the monophyly of the Choanephoraceae-Gilbertellaceae clade is supported by high bootstrap values (100% and 98%). This suggests that the two families can be joined into one family, which leads to the elimination of the Gilbertellaceae as a separate family. In order to test this hypothesis single-locus neighbor-joining analyses were performed on nuclear genes of the 18S, 5.8S, 28S and internal transcribed spacer (ITS) 1 ribosomal RNA and the translation elongation factor 1 alpha (tef) and beta tubulin (betatub) nucleotide sequences. The common monophyletic origin of the Choanephoraceae-Gilbertellaceae clade could be confirmed in all gene trees and by investigation of their ultrastructure. Sporangia with persistent, sutured walls splitting in half at maturity and ellipsoidal sporangiospores with striated ornamentations and polar ciliate appendages arising from spores in persistent sporangia and dehiscent sporangiola represent synapomorphic characters of this group. We discuss our data in the context of the historical development of their taxonomy and physiology and propose a reduction of the two families to one family, the Choanephoraceae sensu lato comprising species which are facultative plant pathogens and parasites, especially in subtropical to tropical regions.

  20. Phylogenetic species delimitation for crayfishes of the genus Pacifastacus.

    Science.gov (United States)

    Larson, Eric R; Castelin, Magalie; Williams, Bronwyn W; Olden, Julian D; Abbott, Cathryn L

    2016-01-01

    Molecular genetic approaches are playing an increasing role in conservation science by identifying biodiversity that may not be evident by morphology-based taxonomy and systematics. So-called cryptic species are particularly prevalent in freshwater environments, where isolation of dispersal-limited species, such as crayfishes, within dendritic river networks often gives rise to high intra- and inter-specific genetic divergence. We apply here a multi-gene molecular approach to investigate relationships among extant species of the crayfish genus Pacifastacus, representing the first comprehensive phylogenetic study of this taxonomic group. Importantly, Pacifastacus includes both the widely invasive signal crayfish Pacifastacus leniusculus, as well as several species of conservation concern like the Shasta crayfish Pacifastacus fortis. Our analysis used 83 individuals sampled across the four extant Pacifastacus species (omitting the extinct Pacifastacus nigrescens), representing the known taxonomic diversity and geographic distributions within this genus as comprehensively as possible. We reconstructed phylogenetic trees from mitochondrial (16S, COI) and nuclear genes (GAPDH), both separately and using a combined or concatenated dataset, and performed several species delimitation analyses (PTP, ABGD, GMYC) on the COI phylogeny to propose Primary Species Hypotheses (PSHs) within the genus. All phylogenies recovered the genus Pacifastacus as monophyletic, within which we identified a range of six to 21 PSHs; more abundant PSHs delimitations from GMYC and ABGD were always nested within PSHs delimited by the more conservative PTP method. Pacifastacus leniusculus included the majority of PSHs and was not monophyletic relative to the other Pacifastacus species considered. Several of these highly distinct P. leniusculus PSHs likely require urgent conservation attention. Our results identify research needs and conservation priorities for Pacifastacus crayfishes in western

  1. A survey on relation of morphological, molecular and phylogenetic structure of zoanthids of the islands located in the Hormoz Strait (Hormoz, Qeshm, Larak, Hengam)

    OpenAIRE

    Noori Koupaei, Atoosa

    2014-01-01

    The order Zoantharia (Zoanthids) is one of the most neglected orders of cnidarians in the Persian Gulf. The present study aims to investigate the biodiversity of this order with morphological and molecular examination in the Persian Gulf. For this purpose, 123 colonies of zoanthids with variety of shape and colors have been collected from intertidal and shallow water zone of four islands, i. e. Hengam, Qeshm, Larak and Hormoz. After sampling, morphological characteristics of each specimen wer...

  2. Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

    Science.gov (United States)

    Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

    1999-01-01

    The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

  3. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  4. Molecular phylogenetic reconstruction and localization of the (TTAGG)n telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863) suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera).

    Science.gov (United States)

    Pereira, Tássia Tatiane Pontes; Dos Reis, Ana Caroline Coelho Corrêa; Cardoso, Danon Clemes; Cristiano, Maykon Passos

    2018-01-01

    Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known) and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known). The main exception is Acromyrmex striatus (Roger, 1863), which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH) with telomeric probes with (TTAGG) 6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus . Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  5. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  6. Genomic repeat abundances contain phylogenetic signal

    Czech Academy of Sciences Publication Activity Database

    Dodsworth, S.; Chase, M.W.; Kelly, L.J.; Leitch, I.J.; Macas, Jiří; Novák, Petr; Piednoël, M.; Weiß-Schneeweiss, H.; Leitch, A.R.

    2015-01-01

    Roč. 64, č. 1 (2015), s. 112-126 ISSN 1063-5157 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Repetitive DNA * continuous characters * genomics * next-generation sequencing * phylogenetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.225, year: 2015

  7. Molecular cloning, phylogenetic analysis, and expression patterns of LATERAL SUPPRESSOR-LIKE and REGULATOR OF AXILLARY MERISTEM FORMATION-LIKE genes in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Fambrini, Marco; Salvini, Mariangela; Pugliesi, Claudio

    2017-03-01

    The wild sunflower (Helianthus annuus) plants develop a highly branched form with numerous small flowering heads. The origin of a no branched sunflower, producing a single large head, has been a key event in the domestication process of this species. The interaction between hormonal factors and several genes organizes the initiation and outgrowth of axillary meristems (AMs). From sunflower, we have isolated two genes putatively involved in this process, LATERAL SUPPRESSOR (LS)-LIKE (Ha-LSL) and REGULATOR OF AXILLARY MERISTEM FORMATION (ROX)-LIKE (Ha-ROXL), encoding for a GRAS and a bHLH transcription factor (TF), respectively. Typical amino acid residues and phylogenetic analyses suggest that Ha-LSL and Ha-ROXL are the orthologs of the branching regulator LS and ROX/LAX1, involved in the growth habit of both dicot and monocot species. qRT-PCR analyses revealed a high accumulation of Ha-LSL transcripts in roots, vegetative shoots, and inflorescence shoots. By contrast, in internodal stems and young leaves, a lower amount of Ha-LSL transcripts was observed. A comparison of transcription patterns between Ha-LSL and Ha-ROXL revealed some analogies but also remarkable differences; in fact, the gene Ha-ROXL displayed a low expression level in all organs analyzed. In situ hybridization (ISH) analysis showed that Ha-ROXL transcription was strongly restricted to a small domain within the boundary zone separating the shoot apical meristem (SAM) and the leaf primordia and in restricted regions of the inflorescence meristem, beforehand the separation of floral bracts from disc flower primordia. These results suggested that Ha-ROXL may be involved to establish a cell niche for the initiation of AMs as well as flower primordia. The accumulation of Ha-LSL transcripts was not restricted to the boundary zones in vegetative and inflorescence shoots, but the mRNA activity was expanded in other cellular domains of primary shoot apical meristem as well as AMs. In addition, Ha

  8. Phylogenetic relationships of African sunbird-like warblers: Moho ...

    African Journals Online (AJOL)

    Phylogenetic relationships of African sunbird-like warblers: Moho ( Hypergerus atriceps ), Green Hylia ( Hylia prasina ) and Tit-hylia ( Pholidornis rushiae ) ... different points in avian evolution reduces the phylogenetic signal in molecular sequence data, making difficult the reconstruction of relationships among taxa resulting ...

  9. Assessing bat droppings and predatory bird pellets for vector-borne bacteria: molecular evidence of bat-associated Neorickettsia sp. in Europe.

    Science.gov (United States)

    Hornok, Sándor; Szőke, Krisztina; Estók, Péter; Krawczyk, Aleksandra; Haarsma, Anne-Jifke; Kováts, Dávid; Boldogh, Sándor A; Morandini, Pál; Szekeres, Sándor; Takács, Nóra; Kontschán, Jenő; Meli, Marina L; Fernández de Mera, Isabel G; de la Fuente, José; Gyuranecz, Miklós; Sulyok, Kinga M; Weibel, Beatrice; Gönczi, Enikő; de Bruin, Arnout; Sprong, Hein; Hofmann-Lehmann, Regina

    2018-02-28

    In Europe, several species of bats, owls and kestrels exemplify highly urbanised, flying vertebrates, which may get close to humans or domestic animals. Bat droppings and bird pellets may have epidemiological, as well as diagnostic significance from the point of view of pathogens. In this work 221 bat faecal and 118 bird pellet samples were screened for a broad range of vector-borne bacteria using PCR-based methods. Rickettsia DNA was detected in 13 bat faecal DNA extracts, including the sequence of a rickettsial insect endosymbiont, a novel Rickettsia genotype and Rickettsia helvetica. Faecal samples of the pond bat (Myotis dasycneme) were positive for a Neorickettsia sp. and for haemoplasmas of the haemofelis group. In addition, two bird pellets (collected from a Long-eared Owl, Asio otus, and from a Common Kestrel, Falco tinnunculus) contained the DNA of a Rickettsia sp. and Anaplasma phagocytophilum, respectively. In both of these bird pellets the bones of Microtus arvalis were identified. All samples were negative for Borrelia burgdorferi s.l., Francisella tularensis, Coxiella burnetii and Chlamydiales. In conclusion, bats were shown to pass rickettsia and haemoplasma DNA in their faeces. Molecular evidence is provided for the presence of Neorickettsia sp. in bat faeces in Europe. In the evaluated regions bat faeces and owl/kestrel pellets do not appear to pose epidemiological risk from the point of view of F. tularensis, C. burnetii and Chlamydiales. Testing of bird pellets may provide an alternative approach to trapping for assessing the local occurrence of vector-borne bacteria in small mammals.

  10. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  11. Postcolonial Europe

    DEFF Research Database (Denmark)

    How has European identity been shaped through its colonial empires? Does this history of imperialism influence the conceptualisation of Europe in the contemporary globalised world? How has coloniality shaped geopolitical differences within Europe? What does this mean for the future of Europe......? Postcolonial Europe: Comparative Reflections after the Empires brings together scholars from across disciplines to rethink European colonialism in the light of its vanishing empires and the rise of new global power structures. Taking an interdisciplinary approach to the postcolonial European legacy the book...... argues that the commonly used nation-centric approach does not effectively capture the overlap between different colonial and postcolonial experiences across Europe....

  12. The limitations of ontogenetic data in phylogenetic analyses

    NARCIS (Netherlands)

    Koenemann, Stefan; Schram, Frederick R.

    2002-01-01

    The analysis of consecutive ontogenetic stages, or events, introduces a new class of data to phylogenetic systematics that are distinctly different from traditional morphological characters and molecular sequence data. Ontogenetic event sequences are distinguished by varying degrees of both a

  13. BIMLR: a method for constructing rooted phylogenetic networks from rooted phylogenetic trees.

    Science.gov (United States)

    Wang, Juan; Guo, Maozu; Xing, Linlin; Che, Kai; Liu, Xiaoyan; Wang, Chunyu

    2013-09-15

    Rooted phylogenetic trees constructed from different datasets (e.g. from different genes) are often conflicting with one another, i.e. they cannot be integrated into a single phylogenetic tree. Phylogenetic networks have become an important tool in molecular evolution, and rooted phylogenetic networks are able to represent conflicting rooted phylogenetic trees. Hence, the development of appropriate methods to compute rooted phylogenetic networks from rooted phylogenetic trees has attracted considerable research interest of late. The CASS algorithm proposed by van Iersel et al. is able to construct much simpler networks than other available methods, but it is extremely slow, and the networks it constructs are dependent on the order of the input data. Here, we introduce an improved CASS algorithm, BIMLR. We show that BIMLR is faster than CASS and less dependent on the input data order. Moreover, BIMLR is able to construct much simpler networks than almost all other methods. BIMLR is available at http://nclab.hit.edu.cn/wangjuan/BIMLR/. © 2013 Elsevier B.V. All rights reserved.

  14. Molecular identification of Anaplasma marginale in two autochthonous South American wild species revealed an identical new genotype and its phylogenetic relationship with those of bovines.

    Science.gov (United States)

    Guillemi, Eliana C; de la Fourniere, Sofía; Orozco, Marcela; Peña Martinez, Jorge; Correa, Elena; Fernandez, Javier; Lopez Arias, Ludmila; Paoletta, Martina; Corona, Belkis; Pinarello, Valérie; Wilkowsky, Silvina E; Farber, Marisa D

    2016-05-26

    Anaplasma marginale is a well-known cattle pathogen of tropical and subtropical world regions. Even though, this obligate intracellular bacterium has been reported in other host species different than bovine, it has never been documented in Myrmecophaga tridactyla (giant anteater) or Hippocamelus antisense (taruca), which are two native endangered species. Samples from two sick wild animals: a Myrmecophaga tridactyla (blood) and a Hippocamelus antisense (blood and serum) were studied for the presence of A. marginale DNA through msp5 gene fragment amplification. Further characterization was done through MSP1a tandem repeats analysis and MLST scheme and the genetic relationship among previously characterized A. marginale sequences were studied by applying, eBURST algorithm and AMOVA analysis. Anaplasma marginale DNA was identified in the Myrmecophaga tridactyla and Hippocamelus antisense samples. Through molecular markers, we identified an identical genotype in both animals that was not previously reported in bovine host. The analysis through eBURST and AMOVA revealed no differentiation between the taruca/anteater isolate and the bovine group. In the present publication we report the identification of A. marginale DNA in a novel ruminant (Hippocamelus antisense) and non-ruminant (Myrmecophaga tridactyla) host species. Genotyping analysis of isolates demonstrated the close relatedness of the new isolate with the circulation population of A. marginale in livestock. Further analysis is needed to understand whether these two hosts contribute to the anaplasmosis epidemiology.

  15. A new species of Mud Snake (Serpentes, Homalopsidae, Gyiophis Murphy & Voris, 2014) from Myanmar with a first molecular phylogenetic assessment of the genus.

    Science.gov (United States)

    Quah, Evan S H; Grismer, L Lee; Wood, Perry L Jr; Thura, Myint Kyaw; Zin, Thaw; Kyaw, Htet; Lwin, Ngwe; Grismer, Marta S; Murdoch, Matthew L

    2017-03-06

    A newly discovered species of homalopsid snake from the genus Gyiophis Murphy & Voris is described from the lowlands of Mawlamyine District in Mon state, southeastern Myanmar. Gyiophis salweenensis sp. nov. is presumed to be closely related to G. maculosa Blanford and G. vorisi Murphy based on the similarities in pholidosis and patterning but can be separated from G. maculosa by the shape of its first three dorsal scale rows that are square, ventral scale pattern that lacks a central spot, and a faint stripe on dorsal scale rows 1-4. It can be further distinguished from G. vorisi by its lower number of ventral scales (129 vs. 142-152), lower number of subcaudals (30/29 vs. 41-58), narrow rostral scale, and having more rows of spots on the dorsum (four vs. three). A preliminary molecular analysis using 1050 base pairs of cytochrome b (cytb) recovered G. salweenensis sp. nov. as the sister species to the Chinese Mud Snake (Myrrophis chinensis). G. maculosa and G. vorisi were unavailable for the analysis. The discovery of G. salweenensis sp. nov. highlights the need for more surveys into the herpetological diversity of eastern Myanmar which remains very much underestimated.

  16. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  17. Molecular Typing and Phylogenetic Analysis of Some Species Belonging to Phlebotomus (Larroussius and Phlebotomus (Adlerius Subgenera (Diptera: Psychodidae from Two Locations in Iran

    Directory of Open Access Journals (Sweden)

    P Parvizi

    2010-12-01

    Full Text Available Background: Haematophagous females of some phlebotomine sandflies are the only natural vectors of Leishmania species, the causative agents of leishmaniasis in many parts of the tropics and subtropics, including Iran.  We report the presence of Phlebotomus (Larroussius major and Phlebotomus (Adlerius halepensis in Tonekabon (Ma­zanderan Province and Phlebotomus (Larroussius tobbi in Pakdasht (Tehran Province. It is the first report of these species, known as potential vectors of zoonotic visceral leishmaniasis in Iran, are identified in these areas.Methods: In 2006-2007 individual wild-caught sandflies were characterized by both morphological features and sequence analysis of their mitochondrial genes (Cytochrome b.  The analyses were based on a fragment of  494 bp at the 3´ end of the Cyt b gene (Cyt b 3´ fragment and a fragment of  382 bp CB3 at the 5´ end of the Cyt b gene (Cyt b 5´ fragment. We also analysed the Cyt b Long fragment, which is located on the last 717 bp of the Cyt b gene, followed by 20 bp of intergenic spacer and the transfer RNA ser(TCN gene.Results: Twenty-seven P. halepensis and four P. major from Dohezar, Tonekabon, Mazanderan province and 8 P. tobbi from Packdasht, Tehran Province were identified by morphological and molecular characters. Cyt b 5´ and Cyt b 3´ fragment sequences were obtained from 15 and 9 flies, respectively. Cyt b long fragment sequences were ob­tained from 8 out of 27 P. halepensis.Conclusion: Parsimony analyses (using heuristic searches of the DNA sequences of Cyt b always showed mono­phyletic clades of subgenera and each species did form a monophyletic group.

  18. Molecular typing and phylogenetic analysis of some species belonging to phlebotomus (larroussius) and phlebotomus (adlerius) subgenera (Diptera: psychodidae) from two locations in iran.

    Science.gov (United States)

    Parvizi, P; Naddaf, S R; Alaeenovin, E

    2010-01-01

    Haematophagous females of some phlebotomine sandflies are the only natural vectors of Leishmania species, the causative agents of leishmaniasis in many parts of the tropics and subtropics, including Iran. We report the presence of Phlebotomus (Larroussius) major and Phlebotomus (Adlerius) halepensis in Tonekabon (Mazanderan Province) and Phlebotomus (Larroussius) tobbi in Pakdasht (Tehran Province). It is the first report of these species, known as potential vectors of zoonotic visceral leishmaniasis in Iran, are identified in these areas. In 2006-2007 individual wild-caught sandflies were characterized by both morphological features and sequence analysis of their mitochondrial genes (Cytochrome b). The analyses were based on a fragment of 494 bp at the 3' end of the Cyt b gene (Cyt b 3' fragment) and a fragment of 382 bp CB3 at the 5' end of the Cyt b gene (Cyt b 5' fragment). We also analysed the Cyt b Long fragment, which is located on the last 717 bp of the Cyt b gene, followed by 20 bp of intergenic spacer and the transfer RNA ser(TCN) gene. Twenty-seven P. halepensis and four P. major from Dohezar, Tonekabon, Mazanderan province and 8 P. tobbi from Packdasht, Tehran Province were identified by morphological and molecular characters. Cyt b 5' and Cyt b 3' fragment sequences were obtained from 15 and 9 flies, respectively. Cyt b long fragment sequences were obtained from 8 out of 27 P. halepensis. Parsimony analyses (using heuristic searches) of the DNA sequences of Cyt b always showed monophyletic clades of subgenera and each species did form a monophyletic group.

  19. Molecular Typing and Phylogenetic Analysis of Some Species Belonging to Phlebotomus (Larroussius and Phlebotomus (Adlerius Subgenera (Diptera: Psychodidae from Two Locations in Iran

    Directory of Open Access Journals (Sweden)

    E AlaeeNovin

    2010-12-01

    Full Text Available "nAbstract"nBackground: Haematophagous females of some phlebotomine sandflies are the only natural vectors of Leishmania species, the causative agents of leishmaniasis in many parts of the tropics and subtropics, including Iran.  We report the presence of Phlebotomus (Larroussius major and Phlebotomus (Adlerius halepensis in Tonekabon (Ma­zanderan Province and Phlebotomus (Larroussius tobbi in Pakdasht (Tehran Province. It is the first report of these species, known as potential vectors of zoonotic visceral leishmaniasis in Iran, are identified in these areas."nMethods: In 2006-2007 individual wild-caught sandflies were characterized by both morphological features and sequence analysis of their mitochondrial genes (Cytochrome b.  The analyses were based on a fragment of  494 bp at the 3´ end of the Cyt b gene (Cyt b 3´ fragment and a fragment of  382 bp CB3 at the 5´ end of the Cyt b gene (Cyt b 5´ fragment. We also analysed the Cyt b Long fragment, which is located on the last 717 bp of the Cyt b gene, followed by 20 bp of intergenic spacer and the transfer RNA ser(TCN gene."nResults: Twenty-seven P. halepensis and four P. major from Dohezar, Tonekabon, Mazanderan province and 8 P. tobbi from Packdasht, Tehran Province were identified by morphological and molecular characters. Cyt b 5´ and Cyt b 3´ fragment sequences were obtained from 15 and 9 flies, respectively. Cyt b long fragment sequences were ob­tained from 8 out of 27 P. halepensis."nConclusion: Parsimony analyses (using heuristic searches of the DNA sequences of Cyt b always showed mono­phyletic clades of subgenera and each species did form a monophyletic group. "nKeywords: Mitochondrial Cytochrome b, Phlebotomus (Larroussius major, Phlebotomus (Larroussius tobbi, Phlebotomus (Adlerius halepensis, Iran

  20. Molecular epidemiology and phylogenetic analysis of human papillomavirus infection in women with cervical lesions and cancer from the coastal region of Ecuador.

    Science.gov (United States)

    Bedoya-Pilozo, Cesar H; Medina Magües, Lex G; Espinosa-García, Maylen; Sánchez, Martha; Parrales Valdiviezo, Johanna V; Molina, Denisse; Ibarra, María A; Quimis-Ponce, María; España, Karool; Párraga Macias, Karla E; Cajas Flores, Nancy V; Orlando, Solon A; Robalino Penaherrera, Jorge A; Chedraui, Peter; Escobar, Saul; Loja Chango, Rita D; Ramirez-Morán, Cecibel; Espinoza-Caicedo, Jasson; Sánchez-Giler, Sunny; Limia, Celia M; Alemán, Yoan; Soto, Yudira; Kouri, Vivian; Culasso, Andrés C A; Badano, Inés

    The aim of the present study was to gather information regarding the molecular epidemiology of Human papillomavirus (HPV) and related risk factors in a group of women with low- and high-grade cervical lesions and cancer from the coastal region of Ecuador. In addition, we studied the evolution of HPV variants from the most prevalent types and provided a temporal framework for their emergence, which may help to trace the source of dissemination within the region. We analyzed 166 samples, including 57 CIN1, 95 CIN2/3 and 14 cancer cases. HPV detection and typing was done by PCR-sequencing (MY09/MY11). HPV variants and estimation of the time to most recent common ancestor (tMRCA) was assessed through phylogeny and coalescence analysis. HPV DNA was found in 54.4% of CIN1, 74.7% of CIN2/3 and 78.6% of cancer samples. HPV16 (38.9%) and HPV58 (19.5%) were the most prevalent types. Risk factors for the development of cervical lesions/cancer were the following: three or more pregnancies (OR=4.3), HPV infection (OR=3.7 for high-risk types; OR=3.5 for HPV16), among others. With regard to HPV evolution, HPV16 isolates belonged to lineages A (69%) and D (31%) whereas HPV58 isolates belonged only to lineage A. The period of emergence of HPV16 was in association with human populations (tMRCA=91052 years for HPV16A and 27000 years for HPV16D), whereas HPV58A preceded Homo sapiens evolution (322257 years). This study provides novel data on HPV epidemiology and evolution in Ecuador, which will be fundamental in the vaccine era. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  1. A molecular phylogenetic and fruit evolutionary analysis of the major groups of the paleotropical woody bamboos (Gramineae: Bambusoideae) based on nuclear ITS, GBSSI gene and plastid trnL-F DNA sequences.

    Science.gov (United States)

    Yang, Han-Qi; Yang, Jun-Bo; Peng, Zhen-Hua; Gao, Jian; Yang, Yu-Ming; Peng, Sheng; Li, De-Zhu

    2008-09-01

    This study presented the first molecular phylogenetic analysis of the major clades of woody bamboos of the Old World tropics based on nuclear and chloroplast sequences (ITS, GBSSI and trnL-F). Sequence data from 53 species, representing 17 paleotropical woody bamboo genera, were analyzed using the maximum parsimony and Bayesian inference methods. All examined ingroup taxa were clustered into two clades, i.e., the Bambusinae+Dinochloa clade and the Melocanninae clade. The former clade included Bambusa, Bonia, Dendrocalamus, Dendrocalamopsis, Dinochloa, Gigantochloa, Molecalamus, Neomicrocalamus, Neosinocalamus, Oxytenanthera s. str. (sensu stricto), Racemobambos and Thyrsostachys. The Melocanninae clade consisted of Cephalostachyum, Leptocanna (better treated as part of Cephalostachyum), Melocanna, Pseudostachyum and Schizostachyum s. str. The subtribe Racemobambosinae and tribes Dendrocalameae and Oxytenanthereae were not supported and may be better placed in subtribe Bambusinae. The ovary characters seemed to be good criteria to distinguish these two clades. The reconstruction of ancestral fruit characters indicated that the bacoid caryopsis, namely, fleshy or berry-like fruits, was found to be scattered in three lineages of the examined paleotropical woody bamboos. Fruit characters are thus not reliable indicators of phylogeny and bacoid caryopsis likely represents a specialization for particular ecological conditions.

  2. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Molecular and phylogenetic analyses of the liver amphistome Explanatum explanatum (Creplin, 1847) Fukui, 1929 in ruminants from Bangladesh and Nepal based on nuclear ribosomal ITS2 and mitochondrial nad1 sequences.

    Science.gov (United States)

    Mohanta, U K; Rana, H B; Devkota, B; Itagaki, T

    2017-07-01

    Explanatum explanatum flukes, liver amphistomes of ruminants, cause significant economic loss in the livestock industry by inducing severe liver damage. A total of 66 flukes from 26 buffaloes and 7 cattle in four different geographic areas of Bangladesh and 20 flukes from 10 buffaloes in the Chitwan district of Nepal were subjected for analysis. The sequences (442 bp) of the second internal transcribed spacer (ITS2) of ribosomal DNA and the variable fragments (657 bp) of mitochondrial nicotinamide dehydrogenase subunit 1 (nad1) of E. explanatum flukes from Bangladesh and Nepal were analysed. The aim of this study was molecular characterization of the flukes and to elucidate their origin and biogeography. In the ITS2 region, two genotypes were detected among the flukes from Bangladesh, while flukes from Nepal were of only one genotype. Phylogenetic analyses inferred from the nad1 gene revealed that at least four divergent populations (groups I-IV) are distributed in Bangladesh, whereas two divergent populations were found to be distributed in Nepal. Fst values (pairwise fixation index) suggest that Bangladeshi and Nepalese populations of group I to IV are significantly different from each other; but within groups III and IV, the populations from Bangladesh and Nepal were genetically close. This divergence in the nad1 gene indicates that each lineage of E. explanatum from diverse geography was co-adapted during the multiple domestication events of ruminants. This study, for the first time, provides molecular characterization of E. explanatum in Bangladesh and Nepal, and may provide useful information for elucidating its origin and dispersal route in Asia.

  4. Phylogenetic Analysis of Petunia sensu Jussieu (Solanaceae) using Chloroplast DNA RFLP

    OpenAIRE

    ANDO, TOSHIO; KOKUBUN, HISASHI; WATANABE, HITOSHI; TANAKA, NORIO; YUKAWA, TOMOHISA; HASHIMOTO, GORO; MARCHESI, EDUARDO; SUÁREZ, ENRIQUE; BASUALDO, ISABEL L.

    2005-01-01

    • Background and Aims The phylogenetic relationships of Petunia sensu Jussieu (Petunia sensu Wijsman plus Calibrachoa) are unclear. This study aimed to resolve this uncertainty using molecular evidence.

  5. Phylogenetic Origins of Brain Organisers

    Directory of Open Access Journals (Sweden)

    Ellen Robertshaw

    2012-01-01

    Full Text Available The regionalisation of the nervous system begins early in embryogenesis, concomitant with the establishment of the anteroposterior (AP and dorsoventral (DV body axes. The molecular mechanisms that drive axis induction appear to be conserved throughout the animal kingdom and may be phylogenetically older than the emergence of bilateral symmetry. As a result of this process, groups of patterning genes that are equally well conserved are expressed at specific AP and DV coordinates of the embryo. In the emerging nervous system of vertebrate embryos, this initial pattern is refined by local signalling centres, secondary organisers, that regulate patterning, proliferation, and axonal pathfinding in adjacent neuroepithelium. The main secondary organisers for the AP neuraxis are the midbrain-hindbrain boundary, zona limitans intrathalamica, and anterior neural ridge and for the DV neuraxis the notochord, floor plate, and roof plate. A search for homologous secondary organisers in nonvertebrate lineages has led to controversy over their phylogenetic origins. Based on a recent study in hemichordates, it has been suggested that the AP secondary organisers evolved at the base of the deuterostome superphylum, earlier than previously thought. According to this view, the lack of signalling centres in some deuterostome lineages is likely to reflect a secondary loss due to adaptive processes. We propose that the relative evolutionary flexibility of secondary organisers has contributed to a broader morphological complexity of nervous systems in different clades.

  6. Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia.

    Science.gov (United States)

    Haklová, B; Majláthová, V; Majláth, I; Harris, D J; Petrilla, V; Litschka-Koen, T; Oros, M; Peťko, B

    2014-03-01

    The blood parasites from the genus Hepatozoon Miller, 1908 (Apicomplexa: Adeleida: Hepatozoidae) represent the most common intracellular protozoan parasites found in snakes. In the present study, we examined 209 individuals of snakes, from different zoogeographical regions (Africa, America, Asia and Europe), for the occurrence of blood parasites using both molecular and microscopic examination methods, and assess phylogenetic relationships of all Hepatozoon parasites from snakes for the first time. In total, 178 blood smears obtained from 209 individuals, representing 40 species, were examined, from which Hepatozoon unicellular parasites were found in 26 samples (14·6% prevalence). Out of 180 samples tested by molecular method polymerase chain reaction (PCR), the presence of parasites was observed in 21 individuals (prevalence 11·6%): 14 snakes from Africa belonging to six genera (Dendroaspis, Dispholidus, Mehelya, Naja, Philothamnus and Python), five snakes from Asia from the genus Morelia and two snakes from America, from two genera (Coluber and Corallus). The intensity of infection varied from one to 1433 infected cells per 10 000 erythrocytes. Results of phylogenetic analyses (Bayesian and Maximum Likelihood) revealed the existence of five haplotypes divided into four main lineages. The present data also indicate neither geographical pattern of studied Hepatozoon sp., nor congruency in the host association.

  7. A Universal Phylogenetic Tree.

    Science.gov (United States)

    Offner, Susan

    2001-01-01

    Presents a universal phylogenetic tree suitable for use in high school and college-level biology classrooms. Illustrates the antiquity of life and that all life is related, even if it dates back 3.5 billion years. Reflects important evolutionary relationships and provides an exciting way to learn about the history of life. (SAH)

  8. treespace: Statistical exploration of landscapes of phylogenetic trees.

    Science.gov (United States)

    Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline

    2017-11-01

    The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  9. On the origin of the treponematoses: a phylogenetic approach.

    Directory of Open Access Journals (Sweden)

    Kristin N Harper

    2008-01-01

    Full Text Available Since the first recorded epidemic of syphilis in 1495, controversy has surrounded the origins of the bacterium Treponema pallidum subsp. pallidum and its relationship to the pathogens responsible for the other treponemal diseases: yaws, endemic syphilis, and pinta. Some researchers have argued that the syphilis-causing bacterium, or its progenitor, was brought from the New World to Europe by Christopher Columbus and his men, while others maintain that the treponematoses, including syphilis, have a much longer history on the European continent.We applied phylogenetics to this problem, using data from 21 genetic regions examined in 26 geographically disparate strains of pathogenic Treponema. Of all the strains examined, the venereal syphilis-causing strains originated most recently and were more closely related to yaws-causing strains from South America than to other non-venereal strains. Old World yaws-causing strains occupied a basal position on the tree, indicating that they arose first in human history, and a simian strain of T. pallidum was found to be indistinguishable from them.Our results lend support to the Columbian theory of syphilis's origin while suggesting that the non-sexually transmitted subspecies arose earlier in the Old World. This study represents the first attempt to address the problem of the origin of syphilis using molecular genetics, as well as the first source of information regarding the genetic make-up of non-venereal strains from the Western hemisphere.

  10. The augmentation algorithm and molecular phylogenetic trees

    Science.gov (United States)

    Holmquist, R.

    1978-01-01

    Moore's (1977) augmentation procedure is discussed, and it is concluded that the procedure is valid for obtaining estimates of the total number of fixed nucleotide substitutions both theoretically and in practice, for both simulated and real data, and in agreement, for experimentally dense data sets, with stochastic estimates of the divergence, provided the restrictions on codon mutability resulting from natural selection are explicitly allowed for. Tateno and Nei's (1978) critique that the augmentation procedure has a systematic bias toward overestimation of the total number of nucleotide replacements is disputed, and a data analysis suggests that ancestral sequences inferred by the method of parsimony contain a large number of incorrectly assigned nucleotides.

  11. Molecular phylogenetics and the diversification of hummingbirds.

    Science.gov (United States)

    McGuire, Jimmy A; Witt, Christopher C; Remsen, J V; Corl, Ammon; Rabosky, Daniel L; Altshuler, Douglas L; Dudley, Robert

    2014-04-14

    The tempo of species diversification in large clades can reveal fundamental evolutionary mechanisms that operate on large temporal and spatial scales. Hummingbirds have radiated into a diverse assemblage of specialized nectarivores comprising 338 species, but their evolutionary history has not, until now, been comprehensively explored. We studied hummingbird diversification by estimating a time-calibrated phylogeny for 284 hummingbird species, demonstrating that hummingbirds invaded South America by ∼22 million years ago, and subsequently diversified into nine principal clades (see [5-7]). Using ancestral state reconstruction and diversification analyses, we (1) estimate the age of the crown-group hummingbird assemblage, (2) investigate the timing and patterns of lineage accumulation for hummingbirds overall and regionally, and (3) evaluate the role of Andean uplift in hummingbird speciation. Detailed analyses reveal disparate clade-specific processes that allowed for ongoing species diversification. One factor was significant variation among clades in diversification rates. For example, the nine principal clades of hummingbirds exhibit ∼15-fold variation in net diversification rates, with evidence for accelerated speciation of a clade that includes the Bee, Emerald, and Mountain Gem groups of hummingbirds. A second factor was colonization of key geographic regions, which opened up new ecological niches. For example, some clades diversified in the context of the uplift of the Andes Mountains, whereas others were affected by the formation of the Panamanian land bridge. Finally, although species accumulation is slowing in all groups of hummingbirds, several major clades maintain rapid rates of diversification on par with classical examples of rapid adaptive radiation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Eastern Europe

    International Nuclear Information System (INIS)

    Baret, J.P.; Corcuff, A.; Jousten, M.; Cherie, J.B.; Gorge, X.; Augustin, X.; Belime, F.

    1999-01-01

    By its economical and political impact, nuclear energy has an important contribution the countries of Eastern Europe that goes beyond simple energy source. The most important challenge is to gain a safety culture. Improvements have been noted but the reactors safety must stay a priority of the international cooperation in Eastern Europe. The plan for the completion and improvement of Mochovce nuclear plant is described, the situation of Chernobyl and how to make the sarcophagus in safe is discussed, the experience of a french P.M.E. ( small and medium size firm) called Corys Tess that has chosen to position itself on the Eastern Europe nuclear market is related. (N.C.)

  13. Mapping Phylogenetic Trees to Reveal Distinct Patterns of Evolution.

    Science.gov (United States)

    Kendall, Michelle; Colijn, Caroline

    2016-10-01

    Evolutionary relationships are frequently described by phylogenetic trees, but a central barrier in many fields is the difficulty of interpreting data containing conflicting phylogenetic signals. We present a metric-based method for comparing trees which extracts distinct alternative evolutionary relationships embedded in data. We demonstrate detection and resolution of phylogenetic uncertainty in a recent study of anole lizards, leading to alternate hypotheses about their evolutionary relationships. We use our approach to compare trees derived from different genes of Ebolavirus and find that the VP30 gene has a distinct phylogenetic signature composed of three alternatives that differ in the deep branching structure. phylogenetics, evolution, tree metrics, genetics, sequencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  15. Multilingual Europe

    DEFF Research Database (Denmark)

    Phillipson, Robert

    2013-01-01

    Review of: Multilingual Europe: Multilingual Europeans. (European Studies: An Interdisciplinary Series in European Culture, History and Politics, Vol. 29). Eds. Láslá Maràcz & Mireille Rosello. Rodopi, 2012. 323 pp.......Review of: Multilingual Europe: Multilingual Europeans. (European Studies: An Interdisciplinary Series in European Culture, History and Politics, Vol. 29). Eds. Láslá Maràcz & Mireille Rosello. Rodopi, 2012. 323 pp....

  16. A cluster of multidrug-resistant Mycobacterium tuberculosis among patients arriving in Europe from the Horn of Africa: a molecular epidemiological study.

    NARCIS (Netherlands)

    Walker, Timothy M; Merker, Matthias; Knoblauch, Astrid M; Helbling, Peter; Schoch, Otto D; van der Werf, Marieke J; Kranzer, Katharina; Fiebig, Lena; Kröger, Stefan; Haas, Walter; Hoffmann, Harald; Indra, Alexander; Egli, Adrian; Cirillo, Daniela M; Robert, Jérôme; Rogers, Thomas R; Groenheit, Ramona; Mengshoel, Anne T; Mathys, Vanessa; Haanperä, Marjo; Soolingen, Dick van; Niemann, Stefan; Böttger, Erik C; Keller, Peter M

    2018-01-01

    The risk of tuberculosis outbreaks among people fleeing hardship for refuge in Europe is heightened. We describe the cross-border European response to an outbreak of multidrug-resistant tuberculosis among patients from the Horn of Africa and Sudan.

  17. First molecular identification of the vertebrate hosts of Culicoides imicola in Europe and a review of its blood-feeding patterns worldwide: implications for the transmission of bluetongue disease and African horse sickness.

    Science.gov (United States)

    Martínez-DE LA Puente, J; Navarro, J; Ferraguti, M; Soriguer, R; Figuerola, J

    2017-12-01

    Culicoides (Diptera: Ceratopogonidae) are vectors of pathogens that affect wildlife, livestock and, occasionally, humans. Culicoides imicola (Kieffer, 1913) is considered to be the main vector of the pathogens that cause bluetongue disease (BT) and African horse sickness (AHS) in southern Europe. The study of blood-feeding patterns in Culicoides is an essential step towards understanding the epidemiology of these pathogens. Molecular tools that increase the accuracy and sensitivity of traditional methods have been developed to identify the hosts of potential insect vectors. However, to the present group's knowledge, molecular studies that identify the hosts of C. imicola in Europe are lacking. The present study genetically characterizes the barcoding region of C. imicola trapped on farms in southern Spain and identifies its vertebrate hosts in the area. The report also reviews available information on the blood-feeding patterns of C. imicola worldwide. Culicoides imicola from Spain feed on blood of six mammals that include species known to be hosts of the BT and AHS viruses. This study provides evidence of the importance of livestock as sources of bloodmeals for C. imicola and the relevance of this species in the transmission of BT and AHS viruses in Europe. © 2017 The Royal Entomological Society.

  18. PhyDesign: an online application for profiling phylogenetic informativeness

    Directory of Open Access Journals (Sweden)

    Townsend Jeffrey P

    2011-05-01

    Full Text Available Abstract Background The rapid increase in number of sequenced genomes for species across of the tree of life is revealing a diverse suite of orthologous genes that could potentially be employed to inform molecular phylogenetic studies that encompass broader taxonomic sampling. Optimal usage of this diversity of loci requires user-friendly tools to facilitate widespread cost-effective locus prioritization for phylogenetic sampling. The Townsend (2007 phylogenetic informativeness provides a unique empirical metric for guiding marker selection. However, no software or automated methodology to evaluate sequence alignments and estimate the phylogenetic informativeness metric has been available. Results Here, we present PhyDesign, a platform-independent online application that implements the Townsend (2007 phylogenetic informativeness analysis, providing a quantitative prediction of the utility of loci to solve specific phylogenetic questions. An easy-to-use interface facilitates uploading of alignments and ultrametric trees to calculate and depict profiles of informativeness over specified time ranges, and provides rankings of locus prioritization for epochs of interest. Conclusions By providing these profiles, PhyDesign facilitates locus prioritization increasing the efficiency of sequencing for phylogenetic purposes compared to traditional studies with more laborious and low capacity screening methods, as well as increasing the accuracy of phylogenetic studies. Together with a manual and sample files, the application is freely accessible at http://phydesign.townsend.yale.edu.

  19. Phylogenetic relationships of Chilean leptodactylids: a molecular approach based on mitochondrial genes 12S and 16S Relaciones filogenéticas de los leptodactílidos chilenos: una aproximación molecular basada en los genes mitocondriales 12S y 16S

    Directory of Open Access Journals (Sweden)

    CLAUDIO CORREA

    2006-12-01

    Full Text Available Most Chilean amphibians belong to the subfamily Telmatobiinae (Anura, Leptodactylidae. Several phylogenetic studies of Leptodactylidae and Telmatobiinae, based principally on morphological characters, have implicitly suggested closer relationships of some species of the Telmatobiinae with members of other subfamilies of leptodactylids, including the leptodactyline genus Pleurodema which is present in Chile. Furthermore, a growing number of molecular studies suggest a non monophyletic status for Telmatobiinae, although none of these studies have investigated the phylogenetic relationships of this subfamily. We compared partial sequences of the ribosomal mitochondrial genes 12S and 16S to determine the phylogenetic relationships of Chilean leptodactylids and its position within the modern anurans (Neobatrachia. We included 22 species from nine of the 10 genera of telmatobiines present in Chile (Alsodes, Atelognathus, Batrachyla, Caudiverbera, Eupsophus, Hylorina, Insuetophrynus, Telmatobufo and Telmatobius, two species of the genus Pleurodema, and one species of Rhinodermatidae, which is considered a leptodactylid derivative family by some authors. We also included 51 species representing most of the families that compose Neobatrachia. Phylogenetic reconstructions were performed using the methods of maximum parsimony, maximum likelihood and Bayesian inference. The topologies obtained in all the analyses indicate that Telmatobiinae is a polyphyletic assemblage, composed by species belonging to Hyloidea (most of the genera and species more related to Australasian taxa (the clade Caudiverbera + Telmatobufo, defined as the tribe Calyptocephalellini. These molecular data support groups based on other kinds of evidence (Caudiverbera + Telmatobufo, Alsodes + Eupsophus and Batrachyla + Hylorina and raise new phylogenetic hypotheses for several genera of telmatobiines (Atelognathus with Batrachyla and Hylorina, Insuetophrynus + Rhinoderma. The phylogenetic

  20. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  1. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  2. Marine turtle mitogenome phylogenetics and evolution

    DEFF Research Database (Denmark)

    Duchene, Sebastián; Frey, Amy; Alfaro-Núñez, Luis Alonso

    2012-01-01

    The sea turtles are a group of cretaceous origin containing seven recognized living species: leatherback, hawksbill, Kemp's ridley, olive ridley, loggerhead, green, and flatback. The leatherback is the single member of the Dermochelidae family, whereas all other sea turtles belong in Cheloniidae...... distributions, shedding light on complex migration patterns and possible geographic or climatic events as driving forces of sea-turtle distribution. We have sequenced complete mitogenomes for all sea-turtle species, including samples from their geographic range extremes, and performed phylogenetic analyses...... to assess sea-turtle evolution with a large molecular dataset. We found variation in the length of the ATP8 gene and a highly variable site in ND4 near a proton translocation channel in the resulting protein. Complete mitogenomes show strong support and resolution for phylogenetic relationships among all...

  3. Europe phrasebook

    CERN Document Server

    2001-01-01

    This book replaces "Western Europe Phrasbook". It includes Basque, Catalan, Dutch, French, German, Greek, Irish, Italian, Maltese, Portugese, Scottish Gaelic, Spanish and Welsh. This fully updated edition includes special sections on going out, sports and festivals, as well as local dishes, shopping and sightseeing.

  4. Social Europe

    NARCIS (Netherlands)

    Paul Dekker; Sjef Ederveen; Gerda Jehoel-Gijsbers; Ruud de Mooij

    2003-01-01

    There is broad support for the European Union (EU) in the Netherlands: 73% of Dutch believe that EU membership is a 'good thing'. The figure in Germany is 59%, in France it is 50% and in the United Kingdom 30%. By contrast, engagement with Europe is very low in the Netherlands. In late 2002 fewer

  5. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  6. Transforming phylogenetic networks: Moving beyond tree space

    OpenAIRE

    Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang

    2016-01-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...

  7. Assessing bat droppings and predatory bird pellets for vector-borne bacteria: molecular evidence of bat-associated Neorickettsia sp. in Europe.

    NARCIS (Netherlands)

    Hornok, Sándor; Szőke, Krisztina; Estók, Péter; Krawczyk, Aleksandra; Haarsma, Anne-Jifke; Kováts, Dávid; Boldogh, Sándor A; Morandini, Pál; Szekeres, Sándor; Takács, Nóra; Kontschán, Jenő; Meli, Marina L; Fernández de Mera, Isabel G; de la Fuente, José; Gyuranecz, Miklós; Sulyok, Kinga M; Weibel, Beatrice; Gönczi, Enikő; de Bruin, Arnout; Sprong, Hein; Hofmann-Lehmann, Regina

    2018-01-01

    In Europe, several species of bats, owls and kestrels exemplify highly urbanised, flying vertebrates, which may get close to humans or domestic animals. Bat droppings and bird pellets may have epidemiological, as well as diagnostic significance from the point of view of pathogens. In this work 221

  8. A cluster of multidrug-resistant Mycobacterium tuberculosis among patients arriving in Europe from the Horn of Africa: a molecular epidemiological study

    NARCIS (Netherlands)

    Walker, T.M.; Merker, M.; Knoblauch, A.M.; Helbling, P.; Schoch, O.D.; Werf, M.J. van der; Kranzer, K.; Fiebig, L.; Kroger, S.; Haas, W.; Hoffmann, H.; Indra, A.; Egli, A.; Cirillo, D.M.; Robert, J.; Rogers, T.R.; Groenheit, R.; Mengshoel, A.T.; Mathys, V.; Haanpera, M.; Soolingen, D.V.; Niemann, S.; Bottger, E.C.; Keller, P.M.; Ingen, J. van; Wagner-Wiening, C.; Witschi, M.

    2018-01-01

    BACKGROUND: The risk of tuberculosis outbreaks among people fleeing hardship for refuge in Europe is heightened. We describe the cross-border European response to an outbreak of multidrug-resistant tuberculosis among patients from the Horn of Africa and Sudan. METHODS: On April 29 and May 30, 2016,

  9. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  10. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  11. Transnational Europe

    DEFF Research Database (Denmark)

    Bondebjerg, Ib

    2016-01-01

    -productions has increased the distribution of original and often local stories in Europe. The article analyses examples of some successful European drama series, their audiences and reception. The analysis is discussed in the context of national and transnational media policy and the impact of globalisation......This article deals with the social and cultural dimensions of globalization and uses both qualitative and quantitative methods to analyse the effects of stronger European integration on media production and reception. It combines theories and methods from sociology, anthropology and media studies...... in this development. The article concludes that encounters of the kind we find in different forms of TV drama will make Europe more diverse and richer for a much broader audience. The interaction between the particular and universal in “narratives” on our past and contemporary social and cultural order contribute...

  12. Charles Darwin, beetles and phylogenetics

    Science.gov (United States)

    Beutel, Rolf G.; Friedrich, Frank; Leschen, Richard A. B.

    2009-11-01

    . This has changed dramatically. With very large data sets and high throughput sampling, phylogenetic questions can be addressed without prior knowledge of morphological characters. Nevertheless, molecular studies have not lead to the great breakthrough in beetle systematics—yet. Especially the phylogeny of the extremely species rich suborder Polyphaga remains incompletely resolved. Coordinated efforts of molecular workers and of morphologists using innovative techniques may lead to more profound insights in the near future. The final aim is to develop a well-founded phylogeny, which truly reflects the evolution of this immensely species rich group of organisms.

  13. Charles Darwin, beetles and phylogenetics.

    Science.gov (United States)

    Beutel, Rolf G; Friedrich, Frank; Leschen, Richard A B

    2009-11-01

    changed dramatically. With very large data sets and high throughput sampling, phylogenetic questions can be addressed without prior knowledge of morphological characters. Nevertheless, molecular studies have not lead to the great breakthrough in beetle systematics--yet. Especially the phylogeny of the extremely species rich suborder Polyphaga remains incompletely resolved. Coordinated efforts of molecular workers and of morphologists using innovative techniques may lead to more profound insights in the near future. The final aim is to develop a well-founded phylogeny, which truly reflects the evolution of this immensely species rich group of organisms.

  14. Coalescent methods for estimating phylogenetic trees.

    Science.gov (United States)

    Liu, Liang; Yu, Lili; Kubatko, Laura; Pearl, Dennis K; Edwards, Scott V

    2009-10-01

    We review recent models to estimate phylogenetic trees under the multispecies coalescent. Although the distinction between gene trees and species trees has come to the fore of phylogenetics, only recently have methods been developed that explicitly estimate species trees. Of the several factors that can cause gene tree heterogeneity and discordance with the species tree, deep coalescence due to random genetic drift in branches of the species tree has been modeled most thoroughly. Bayesian approaches to estimating species trees utilizes two likelihood functions, one of which has been widely used in traditional phylogenetics and involves the model of nucleotide substitution, and the second of which is less familiar to phylogeneticists and involves the probability distribution of gene trees given a species tree. Other recent parametric and nonparametric methods for estimating species trees involve parsimony criteria, summary statistics, supertree and consensus methods. Species tree approaches are an appropriate goal for systematics, appear to work well in some cases where concatenation can be misleading, and suggest that sampling many independent loci will be paramount. Such methods can also be challenging to implement because of the complexity of the models and computational time. In addition, further elaboration of the simplest of coalescent models will be required to incorporate commonly known issues such as deviation from the molecular clock, gene flow and other genetic forces.

  15. HLA-C molecular characterization of a Lebanese population and genetic structure of 39 populations from Europe to India-Pakistan.

    Science.gov (United States)

    Buhler, S; Megarbane, A; Lefranc, G; Tiercy, J-M; Sanchez-Mazas, A

    2006-07-01

    Lebanon is located at a continental crossroad between Europe, Africa, and Asia. This region has been the center of wide-scale movements of populations as well as the theater of genetic and cultural trade off among neighboring populations. In this study, HLA-C alleles were characterized by a PCR-SSOP (sequence-specific oligonucleotide probes) hybridization protocol in a sample of 97 Lebanese. A total of 23 alleles were identified with four predominant, Cw*0401, Cw*0602, Cw*0701/06, and Cw*1203, accounting for almost 60% of HLA-C allele frequencies. We included the Lebanese data into a broad analysis of the HLA-C genetic structure of a large set of populations located in Europe, the Middle East, and the Indian subcontinent. Our results indicate that Lebanese exhibit an intermediate genetic profile among the populations from the Middle East, which constitute a rather homogeneous genetic group. In Europe, a high correlation coefficient is found between genetic and geographic distances. In this continent, we also identified a significant genetic frontier following a north-east to south-west axis. This frontier cuts through the Alps and the Pyrenees, thus separating the north-western European populations from those located in the eastern and Mediterranean areas. Finally, the populations from India - Pakistan are very heterogeneous, particularly the Dravidians. Their differentiation has probably been caused by rapid genetic drift under complex influences of cultural, linguistic, and/or religious barriers. Overall, the results show that the HLA-C genetic patterns of these three geographic regions, i.e., the Middle East, Europe, and India-Pakistan, have been shaped by very different genetic histories.

  16. Bayesian phylogenetic estimation of fossil ages.

    Science.gov (United States)

    Drummond, Alexei J; Stadler, Tanja

    2016-07-19

    Recent advances have allowed for both morphological fossil evidence and molecular sequences to be integrated into a single combined inference of divergence dates under the rule of Bayesian probability. In particular, the fossilized birth-death tree prior and the Lewis-Mk model of discrete morphological evolution allow for the estimation of both divergence times and phylogenetic relationships between fossil and extant taxa. We exploit this statistical framework to investigate the internal consistency of these models by producing phylogenetic estimates of the age of each fossil in turn, within two rich and well-characterized datasets of fossil and extant species (penguins and canids). We find that the estimation accuracy of fossil ages is generally high with credible intervals seldom excluding the true age and median relative error in the two datasets of 5.7% and 13.2%, respectively. The median relative standard error (RSD) was 9.2% and 7.2%, respectively, suggesting good precision, although with some outliers. In fact, in the two datasets we analyse, the phylogenetic estimate of fossil age is on average less than 2 Myr from the mid-point age of the geological strata from which it was excavated. The high level of internal consistency found in our analyses suggests that the Bayesian statistical model employed is an adequate fit for both the geological and morphological data, and provides evidence from real data that the framework used can accurately model the evolution of discrete morphological traits coded from fossil and extant taxa. We anticipate that this approach will have diverse applications beyond divergence time dating, including dating fossils that are temporally unconstrained, testing of the 'morphological clock', and for uncovering potential model misspecification and/or data errors when controversial phylogenetic hypotheses are obtained based on combined divergence dating analyses.This article is part of the themed issue 'Dating species divergences using

  17. phangorn: phylogenetic analysis in R.

    Science.gov (United States)

    Schliep, Klaus Peter

    2011-02-15

    phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.

  18. On Nakhleh's metric for reduced phylogenetic networks

    OpenAIRE

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro

    2009-01-01

    We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...

  19. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  20. Molecular phylogenetics of the family Cyprinidae (Actinopterygii: Cypriniformes) as evidenced by sequence variation in the first intron of S7 ribosomal protein-coding gene: further evidence from a nuclear gene of the systematic chaos in the family.

    Science.gov (United States)

    He, Shunping; Mayden, Richard L; Wang, Xuzheng; Wang, Wei; Tang, Kevin L; Chen, Wei-Jen; Chen, Yiyu

    2008-03-01

    The family Cyprinidae is the largest freshwater fish group in the world, including over 200 genera and 2100 species. The phylogenetic relationships of major clades within this family are simply poorly understood, largely because of the overwhelming diversity of the group; however, several investigators have advanced different hypotheses of relationships that pre- and post-date the use of shared-derived characters as advocated through phylogenetic systematics. As expected, most previous investigations used morphological characters. Recently, mitochondrial DNA (mtDNA) sequences and combined morphological and mtDNA investigations have been used to explore and advance our understanding of species relationships and test monophyletic groupings. Limitations of these studies include limited taxon sampling and a strict reliance upon maternally inherited mtDNA variation. The present study is the first endeavor to recover the phylogenetic relationships of the 12 previously recognized monophyletic subfamilies within the Cyprinidae using newly sequenced nuclear DNA (nDNA) for over 50 species representing members of the different previously hypothesized subfamily and family groupings within the Cyprinidae and from other cypriniform families as outgroup taxa. Hypothesized phylogenetic relationships are constructed using maximum parsimony and Basyesian analyses of 1042 sites, of which 971 sites were variable and 790 were phylogenetically informative. Using other appropriate cypriniform taxa of the families Catostomidae (Myxocyprinus asiaticus), Gyrinocheilidae (Gyrinocheilus aymonieri), and Balitoridae (Nemacheilus sp. and Beaufortia kweichowensis) as outgroups, the Cyprinidae is resolved as a monophyletic group. Within the family the genera Raiamas, Barilius, Danio, and Rasbora, representing many of the tropical cyprinids, represent basal members of the family. All other species can be classified into variably supported and resolved monophyletic lineages, depending upon analysis

  1. Dreyfusia nordmannianae in Northern and Central Europe

    DEFF Research Database (Denmark)

    Ravn, Hans Peter; Havill, N.P.; Akbulut, S.

    2013-01-01

    The silver fir woolly adelgid, Dreyfusia nordmannianae, is the most severe pest occurring on Abies nordmanniana in Central and Northern Europe. The adelgid is particularly damaging to trees in Christmas tree plantations. Dreyfusia nordmannianae is native to the Caucasus region and alien to Europe...... were examined for phylogenetic structure. There was no evidence of differentiation, suggesting that these Dreyfusia species have recently diverged or require taxonomic revision. All existing published and unpublished reports on natural enemies of D. nordmannianae in its place of origin were reviewed...

  2. Unhomely Europes

    Directory of Open Access Journals (Sweden)

    Dimitris Eleftheriotis

    2007-10-01

    Full Text Available This special issue of PORTAL constitutes an indirect, sideways reflection on the EU’s move toward (re-discovering, establishing, and promoting shared cultural values. It seeks to unveil not the official historical contexts and traditions in which contemporary inventions of cultural identity occur. Rather, its aim is to discover and listen to competing voices and alternative visions—be they cultural, social, political, literary or cinematic—that give different shape to trans-European identities and model union, commonality, and belonging, according to transregional or translocal values. The special issue, then, is an exploration of possible forms of frictions occurring across the European cultural and historical landscape. It questions the pre-eminence of formal EU discourses on values, and the branding of Europe in the global marketplace, by listening to marginalised, unheard or discordant Euro-voices. The issue demonstrates the need for more rigorous theorisations of notions such as ‘value,’ whether ‘shared’ or ‘cultural,’ in the European region, and posits alternative mappings and visions of European belonging and identity. The essays included in this special issue consider Europe as a locus of frictions, consensus, tension, contestation and reconciliation. This locus is capable of co-locating Scotland with the Costa Brava, crossing Swedish views of Russia with their converse, recognising a Europe of borders that continuously unfold, acknowledging the interference of historical memories, and inflecting the Houellebecquian Euro-futurescape with Greco-Australian undertones; to cite a few examples of vibrant transvaluation occurring in the issue.

  3. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Molecular characterization of 18 Chaetomium isolates collected from India based on the internal transcribed spacer (ITS) region of the rRNA gene sequences was done. Phylogenetic analysis of full length ITS region showed that Chaetomium globosum isolates, Cg1, Cg2, Cg6, Cg11 and Cg15, Chaetomium spp. isolates, ...

  4. Phylogenetic placement of the Dominican Republic endemic genus Sarcopilea (Urticaceae)

    Czech Academy of Sciences Publication Activity Database

    Jestrow, B.; Valdés, James J.; Rodríguez, F. J.; Francisco-Ortega, J.

    2012-01-01

    Roč. 61, č. 3 (2012), s. 592-600 ISSN 0040-0262 Institutional support: RVO:60077344 Keywords : CAM * Caribbean Islands * cystoliths * epistomatic * hyperstomatic * hydathodes * phylogenetics * Pilea * Sarcopilea * succulent * Urticaceae Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.782, year: 2012

  5. Phylogenetic analysis of the genus Hordeum using repetitive DNA sequences

    DEFF Research Database (Denmark)

    Svitashev, S.; Bryngelsson, T.; Vershinin, A.

    1994-01-01

    A set of six cloned barley (Hordeum vulgare) repetitive DNA sequences was used for the analysis of phylogenetic relationships among 31 species (46 taxa) of the genus Hordeum, using molecular hybridization techniques. In situ hybridization experiments showed dispersed organization of the sequences...

  6. The rhabdoviruses: biodiversity, phylogenetics, and evolution.

    Science.gov (United States)

    Kuzmin, I V; Novella, I S; Dietzgen, R G; Padhi, A; Rupprecht, C E

    2009-07-01

    Rhabdoviruses (family Rhabdoviridae) include a diversity of important pathogens of animals and plants. They share morphology and genome organization. The understanding of rhabdovirus phylogeny, ecology and evolution has progressed greatly during the last 30 years, due to enhanced surveillance and improved methodologies of molecular characterization. Along with six established genera, several phylogenetic groups at different levels were described within the Rhabdoviridae. However, comparative relationships between viral phylogeny and taxonomy remains incomplete, with multiple representatives awaiting further genetic characterization. The same is true for rhabdovirus evolution. To date, rather simplistic molecular clock models only partially describe the evolutionary dynamics of postulated viral lineages. Ongoing progress in viral evolutionary and ecological investigations will provide the platform for future studies of this diverse family.

  7. A taxonomic and phylogenetic re-appraisal of the genus Curvularia

    Science.gov (United States)

    Species of Curvularia are important plant and human pathogens worldwide. In this study, the genus Curvularia is re-assessed based on molecular phylogenetic analysis and morphological observations of available isolates and specimens. A multi-gene phylogenetic tree inferred from ITS, TEF and GPDH gene...

  8. Phylogenetic Analysis of Phytophthora Species Based on Mitochondrial and Nuclear DNA Sequences

    NARCIS (Netherlands)

    Kroon, L.P.N.M.; Bakker, F.T.; Bosch, van den G.B.M.; Bonants, P.J.M.; Flier, W.G.

    2004-01-01

    A molecular phylogenetic analysis of the genus Phytophthora was performed, 113 isolates from 48 Phytophthora species were included in this analysis. Phylogenetic analyses were performed on regions of mitochondrial (cytochrome c oxidase subunit 1; NADH dehydrogenase subunit 1) and nuclear gene

  9. A phylogenetic blueprint for a modern whale.

    Science.gov (United States)

    Gatesy, John; Geisler, Jonathan H; Chang, Joseph; Buell, Carl; Berta, Annalisa; Meredith, Robert W; Springer, Mark S; McGowen, Michael R

    2013-02-01

    The emergence of Cetacea in the Paleogene represents one of the most profound macroevolutionary transitions within Mammalia. The move from a terrestrial habitat to a committed aquatic lifestyle engendered wholesale changes in anatomy, physiology, and behavior. The results of this remarkable transformation are extant whales that include the largest, biggest brained, fastest swimming, loudest, deepest diving mammals, some of which can detect prey with a sophisticated echolocation system (Odontoceti - toothed whales), and others that batch feed using racks of baleen (Mysticeti - baleen whales). A broad-scale reconstruction of the evolutionary remodeling that culminated in extant cetaceans has not yet been based on integration of genomic and paleontological information. Here, we first place Cetacea relative to extant mammalian diversity, and assess the distribution of support among molecular datasets for relationships within Artiodactyla (even-toed ungulates, including Cetacea). We then merge trees derived from three large concatenations of molecular and fossil data to yield a composite hypothesis that encompasses many critical events in the evolutionary history of Cetacea. By combining diverse evidence, we infer a phylogenetic blueprint that outlines the stepwise evolutionary development of modern whales. This hypothesis represents a starting point for more detailed, comprehensive phylogenetic reconstructions in the future, and also highlights the synergistic interaction between modern (genomic) and traditional (morphological+paleontological) approaches that ultimately must be exploited to provide a rich understanding of evolutionary history across the entire tree of Life. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. A molecular approach to the genus Alburnoides using COI sequences data set and the description of a new species, A. damghani, from the Damghan River system (the Dasht-e Kavir Basin, Iran) (Actinopterygii, Cyprinidae)

    OpenAIRE

    Jouladeh Roudbar,Arash; Eagderi,Soheil; Esmaeili,Hamid Reza; Coad,Brian; Bogutskaya,Nina

    2016-01-01

    Abstract The molecular status of nine species of the genus Alburnoides from different river drainages in Iran and additionally by seven species from Europe was assessed. mtDNA COI gene sequences from freshly collected specimens and available NCBI data revealed four major phylogenetic lineages. Based on the results, a distinct taxon from the Cheshmeh Ali (Ali Spring), a Damghan River tributary in the endorheic Dasht-e Kavir basin, northern Iran, which is the closest sister to Alburnoides namak...

  11. Point estimates in phylogenetic reconstructions

    OpenAIRE

    Benner, Philipp; Bacak, Miroslav; Bourguignon, Pierre-Yves

    2013-01-01

    Motivation: The construction of statistics for summarizing posterior samples returned by a Bayesian phylogenetic study has so far been hindered by the poor geometric insights available into the space of phylogenetic trees, and ad hoc methods such as the derivation of a consensus tree makeup for the ill-definition of the usual concepts of posterior mean, while bootstrap methods mitigate the absence of a sound concept of variance. Yielding satisfactory results with sufficiently concentrated pos...

  12. One tree to link them all: a phylogenetic dataset for the European tetrapoda.

    Science.gov (United States)

    Roquet, Cristina; Lavergne, Sébastien; Thuiller, Wilfried

    2014-08-08

    Since the ever-increasing availability of phylogenetic informative data, the last decade has seen an upsurge of ecological studies incorporating information on evolutionary relationships among species. However, detailed species-level phylogenies are still lacking for many large groups and regions, which are necessary for comprehensive large-scale eco-phylogenetic analyses. Here, we provide a dataset of 100 dated phylogenetic trees for all European tetrapods based on a mixture of supermatrix and supertree approaches. Phylogenetic inference was performed separately for each of the main Tetrapoda groups of Europe except mammals (i.e. amphibians, birds, squamates and turtles) by means of maximum likelihood (ML) analyses of supermatrix applying a tree constraint at the family (amphibians and squamates) or order (birds and turtles) levels based on consensus knowledge. For each group, we inferred 100 ML trees to be able to provide a phylogenetic dataset that accounts for phylogenetic uncertainty, and assessed node support with bootstrap analyses. Each tree was dated using penalized-likelihood and fossil calibration. The trees obtained were well-supported by existing knowledge and previous phylogenetic studies. For mammals, we modified the most complete supertree dataset available on the literature to include a recent update of the Carnivora clade. As a final step, we merged the phylogenetic trees of all groups to obtain a set of 100 phylogenetic trees for all European Tetrapoda species for which data was available (91%). We provide this phylogenetic dataset (100 chronograms) for the purpose of comparative analyses, macro-ecological or community ecology studies aiming to incorporate phylogenetic information while accounting for phylogenetic uncertainty.

  13. Towards an integrated phylogenetic classification of the Tremellomycetes.

    Science.gov (United States)

    Liu, X-Z; Wang, Q-M; Göker, M; Groenewald, M; Kachalkin, A V; Lumbsch, H T; Millanes, A M; Wedin, M; Yurkov, A M; Boekhout, T; Bai, F-Y

    2015-06-01

    Families and genera assigned to Tremellomycetes have been mainly circumscribed by morphology and for the yeasts also by biochemical and physiological characteristics. This phenotype-based classification is largely in conflict with molecular phylogenetic analyses. Here a phylogenetic classification framework for the Tremellomycetes is proposed based on the results of phylogenetic analyses from a seven-genes dataset covering the majority of tremellomycetous yeasts and closely related filamentous taxa. Circumscriptions of the taxonomic units at the order, family and genus levels recognised were quantitatively assessed using the phylogenetic rank boundary optimisation (PRBO) and modified general mixed Yule coalescent (GMYC) tests. In addition, a comprehensive phylogenetic analysis on an expanded LSU rRNA (D1/D2 domains) gene sequence dataset covering as many as available teleomorphic and filamentous taxa within Tremellomycetes was performed to investigate the relationships between yeasts and filamentous taxa and to examine the stability of undersampled clades. Based on the results inferred from molecular data and morphological and physiochemical features, we propose an updated classification for the Tremellomycetes. We accept five orders, 17 families and 54 genera, including seven new families and 18 new genera. In addition, seven families and 17 genera are emended and one new species name and 185 new combinations are proposed. We propose to use the term pro tempore or pro tem. in abbreviation to indicate the species names that are temporarily maintained.

  14. Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

    Science.gov (United States)

    Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

    2016-08-05

    This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

  15. Phylogenetic lineages in Pseudocercospora.

    Science.gov (United States)

    Crous, P W; Braun, U; Hunter, G C; Wingfield, M J; Verkley, G J M; Shin, H-D; Nakashima, C; Groenewald, J Z

    2013-06-30

    Pseudocercospora is a large cosmopolitan genus of plant pathogenic fungi that are commonly associated with leaf and fruit spots as well as blights on a wide range of plant hosts. They occur in arid as well as wet environments and in a wide range of climates including cool temperate, sub-tropical and tropical regions. Pseudocercospora is now treated as a genus in its own right, although formerly recognised as either an anamorphic state of Mycosphaerella or having mycosphaerella-like teleomorphs. The aim of this study was to sequence the partial 28S nuclear ribosomal RNA gene of a selected set of isolates to resolve phylogenetic generic limits within the Pseudocercospora complex. From these data, 14 clades are recognised, six of which cluster in Mycosphaerellaceae. Pseudocercospora s. str. represents a distinct clade, sister to Passalora eucalypti, and a clade representing the genera Scolecostigmina, Trochophora and Pallidocercospora gen. nov., taxa formerly accommodated in the Mycosphaerella heimii complex and characterised by smooth, pale brown conidia, as well as the formation of red crystals in agar media. Other clades in Mycosphaerellaceae include Sonderhenia, Microcyclosporella, and Paracercospora. Pseudocercosporella resides in a large clade along with Phloeospora, Miuraea, Cercospora and Septoria. Additional clades represent Dissoconiaceae, Teratosphaeriaceae, Cladosporiaceae, and the genera Xenostigmina, Strelitziana, Cyphellophora and Thedgonia. The genus Phaeomycocentrospora is introduced to accommodate Mycocentrospora cantuariensis, primarily distinguished from Pseudocercospora based on its hyaline hyphae, broad conidiogenous loci and hila. Host specificity was considered for 146 species of Pseudocercospora occurring on 115 host genera from 33 countries. Partial nucleotide sequence data for three gene loci, ITS, EF-1α, and ACT suggest that the majority of these species are host specific. Species identified on the basis of host, symptomatology and general

  16. Locating a tree in a phylogenetic network

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Semple, C.; Steel, M.A.

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster

  17. The scale of divergence: a phylogenetic appraisal of intercontinental allopatric speciation in a passively dispersed freshwater zooplankton genus.

    Science.gov (United States)

    Adamowicz, Sarah J; Petrusek, Adam; Colbourne, John K; Hebert, Paul D N; Witt, Jonathan D S

    2009-03-01

    Molecular studies have enlightened our understanding of freshwater zooplankton biogeography, yet questions remain regarding the scale and commonality of geographic speciation. Here, we present a mtDNA-based phylogenetic hypothesis for 92 Daphnia species from all seven continents, with a focus on North and South America, Europe, and Australia, and use it to explore the frequency, scale, and geographical orientation of allopatric divergence events. Allopatric speciation can conservatively account for at least 42% of cladogenetic events among the species included in our study; most of these involve intercontinental splits. Closely related species pairs are concentrated in the circumarctic region and between northern and southern continents, aligned with bird migration routes, suggesting recent dispersal. By contrast, deeper phylogenetic patterns are consistent with vicariance scenarios linked to continental fragmentation. The possible reasons for the puzzling persistence of these ancient patterns in light of the eroding force of dispersal are considered. Our results demonstrate the high frequency and complex pattern of allopatric speciation in this ancient, passively dispersed genus.

  18. Locating a tree in a phylogenetic network

    OpenAIRE

    van Iersel, Leo; Semple, Charles; Steel, Mike

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...

  19. Phylogenetic distribution of fungal sterols.

    Directory of Open Access Journals (Sweden)

    John D Weete

    Full Text Available BACKGROUND: Ergosterol has been considered the "fungal sterol" for almost 125 years; however, additional sterol data superimposed on a recent molecular phylogeny of kingdom Fungi reveals a different and more complex situation. METHODOLOGY/PRINCIPAL FINDINGS: The interpretation of sterol distribution data in a modern phylogenetic context indicates that there is a clear trend from cholesterol and other Delta(5 sterols in the earliest diverging fungal species to ergosterol in later diverging fungi. There are, however, deviations from this pattern in certain clades. Sterols of the diverse zoosporic and zygosporic forms exhibit structural diversity with cholesterol and 24-ethyl -Delta(5 sterols in zoosporic taxa, and 24-methyl sterols in zygosporic fungi. For example, each of the three monophyletic lineages of zygosporic fungi has distinctive major sterols, ergosterol in Mucorales, 22-dihydroergosterol in Dimargaritales, Harpellales, and Kickxellales (DHK clade, and 24-methyl cholesterol in Entomophthorales. Other departures from ergosterol as the dominant sterol include: 24-ethyl cholesterol in Glomeromycota, 24-ethyl cholest-7-enol and 24-ethyl-cholesta-7,24(28-dienol in rust fungi, brassicasterol in Taphrinales and hypogeous pezizalean species, and cholesterol in Pneumocystis. CONCLUSIONS/SIGNIFICANCE: Five dominant end products of sterol biosynthesis (cholesterol, ergosterol, 24-methyl cholesterol, 24-ethyl cholesterol, brassicasterol, and intermediates in the formation of 24-ethyl cholesterol, are major sterols in 175 species of Fungi. Although most fungi in the most speciose clades have ergosterol as a major sterol, sterols are more varied than currently understood, and their distribution supports certain clades of Fungi in current fungal phylogenies. In addition to the intellectual importance of understanding evolution of sterol synthesis in fungi, there is practical importance because certain antifungal drugs (e.g., azoles target reactions in

  20. Molecular tools for bathing water assessment in Europe: Balancing social science research with a rapidly developing environmental science evidence-base.

    Science.gov (United States)

    Oliver, David M; Hanley, Nick D; van Niekerk, Melanie; Kay, David; Heathwaite, A Louise; Rabinovici, Sharyl J M; Kinzelman, Julie L; Fleming, Lora E; Porter, Jonathan; Shaikh, Sabina; Fish, Rob; Chilton, Sue; Hewitt, Julie; Connolly, Elaine; Cummins, Andy; Glenk, Klaus; McPhail, Calum; McRory, Eric; McVittie, Alistair; Giles, Amanna; Roberts, Suzanne; Simpson, Katherine; Tinch, Dugald; Thairs, Ted; Avery, Lisa M; Vinten, Andy J A; Watts, Bill D; Quilliam, Richard S

    2016-02-01

    The use of molecular tools, principally qPCR, versus traditional culture-based methods for quantifying microbial parameters (e.g., Fecal Indicator Organisms) in bathing waters generates considerable ongoing debate at the science-policy interface. Advances in science have allowed the development and application of molecular biological methods for rapid (~2 h) quantification of microbial pollution in bathing and recreational waters. In contrast, culture-based methods can take between 18 and 96 h for sample processing. Thus, molecular tools offer an opportunity to provide a more meaningful statement of microbial risk to water-users by providing near-real-time information enabling potentially more informed decision-making with regard to water-based activities. However, complementary studies concerning the potential costs and benefits of adopting rapid methods as a regulatory tool are in short supply. We report on findings from an international Working Group that examined the breadth of social impacts, challenges, and research opportunities associated with the application of molecular tools to bathing water regulations.

  1. Evolution of microgastropods (Ellobioidea, Carychiidae): integrating taxonomic, phylogenetic and evolutionary hypotheses

    Science.gov (United States)

    2013-01-01

    Background Current biodiversity patterns are considered largely the result of past climatic and tectonic changes. In an integrative approach, we combine taxonomic and phylogenetic hypotheses to analyze temporal and geographic diversification of epigean (Carychium) and subterranean (Zospeum) evolutionary lineages in Carychiidae (Eupulmonata, Ellobioidea). We explicitly test three hypotheses: 1) morphospecies encompass unrecognized evolutionary lineages, 2) limited dispersal results in a close genetic relationship of geographical proximally distributed taxa and 3) major climatic and tectonic events had an impact on lineage diversification within Carychiidae. Results Initial morphospecies assignments were investigated by different molecular delimitation approaches (threshold, ABGD, GMYC and SP). Despite a conservative delimitation strategy, carychiid morphospecies comprise a great number of unrecognized evolutionary lineages. We attribute this phenomenon to historic underestimation of morphological stasis and phenotypic variability amongst lineages. The first molecular phylogenetic hypothesis for the Carychiidae (based on COI, 16S and H3) reveals Carychium and Zospeum to be reciprocally monophyletic. Geographical proximally distributed lineages are often closely related. The temporal diversification of Carychiidae is best described by a constant rate model of diversification. The evolution of Carychiidae is characterized by relatively few (long distance) colonization events. We find support for an Asian origin of Carychium. Zospeum may have arrived in Europe before extant members of Carychium. Distantly related Carychium clades inhabit a wide spectrum of the available bioclimatic niche and demonstrate considerable niche overlap. Conclusions Carychiid taxonomy is in dire need of revision. An inferred wide distribution and variable phenotype suggest underestimated diversity in Zospeum. Several Carychium morphospecies are results of past taxonomic lumping. By collecting

  2. Inferring phylogenetic trees from the knowledge of rare evolutionary events.

    Science.gov (United States)

    Hellmuth, Marc; Hernandez-Rosales, Maribel; Long, Yangjing; Stadler, Peter F

    2018-06-01

    Rare events have played an increasing role in molecular phylogenetics as potentially homoplasy-poor characters. In this contribution we analyze the phylogenetic information content from a combinatorial point of view by considering the binary relation on the set of taxa defined by the existence of a single event separating two taxa. We show that the graph-representation of this relation must be a tree. Moreover, we characterize completely the relationship between the tree of such relations and the underlying phylogenetic tree. With directed operations such as tandem-duplication-random-loss events in mind we demonstrate how non-symmetric information constrains the position of the root in the partially reconstructed phylogeny.

  3. Interpreting the universal phylogenetic tree

    Science.gov (United States)

    Woese, C. R.

    2000-01-01

    The universal phylogenetic tree not only spans all extant life, but its root and earliest branchings represent stages in the evolutionary process before modern cell types had come into being. The evolution of the cell is an interplay between vertically derived and horizontally acquired variation. Primitive cellular entities were necessarily simpler and more modular in design than are modern cells. Consequently, horizontal gene transfer early on was pervasive, dominating the evolutionary dynamic. The root of the universal phylogenetic tree represents the first stage in cellular evolution when the evolving cell became sufficiently integrated and stable to the erosive effects of horizontal gene transfer that true organismal lineages could exist.

  4. Age, origins and extinctions of the avifauna of Macaronesia: a synthesis of phylogenetic and fossil information

    Science.gov (United States)

    Illera, Juan Carlos; Rando, Juan Carlos; Richardson, David S.; Emerson, Brent C.

    2012-09-01

    Understanding the age, origins and extinction of oceanic island biota has captivated the interest of evolutionary biologists since Darwin and Wallace. Because oceanic islands are discrete entities of small geographical size but with considerable habitat diversity, they provide ideal templates within which to study evolutionary processes. The peripheral North Atlantic islands, collectively referred to as Macaronesia, are considered a hot spot of biodiversity due to the fact that they contain a large proportion of endemic taxa (ca 25%). Recent molecular studies are providing insight into the patterns of colonization and radiation within the extant avifauna, while paleontological studies have described many extinct avian species, sometimes identifying the causes and chronology of extinction. The aim of this review is to develop an understanding of the evolutionary and biogeographic history of the macaronesian avifauna, combining information from phylogenetic and paleontological studies. We then compare patterns for Macaronesia with those of other oceanic archipelagos to evaluate to what extent patterns may be generalised across regions. Phylogenetic analyses have confirmed the close relationships between endemic macaronesian avifauna and the closest mainland areas (Europe and Africa), however, in contrast to other archipelagos of a similar age, we show that most extant birds appear to have colonized macaronesian archipelagos relatively recently, within the last four million years, despite some islands being approximately 30 million years old. Fossil records support the idea that higher species richness previously existed, with recent dating on bone collagen of selected extinct species suggesting that their extinction coincided with the arrival of aboriginal people ca 2500 years ago in the Canary Islands, or the arrival of Europeans across all the macaronesian islands in the 14th century. It is plausible that these human mediated extinctions may have selectively acted

  5. BLAST-EXPLORER helps you building datasets for phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Claverie Jean-Michel

    2010-01-01

    Full Text Available Abstract Background The right sampling of homologous sequences for phylogenetic or molecular evolution analyses is a crucial step, the quality of which can have a significant impact on the final interpretation of the study. There is no single way for constructing datasets suitable for phylogenetic analysis, because this task intimately depends on the scientific question we want to address, Moreover, database mining softwares such as BLAST which are routinely used for searching homologous sequences are not specifically optimized for this task. Results To fill this gap, we designed BLAST-Explorer, an original and friendly web-based application that combines a BLAST search with a suite of tools that allows interactive, phylogenetic-oriented exploration of the BLAST results and flexible selection of homologous sequences among the BLAST hits. Once the selection of the BLAST hits is done using BLAST-Explorer, the corresponding sequence can be imported locally for external analysis or passed to the phylogenetic tree reconstruction pipelines available on the Phylogeny.fr platform. Conclusions BLAST-Explorer provides a simple, intuitive and interactive graphical representation of the BLAST results and allows selection and retrieving of the BLAST hit sequences based a wide range of criterions. Although BLAST-Explorer primarily aims at helping the construction of sequence datasets for further phylogenetic study, it can also be used as a standard BLAST server with enriched output. BLAST-Explorer is available at http://www.phylogeny.fr

  6. The power and pitfalls of HIV phylogenetics in public health.

    Science.gov (United States)

    Brooks, James I; Sandstrom, Paul A

    2013-07-25

    Phylogenetics is the application of comparative studies of genetic sequences in order to infer evolutionary relationships among organisms. This tool can be used as a form of molecular epidemiology to enhance traditional population-level communicable disease surveillance. Phylogenetic study has resulted in new paradigms being created in the field of communicable diseases and this commentary aims to provide the reader with an explanation of how phylogenetics can be used in tracking infectious diseases. Special emphasis will be placed upon the application of phylogenetics as a tool to help elucidate HIV transmission patterns and the limitations to these methods when applied to forensic analysis. Understanding infectious disease epidemiology in order to prevent new transmissions is the sine qua non of public health. However, with increasing epidemiological resolution, there may be an associated potential loss of privacy to the individual. It is within this context that we aim to promote the discussion on how to use phylogenetics to achieve important public health goals, while at the same time protecting the rights of the individual.

  7. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  8. Phylogenetic systematics of the genus Echinococcus (Cestoda: Taeniidae).

    Science.gov (United States)

    Nakao, Minoru; Lavikainen, Antti; Yanagida, Tetsuya; Ito, Akira

    2013-11-01

    Echinococcosis is a serious helminthic zoonosis in humans, livestock and wildlife. The pathogenic organisms are members of the genus Echinococcus (Cestoda: Taeniidae). Life cycles of Echinococcus spp. are consistently dependent on predator-prey association between two obligate mammalian hosts. Carnivores (canids and felids) serve as definitive hosts for adult tapeworms and their herbivore prey (ungulates, rodents and lagomorphs) as intermediate hosts for metacestode larvae. Humans are involved as an accidental host for metacestode infections. The metacestodes develop in various internal organs, particularly in liver and lungs. Each metacestode of Echinococcus spp. has an organotropism and a characteristic form known as an unilocular (cystic), alveolar or polycystic hydatid. Recent molecular phylogenetic studies have demonstrated that the type species, Echinococcus granulosus, causing cystic echinococcosis is a cryptic species complex. Therefore, the orthodox taxonomy of Echinococcus established from morphological criteria has been revised from the standpoint of phylogenetic systematics. Nine valid species including newly resurrected taxa are recognised as a result of the revision. This review summarises the recent advances in the phylogenetic systematics of Echinococcus, together with the historical backgrounds and molecular epidemiological aspects of each species. A new phylogenetic tree inferred from the mitochondrial genomes of all valid Echinococcus spp. is also presented. The taxonomic nomenclature for Echinococcus oligarthrus is shown to be incorrect and this name should be replaced with Echinococcus oligarthra. Copyright © 2013 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  9. The adder (Vipera berus in Southern Altay Mountains: population characteristics, distribution, morphology and phylogenetic position

    Directory of Open Access Journals (Sweden)

    Shaopeng Cui

    2016-08-01

    Full Text Available As the most widely distributed snake in Eurasia, the adder (Vipera berus has been extensively investigated in Europe but poorly understood in Asia. The Southern Altay Mountains represent the adder’s southern distribution limit in Central Asia, whereas its population status has never been assessed. We conducted, for the first time, field surveys for the adder at two areas of Southern Altay Mountains using a combination of line transects and random searches. We also described the morphological characteristics of the collected specimens and conducted analyses of external morphology and molecular phylogeny. The results showed that the adder distributed in both survey sites and we recorded a total of 34 sightings. In Kanas river valley, the estimated encounter rate over a total of 137 km transects was 0.15 ± 0.05 sightings/km. The occurrence of melanism was only 17%. The small size was typical for the adders in Southern Altay Mountains in contrast to other geographic populations of the nominate subspecies. A phylogenetic tree obtained by Bayesian Inference based on DNA sequences of the mitochondrial cytochrome b (1,023 bp grouped them within the Northern clade of the species but failed to separate them from the subspecies V. b. sachalinensis. Our discovery extends the distribution range of V. berus and provides a basis for further researches. We discuss the hypothesis that the adder expands its distribution border to the southwest along the mountains’ elevation gradient, but the population abundance declines gradually due to a drying climate.

  10. Phylogenetic placement of two species known only from resting spores

    DEFF Research Database (Denmark)

    Hajek, Ann E; Gryganskyi, Andrii; Bittner, Tonya

    2016-01-01

    resting spores, Zoophthora independentia, infecting Tipula (Lunatipula) submaculata in New York State, is now described as a new species and Tarichium porteri, described in 1942, which infects Tipula (Triplicitipula) colei in Tennessee, is transferred to the genus Zoophthora. We have shown that use......Molecular methods were used to determine the generic placement of two species of Entomophthorales known only from resting spores. Historically, these species would belong in the form-genus Tarichium, but this classification provides no information about phylogenetic relationships. Using DNA from...... of molecular methods can assist with determination of the phylogenetic relations of specimens within the form-genus Tarichium for an already described species and a new species for which only resting spores are available....

  11. Phylogenetic Position of Barbus lacerta Heckel, 1843

    Directory of Open Access Journals (Sweden)

    Mustafa Korkmaz

    2015-11-01

    As a result, five clades come out from phylogenetic reconstruction and in phylogenetic tree Barbus lacerta determined to be sister group of Barbus macedonicus, Barbus oligolepis and Barbus plebejus complex.

  12. The transposition distance for phylogenetic trees

    OpenAIRE

    Rossello, Francesc; Valiente, Gabriel

    2006-01-01

    The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...

  13. TreeCluster: Massively scalable transmission clustering using phylogenetic trees

    OpenAIRE

    Moshiri, Alexander

    2018-01-01

    Background: The ability to infer transmission clusters from molecular data is critical to designing and evaluating viral control strategies. Viral sequencing datasets are growing rapidly, but standard methods of transmission cluster inference do not scale well beyond thousands of sequences. Results: I present TreeCluster, a cross-platform tool that performs transmission cluster inference on a given phylogenetic tree orders of magnitude faster than existing inference methods and supports multi...

  14. Phylogenetic footprints in organizational behavior

    OpenAIRE

    Witt, Ulrich; Schwesinger, Georg

    2012-01-01

    An evolutionary tool kit is applied in this paper to explain how innate social behavior traits evolved in early human groups. These traits were adapted to the particular production requirements of the group in human phylogeny. They shaped the group members' attitudes towards contributing to the group's goals and towards other group members. We argue that these attitudes are still present in modern humans and leave their phylogenetic footprints also in present-day organizational life. We discu...

  15. Molecular characterization of organic matter in converted forests in Western Europe; disentangling the effects of edaphic factors and input differences on SOM composition

    Science.gov (United States)

    Brock, Olaf; Kooijman, Annemieke; Vancampenhout, Karen; Muys, Bart; Jansen, Boris

    2017-04-01

    By storing carbon in the soil, forests can play an important role in climate mitigation. We studied how the SOM composition was affected by conversion of deciduous stands to mono-culture spruce plantations in the Mullerthal in Luxembourg and the Gaume in south-east Belgium. Both regions have a known and similar vegetation history on different lithologies, ranging from carcareous marls to decalcified sands. Lignin and cutin/suberin biomarkers were identified by using thermally assisted hydrolysis and methylation (THM) with unlabelled tetra methyl ammonium hydroxide (TMAH). Lignin was used to distinguish deciduous and coniferous litter sources, whereas cutin and suberin indicated the respective input of above- and belowground litter input. A twinplot setup was used to be able to independently evaluate the effect of edaphic factors versus input differences on SOM composition. pH values and SOC stocks reflected the lithological gradients in both study areas. The difference was more subtle in the Gaume where the gradient is much narrower. The existence of pedogenic thresholds explains why significant differences in lignin yield and SOC stocks between plots with different lithology were also found along the subtle gradient in the Gaume. Secondly, we observed differences in molecular composition and also in decomposition state of lignin that were caused solely by input differences between adjacent deciduous and coniferous forest plots. Furthermore, we found a legacy effect, a signal of former deciduous forest in the deeper soil layers (15-20 cm) under the current spruce plantations, in the loamy substrate plots of the Gaume, which was not observed in the Mullerthal, despite the similar vegetation history of both regions. This can be explained by differences in environmental conditions between both areas. Higher pH values resulting in a higher biological activity could explain the absence of a legacy effect in the Mullerthal plots. Therefore, an important conclusion of

  16. Maximum Parsimony on Phylogenetic networks

    Science.gov (United States)

    2012-01-01

    Background Phylogenetic networks are generalizations of phylogenetic trees, that are used to model evolutionary events in various contexts. Several different methods and criteria have been introduced for reconstructing phylogenetic trees. Maximum Parsimony is a character-based approach that infers a phylogenetic tree by minimizing the total number of evolutionary steps required to explain a given set of data assigned on the leaves. Exact solutions for optimizing parsimony scores on phylogenetic trees have been introduced in the past. Results In this paper, we define the parsimony score on networks as the sum of the substitution costs along all the edges of the network; and show that certain well-known algorithms that calculate the optimum parsimony score on trees, such as Sankoff and Fitch algorithms extend naturally for networks, barring conflicting assignments at the reticulate vertices. We provide heuristics for finding the optimum parsimony scores on networks. Our algorithms can be applied for any cost matrix that may contain unequal substitution costs of transforming between different characters along different edges of the network. We analyzed this for experimental data on 10 leaves or fewer with at most 2 reticulations and found that for almost all networks, the bounds returned by the heuristics matched with the exhaustively determined optimum parsimony scores. Conclusion The parsimony score we define here does not directly reflect the cost of the best tree in the network that displays the evolution of the character. However, when searching for the most parsimonious network that describes a collection of characters, it becomes necessary to add additional cost considerations to prefer simpler structures, such as trees over networks. The parsimony score on a network that we describe here takes into account the substitution costs along the additional edges incident on each reticulate vertex, in addition to the substitution costs along the other edges which are

  17. Phylogenetic reconstruction prompts taxonomic changes in Sauropus, Synostemon and Breynia (Phyllanthaceae tribe Phyllantheae)

    NARCIS (Netherlands)

    Welzen, van P.C.; Pruesapan, K.; Telford, I.R.H.; Esser, H.-J.; Bruhl, J.J.

    2014-01-01

    Previous molecular phylogenetic studies indicated expansion of Breynia with inclusion of Sauropus s.str. (excluding Synostemon). The present study adds qualitative and quantitative morphological characters to molecular data to find more resolution and/or higher support for the subgroups within

  18. Transforming phylogenetic networks: Moving beyond tree space.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Wu, Taoyang

    2016-09-07

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Nonbinary Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Jetten, Laura; van Iersel, Leo

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

  20. Functional and phylogenetic ecology in R

    CERN Document Server

    Swenson, Nathan G

    2014-01-01

    Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...

  1. PhyloSift: phylogenetic analysis of genomes and metagenomes.

    Science.gov (United States)

    Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A

    2014-01-01

    Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).

  2. PhyloSift: phylogenetic analysis of genomes and metagenomes

    Directory of Open Access Journals (Sweden)

    Aaron E. Darling

    2014-01-01

    Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.

  3. Phylogenetic mixtures and linear invariants for equal input models.

    Science.gov (United States)

    Casanellas, Marta; Steel, Mike

    2017-04-01

    The reconstruction of phylogenetic trees from molecular sequence data relies on modelling site substitutions by a Markov process, or a mixture of such processes. In general, allowing mixed processes can result in different tree topologies becoming indistinguishable from the data, even for infinitely long sequences. However, when the underlying Markov process supports linear phylogenetic invariants, then provided these are sufficiently informative, the identifiability of the tree topology can be restored. In this paper, we investigate a class of processes that support linear invariants once the stationary distribution is fixed, the 'equal input model'. This model generalizes the 'Felsenstein 1981' model (and thereby the Jukes-Cantor model) from four states to an arbitrary number of states (finite or infinite), and it can also be described by a 'random cluster' process. We describe the structure and dimension of the vector spaces of phylogenetic mixtures and of linear invariants for any fixed phylogenetic tree (and for all trees-the so called 'model invariants'), on any number n of leaves. We also provide a precise description of the space of mixtures and linear invariants for the special case of [Formula: see text] leaves. By combining techniques from discrete random processes and (multi-) linear algebra, our results build on a classic result that was first established by James Lake (Mol Biol Evol 4:167-191, 1987).

  4. Taenia solium in Europe

    DEFF Research Database (Denmark)

    Devleesschauwer, Brecht; Allepuz, Alberto; Dermauw, Veronique

    2017-01-01

    is known about the true endemicity status of T. solium throughout Europe. Three recent reviews indicate that autochthonous human T. solium taeniasis/cysticercosis may be possible in Europe, but that current peer-reviewed literature is biased towards Western Europe. Officially reported data on porcine...

  5. Phylogenetic analysis of G1P[8] and G12P[8] rotavirus A samples obtained in the pre- and post-vaccine periods, and molecular modeling of VP4 and VP7 proteins.

    Science.gov (United States)

    Almeida, Tâmera Nunes Vieira; de Sousa, Teresinha Teixeira; da Silva, Roosevelt Alves; Fiaccadori, Fabíola Souza; Souza, Menira; Badr, Kareem Rady; de Paula Cardoso, Divina das Dôres

    2017-09-01

    Reduction in morbimortality rates for acute gastroenteritis (AGE) by Rotavirus A (RVA) has been observed after the introduction of vaccines, however the agent continues to circulate. The present study described the genomic characterization of the 11 dsRNA segments of two RVA samples G1P[8] obtained in the pre- and post-vaccination periods and one of G12P[8] sample (post-vaccine), compared to Rotarix™ vaccine. Analysis by molecular sequencing of the samples showed that the three samples belonged to genogroup I. In addition, the analysis of VP7 gene revealed that the samples G1 (pre-vaccine), G1 (post-vaccine) and G12 were characterized as lineages II, I and III, respectively. Regarding to VP4 and NSP4 gene it was observed that all samples belonged to lineage III, whereas for VP6 gene, the sample of the pre- and post-vaccine belonged to the lineage IV and I, respectively. Considering the VP7 gene, it was observed high nucleotide and amino acid identity for the two G1 samples when compared to Rotarix™ vaccine and lesser identity for the G12 sample. In relation to antigenic epitope of VP7 greater modifications were observed for the G12 sample in the 7-2 epitope that was confirmed by molecular modeling. On the other hand, for VP4, some changes in the 8-1 and 8-3 antigenic epitopes was observed for the three samples. This data could be interpreted as a low selective pressure exerted by vaccination in relation to G1P[8] samples and lesser protection in relation to G12P[8]. Thus, the continuous monitoring of RVA circulating samples remains important. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Phylogenetic trees and Euclidean embeddings.

    Science.gov (United States)

    Layer, Mark; Rhodes, John A

    2017-01-01

    It was recently observed by de Vienne et al. (Syst Biol 60(6):826-832, 2011) that a simple square root transformation of distances between taxa on a phylogenetic tree allowed for an embedding of the taxa into Euclidean space. While the justification for this was based on a diffusion model of continuous character evolution along the tree, here we give a direct and elementary explanation for it that provides substantial additional insight. We use this embedding to reinterpret the differences between the NJ and BIONJ tree building algorithms, providing one illustration of how this embedding reflects tree structures in data.

  7. Disentangling Peronospora on Papaver: Phylogenetics, Taxonomy, Nomenclature and Host Range of Downy Mildew of Opium Poppy (Papaver somniferum) and Related Species

    Science.gov (United States)

    Voglmayr, Hermann; Montes-Borrego, Miguel; Landa, Blanca B.

    2014-01-01

    Based on sequence data from ITS rDNA, cox1 and cox2, six Peronospora species are recognised as phylogenetically distinct on various Papaver species. The host ranges of the four already described species P. arborescens, P. argemones, P. cristata and P. meconopsidis are clarified. Based on sequence data and morphology, two new species, P. apula and P. somniferi, are described from Papaver apulum and P. somniferum, respectively. The second Peronospora species parasitizing Papaver somniferum, that was only recently recorded as Peronospora cristata from Tasmania, is shown to represent a distinct taxon, P. meconopsidis, originally described from Meconopsis cambrica. It is shown that P. meconopsidis on Papaver somniferum is also present and widespread in Europe and Asia, but has been overlooked due to confusion with P. somniferi and due to less prominent, localized disease symptoms. Oospores are reported for the first time for P. meconopsidis from Asian collections on Papaver somniferum. Morphological descriptions, illustrations and a key are provided for all described Peronospora species on Papaver. cox1 and cox2 sequence data are confirmed as equally good barcoding loci for reliable Peronospora species identification, whereas ITS rDNA does sometimes not resolve species boundaries. Molecular phylogenetic data reveal high host specificity of Peronospora on Papaver, which has the important phytopathological implication that wild Papaver spp. cannot play any role as primary inoculum source for downy mildew epidemics in cultivated opium poppy crops. PMID:24806292

  8. Phylogenetic Conservatism in Plant Phenology

    Science.gov (United States)

    Davies, T. Jonathan; Wolkovich, Elizabeth M.; Kraft, Nathan J. B.; Salamin, Nicolas; Allen, Jenica M.; Ault, Toby R.; Betancourt, Julio L.; Bolmgren, Kjell; Cleland, Elsa E.; Cook, Benjamin I.; hide

    2013-01-01

    Phenological events defined points in the life cycle of a plant or animal have been regarded as highly plastic traits, reflecting flexible responses to various environmental cues. The ability of a species to track, via shifts in phenological events, the abiotic environment through time might dictate its vulnerability to future climate change. Understanding the predictors and drivers of phenological change is therefore critical. Here, we evaluated evidence for phylogenetic conservatism the tendency for closely related species to share similar ecological and biological attributes in phenological traits across flowering plants. We aggregated published and unpublished data on timing of first flower and first leaf, encompassing 4000 species at 23 sites across the Northern Hemisphere. We reconstructed the phylogeny for the set of included species, first, using the software program Phylomatic, and second, from DNA data. We then quantified phylogenetic conservatism in plant phenology within and across sites. We show that more closely related species tend to flower and leaf at similar times. By contrasting mean flowering times within and across sites, however, we illustrate that it is not the time of year that is conserved, but rather the phenological responses to a common set of abiotic cues. Our findings suggest that species cannot be treated as statistically independent when modelling phenological responses.Closely related species tend to resemble each other in the timing of their life-history events, a likely product of evolutionarily conserved responses to environmental cues. The search for the underlying drivers of phenology must therefore account for species' shared evolutionary histories.

  9. Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

    Science.gov (United States)

    Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

    2013-01-01

    The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

  10. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.

  11. Nonbinary tree-based phylogenetic networks

    OpenAIRE

    Jetten, Laura; van Iersel, Leo

    2016-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and st...

  12. Improved Maximum Parsimony Models for Phylogenetic Networks.

    Science.gov (United States)

    Van Iersel, Leo; Jones, Mark; Scornavacca, Celine

    2018-05-01

    Phylogenetic networks are well suited to represent evolutionary histories comprising reticulate evolution. Several methods aiming at reconstructing explicit phylogenetic networks have been developed in the last two decades. In this article, we propose a new definition of maximum parsimony for phylogenetic networks that permits to model biological scenarios that cannot be modeled by the definitions currently present in the literature (namely, the "hardwired" and "softwired" parsimony). Building on this new definition, we provide several algorithmic results that lay the foundations for new parsimony-based methods for phylogenetic network reconstruction.

  13. Nuclear power in Europe

    International Nuclear Information System (INIS)

    Perera, J.

    2000-01-01

    Currently nuclear power accounts for more than 25% of total electricity production in Europe (including Eastern Europe and the former Soviet Union) However, significant new construction is planned in Central and Eastern Europe only, apart from some in France and, possibly in Finland. Many countries in Western Europe have put nuclear construction plans on hold and several have cancelled their nuclear programs. This report looks at the history of nuclear power and its current status in both Eastern and Western Europe. It provides an outline of nuclear fuel cycle facilities, from uranium procurement to final waste disposal. Economic and environmental issues are discussed, as well as the prospect of increased East-West trade and cooperation in the new poso-cold war world. Detailed profiles are provided of all the countries in Western Europe with significant nuclear power programs, as well as profiles of major energy and nuclear companies

  14. Heat Roadmap Europe

    DEFF Research Database (Denmark)

    Connolly, David; Mathiesen, Brian Vad; Lund, Henrik

    2015-01-01

    This document is a summary of the key technical inputs for the modelling of the heat strategy for Europe outlined in the latest Heat Roadmap Europe studies [1, 2]. These studies quantify the impact of alternative heating strategies for Europe in 2030 and 2050. The study is based on geographical...... information systems (GIS) and energy system analyses. In this report, the inputs for other modelling tools such as PRIMES are presented, in order to enable other researches to generate similar heating scenarios for Europe. Although Heat Roadmap Europe presents a complete heat strategy for Europe, which...... includes energy efficiency, individual heating units (such as boilers and heat pumps), and heat networks, the recommendations here are primarily relating to the potential and modelling of district heating. Although other solutions will play a significant role in decarbonising the heating and cooling sector...

  15. Europe representations in textbooks

    OpenAIRE

    Brennetot , Arnaud

    2011-01-01

    This EuroBroadMap working paper presents an analysis of textbooks dealing with the representations of Europe and European Union. In most of these textbooks from secondary school, the teaching of the geography of Europe precedes the evocation of the EU. Europe is often depicted as a given object, reduced to a number of structural aspects (relief, climate, demography, traditional cultures, economic activities, etc.) whose only common point is their location within conventional boundaries. Such ...

  16. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales

    OpenAIRE

    Purschke, Oliver; Michalski, Stefan G.; Bruelheide, Helge; Durka, Walter

    2017-01-01

    Abstract Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic ...

  17. New approaches to phylogenetic tree search and their application to large numbers of protein alignments.

    Science.gov (United States)

    Whelan, Simon

    2007-10-01

    Phylogenetic tree estimation plays a critical role in a wide variety of molecular studies, including molecular systematics, phylogenetics, and comparative genomics. Finding the optimal tree relating a set of sequences using score-based (optimality criterion) methods, such as maximum likelihood and maximum parsimony, may require all possible trees to be considered, which is not feasible even for modest numbers of sequences. In practice, trees are estimated using heuristics that represent a trade-off between topological accuracy and speed. I present a series of novel algorithms suitable for score-based phylogenetic tree reconstruction that demonstrably improve the accuracy of tree estimates while maintaining high computational speeds. The heuristics function by allowing the efficient exploration of large numbers of trees through novel hill-climbing and resampling strategies. These heuristics, and other computational approximations, are implemented for maximum likelihood estimation of trees in the program Leaphy, and its performance is compared to other popular phylogenetic programs. Trees are estimated from 4059 different protein alignments using a selection of phylogenetic programs and the likelihoods of the tree estimates are compared. Trees estimated using Leaphy are found to have equal to or better likelihoods than trees estimated using other phylogenetic programs in 4004 (98.6%) families and provide a unique best tree that no other program found in 1102 (27.1%) families. The improvement is particularly marked for larger families (80 to 100 sequences), where Leaphy finds a unique best tree in 81.7% of families.

  18. West Europe Report

    National Research Council Canada - National Science Library

    1986-01-01

    .... This report from Western Europe, Austria, Finland, Greece, Norway, Portugal, Sweden, Turkey, Greenland, Netherlands, Federal Republic of Germany, France and Italy, contains articles on Politics...

  19. West Europe Report

    National Research Council Canada - National Science Library

    1987-01-01

    .... This document contains articles about Western Europe. Some topics discussed are socialism, political parties, international relations, foreign policy, sociology, consumerism, economics, military operations, commerce, industries, energy, trade, private...

  20. JPRS Report, East Europe

    National Research Council Canada - National Science Library

    1988-01-01

    Partial Contents: East Europe, Party Activities, Socialist Party, Freedom Fighters, Education, Youth Training, Historian, Death Penalty, Peace Making Duties, Socialism, Communism, Economics, Restructuring...

  1. Creationism in Europe

    DEFF Research Database (Denmark)

    For decades, the creationist movement was primarily situated in the United States. Then, in the 1970s, American creationists found their ideas welcomed abroad, first in Australia and New Zealand, then in Korea, India, South Africa, Brazil, and elsewhere—including Europe, where creationism plays...... the teaching of creationism as a scientific discipline on an equal footing with the theory of evolution." Creationism in Europe offers a discerning introduction to the cultural history of modern Europe, the variety of worldviews in Europe, and the interplay of science and religion in a global context...

  2. JPRS Report, East Europe

    National Research Council Canada - National Science Library

    1991-01-01

    Partial Contents: Eastern Europe, Interior's agreement, Political Health, Refugee, WOrking People, Saving Banks, Radio Telephones, Budget Draft, Reduced Inflation Rate, New Land, Land Management, Real Estate Laws...

  3. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  4. Nonbinary Tree-Based Phylogenetic Networks

    NARCIS (Netherlands)

    Jetten, L.; van Iersel, L.J.J.

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example

  5. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  6. Characterization of Escherichia coli Phylogenetic Groups ...

    African Journals Online (AJOL)

    Background: Escherichia coli strains mainly fall into four phylogenetic groups (A, B1, B2, and D) and that virulent extra‑intestinal strains mainly belong to groups B2 and D. Aim: The aim was to determine the association between phylogenetic groups of E. coli causing extraintestinal infections (ExPEC) regarding the site of ...

  7. The phylogenetic relationships among infraorders and superfamilies of Diptera based on morphological evidence

    DEFF Research Database (Denmark)

    Lambkin, Christine L.; Sinclair, Bradley J.; Pape, Thomas

    2013-01-01

    Members of the megadiverse insect order Diptera (flies) have successfully colonized all continents and nearly all habitats. There are more than 154 000 described fly species, representing 1012% of animal species. Elucidating the phylogenetic relationships of such a large component of global...... biodiversity is challenging, but significant advances have been made in the last few decades. Since Hennig first discussed the monophyly of major groupings, Diptera has attracted much study, but most researchers have used non-numerical qualitative methods to assess morphological data. More recently......, quantitative phylogenetic methods have been used on both morphological and molecular data. All previous quantitative morphological studies addressed narrower phylogenetic problems, often below the suborder or infraorder level. Here we present the first numerical analysis of phylogenetic relationships...

  8. Aspergillus niger contains the cryptic phylogenetic species A. awamori.

    Science.gov (United States)

    Perrone, Giancarlo; Stea, Gaetano; Epifani, Filomena; Varga, János; Frisvad, Jens C; Samson, Robert A

    2011-11-01

    Aspergillus section Nigri is an important group of species for food and medical mycology, and biotechnology. The Aspergillus niger 'aggregate' represents its most complicated taxonomic subgroup containing eight morphologically indistinguishable taxa: A. niger, Aspergillus tubingensis, Aspergillus acidus, Aspergillus brasiliensis, Aspergillus costaricaensis, Aspergillus lacticoffeatus, Aspergillus piperis, and Aspergillus vadensis. Aspergillus awamori, first described by Nakazawa, has been compared taxonomically with other black aspergilli and recently it has been treated as a synonym of A. niger. Phylogenetic analyses of sequences generated from portions of three genes coding for the proteins β-tubulin (benA), calmodulin (CaM), and the translation elongation factor-1 alpha (TEF-1α) of a population of A. niger strains isolated from grapes in Europe revealed the presence of a cryptic phylogenetic species within this population, A. awamori. Morphological, physiological, ecological and chemical data overlap occurred between A. niger and the cryptic A. awamori, however the splitting of these two species was also supported by AFLP analysis of the full genome. Isolates in both phylospecies can produce the mycotoxins ochratoxin A and fumonisin B₂, and they also share the production of pyranonigrin A, tensidol B, funalenone, malformins, and naphtho-γ-pyrones. In addition, sequence analysis of four putative A. awamori strains from Japan, used in the koji industrial fermentation, revealed that none of these strains belong to the A. awamori phylospecies. Copyright © 2011 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  9. A Genome-Scale Investigation of How Sequence, Function, and Tree-Based Gene Properties Influence Phylogenetic Inference.

    Science.gov (United States)

    Shen, Xing-Xing; Salichos, Leonidas; Rokas, Antonis

    2016-09-02

    Molecular phylogenetic inference is inherently dependent on choices in both methodology and data. Many insightful studies have shown how choices in methodology, such as the model of sequence evolution or optimality criterion used, can strongly influence inference. In contrast, much less is known about the impact of choices in the properties of the data, typically genes, on phylogenetic inference. We investigated the relationships between 52 gene properties (24 sequence-based, 19 function-based, and 9 tree-based) with each other and with three measures of phylogenetic signal in two assembled data sets of 2,832 yeast and 2,002 mammalian genes. We found that most gene properties, such as evolutionary rate (measured through the percent average of pairwise identity across taxa) and total tree length, were highly correlated with each other. Similarly, several gene properties, such as gene alignment length, Guanine-Cytosine content, and the proportion of tree distance on internal branches divided by relative composition variability (treeness/RCV), were strongly correlated with phylogenetic signal. Analysis of partial correlations between gene properties and phylogenetic signal in which gene evolutionary rate and alignment length were simultaneously controlled, showed similar patterns of correlations, albeit weaker in strength. Examination of the relative importance of each gene property on phylogenetic signal identified gene alignment length, alongside with number of parsimony-informative sites and variable sites, as the most important predictors. Interestingly, the subsets of gene properties that optimally predicted phylogenetic signal differed considerably across our three phylogenetic measures and two data sets; however, gene alignment length and RCV were consistently included as predictors of all three phylogenetic measures in both yeasts and mammals. These results suggest that a handful of sequence-based gene properties are reliable predictors of phylogenetic signal

  10. An attempt to reconstruct phylogenetic relationships within Caribbean nummulitids: simulating relationships and tracing character evolution

    Science.gov (United States)

    Eder, Wolfgang; Ives Torres-Silva, Ana; Hohenegger, Johann

    2017-04-01

    Phylogenetic analysis and trees based on molecular data are broadly applied and used to infer genetical and biogeographic relationship in recent larger foraminifera. Molecular phylogenetic is intensively used within recent nummulitids, however for fossil representatives these trees are only of minor informational value. Hence, within paleontological studies a phylogenetic approach through morphometric analysis is of much higher value. To tackle phylogenetic relationships within the nummulitid family, a much higher number of morphological character must be measured than are commonly used in biometric studies, where mostly parameters describing embryonic size (e.g., proloculus diameter, deuteroloculus diameter) and/or the marginal spiral (e.g., spiral diagrams, spiral indices) are studied. For this purpose 11 growth-independent and/or growth-invariant characters have been used to describe the morphological variability of equatorial thin sections of seven Carribbean nummulitid taxa (Nummulites striatoreticulatus, N. macgillavry, Palaeonummulites willcoxi, P.floridensis, P. soldadensis, P.trinitatensis and P.ocalanus) and one outgroup taxon (Ranikothalia bermudezi). Using these characters, phylogenetic trees were calculated using a restricted maximum likelihood algorithm (REML), and results are cross-checked by ordination and cluster analysis. Square-change parsimony method has been run to reconstruct ancestral states, as well as to simulate the evolution of the chosen characters along the calculated phylogenetic tree and, independent - contrast analysis was used to estimate confidence intervals. Based on these simulations, phylogenetic tendencies of certain characters proposed for nummulitids (e.g., Cope's rule or nepionic acceleration) can be tested, whether these tendencies are valid for the whole family or only for certain clades. At least, within the Carribean nummulitids, phylogenetic trends along some growth-independent characters of the embryo (e.g., first

  11. Phylogeographic history of grey wolves in Europe

    Directory of Open Access Journals (Sweden)

    Dykyy Ihor

    2010-04-01

    Full Text Available Abstract Background While it is generally accepted that patterns of intra-specific genetic differentiation are substantially affected by glacial history, population genetic processes occurring during Pleistocene glaciations are still poorly understood. In this study, we address the question of the genetic consequences of Pleistocene glaciations for European grey wolves. Combining our data with data from published studies, we analysed phylogenetic relationships and geographic distribution of mitochondrial DNA haplotypes for 947 contemporary European wolves. We also compared the contemporary wolf sequences with published sequences of 24 ancient European wolves. Results We found that haplotypes representing two haplogroups, 1 and 2, overlap geographically, but substantially differ in frequency between populations from south-western and eastern Europe. A comparison between haplotypes from Europe and other continents showed that both haplogroups are spread throughout Eurasia, while only haplogroup 1 occurs in contemporary North American wolves. All ancient wolf samples from western Europe that dated from between 44,000 and 1,200 years B.P. belonged to haplogroup 2, suggesting the long-term predominance of this haplogroup in this region. Moreover, a comparison of current and past frequencies and distributions of the two haplogroups in Europe suggested that haplogroup 2 became outnumbered by haplogroup 1 during the last several thousand years. Conclusions Parallel haplogroup replacement, with haplogroup 2 being totally replaced by haplogroup 1, has been reported for North American grey wolves. Taking into account the similarity of diets reported for the late Pleistocene wolves from Europe and North America, the correspondence between these haplogroup frequency changes may suggest that they were associated with ecological changes occurring after the Last Glacial Maximum.

  12. Detection of Horizontal Gene Transfers from Phylogenetic Comparisons

    Science.gov (United States)

    Pylro, Victor Satler; Vespoli, Luciano de Souza; Duarte, Gabriela Frois; Yotoko, Karla Suemy Clemente

    2012-01-01

    Bacterial phylogenies have become one of the most important challenges for microbial ecology. This field started in the mid-1970s with the aim of using the sequence of the small subunit ribosomal RNA (16S) tool to infer bacterial phylogenies. Phylogenetic hypotheses based on other sequences usually give conflicting topologies that reveal different evolutionary histories, which in some cases may be the result of horizontal gene transfer events. Currently, one of the major goals of molecular biology is to understand the role that horizontal gene transfer plays in species adaptation and evolution. In this work, we compared the phylogenetic tree based on 16S with the tree based on dszC, a gene involved in the cleavage of carbon-sulfur bonds. Bacteria of several genera perform this survival task when living in environments lacking free mineral sulfur. The biochemical pathway of the desulphurization process was extensively studied due to its economic importance, since this step is expensive and indispensable in fuel production. Our results clearly show that horizontal gene transfer events could be detected using common phylogenetic methods with gene sequences obtained from public sequence databases. PMID:22675653

  13. Phylogenetic signal dissection identifies the root of starfishes.

    Directory of Open Access Journals (Sweden)

    Roberto Feuda

    Full Text Available Relationships within the class Asteroidea have remained controversial for almost 100 years and, despite many attempts to resolve this problem using molecular data, no consensus has yet emerged. Using two nuclear genes and a taxon sampling covering the major asteroid clades we show that non-phylogenetic signal created by three factors--Long Branch Attraction, compositional heterogeneity and the use of poorly fitting models of evolution--have confounded accurate estimation of phylogenetic relationships. To overcome the effect of this non-phylogenetic signal we analyse the data using non-homogeneous models, site stripping and the creation of subpartitions aimed to reduce or amplify the systematic error, and calculate Bayes Factor support for a selection of previously suggested topological arrangements of asteroid orders. We show that most of the previous alternative hypotheses are not supported in the most reliable data partitions, including the previously suggested placement of either Forcipulatida or Paxillosida as sister group to the other major branches. The best-supported solution places Velatida as the sister group to other asteroids, and the implications of this finding for the morphological evolution of asteroids are presented.

  14. Supranational Cooperation in Europe

    NARCIS (Netherlands)

    de Deugd, Nienke; Stamm, Katharina; Westerman, Wim

    The sovereign debt crisis and the euro crisis have prompted heads of state and government in Europe to intensify supranational cooperation. However, some political leaders and policy makers aim for more. They propose the introduction of a common European economic government that would prevent Europe

  15. Sustainable growth in Europe

    International Nuclear Information System (INIS)

    Andreini, P.

    1993-01-01

    The measures till now adopted did not stop environmental deterioration in Europe and the growth of economic activities in the future will make the situation more and more heavy. The European Communities (EEC) Cabinet launched a long term program for a sustainable growth in Europe, which could conciliate economic needs with environmental protection. This paper presents the first part of the program

  16. Islam in Europe

    DEFF Research Database (Denmark)

    Nielsen, Jørgen Schøler

    2008-01-01

    A discussion of various approaches to Islam and Muslims in Europe in seven books published in the USA and the UK between 2005 and 2007.......A discussion of various approaches to Islam and Muslims in Europe in seven books published in the USA and the UK between 2005 and 2007....

  17. Small States in Europe

    DEFF Research Database (Denmark)

    This book offers an accessible, coherent and informative analysis of contemporary and future foreign policy challenges facing small states in Europe.......This book offers an accessible, coherent and informative analysis of contemporary and future foreign policy challenges facing small states in Europe....

  18. Imams in Western Europe

    DEFF Research Database (Denmark)

    As European Muslims and Muslims in the Middle East diverge, imams in Europe have emerged as major agents of religious authority who shape Islam’s presence in Western societies. This volume examines the theoretical and practical questions concerning the evolving role of imams in Europe. To what...

  19. The new Europe

    International Nuclear Information System (INIS)

    Richardson, J.

    1991-01-01

    This article examines the opportunities for business growth in an area of changing social, economic and political climate. The topics include existing political and economic ties, how these ties are evolving, comparisons between east and west, pollution and environmental issues, battery markets in eastern Europe, motive power, standby power, the transition of eastern europe to a market economy, and opportunities for the west

  20. Evidence of two distinct phylogenetic lineages of dog rabies virus circulating in Cambodia.

    Science.gov (United States)

    Mey, Channa; Metlin, Artem; Duong, Veasna; Ong, Sivuth; In, Sotheary; Horwood, Paul F; Reynes, Jean-Marc; Bourhy, Hervé; Tarantola, Arnaud; Buchy, Philippe

    2016-03-01

    This first extensive retrospective study of the molecular epidemiology of dog rabies in Cambodia included 149 rabies virus (RABV) entire nucleoprotein sequences obtained from 1998-2011. The sequences were analyzed in conjunction with RABVs from other Asian countries. Phylogenetic reconstruction confirmed the South-East Asian phylogenetic clade comprising viruses from Cambodia, Vietnam, Thailand, Laos and Myanmar. The present study represents the first attempt to classify the phylogenetic lineages inside this clade, resulting in the confirmation that all the Cambodian viruses belonged to the South-East Asian (SEA) clade. Three distinct phylogenetic lineages in the region were established with the majority of viruses from Cambodia closely related to viruses from Thailand, Laos and Vietnam, forming the geographically widespread phylogenetic lineage SEA1. A South-East Asian lineage SEA2 comprised two viruses from Cambodia was identified, which shared a common ancestor with RABVs originating from Laos. Viruses from Myanmar formed separate phylogenetic lineages within the major SEA clade. Bayesian molecular clock analysis suggested that the time to most recent common ancestor (TMRCA) of all Cambodian RABVs dated to around 1950. The TMRCA of the Cambodian SEA1 lineage was around 1964 and that of the SEA2 lineage was around 1953. The results identified three phylogenetically distinct and geographically separated lineages inside the earlier identified major SEA clade, covering at least five countries in the region. A greater understanding of the molecular epidemiology of rabies in South-East Asia is an important step to monitor progress on the efforts to control canine rabies in the region. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. West Nile virus outbreak in Israel in 2015: phylogenetic and geographic characterization in humans and mosquitoes.

    Science.gov (United States)

    Lustig, Y; Kaufman, Z; Mannasse, B; Koren, R; Katz-Likvornik, S; Orshan, L; Glatman-Freedman, A; Mendelson, E

    2017-12-01

    West Nile Virus (WNV) is endemic in Israel and was responsible for several outbreaks in the past 16 years. The aim of the present study was to investigate the spatial distribution of WNV acute infections from an outbreak that occurred in 2015 in Israel and report the molecular and geographic characterization of WNV isolates from human cases and mosquito pools obtained during this outbreak. Using a geographical layer comprising 51 continuous areas of Israel, the number of WNV infection cases per 100 000 people in each area and the locations of WNV-infected mosquitoes in 2015 were analysed. Sequencing and phylogenetic analyses followed by geographic localization were performed on 13 WNV human isolates and 19 WNV-infected mosquito pools. Substantial geographical variation in the prevalence of acute WNV in patients in Israel was found and an overall correlation with WNV-infected mosquitoes. All human patients sequenced were infected only with the Mediterranean subtype of WNV Lineage 1 and resided primarily in the coastal regions in central Israel. In contrast, mosquitoes were infected with both the Mediterranean and Eastern European subtypes of WNV lineage 1; however, only the Mediterranean subtype was found in mosquitoes from the coastal region in central Israel. These results demonstrate differential geographic dispersion in Israel of the two WNV subtypes and may also point to a differential pattern of human infections. As a geographical bridge between Europe, Asia and Africa, analysis of WNV circulation in humans and mosquitoes in Israel provides information relevant to WNV infections in Eurasia. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  2. A phylogenetic delimitation of the "Sphagnum subsecundum complex" (Sphagnaceae, Bryophyta).

    Science.gov (United States)

    Shaw, A Jonathan; Boles, Sandra; Shaw, Blanka

    2008-06-01

    A seemingly obvious but sometimes overlooked premise of any evolutionary analysis is delineating the group of taxa under study. This is especially problematic in some bryophyte groups because of morphological simplicity and convergence. This research applies information from nucleotide sequences for eight plastid and nuclear loci to delineate a group of northern hemisphere peat moss species, the so-called Sphagnum subsecundum complex, which includes species known to be gametophytically haploid or diploid (i.e., sporophytically diploid-tetraploid). Despite the fact that S. subsecundum and several species in the complex have been attributed disjunct ranges that include all major continents, phylogenetic analyses suggest that the group is actually restricted to Europe and eastern North America. Plants from western North America, from California to Alaska, which are morphologically similar to species of the S. subsecundum complex in eastern N. America and Europe, actually belong to a different deep clade within Sphagnum section Subsecunda. One species often considered part of the S. subsecundum complex, S. contortum, likely has a reticulate history involving species in the two deepest clades within section Subsecunda. Nucleotide sequences have a strong geographic structure across the section Subsecunda, but shallow tip clades suggest repeated long-distance dispersal in the section as well.

  3. Characterization of photoautotrophic picoplankton assemblages in turbid, alkaline lakes of the Carpathian Basin (Central Europe

    Directory of Open Access Journals (Sweden)

    Lajos VÖRÖS

    2009-08-01

    Full Text Available The photoautotrophic picoplankton (PPP of ten shallow, hyposaline soda lakes located in three different geographical regions in the Carpathian Basin (Central Europe was characterized. These lakes, which frequently dry out completely, are extremely rich in PPP. Epifluorescence microscopy was applied to determine picocyanobacterial and picoeukaryotic cell abundance and PCR-based molecular techniques (denaturing gradient gel electrophoresis and cloning with phylospecies delineation to identify the members of PPP. Most of these lakes were eu- and hypertrophic with varying contribution of picocyanobacteria to the total PPP cell number. We found an unusually high PPP abundance with peaks of 8.16 × 106 cells mL-1 for picoeukaryotes and 1.78 × 107 cells mL-1 for picocyanobacteria. The majority of the retrieved PPP sequences belonged to picocyanobacteria (nonmarine Synechococcus/ Cyanobium, while others showed similarity to eukaryotic algal plastids (close to Trebouxiophycean isolates. Molecular analysis revealed significant genetic diversity in the PPP fraction of these lakes and showed that the closest relatives of our picocyanobacterial clones were recovered from different habitats, indicating seemingly no correlation between the 'saline' ecotypes and their phylogenetic position. Our results also confirmed that PPP might exploit different aquatic ecosystems and be successful even in the case of abrupt changes of environmental parameters (in our case, salinity. According to our knowledge, this is the first survey focusing on the identification of the PPP community members in turbid and alkaline lakes with extraordinarily high picoplankton productivity.

  4. Bias in phylogenetic reconstruction of vertebrate rhodopsin sequences.

    Science.gov (United States)

    Chang, B S; Campbell, D L

    2000-08-01

    Two spurious nodes were found in phylogenetic analyses of vertebrate rhodopsin sequences in comparison with well-established vertebrate relationships. These spurious reconstructions were well supported in bootstrap analyses and occurred independently of the method of phylogenetic analysis used (parsimony, distance, or likelihood). Use of this data set of vertebrate rhodopsin sequences allowed us to exploit established vertebrate relationships, as well as the considerable amount known about the molecular evolution of this gene, in order to identify important factors contributing to the spurious reconstructions. Simulation studies using parametric bootstrapping indicate that it is unlikely that the spurious nodes in the parsimony analyses are due to long branches or other topological effects. Rather, they appear to be due to base compositional bias at third positions, codon bias, and convergent evolution at nucleotide positions encoding the hydrophobic residues isoleucine, leucine, and valine. LogDet distance methods, as well as maximum-likelihood methods which allow for nonstationary changes in base composition, reduce but do not entirely eliminate support for the spurious resolutions. Inclusion of five additional rhodopsin sequences in the phylogenetic analyses largely corrected one of the spurious reconstructions while leaving the other unaffected. The additional sequences not only were more proximal to the corrected node, but were also found to have intermediate levels of base composition and codon bias as compared with neighboring sequences on the tree. This study shows that the spurious reconstructions can be corrected either by excluding third positions, as well as those encoding the amino acids Ile, Val, and Leu (which may not be ideal, as these sites can contain useful phylogenetic signal for other parts of the tree), or by the addition of sequences that reduce problems associated with convergent evolution.

  5. Make Your Own Phylogenetic Tree

    Science.gov (United States)

    Rau, Gerald

    2012-01-01

    Molecular similarity is one of the strongest lines of evidence for evolution--and one of the most difficult for students to grasp. That is because the underlying observations--that identical mutations are found in closely related species and the degree of similarity decreases with evolutionary distance--are not visible to the human eye. And it's…

  6. The space of ultrametric phylogenetic trees.

    Science.gov (United States)

    Gavryushkin, Alex; Drummond, Alexei J

    2016-08-21

    The reliability of a phylogenetic inference method from genomic sequence data is ensured by its statistical consistency. Bayesian inference methods produce a sample of phylogenetic trees from the posterior distribution given sequence data. Hence the question of statistical consistency of such methods is equivalent to the consistency of the summary of the sample. More generally, statistical consistency is ensured by the tree space used to analyse the sample. In this paper, we consider two standard parameterisations of phylogenetic time-trees used in evolutionary models: inter-coalescent interval lengths and absolute times of divergence events. For each of these parameterisations we introduce a natural metric space on ultrametric phylogenetic trees. We compare the introduced spaces with existing models of tree space and formulate several formal requirements that a metric space on phylogenetic trees must possess in order to be a satisfactory space for statistical analysis, and justify them. We show that only a few known constructions of the space of phylogenetic trees satisfy these requirements. However, our results suggest that these basic requirements are not enough to distinguish between the two metric spaces we introduce and that the choice between metric spaces requires additional properties to be considered. Particularly, that the summary tree minimising the square distance to the trees from the sample might be different for different parameterisations. This suggests that further fundamental insight is needed into the problem of statistical consistency of phylogenetic inference methods. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Molecular diversity and phylogenetic relationships of the gastropod ...

    African Journals Online (AJOL)

    The freshwater snails belonging to the genus Melanoides Olivier, 1804 are widespread across tropical regions of the world and endemic species have evolved in the African Lakes Malawi, Mweru and Tanganyika. The endemic Melanoides species of Lake Malawi have been investigated several times during the last century ...

  8. Molecular study and phylogenetic analysis of Mycoplasma synoviae ...

    African Journals Online (AJOL)

    Mycoplasma synoviae (MS) is one of the important pathogens in chicken and turkey which cause great economic losses in poultry industry. M. synoviae has one serotype but there is heterogeneity among MS strains. The aim of this study was to analyze the DNA sequence of Mycoplasma synoviae isolates from Mazandran ...

  9. Molecular phylogenetic implications in Brassica napus based on ...

    Indian Academy of Sciences (India)

    important oil crops in many countries (Abdelmigid 2012;. Fayyaz et al. 2014), and ... 2008). DNA markers have essential role in the reconstruction of evolutionary rela- ... Genomic DNA was extracted from fresh leaves using. Gene JET Plant ...

  10. Molecular study and phylogenetic analysis of Mycoplasma synoviae ...

    African Journals Online (AJOL)

    Dr.Hosseini

    2012-01-26

    Jan 26, 2012 ... 4Clinical Sciences Department, Faculty of Veterinary Science, University of Tehran, Iran. .... France) in 2% agarose (Agarose MP, Roche) gel in TAE buffer. ... were performed with sequencing project management and.

  11. On Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Zhang, Louxin

    2016-07-01

    A large class of phylogenetic networks can be obtained from trees by the addition of horizontal edges between the tree edges. These networks are called tree-based networks. We present a simple necessary and sufficient condition for tree-based networks and prove that a universal tree-based network exists for any number of taxa that contains as its base every phylogenetic tree on the same set of taxa. This answers two problems posted by Francis and Steel recently. A byproduct is a computer program for generating random binary phylogenetic networks under the uniform distribution model.

  12. Building Phylogenetic Trees from DNA Sequence Data: Investigating Polar Bear and Giant Panda Ancestry.

    Science.gov (United States)

    Maier, Caroline Alexandra

    2001-01-01

    Presents an activity in which students seek answers to questions about evolutionary relationships by using genetic databases and bioinformatics software. Students build genetic distance matrices and phylogenetic trees based on molecular sequence data using web-based resources. Provides a flowchart of steps involved in accessing, retrieving, and…

  13. World review: Europe

    International Nuclear Information System (INIS)

    Anon.

    2000-01-01

    The article gives information on contracts announced (and to whom) and recently completed in some parts of Europe in the petroleum, natural gas and petrochemicals industries. Countries specifically mentioned are Belgium, Czech Republic, France, the former Soviet Union, Germany, Greece, Hungary, Ireland, Italy, Netherlands, Russia, Slovakia, Spain, Sweden and the United Kingdom. It is suggested that in E. Europe, the demand for gas could triple by 2020, in S. Europe the market for gas will double in the next ten years and the Mediterranean will continue to be a developing global refinery into the 21st century

  14. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  15. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  16. Phylogenetic structure in tropical hummingbird communities

    DEFF Research Database (Denmark)

    Graham, Catherine H; Parra, Juan L; Rahbek, Carsten

    2009-01-01

    How biotic interactions, current and historical environment, and biogeographic barriers determine community structure is a fundamental question in ecology and evolution, especially in diverse tropical regions. To evaluate patterns of local and regional diversity, we quantified the phylogenetic...... composition of 189 hummingbird communities in Ecuador. We assessed how species and phylogenetic composition changed along environmental gradients and across biogeographic barriers. We show that humid, low-elevation communities are phylogenetically overdispersed (coexistence of distant relatives), a pattern...... that is consistent with the idea that competition influences the local composition of hummingbirds. At higher elevations communities are phylogenetically clustered (coexistence of close relatives), consistent with the expectation of environmental filtering, which may result from the challenge of sustaining...

  17. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    PARUL BANERJEE

    c Indian Academy of Sciences. RESEARCH ARTICLE. The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. PARUL BANERJEE and BASHISTH N. SINGH. ∗. Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi ...

  18. The phylogenetics of succession can guide restoration

    DEFF Research Database (Denmark)

    Shooner, Stephanie; Chisholm, Chelsea Lee; Davies, T. Jonathan

    2015-01-01

    Phylogenetic tools have increasingly been used in community ecology to describe the evolutionary relationships among co-occurring species. In studies of succession, such tools may allow us to identify the evolutionary lineages most suited for particular stages of succession and habitat...... rehabilitation. However, to date, these two applications have been largely separate. Here, we suggest that information on phylogenetic community structure might help to inform community restoration strategies following major disturbance. Our study examined phylogenetic patterns of succession based...... for species sorting along abiotic gradients (slope and aspect) on the mine sites that had been abandoned for the longest. Synthesis and applications. Understanding the trajectory of succession is critical for restoration efforts. Our results suggest that early colonizers represent a phylogenetically random...

  19. Phylogenetic search through partial tree mixing

    Science.gov (United States)

    2012-01-01

    Background Recent advances in sequencing technology have created large data sets upon which phylogenetic inference can be performed. Current research is limited by the prohibitive time necessary to perform tree search on a reasonable number of individuals. This research develops new phylogenetic algorithms that can operate on tens of thousands of species in a reasonable amount of time through several innovative search techniques. Results When compared to popular phylogenetic search algorithms, better trees are found much more quickly for large data sets. These algorithms are incorporated in the PSODA application available at http://dna.cs.byu.edu/psoda Conclusions The use of Partial Tree Mixing in a partition based tree space allows the algorithm to quickly converge on near optimal tree regions. These regions can then be searched in a methodical way to determine the overall optimal phylogenetic solution. PMID:23320449

  20. Constructing phylogenetic trees using interacting pathways.

    Science.gov (United States)

    Wan, Peng; Che, Dongsheng

    2013-01-01

    Phylogenetic trees are used to represent evolutionary relationships among biological species or organisms. The construction of phylogenetic trees is based on the similarities or differences of their physical or genetic features. Traditional approaches of constructing phylogenetic trees mainly focus on physical features. The recent advancement of high-throughput technologies has led to accumulation of huge amounts of biological data, which in turn changed the way of biological studies in various aspects. In this paper, we report our approach of building phylogenetic trees using the information of interacting pathways. We have applied hierarchical clustering on two domains of organisms-eukaryotes and prokaryotes. Our preliminary results have shown the effectiveness of using the interacting pathways in revealing evolutionary relationships.

  1. Virulence, serotype and phylogenetic groups of diarrhoeagenic ...

    African Journals Online (AJOL)

    Dr DADIE Thomas

    2014-02-17

    Feb 17, 2014 ... Phylogenetic characteristics play an important role for traceability and knowledge of ... amplification reaction was performed by PCR in a 25 μl reaction ...... Hierarchical grouping to optimize an objective function. J. Am. Statist.

  2. Phylogenetically Acquired Representations and Evolutionary Algorithms.

    OpenAIRE

    Wozniak , Adrianna

    2006-01-01

    First, we explain why Genetic Algorithms (GAs), inspired by the Modern Synthesis, do not accurately model biological evolution, being rather an artificial version of artificial, rather than natural selection. Being focused on optimisation, we propose two improvements of GAs, with the aim to successfully generate adapted, desired behaviour. The first one concerns phylogenetic grounding of meaning, a way to avoid the Symbol Grounding Problem. We give a definition of Phylogenetically Acquired Re...

  3. How does cognition evolve? Phylogenetic comparative psychology.

    Science.gov (United States)

    MacLean, Evan L; Matthews, Luke J; Hare, Brian A; Nunn, Charles L; Anderson, Rindy C; Aureli, Filippo; Brannon, Elizabeth M; Call, Josep; Drea, Christine M; Emery, Nathan J; Haun, Daniel B M; Herrmann, Esther; Jacobs, Lucia F; Platt, Michael L; Rosati, Alexandra G; Sandel, Aaron A; Schroepfer, Kara K; Seed, Amanda M; Tan, Jingzhi; van Schaik, Carel P; Wobber, Victoria

    2012-03-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution.

  4. How does cognition evolve? Phylogenetic comparative psychology

    Science.gov (United States)

    Matthews, Luke J.; Hare, Brian A.; Nunn, Charles L.; Anderson, Rindy C.; Aureli, Filippo; Brannon, Elizabeth M.; Call, Josep; Drea, Christine M.; Emery, Nathan J.; Haun, Daniel B. M.; Herrmann, Esther; Jacobs, Lucia F.; Platt, Michael L.; Rosati, Alexandra G.; Sandel, Aaron A.; Schroepfer, Kara K.; Seed, Amanda M.; Tan, Jingzhi; van Schaik, Carel P.; Wobber, Victoria

    2014-01-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution. PMID:21927850

  5. Nodal distances for rooted phylogenetic trees.

    Science.gov (United States)

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel

    2010-08-01

    Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).

  6. Maximizing the phylogenetic diversity of seed banks.

    Science.gov (United States)

    Griffiths, Kate E; Balding, Sharon T; Dickie, John B; Lewis, Gwilym P; Pearce, Tim R; Grenyer, Richard

    2015-04-01

    Ex situ conservation efforts such as those of zoos, botanical gardens, and seed banks will form a vital complement to in situ conservation actions over the coming decades. It is therefore necessary to pay the same attention to the biological diversity represented in ex situ conservation facilities as is often paid to protected-area networks. Building the phylogenetic diversity of ex situ collections will strengthen our capacity to respond to biodiversity loss. Since 2000, the Millennium Seed Bank Partnership has banked seed from 14% of the world's plant species. We assessed the taxonomic, geographic, and phylogenetic diversity of the Millennium Seed Bank collection of legumes (Leguminosae). We compared the collection with all known legume genera, their known geographic range (at country and regional levels), and a genus-level phylogeny of the legume family constructed for this study. Over half the phylogenetic diversity of legumes at the genus level was represented in the Millennium Seed Bank. However, pragmatic prioritization of species of economic importance and endangerment has led to the banking of a less-than-optimal phylogenetic diversity and prioritization of range-restricted species risks an underdispersed collection. The current state of the phylogenetic diversity of legumes in the Millennium Seed Bank could be substantially improved through the strategic banking of relatively few additional taxa. Our method draws on tools that are widely applied to in situ conservation planning, and it can be used to evaluate and improve the phylogenetic diversity of ex situ collections. © 2014 Society for Conservation Biology.

  7. Inferring Phylogenetic Networks Using PhyloNet.

    Science.gov (United States)

    Wen, Dingqiao; Yu, Yun; Zhu, Jiafan; Nakhleh, Luay

    2018-07-01

    PhyloNet was released in 2008 as a software package for representing and analyzing phylogenetic networks. At the time of its release, the main functionalities in PhyloNet consisted of measures for comparing network topologies and a single heuristic for reconciling gene trees with a species tree. Since then, PhyloNet has grown significantly. The software package now includes a wide array of methods for inferring phylogenetic networks from data sets of unlinked loci while accounting for both reticulation (e.g., hybridization) and incomplete lineage sorting. In particular, PhyloNet now allows for maximum parsimony, maximum likelihood, and Bayesian inference of phylogenetic networks from gene tree estimates. Furthermore, Bayesian inference directly from sequence data (sequence alignments or biallelic markers) is implemented. Maximum parsimony is based on an extension of the "minimizing deep coalescences" criterion to phylogenetic networks, whereas maximum likelihood and Bayesian inference are based on the multispecies network coalescent. All methods allow for multiple individuals per species. As computing the likelihood of a phylogenetic network is computationally hard, PhyloNet allows for evaluation and inference of networks using a pseudolikelihood measure. PhyloNet summarizes the results of the various analyzes and generates phylogenetic networks in the extended Newick format that is readily viewable by existing visualization software.

  8. A RAD-based phylogenetics for Orestias fishes from Lake Titicaca.

    Science.gov (United States)

    Takahashi, Tetsumi; Moreno, Edmundo

    2015-12-01

    The fish genus Orestias is endemic to the Andes highlands, and Lake Titicaca is the centre of the species diversity of the genus. Previous phylogenetic studies based on a single locus of mitochondrial and nuclear DNA strongly support the monophyly of a group composed of many of species endemic to the Lake Titicaca basin (the Lake Titicaca radiation), but the relationships among the species in the radiation remain unclear. Recently, restriction site-associated DNA (RAD) sequencing, which can produce a vast number of short sequences from various loci of nuclear DNA, has emerged as a useful way to resolve complex phylogenetic problems. To propose a new phylogenetic hypothesis of Orestias fishes of the Lake Titicaca radiation, we conducted a cluster analysis based on morphological similarities among fish samples and a molecular phylogenetic analysis based on RAD sequencing. From a morphological cluster analysis, we recognised four species groups in the radiation, and three of the four groups were resolved as monophyletic groups in maximum-likelihood trees based on RAD sequencing data. The other morphology-based group was not resolved as a monophyletic group in molecular phylogenies, and some members of the group were diverged from its sister group close to the root of the Lake Titicaca radiation. The evolution of these fishes is discussed from the phylogenetic relationships. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Churchill, Europe and Turkey

    Directory of Open Access Journals (Sweden)

    Warren Dockter

    2016-12-01

    Full Text Available From the early 1930s until his peace time premiership (1951-1955, Winston Churchill was one of the strongest advocates of the concept of a United Europe. While this is well known among scholars of 20th century British history, Churchill’s actual vision for what a United Europe might look like has received less attention. Still less attention has been paid to Churchill’s opinions of the roles other nations might play within the new Europe. This article will examine Churchill’s view of Turkey in the new European order and will reveal that Churchill saw Turkey as a part of, (or at least an extension of Europe. However, this article will also reveal that Churchill’s conceptualisation of Turkey’s role was largely predicated on 19th century geostrategic thinking.

  10. Creationism in Europe

    DEFF Research Database (Denmark)

    For decades, the creationist movement was primarily situated in the United States. Then, in the 1970s, American creationists found their ideas welcomed abroad, first in Australia and New Zealand, then in Korea, India, South Africa, Brazil, and elsewhere—including Europe, where creationism plays...... an expanding role in public debates about science policy and school curricula. In this, the first comprehensive history of creationism in Europe, leading historians, philosophers, and scientists narrate the rise of—and response to—scientific creationism, creation science, intelligent design, and organized...... antievolutionism in countries and religions throughout Europe. Providing a unique map of creationism in Europe, the authors chart the surprising history of creationist activities and strategies there. Over the past forty years, creationism has spread swiftly among European Catholics, Protestants, Jews, Hindus...

  11. EPA Collaboration with Europe

    Science.gov (United States)

    By working together to achieve common goals, the U.S. and Europe can enhance our respective environmental protection efforts while creating a cleaner environment on both continents and around the world.

  12. Assessment of Molecular Modeling & Simulation

    Energy Technology Data Exchange (ETDEWEB)

    None

    2002-01-03

    This report reviews the development and applications of molecular and materials modeling in Europe and Japan in comparison to those in the United States. Topics covered include computational quantum chemistry, molecular simulations by molecular dynamics and Monte Carlo methods, mesoscale modeling of material domains, molecular-structure/macroscale property correlations like QSARs and QSPRs, and related information technologies like informatics and special-purpose molecular-modeling computers. The panel's findings include the following: The United States leads this field in many scientific areas. However, Canada has particular strengths in DFT methods and homogeneous catalysis; Europe in heterogeneous catalysis, mesoscale, and materials modeling; and Japan in materials modeling and special-purpose computing. Major government-industry initiatives are underway in Europe and Japan, notably in multi-scale materials modeling and in development of chemistry-capable ab-initio molecular dynamics codes.

  13. Biotechnological research in Europe

    Energy Technology Data Exchange (ETDEWEB)

    Rehm, H J

    1982-01-01

    The current research possibilities in the expanding field of biotechnology in Europe are very briefly described. Remarks on research and development are limited to six topics: fermented food products; biomass production; product formation; bioreactors; waste-water treatment, environmental processes and methane formation; central research institutions. It is summarised that increased efforts at co-operation on all levels are vital for an improved development in the field of biotechnology throughout Europe.

  14. Somalis in Europe

    OpenAIRE

    FAGIOLI-NDLOVU, Monica

    2015-01-01

    INTERACT - Researching Third Country Nationals? Integration as a Three-way Process - Immigrants, Countries of Emigration and Countries of Immigration as Actors of Integration Somalis have a long history in Europe; the first Somalis were seamen who arrived in the UK working on British ships at the beginning of the 20th century. Throughout different waves of migrations directly related to European colonial history, Somalis have settled down in various cities throughout Europe. More recently,...

  15. Hepatitis a virus genotypes and strains from an endemic area of Europe, Bulgaria 2012-2014.

    Science.gov (United States)

    Bruni, Roberto; Taffon, Stefania; Equestre, Michele; Cella, Eleonora; Lo Presti, Alessandra; Costantino, Angela; Chionne, Paola; Madonna, Elisabetta; Golkocheva-Markova, Elitsa; Bankova, Diljana; Ciccozzi, Massimo; Teoharov, Pavel; Ciccaglione, Anna Rita

    2017-07-14

    Hepatitis A virus (HAV) infection is endemic in Eastern European and Balkan region countries. In 2012, Bulgaria showed the highest rate (67.13 cases per 100,000) in Europe. Nevertheless, HAV genotypes and strains circulating in this country have never been described. The present study reports the molecular characterization of HAV from 105 patients from Bulgaria. Anti-HAV IgM positive serum samples collected in 2012-2014 from different towns and villages in Bulgaria were analysed by nested RT-PCR, sequencing of the VP1/2A region and phylogenetic analysis; the results were analysed together with patient and geographical data. Phylogenetic analysis revealed two main sequence groups corresponding to the IA (78/105, 74%) and IB (27/105, 26%) sub-genotypes. In the IA group, a major and a minor cluster were observed (62 and 16 sequences, respectively). Most sequences from the major cluster (44/62, 71%) belonged to either of two strains, termed "strain 1" and "strain 2", differing only for a single specific nucleotide; the remaining sequences (18/62, 29%) showed few (1 to 4) nucleotide variations respect to strain 1 and 2. Strain 2 is identical to the strain previously responsible for an outbreak in the Czech Republic in 2008 and a large multi-country European outbreak caused by contaminated mixed frozen berries in 2013. Most sequences of the IA minor cluster and the IB group were detected in large/medium centers (LMCs). Overall, sequences from the IA major cluster were more frequent in small centers (SCs), but strain 1 and strain 2 showed an opposite relative frequency in SCs and LMCs (strain 1 more frequent in SCs, strain 2 in LMCs). Genotype IA predominated in Bulgaria in 2012-2014 and phylogenetic analysis identified a major cluster of highly related or identical IA sequences, representing 59% of the analysed cases; these isolates were mostly detected in SCs, in which HAV shows higher endemicity than in LMCs. The distribution of viral sequences suggests the existence

  16. Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences

    OpenAIRE

    Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

    2015-01-01

    Background Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Methods Ecdysozoan phylogeny was reconstruct...

  17. Phylogenetic climatic niche conservatism and evolution of climatic suitability in Neotropical Angraecinae (Vandeae, Orchidaceae) and their closest African relatives

    Czech Academy of Sciences Publication Activity Database

    Kolanowska, Marta; Grochocka, E.; Konowalik, K.

    2017-01-01

    Roč. 5, may (2017), č. článku e3328. ISSN 2167-8359 R&D Projects: GA ČR GB14-36098G Institutional support: RVO:86652079 Keywords : campylocentrum orchidaceae * molecular phylogenetics * environmental niches * costa-rica * diversity * models * speciation * ecology * pollination * divergence * Angraecinae * Ecological niche modeling * Orchidaceae * Phylogenetic niche conservatism * Angraecum * Campylocentrum * Dendrophylax Subject RIV: EH - Ecology, Behaviour OBOR OECD: Biodiversity conservation Impact factor: 2.177, year: 2016

  18. Rearrangement moves on rooted phylogenetic networks.

    Science.gov (United States)

    Gambette, Philippe; van Iersel, Leo; Jones, Mark; Lafond, Manuel; Pardi, Fabio; Scornavacca, Celine

    2017-08-01

    Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide a solid basis for

  19. Rearrangement moves on rooted phylogenetic networks.

    Directory of Open Access Journals (Sweden)

    Philippe Gambette

    2017-08-01

    Full Text Available Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide

  20. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  1. Phylogenetic tests of distribution patterns in South Asia: towards

    Indian Academy of Sciences (India)

    The last four decades have seen an increasing integration of phylogenetics and biogeography. However, a dearth of phylogenetic studies has precluded such biogeographic analyses in South Asia until recently. Noting the increase in phylogenetic research and interest in phylogenetic biogeography in the region, we ...

  2. Phylogenetic groups among Klebsiella pneumoniae isolates from Brazil: relationship with antimicrobial resistance and origin.

    Science.gov (United States)

    de Melo, Maíra Espíndola Silva; Cabral, Adriane Borges; Maciel, Maria Amélia Vieira; da Silveira, Vera Magalhães; de Souza Lopes, Ana Catarina

    2011-05-01

    The objectives of this study were to determine the distribution of phylogenetic groups among Klebsiella pneumoniae isolates from Recife, Brazil and to assess the relationship between the groups and the isolation sites and resistance profile. Ninety four isolates of K. pneumoniae from hospital or community infections and from normal microbiota were analyzed by gyrA PCR-RFLP, antibiotic susceptibility, and adonitol fermentation. The results revealed the distinction of three phylogenetic groups, as it has also been reported in Europe, showing that these clusters are highly conserved within K. pneumoniae. Group KpI was dominantly represented by hospital and community isolates while groups KpII and KpIII displayed mainly normal microbiota isolates. The resistance to third generation cephalosporins, aztreonam, imipenem, amoxicillin/clavulanic acid, and streptomycin was only observed in KpI. The percentage of resistance was higher in KpI, followed by KpII and KpIII. The differences in the distribution of K. pneumoniae phylogenetic groups observed in this study suggest distinctive clinical and epidemiological characteristics among the three groups, which is important to understand the epidemiology of infections caused by this organism. This is the first study in Brazil on K. pneumoniae isolates from normal microbiota and community infections regarding the distribution of phylogenetic groups based on the gyrA gene.

  3. Encoding phylogenetic trees in terms of weighted quartets.

    Science.gov (United States)

    Grünewald, Stefan; Huber, Katharina T; Moulton, Vincent; Semple, Charles

    2008-04-01

    One of the main problems in phylogenetics is to develop systematic methods for constructing evolutionary or phylogenetic trees. For a set of species X, an edge-weighted phylogenetic X-tree or phylogenetic tree is a (graph theoretical) tree with leaf set X and no degree 2 vertices, together with a map assigning a non-negative length to each edge of the tree. Within phylogenetics, several methods have been proposed for constructing such trees that work by trying to piece together quartet trees on X, i.e. phylogenetic trees each having four leaves in X. Hence, it is of interest to characterise when a collection of quartet trees corresponds to a (unique) phylogenetic tree. Recently, Dress and Erdös provided such a characterisation for binary phylogenetic trees, that is, phylogenetic trees all of whose internal vertices have degree 3. Here we provide a new characterisation for arbitrary phylogenetic trees.

  4. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales.

    Science.gov (United States)

    Purschke, Oliver; Michalski, Stefan G; Bruelheide, Helge; Durka, Walter

    2017-12-01

    Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic turnover across phylogenetic scales, accounting for covariation with environmental differences. We compared phylogenetic turnover, at the species- and individual-level, within and between five successional stages, representing woody plant communities in a subtropical forest chronosequence. We decomposed turnover at different phylogenetic depths and assessed its covariation with between-plot abiotic differences. Phylogenetic turnover between stages was low relative to species turnover and was not explained by abiotic differences. However, within the late-successional stages, there was high presence-/absence-based turnover (clustering) that occurred deep in the phylogeny and covaried with environmental differentiation. Our results support a deterministic model of community assembly where (i) phylogenetic composition is constrained through successional time, but (ii) toward late succession, species sorting into preferred habitats according to niche traits that are conserved deep in phylogeny, becomes increasingly important.

  5. Phylogenetic radiation of the greenbottle flies (Diptera, Calliphoridae, Luciliinae)

    Science.gov (United States)

    Williams, Kirstin A.; Lamb, Jennifer; Villet, Martin H.

    2016-01-01

    Abstract The subfamily Luciliinae is diverse and geographically widespread. Its four currently recognised genera (Dyscritomyia Grimshaw, 1901, Hemipyrellia Townsend, 1918, Hypopygiopsis Townsend 1916 and Lucilia Robineau-Desvoidy, 1830) contain species that range from saprophages to obligate parasites, but their pattern of phylogenetic diversification is unclear. The 28S rRNA, COI and Period genes of 14 species of Lucilia and Hemipyrellia were partially sequenced and analysed together with sequences of 11 further species from public databases. The molecular data confirmed molecular paraphyly in three species-pairs in Lucilia that hamper barcode identifications of those six species. Lucilia sericata and Lucilia cuprina were confirmed as mutual sister species. The placements of Dyscritomyia and Hypopygiopsis were ambiguous, since both made Lucilia paraphyletic in some analyses. Recognising Hemipyrellia as a genus consistently left Lucilia s.l. paraphyletic, and the occasionally-recognised (sub)genus Phaenicia was consistently paraphyletic, so these taxa should be synonymised with Lucilia to maintain monophyly. Analysis of a matrix of 14 morphological characters scored for adults of all genera and for most of the species included in the molecular analysis confirmed several of these findings. The different degrees of parasitism were phylogenetically clustered within this genus but did not form a graded series of evolutionary stages, and there was no particular relationship between feeding habits and biogeography. Because of the ubiquity of hybridization, introgression and incomplete lineage sorting in blow flies, we recommend that using a combination of mitochondrial and nuclear markers should be a procedural standard for medico-criminal forensic identifications of insects. PMID:27103874

  6. Fourier transform inequalities for phylogenetic trees.

    Science.gov (United States)

    Matsen, Frederick A

    2009-01-01

    Phylogenetic invariants are not the only constraints on site-pattern frequency vectors for phylogenetic trees. A mutation matrix, by its definition, is the exponential of a matrix with non-negative off-diagonal entries; this positivity requirement implies non-trivial constraints on the site-pattern frequency vectors. We call these additional constraints "edge-parameter inequalities". In this paper, we first motivate the edge-parameter inequalities by considering a pathological site-pattern frequency vector corresponding to a quartet tree with a negative internal edge. This site-pattern frequency vector nevertheless satisfies all of the constraints described up to now in the literature. We next describe two complete sets of edge-parameter inequalities for the group-based models; these constraints are square-free monomial inequalities in the Fourier transformed coordinates. These inequalities, along with the phylogenetic invariants, form a complete description of the set of site-pattern frequency vectors corresponding to bona fide trees. Said in mathematical language, this paper explicitly presents two finite lists of inequalities in Fourier coordinates of the form "monomial < or = 1", each list characterizing the phylogenetically relevant semialgebraic subsets of the phylogenetic varieties.

  7. Folding and unfolding phylogenetic trees and networks.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Steel, Mike; Wu, Taoyang

    2016-12-01

    Phylogenetic networks are rooted, labelled directed acyclic graphswhich are commonly used to represent reticulate evolution. There is a close relationship between phylogenetic networks and multi-labelled trees (MUL-trees). Indeed, any phylogenetic network N can be "unfolded" to obtain a MUL-tree U(N) and, conversely, a MUL-tree T can in certain circumstances be "folded" to obtain aphylogenetic network F(T) that exhibits T. In this paper, we study properties of the operations U and F in more detail. In particular, we introduce the class of stable networks, phylogenetic networks N for which F(U(N)) is isomorphic to N, characterise such networks, and show that they are related to the well-known class of tree-sibling networks. We also explore how the concept of displaying a tree in a network N can be related to displaying the tree in the MUL-tree U(N). To do this, we develop aphylogenetic analogue of graph fibrations. This allows us to view U(N) as the analogue of the universal cover of a digraph, and to establish a close connection between displaying trees in U(N) and reconciling phylogenetic trees with networks.

  8. Tree-Based Unrooted Phylogenetic Networks.

    Science.gov (United States)

    Francis, A; Huber, K T; Moulton, V

    2018-02-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent non-tree-like evolutionary histories that arise in organisms such as plants and bacteria, or uncertainty in evolutionary histories. An unrooted phylogenetic network on a non-empty, finite set X of taxa, or network, is a connected, simple graph in which every vertex has degree 1 or 3 and whose leaf set is X. It is called a phylogenetic tree if the underlying graph is a tree. In this paper we consider properties of tree-based networks, that is, networks that can be constructed by adding edges into a phylogenetic tree. We show that although they have some properties in common with their rooted analogues which have recently drawn much attention in the literature, they have some striking differences in terms of both their structural and computational properties. We expect that our results could eventually have applications to, for example, detecting horizontal gene transfer or hybridization which are important factors in the evolution of many organisms.

  9. Phylogenetic analysis using parsimony and likelihood methods.

    Science.gov (United States)

    Yang, Z

    1996-02-01

    The assumptions underlying the maximum-parsimony (MP) method of phylogenetic tree reconstruction were intuitively examined by studying the way the method works. Computer simulations were performed to corroborate the intuitive examination. Parsimony appears to involve very stringent assumptions concerning the process of sequence evolution, such as constancy of substitution rates between nucleotides, constancy of rates across nucleotide sites, and equal branch lengths in the tree. For practical data analysis, the requirement of equal branch lengths means similar substitution rates among lineages (the existence of an approximate molecular clock), relatively long interior branches, and also few species in the data. However, a small amount of evolution is neither a necessary nor a sufficient requirement of the method. The difficulties involved in the application of current statistical estimation theory to tree reconstruction were discussed, and it was suggested that the approach proposed by Felsenstein (1981, J. Mol. Evol. 17: 368-376) for topology estimation, as well as its many variations and extensions, differs fundamentally from the maximum likelihood estimation of a conventional statistical parameter. Evidence was presented showing that the Felsenstein approach does not share the asymptotic efficiency of the maximum likelihood estimator of a statistical parameter. Computer simulations were performed to study the probability that MP recovers the true tree under a hierarchy of models of nucleotide substitution; its performance relative to the likelihood method was especially noted. The results appeared to support the intuitive examination of the assumptions underlying MP. When a simple model of nucleotide substitution was assumed to generate data, the probability that MP recovers the true topology could be as high as, or even higher than, that for the likelihood method. When the assumed model became more complex and realistic, e.g., when substitution rates were

  10. Untangling hybrid phylogenetic signals: horizontal gene transfer and artifacts of phylogenetic reconstruction.

    Science.gov (United States)

    Beiko, Robert G; Ragan, Mark A

    2009-01-01

    Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.

  11. Phylogenetic system and zoogeography of the Plecoptera.

    Science.gov (United States)

    Zwick, P

    2000-01-01

    Information about the phylogenetic relationships of Plecoptera is summarized. The few characters supporting monophyly of the order are outlined. Several characters of possible significance for the search for the closest relatives of the stoneflies are discussed, but the sister-group of the order remains unknown. Numerous characters supporting the presently recognized phylogenetic system of Plecoptera are presented, alternative classifications are discussed, and suggestions for future studies are made. Notes on zoogeography are appended. The order as such is old (Permian fossils), but phylogenetic relationships and global distribution patterns suggest that evolution of the extant suborders started with the breakup of Pangaea. There is evidence of extensive recent speciation in all parts of the world.

  12. Consequences of recombination on traditional phylogenetic analysis

    DEFF Research Database (Denmark)

    Schierup, M H; Hein, J

    2000-01-01

    We investigate the shape of a phylogenetic tree reconstructed from sequences evolving under the coalescent with recombination. The motivation is that evolutionary inferences are often made from phylogenetic trees reconstructed from population data even though recombination may well occur (mt......DNA or viral sequences) or does occur (nuclear sequences). We investigate the size and direction of biases when a single tree is reconstructed ignoring recombination. Standard software (PHYLIP) was used to construct the best phylogenetic tree from sequences simulated under the coalescent with recombination....... With recombination present, the length of terminal branches and the total branch length are larger, and the time to the most recent common ancestor smaller, than for a tree reconstructed from sequences evolving with no recombination. The effects are pronounced even for small levels of recombination that may...

  13. Desertification in Europe

    International Nuclear Information System (INIS)

    Fantechi, R.; Margaris, N.S.

    1986-01-01

    Desertification in Europe highlights a phenomenon which is widespread in most of Southern Europe. The continuous loss of fertile soil, wind and water erosion, vegetation degradation, droughts and forest fires all contribute to the creation of a potentially alarming situation. If one adds to this list the threat posed by acid rain, and the possibility of a climatic change inducing drier and warmer conditions in areas already heavily affected by degradation of soil and vegetation, the problem of desertification in Europe could be seen as being grave. This book focuses on those processes in which nature and Man cooperate in producing accelerated and irreversible barreness of once fertile soils. One paper discusses the use of short-lived radioisotopes to provide chronologies of sedimentation

  14. Generation in Europe

    International Nuclear Information System (INIS)

    Aveline, Michelle; Mason, Laura.

    1994-01-01

    Information for this document has been collected from a range of primary sources which include annual reports, strategy statements and company information leaflets. The first part consists of profiles for each of the countries of Western Europe and selected countries in Eastern Europe. In each case an overview of the organization of the electricity industry is given and information where available on interconnections, new projects, ongoing work at existing plant, environmental issues and details of plant and closures. In the second part, details are given of some of the largest power generating companies in Europe listed in alphabetical order. The most up-to-date figures available have been used in all cases and the companies have been invited to comment on the text. (UK)

  15. Gas in Europe: supply

    International Nuclear Information System (INIS)

    Anon.

    1994-01-01

    It is predicted that natural gas consumption in western Europe could rise by more than 55% over the next two decades, from 290bn cubic metres (cm) in 1991 to 450bn cm in 2010. This growth, projected by the consultants, Arthur D Little, reflects the environmental and economic attractions of natural gas, particularly in the power generation sector. Another consultant, Poten and Partners, predicts an even greater rise in gas consumption, from 301bn cm in 1992 to 482 bn cm in 2010. However, while demand is forecast to increase in all major European gas markets, indigenous production within Europe is expected to remain stable for the foreseeable future, with indigenous supplies projected to peak at approximately 350bn cubic metres per year (cm/y) in the late 1990s. This raises the prospect of significant supply constraints emerging in Europe. (author)

  16. Heat Roadmap Europe 1

    DEFF Research Database (Denmark)

    Connolly, David; Mathiesen, Brian Vad; Østergaard, Poul Alberg

    2012-01-01

    Heat Roadmap Europe (Pre-study 1) investigates the role of district heating in the EU27 energy system by mapping local conditions across Europe, identifying the potential for district heating expansion, and subsequently simulating the potential resource in an hourly model of the EU27 energy system....... In 2010, approximately 12% of the space heating demand in Europe is met by district heating, but in this study four alternative scenarios are considered for the EU27 energy system: 1. 2010 with 30% district heating 2. 2010 with 50% district heating 3. 2030 with 30% district heating 4. 2050 with 50......% district heating These scenarios are investigated in two steps. Firstly, district heating replaces individual boilers by converting condensing power plants to combined heat and power plants (CHP) to illustrate how district heating improves the overall efficiency of the energy system. In the second step...

  17. Europe's New Energy Policy

    International Nuclear Information System (INIS)

    Piebalgs, A.; Conn, I.; Dobbeni, D.; Josefsson, L.G.; Mogg, L.; Rifkin, J.; Scaroni, P.; Tanaka, N.

    2009-01-01

    Europe's energy policy has been completely transformed over the last few years, tackling the dual challenges of climate change and energy security. This has lead to major new laws on issues such as energy liberalisation, renewable energy and energy efficiency. In this volume the detailed reasons for these changes are outlined and the way in which the European Union has risen to these challenges is discussed. Views are given on where Europe's energy policy will go next, the challenges of 2050 and the development of a 'third industrial revolution'. This insight is complemented by the observations and comments of some of the leading figures concerning European and global energy issues, explaining how industry, energy regulators and global thinkers see Europe's energy policy and the challenges that it now faces

  18. Complete mitochondrial genome of the Indian peafowl (Pavo cristatus), with phylogenetic analysis in phasianidae.

    Science.gov (United States)

    Zhou, Tai-Cheng; Sha, Tao; Irwin, David M; Zhang, Ya-Ping

    2015-01-01

    Pavo cristatus, known as the Indian peafowl, is endemic to India and Sri Lanka and has been domesticated for its ornamental and food value. However, its phylogenetic status is still debated. Here, to clarify the phylogenetic status of P. cristatus within Phasianidae, we analyzed its mitochondrial genome (mtDNA). The complete mitochondrial DNA (mtDNA) genome was determined using 34 pairs of primers. Our data show that the mtDNA genome of P. cristatus is 16,686 bp in length. Molecular phylogenetic analyses of P. cristatus was performed along with 22 complete mtDNA genomes belonging to other species in Phasianidae using Bayesian and maximum likelihood methods, where Aythya americana and Anas platyrhynchos were used as outgroups. Our results show that P. critatus has its closest genetic affinity with Pavo muticus and belongs to clade that contains Gallus, Bambusicola and Francolinus.

  19. TreeScaper: Visualizing and Extracting Phylogenetic Signal from Sets of Trees.

    Science.gov (United States)

    Huang, Wen; Zhou, Guifang; Marchand, Melissa; Ash, Jeremy R; Morris, David; Van Dooren, Paul; Brown, Jeremy M; Gallivan, Kyle A; Wilgenbusch, Jim C

    2016-12-01

    Modern phylogenomic analyses often result in large collections of phylogenetic trees representing uncertainty in individual gene trees, variation across genes, or both. Extracting phylogenetic signal from these tree sets can be challenging, as they are difficult to visualize, explore, and quantify. To overcome some of these challenges, we have developed TreeScaper, an application for tree set visualization as well as the identification of distinct phylogenetic signals. GUI and command-line versions of TreeScaper and a manual with tutorials can be downloaded from https://github.com/whuang08/TreeScaper/releases TreeScaper is distributed under the GNU General Public License. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Heat Roadmap Europe

    DEFF Research Database (Denmark)

    David, Andrei; Mathiesen, Brian Vad; Averfalk, Helge

    2017-01-01

    The Heat Roadmap Europe (HRE) studies estimated a potential increase of the district heating (DH) share to 50% of the entire heat demand by 2050, with approximately 25–30% of it being supplied using large-scale electric heat pumps. This study builds on this potential and aims to document that suc......The Heat Roadmap Europe (HRE) studies estimated a potential increase of the district heating (DH) share to 50% of the entire heat demand by 2050, with approximately 25–30% of it being supplied using large-scale electric heat pumps. This study builds on this potential and aims to document...

  1. English-Only Europe?

    DEFF Research Database (Denmark)

    Phillipson, Robert

    and international relations. In this book, Robert Phillipson considers whether the contemporary expansion of English represents a serious threat to other European languages. After exploring the implications of current policies, Phillipson argues the case for more active language policies to safeguard a multilingual......English-Only Europe? explores the role of languages in the process of European integration. Languages are central to the development of an integrated Europe. The way in which the European Union deals with multilingualism has serious implications for both individual member countries...

  2. Penicillium simile sp. nov. revealed by morphological and phylogenetic analysis.

    Science.gov (United States)

    Davolos, Domenico; Pietrangeli, Biancamaria; Persiani, Anna Maria; Maggi, Oriana

    2012-02-01

    The morphology of three phenetically identical Penicillium isolates, collected from the bioaerosol in a restoration laboratory in Italy, displayed macro- and microscopic characteristics that were similar though not completely ascribable to Penicillium raistrickii. For this reason, a phylogenetic approach based on DNA sequencing analysis was performed to establish both the taxonomic status and the evolutionary relationships of these three peculiar isolates in relation to previously described species of the genus Penicillium. We used four nuclear loci (both rRNA and protein coding genes) that have previously proved useful for the molecular investigation of taxa belonging to the genus Penicillium at various evolutionary levels. The internal transcribed spacer region (ITS1-5.8S-ITS2), domains D1 and D2 of the 28S rDNA, a region of the tubulin beta chain gene (benA) and part of the calmodulin gene (cmd) were amplified by PCR and sequenced. Analysis of the rRNA genes and of the benA and cmd sequence data indicates the presence of three isogenic isolates belonging to a genetically distinct species of the genus Penicillium, here described and named Penicillium simile sp. nov. (ATCC MYA-4591(T)  = CBS 129191(T)). This novel species is phylogenetically different from P. raistrickii and other related species of the genus Penicillium (e.g. Penicillium scabrosum), from which it can be distinguished on the basis of morphological trait analysis.

  3. Phylogenetics links monster larva to deep-sea shrimp.

    Science.gov (United States)

    Bracken-Grissom, Heather D; Felder, Darryl L; Vollmer, Nicole L; Martin, Joel W; Crandall, Keith A

    2012-10-01

    Mid-water plankton collections commonly include bizarre and mysterious developmental stages that differ conspicuously from their adult counterparts in morphology and habitat. Unaware of the existence of planktonic larval stages, early zoologists often misidentified these unique morphologies as independent adult lineages. Many such mistakes have since been corrected by collecting larvae, raising them in the lab, and identifying the adult forms. However, challenges arise when the larva is remarkably rare in nature and relatively inaccessible due to its changing habitats over the course of ontogeny. The mid-water marine species Cerataspis monstrosa (Gray 1828) is an armored crustacean larva whose adult identity has remained a mystery for over 180 years. Our phylogenetic analyses, based in part on recent collections from the Gulf of Mexico, provide definitive evidence that the rare, yet broadly distributed larva, C. monstrosa, is an early developmental stage of the globally distributed deepwater aristeid shrimp, Plesiopenaeus armatus. Divergence estimates and phylogenetic relationships across five genes confirm the larva and adult are the same species. Our work demonstrates the diagnostic power of molecular systematics in instances where larval rearing seldom succeeds and morphology and habitat are not indicative of identity. Larval-adult linkages not only aid in our understanding of biodiversity, they provide insights into the life history, distribution, and ecology of an organism.

  4. Phylogenetic reconstruction and shell evolution of the Diplommatinidae (Gastropoda: Caenogastropoda).

    Science.gov (United States)

    Webster, Nicole B; Van Dooren, Tom J M; Schilthuizen, Menno

    2012-06-01

    The fascinating and often unlikely shell shapes in the terrestrial micromollusc family Diplommatinidae (Gastropoda: Caenogastropoda) provide a particularly attractive set of multiple morphological traits to investigate evolutionary patterns of shape variation. Here, a molecular phylogenetic reconstruction, based on five genes and 2700 bp, was undertaken for this family, integrated with ancestral state reconstruction and phylogenetic PCA of discrete and quantitative traits, respectively. We found strong support for the Diplommatininae as a monophyletic group, separating the Cochlostomatidae into a separate family. Five main clades appear within the Diplommatininae, corresponding with both coiling direction and biogeographic patterns. A Belau clade (A) with highly diverse (but always sinistral) morphology comprised Hungerfordia, Palaina, and some Diplommatina. Arinia (dextral) and Opisthostoma (sinistroid) are sister groups in clade B. Clade C and D solely contain sinistral Diplommatina that are robust and little ornamented (clade C) or slender and sculptured (clade D). Clade E is dextral but biogeographically diverse with species from all sampled regions save the Caroline Islands. Adelopoma, Diplommatina, Palaina, and Hungerfordia require revision to allow taxonomy to reflect phylogeny, whereas Opisthostoma is clearly monophyletic. Ancestral state reconstruction suggests a sinistral origin for the Diplommatinidae, with three reversals to dextrality. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. An Extremely Peramorphic Newt (Urodela: Salamandridae: Pleurodelini) from the Latest Oligocene of Germany, and a New Phylogenetic Analysis of Extant and Extinct Salamandrids.

    Science.gov (United States)

    Marjanović, David; Witzmann, Florian

    2015-01-01

    We describe an Oligocene newt specimen from western Germany that has gone practically unnoticed in the literature despite having been housed in the Museum für Naturkunde (Berlin) for a century. It is referable to the coeval Chelotriton, but is unusually peramorphic; for many characters it is more peramorphic than all other caudates or even all other lissamphibians. Most noticeable are the position of the jaw joints far caudal to the occiput, the honeycombed sculpture on the maxilla, and the possible presence of a septomaxilla (which would be unique among salamandrids). Referral to a species would require a revision of the genus, but the specimen likely does not belong to the type species. A phylogenetic analysis of nonmolecular characters of Salamandridae, far larger than all predecessors, confirms the referral to Chelotriton. It further loosely associates the Oligocene Archaeotriton and the Miocene Carpathotriton with the extant Lissotriton, though the former may alternatively lie outside Pleurodelinae altogether. The Miocene? I. randeckensis may not belong to the extant Ichthyosaura. The Miocene "Triturus" roehrsi is found neither with the extant Ommatotriton nor with Lissotriton, but inside an Asian/aquatic clade or, when geographic distribution is included as a character, as the sister-group to all other European molgins. The main cause for discrepancies between the results and the molecular consensus is not heterochrony, but adaptations to a life in mountain streams; this is the most likely reason why the Paleocene Koalliella from western Europe forms the sister-group to some or all of the most aquatic extant newts in different analyses. We would like to urge neontologists working on salamandrids to pay renewed attention to the skeleton, not limited to the skull, as a source of diagnostic and phylogenetically informative characters.

  6. An Extremely Peramorphic Newt (Urodela: Salamandridae: Pleurodelini from the Latest Oligocene of Germany, and a New Phylogenetic Analysis of Extant and Extinct Salamandrids.

    Directory of Open Access Journals (Sweden)

    David Marjanović

    Full Text Available We describe an Oligocene newt specimen from western Germany that has gone practically unnoticed in the literature despite having been housed in the Museum für Naturkunde (Berlin for a century. It is referable to the coeval Chelotriton, but is unusually peramorphic; for many characters it is more peramorphic than all other caudates or even all other lissamphibians. Most noticeable are the position of the jaw joints far caudal to the occiput, the honeycombed sculpture on the maxilla, and the possible presence of a septomaxilla (which would be unique among salamandrids. Referral to a species would require a revision of the genus, but the specimen likely does not belong to the type species. A phylogenetic analysis of nonmolecular characters of Salamandridae, far larger than all predecessors, confirms the referral to Chelotriton. It further loosely associates the Oligocene Archaeotriton and the Miocene Carpathotriton with the extant Lissotriton, though the former may alternatively lie outside Pleurodelinae altogether. The Miocene? I. randeckensis may not belong to the extant Ichthyosaura. The Miocene "Triturus" roehrsi is found neither with the extant Ommatotriton nor with Lissotriton, but inside an Asian/aquatic clade or, when geographic distribution is included as a character, as the sister-group to all other European molgins. The main cause for discrepancies between the results and the molecular consensus is not heterochrony, but adaptations to a life in mountain streams; this is the most likely reason why the Paleocene Koalliella from western Europe forms the sister-group to some or all of the most aquatic extant newts in different analyses. We would like to urge neontologists working on salamandrids to pay renewed attention to the skeleton, not limited to the skull, as a source of diagnostic and phylogenetically informative characters.

  7. Some limitations of public sequence data for phylogenetic inference (in plants).

    Science.gov (United States)

    Hinchliff, Cody E; Smith, Stephen Andrew

    2014-01-01

    The GenBank database contains essentially all of the nucleotide sequence data generated for published molecular systematic studies, but for the majority of taxa these data remain sparse. GenBank has value for phylogenetic methods that leverage data-mining and rapidly improving computational methods, but the limits imposed by the sparse structure of the data are not well understood. Here we present a tree representing 13,093 land plant genera--an estimated 80% of extant plant diversity--to illustrate the potential of public sequence data for broad phylogenetic inference in plants, and we explore the limits to inference imposed by the structure of these data using theoretical foundations from phylogenetic data decisiveness. We find that despite very high levels of missing data (over 96%), the present data retain the potential to inform over 86.3% of all possible phylogenetic relationships. Most of these relationships, however, are informed by small amounts of data--approximately half are informed by fewer than four loci, and more than 99% are informed by fewer than fifteen. We also apply an information theoretic measure of branch support to assess the strength of phylogenetic signal in the data, revealing many poorly supported branches concentrated near the tips of the tree, where data are sparse and the limiting effects of this sparseness are stronger. We argue that limits to phylogenetic inference and signal imposed by low data coverage may pose significant challenges for comprehensive phylogenetic inference at the species level. Computational requirements provide additional limits for large reconstructions, but these may be overcome by methodological advances, whereas insufficient data coverage can only be remedied by additional sampling effort. We conclude that public databases have exceptional value for modern systematics and evolutionary biology, and that a continued emphasis on expanding taxonomic and genomic coverage will play a critical role in developing

  8. [Comparative leaf anatomy and phylogenetic relationships of 11 species of Laeliinae with emphasis on Brassavola (Orchidaceae)].

    Science.gov (United States)

    Noguera-Savelli, Eliana; Jáuregui, Damelis

    2011-09-01

    Brassavola inhabits a wide altitude range and habitat types from Northern Mexico to Northern Argentina. Classification schemes in plants have normally used vegetative and floral characters, but when species are very similar, as in this genus, conflicts arise in species delimitation, and alternative methods should be applied. In this study we explored the taxonomic and phylogenetic value of the anatomical structure of leaves in Brassavola; as ingroup, seven species of Brassavola were considered, and as an outgroup Guarianthe skinneri, Laelia anceps, Rhyncholaelia digbyana and Rhyncholaelia glauca were evaluated. Leaf anatomical characters were studied in freehand cross sections of the middle portion with a light microscope. Ten vegetative anatomical characters were selected and coded for the phylogenetic analysis. Phylogenetic reconstruction was carried out under maximum parsimony using the program NONA through WinClada. Overall, Brassavola species reveal a wide variety of anatomical characters, many of them associated with xeromorphic plants: thick cuticle, hypodermis and cells of the mesophyll with spiral thickenings in the secondary wall. Moreover, mesophyll is either homogeneous or heterogeneous, often with extravascular bundles of fibers near the epidermis at both terete and flat leaves. All vascular bundles are collateral, arranged in more than one row in the mesophyll. The phylogenetic analysis did not resolve internal relationships of the genus; we obtained a polytomy, indicating that the anatomical characters by themselves have little phylogenetic value in Brassavola. We concluded that few anatomical characters are phylogenetically important; however, they would provide more support to elucidate the phylogenetic relantionships in the Orchidaceae and other plant groups if they are used in conjunction with morphological and/or molecular characters.

  9. The Development of Three Long Universal Nuclear Protein-Coding Locus Markers and Their Application to Osteichthyan Phylogenetics with Nested PCR

    Science.gov (United States)

    Zhang, Peng

    2012-01-01

    Background Universal nuclear protein-coding locus (NPCL) markers that are applicable across diverse taxa and show good phylogenetic discrimination have broad applications in molecular phylogenetic studies. For example, RAG1, a representative NPCL marker, has been successfully used to make phylogenetic inferences within all major osteichthyan groups. However, such markers with broad working range and high phylogenetic performance are still scarce. It is necessary to develop more universal NPCL markers comparable to RAG1 for osteichthyan phylogenetics. Methodology/Principal Findings We developed three long universal NPCL markers (>1.6 kb each) based on single-copy nuclear genes (KIAA1239, SACS and TTN) that possess large exons and exhibit the appropriate evolutionary rates. We then compared their phylogenetic utilities with that of the reference marker RAG1 in 47 jawed vertebrate species. In comparison with RAG1, each of the three long universal markers yielded similar topologies and branch supports, all in congruence with the currently accepted osteichthyan phylogeny. To compare their phylogenetic performance visually, we also estimated the phylogenetic informativeness (PI) profile for each of the four long universal NPCL markers. The PI curves indicated that SACS performed best over the whole timescale, while RAG1, KIAA1239 and TTN exhibited similar phylogenetic performances. In addition, we compared the success of nested PCR and standard PCR when amplifying NPCL marker fragments. The amplification success rate and efficiency of the nested PCR were overwhelmingly higher than those of standard PCR. Conclusions/Significance Our work clearly demonstrates the superiority of nested PCR over the conventional PCR in phylogenetic studies and develops three long universal NPCL markers (KIAA1239, SACS and TTN) with the nested PCR strategy. The three markers exhibit high phylogenetic utilities in osteichthyan phylogenetics and can be widely used as pilot genes for

  10. Undergraduate Students’ Difficulties in Reading and Constructing Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Tapilouw, F. S.; Hidayat, T.

    2017-02-01

    Representation is a very important communication tool to communicate scientific concepts. Biologists produce phylogenetic representation to express their understanding of evolutionary relationships. The phylogenetic tree is visual representation depict a hypothesis about the evolutionary relationship and widely used in the biological sciences. Phylogenetic tree currently growing for many disciplines in biology. Consequently, learning about phylogenetic tree become an important part of biological education and an interesting area for biology education research. However, research showed many students often struggle with interpreting the information that phylogenetic trees depict. The purpose of this study was to investigate undergraduate students’ difficulties in reading and constructing a phylogenetic tree. The method of this study is a descriptive method. In this study, we used questionnaires, interviews, multiple choice and open-ended questions, reflective journals and observations. The findings showed students experiencing difficulties, especially in constructing a phylogenetic tree. The students’ responds indicated that main reasons for difficulties in constructing a phylogenetic tree are difficult to placing taxa in a phylogenetic tree based on the data provided so that the phylogenetic tree constructed does not describe the actual evolutionary relationship (incorrect relatedness). Students also have difficulties in determining the sister group, character synapomorphy, autapomorphy from data provided (character table) and comparing among phylogenetic tree. According to them building the phylogenetic tree is more difficult than reading the phylogenetic tree. Finding this studies provide information to undergraduate instructor and students to overcome learning difficulties of reading and constructing phylogenetic tree.

  11. Monogenean anchor morphometry: systematic value, phylogenetic signal, and evolution

    Science.gov (United States)

    Soo, Oi Yoon Michelle; Tan, Wooi Boon; Lim, Lee Hong Susan

    2016-01-01

    Background. Anchors are one of the important attachment appendages for monogenean parasites. Common descent and evolutionary processes have left their mark on anchor morphometry, in the form of patterns of shape and size variation useful for systematic and evolutionary studies. When combined with morphological and molecular data, analysis of anchor morphometry can potentially answer a wide range of biological questions. Materials and Methods. We used data from anchor morphometry, body size and morphology of 13 Ligophorus (Monogenea: Ancyrocephalidae) species infecting two marine mugilid (Teleostei: Mugilidae) fish hosts: Moolgarda buchanani (Bleeker) and Liza subviridis (Valenciennes) from Malaysia. Anchor shape and size data (n = 530) were generated using methods of geometric morphometrics. We used 28S rRNA, 18S rRNA, and ITS1 sequence data to infer a maximum likelihood phylogeny. We discriminated species using principal component and cluster analysis of shape data. Adams’s Kmult was used to detect phylogenetic signal in anchor shape. Phylogeny-correlated size and shape changes were investigated using continuous character mapping and directional statistics, respectively. We assessed morphological constraints in anchor morphometry using phylogenetic regression of anchor shape against body size and anchor size. Anchor morphological integration was studied using partial least squares method. The association between copulatory organ morphology and anchor shape and size in phylomorphospace was used to test the Rohde-Hobbs hypothesis. We created monogeneaGM, a new R package that integrates analyses of monogen