Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

International Nuclear Information System (INIS)

Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

1987-01-01

The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

Formation of large colonies: a defense mechanism of Microcystis aeruginosa under continuous grazing pressure by flagellate Ochromonas sp.

Directory of Open Access Journals (Sweden)

Fanxiang Kong

2012-01-01

Full Text Available Induced colony formation under grazing pressure has been reported in our previous results. However, the colonies induced in these studies comprised only tens of cells which are far smaller than the naturally occurring colonies. In this work, unicellular Microcystis aeruginosa Kützing were co-cultivated with flagellate Ochromonas sp. for 50 d to investigate colony formation in M. aeruginosa under continuous grazing pressure. Results revealed that colonial M. aeruginosa formed on the 10th d under the grazing pressure of flagellate. These algal colonies resulted from the daughter cells of freshly dividing cells that failed to separate during the reproductive process. The diameters and cell numbers of the colonies increased slowly with time. Under continuous grazing pressure by Ochromonas sp. for 50 d, the diameter of some colonies reached over 180 μm. Analysis showed that the extracellular polysaccharide (EPS content and relative gas vesicle (RGV of each cell increased significantly after colony formation. However, there was no significant difference on the monosaccharide composition between unicellular and colonial M. aeruginosa. The loose aggregation of cells in the floating colonies suggests that a correlation probably exists between cell compactness and colony buoyancy.

Sequestration and Distribution Characteristics of Cd(II by Microcystis aeruginosa and Its Role in Colony Formation

Directory of Open Access Journals (Sweden)

Xiangdong Bi

2016-01-01

Full Text Available To investigate the sequestration and distribution characteristics of Cd(II by Microcystis aeruginosa and its role in Microcystis colony formation, M. aeruginosa was exposed to six different Cd(II concentrations for 10 days. Cd(II exposure caused hormesis in the growth of M. aeruginosa. Low concentrations of Cd(II significantly induced formation of small Microcystis colonies (P93% of Cd(II was sequestrated in the groups with lower added concentrations of Cd(II. More than 80% of the sequestrated Cd(II was bioadsorbed by bEPS. The Pearson correlation coefficients of exterior and interior factors related to colony formation of M. aeruginosa revealed that Cd(II could stimulate the production of IPS and bEPS via increasing Cd(II bioaccumulation and bioadsorption. Increased levels of cross-linking between Cd(II and bEPS stimulated algal cell aggregation, which eventually promoted the formation of Microcystis colonies.

Impedimetric quantification of the formation process and the chemosensitivity of cancer cell colonies suspended in 3D environment.

Science.gov (United States)

Lei, Kin Fong; Wu, Zong-Ming; Huang, Chia-Hao

2015-12-15

In cancer research, colony formation assay is a gold standard for the investigation of the development of early tumors and the effects of cytotoxic agents on tumors in vitro. Quantification of cancer cell colonies suspended in hydrogel is currently achieved by manual counting under microscope. It is challenging to microscopically quantify the colony number and size without subjective bias. In this work, impedimetric quantification of cancer cell colonies suspended in hydrogel was successfully developed and provides a quantitative and objective method to describe the colony formation process and the development of colony size during the culture course. A biosensor embedded with a pair of parallel plate electrodes was fabricated for the impedimetric quantification. Cancer cell (cell line: Huh-7) were encapsulated in methyl cellulose hydrogel and cultured to gradually form cancer cell colonies suspended in 3D environment. At pre-set schedule during the culture course, small volume (50 μL) of colonies/MC hydrogel was collected, mixed with measurement hydrogel, and loaded to the biosensor for measurement. Hence, the colony formation process could be quantitatively represented by a colony index and a colony size index calculated from electrical impedance. Based on these developments, chemosensitivity of cancer cell colonies under different concentrations of anti-cancer drug, i.e., doxorubicin, was quantitatively investigated to study the efficacy of anti-cancer drug. Also, dose-response curve was constructed to calculate the IC50 value, which is an important indicator for chemosensitivity assay. These results showed the impedimetric quantification is a promising technique for the colony formation assay. Copyright © 2015 Elsevier B.V. All rights reserved.

Sequestration and Distribution Characteristics of Cd(II) by Microcystis aeruginosa and Its Role in Colony Formation.

Science.gov (United States)

Bi, Xiangdong; Yan, Ran; Li, Fenxiang; Dai, Wei; Jiao, Kewei; Zhou, Qixing; Liu, Qi

2016-01-01

To investigate the sequestration and distribution characteristics of Cd(II) by Microcystis aeruginosa and its role in Microcystis colony formation, M. aeruginosa was exposed to six different Cd(II) concentrations for 10 days. Cd(II) exposure caused hormesis in the growth of M. aeruginosa . Low concentrations of Cd(II) significantly induced formation of small Microcystis colonies ( P bEPS) contents of M. aeruginosa significantly ( P 93% of Cd(II) was sequestrated in the groups with lower added concentrations of Cd(II). More than 80% of the sequestrated Cd(II) was bioadsorbed by bEPS. The Pearson correlation coefficients of exterior and interior factors related to colony formation of M. aeruginosa revealed that Cd(II) could stimulate the production of IPS and bEPS via increasing Cd(II) bioaccumulation and bioadsorption. Increased levels of cross-linking between Cd(II) and bEPS stimulated algal cell aggregation, which eventually promoted the formation of Microcystis colonies.

PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

Science.gov (United States)

Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

2017-05-01

Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

Combined effects of nitrogen content in media and Ochromonas sp. grazing on colony formation of cultured Microcystis aeruginosa

Directory of Open Access Journals (Sweden)

Zhou YANG

2010-08-01

Full Text Available To gain insight into the combined effects of nitrogen content in media and flagellate grazing on colony formation of Microcystis aeruginosa, we added Ochromonas sp. to M. aeruginosa cultured in different nitrogen content media for 7 days. Results showed that M. aeruginosa could be efficiently ingested by Ochromonas sp., no matter what nitrogen content media M. aeruginosa was cultured in. Colony formation was observed in M. aeruginosa in all Ochromonas sp. grazing treatments during the experiment. In contrast, M. aeruginosa populations in the controls were strongly dominated by unicellular and paired cell forms, and no colonies were observed. Among all Ochromonas sp. grazing treatments, the mean numbers of cells per particle of M. aeruginosa increased with decreased nitrogen concentration (except 0% N, therefore colony formation of M. aeruginosa can be enhanced under lower nitrogen conditions. This suggests that both nitrogen content and Ochromonas sp. grazing combine to affect M. aeruginosa colony formation. Three-way ANOVA showed a statistically significant interaction between time (day 1, 3, 5, and 7, treatment (with and without Ochromonas sp. grazing and N content (0%, 10%, 25%, and 100% N on the mean numbers of cells per particle, i.e. the extent of colony formation. At the end of the experiment, the influence of nitrogen content (except 0% N on the numbers of cells per particle followed a rectangular hyperbolic response. The experiments demonstrated that there exists a combined effect of nitrogen concentration and flagellate grazing on colony formation of M. aeruginosa under laboratory conditions.

Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

DEFF Research Database (Denmark)

Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

2015-01-01

Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

International Nuclear Information System (INIS)

Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.

1991-01-01

These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

Science.gov (United States)

Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

2017-05-01

Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

Peripheral blood cells from children with RASopathies show enhanced spontaneous colonies growth in vitro and hyperactive RAS signaling

International Nuclear Information System (INIS)

Gaipa, G; Bugarin, C; Cianci, P; Sarno, J; Bonaccorso, P; Biondi, A; Selicorni, A

2015-01-01

Germline mutations in genes coding for molecules involved in the RAS/RAF/MEK/ERK pathway are the hallmarks of a newly classified family of autosomal dominant syndromes termed RASopathies. Myeloproliferative disorders (MPDs), in particular, juvenile myelomonocytic leukemia, can lead to potentially severe complications in children with Noonan syndrome (NS). We studied 27 children with NS or other RASopathies and 35 age-matched children as control subjects. Peripheral blood (PB) cells from these patients were studied for in vitro colony-forming units (CFUs) activity, as well as for intracellular phosphosignaling. Higher spontaneous growth of both burst-forming units-erythroid (BFU-E) and CFU-granulocyte/macrophage (CFU-GM) colonies from RAS-mutated patients were observed as compared with control subjects. We also observed a significantly higher amount of GM-colony-stimulating factor-induced p-ERK in children with RASopathies. Our findings demonstrate for the first time that PB cells isolated from children suffering from NS or other RASopathies without MPD display enhanced BFU-E and CFU-GM colony formation in vitro. The biological significance of these findings clearly awaits further studies. Collectively, our data provide a basis for further investigating of only partially characterized hematological alterations present in children suffering from RASopathies, and may provide new markers for progression toward malignant MPD in these patients

Evaluation of drug-induced hematotoxicity using novel in vitro monkey CFU-GM and BFU-E colony assays.

Science.gov (United States)

Goto, Koichi; Goto, Mayumi; Ando-Imaoka, Masako; Kai, Kiyonori; Mori, Kazuhiko

2017-01-01

In order to evaluate drug-induced hematotoxicity in monkey cells in vitro, colony-forming unit-granulocyte, macrophage (CFU-GM), and burst-forming unit-erythroid (BFU-E) colony assays were established using mononuclear cells in the bone marrow collected from male cynomolgus monkeys. Furthermore, the effects of doxorubicin, chloramphenicol, and linezolid on CFU-GM and BFU-E colony formation were investigated using established monkey CFU-GM and BFU-E colony assays in comparison with those on human CFU-GM and BFU-E colonies acquired from human umbilical cord blood cells. Bone marrow mononuclear cells were collected from the ischial or iliac bone of male cynomolgus monkeys. The cells were subsequently processed by density gradient separation at 1.067, 1.070, or 1.077 g/mL for CFU-GM or 1.077 g/mL for BFU-E, and then cultured in methylcellulose medium for 9 or 13 days, respectively. A sufficient number of CFU-GM colonies were formed from mononuclear cells processed at a density of 1.070 g/mL. Moreover, the number of BFU-E colonies from the cells processed at a density of 1.077 g/mL was sufficient for the colony assay. The number of CFU-GM or BFU-E colonies decreased after treatment with the drugs of interest in a concentration-dependent manner. Compared with human CFU-GM, monkey CFU-GM were more sensitive to chloramphenicol and resistant to doxorubicin, whereas monkey BFU-E were more sensitive to all compounds in comparison to the sensitivity of human BFU-E. In conclusion, monkey CFU-GM and BFU-E colony assays were established and considered useful tools to evaluate the differences in drug-induced hematotoxicity between species.

High nutrient concentration and temperature alleviated formation of large colonies of Microcystis: Evidence from field investigations and laboratory experiments.

Science.gov (United States)

Zhu, Wei; Zhou, Xiaohua; Chen, Huaimin; Gao, Li; Xiao, Man; Li, Ming

2016-09-15

Correlations between Microcystis colony size and environmental factors were investigated in Meiliang Bay and Gonghu Bay of Lake Taihu (China) from 2011 to 2013. Compared with Gonghu Bay, both nutrient concentrations and Microcystis colony sizes were greater in Meiliang Bay. The median colony size (D50: 50% of the total mass of particles smaller than this size) increased from April to August and then decreased until November. In both bays, the average D50 of Microcystis colonies were 500 μm) dominated in summer. The differences in colony size in Meiliang Bay and Gonghu Bay were probably due to horizontal drift driven by the prevailing south wind in summer. Redundancy analysis (RDA) of field data indicated that colony size was negatively related to nutrient concentrations but positively related to air temperature, suggesting that low nutrient concentrations and high air temperature promoted formation of large colonies. To validate the field survey, Microcystis colonies collected from Lake Taihu were cultured at different temperatures (15, 20, 25 and 30 °C) under high and low nutrient concentrations for 9 days. The size of Microcystis colonies significantly decreased when temperature was above 20 °C but had no significant change at 15 °C. The differences in temperature effects on colony formation shown from field and laboratory suggested that the larger colonies in summer were probably due to the longer growth period rather than the higher air temperature and light intensity. In addition, colony size decreased more significantly at high nutrient levels. Therefore, it could be concluded that high nutrient concentration and temperature may alleviate formation of large colonies of Microcystis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

Directory of Open Access Journals (Sweden)

Abigail A Lamikanra

2009-12-01

Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

International Nuclear Information System (INIS)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

2012-01-01

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

Energy Technology Data Exchange (ETDEWEB)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

2012-11-15

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

Science.gov (United States)

Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

2015-01-01

We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

International Nuclear Information System (INIS)

Porter, P.N.; Ogawa, M.

1982-01-01

Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

International Nuclear Information System (INIS)

Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

1981-01-01

The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

International Nuclear Information System (INIS)

Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

2010-01-01

Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

Studies of globin gene expression in differentiating erythroid cells

International Nuclear Information System (INIS)

Sullivan, T.D.

1985-01-01

The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

Extrapulmonary colony formation after intravenous injection of tumour cells into heparin treated animals

NARCIS (Netherlands)

Maat, B.

1978-01-01

Recent data on extrapulmonary colony formation after heparin administration are inconclusive. A systemic study of this topic was undertaken with 4 experimental tumour systems and 2 distinct periods of reduced clotting capacity in rats and mice. I.v. injection of various numbers of tumour cells into

Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

Science.gov (United States)

Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

2018-06-15

In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

An HTS-compatible 3D colony formation assay to identify tumor-specific chemotherapeutics.

Science.gov (United States)

Horman, Shane R; To, Jeremy; Orth, Anthony P

2013-12-01

There has been increasing interest in the development of cellular behavior models that take advantage of three-dimensional (3D) cell culture. To enable assessment of differential perturbagen impacts on cell growth in 2D and 3D, we have miniaturized and adapted for high-throughput screening (HTS) the soft agar colony formation assay, employing a laser-scanning cytometer to image and quantify multiple cell types simultaneously. The assay is HTS compatible, providing high-quality, image-based, replicable data for multiple, co-cultured cell types. As proof of concept, we subjected colorectal carcinoma colonies in 3D soft agar to a mini screen of 1528 natural product compounds. Hit compounds from the primary screen were rescreened in an HTS 3D co-culture matrix containing colon stromal cells and cancer cells. By combining tumor cells and normal, nontransformed colon epithelial cells in one primary screening assay, we were able to obtain differential IC50 data, thereby distinguishing tumor-specific compounds from general cytotoxic compounds. Moreover, we were able to identify compounds that antagonized tumor colony formation in 3D only, highlighting the importance of this assay in identifying agents that interfere with 3D tumor structural growth. This screening platform provides a fast, simple, and robust method for identification of tumor-specific agents in a biologically relevant microenvironment.

Convergence of bone morphogenetic protein and laminin-1 signaling pathways promotes proliferation and colony formation by fetal mouse pancreatic cells

International Nuclear Information System (INIS)

Jiang Fangxu; Harrison, Leonard C.

2005-01-01

We previously reported that bone morphogenetic proteins (BMPs), members of the transforming growth factor superfamily, together with the basement membrane glycoprotein laminin-1 (Ln-1), promote proliferation of fetal pancreatic cells and formation of colonies containing peripheral insulin-positive cells. Here, we further investigate the cross-talk between BMP and Ln-1 signals. By RT-PCR, receptors for BMP (BMPR) (excepting BMPR-1B) and Ln-1 were expressed in the fetal pancreas between E13.5 and E17.5. Specific blocking antibodies to BMP-4 and -6 and selective BMP antagonists partially inhibited colony formation by fetal pancreas cells. Colony formation induced by BMP-6 and Ln-1 was completely abolished in a dose-dependent manner by blocking Ln-1 binding to its α 6 integrin and α-dystroglycan receptors or by blocking the Ln-1 signaling molecules, phosphatidyl-inositol-3-kinase (P13K) and MAP kinase kinase-1. These results demonstrate a convergence of BMP and Ln-1 signaling through P13K and MAP kinase pathways to induce proliferation and colony formation in E15.5 fetal mouse pancreatic cells

Cell colony formation induced by Xenopus egg extract as a marker for improvement of cloned blastocyst formation in pig

DEFF Research Database (Denmark)

Liu, Ying; Østrup, Olga; Li, Juan

2011-01-01

method based on the colony formation of cells after extract treatment, and subsequent in vitro cloning efficiency using treated cells as chromatin donors. Porcine fetal fibroblasts were treated with each batch of extract, and cultured in embryonic stem cell (ES) medium for 12 days. The number of forming...

Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

Science.gov (United States)

Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

2002-02-01

The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

The time-course relationship between endogenous spleen colony formation and marrow cellularity after midlethal irradiation of mice

International Nuclear Information System (INIS)

Koch, I.; Wiktor-Jedrzejczak, W.; Wojskowa Akademia Medyczna, Warsaw

1981-01-01

The kinetics of appearance and disappearance of endogenous spleen colonies following 4 and 6 Gy of X-irradiation was compared with the kinetics of changes of cellular contents of femur cavities. Additionally, the effect of postirradiation bleeding and this way of the subsequent increase in the level of endogenous erythropoietin was studied. It was found that the kinetics of endogenous haemopoietic recovery in the marrow follows the same characteristic biphasic pattern as in the spleen although it is slightly delayed in time. First wave of regeneration corresponded in time with the formation of transient endogenous spleen colonies 4-7 days postirradiation, and the 2nd wave corresponded in time witn the formation of classical haemopoietic stem-cell derived endogenous spleen colonies 9-12 days following irradiation. Postirradiation bleeding markedly stimulated particularly the first wave of regeneration both in the marrow and in the spleen. (orig.) [de

Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

Science.gov (United States)

Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

2010-01-01

Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

TMEM14C is required for erythroid mitochondrial heme metabolism.

Science.gov (United States)

Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

2014-10-01

The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

Colonial Army Formats in Africa and Post-Colonial Military Coups:

African Journals Online (AJOL)

BSOS USER

The centralised and autocratic features of Caliphate rule were .... latter's participation in the affairs of their respective societies, and leadership ..... deployment of the army by the NPC for internal colonial-style repression duties in the Middle Belt ...

Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

Science.gov (United States)

Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

2018-04-01

During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

Abiotic factors in colony formation: effects of nutrition and light on extracellular polysaccharide production and cell aggregates of Microcystis aeruginosa

Science.gov (United States)

Yang, Zhen; Kong, Fanxiang

2013-07-01

Colony morphology is important for Microcystis to sustain a competitive advantage in eutrophic lakes. The mechanism of colony formation in Microcystis is currently unclear. Extracellular polysaccharide (EPS) has been reported to play an important role in cell aggregate formation of some phytoplankton. Microcystis aeruginosa was cultivated under varied abiotic conditions, including different nutrient, light, and temperature conditions, to investigate their effects on EPS production and morphological change. The results show that nutrient concentration and light intensity have great effects on EPS productionin M. aeruginosa. There was a considerable increase in EPS production after M. aeruginosa was cultivated in adjusted culture conditions similar to those present in the field (28.9 mg C/L, 1.98 mg N/L, 0.65 mg P/L, light intensity: 100 μmol/(m2 · s)). These results indicate that abiotic factors might be one of the triggers for colony formation in Microcystis.

The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

Energy Technology Data Exchange (ETDEWEB)

Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

2013-12-15

Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

International Nuclear Information System (INIS)

Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

2013-01-01

Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

Science.gov (United States)

Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

2013-12-15

Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

Are self-ligating brackets related to less formation of Streptococcus mutans colonies? A systematic review

Directory of Open Access Journals (Sweden)

Leonard Euler Andrade Gomes do Nascimento

2014-01-01

Full Text Available OBJECTIVE: To verify, by means of a systematic review, whether the design of brackets (conventional or self-ligating influences adhesion and formation of Streptococcus mutans colonies. METHODS: Search strategy: four databases (Cochrane Central Register of Controlled Trials, Ovid ALL EMB Reviews, PubMed and BIREME were selected to search relevant articles covering the period from January 1965 to December 2012. Selection Criteria: in first consensus by reading the title and abstract. The full text was obtained from publications that met the inclusion criteria. Data collection and analysis: Two reviewers independently extracted data using the keywords: conventional, self-ligating, biofilm, Streptococcus mutans, and systematic review; and independently evaluated the quality of the studies. In case of divergence, the technique of consensus was adopted. RESULTS: The search strategy resulted in 1,401 articles. The classification of scientific relevance revealed the high quality of the 6 eligible articles of which outcomes were not unanimous in reporting not only the influence of the design of the brackets (conventional or self-ligating over adhesion and formation of colonies of Streptococcus mutans, but also that other factors such as the quality of the bracket type, the level of individual oral hygiene, bonding and age may have greater influence. Statistical analysis was not feasible because of the heterogeneous methodological design. CONCLUSIONS: Within the limitations of this study, it was concluded that there is no evidence for a possible influence of the design of the brackets (conventional or self-ligating over colony formation and adhesion of Streptococcus mutans.

Hemopoietic cell precursor responses to erythropoietin in plasma clot cultures

Energy Technology Data Exchange (ETDEWEB)

Kennedy, W.L.

1979-01-01

The time dependence of the response of mouse bone marrow cells to erythropoietin (Ep) in vitro was studied. Experiments include studies on the Ep response of marrow cells from normal, plethoric, or bled mice. Results with normal marrow reveal: (1) Not all erythroid precursors (CFU-E) are alike in their response to Ep. A significant number of the precursors develop to a mature erythroid colony after very short Ep exposures, but they account for only approx. 13% of the total colonies generated when Ep is active for 48 hrs. If Ep is active more than 6 hrs, a second population of erythroid colonies emerges at a nearly constant rate until the end of the culture. Full erythroid colony production requires prolonged exposure to erythropoietin. (2) The longer erythropoietin is actively present, the larger the number of erythroid colonies that reach 17 cells or more. Two distinct populations of immediate erythroid precursors are also present in marrow from plethoric mice. In these mice, total colony numbers are equal to or below those obtained from normal mice. However, the population of fast-responding CFU-E is consistently decreased to 10 to 20% of that found in normal marrow. The remaining colonies are formed from plethoric marrow at a rate equal to normal marrow. With increasing Ep exposures, the number of large colonies produced increases. From the marrow of bled mice, total erythroid colony production is equal to or above that of normal marrow. Two populations of colony-forming cells are again evident, with the fast-responding CFU-E being below normal levels. The lack of colonies from this group was compensated in bled mice by rapid colony production in the second population. A real increase in numbers of precursors present in this pool increased the rate of colony production in culture to twice that of normal marrow. The number of large colonies obtained from bled mice was again increased as the Ep exposure was lengthened. (ERB)

Characterization of the integrated filamentous phage Pf5 and its involvement in small-colony formation

NARCIS (Netherlands)

Mooij, Marlies J.; Drenkard, Eliana; Llamas, María A.; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.; Ausubel, Frederick M.; Bitter, Wilbert

2007-01-01

Bacteriophages play an important role in bacterial virulence and phenotypic variation. It has been shown that filamentous bacteriophage Pf4 of Pseudomonas aeruginosa strain PAO1 mediates the formation of small-colony variants (SCVs) in biofilms. This morphology type is associated with parameters of

Regulator of differentiation 1 (ROD1) binds to the amphipathic C-terminal peptide of thrombospondin-4 and is involved in its mitogenic activity.

Science.gov (United States)

Sadvakassova, Gulzhakhan; Dobocan, Monica C; Difalco, Marcos R; Congote, Luis F

2009-09-01

The matrix protein thrombospondin-4 has an acidic amphipathic C-terminal peptide (C21) which stimulates erythroid cell proliferation. Here we show that C21 stimulates red cell formation in anemic mice in vivo. In vitro experiments indicated that the peptide-mediated increase of erythroid colony formation in cultures of human CD34+ hematopoietic progenitor cells was possible only under continuous presence of erythropoietin. In the absence of this cytokine, C21 stimulated exclusively myeloid colony formation. Therefore, the peptide is not a specific erythroid differentiation factor. In fact, it is mitogenic in non-erythroid cells, such as skin fibroblasts and kidney epithelial cells. In erythroleukemic TF-1 cells, it actually decreased the production of the erythroid differentiation marker glycophorin A. C21-affinity chromatography revealed regulator of differentiation 1 (ROD1) as a major C21-binding protein. ROD1 is the hematopoietic cell paralog of polypyrimidine tract binding proteins (PTBs), RNA splice regulators which regulate differentiation by repressing tissue-specific exons. ROD1 binding to C21 was strongly inhibited by synthetic RNAs in the order poly A > poly U > poly G = poly C and was weakly inhibited by a synthetic phosphorylated peptide mimicking the C-terminal domain of RNA polymerase II. Cellular overexpression or knockdown experiments of ROD1 suggest a role for this protein in the mitogenic activity of C21. Since the nuclear proteins ROD1 and PTBs regulate differentiation at a posttranscriptional level and there is a fast nuclear uptake of C21, we put forward the idea that the peptide is internalized, goes to the nucleus and maintains cells in a proliferative state by supporting ROD1-mediated inhibition of differentiation.

In vitro studies on the radiosensitivity of multipotent hemopoietic progenitors in canine bone marrow

International Nuclear Information System (INIS)

Kreja, L.; Weinsheimer, W.; Nothdurft, W.

1991-01-01

The in vitro radiation response to 280-kV x-rays (does rate 72 cGy/min) of multipotent hemopoietic progenitor cells, mixed colony-forming units (CFU-mix), from canine bone marrow was assayed and compared to the radiation response characteristics of early erythroid progenitors, erythroid burst-forming units (BFU-E). To improve the colony-forming efficiency, the effect of various bone marrow cell separation techniques on colony formation of both progenitors was examined. The separation of bone marrow aspirates by discontinuous buoyant gradient centrifugation using the lymphocyte separation medium Lymphoprep with a density of 1.070 g/ml allowed the establishment of reproducible survival curves. The survival curves for both progenitors were strictly exponential, and CFU-mix were found to be more radiosensitive (D0 = 12 ± 2 cGy) than BFU-E (D0 = 16 ± 2 cGy)

Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

Directory of Open Access Journals (Sweden)

Ruth Merkle

2016-08-01

Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

Early Developmental Program Shapes Colony Morphology in Bacteria

Directory of Open Access Journals (Sweden)

Gideon Mamou

2016-03-01

Full Text Available When grown on a solid surface, bacteria form highly organized colonies, yet little is known about the earliest stages of colony establishment. Following Bacillus subtilis colony development from a single progenitor cell, a sequence of highly ordered spatiotemporal events was revealed. Colony was initiated by the formation of leading-cell chains, deriving from the colony center and extending in multiple directions, typically in a “Y-shaped” structure. By eradicating particular cells during these early stages, we could influence the shape of the resulting colony and demonstrate that Y-arm extension defines colony size. A mutant in ymdB encoding a phosphodiesterase displayed unordered developmental patterns, indicating a role in guiding these initial events. Finally, we provide evidence that intercellular nanotubes contribute to proper colony formation. In summary, we reveal a “construction plan” for building a colony and provide the initial molecular basis for this process.

Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

International Nuclear Information System (INIS)

Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

1976-01-01

Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

Energy Technology Data Exchange (ETDEWEB)

Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

1976-01-01

Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

KAUST Repository

Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

2017-01-01

are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

Science.gov (United States)

Matsuura, Shu; Miyazima, Sasuke

Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

Extending Jak2V617F and MplW515 mutation analysis to single hematopoietic colonies and B and T lymphocytes.

Science.gov (United States)

Pardanani, Animesh; Lasho, Terra L; Finke, Christy; Mesa, Ruben A; Hogan, William J; Ketterling, Rhett P; Gilliland, Dwight Gary; Tefferi, Ayalew

2007-09-01

JAK2V617F and MPLW515L/K are myeloproliferative disorder (MPD)-associated mutations. We genotyped 552 individual hematopoietic colonies obtained by CD34+ cell culture from 16 affected patients (13 JAK2V617F and 3 MPLW515L/K) to determine (a) the proportion of colonies harboring a particular mutation in the presence or absence of cytokines, (b) the lineage distribution of endogenous colonies for each mutation, and (c) the differences (if any) in the pattern of mutation among the various MPDs, as established by genotyping of individual colonies. Genotyping analysis revealed cohabitation of mutation-negative and mutation-positive endogenous colonies in polycythemia vera as well as other MPDs. Culture of progenitor cells harboring MPLW515L/K yielded virtually no endogenous erythroid colonies in contrast to JAK2V617F-harboring progenitor cells. The mutation pattern (i.e., relative distribution of homozygous, heterozygous, or wild-type colonies) was not a distinguishing feature among the MPDs, and MPLW515 mutations were detected in B and/or T lymphocytes in all three patients tested. These observations suggest that clonal myelopoiesis antedates acquisition of JAK2V617F or MPLW515L/K mutations and that the latter is acquired in a lympho-myeloid progenitor cell.

Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

KAUST Repository

Barbarani, Gloria

2017-10-20

The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

Thrombopoietin has a differentiative effect on late-stage human erythropoiesis.

Science.gov (United States)

Liu, W; Wang, M; Tang, D C; Ding, I; Rodgers, G P

1999-05-01

To further explore the mechanism of the effect of thrombopoietin (TPO) on erythropoiesis, we used a two-phase culture system to investigate the effect of TPO on late-stage human erythroid lineage differentiation. In serum-free suspension and semisolid cultures of human peripheral blood derived erythroid progenitors, TPO alone did not produce benzidine-positive cells. However, in serum-containing culture, TPO alone stimulated erythroid cell proliferation and differentiation, demonstrated by erythroid colony formation, production of benzidine-positive cells and haemoglobin (Hb) synthesis. Monoclonal anti-human erythropoietin antibody and anti-human erythropoietin receptor antibody completely abrogated the erythroid differentiative ability of TPO in the serum-containing systems. This implied that binding of EPO and EPO-R was essential for erythropoiesis and the resultant signal transduction may be augmented by the signals emanating from TPO-c-Mpl interaction. Experiment of withdrawal of TPO further demonstrated the involvement of TPO in late-stage erythropoiesis. RT-PCR results showed that there was EPO-R but not c-Mpl expression on developing erythroblasts induced by TPO in serum-containing system. Our results establish that TPO affects not only the proliferation of erythroid progenitors but also the differentiation of erythroid progenitors to mature erythroid cells.

Bmi-1 Regulates Extensive Erythroid Self-Renewal

Directory of Open Access Journals (Sweden)

Ah Ram Kim

2015-06-01

Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

Effects of lead(II) on the extracellular polysaccharide (EPS) production and colony formation of cultured Microcystis aeruginosa.

Science.gov (United States)

Bi, Xiang-dong; Zhang, Shu-lin; Dai, Wei; Xing, Ke-zhing; Yang, Fan

2013-01-01

To investigate the effects of lead(II) on the production of extracellular polysaccharides (EPS), including bound extracellular polysaccharides (bEPS) and soluble extracellular polysaccharides (sEPS), and the colony formation of Microcystis aeruginosa, cultures of M. aeruginosa were exposed to four concentrations (5.0, 10.0, 20.0 and 40.0 mg/L) of lead(II) for 10 d under controlled laboratory conditions. The results showed that 5.0 and 10.0 mg/L lead(II) stimulated M. aeruginosa growth throughout the experiment while 20.0 and 40.0 mg/L lead(II) inhibited M. aeruginosa growth in the first 2 d exposure and then stimulated it. As compared to the control group, significant increases in the bEPS and sEPS production were observed in 20.0 and 40.0 mg/L lead(II) treatments (P bEPS production, which conversely promoted colony formation, suggesting that heavy metals might be contributing to the bloom-forming of M. aeruginosa in natural conditions.

Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

International Nuclear Information System (INIS)

Watanabe, T.; Oishi, M.

1987-01-01

A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

Science.gov (United States)

Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

1998-06-01

A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

Science.gov (United States)

Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

1998-01-01

A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

Directory of Open Access Journals (Sweden)

Eyayu Belay

Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

The negative impact of Wnt signaling on megakaryocyte and primitive erythroid progenitors derived from human embryonic stem cells

Directory of Open Access Journals (Sweden)

Prasuna Paluru

2014-03-01

Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.

Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

Directory of Open Access Journals (Sweden)

Ryo Kurita

Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

NARCIS (Netherlands)

DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

1994-01-01

Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

Heterozygous and homozygous JAK2(V617F states modeled by induced pluripotent stem cells from myeloproliferative neoplasm patients.

Directory of Open Access Journals (Sweden)

Joseph Saliba

Full Text Available JAK2(V617F is the predominant mutation in myeloproliferative neoplasms (MPN. Modeling MPN in a human context might be helpful for the screening of molecules targeting JAK2 and its intracellular signaling. We describe here the derivation of induced pluripotent stem (iPS cell lines from 2 polycythemia vera patients carrying a heterozygous and a homozygous mutated JAK2(V617F, respectively. In the patient with homozygous JAK2(V617F, additional ASXL1 mutation and chromosome 20 allowed partial delineation of the clonal architecture and assignation of the cellular origin of the derived iPS cell lines. The marked difference in the response to erythropoietin (EPO between homozygous and heterozygous cell lines correlated with the constitutive activation level of signaling pathways. Strikingly, heterozygous iPS cells showed thrombopoietin (TPO-independent formation of megakaryocytic colonies, but not EPO-independent erythroid colony formation. JAK2, PI3K and HSP90 inhibitors were able to block spontaneous and EPO-induced growth of erythroid colonies from GPA(+CD41(+ cells derived from iPS cells. Altogether, this study brings the proof of concept that iPS can be used for studying MPN pathogenesis, clonal architecture, and drug efficacy.

Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

Science.gov (United States)

Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

2012-08-01

Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

Science.gov (United States)

Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

2017-07-01

Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

CFAssay: statistical analysis of the colony formation assay

International Nuclear Information System (INIS)

Braselmann, Herbert; Michna, Agata; Heß, Julia; Unger, Kristian

2015-01-01

Colony formation assay is the gold standard to determine cell reproductive death after treatment with ionizing radiation, applied for different cell lines or in combination with other treatment modalities. Associated linear-quadratic cell survival curves can be calculated with different methods. For easy code exchange and methodological standardisation among collaborating laboratories a software package CFAssay for R (R Core Team, R: A Language and Environment for Statistical Computing, 2014) was established to perform thorough statistical analysis of linear-quadratic cell survival curves after treatment with ionizing radiation and of two-way designs of experiments with chemical treatments only. CFAssay offers maximum likelihood and related methods by default and the least squares or weighted least squares method can be optionally chosen. A test for comparision of cell survival curves and an ANOVA test for experimental two-way designs are provided. For the two presented examples estimated parameters do not differ much between maximum-likelihood and least squares. However the dispersion parameter of the quasi-likelihood method is much more sensitive for statistical variation in the data than the multiple R 2 coefficient of determination from the least squares method. The dispersion parameter for goodness of fit and different plot functions in CFAssay help to evaluate experimental data quality. As open source software interlaboratory code sharing between users is facilitated

Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

Directory of Open Access Journals (Sweden)

Ibrahim Mansur

2016-01-01

Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

Colony Dimorphism in Bradyrhizobium Strains

Science.gov (United States)

Sylvester-Bradley, Rosemary; Thornton, Philip; Jones, Peter

1988-01-01

Ten isolates of Bradyrhizobium spp. which form two colony types were studied; the isolates originated from a range of legume species. The two colony types differed in the amount of gum formed or size or both, depending on the strain. Whole 7-day-old colonies of each type were subcultured to determine the proportion of cells which had changed to the other type. An iterative computerized procedure was used to determine the rate of switching per generation between the two types and to predict proportions reached at equilibrium for each strain. The predicted proportions of the wetter (more gummy) or larger colony type at equilibrium differed significantly between strains, ranging from 0.9999 (strain CIAT 2383) to 0.0216 (strain CIAT 2469), because some strains switched faster from dry to wet (or small to large) and others switched faster from wet to dry (or large to small). Predicted equilibrium was reached after about 140 generations in strain USDA 76. In all but one strain (CIAT 3030) the growth rate of the wetter colony type was greater than or similar to that of the drier type. The mean difference in generation time between the two colony types was 0.37 h. Doubling times calculated for either colony type after 7 days of growth on the agar surface ranged from 6.0 to 7.3 h. The formation of two persistent colony types by one strain (clonal or colony dimorphism) may be a common phenomenon among Bradyrhizobium strains. Images PMID:16347599

Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

Science.gov (United States)

Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

2015-01-01

Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

Science.gov (United States)

Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

2015-12-01

Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

Directory of Open Access Journals (Sweden)

Deepti Jain

2015-06-01

Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

Directory of Open Access Journals (Sweden)

Pablo Manresa

2017-12-01

Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

Directory of Open Access Journals (Sweden)

Dongsheng Wang

2018-03-01

Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

Increased numbers of spleen colony forming units in B cell deficient CBA/N mice

International Nuclear Information System (INIS)

Wiktor-Jedrzejczak, W.; Krupienicz, A.; Scher, I.

1986-01-01

The formation of exogenous and endogenous spleen colonies was studied in immune-defective mice expressing the CBA/N X-linked xid gene. Bone marrow and spleen cells of immune deficient mice formed increased numbers of eight-day exogenous spleen colonies when transferred to either normal or B cell deficient lethally irradiated recipients. Moreover, defective mice showed increased formation of five-day endogenous spleen colonies (derived from transient endogenous colony forming units; T-CFU) and of ten-day endogenous spleen colonies (derived from CFU-S). Among the possible mechanisms responsible for the observed effects, the most probable appears the one in which decreased numbers of B cell precursors stimulate stem cell pools through a feedback mechanism. (orig.) [de

A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

Directory of Open Access Journals (Sweden)

Ikuta T

2013-12-01

Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

Directory of Open Access Journals (Sweden)

Shlomi Toobiak

Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

Colony formation by sublethally heat-injured Zygosaccharomyces rouxii as affected by solutes in the recovery medium and procedure for sterilizing medium.

Science.gov (United States)

Golden, D A; Beuchat, L R

1990-01-01

Recovery and colony formation by healthy and sublethally heat-injured cells of Zygosaccharomyces rouxii as influenced by the procedure for sterilizing recovery media (YM agar [YMA], wort agar, cornmeal agar, and oatmeal agar) were investigated. Media were supplemented with various concentrations of glucose, sucrose, glycerol, or sorbitol and sterilized by autoclaving (110 degrees C, 15 min) and by repeated treatment with steam (100 degrees C). An increase in sensitivity was observed when heat-injured cells were plated on glucose-supplemented YMA at an aw of 0.880 compared with aws of 0.933 and 0.998. Colonies which developed from unheated and heated cells on YMA at aws of 0.998 and 0.933 generally exceeded 0.5 mm in diameter within 3.5 to 4 days of incubation at 25 degrees C, whereas colonies formed on YMA at an aw of 0.880 typically did not exceed 0.5 mm in diameter until after 5.5 to 6.5 days of incubation. The number of colonies exceeding 0.5 mm in diameter which were formed by heat-injured cells on YMA at an aw of 0.880 was 2 to 3 logs less than the total number of colonies detected, i.e., on YMA at an aw of 0.933 and using no limits of exclusion based on colony diameter. A substantial portion of cells which survived heat treatment were sublethally injured as evidenced by increased sensitivity to a suboptimum aw (0.880). In no instance was recovery of Z. rouxii significantly affected by medium sterilization procedure when glucose or sorbitol was used as the aw-suppressing solute.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2403251

Colony formation by sublethally heat-injured Zygosaccharomyces rouxii as affected by solutes in the recovery medium and procedure for sterilizing medium.

Science.gov (United States)

Golden, D A; Beuchat, L R

1990-08-01

Recovery and colony formation by healthy and sublethally heat-injured cells of Zygosaccharomyces rouxii as influenced by the procedure for sterilizing recovery media (YM agar [YMA], wort agar, cornmeal agar, and oatmeal agar) were investigated. Media were supplemented with various concentrations of glucose, sucrose, glycerol, or sorbitol and sterilized by autoclaving (110 degrees C, 15 min) and by repeated treatment with steam (100 degrees C). An increase in sensitivity was observed when heat-injured cells were plated on glucose-supplemented YMA at an aw of 0.880 compared with aws of 0.933 and 0.998. Colonies which developed from unheated and heated cells on YMA at aws of 0.998 and 0.933 generally exceeded 0.5 mm in diameter within 3.5 to 4 days of incubation at 25 degrees C, whereas colonies formed on YMA at an aw of 0.880 typically did not exceed 0.5 mm in diameter until after 5.5 to 6.5 days of incubation. The number of colonies exceeding 0.5 mm in diameter which were formed by heat-injured cells on YMA at an aw of 0.880 was 2 to 3 logs less than the total number of colonies detected, i.e., on YMA at an aw of 0.933 and using no limits of exclusion based on colony diameter. A substantial portion of cells which survived heat treatment were sublethally injured as evidenced by increased sensitivity to a suboptimum aw (0.880). In no instance was recovery of Z. rouxii significantly affected by medium sterilization procedure when glucose or sorbitol was used as the aw-suppressing solute.(ABSTRACT TRUNCATED AT 250 WORDS)

Relationship of colony-stimulating activity to apparent kill of human colony-forming cells by irradiation and hydroxyurea

International Nuclear Information System (INIS)

Broxmeyer, H.E.; Galbraith, P.R.; Baker, F.L.

1976-01-01

Suspensions of human bone marrow cells were subjected to 137 Cs irradiation in vitro and then cultured in semisolid agar medium. Cultures of irradiated cells were stimulated with colony-stimulating activity (CSA) of different potencies, and it was found that the amount of stimulation applied to cultures influenced the apparent kill of colony-forming cells (CFC). It was also found that the effects of irradiation on colony formation were not confined to CFC kill since medium conditioned by cells during irradiation exhibited stimulatory and inhibitory properties after treatment by 600 and 1000 rads, respectively. Studies in which irradiated cells were pretreated with hydroxyurea indicated that CFC in the DNA synthetic phase of the cell cycle were particularly sensitive to low doses of irradiation. The proliferative capacity of CFC surviving 1000 rads was undiminished as judged by their ability to form large colonies. Estimates of CFC kill by hydroxyurea were also affected by the level of CSA

Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

Directory of Open Access Journals (Sweden)

Zita Garate

2015-12-01

Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

Science.gov (United States)

Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

2017-03-01

Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

Agar Technique for the Cultivation In Vitro of Bone-Marrow Colonies

Energy Technology Data Exchange (ETDEWEB)

Metcalf, D. [Walter and Eliza Hall Institute, Royal Melbourne Hospital, Melbourne, VIC (Australia)

1969-07-15

In solid-state agar cultures certain haemopoietic cells proliferate and form discrete colonies of 200 - 4000 cells. Colony formation is dependent on stimulation by the colony-stimulating factor, and this is achieved by (1) the use of a cell feeder layer, (2) the addition of conditioned medium, or (3) the addition of human or mouse serum or urine containing the factor. All colonies initially contain granulocytic cells which differentiate from myeloblasts to polymorphs as colony growth proceeds. Later colonies develop a second population of phagocytic mononuclear cells (macrophages). The colony-forming-system is simple, readily quantitated and highly reproducible. Linear dose responses occur between the dose of colony-stimulating factor and the number and size of colonies developing from a standard number of bone-marrow cells. In-vitro colony formation has been achieved with haemopoietic cells of the following species: mouse, rat, hamster, guinea pig, rabbit and human. In the adult mouse, colony-forming cells are located in the bone marrow, spleen and blood and in the embryo, in the yolk sac, liver and spleen. The colony-forming cell appears to be an early member of the granulocytic series. The colony-forming system has been used as a quantitative assay system: (1) to assay levels of colony-stimulating factor in serum and urine and in the chemical- characterization and purification of the factor; and (2) to enumerate the number of colony-forming cells in haemopoietic tissues in response to a variety of experimental procedures and disease states. Since the system is applicable to human bone-marrow cells, it should prove of value in the quantitative assay of (1) survival of human bone marrow on storage, and (2) bone-marrow content of granulocytic precursor cells in various disease states and following various types of therapy. The system is not suitable for the mass production in vitro of haemopoietic cells for therapeutic use. (author)

Growth of human T lymphocyte colonies from whole blood: culture requirements and applications

International Nuclear Information System (INIS)

Knox, S.J.; Wilson, F.D.; Greenberg, B.R.; Shifrine, M.

1982-01-01

Growth of human lymphocyte colonies from whole blood following stimulation with PHA, Con A, or PPD is described. Individual colony cells were identified as T lymphocytes on the basis of surface marker and enzyme cytochemical characterizations. Colony formation increased as a power function over a wide range of cell concentrations above a critical minimal concentration. The whole blood culture system eliminates possible selective effects of lymphocyte colony techniques utilizing gradient-enriched lymphocyte fractions and more closely approximates the in vivo milieu. The whole blood colony method is more sensitive for the detection of low-level radiation effects on lymphocytes than widely used tests that measure 3 H-thymidine incorporation. In preliminary studies, researchers used the whole blood method to determine the relative radiosensitivity of lymphocytes from humans with various hematopoietic disorders, and observed abnormalities in mitogen responsiveness and colony formation in some of the patient groups. This method has wide application for studies in cellular and clinical immunology

CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

Directory of Open Access Journals (Sweden)

Laurie A Steiner

Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

In vitro radiosensitivity of human fresh T-lymphocytes by colony formation assay using PHA and recombinant Interleukin-2

International Nuclear Information System (INIS)

Tatsugawa, Kaori; Nakamura, Nori; Hakoda, Masayuki; Akiyama, Mitoshi.

1988-05-01

In vitro culture conditions for colony formation of human fresh peripheral T-cells using phytohemagglutinin (PHA) and recombinant Interleukin-2 are defined. Peripheral lymphocytes, from six individuals, were exposed to X or gamma rays in vitro, and dose-survival curves were obtained. The results showed typical sigmoid curves similar to those observed when other mammalian cells are exposed to radiation. The D 10 (dose required to kill 90 % of the cells) was found to be 3.0 to 3.5 Gy. (author)

Chinua Achebe and the Post-colonial Esthetic: Writing, Identity, and National Formation

Directory of Open Access Journals (Sweden)

Simon Gikandi

1991-01-01

Full Text Available Chinua Achebe is recognized as one of Africa's most important and influential writers, and his novels have focused on the ways in which the European tradition of the novel and African modes of expression relate to each other in both complementary and contesting ways. Achebe's novels are informed by an important theory of writing which tries to mediate the politics of the novel as a form of commentary on the emergence and transformation of nationalism which constitutes the African writer's epistemological context. Achebe's esthetic has been overdetermined by the changing discourse on representation and national identity in colonial and post-colonial Africa. His anxious quest for a post-colonial esthetic is predicated on the belief that narrative can enable the writer to express an alternative order of things opposed to realities imprisoned by imperialism and Western domination.

Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

DEFF Research Database (Denmark)

Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

2013-01-01

Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

Science.gov (United States)

Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

2017-11-01

The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

International Nuclear Information System (INIS)

Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

2013-01-01

Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

Colony Size of Phaeocystis Antarctica (Prymnesiophyceae) as Influenced by Zooplankton Grazers

Science.gov (United States)

The haptophyte Phaeocystis antarctica is a dominant phytoplankton species in the Ross Sea, Antarctica, and exists as solitary cells and mucilaginous colonies that differ by several orders of magnitude in size. Recent studies with P. globosa suggested that colony formation and enl...

Genetic factors affecting radiosensitivity and cancer predisposition: application of a continuous low dose-rate irradiation colony formation assay to select radiosensitive retinoblastoma family members for correction with a cDNA library

International Nuclear Information System (INIS)

Wilson, P.F.; Nagasawa, H.; Bedford, J.S.; Little, J.B.

2003-01-01

Full text: The aim of this study is to identify new or undescribed functions of radiosensitivity and genomic instability genes using a continuous low dose-rate colony formation assay. This assay expands on the standard colony formation assay, whereby colony formation ability (retention of proliferative capacity) is measured during continuous low dose-rate irradiation rather than 10-14 days following the completion of such exposures. This approach has previously employed by the Bedford laboratory to identify a Prkdc (DNA-PKcs) mutant of CHO cells, irs-20. In this study we examine the growth response of fibroblasts derived from recently identified radiosensitive retinoblastoma family members, both affected probands and their unaffected parents, and various apparently normal fibroblast lines obtained from the NIGMS Human Genetic Cell Repository (Coriell Medical Institute, Camden, NJ). Colony formation was assayed by plating single cells, exposing them at 37 deg C to continuous Cs-137 gamma irradiation at dose rates of 0.5-8.5 cGy/h, and scoring survivors as colonies with >100 viable cells. The retinoblastoma family members display severely limited growth (survival less than 10E-3) at dose rates greater than 2-2.5 cGy/h, while the apparently normal cell lines do not display such inhibited growth until 6-7 cGy/h. Two of the retinoblastoma family cell lines, MF-6F and MF-15F (both unaffected but radiosensitive parents), were selected as targets of transfection with a viral cDNA library (ViraPort human cDNA library, Stratagene Cloning Systems, La Jolla, CA) and subjected to a ∼3 cGy/h selection dose rate, where uncorrected survival relative to normal cells is lower by a factor of 50-150. Colonies recovered will provide valuable information regarding the genetic nature of their radiosensitivity (possibly involving chromosome stability, DNA repair, and/or cell cycle regulatory pathways), that may influence risks for cancer and heritable effects for a previously

Natural factors and antropics and their relationship with the density of colonies of Melipona beecheii in five vegetable formations of the valley San Andres

Directory of Open Access Journals (Sweden)

Katiuska Ravelo Pimentel

2014-12-01

Full Text Available It is evaluated the influence of natural factors and antropics on the density of colonies of Melipona beecheii in forest five vegetable formations of the solid one of the valley San Andrés, through surveys to residents and workers of the area, as well as the observations and samplings carried out in the studied vegetable formations. The following factors were studied: rocosity, vegetable covering, flourished plants, height of the entrance hole and the man's activity; being determined that the density of beehives has been affected fundamentally by factors antropics, having this its biggest incidence in the gallery forests, being this the most affected one. The pruning of trees, the naturalness of the forests and their access affect the population's conservation considerably under natural conditions, what demonstrates that this it is the main factor that locates in extirpation danger to the species in the study area. In turn the density of colonies keeps direct relationship with the other analyzed factors, since the same ones depend on the trees for the location of its nests, of the time in that the plants flourish for its feeding and of the holes found in the rocks, so much for the making of its colonies like it stops its establishment and reproduction.

Radiosensitivity of mice and its modifiers based on the endogeneous spleen colony formation

Energy Technology Data Exchange (ETDEWEB)

Kobayashi, Jindo; Wagatuma, Kaoru

1987-02-01

In irradiated mouse hematopoietic tissue, there is a group of cells which can proliferate and form macroscopic colonies. In the spleen, the colonies formed in this manner are discrete and easy to count. In order to look into a difference of radiosensitivity between male and female and the mechanisms of the modification, such as protective agent and hormones on radiosensitivity, the spleen colony forming (SCF) is used as an indicator of reactions in the x-rays irradiated mice. A linear decrease was found in SCF depended on x-rays dose. From the colony forming after irradiation the male was more radiosensitive than female. AET protected from the injury depended on the radiation dose in male mice, but in female mice, protection effects were not observed. Gonatropin showed protective effects for radiation injury on high dose irradiation both in male and female mice. Adrenaline showed similar effects as Gonatropin. Insuline showed a negative effects of protection on 400 R irradiation, while on 600 R irradiation, protective effects were observed.

Reading Female Identity Creation: Self-realization in Colonial and Postcolonial African Literature

OpenAIRE

Jorgensen, Katie Johnson

2018-01-01

The thesis, Re-defining Madness: Reading Female Identity Creation and Self-realization in Colonial and Postcolonial African Literature, compares female identity creation in three novels by African female authors. It reveals how the colonial texts represent extreme female identity formation (stagnation vs. transcendent life) juxtaposed with the dynamic and interconnected identity formation represented in postcolonial writing. The analysis begins with The Joys of Motherhood by Buchi Emecheta (N...

Binucleate cell formation correlates to loss of colony-forming ability in X-irradiated cultured mammalian cells

International Nuclear Information System (INIS)

Sasaki, H.; Yoshinaga, H.; Kura, S.

1986-01-01

The relationship between binucleate cell formation and the loss of colony-forming ability was examined in several cultured mammalian cell lines irradiated with X rays. The maximum fraction of binucleate cells after X irradiation increased dose-dependently within the range in which reproductive cell death might predominate over interphase cell death. When the logarithm of percentage survival was plotted against the percentage binucleate cells, a similar correlation was found for all cell lines tested, with the exception of mouse leukemia L5178Y cells, the most radiosensitive cells used. These observations suggest that the fraction of binucleate cells in the cell population can serve as a measure of cellular radiation damage

Effects of a diphenyl-ether herbicide, oxyfluorfen, on human BFU-E/CFU-E development and haemoglobin synthesis.

Science.gov (United States)

Rio, B; Parent-Massin, D; Lautraite, S; Hoellinger, H

1997-02-01

The diphenyl-ether herbicides exert their phytotoxic activity by preventing chlorophyll formation in plants as a result of inhibition of protoporphyrinogen oxidase. This enzyme is the last step of the common pathway for chlorophyll and haem biosynthesis. The aim of this work is to determine whether herbicide inhibitors of plant protoporphyrinogen oxidase could act on the human protoporphyrinogen oxidase involved in haemoglobin synthesis and cause heamatologic diseases. Human erythroblastic progenitors (BFU-E/CFU-E: Burst Forming Unit-Erythroid and Colony Forming Unit-Erythroid) were exposed to oxyfluorfen, a diphenyl-ether herbicide in the presence of erythropoietin, and the haematoxicity evaluated in vitro by scoring the development of BFU-E/CFU-E colonies after 7 and 14 days of culture. The toxic effect on differentiation has been evaluated using four criteria: morphology, total protein, total porphyrin, and haemoglobin content. The study of BFU-E/CFU-E proliferation and differentiation showed a cytotoxic effect of oxyfluorfen only at very high concentrations. In contrast, haemoglobin synthesis can be inhibited by concentration of oxyfluorfen (10(-4) M) that have no adverse effect on cellular proliferation.

Laser-induced speckle scatter patterns in Bacillus colonies

Directory of Open Access Journals (Sweden)

Huisung eKim

2014-10-01

Full Text Available Label-free bacterial colony phenotyping technology called BARDOT (BActerial Rapid Detection using Optical scattering Technology provided successful classification of several different bacteria at the genus, species, and serovar level. Recent experiments with colonies of Bacillus species provided strikingly different characteristics of elastic light scatter (ELS patterns, which were comprised of random speckles compared to other bacteria, which are dominated by concentric rings and spokes. Since this laser-based optical sensor interrogates the whole volume of the colony, 3-D information of micro- and macro-structures are all encoded in the far-field scatter patterns. Here, we present a theoretical model explaining the underlying mechanism of the speckle formation by the colonies from Bacillus species. Except for Bacillus polymyxa, all Bacillus spp. produced random bright spots on the imaging plane, which presumably dependent on the cellular and molecular organization and content within the colony. Our scatter model-based analysis revealed that colony spread resulting in variable surface roughness can modify the wavefront of the scatter field. As the center diameter of the Bacillus spp. colony grew from 500 μm to 900 μm, average speckles area decreased 2-fold and the number of small speckles increased 7-fold. In conclusion, as Bacillus colony grows, the average speckle size in the scatter pattern decreases and the number of smaller speckle increases due to the swarming growth characteristics of bacteria within the colony.

Redox signaling in the growth and development of colonial hydroids.

Science.gov (United States)

Blackstone, Neil W

2003-02-01

Redox signaling provides a quick and efficient mechanism for clonal or colonial organisms to adapt their growth and development to aspects of the environment, e.g. the food supply. A 'signature' of mitochondrial redox signaling, particularly as mediated by reactive oxygen species (ROS), can be elucidated by experimental manipulation of the electron transport chain. The major sites of ROS formation are found at NADH dehydrogenase of complex I and at the interface between coenzyme Q and complex III. Inhibitors of complex III should thus upregulate ROS from both sites; inhibitors of complex I should upregulate ROS from the first but not the second site, while uncouplers of oxidative phosphorylation should downregulate ROS from both sites. To investigate the possibility of such redox signaling, perturbations of colony growth and development were carried out using the hydroid Podocoryna carnea. Oxygen uptake of colonies was measured to determine comparable physiological doses of antimycin A(1) (an inhibitor of complex III), rotenone (an inhibitor of complex I) and carbonyl cyanide m-chlorophenylhydrazone (CCCP; an uncoupler of oxidative phosphorylation). Using these doses, clear effects on colony growth and development were obtained. Treatment with antimycin A(1) results in 'runner-like' colony growth, with widely spaced polyps and stolon branches, while treatment with CCCP results in 'sheet-like' growth, with closely spaced polyps and stolon branches. Parallel results have been obtained previously with azide, an inhibitor of complex IV, and dinitrophenol, another uncoupler of oxidative phosphorylation. Perhaps surprisingly, rotenone produced effects on colony development similar to those of CCCP. Assays of peroxides using 2',7'-dichlorofluorescin diacetate and fluorescent microscopy suggest a moderate difference in ROS formation between the antimycin and rotenone treatments. The second site of ROS formation (the interface between coenzyme Q and complex III) may thus

Colonial Figures: Memories of Street Traders in the Colonial and Early Post-colonial Periods

Directory of Open Access Journals (Sweden)

Sheri Lynn Gibbings

2012-12-01

Full Text Available This article explores post-colonial memories about street traders among individuals who lived in the former colony of the Dutch East Indies. It argues that these narratives romanticize the relationship between Europeans and indigenous peoples. Street vendors are also used to differentiate between periods within colonial and post-colonial history. The nostalgic representation of interracial contact between Europeans and traders is contrasted with representations of other figures such as the Japanese and the nationalist. A recurring feature of these representations is the ability of Europeans to speak with street traders and imagine what they wanted and needed. The traders are remembered as a social type that transgressed politics and represented the neutrality of the economic sphere as a place for shared communication. The article concludes that the figure of the street vendor contributes to the nostalgic reinvention of the colony but is also used in narratives to differentiate between and mark changes across the colonial and post-colonial periods.

All you can eat: is food supply unlimited in a colonially breeding bird?

OpenAIRE

Hoi, Herbert; Kri?tof?k, J?n; Darolov?, Al?beta

2015-01-01

Food availability is generally considered to determine breeding site selection and therefore plays an important role in hypotheses explaining the evolution of colony formation. Hypotheses trying to explain why birds join a colony usually assume that food is not limited, whereas those explaining variation in colony size suggest that food is under constraint. In this study, we investigate the composition and amount of food items not eaten by the nestlings and found in nest burrows of colonially...

Erythroid cells in vitro: from developmental biology to blood transfusion products.

Science.gov (United States)

Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

2009-07-01

Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

Defibrotide in combination with granulocyte colony-stimulating factor significantly enhances the mobilization of primitive and committed peripheral blood progenitor cells in mice.

Science.gov (United States)

Carlo-Stella, Carmelo; Di Nicola, Massimo; Magni, Michele; Longoni, Paolo; Milanesi, Marco; Stucchi, Claudio; Cleris, Loredana; Formelli, Franca; Gianni, Massimo A

2002-11-01

Defibrotide is a polydeoxyribonucleotide, which significantly reduces the expression of adhesion molecules on endothelial cells. We investigated the activity of Defibrotide alone or in combination with recombinant human granulocyte colony-stimulating factor (rhG-CSF) to mobilize peripheral blood progenitor cells (PBPCs) in BALB/c mice. A 5-day treatment with Defibrotide alone (1-15 mg/mouse/day) had no effect on WBC counts, frequencies and absolute numbers of total circulating colony-forming cells (CFCs), i.e., granulocyte-macrophage colony-forming units, erythroid burst-forming units, and multilineage colony-forming units. As compared with mock-injected mice, administration of rhG-CSF alone (5 micro g/mouse/day) for 5 days significantly (P Defibrotide (15 mg/mouse/day) and rhG-CSF significantly (P Defibrotide plus rhG-CSF resulted in a significant increase (P Defibrotide/rhG-CSF-mobilized mononuclear cells rescued 43% and 71% of recipient mice, respectively. Experiments of CFC homing performed in lethally irradiated or nonirradiated recipients showed that marrow homing of transplanted PBPCs was reduced by 3-fold in Defibrotide-treated animals as compared with mock-injected mice (P Defibrotide might be because of an effect on PBPC trafficking. In conclusion, our data demonstrate that Defibrotide synergizes with rhG-CSF and significantly increases the mobilization of a broad spectrum of PBPCs, including primitive and committed progenitor cells. These data might have relevant implications for autologous and allogeneic anticancer therapy in humans.

ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

Science.gov (United States)

Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

2016-01-01

Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

Science.gov (United States)

Sherazi, Syed Furqan Haider; Butt, Zeeshan

2012-09-01

AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

Arsenic promotes centrosome abnormalities and cell colony formation in p53 compromised human lung cells

International Nuclear Information System (INIS)

Liao Weiting; Lin Pinpin; Cheng, T.-S.; Yu, H.-S.; Chang, Louis W.

2007-01-01

Epidemiological evidence indicated that residents, especially cigarette smokers, in arseniasis areas had significantly higher lung cancer risk than those living in non-arseniasis areas. Thus, an interaction between arsenic and cigarette smoking in lung carcinogenesis was suspected. p53 dysfunction or mutation in lung epithelial cells was frequently observed in cigarette smokers. Our present study was to explore the differential effects by arsenic on H1355 cells (human lung adenocarcinoma cell line with mutation in p53), BEAS-2B (immortalized lung epithelial cell with functional p53) and pifithrin-α-treated BEAS-2B cells (p53-inhibited cells). These cells were treated with different doses of sodium arsenite (0, 0.1, 1, 5 and 10 μM) for 48 h. A greater reduction in cell viability was observed in the BEAS-2B cells vs. p53 compromised cells (H1355 or p53-inhibited BEAS-2B). Similar observation was also made on 7-day cell survival (growth) study. TUNEL analysis confirmed that there was indeed a significantly reduced arsenite-induced apoptosis found in p53-compromised cells. Centrosomal abnormality has been attributed to eventual chromosomal missegregation, aneuploidy and tumorigenesis. In our present study, reduced p21 and Gadd45a expressions and increased centrosomal abnormality (atopic and multiple centrosomes) were observed in both arsenite-treated H1355 and p53-inhibited BEAS-2B cells as compared with similarly treated BEAS-2B cells. Increased anchorage-independent growth (colony formation) of BEAS-2B cells co-treated with pifithrin-α and 5 μM sodium arsenite was also observed in soft agar. Our present investigation demonstrated that arsenic would act specifically on p53 compromised cells (either with p53 dysfunction or inhibited) to induce centrosomal abnormality and colony formation. These findings provided strong evidence on the carcinogenic promotional role of arsenic, especially under the condition of p53 dysfunction

Lenalidomide induces lipid raft assembly to enhance erythropoietin receptor signaling in myelodysplastic syndrome progenitors.

Science.gov (United States)

McGraw, Kathy L; Basiorka, Ashley A; Johnson, Joseph O; Clark, Justine; Caceres, Gisela; Padron, Eric; Heaton, Ruth; Ozawa, Yukiyasu; Wei, Sheng; Sokol, Lubomir; List, Alan F

2014-01-01

Anemia remains the principal management challenge for patients with lower risk Myelodysplastic Syndromes (MDS). Despite appropriate cytokine production and cellular receptor display, erythropoietin receptor (EpoR) signaling is impaired. We reported that EpoR signaling is dependent upon receptor localization within lipid raft microdomains, and that disruption of raft integrity abolishes signaling capacity. Here, we show that MDS erythroid progenitors display markedly diminished raft assembly and smaller raft aggregates compared to normal controls (p = 0.005, raft number; p = 0.023, raft size). Because lenalidomide triggers raft coalescence in T-lymphocytes promoting immune synapse formation, we assessed effects of lenalidomide on raft assembly in MDS erythroid precursors and UT7 cells. Lenalidomide treatment rapidly induced lipid raft formation accompanied by EpoR recruitment into raft fractions together with STAT5, JAK2, and Lyn kinase. The JAK2 phosphatase, CD45, a key negative regulator of EpoR signaling, was displaced from raft fractions. Lenalidomide treatment prior to Epo stimulation enhanced both JAK2 and STAT5 phosphorylation in UT7 and primary MDS erythroid progenitors, accompanied by increased STAT5 DNA binding in UT7 cells, and increased erythroid colony forming capacity in both UT7 and primary cells. Raft induction was associated with F-actin polymerization, which was blocked by Rho kinase inhibition. These data indicate that deficient raft integrity impairs EpoR signaling, and provides a novel strategy to enhance EpoR signal fidelity in non-del(5q) MDS.

Phytohemagglutinin (PHA) stimulation of peripheral-blood lymphocytes and stem cell take

Energy Technology Data Exchange (ETDEWEB)

Astaldi, G [Blood Research Foundation Center, Tortona, Italy; Karanovic, D; Vettori, P P; Karanovic, J; Piletic, O

1974-01-01

The effect of PHA-stimulation of peripheral-blood lymphocytes on the spleen-colony formation in irradiated rats was examined. 25-day old Wistar rats underwent total-body irradiation (600 R), and they were used as recipients. On the other hand, 2 and /sup 1///sub 2/ month old untreated Wistar rats were used as donors of peripheral-blood lymphocytes, which were obtained by sedimentation with Dextraven from defibrinated blood. Four rat lots were used. The 1st one did not receive irradiation, and was kept as ''blank control.'' The 2nd one was just irradiated and kept as ''radiated control.'' The 3rd and the 4th rat lots of the series were irradiated, but the former lot was injected i.v. with 5 x 10/sup 7/ peripheral-blood untreated lymphocytes, whereas the fourth lot was injected i.v. with the same amount of lymphocytes, which were previously incubated in vitro for 24 hrs with PHA-M (Difco). The results showed that the PHA-incubation of transplanted peripheral-blood lymphocytes significantly increases the number and size of the macroscopic spleen colonies, in relationship to the colonies which occurs after transplantation of untreated lymphocytes. Histo-cytological observation clearly showed that the colonies formed after injection of mitogen-pretreated peripheral-blood lymphocytes were predominantly of erythroid type and, then, of non-differentiated cells. Only a few of them were of a mixed type, consisting of both undifferentiated cells and erythroid cells.

Effects of protozoan grazing on colony formation in Phaeocystis globosa (Prymnesiophyceae) and the potential costs and benefits

DEFF Research Database (Denmark)

Jakobsen, Hans Henrik; Tang, K.W.

2002-01-01

. scintillans increased the mean colony size by up to 50 % relative to the controls, whereas grazing by G. dominans enhanced the mean colony size by up to 3-fold. Microscopic observations confirmed that N. scintillans was also able to ingest small colonies. In contrast, G. dominans apparently did not ingest...

Branch to colony trajectory in a modular organism: pattern formation in the Indo-Pacific coral Stylophora pistillata.

Science.gov (United States)

Shaish, Lee; Abelson, Avigdor; Rinkevich, Baruch

2006-08-01

The architecture of the colony in a branching coral is an iterative process in which new layers of calcium carbonate compile atop existing structures that remain unchanged. Colony growth and development, known as astogeny, is believed to be a continuous process, characterized by replication of lower rank unites, polyps, and branches. This study seeks to explore the genetic blueprint of branch-to-colony developmental trajectory in the branching coral Stylophora pistillata, within an astogeny period of 1 year. One hundred small branches (initially 2-4 cm long) were sampled from 10 colonies. A year later, 63 remaining colonies were analyzed for their architectural rules by using 15 morphometric parameters. Multivariate statistical tests were preformed. Cluster and two-dimensional nonmetric Multi-Dimensional Scaling analyses revealed that the 10 genotypes could be divided into two major morphometric groups and two intermediate groups, whereas SIMPER analyses (a similarity percentage test) on within-genet similarities showed high similarity between the ramets developed from each of the 10 genotypes. Although, at first, it seemed that different colonies exhibited variable and different architectural designs (each characterized by specific morphometric parameters), a comprehensive analysis revealed that all 10 coral genotypes exhibited a single common developmental plan that was characterized by a continuum of architectural design with several distinct stages. Each stage is marked by its own characteristic morphometric parameters. Changing of developmental rules during the trajectory from branch to coral colony may help the colony to cope better with environmental constraints.

Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

Directory of Open Access Journals (Sweden)

Pascariello Caterina

2008-05-01

Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

OpenAIRE

Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

1981-01-01

Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

Studies of leukemogenesis by means of in vitro CA membrane method

International Nuclear Information System (INIS)

Seki, Masatoshi; Yoshida, Kazuko; Shimizu, Shizuko; Nishimura, Mayumi

1978-01-01

A new method of hematopoietic colony formation in vitro with macrophage-fibroblast (M-F) layer, which forms on cellulose acetate membrane in the peritoneal cavity of mouse, has been developed in this laboratory. Granuloid colonies develop in M-F layer without any external colony stimulating factors. Clear dose-response relationship between the number of seeded bone marrow cells and the colony counts has been obtained. Erythroid colonies can develop too, only when Erythropoietin is added in culture medium. With this method, the kinetics of granulopoiesis was studied. Granuloid cell line is consisted from two compartments, i.e. proliferative and maturative compartment. The presence of some unknown regulatory mechanism between those compartments has been suggested. In leukemia, the influx of promyclocyte, an element of proliferative compartment, into maturative compartment is inhibited to various extent, so that tremendous enlargement of the former takes place. M-F layer is proved to play an active role on the production and transfer of leukemic virus. Leukemic stem cells capable of forming clusters in conventional semisolid cultures make the well-developed colonies in M-F layer in vitro. (author)

Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

Science.gov (United States)

Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

2012-01-01

Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

Effect of serum from rats with destructed nuclei of the posterior hypothalamus on the formation of hemopoietic colonies in the spleen of lethally irradiated mice after bone marrow cell transplantation

International Nuclear Information System (INIS)

Fedorov, N.A.; Likhovetskaya, Z.M.; Kurbanova, G.N.; Prigozhina, T.A.; L'vovich, A.I.

1982-01-01

Colony formation capability of serum from animals with destructed nuclei of the posterior hypothalamus was studied in lethally irradiated mice. Male-rats of Wistar line and hybrid mice (CBA x C57 BL) were used in the experiments. The serum from rats with destructed nuclei of the posterior hypothalamus was injected simultaneously with bone marrow transplantation into lethally irradiated mice. The number of macrocolonies in the spleen was counted on the 9th day. It was ascertained that the serum from rats with destructed nuclei of the posterior hypothalamus caused an increase of the number of macroscopically visible colonies in the spleen of lethally irradiated mice. The determination of hemopoetic types of colonies showed that the effect of the serum from those animals caused an increase of the number of granulocytic-type colonies. The initiation of colony stimulating and leukopoetic activity in the blood of animals after the destruction of mammillary body nuclei and posterior hypothalamic nucleus attested, according to the authors point of view, that humoral mediators (humoral mediator) could participated in the mechanism of hypothalamus effect on leulopoiesis

Colony formation in agar: in vitro assay for haemopoietic stem cells

NARCIS (Netherlands)

Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van

1971-01-01

Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain

Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

International Nuclear Information System (INIS)

Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

1982-01-01

Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

NARCIS (Netherlands)

Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

Phytohemagglutinin (PHA) stimulation of peripheral-blood lymphocytes and stem cell take

Energy Technology Data Exchange (ETDEWEB)

Astaldi, G. (Blood Research Foundation Center, Tortona, Italy); Karanovic, D.; Vettori, P.P.; Karanovic, J.; Piletic, O.

1974-01-01

The effect of PHA-stimulation of peripheral-blood lymphocytes on the spleen-colony formation in irradiated rats was examined. 25-day old Wistar rats underwent total-body irradiation (600 R), and they were used as recipients. On the other hand, 2 and /sup 1///sub 2/ month old untreated Wistar rats were used as donors of peripheral-blood lymphocytes, which were obtained by sedimentation with Dextraven from defibrinated blood. Four rat lots were used. The 1st one did not receive irradiation, and was kept as ''blank control.'' The 2nd one was just irradiated and kept as ''radiated control.'' The 3rd and the 4th rat lots of the series were irradiated, but the former lot was injected i.v. with 5 x 10/sup 7/ peripheral-blood untreated lymphocytes, whereas the fourth lot was injected i.v. with the same amount of lymphocytes, which were previously incubated in vitro for 24 hrs with PHA-M (Difco). The results showed that the PHA-incubation of transplanted peripheral-blood lymphocytes significantly increases the number and size of the macroscopic spleen colonies, in relationship to the colonies which occurs after transplantation of untreated lymphocytes. Histo-cytological observation clearly showed that the colonies formed after injection of mitogen-pretreated peripheral-blood lymphocytes were predominantly of erythroid type and, then, of non-differentiated cells. Only a few of them were of a mixed type, consisting of both undifferentiated cells and erythroid cells.

Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

OpenAIRE

Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

2015-01-01

Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

Understanding Long-Run African Growth : Colonial Institutions or Colonial Education?

NARCIS (Netherlands)

Bolt, J.; Bezemer, D.J.

2009-01-01

Long-term growth in developing countries has been explained in four frameworks: 'extractive colonial institutions' (Acemoglu et al., 2001), 'colonial legal origin' (La Porta et al., 2004), 'geography' (Gallup et al., 1998) and 'colonial human capital' (Glaeser et al., 2004). In this paper we test

Colony stimulating factors and their clinical implication

International Nuclear Information System (INIS)

Asano, Shigetaka

1989-01-01

Granulocytes and macrophage are dependent for their production and/or functional activation in vitro on the presence of a family of glycoproteins. They are generally called colony-stimulating factors (CSFs) because of their capacity to stimulate colony formation in semi-solid cultures, and are currently classified into four distinct subtypes, that is, Multi-CSF, GM-CSF, G-CSF and M-CSF, according to the cell type of colonies formed under their stimulation or their target cell specificity. All of the murine and human CSF subtypes and the genes for them have become available in a purified form and in a large scale, and now allow us to investigate their interactions, the mechanisms for their actions, the cell-cell interactions leading to their production and secretion, and their actions in vivo. Furthermore, the preclinical and/or clinical studies which were carried out using the purified CSFs strongly indicate that human CSFs will be effective strategies for preventing and treating opportunistic bacterial and fungal infection as a major cause of death in granulocytopenic patients. (author)

Analysis of multidrug resistant group B streptococci with reduced penicillin susceptibility forming small, less hemolytic colonies.

Directory of Open Access Journals (Sweden)

Hirotsugu Banno

Full Text Available Group B streptococci (GBS; Streptococcus agalactiae are the leading cause of neonatal invasive diseases and are also important pathogens for elderly adults. Until now, nearly all GBS with reduced penicillin susceptibility (PRGBS have shown β-hemolytic activity and grow on sheep blood agar. However, we have previously reported three PRGBS clinical isolates harboring a CylK deletion that form small less hemolytic colonies. In this study, we examined the causes of small, less hemolytic colony formation in these clinical isolates. Isogenic strains were sequenced to identify the mutation related to a small colony size. We identified a 276_277insG nucleic acid insertion in the thiamin pyrophosphokinase (tpk gene, resulting in premature termination at amino acid 103 in TPK, as a candidate mutation responsible for small colony formation. The recombinant strain Δtpk, which harbored the 276_277insG insertion in the tpk gene, showed small colony formation. The recombinant strain ΔcylK, which harbored the G379T substitution in cylK, showed a reduction in hemolytic activity. The phenotypes of both recombinant strains were complemented by the expression of intact TPK or CylK, respectively. Moreover, the use of Rapid ID 32 API and VITEK MS to identify strains as GBS was evaluated clinical isolates and recombinant strains. VITEK MS, but not Rapid ID 32 API, was able to accurately identify the strains as GBS. In conclusion, we determined that mutations in tpk and cylK caused small colonies and reduced hemolytic activity, respectively, and characterized the clinical isolates in detail.

Genetic diversity affects colony survivorship in commercial honey bee colonies

Science.gov (United States)

Tarpy, David R.; vanEngelsdorp, Dennis; Pettis, Jeffrey S.

2013-08-01

Honey bee ( Apis mellifera) queens mate with unusually high numbers of males (average of approximately 12 drones), although there is much variation among queens. One main consequence of such extreme polyandry is an increased diversity of worker genotypes within a colony, which has been shown empirically to confer significant adaptive advantages that result in higher colony productivity and survival. Moreover, honey bees are the primary insect pollinators used in modern commercial production agriculture, and their populations have been in decline worldwide. Here, we compare the mating frequencies of queens, and therefore, intracolony genetic diversity, in three commercial beekeeping operations to determine how they correlate with various measures of colony health and productivity, particularly the likelihood of queen supersedure and colony survival in functional, intensively managed beehives. We found the average effective paternity frequency ( m e ) of this population of honey bee queens to be 13.6 ± 6.76, which was not significantly different between colonies that superseded their queen and those that did not. However, colonies that were less genetically diverse (headed by queens with m e ≤ 7.0) were 2.86 times more likely to die by the end of the study when compared to colonies that were more genetically diverse (headed by queens with m e > 7.0). The stark contrast in colony survival based on increased genetic diversity suggests that there are important tangible benefits of increased queen mating number in managed honey bees, although the exact mechanism(s) that govern these benefits have not been fully elucidated.

On colonial grounds

NARCIS (Netherlands)

Dommelen, Peter Alexander René van

1998-01-01

As a study of the colonial situations of first millennium BC Sardinia, this book is as much an investigation into colonialism as a sociological category, as it explores the specific historical conditions of a particular region. Taking a fresh look at colonialism in Mediterranean archaeology from a

Thymidine kinase deficient human cells have increased UV sensitivity in their capacity to support herpes simplex virus but normal UV sensitivity for colony formation

International Nuclear Information System (INIS)

Rainbow, A.J.

1989-01-01

A thymidine kinase deficient (tk - ) and two thymidine kinase proficient (tk + ) human cell lines were compared for UV sensitivity using colony-forming ability as well as their capacity to support the plaque formation of herpes simplex type 1 (HSV-1).The tk - line (143 cells) was a derivative of one of the tk + lines (R970-5), whereas the other tk + line (AC4 cells) was a derivative of the 143 cells obtained by transfection with purified sheared HSV-2 DNA encoding the viral tk gene. 143, R970-5 and AC4 cells showed a similar UV sensitivity for colony-forming ability. In contrast, the capacity to support HSV-1 plaque formation immediately (within 1 h) afte UV-irradiation was reduced to a greater extent in the 143 cells compared to the R970-5 and AC4 cells. Capacity curves for plaque formation of the HSV-1: KOS wild-type (tk + ) strain were similar to those for the HSV-1: PTK3B mutant (tk - ) strain were similar to those for the HSV-1: PTK3B mutant (tk - ) strain in the 3 cell strains, indicating that the viral tk gene does not influence the ability of HSV-1 to form plaques in UV-irradiated compared to unirradiated human cells. Cellular capacity for HSV-1 plaque formation was found to recover in both tk - and tk + cells for cultures infected 24 h after UV-irradiation. These results suggest that repair of UV-damaged DNA takes place to a similar extent in both tk - and tk + human cells, but the kinetics of repair are initially slower in tk - compared to tk + human cells. (author). 33 refs.; 3 figs.; 1 tab

Enhancement of committed hematopoietic stem cell colony formation by nandrolone decanoate after sublethal whole body irradiation

Energy Technology Data Exchange (ETDEWEB)

Gallicchio, V.S.; Chen, M.G.; Watts, T.D.

1984-11-01

The ability of an anabolic steroid, nandrolone decanoate, to increase committed topoietic stem cell (CFU-gm, CFU-e, and BFU-e) colony formation after sublethal irradiation was evaluated. Immediately after receiving whole body irradiation and on the next two days, each mouse was injected intraperitoneally with nandrolone decanoate (1.25 mg) in propylene glycol. Irradiated control mice received only propylene glycol. Compared to controls, drug-treated mice showed marked peripheral blood leukocytosis and more stable packed red cell volume. Drug-treated mice also demonstrated increased erythropoiesis, as CFU-e/BFU-e concentrations from both marrow (9% to 581%) and spleen (15% to 797%) were elevated. Granulopoiesis was increased similarly, as CFU-gm concentrations from marrow (38% to 685%) and spleen (9% to 373%) were elevated. These results demonstrate that nandrolone decanoate enhances hematopoietic stem cell recovery after sublethal whole body irradiation. This suggests that following hematopoietic suppression, nandrolone decanoate may stimulate the recovery of hematopoiesis at the stem cell level and in peripheral blood.

Enhancement of committed hematopoietic stem cell colony formation by nandrolone decanoate after sublethal whole body irradiation

International Nuclear Information System (INIS)

Gallicchio, V.S.; Chen, M.G.; Watts, T.D.

1984-01-01

The ability of an anabolic steroid, nandrolone decanoate, to increase committed topoietic stem cell (CFU-gm, CFU-e, and BFU-e) colony formation after sublethal irradiation was evaluated. Immediately after receiving whole body irradiation and on the next two days, each mouse was injected intraperitoneally with nandrolone decanoate (1.25 mg) in propylene glycol. Irradiated control mice received only propylene glycol. Compared to controls, drug-treated mice showed marked peripheral blood leukocytosis and more stable packed red cell volume. Drug-treated mice also demonstrated increased erythropoiesis, as CFU-e/BFU-e concentrations from both marrow (9% to 581%) and spleen (15% to 797%) were elevated. Granulopoiesis was increased similarly, as CFU-gm concentrations from marrow (38% to 685%) and spleen (9% to 373%) were elevated. These results demonstrate that nandrolone decanoate enhances hematopoietic stem cell recovery after sublethal whole body irradiation. This suggests that following hematopoietic suppression, nandrolone decanoate may stimulate the recovery of hematopoiesis at the stem cell level and in peripheral blood

Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

Directory of Open Access Journals (Sweden)

Jian-Guo Ren

2010-09-01

Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

Ireland – a test case of Post-colonialism / Post colonialism

Directory of Open Access Journals (Sweden)

Brenda Murray

2006-05-01

Full Text Available Contextualisation This review attempts to set the stage for post-colonial theorising, in the light of alternative representations of ‘whiteness’, on issues of gender, race and language within the discourse of equality. In this paper Ireland and the Irish provide a backdrop against which the nature and impact of colonialism on the colonised and the coloniser are explored. Many challenging questions emerge about the ideological basis of post colonial theory, not least when traditional paradigms of racism, as conveyed by the black / white dichotomy, are examined: Ireland presents a context, it is argued, where subjugation is of white on white. Linked to this is the language of the coloniser, a powerful hegemonic force which, in some situations, has been nurtured by the colonised and later developed into a text which is unique, producing a new literature which, it is asserted, truly invokes the ‘post colonial’. Abstract: Post-colonialism – essentially a critique of colonialism, is characterised by a process of disengagement from the colonial epoch and has taken many forms. In this article a set of phenomena are examined that have become inscribed in the cultures of the colonised with a view to identifying alternative cultural origins and dispositions recovered in this post-colonial era. Ireland and the Irish provide the background context of this exploration into perspectives generated by the peripheral or post-colonial nations. Globalisation, too, has had a role to play in the increasing de-territorialisation of communities as a result of cross-frontier mobility, increased intra-community mobility and new communication technologies. A critical reflection on the process of disengagement leads the author to conclude that we must come to recognise new cultural forms which are accepting of a heterogeneous and inclusive society: one which is not characterised by difference.

Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

OpenAIRE

Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

2013-01-01

Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

Expression of assayable residual stem cell damage in erythroid differentiation

International Nuclear Information System (INIS)

Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

1985-01-01

In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

Lysinibacillus fusiformis M5 induces increased complexity in Bacillus subtilis 168 colony biofilms via hypoxanthine

DEFF Research Database (Denmark)

Gallegos-Monterrosa, Ramses; Kankel, Stefanie; Götze, Sebastian

2017-01-01

to identify soil bacteria, which induce architectural changes in biofilm colonies when cocultured with B. subtilis. We identified the soil bacterium Lysinibacillus fusiformis M5 as inducer of wrinkle-formation in B. subtilis colonies mediated by a diffusible signaling molecule. This compound was isolated......O, but not PbuG, is necessary for hypoxanthine to induce an increase in wrinkle formation of B. subtilis biofilm colonies. Our results suggest that hypoxanthine-stimulated wrinkle development is not due to a direct induction of biofilm-related gene expression, but rather caused by the excess of hypoxanthine...... within B. subtilis cells, which may lead to cell stress and death. Importance Biofilms are a bacterial lifestyle with high relevance regarding diverse human activities. Biofilms can be favorable, for instance in crop protection. In nature, biofilms are commonly found as multispecies communities...

Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

Science.gov (United States)

Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

2015-07-01

Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.

The genetics of colony form and function in Caribbean Acropora corals.

Science.gov (United States)

Hemond, Elizabeth M; Kaluziak, Stefan T; Vollmer, Steven V

2014-12-17

Colonial reef-building corals have evolved a broad spectrum of colony morphologies based on coordinated asexual reproduction of polyps on a secreted calcium carbonate skeleton. Though cnidarians have been shown to possess and use similar developmental genes to bilaterians during larval development and polyp formation, little is known about genetic regulation of colony morphology in hard corals. We used RNA-seq to evaluate transcriptomic differences between functionally distinct regions of the coral (apical branch tips and branch bases) in two species of Caribbean Acropora, the staghorn coral, A. cervicornis, and the elkhorn coral, A. palmata. Transcriptome-wide gene profiles differed significantly between different parts of the coral colony as well as between species. Genes showing differential expression between branch tips and bases were involved in developmental signaling pathways, such as Wnt, Notch, and BMP, as well as pH regulation, ion transport, extracellular matrix production and other processes. Differences both within colonies and between species identify a relatively small number of genes that may contribute to the distinct "staghorn" versus "elkhorn" morphologies of these two sister species. The large number of differentially expressed genes supports a strong division of labor between coral branch tips and branch bases. Genes involved in growth of mature Acropora colonies include the classical signaling pathways associated with development of cnidarian larvae and polyps as well as morphological determination in higher metazoans.

Ant colony search algorithm for optimal reactive power optimization

Directory of Open Access Journals (Sweden)

Lenin K.

2006-01-01

Full Text Available The paper presents an (ACSA Ant colony search Algorithm for Optimal Reactive Power Optimization and voltage control of power systems. ACSA is a new co-operative agents’ approach, which is inspired by the observation of the behavior of real ant colonies on the topic of ant trial formation and foraging methods. Hence, in the ACSA a set of co-operative agents called "Ants" co-operates to find good solution for Reactive Power Optimization problem. The ACSA is applied for optimal reactive power optimization is evaluated on standard IEEE, 30, 57, 191 (practical test bus system. The proposed approach is tested and compared to genetic algorithm (GA, Adaptive Genetic Algorithm (AGA.

Spatial Arrangement of Colonies in Intact Biofilms from a Model Cooling Water System

Directory of Open Access Journals (Sweden)

Michael Taylor

2013-01-01

Full Text Available There is disagreement among microbiologists about whether Legionella requires a protozoan host in order to replicate. This research sought to determine where in biofilm Legionellae are found and whether all biofilm associated Legionella would be located within protozoan hosts. While it is accepted that Legionella colonizes biofilm, its life cycle and nutritional fastidiousness suggest that Legionella employs multiple survival strategies to persist within microbial systems. Fluorescent in situ hybridization (FISH and confocal laser scanning microscopy (CLSM demonstrated an undulating biofilm surface architecture and a roughly homogenous distribution of heterotrophic bacteria with clusters of protozoa. Legionella displayed 3 distinct spatial arrangements either contained within or directly associated with protozoa, or dispersed in loosely associated clusters or in tightly packed aggregations of cells forming dense colonial clusters. The formation of discreet clusters of tightly packed Legionella suggests that colony formation is influenced by specific environmental conditions allowing for limited extracellular replication. This work represents the first time that an environmentally representative, multispecies biofilm containing Legionella has been fluorescently tagged and Legionella colony morphology noted within a complex microbial system.

Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

Czech Academy of Sciences Publication Activity Database

Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

2007-01-01

Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

Cellular function reinstitution of offspring red blood cells cloned from the sickle cell disease patient blood post CRISPR genome editing

Directory of Open Access Journals (Sweden)

Jianguo Wen

2017-06-01

Full Text Available Abstract Background Sickle cell disease (SCD is a disorder of red blood cells (RBCs expressing abnormal hemoglobin-S (HbS due to genetic inheritance of homologous HbS gene. However, people with the sickle cell trait (SCT carry a single allele of HbS and do not usually suffer from SCD symptoms, thus providing a rationale to treat SCD. Methods To validate gene therapy potential, hematopoietic stem cells were isolated from the SCD patient blood and treated with CRISPR/Cas9 approach. To precisely dissect genome-editing effects, erythroid progenitor cells were cloned from single colonies of CRISPR-treated cells and then expanded for simultaneous gene, protein, and cellular function studies. Results Genotyping and sequencing analysis revealed that the genome-edited erythroid progenitor colonies were converted to SCT genotype from SCD genotype. HPLC protein assays confirmed reinstallation of normal hemoglobin at a similar level with HbS in the cloned genome-edited erythroid progenitor cells. For cell function evaluation, in vitro RBC differentiation of the cloned erythroid progenitor cells was induced. As expected, cell sickling assays indicated function reinstitution of the genome-edited offspring SCD RBCs, which became more resistant to sickling under hypoxia condition. Conclusions This study is an exploration of genome editing of SCD HSPCs.

Influence of feeding bee colonies on colony strenght and honey authenticity

Directory of Open Access Journals (Sweden)

Andreja KANDOLF BOROVŠAK

2015-12-01

Full Text Available For the natural development of bee colonies, there is the need for appropriate nutrition. Lack of natural honey flow must be supplemented by feeding bee colonies with sugar syrups or candy paste. This supplementary feeding encourages brood breeding and forage activity, whereby stronger colonies collect more honey. Sugar syrups can cause honey adulteration, which is more frequent with the reversing of the brood combs with the bee food, with the combs moved from the brood chamber to the upper chamber. Authentication of honey from the standpoint of the presence of sugar syrup is very complex, because there is no single method by which honey adulteration can be reliably confirmed. Feeding the colonies in spring should result in stronger colonies and hence the collection of more honey in the brood chambers. The objective of the present study was to determine whether this has effects also on honey authenticity, and to discover a simple method for detection of honey adulteration. The colonies were fed with candy paste that had added yeast and blue dye, to provide markers for detection of honey adulteration. The strength of the colonies and quantity of honey in the brood chambers were monitored. The results of the analysis of stable isotope and activity of foreign enzymes were compared with the results of yeast quantity and colour of the honey (absorbance, L*, a*, b* parameters. Detection of yeast in the honey samples and presence of colour as a consequence of added dye appear to be appropriate methods to follow honey adulteration, and further studies are ongoing.

PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

Directory of Open Access Journals (Sweden)

Schmidt Enrico K

2004-05-01

Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

Review Essay A history of colonialism through post-colonial lenses ...

African Journals Online (AJOL)

Review Essay A history of colonialism through post-colonial lenses: reading Mahmood Mamdani's citizen and subject. Sanya Osha. Abstract. No Abstract. The Nigerian Journal of Economic History Vol. 2, 1999: 155-161. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.

Colony formation of C57BL/6J mice in visible burrow system: Identification of eusocial behaviors in a background strain for genetic animal models of autism

OpenAIRE

Arakawa, Hiroyuki; Blanchard, D. Caroline; Blanchard, Robert J.

2006-01-01

Deficits in social interaction are primary characteristics of autism, which has strong genetic components. Genetically-manipulated mouse models may provide a useful research tool to advance the investigation of genes associated with autism. To identify these genes using mouse models, behavioral assays for social relationships in the background strains must be developed. The present study examined colony formation in groups of one male and three female mice (Experiment 1) and, groups of three ...

In Vitro Large Scale Production of Human Mature Red Blood Cells from Hematopoietic Stem Cells by Coculturing with Human Fetal Liver Stromal Cells

Directory of Open Access Journals (Sweden)

Jiafei Xi

2013-01-01

Full Text Available In vitro models of human erythropoiesis are useful in studying the mechanisms of erythroid differentiation in normal and pathological conditions. Here we describe an erythroid liquid culture system starting from cord blood derived hematopoietic stem cells (HSCs. HSCs were cultured for more than 50 days in erythroid differentiation conditions and resulted in a more than 109-fold expansion within 50 days under optimal conditions. Homogeneous erythroid cells were characterized by cell morphology, flow cytometry, and hematopoietic colony assays. Furthermore, terminal erythroid maturation was improved by cosculturing with human fetal liver stromal cells. Cocultured erythroid cells underwent multiple maturation events, including decrease in size, increase in glycophorin A expression, and nuclear condensation. This process resulted in extrusion of the pycnotic nuclei in up to 80% of the cells. Importantly, they possessed the capacity to express the adult definitive β-globin chain upon further maturation. We also show that the oxygen equilibrium curves of the cord blood-differentiated red blood cells (RBCs are comparable to normal RBCs. The large number and purity of erythroid cells and RBCs produced from cord blood make this method useful for fundamental research in erythroid development, and they also provide a basis for future production of available RBCs for transfusion.

Erythropoiesis in the aged mouse. I. Response to stimulation in vivo

International Nuclear Information System (INIS)

Udupa, K.B.; Lipschitz, D.A.

1984-01-01

Changes in erythropoiesis with age were studied by examining the hematocrit increase in response to hypoxia in aged mice and by assessing the change in erythropoiesis following the injection of erythropoietin in young and old polycythemic mice. The increase in hematocrit after exposure to hypoxia was more variable and generally lower in old mice than in young mice. When erythropoietin was injected into polycythemic animals, the increase in differentiated erythroid cells and 59 Fe incorporation into erythroid marrow and peripheral blood cells was significantly lower in old mice than in young mice. In contrast to differentiated erythroid cells, there was less evidence of a reduced response to simulation of the more primitive erythroid progenitor cells of aged animals. The early undifferentiated erythroid progenitor, burst-forming units, did not decrease when either young or aged mice were made polycythemic, and no change following erythropoietin injection was noted. Polycythemia suppressed the late-differentiated erythroid progenitor, erythroid colony-forming units, to a greater extent in aged animals, but when erythropoietin was injected, the percent increase over the subsequent 24 hours was identical to that in young mice. These observations indicate a reduced erythropoietic capacity with age, the abnormality being most obvious in the more mature erythroid precursors

Colonial Legal Reasoning in the Post-Colonial African State: A ...

African Journals Online (AJOL)

Colonial Legal Reasoning in the Post-Colonial African State: A Critique and a Defense of the Argument from African Metaphysical Epistemology. ... Africa, as it has the advantageous result of helping in the search for truth concerning such offences, thereby promoting the delivery of effective legal justice, and thus contributing ...

Life in the colonies: learning the alien ways of colonial organisms.

Science.gov (United States)

Winston, Judith E

2010-12-01

Who needs to go to outer space to study alien beings when the oceans of our own planet abound with bizarre and unknown creatures? Many of them belong to sessile clonal and colonial groups, including sponges, hydroids, corals, octocorals, ascidians, bryozoans, and some polychaetes. Their life histories, in many ways unlike our own, are a challenge for biologists. Studying their ecology, behavior, and taxonomy means trying to “think like a colony” to understand the factors important in their lives. Until the 1980s, most marine ecologists ignored these difficult modular organisms. Plant ecologists showed them ways to deal with the two levels of asexually produced modules and genetic individuals, leading to a surge in research on the ecology of clonal and colonial marine invertebrates. Bryozoans make excellent model colonial animals. Their life histories range from ephemeral to perennial. Aspects of their lives such as growth, reproduction, partial mortality due to predation or fouling, and the behavior of both autozooids and polymorphs can be studied at the level of the colony, as well as that of the individual module, in living colonies and over time.

Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

Science.gov (United States)

Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

2016-12-01

In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

International Nuclear Information System (INIS)

Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

2012-01-01

Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

All you can eat: is food supply unlimited in a colonially breeding bird?

Science.gov (United States)

Hoi, Herbert; Krištofík, Ján; Darolová, Alžbeta

2015-01-01

Food availability is generally considered to determine breeding site selection and therefore plays an important role in hypotheses explaining the evolution of colony formation. Hypotheses trying to explain why birds join a colony usually assume that food is not limited, whereas those explaining variation in colony size suggest that food is under constraint. In this study, we investigate the composition and amount of food items not eaten by the nestlings and found in nest burrows of colonially nesting European bee-eaters (Merops apiaster). We aimed to determine whether this unconsumed food is an indicator of unlimited food supply, the result of mistakes during food transfer between parents and chicks or foraging selectivity of chicks. Therefore, we investigated the amount of dropped food for each nest in relation to reproductive performance and parameters reflecting parental quality. Our data suggest that parents carry more food to the nest than chicks can eat and, hence, food is not limited. This assumption is supported by the facts that there is a positive relationship between dropped food found in a nest and the number of fledglings, nestling age, and chick health condition and that the amount of dropped food is independent of colony size. There is variation in the amount of dropped food within colonies, suggesting that parent foraging efficiency may also be an important determinant. Pairs nesting in the center of a colony performed better than those nesting on the edge, which supports the assumption that quality differences between parents are important as well. However, dropped food cannot be used as an indicator of local food availability as (1) within-colony variation in dropped food is larger than between colony variation and, (2) the average amount of dropped food is not related to colony size.

Geobacillus thermoglucosidasius Endospores Function as Nuclei for the Formation of Single Calcite Crystals

Science.gov (United States)

Murai, Rie

2013-01-01

Geobacillus thermoglucosidasius colonies were placed on an agar hydrogel containing acetate, calcium ions, and magnesium ions, resulting in the formation of single calcite crystals (calcites) within and peripheral to the plating area or parent colony. Microscopic observation of purified calcites placed on the surface of soybean casein digest (SCD) nutrient medium revealed interior crevices from which bacterial colonies originated. Calcites formed on the gel contained [1-13C]- and [2-13C]acetate, demonstrating that G. thermoglucosidasius utilizes carbon derived from acetate for calcite formation. During calcite formation, vegetative cells swam away from the parent colony in the hydrogel. Hard-agar hydrogel inhibited the formation of calcites peripheral to the parent colony. The calcite dissolved completely in 1 M HCl, with production of bubbles, and the remaining endospore-like particles were easily stained with Brilliant green dye. The presence of DNA and protein in calcites was demonstrated by electrophoresis. We propose that endospores initiate the nucleation of calcites. Endospores of G. thermoglucosidasius remain alive and encapsulated in calcites. PMID:23455343

Seabird Colonies in Western Greenland

DEFF Research Database (Denmark)

Boertmann, D.; Mosbech, A.; Falk, K.

About 1 million seabirds (indvs) breed in 1032 colonies distributed along the coasts of western Greenland (Fig. 1). However, this figure does not include the little auk colonies in Avanersuaq. These colonies are roughly estimated to hold about 20 mill. pairs. All the basic information on seabird...... colonies in Greenland is compiled in a database maintained by NERI-AE. This report presents data on distribution, population numbers and population trends of 19 species of breeding colonial seabirds in western Greenland. Distributions are depicted on maps in Fig. 18-39. It is apparent that the major...... colonies are found in the northern part of the region, viz. Upernavik and Avanersuaq. The numbers of birds recorded in the database for each species are presented in Tab. 4, and on the basis of these figures estimates of the populations in western Greenland are given (Tab. 5). The most numerous species...

The regulation of ant colony foraging activity without spatial information.

Directory of Open Access Journals (Sweden)

Balaji Prabhakar

Full Text Available Many dynamical networks, such as the ones that produce the collective behavior of social insects, operate without any central control, instead arising from local interactions among individuals. A well-studied example is the formation of recruitment trails in ant colonies, but many ant species do not use pheromone trails. We present a model of the regulation of foraging by harvester ant (Pogonomyrmex barbatus colonies. This species forages for scattered seeds that one ant can retrieve on its own, so there is no need for spatial information such as pheromone trails that lead ants to specific locations. Previous work shows that colony foraging activity, the rate at which ants go out to search individually for seeds, is regulated in response to current food availability throughout the colony's foraging area. Ants use the rate of brief antennal contacts inside the nest between foragers returning with food and outgoing foragers available to leave the nest on the next foraging trip. Here we present a feedback-based algorithm that captures the main features of data from field experiments in which the rate of returning foragers was manipulated. The algorithm draws on our finding that the distribution of intervals between successive ants returning to the nest is a Poisson process. We fitted the parameter that estimates the effect of each returning forager on the rate at which outgoing foragers leave the nest. We found that correlations between observed rates of returning foragers and simulated rates of outgoing foragers, using our model, were similar to those in the data. Our simple stochastic model shows how the regulation of ant colony foraging can operate without spatial information, describing a process at the level of individual ants that predicts the overall foraging activity of the colony.

Intraspecific Variation among Social Insect Colonies: Persistent Regional and Colony-Level Differences in Fire Ant Foraging Behavior.

Directory of Open Access Journals (Sweden)

Alison A Bockoven

Full Text Available Individuals vary within a species in many ecologically important ways, but the causes and consequences of such variation are often poorly understood. Foraging behavior is among the most profitable and risky activities in which organisms engage and is expected to be under strong selection. Among social insects there is evidence that within-colony variation in traits such as foraging behavior can increase colony fitness, but variation between colonies and the potential consequences of such variation are poorly documented. In this study, we tested natural populations of the red imported fire ant, Solenopsis invicta, for the existence of colony and regional variation in foraging behavior and tested the persistence of this variation over time and across foraging habitats. We also reared single-lineage colonies in standardized environments to explore the contribution of colony lineage. Fire ants from natural populations exhibited significant and persistent colony and regional-level variation in foraging behaviors such as extra-nest activity, exploration, and discovery of and recruitment to resources. Moreover, colony-level variation in extra-nest activity was significantly correlated with colony growth, suggesting that this variation has fitness consequences. Lineage of the colony had a significant effect on extra-nest activity and exploratory activity and explained approximately half of the variation observed in foraging behaviors, suggesting a heritable component to colony-level variation in behavior.

Effect of Co-Culturing of Mice Liver Cells and Embryonic Carcinomatous Stem Cells on the Rate of Differentiation to Hematopoietic Cells

Directory of Open Access Journals (Sweden)

AA Pourfatollah

2005-10-01

Full Text Available Introduction: Considering the importance of co-culture in differentiation of embryonic stem cells, the aim of this study was evaluation of the effect of co-culturing fetal liver stroma cells with P19 cells on the line of differentiation. Materials and Methods: For this purpose, P19 cells were cultured directly in semisolid medium. These cells proliferated and primarily differentiated to colonies know as embryoid bodies (EBs after 8-12 days. The Ebs cells were trypsinized and dissociated to single or double cells. Then these cells were co-cultured on the mouse fetal liver feeder layer in the absence of exogenous factors. After 14-18 days, the colonies were studied morphologically by benzidine and giemsa staining and also counted under invert microscope. Results: The percentages of benzidine positive (or erythroid and negative colonies were 94% and 6% respectively and also the cells of colonies were studied by Giemsa staining. Results showed that they were myeloid or lymphoid type cells. Thus, the results show that in the presence of mouse fetal liver feeder layer, the number of erythroid colonies was increased. Conclusions: Therefore, this technique may be effective for differentiation of stem cells from different sources into hematopoietic cells and can be used in future for human cell therapy.

A Burkholderia pseudomallei colony variant necessary for gastric colonization.

Science.gov (United States)

Austin, C R; Goodyear, A W; Bartek, I L; Stewart, A; Sutherland, M D; Silva, E B; Zweifel, A; Vitko, N P; Tuanyok, A; Highnam, G; Mittelman, D; Keim, P; Schweizer, H P; Vázquez-Torres, A; Dow, S W C; Voskuil, M I

2015-02-03

colony variant was the only form capable of chronic stomach colonization. Areas of gastric infection were marked by bacteria encased in a DNA matrix, and the yellow forms were able to produce large amounts of extracellular DNA in vitro. We also identified the regulator in control of yellow colony variant formation. These findings demonstrate a role in infection for colony variation and provide a mechanism for chronic stomach colonization-a frequently overlooked niche in melioidosis. Copyright © 2015 Austin et al.

DYNAMICS OF NUMBER OF GREY HERONS (ARDEA CINEREA L. COLONY IN THE UPPER COURSE OF ZAPOROZHYE (DNEPROVSKOYE RESERVOIR

Directory of Open Access Journals (Sweden)

Vovk M.V.

2012-11-01

Full Text Available The research was performed in the area of natural reserve "Dneprovsko-Orelsky" and its adjacent territory – the island Pogorely. We discovered the changes of number of grey heron in colonial settlements, determined the principal factors influencing the formation of spatial structure of island bird communities. The analysis of nest distribution towards tree breeding biotopes was performed and stability of spatial structure of bird colonies was proved. We were tracking the number dynamics of pioneer colony and revealed the principal ecological and anthropogenic factors influencing the fluctuation of its abundance.

Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

Directory of Open Access Journals (Sweden)

Reed Christopher

2009-11-01

Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

The role of tumor suppressor p15Ink4b in the regulation of hematopoietic progenitor cell fate

International Nuclear Information System (INIS)

Humeniuk, R; Rosu-Myles, M; Fares, J; Koller, R; Bies, J; Wolff, L

2013-01-01

Epigenetic silencing of the tumor suppressor gene p15Ink4b (CDKN2B) is a frequent event in blood disorders like acute myeloid leukemia and myelodysplastic syndromes. The molecular function of p15Ink4b in hematopoietic differentiation still remains to be elucidated. Our previous study demonstrated that loss of p15Ink4b in mice results in skewing of the differentiation pattern of the common myeloid progenitor towards the myeloid lineage. Here, we investigated a function of p15Ink4b tumor suppressor gene in driving erythroid lineage commitment in hematopoietic progenitors. It was found that p15Ink4b is expressed more highly in committed megakaryocyte–erythroid progenitors than granulocyte–macrophage progenitors. More importantly, mice lacking p15Ink4b have lower numbers of primitive red cell progenitors and a severely impaired response to 5-fluorouracil- and phenylhydrazine-induced hematopoietic stress. Introduction of p15Ink4b into multipotential progenitors produced changes at the molecular level, including activation of mitogen-activated protein kinase/extracellular signal-regulated kinase (MEK/ERK) signaling, increase GATA-1, erythropoietin receptor (EpoR) and decrease Pu1, GATA-2 expression. These changes rendered cells more permissive to erythroid commitment and less permissive to myeloid commitment, as demonstrated by an increase in early burst-forming unit-erythroid formation with concomitant decrease in myeloid colonies. Our results indicate that p15Ink4b functions in hematopoiesis, by maintaining proper lineage commitment of progenitors and assisting in rapid red blood cells replenishment following stress

In vitro study on chromosomal abnormality, proliferation and differentiation of hemopoietic stem cells from atomic bomb exposures and patients with acute leukemia and related disorders

Energy Technology Data Exchange (ETDEWEB)

Amenomori, Tatsuhiko

1988-12-01

By using in vitro cloning method and cytogenetic analysis from single hemopoietic colonies, the kinetics of differentiation and proliferation, and chromosomal abnormalities of hemopoietic stem cells (CFU-GM, BFU-E) from atomic bomb exposures and patients with acute leukemia and myelodysplastic syndrome (MDS) were investigated. High incidence (24 colonies/ 206 total colonies; 11.7%) of irradiation-induced chromosomal abnormalities was observed in circulating hemopoietic stem cells from 21 high dose exposures. In two individuals, karyotypic abnormalities closely resembling those observed in the peripheral T lymphocytes were also seen in the myeloid stem cells (BFU-E). This finding suggests that totipotential stem cells common to myeloid and lymphoid lineages exist in healthy human adults and atomic bomb irradiation produced chromosomal aberrations in them. In each of 5 MDS cases with both GM colony and erythroid burst formation, identical marker chromosomes were seen in CFU-GM and BFU-E. This finding demonstrates that MDS is a clonal hemopathy that originates in a pluripotential stem cell. Whether acute leukemia is also a clonal hemopathy originating in a pluripotential stem cell remains to be determined. But there was a considerable heterogeneity in kinetics of proliferation and in responsiveness to colony stimulating factors among these cases. (author) 54 refs.

Kant's Second Thoughts on Colonialism

NARCIS (Netherlands)

Kleingeld, Pauline; Flikschuh, Katrin; Ypi, Lea

2014-01-01

Kant is widely regarded as a fierce critic of colonialism. In Toward Perpetual Peace and the Metaphysics of Morals, for example, he forcefully condemns European conduct in the colonies as a flagrant violation of the principles of right. His earlier views on colonialism have not yet received much

The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

NARCIS (Netherlands)

von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

1999-01-01

Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

Behavioral Modulation of Infestation by Varroa destructor in Bee Colonies. Implications for Colony Stability.

Science.gov (United States)

de Figueiró Santos, Joyce; Coelho, Flávio Codeço; Bliman, Pierre-Alexandre

2016-01-01

Colony Collapse Disorder (CCD) has become a global problem for beekeepers and for the crops that depend on bee pollination. While many factors are known to increase the risk of colony collapse, the ectoparasitic mite Varroa destructor is considered to be the most serious one. Although this mite is unlikely to cause the collapse of hives itself, it is the vector for many viral diseases which are among the likely causes for Colony Collapse Disorder. The effects of V. destructor infestation differ from one part of the world to another, with greater morbidity and higher colony losses in European honey bees (EHB) in Europe, Asia and North America. Although this mite has been present in Brazil for many years, there have been no reports of colony losses amongst Africanized Honey Bees (AHB). Studies carried out in Mexico have highlighted different behavioral responses by the AHB to the presence of the mite, notably as far as grooming and hygienic behavior are concerned. Could these explain why the AHB are less susceptible to Colony Collapse Disorder? In order to answer this question, we have developed a mathematical model of the infestation dynamics to analyze the role of resistance behavior by bees in the overall health of the colony, and as a consequence, its ability to face epidemiological challenges.

Behavioral Modulation of Infestation by Varroa destructor in Bee Colonies. Implications for Colony Stability.

Directory of Open Access Journals (Sweden)

Joyce de Figueiró Santos

Full Text Available Colony Collapse Disorder (CCD has become a global problem for beekeepers and for the crops that depend on bee pollination. While many factors are known to increase the risk of colony collapse, the ectoparasitic mite Varroa destructor is considered to be the most serious one. Although this mite is unlikely to cause the collapse of hives itself, it is the vector for many viral diseases which are among the likely causes for Colony Collapse Disorder. The effects of V. destructor infestation differ from one part of the world to another, with greater morbidity and higher colony losses in European honey bees (EHB in Europe, Asia and North America. Although this mite has been present in Brazil for many years, there have been no reports of colony losses amongst Africanized Honey Bees (AHB. Studies carried out in Mexico have highlighted different behavioral responses by the AHB to the presence of the mite, notably as far as grooming and hygienic behavior are concerned. Could these explain why the AHB are less susceptible to Colony Collapse Disorder? In order to answer this question, we have developed a mathematical model of the infestation dynamics to analyze the role of resistance behavior by bees in the overall health of the colony, and as a consequence, its ability to face epidemiological challenges.

Colonialism, customary law and the post-colonial state in Africa: the ...

African Journals Online (AJOL)

Colonialism became a fact of life in many African countries. An effect of colonialism especially in the former British colonized countries was the transplantation of the British legal system, which led to recognition of both systems and the gradual relegation of the indigenous system otherwise called customary law. The use and ...

Public Heath in Colonial and Post-Colonial Ghana: Lesson-Drawing for The Twenty-First Century

Directory of Open Access Journals (Sweden)

Adu-Gyamfi, Samuel

2017-06-01

Full Text Available Public health in twenty-first century Ghana is mired with several issues ranging from the inadequacy of public health facilities, improper settlement planning, insanitary conditions, and the inadequacy of laws and their implementation. This situation compared to the colonial era is a direct contradiction. Development in the pre-colonial era to the colonial era sought to make the prevention of diseases a priority in the colonial administration. This was begun with the establishment of the health branch in 1909 as a response to the bubonic plague that was fast spreading in the colony. From here public health policies and strategies were enacted to help the diseases prevention cause. Various public health boards, the medical research institute or the laboratory branch, the waste management department, the use of preventive medicine and maintenance of good settlement planning and sanitation were public health measures in the colonial era. This research seeks to analyse the public health system in the colonial era so as to draw basic lessons for twenty-first century Ghana. Archival data and other secondary sources are reviewed and analysed to help draw these lessons. Richard Rose’s lesson-drawing approach was used to draw the lessons.

Hemopoiesis in mouse heterozygous for the W trait. Difference in postirradiation recovery related to the defect in formation of transient endogenous spleen colonies

International Nuclear Information System (INIS)

Wiktor-Jedrzejczak, W.; Urbanowska, E.; Szczylik, C.; Siekierzynski, M.; Pojda, Z.

1985-01-01

The hemopoietic regeneration following midlethal irradiation in Wsup(v)/+ mice had similarly biphasic kinetics as in their hematologically normal +/+ littermates. The first abortive phase of regeneration was either severly reduced (formation of transient endogenous spleen colonies, reticulocyte count, granulocyte count) or absent (spleen and femur cellularity, platelet count, PCV) in Wsup(v)/+ mice, when compared to +/+ mice. The second phase leading to permanent recovery of hemopoiesis was in Wsup(v)/+ mice delayed in time. Moreover, although to a lesser extent the values of spleen and femur cellularity, PCV and platelet count were decreased in Wsup(v)/+ mice. Postirradiation bleeding, which stimulated particularly the 1st phase of regeneration both in Wsup(v)/+ and +/+ mice did not lead to the minimization of differences between above two genotypes. It is suggested that the observed differences in the abortive regeneration between Wsup(v)/+ and +/+ mice are primarily dependent on the presence in Wsup(v)/+ mice of selective defect of transient endogeneous colony forming units (TE-CFUs). Moreover, it is possible that the differences in the second phase of regeneration leading to permanent recovery are secondarily dependent on the TE-CFUs defect, as most probably the TE-CFU is the step in stem cell differentiation to mature cells. (orig.) [de

Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

Directory of Open Access Journals (Sweden)

Gloria Bua

Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

Science.gov (United States)

Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

2016-01-01

The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

Science.gov (United States)

Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

2011-01-01

Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

Science.gov (United States)

Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

2017-07-11

Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

Directory of Open Access Journals (Sweden)

Alessandro Di Tullio

2017-07-01

Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

Science.gov (United States)

Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

2015-11-01

Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

Dynamics of the Presence of Israeli Acute Paralysis Virus in Honey Bee Colonies with Colony Collapse Disorder

Directory of Open Access Journals (Sweden)

Chunsheng Hou

2014-05-01

Full Text Available The determinants of Colony Collapse Disorder (CCD, a particular case of collapse of honey bee colonies, are still unresolved. Viruses including the Israeli acute paralysis virus (IAPV were associated with CCD. We found an apiary with colonies showing typical CCD characteristics that bore high loads of IAPV, recovered some colonies from collapse and tested the hypothesis if IAPV was actively replicating in them and infectious to healthy bees. We found that IAPV was the dominant pathogen and it replicated actively in the colonies: viral titers decreased from April to September and increased from September to December. IAPV extracted from infected bees was highly infectious to healthy pupae: they showed several-fold amplification of the viral genome and synthesis of the virion protein VP3. The health of recovered colonies was seriously compromised. Interestingly, a rise of IAPV genomic copies in two colonies coincided with their subsequent collapse. Our results do not imply IAPV as the cause of CCD but indicate that once acquired and induced to replication it acts as an infectious factor that affects the health of the colonies and may determine their survival. This is the first follow up outside the US of CCD-colonies bearing IAPV under natural conditions.

O ensino jesuítico no período colonial brasileiro: algumas discussões Discussions on jesuit teaching in Brazil during the colonial period

Directory of Open Access Journals (Sweden)

Alexandre Shigunov Neto

2008-01-01

Full Text Available O presente artigo pretende realizar uma análise do ensino jesuítico implementado no período colonial brasileiro e demonstrar que a estrutura escolar fundada pelos padres jesuítas no Brasil era adequada para o momento histórico vivenciado, levando-se em consideração quatro aspectos: os objetivos do Projeto Português para o Brasil; o projeto educacional Jesuítico; a própria estrutura social brasileira da época; e o modelo de homem necessário para a época Colonial. Os jesuítas, com seu Projeto Educacional, e os portugueses que vieram para a colônia brasileira em busca de riquezas, tiveram papel fundamental na formação da estrutura social, administrativa e produtiva da sociedade que estava sendo formada. Partindo do pressuposto de que o fenômeno educacional não é um fenômeno independente e autônomo da realidade social de determinado momento histórico, devemos analisar o projeto jesuítico levando-se em conta o desenvolvimento social e produtivo da época colonial. Assim, pode-se supor que o modelo educacional proposto pelos jesuítas, que pretendia formar um modelo de homem, baseado nos princípios escolásticos, era coerente com as necessidades e aspirações de uma sociedade em formação na primeira fase do período colonial brasileiro.Jesuit teaching in Brazil during the colonial period is analyzed. It may even be proved that the schooling structure established by the Jesuit fathers was extremely adequate for that specific historical period. Four aspects may be taken into account: the aims of the Portuguese Project for Brazil; the Jesuit Educational Project; the Brazilian social structure at that time; and the human model needed for the colonial period. The Jesuits' Educational Project and the Portuguese colonizers that came to the colony in search of wealth have an important role in the formation of the social, administrative and productive structure of a society in constant evolution. Since the educational phenomenon

Globalization in the post - colonial world

Directory of Open Access Journals (Sweden)

Korobeynikova Larisa A.

2016-01-01

Full Text Available The paper presents a new interpretation of globalization within the boundaries of the author’s concept of soft globalization, which exploits a normatively attractive alternative to the concept of the Empire. It is argued here that the conditions of development of contemporary post - colonial world communities do not require any unification in the form of the Empire, but instead the creation of a non repressive mechanism of social regulation - the implementation of a form of soft globalization, a globalization with a mental form are expedient here. Historically, globalization occurred in a strict material(i.e. economical and military form that prompted the conditions for the evolution of civilization as the Empire: a case in which the development of the world occurs under the power of a single dominating state. Imperialistic politics leads to colonial politics formation. The history of the phenomena of civilization shows many instances of Empire globalization. Globalization in the Empire form was already observed at the time of the Roman Empire. At this time processes of development inside the Empire were manifestations of globalization in its highest cultural shape. But ancient Rome was also a social and political experiment that acquired the attributes of a purely material globalization in the end, and historically brought about the irreversible crash of the Roman Empire itself. Contemporary fluctuations referring to the process of globalization can be registered in the US’s attempts of material domination inside this or that existing case of civilization, which causes colonialism appearance. The main idea stressed in the paper is that only a mental globalization could succeed in the end.

Targeted Gene Deletion Demonstrates that Cell Adhesion MoleculeICAM-4 is Critical for Erythroblastic Island Formation

Energy Technology Data Exchange (ETDEWEB)

Lee, Gloria; Lo, Annie; Short, Sarah A.; Mankelow, Tosti J.; Spring, Frances; Parsons, Stephen F.; Mohandas, Narla; Anstee, David J.; Chasis, Joel Anne

2006-02-15

Erythroid progenitors differentiate in erythroblastic islands, bone marrow niches composed of erythroblasts surrounding a central macrophage. Evidence suggests that within islands adhesive interactions regulate erythropoiesis and apoptosis. We are exploring whether erythroid intercellular adhesion molecule-4 (ICAM-4), animmunoglobulin superfamily member, participates in island formation. Earlier, we identified alpha V integrins as ICAM-4 counter receptors. Since macrophages express alpha V, ICAM-4 potentially mediates island attachments. To test this, we generated ICAM-4 knockout mice and developed quantitative, live cell techniques for harvesting intact islands and for reforming islands in vitro. We observed a 47 percent decrease in islands reconstituted from ICAM-4 null marrow compared to wild type. We also found a striking decrease in islands formed in vivo in knockout mice. Further, peptides that block ICAM-4 alpha V adhesion produced a 53-57 percent decrease in reconstituted islands, strongly suggesting that ICAM-4 binding to macrophage alpha V functions in island integrity. Importantly, we documented that alpha V integrin is expressed in macrophages isolated from erythro blastic islands. Collectively, these data provide convincing evidence that ICAM-4 is critical in erythroblastic island formation via ICAM-4/alpha V adhesion and also demonstrate that the novel experimental strategies we developed will be valuable in exploring molecular mechanisms of erythroblastic island formation and their functional role in regulating erythropoiesis.

Regulated proliferation of primitive hematopoietic progenitor cells in long-term human marrow cultures

International Nuclear Information System (INIS)

Cashman, J.; Eaves, A.C.; Eaves, C.J.

1985-01-01

We have examined the cycling status of various classes of erythroid and granulopoietic progenitor populations maintained for many weeks in standard normal long-term human marrow cultures. These were initiated with a single inoculum of marrow aspirate and were routinely fed by weekly removal of half of the nonadherent cells and replacement of half of the growth medium. Progenitors of large erythroid colonies (more than eight erythroblast clusters) present in the nonadherent fraction and progenitors of small granulocyte/macrophage colonies (fewer than 500 cells) present in both the nonadherent and adherent fractions were found to be actively cycling at all times examined (28% to 63% kill following a 20-minute exposure to 20 microCi/mL of high specific activity 3 H-thymidine). In contrast, progenitors of large granulocyte/macrophage colonies (more than 500 cells) and progenitors of large erythroid colonies (more than eight erythroblast clusters), present in the adherent layer, consistently alternated between a quiescent state at the time of each weekly medium change and a proliferating state two to three days later (0% to 13% kill and 21% to 49% kill, respectively). Additional experiments revealed that the activation of primitive progenitors in the adherent layer was not dependent on the addition of fresh glutamine or hydrocortisone, nor on the physical manipulations involved in changing the growth medium. These studies provide the first direct evidence that normal long-term human marrow cultures support the continued turnover of a variety of early hematopoietic progenitor cell types. Further, they indicate that the proliferative activity of the most primitive of these progenitors is regulated by stage-specific cell-cell interactions that are subject to manipulation

Negotiating Colonial Korean Cinema in the Japanese Empire: From the Silent Era to the Talkies, 1923-1939

Directory of Open Access Journals (Sweden)

Chonghwa Chung

2012-12-01

Full Text Available This article examines what I call a “system of cooperation” (K. hyŏp’ŏp, J. kyōgyō, 協業 in the colonial Korean film industry from 1923, when silent films appeared, to the late 1930s, when colonial cinema was restructured within an imperial wartime system. In other words, this article examines the interworking of colonial Korean and imperial Japanese cinema from Yun Hae-dong’s “colonial modern” perspective in order to go beyond the long established lens on colonial Korean film and film historiography that merely focused on the contributions of colonial Korean filmmakers. Here the author rather focuses on the cooperation or collaboration between Japan and Korea: Japanese directors and cinematographers working in Korea, Korean filmmakers with experience in the Japanese apprenticeship system, and filmmakers working together and independently during the silent film era. During the transition from the silent to the early talkie eras, second-generation filmmakers, especially those who trained in film studios in Japan, were significant. They dreamed of the corporatization of the colonial Korean film industry and took the lead in coproductions between Japanese film companies and their colonial Korean counterparts. Korean filmmakers were not unilaterally suppressed by imperial Japan, nor did they independently operate within the Korean film industry during the colonial period. The Japanese in colonial Korea did not take the lead in forming the colonial Korean film scene, either. The core formation of colonial Korean / Korean film was a process of Korean and Japanese filmmakers in competition and negotiation with one another within a complex film sphere launched with Japanese capital and technology.

Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow

International Nuclear Information System (INIS)

Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.

1976-01-01

The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors

Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

Science.gov (United States)

Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

2016-07-15

Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

Growth Mechanism of Microbial Colonies

Science.gov (United States)

Zhu, Minhui; Martini, K. Michael; Kim, Neil H.; Sherer, Nicholas; Lee, Jia Gloria; Kuhlman, Thomas; Goldenfeld, Nigel

Experiments on nutrient-limited E. coli colonies, growing on agar gel from single cells reveal a power-law distribution of sizes, both during the growth process and in the final stage when growth has ceased. We developed a Python simulation to study the growth mechanism of the bacterial population and thus understand the broad details of the experimental findings. The simulation takes into account nutrient uptake, metabolic function, growth and cell division. Bacteria are modeled in two dimensions as hard circle-capped cylinders with steric interactions and elastic stress dependent growth characteristics. Nutrient is able to diffuse within and between the colonies. The mechanism of microbial colony growth involves reproduction of cells within the colonies and the merging of different colonies. We report results on the dynamic scaling laws and final state size distribution, that capture in semi-quantitative detail the trends observed in experiment. Supported by NSF Grant 0822613.

Pollen foraging in colonies of Melipona bicolor (Apidae, Meliponini): effects of season, colony size and queen number.

Science.gov (United States)

Hilário, S D; Imperatriz-Fonseca, V L

2009-01-01

We evaluated the ratio between the number of pollen foragers and the total number of bees entering colonies of Melipona bicolor, a facultative polygynous species of stingless bees. The variables considered in our analysis were: seasonality, colony size and the number of physogastric queens in each colony. The pollen forager ratios varied significantly between seasons; the ratio was higher in winter than in summer. However, colony size and number of queens per colony had no significant effect. We conclude that seasonal differences in pollen harvest are related to the production of sexuals and to the number of individuals and their body size.

[Update on the biology of heme synthesis in erythroid cells].

Science.gov (United States)

Fujiwara, Tohru; Harigae, Hideo

2015-02-01

Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

Differential gene expression of two extreme honey bee (Apis mellifera) colonies showing varroa tolerance and susceptibility.

Science.gov (United States)

Jiang, S; Robertson, T; Mostajeran, M; Robertson, A J; Qiu, X

2016-06-01

Varroa destructor, an ectoparasitic mite of honey bees (Apis mellifera), is the most serious pest threatening the apiculture industry. In our honey bee breeding programme, two honey bee colonies showing extreme phenotypes for varroa tolerance/resistance (S88) and susceptibility (G4) were identified by natural selection from a large gene pool over a 6-year period. To investigate potential defence mechanisms for honey bee tolerance to varroa infestation, we employed DNA microarray and real time quantitative (PCR) analyses to identify differentially expressed genes in the tolerant and susceptible colonies at pupa and adult stages. Our results showed that more differentially expressed genes were identified in the tolerant bees than in bees from the susceptible colony, indicating that the tolerant colony showed an increased genetic capacity to respond to varroa mite infestation. In both colonies, there were more differentially expressed genes identified at the pupa stage than at the adult stage, indicating that pupa bees are more responsive to varroa infestation than adult bees. Genes showing differential expression in the colony phenotypes were categorized into several groups based on their molecular functions, such as olfactory signalling, detoxification processes, exoskeleton formation, protein degradation and long-chain fatty acid metabolism, suggesting that these biological processes play roles in conferring varroa tolerance to naturally selected colonies. Identification of differentially expressed genes between the two colony phenotypes provides potential molecular markers for selecting and breeding varroa-tolerant honey bees. © 2016 The Royal Entomological Society.

Colony, hanging drop, and methylcellulose three dimensional hypoxic growth optimization of renal cell carcinoma cell lines.

Science.gov (United States)

Matak, Damian; Brodaczewska, Klaudia K; Lipiec, Monika; Szymanski, Łukasz; Szczylik, Cezary; Czarnecka, Anna M

2017-08-01

Renal cell carcinoma (RCC) is the most lethal of the common urologic malignancies, comprising 3% of all human neoplasms, and the incidence of kidney cancer is rising annually. We need new approaches to target tumor cells that are resistant to current therapies and that give rise to recurrence and treatment failure. In this study, we focused on low oxygen tension and three-dimensional (3D) cell culture incorporation to develop a new RCC growth model. We used the hanging drop and colony formation methods, which are common in 3D culture, as well as a unique methylcellulose (MC) method. For the experiments, we used human primary RCC cell lines, metastatic RCC cell lines, human kidney cancer stem cells, and human healthy epithelial cells. In the hanging drop assay, we verified the potential of various cell lines to create solid aggregates in hypoxic and normoxic conditions. With the semi-soft agar method, we also determined the ability of various cell lines to create colonies under different oxygen conditions. Different cell behavior observed in the MC method versus the hanging drop and colony formation assays suggests that these three assays may be useful to test various cell properties. However, MC seems to be a particularly valuable alternative for 3D cell culture, as its higher efficiency of aggregate formation and serum independency are of interest in different areas of cancer biology.

Political instability and discontinuity in Nigeria: The pre-colonial past and public goods provision under colonial and post-colonial political orders

NARCIS (Netherlands)

Papaioannou, K.I.; Dalrymple-Smith, A.E.

2015-01-01

This article explores the relative importance of pre-colonial institutional capacity and the effects of periods of peace and stability on long-term development outcomes in Nigeria. We use data on education, health, and public works at a provincial level from a variety of colonial and Nigerian state

Post-UV colony-forming ability of normal fibroblast strains and of the xeroderma pigmentosum group G strain

International Nuclear Information System (INIS)

Barrett, S.F.; Tarone, R.E.; Moshell, A.N.; Ganges, M.B.; Robbins, J.H.

1981-01-01

In xeroderma pigmentosum, an inherited disorder of defective DNA repair, post-uv colony-forming ability of fibroblasts from patients in complementation groups A through F correlates with the patients' neurological status. The first xeroderma pigmentosum patient assigned to the recently discovered group G had the neurological abnormalities of XP. Researchers have determined the post-uv colony-forming ability of cultured fibroblasts from this patient and from 5 more control donors. Log-phase fibroblasts were irradiated with 254 nm uv light from a germicidal lamp, trypsinized, and replated at known densities. After 2 to 4 weeks' incubation the cells were fixed, stained and scored for colony formation. The strains' post-uv colony-forming ability curves were obtained by plotting the log of the percent remaining post-uv colony-forming ability as a function of the uv dose. The post-uv colony-forming ability of 2 of the 5 new normal strains was in the previously defined control donor zone, but that of the other 3 extended down to the level of the most resistant xeroderma pigmentosum strain. The post-uv colony-forming ability curve of the group G fibroblasts was not significantly different from the curves of the group D fibroblast strains from patients with clinical histories similar to that of the group G patient

Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

Directory of Open Access Journals (Sweden)

Ali Dehghanifard

2012-07-01

Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

A branching process model for the analysis of abortive colony size distributions in carbon ion-irradiated normal human fibroblasts

International Nuclear Information System (INIS)

Sakashita, Tetsuya; Kobayashi, Yasuhiko; Hamada, Nobuyuki; Kawaguchi, Isao; Hara, Takamitsu; Saito, Kimiaki

2014-01-01

A single cell can form a colony, and ionizing irradiation has long been known to reduce such a cellular clonogenic potential. Analysis of abortive colonies unable to continue to grow should provide important information on the reproductive cell death (RCD) following irradiation. Our previous analysis with a branching process model showed that the RCD in normal human fibroblasts can persist over 16 generations following irradiation with low linear energy transfer (LET) γ-rays. Here we further set out to evaluate the RCD persistency in abortive colonies arising from normal human fibroblasts exposed to high-LET carbon ions (18.3 MeV/u, 108 keV/μm). We found that the abortive colony size distribution determined by biological experiments follows a linear relationship on the log–log plot, and that the Monte Carlo simulation using the RCD probability estimated from such a linear relationship well simulates the experimentally determined surviving fraction and the relative biological effectiveness (RBE). We identified the short-term phase and long-term phase for the persistent RCD following carbon-ion irradiation, which were similar to those previously identified following γ-irradiation. Taken together, our results suggest that subsequent secondary or tertiary colony formation would be invaluable for understanding the long-lasting RCD. All together, our framework for analysis with a branching process model and a colony formation assay is applicable to determination of cellular responses to low- and high-LET radiation, and suggests that the long-lasting RCD is a pivotal determinant of the surviving fraction and the RBE. (author)

Queen promiscuity lowers disease within honeybee colonies

Science.gov (United States)

Seeley, Thomas D; Tarpy, David R

2006-01-01

Most species of social insects have singly mated queens, but in some species each queen mates with numerous males to create a colony with a genetically diverse worker force. The adaptive significance of polyandry by social insect queens remains an evolutionary puzzle. Using the honeybee (Apis mellifera), we tested the hypothesis that polyandry improves a colony's resistance to disease. We established colonies headed by queens that had been artificially inseminated by either one or 10 drones. Later, we inoculated these colonies with spores of Paenibacillus larvae, the bacterium that causes a highly virulent disease of honeybee larvae (American foulbrood). We found that, on average, colonies headed by multiple-drone inseminated queens had markedly lower disease intensity and higher colony strength at the end of the summer relative to colonies headed by single-drone inseminated queens. These findings support the hypothesis that polyandry by social insect queens is an adaptation to counter disease within their colonies. PMID:17015336

JAX Colony Management System (JCMS): an extensible colony and phenotype data management system.

Science.gov (United States)

Donnelly, Chuck J; McFarland, Mike; Ames, Abigail; Sundberg, Beth; Springer, Dave; Blauth, Peter; Bult, Carol J

2010-04-01

The Jackson Laboratory Colony Management System (JCMS) is a software application for managing data and information related to research mouse colonies, associated biospecimens, and experimental protocols. JCMS runs directly on computers that run one of the PC Windows operating systems, but can be accessed via web browser interfaces from any computer running a Windows, Macintosh, or Linux operating system. JCMS can be configured for a single user or multiple users in small- to medium-size work groups. The target audience for JCMS includes laboratory technicians, animal colony managers, and principal investigators. The application provides operational support for colony management and experimental workflows, sample and data tracking through transaction-based data entry forms, and date-driven work reports. Flexible query forms allow researchers to retrieve database records based on user-defined criteria. Recent advances in handheld computers with integrated barcode readers, middleware technologies, web browsers, and wireless networks add to the utility of JCMS by allowing real-time access to the database from any networked computer.

Single-Cell Network Analysis Identifies DDIT3 as a Nodal Lineage Regulator in Hematopoiesis

Directory of Open Access Journals (Sweden)

Cristina Pina

2015-06-01

Full Text Available We explore cell heterogeneity during spontaneous and transcription-factor-driven commitment for network inference in hematopoiesis. Since individual genes display discrete OFF states or a distribution of ON levels, we compute and combine pairwise gene associations from binary and continuous components of gene expression in single cells. Ddit3 emerges as a regulatory node with positive linkage to erythroid regulators and negative association with myeloid determinants. Ddit3 loss impairs erythroid colony output from multipotent cells, while forcing Ddit3 in granulo-monocytic progenitors (GMPs enhances self-renewal and impedes differentiation. Network analysis of Ddit3-transduced GMPs reveals uncoupling of myeloid networks and strengthening of erythroid linkages. RNA sequencing suggests that Ddit3 acts through development or stabilization of a precursor upstream of GMPs with inherent Meg-E potential. The enrichment of Gata2 target genes in Ddit3-dependent transcriptional responses suggests that Ddit3 functions in an erythroid transcriptional network nucleated by Gata2.

Collective Memories of Portuguese Colonial Action in Africa: Representations of the Colonial Past among Mozambicans and Portuguese Youths

Directory of Open Access Journals (Sweden)

João Feijó

2010-05-01

Full Text Available Social representations of the colonization and decolonization processes among young people from a former European colonial power (Portugal and from an African ex-colony (Mozambique were investigated through surveys using open- and closed-ended questions about national history, focusing on the identity functions of collective memories. Hegemonic and contested representations were found of the most prominent events related to Portuguese colonization of Mozambique, arousing a range of collective emotions. A central place is occupied by memories of the Colonial War, which ended with the Carnation Revolution in Portugal and the subsequent independence of the Portuguese African colonies. Overall, the depiction of colonialism was more negative for Mozambican than for Portuguese participants. The violent effects of colonial action were very salient in Mozambican memories, which stressed the most oppressive aspects of the colonial period, associated with slave trade and brutal repression. On the Portuguese side, the idealization of the voyages of discovery persisted, obscuring the most violent effects of colonial expansion. However, collective memories of colonization of former colonizer and former colonized do not simply stand opposed. Both Mozambican and Portuguese participants reported ambivalent feelings towards the colonization process.

Relationship between lung colony and in situ assays

International Nuclear Information System (INIS)

Ando, K.; Koike, S.

1985-01-01

The relationship between different assays: tumor control, tumor growth delay and lung colony formation was examined after fast neutron and γ ray irradiations. Fibrosarcomas (NFSa) in syngeneic C3Hf mice were irradiated locally with 60 Co γ rays, fast neutrons or mixed beams (γ rays and fast neutrons). A comparison between the lung colony assay and the TRT 50 (50% tumor growth delay time) assay when cells were exposed to single doses of fast neutrons or γ rays, resulted in identical growth delay times. The fraction of cells surviving a single dose of fast neutrons, was 10 times higher than the surviving fraction of cells after a single dose of γ rays. Both doses resulted in the same tumor control probability (TCD 50 assay). Neither repair of potentially lethal damage nor tumor bed effect was sufficient to explain the difference between cell survival and tumor control probability. The surviving fraction of cells following fractionated irradiations of γ rays and fast neutrons were identical at 50% tumor control probabilities

Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

OpenAIRE

Walker, Aisha L.; Ofori-Acquah, Solomon

2016-01-01

The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

Post-colonial identity in Greenland?

DEFF Research Database (Denmark)

Gad, Ulrik Pram

2009-01-01

could be furthered by bringing politics back in. Based on a discourse analysis of the Greenlandic debate on language, this paper makes three claims: First, the identity projects promoted in Greenland are based on an essentialist conception of identity. Secondly, Greenlandic identity discourse combines......In the gradual unravelling of Greenland’s colonial relationship to Denmark, an essentialist conceptualization of Greenlandic identity has played a significant role. However, both our scholarly understanding of post-colonial Greenlandic identity and the process towards independence for Greenland...... elements of traditional Inuit culture and elements of colonial modernity. Thirdly, monolingual Greenlanders are those with the most to gain from abandoning the dichotomy of essentialist identities. Strategically, the paper suggests a post-post-colonial Greenlandic identity as a means of avoiding...

Modernity/Coloniality and Eurocentric Education: Towards a Post-Occidental Self-Understanding of the Present

Science.gov (United States)

Baker, Michael

2012-01-01

This article sketches a post-Occidental interpretation of the historical/conceptual relationships between modern western education and European civilizational identity formation. Modern western education will be interpreted as a modern/colonial institution that emerged along with the sixteenth-century responses to the questions provoked by the…

Inoculation density and nutrient level determine the formation of mushroom-shaped structures in Pseudomonas aeruginosa biofilms

Science.gov (United States)

Ghanbari, Azadeh; Dehghany, Jaber; Schwebs, Timo; Müsken, Mathias; Häussler, Susanne; Meyer-Hermann, Michael

2016-09-01

Pseudomonas aeruginosa often colonises immunocompromised patients and the lungs of cystic fibrosis patients. It exhibits resistance to many antibiotics by forming biofilms, which makes it hard to eliminate. P. aeruginosa biofilms form mushroom-shaped structures under certain circumstances. Bacterial motility and the environment affect the eventual mushroom morphology. This study provides an agent-based model for the bacterial dynamics and interactions influencing bacterial biofilm shape. Cell motility in the model relies on recently published experimental data. Our simulations show colony formation by immotile cells. Motile cells escape from a single colony by nutrient chemotaxis and hence no mushroom shape develops. A high number density of non-motile colonies leads to migration of motile cells onto the top of the colonies and formation of mushroom-shaped structures. This model proposes that the formation of mushroom-shaped structures can be predicted by parameters at the time of bacteria inoculation. Depending on nutrient levels and the initial number density of stalks, mushroom-shaped structures only form in a restricted regime. This opens the possibility of early manipulation of spatial pattern formation in bacterial colonies, using environmental factors.

Inoculation density and nutrient level determine the formation of mushroom-shaped structures in Pseudomonas aeruginosa biofilms.

Science.gov (United States)

Ghanbari, Azadeh; Dehghany, Jaber; Schwebs, Timo; Müsken, Mathias; Häussler, Susanne; Meyer-Hermann, Michael

2016-09-09

Pseudomonas aeruginosa often colonises immunocompromised patients and the lungs of cystic fibrosis patients. It exhibits resistance to many antibiotics by forming biofilms, which makes it hard to eliminate. P. aeruginosa biofilms form mushroom-shaped structures under certain circumstances. Bacterial motility and the environment affect the eventual mushroom morphology. This study provides an agent-based model for the bacterial dynamics and interactions influencing bacterial biofilm shape. Cell motility in the model relies on recently published experimental data. Our simulations show colony formation by immotile cells. Motile cells escape from a single colony by nutrient chemotaxis and hence no mushroom shape develops. A high number density of non-motile colonies leads to migration of motile cells onto the top of the colonies and formation of mushroom-shaped structures. This model proposes that the formation of mushroom-shaped structures can be predicted by parameters at the time of bacteria inoculation. Depending on nutrient levels and the initial number density of stalks, mushroom-shaped structures only form in a restricted regime. This opens the possibility of early manipulation of spatial pattern formation in bacterial colonies, using environmental factors.

An American termite in Paris: temporal colony dynamics.

Science.gov (United States)

Baudouin, Guillaume; Dedeine, Franck; Bech, Nicolas; Bankhead-Dronnet, Stéphanie; Dupont, Simon; Bagnères, Anne-Geneviève

2017-12-01

Termites of the genus Reticulitermes are widespread invaders, particularly in urban habitats. Their cryptic and subterranean lifestyle makes them difficult to detect, and we know little about their colony dynamics over time. In this study we examined the persistence of Reticulitermes flavipes (Kollar) colonies in the city of Paris over a period of 15 years. The aim was (1) to define the boundaries of colonies sampled within the same four areas over two sampling periods, (2) to determine whether the colonies identified during the first sampling period persisted to the second sampling period, and (3) to compare the results obtained when colonies were delineated using a standard population genetic approach versus a Bayesian clustering method that combined both spatial and genetic information. Herein, colony delineations were inferred from genetic differences at nine microsatellite loci and one mitochondrial locus. Four of the 18 identified colonies did not show significant differences in their genotype distributions between the two sampling periods. While allelic richness was low, making it hard to reliably distinguish colony family type, most colonies appeared to retain the same breeding structure over time. These large and expansive colonies showed an important ability to fuse (39% were mixed-family colonies), contained hundreds of reproductives and displayed evidence of isolation-by-distance, suggesting budding dispersal. These traits, which favor colony persistence over time, present a challenge for pest control efforts, which apply treatment locally. The other colonies showed significant differences, but we cannot exclude the possibility that their genotype distributions simply changed over time.

Pathogenetic Role of JAK2 V617F Mutation in Chronic Myeloproliferative Disorders

Directory of Open Access Journals (Sweden)

Hui-Chi Hsu

2007-03-01

Full Text Available The molecular pathogenesis of chronic myeloproliferative disorders (MPDs is poorly understood. The hematopoietic progenitor cells of patients with polycythemia vera (PV or essential thrombocythemia (ET are characterized by hypersensitiv-ity to hematopoietic growth factors and formation of endogenous erythroid colonies. Recently, 4 groups reported almost simultaneously Janus kinase 2 (JAK2 V617F mutation in more than 80% of PV patients, 30% of patients with ET and in about 50% of patients with idiopathic myelofibrosis. The identification of the JAK2 mutation represents a major advance in the understanding of the molecular pathogenesis of MPDs that will likely permit a new classification and the development of novel therapeutic strategies for these diseases.

Botryllus schlosseri (Tunicata) whole colony irradiation: Do senescent zooid resorption and immunological resorption involve similar recognition events

International Nuclear Information System (INIS)

Rinkevich, B.; Weissman, I.L.

1990-01-01

The colonial tunicate Botryllus schlosseri undergoes cyclic blastogenesis where feeding zooids are senescened and resorbed and a new generation of zooids takes over the colony. When non-identical colonies come into direct contact, they either reject each other or fuse. Fusion is usually followed by the resorption of one of the partners in the chimera (immunological resorption). The striking morphological similarities between the two resorption phenomena suggest that both may involve tissue destruction following self-nonself recognition events. Here we attempt to modify these two events by whole colony gamma irradiation assays. Three sets of experiments were performed: (1) different doses of whole colony irradiation for determination of irradiation effects (110 colonies); (2) pairs of irradiated-nonirradiated isografts of clonal replicates for the potential of reconstruction of the irradiated partners (23 pairs); (3) chimeras of irradiated-nonirradiated partners for analysis of resorption hierarchy. Mortality increased with the irradiation dose. All colonies exposed to more than 5,000 rads died within 19 days, while no colony died below 2,000 rads. The average mortality periods, in days, for doses of 6,000-8,000, 5,000, and 2,500-4,000 rads were 14.4 +/- 3.1 (n = 24), 19.8 +/- 6.0 (n = 15), and 19.6 + 5.1 (n = 22), respectively. Younger colonies (3-6 months old) may survive radiation better than older ones (more than 13 months). Many morphological alterations were recorded in irradiated colonies: ampullar contraction and/or dilation, accumulation of pigment cells within ampullae, abnormal bleeding from blood vessels, sluggish blood circulation, necrotic zones, reduction in bud number, and irregularities in zooid and system structures. With doses of 3,000-4,000 rads and above, irradiation arrested the formation of new buds and interrupted normal takeover

Post-Colonial Theory and Action Research

Directory of Open Access Journals (Sweden)

Jim Parsons

2011-02-01

Full Text Available This essay explores connections between post-colonial theory and action research. Post-colonial theory is committed to addressing the plague of colonialism. Action research, at its core, promises to problematize uncontested ‘colonial’ hegemonies of any form. Both post-colonial theory and action research engage dialogic, critically reflective and collaborative values to offer a fuller range of human wisdom. The authors contend that post-colonialism theory calls for justice and seeks to speak to social and psychological suffering, exploitation, violence and enslavement done to the powerless victims of colonization around the world by challenging the superiority of dominant perspectives and seeking to re-position and empower the marginalized and subordinated. In similar ways, action research works to eradicate oppression, powerlessness and worthlessness by affirming solidarity with the oppressed, helping humans move from passive to active and by fundamentally reshaping power. Because both post-colonial theory and action research position the insider or oppressed in an ethic of efficacy, it values community, relationships, communication and equality, and is committed to reciprocity, reflexivity and reflection. Thus, both hold the potential to help reconstruct conditions for a more democratic and just society

Post-Colonial Theory and Action Research

Directory of Open Access Journals (Sweden)

Jim B. Parsons

2011-04-01

Full Text Available This essay explores connections between post-colonial theory and action research. Post-colonial theory is committed to addressing the plague of colonialism. Action research, at its core, promises to problematize uncontested ‘colonial’ hegemonies of any form. Both post-colonial theory and action research engage dialogic, critically reflective and collaborative values to offer a fuller range of human wisdom. The authors contend that post-colonialism theory calls for justice and seeks to speak to social and psychological suffering, exploitation, violence and enslavement done to the powerless victims of colonization around the world by challenging the superiority of dominant perspectives and seeking to re-position and empower the marginalized and subordinated. In similar ways, action research works to eradicate oppression, powerlessness and worthlessness by affirming solidarity with the oppressed, helping humans move from passive to active and by fundamentally reshaping power. Because both post-colonial theory and action research position the insider or oppressed in an ethic of efficacy, it values community, relationships, communication and equality, and is committed to reciprocity, reflexivity and reflection. Thus, both hold the potential to help reconstruct conditions for a more democratic and just society.

Selective binding and oligomerization of the murine granulocyte colony-stimulating factor receptor by a low molecular weight, nonpeptidyl ligand.

Science.gov (United States)

Doyle, Michael L; Tian, Shin-Shay; Miller, Stephen G; Kessler, Linda; Baker, Audrey E; Brigham-Burke, Michael R; Dillon, Susan B; Duffy, Kevin J; Keenan, Richard M; Lehr, Ruth; Rosen, Jon; Schneeweis, Lumelle A; Trill, John; Young, Peter R; Luengo, Juan I; Lamb, Peter

2003-03-14

Granulocyte colony-stimulating factor regulates neutrophil production by binding to a specific receptor, the granulocyte colony-stimulating factor receptor, expressed on cells of the granulocytic lineage. Recombinant forms of granulocyte colony-stimulating factor are used clinically to treat neutropenias. As part of an effort to develop granulocyte colony-stimulating factor mimics with the potential for oral bioavailability, we previously identified a nonpeptidyl small molecule (SB-247464) that selectively activates murine granulocyte colony-stimulating factor signal transduction pathways and promotes neutrophil formation in vivo. To elucidate the mechanism of action of SB-247464, a series of cell-based and biochemical assays were performed. The activity of SB-247464 is strictly dependent on the presence of zinc ions. Titration microcalorimetry experiments using a soluble murine granulocyte colony-stimulating factor receptor construct show that SB-247464 binds to the extracellular domain of the receptor in a zinc ion-dependent manner. Analytical ultracentrifugation studies demonstrate that SB-247464 induces self-association of the N-terminal three-domain fragment in a manner that is consistent with dimerization. SB-247464 induces internalization of granulocyte colony-stimulating factor receptor on intact cells, consistent with a mechanism involving receptor oligomerization. These data show that small nonpeptidyl compounds are capable of selectively binding and inducing productive oligomerization of cytokine receptors.

CHRISTIANITY AND COLONIALISM IN SOME ENGLISH SHORT STORIES

Directory of Open Access Journals (Sweden)

Tatang Iskarna

2017-04-01

Full Text Available Colonial and postcolonial studies are often linked to the power domination of the West upon the East in the way that the East economically, politically, and socially oppressed. Colonialism is often associated with three elements, the explorers dealing with geographical information, missionaries approaching the local people culturally, and the colonial administrators ruling the colony. Gold, glory, and gospel are the European’s concern. However, in representing the relation between Christianity and colonialism there is critical dialectic amongst historians, anthropologists, Christian missions, or cultural critics. Some propose that Christianity is considered to be the religious arm of colonialism. Others state that Christianity is spread without any secular interest as it is a great commandment of Jesus Christ. A few believe that Christianity give critical resistance against colonialism. The relation between Christianity and colonialism cannot be simplified as being neutral, in complicity, or in opposition. So, it is worth-discussing to understand how European writers construct the relation between Christianity and colonialism in their literary work. How Christianity is constructed and how Christianity is related to colonialism will be discussed in this paper. Using postcolonial paradigm, two English short stories will be analyzed in that way. They are Rudyard Kipling’s “Lispeth” and Doris Lessing’s “No Witchcraft for Sale”.

Representing Distant Victims: The Emergence of an Ethical Movement in Dutch Colonial Politics, 1840-1880

Directory of Open Access Journals (Sweden)

Maartje Janse

2013-03-01

Full Text Available This article attempts to add to our understanding of the relations between the Netherlands and its colonies in the little researched period of 1840-1880 when this relation became politicised. This was a direct result of a new notion of citizenship that developed after the 1848 constitution was implemented: many believed that citizens had now become accountable for government policies, that is, as far as they were acquainted with the effects these had abroad. Colonial issues were among the first for which citizens developed new protest forms and demanded that public opinion should be taken more seriously by the government. This means that not only what happened in the colonies influenced the shape and structure of Dutch politics in an important formative stage, but also that sentiments usually connected to the introduction of the Ethical Policy can be traced back much earlier than isoften assumed.

Neonicotinoid pesticides can reduce honeybee colony genetic diversity.

Directory of Open Access Journals (Sweden)

Nadège Forfert

Full Text Available Neonicotinoid insecticides can cause a variety of adverse sub-lethal effects in bees. In social species such as the honeybee, Apis mellifera, queens are essential for reproduction and colony functioning. Therefore, any negative effect of these agricultural chemicals on the mating success of queens may have serious consequences for the fitness of the entire colony. Queens were exposed to the common neonicotinoid pesticides thiamethoxam and clothianidin during their developmental stage. After mating, their spermathecae were dissected to count the number of stored spermatozoa. Furthermore, their worker offspring were genotyped with DNA microsatellites to determine the number of matings and the genotypic composition of the colony. Colonies providing the male mating partners were also inferred. Both neonicotinoid and control queens mated with drones originating from the same drone source colonies, and stored similar number of spermatozoa. However, queens reared in colonies exposed to both neonicotinoids experienced fewer matings. This resulted in a reduction of the genetic diversity in their colonies (i.e. higher intracolonial relatedness. As decreased genetic diversity among worker bees is known to negatively affect colony vitality, neonicotinoids may have a cryptic effect on colony health by reducing the mating frequency of queens.

Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

Directory of Open Access Journals (Sweden)

Josephine Wesely

2017-01-01

Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

Varroa-Virus Interaction in Collapsing Honey Bee Colonies

DEFF Research Database (Denmark)

Francis, Roy Mathew; Nielsen, Steen L.; Kryger, Per

2013-01-01

Varroa mites and viruses are the currently the high-profile suspects in collapsing bee colonies. Therefore, seasonal variation in varroa load and viruses (Acute-Kashmir-Israeli complex (AKI) and Deformed Wing Virus (DWV)) were monitored in a year-long study. We investigated the viral titres...... in honey bees and varroa mites from 23 colonies (15 apiaries) under three treatment conditions: Organic acids (11 colonies), pyrethroid (9 colonies) and untreated (3 colonies). Approximately 200 bees were sampled every month from April 2011 to October 2011, and April 2012. The 200 bees were split to 10...... subsamples of 20 bees and analysed separately, which allows us to determine the prevalence of virus-infected bees. The treatment efficacy was often low for both treatments. In colonies where varroa treatment reduced the mite load, colonies overwintered successfully, allowing the mites and viruses...

Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

International Nuclear Information System (INIS)

Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

1986-01-01

Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

First recorded loss of an emperor penguin colony in the recent period of Antarctic regional warming: implications for other colonies.

Directory of Open Access Journals (Sweden)

Philip N Trathan

Full Text Available In 1948, a small colony of emperor penguins Aptenodytes forsteri was discovered breeding on Emperor Island (67° 51' 52″ S, 68° 42' 20″ W, in the Dion Islands, close to the West Antarctic Peninsula (Stonehouse 1952. When discovered, the colony comprised approximately 150 breeding pairs; these numbers were maintained until 1970, after which time the colony showed a continuous decline. By 1999 there were fewer than 20 pairs, and in 2009 high-resolution aerial photography revealed no remaining trace of the colony. Here we relate the decline and loss of the Emperor Island colony to a well-documented rise in local mean annual air temperature and coincident decline in seasonal sea ice duration. The loss of this colony provides empirical support for recent studies (Barbraud & Weimerskirch 2001; Jenouvrier et al 2005, 2009; Ainley et al 2010; Barber-Meyer et al 2005 that have highlighted the vulnerability of emperor penguins to changes in sea ice duration and distribution. These studies suggest that continued climate change is likely to impact upon future breeding success and colony viability for this species. Furthermore, a recent circumpolar study by Fretwell & Trathan (2009 highlighted those Antarctic coastal regions where colonies appear most vulnerable to such changes. Here we examine which other colonies might be at risk, discussing various ecological factors, some previously unexplored, that may also contribute to future declines. The implications of this are important for future modelling work and for understanding which colonies actually are most vulnerable.

Sociological means : colonial reactions to the radicalization of Rastafari in Jamaica, 1956-1959

Directory of Open Access Journals (Sweden)

Frank Jan van Dijk

1995-01-01

Full Text Available Study of the formative stage in the development of the Rastafarian movement. It was a time of rapid radicalization and heightened expectations of an imminent return to Africa. It ended, after a series of violent incidents, with an abortive repatriation effort in 1959. Focuses on the ways the colonial government reacted to Rastafari and the social unrest it created.

Central Asia, Euro-centrism and Colonialism

Directory of Open Access Journals (Sweden)

Nargis T. Nurulla-Khodzhaeva

2015-01-01

Full Text Available The following article should not be dismissed as yet another attempt to construct a renewed round ofrevisionism in history. On the contrary, it aims to explore the possibility of scaling down the dominant Eurocentric epistemology that served as a basis for a stereotypical frame of knowledge about Central Asia. The majority of researchers of the region do not deem the need to review the scale of contradictory clashes created by the notion of Eurocentrism. The latter is reflected in numerous articles about the frozen (and sadly deadlock dilemma on why and how were the lands of Tajiks, Uzbeks and Kazakhs divided. By publishing conventional analyses on the region's "clumsy separation", experts illustrate their subaltern, narrowly framed by the colonial world, knowledge and hence, remain as gravestones of the Eurocentric methodology. In the process of such explication, the most important role is allocated to the modern culture, which encouraged the formation of the paradox, represented to us via the paraphrased Soviet aphorism: modernity and coloniality are twin brothers. The initiation of the process of decolonizing the mind within the five republics of the region is possible. One of the solutions involves recognizing the integrity of the pluralist-cycled culture and philosophy of the region. The proposed act will allow shrinking the focus on the knowledge within the limited national units and frames (thus, lessening the degree of'fetishism of the national identity', and rather creating conditions for designing the "bridge", linking different cultures, ideologies and institutional spaces in Central Asia, as a transnational intellectual matrix. The aforementioned theory will provide a basis and structure for empirical facts, and, therefore, drive the researchers from merely constituting to critically thinking, and consequently, inspire to come upon new approaches and fields of study, connecting them with the existing, colonial experiences. It is

In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.

Science.gov (United States)

Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A

2008-01-01

Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.

Effect of aspirin on tumour cell colony formation and evolution.

Science.gov (United States)

Wodarz, Dominik; Goel, Ajay; Boland, C Richard; Komarova, Natalia L

2017-09-01

Aspirin is known to reduce the risk of colorectal cancer (CRC) incidence, but the underlying mechanisms are not fully understood. In a previous study, we quantified the in vitro growth kinetics of different CRC tumour cell lines treated with varying doses of aspirin, measuring the rate of cell division and cell death. Here, we use these measured parameters to calculate the chances of successful clonal expansion and to determine the evolutionary potential of the tumour cell lines in the presence and absence of aspirin. The calculations indicate that aspirin increases the probability that a single tumour cell fails to clonally expand. Further, calculations suggest that aspirin increases the evolutionary potential of an expanding tumour cell colony. An aspirin-treated tumour cell population is predicted to result in the accumulation of more mutations (and is thus more virulent and more difficult to treat) than a cell population of the same size that grew without aspirin. This indicates a potential trade-off between delaying the onset of cancer and increasing its evolutionary potential through chemoprevention. Further work needs to investigate to what extent these findings apply to in vivo settings, and to what degree they contribute to the epidemiologically documented aspirin-mediated protection. © 2017 The Author(s).

Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

Directory of Open Access Journals (Sweden)

Sreoshi Chatterjee

Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

JAX Colony Management System (JCMS): an extensible colony and phenotype data management system

OpenAIRE

Donnelly, Chuck J.; McFarland, Mike; Ames, Abigail; Sundberg, Beth; Springer, Dave; Blauth, Peter; Bult, Carol J.

2010-01-01

The Jackson Laboratory Colony Management System (JCMS) is a software application for managing data and information related to research mouse colonies, associated biospecimens, and experimental protocols. JCMS runs directly on computers that run one of the PC Windows® operating systems, but can be accessed via web browser interfaces from any computer running a Windows, Macintosh®, or Linux® operating system. JCMS can be configured for a single user or multiple users in small- to medium-size wo...

Improved Ant Colony Clustering Algorithm and Its Performance Study

Science.gov (United States)

Gao, Wei

2016-01-01

Clustering analysis is used in many disciplines and applications; it is an important tool that descriptively identifies homogeneous groups of objects based on attribute values. The ant colony clustering algorithm is a swarm-intelligent method used for clustering problems that is inspired by the behavior of ant colonies that cluster their corpses and sort their larvae. A new abstraction ant colony clustering algorithm using a data combination mechanism is proposed to improve the computational efficiency and accuracy of the ant colony clustering algorithm. The abstraction ant colony clustering algorithm is used to cluster benchmark problems, and its performance is compared with the ant colony clustering algorithm and other methods used in existing literature. Based on similar computational difficulties and complexities, the results show that the abstraction ant colony clustering algorithm produces results that are not only more accurate but also more efficiently determined than the ant colony clustering algorithm and the other methods. Thus, the abstraction ant colony clustering algorithm can be used for efficient multivariate data clustering. PMID:26839533

Is colonialism history? The declining impact of colonial legacies on African institutional and economic development : The declining impact of colonial legacies on African institutional and economic development

NARCIS (Netherlands)

Maseland, Robbert

2018-01-01

This paper investigates the claim that colonial history has left an enduring imprint on Africa's institutional and economic development. The literature following Acemoglu, Johnson and Robinson (2001) and Sokoloff and Engerman (2000) maintains that different types of colonialism affected the

Engaging With Colonial Archives: Reflections Of An End-User

Directory of Open Access Journals (Sweden)

Ayodeji Olukoju

2016-06-01

Full Text Available Official and/or public archives were a byproduct of colonial rule in Africa. (Archives are a byproduct of administrative governance everywhere. Given the density and diversity of colonial archival records, historians have tended to rely on them for the study of the colonial period. Publications on the use of archives have not captured the perspective of end-users, who often face peculiar challenges in the use of colonial and metropolitan archives. This paper provides an end-user perspective on colonial archives in Nigeria and the United Kingdom. It highlights the challenges of data collection and prospects of optimal use of archival source material. The discussion is of general application to users of colonial archives especially in the former British colonies in Africa.

Comparison of different methods for erythroid differentiation in the K562 cell line.

Science.gov (United States)

Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

2016-08-01

To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

Freeze-drying of mononuclear cells derived from umbilical cord blood followed by colony formation.

Directory of Open Access Journals (Sweden)

Dity Natan

Full Text Available BACKGROUND: We recently showed that freeze-dried cells stored for 3 years at room temperature can direct embryonic development following cloning. However, viability, as evaluated by membrane integrity of the cells after freeze-drying, was very low; and it was mainly the DNA integrity that was preserved. In the present study, we improved the cells' viability and functionality after freeze-drying. METHODOLOGY/PRINCIPAL FINDINGS: We optimized the conditions of directional freezing, i.e. interface velocity and cell concentration, and we added the antioxidant EGCG to the freezing solution. The study was performed on mononuclear cells (MNCs derived from human umbilical cord blood. After freeze-drying, we tested the viability, number of CD34(+-presenting cells and ability of the rehydrated hematopoietic stem cells to differentiate into different blood cells in culture. The viability of the MNCs after freeze-drying and rehydration with pure water was 88%-91%. The total number of CD34(+-presenting cells and the number of colonies did not change significantly when evaluated before freezing, after freeze-thawing, and after freeze-drying (5.4 x 10(4+/-4.7, 3.49 x 10(4+/-6 and 6.31 x 10(4+/-12.27 cells, respectively, and 31+/-25.15, 47+/-45.8 and 23.44+/-13.3 colonies, respectively. CONCLUSIONS: This is the first report of nucleated cells which have been dried and then rehydrated with double-distilled water remaining viable, and of hematopoietic stem cells retaining their ability to differentiate into different blood cells.

Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

Science.gov (United States)

Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

2017-02-03

Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

Coalescing colony model: Mean-field, scaling, and geometry

Science.gov (United States)

Carra, Giulia; Mallick, Kirone; Barthelemy, Marc

2017-12-01

We analyze the coalescing model where a `primary' colony grows and randomly emits secondary colonies that spread and eventually coalesce with it. This model describes population proliferation in theoretical ecology, tumor growth, and is also of great interest for modeling urban sprawl. Assuming the primary colony to be always circular of radius r (t ) and the emission rate proportional to r (t) θ , where θ >0 , we derive the mean-field equations governing the dynamics of the primary colony, calculate the scaling exponents versus θ , and compare our results with numerical simulations. We then critically test the validity of the circular approximation for the colony shape and show that it is sound for a constant emission rate (θ =0 ). However, when the emission rate is proportional to the perimeter, the circular approximation breaks down and the roughness of the primary colony cannot be discarded, thus modifying the scaling exponents.

Cycles of light and dark co-ordinate reversible colony differentiation in Listeria monocytogenes.

Science.gov (United States)

Tiensuu, Teresa; Andersson, Christopher; Rydén, Patrik; Johansson, Jörgen

2013-02-01

Recently, several light receptors have been identified in non-phototrophic bacteria, but their physiological roles still remain rather elusive. Here we show that colonies of the saprophytic bacterium Listeria monocytogenes undergo synchronized multicellular behaviour on agar plates, in response to oscillating light/dark conditions, giving rise to alternating ring formation (opaque and translucent rings). On agar plates, bacteria from opaque rings survive increased levels of reactive oxygen species (ROS), as well as repeated cycles of light and dark, better than bacteria from translucent rings. The ring formation is strictly dependent on a blue-light receptor, Lmo0799, acting through the stress-sigma factor, σ(B) . A transposon screening identified 48 mutants unable to form rings at alternating light conditions, with several of them showing a decreased σ(B) activity/level. However, some of the tested mutants displayed a varied σ(B) activity depending on which of the two stress conditions tested (light or H(2) O(2) exposure). Intriguingly, the transcriptional regulator PrfA and the virulence factor ActA were shown to be required for ring formation by a mechanism involving activation of σ(B) . All in all, this suggests a distinct pathway for Lmo0799 that converge into a common signalling pathway for σ(B) activation. Our results show that night and day cycles co-ordinate a reversible differentiation of a L. monocytogenes colony at room temperature, by a process synchronized by a blue-light receptor and σ(B) . © 2013 Blackwell Publishing Ltd.

Hegemony and Accommodation in the History Curriculum in Colonial Botswana

Science.gov (United States)

Mafela, Lily

2014-01-01

A reanalysis of colonial education is necessary in order to highlight its multifaceted and hybrid nature in specific colonial contexts. Although in general, colonial education served the socio-political needs of the colonial machinery, the colonial government's hegemonic authority over the school curriculum did not operate as a totalising project.…

Colonial Institutions

DEFF Research Database (Denmark)

McAtackney, Laura; Palmer, Russell

2016-01-01

and the USA which reveal that the study of colonial institutions should not be limited to the functional life of these institutions—or solely those that take the form of monumental architecture—but should include the long shadow of “imperial debris” (Stoler 2008) and immaterial institutions....

MPP1 directly interacts with flotillins in erythrocyte membrane - Possible mechanism of raft domain formation.

Science.gov (United States)

Biernatowska, Agnieszka; Augoff, Katarzyna; Podkalicka, Joanna; Tabaczar, Sabina; Gajdzik-Nowak, Weronika; Czogalla, Aleksander; Sikorski, Aleksander F

2017-11-01

Flotillins are prominent, oligomeric protein components of erythrocyte (RBC) membrane raft domains and are considered to play an important structural role in lateral organization of the plasma membrane. In our previous work on erythroid membranes and giant plasma membrane vesicles (GPMVs) derived from them we have shown that formation of functional domains (resting state rafts) depends on the presence of membrane palmitoylated protein 1 (MPP1/p55), pointing to its new physiological role. Exploration of the molecular mechanism of MPP1 function in organizing membrane domains described here, through searching for its molecular partners in RBC membrane by using different methods, led to the identification of the raft-marker proteins, flotillin 1 and flotillin 2, as hitherto unreported direct MPP1 binding-partners in the RBC membrane. These proteins are found in high molecular-weight complexes in native RBC membrane and, significantly, their presence was shown to be separate from the well-known protein 4.1-dependent interactions of MPP1 with membrane proteins. Furthermore, FLIM analysis revealed that loss of the endogenous MPP1-flotillins interactions resulted in significant changes in RBC membrane-fluidity, emphasizing the physiological importance of such interactions in vivo. Therefore, our data establish a new perspective on the role of MPP1 in erythroid cells and suggests that direct MPP1-flotillins interactions could be the major driving-force behind the formation of raft domains in RBC. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

Effect of interleukin-9 on clonogenic maturation and cell-cycle status of fetal and adult hematopoietic progenitors

Energy Technology Data Exchange (ETDEWEB)

Holbrook, S.T.; Ohls, R.K.; Schibler, K.R.; Yang, Y.C.; Christensen, R.D. (Univ. of Utah School of Medicine, Salt Lake City (USA))

1991-05-15

We assessed the effect of interleukin-9 (IL-9) on clonogenic maturation and cell-cycle status of hematopoietic progenitors of fetal (umbilical cord blood) and adult (bone marrow) origin. As a single agent IL-9 supported, in a concentration-dependent fashion, maturation of burst-forming units-erythroid (BFU-E) of adult and fetal origin. However, only 1/3 the number of adult BFU-E colonies developed, as did in response to granulocyte-macrophage colony-stimulating factor (GM-CSF), and only 1/6 the number developed as did in response to IL-3. In contrast, the effect of IL-9 on fetal BFU-E colonies was equal to that of GM-CSF and IL-3. Synergistic effects of IL-9 with low concentrations (0.1 ng/mL) of GM-CSF and IL-3 were seen on adult BFU-E colony formation, but no effect was apparent at higher concentrations (1.0 ng/mL). In contrast, using fetal cells, synergistic effects of IL-9 with low and high concentrations of GM-CSF and IL-3 were apparent. Addition of IL-9 to plates containing fetal cells plus GM-CSF and IL-3 not only resulted in more BFU-E colonies, but also in more multicentered (greater than or equal to 10 individual centers) colonies, and more cells per colony. IL-9 had a wider spectrum of action on progenitors of fetal origin than on progenitors of adult origin, supporting the generation of fetal multipotent colony-forming unit (CFU)-Mix and CFU-GM colonies. Incubation with IL-9 did not accelerate cycling of adult or fetal BFU-E, CFU-Mix, or CFU-GM to the extent observed after incubation with IL-6.

Effect of interleukin-9 on clonogenic maturation and cell-cycle status of fetal and adult hematopoietic progenitors

International Nuclear Information System (INIS)

Holbrook, S.T.; Ohls, R.K.; Schibler, K.R.; Yang, Y.C.; Christensen, R.D.

1991-01-01

We assessed the effect of interleukin-9 (IL-9) on clonogenic maturation and cell-cycle status of hematopoietic progenitors of fetal (umbilical cord blood) and adult (bone marrow) origin. As a single agent IL-9 supported, in a concentration-dependent fashion, maturation of burst-forming units-erythroid (BFU-E) of adult and fetal origin. However, only 1/3 the number of adult BFU-E colonies developed, as did in response to granulocyte-macrophage colony-stimulating factor (GM-CSF), and only 1/6 the number developed as did in response to IL-3. In contrast, the effect of IL-9 on fetal BFU-E colonies was equal to that of GM-CSF and IL-3. Synergistic effects of IL-9 with low concentrations (0.1 ng/mL) of GM-CSF and IL-3 were seen on adult BFU-E colony formation, but no effect was apparent at higher concentrations (1.0 ng/mL). In contrast, using fetal cells, synergistic effects of IL-9 with low and high concentrations of GM-CSF and IL-3 were apparent. Addition of IL-9 to plates containing fetal cells plus GM-CSF and IL-3 not only resulted in more BFU-E colonies, but also in more multicentered (greater than or equal to 10 individual centers) colonies, and more cells per colony. IL-9 had a wider spectrum of action on progenitors of fetal origin than on progenitors of adult origin, supporting the generation of fetal multipotent colony-forming unit (CFU)-Mix and CFU-GM colonies. Incubation with IL-9 did not accelerate cycling of adult or fetal BFU-E, CFU-Mix, or CFU-GM to the extent observed after incubation with IL-6

Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

Directory of Open Access Journals (Sweden)

Jennifer A Mitchell

Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

Incomplete Homogenization of Chemical Recognition Labels Between Formica sanguinea and Formica rufa Ants (Hymenoptera: Formicidae) Living in a Mixed Colony

Science.gov (United States)

Włodarczyk, Tomasz; Szczepaniak, Lech

2014-01-01

Abstract Formica sanguinea Latreille (Hymenoptera: Formicidae) is a slave-making species, i.e., it raids colonies of host species and pillages pupae, which are taken to develop into adult workers in a parasite colony. However, it has been unclear if the coexistence of F. sanguinea with slave workers requires uniformity of cuticular hydrocarbons (CHCs), among which those other than n -alkanes are believed to be the principal nestmate recognition cues utilized by ants. In this study, a mixed colony (MC) of F. sanguinea and Formica rufa L. as a slave species was used to test the hypothesis that CHCs are exchanged between the species. Chemical analysis of hexane extracts from ants’ body surfaces provided evidence for interspecific exchange of alkenes and methyl-branched alkanes. This result was confirmed by behavioral tests during which ants exhibited hostility toward conspecific individuals from the MC but not toward ones from homospecific colonies of their own species. However, it seems that species-specific differences in chemical recognition labels were not eliminated completely because ants from the MC were treated differently depending on whether they were con- or allospecific to the individuals whose behavioral reactions were tested. These findings are discussed in the context of mechanisms of colony's odor formation and effective integration of slaves into parasite colony. PMID:25502026

21 CFR 866.2170 - Automated colony counter.

Science.gov (United States)

2010-04-01

...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2170 Automated colony counter. (a) Identification. An automated colony counter is a mechanical device intended for medical...

Inbred or Outbred? Genetic Diversity in Laboratory Rodent Colonies

Science.gov (United States)

Brekke, Thomas D.; Steele, Katherine A.; Mulley, John F.

2017-01-01

Nonmodel rodents are widely used as subjects for both basic and applied biological research, but the genetic diversity of the study individuals is rarely quantified. University-housed colonies tend to be small and subject to founder effects and genetic drift; so they may be highly inbred or show substantial genetic divergence from other colonies, even those derived from the same source. Disregard for the levels of genetic diversity in an animal colony may result in a failure to replicate results if a different colony is used to repeat an experiment, as different colonies may have fixed alternative variants. Here we use high throughput sequencing to demonstrate genetic divergence in three isolated colonies of Mongolian gerbil (Meriones unguiculatus) even though they were all established recently from the same source. We also show that genetic diversity in allegedly “outbred” colonies of nonmodel rodents (gerbils, hamsters, house mice, deer mice, and rats) varies considerably from nearly no segregating diversity to very high levels of polymorphism. We conclude that genetic divergence in isolated colonies may play an important role in the “replication crisis.” In a more positive light, divergent rodent colonies represent an opportunity to leverage genetically distinct individuals in genetic crossing experiments. In sum, awareness of the genetic diversity of an animal colony is paramount as it allows researchers to properly replicate experiments and also to capitalize on other genetically distinct individuals to explore the genetic basis of a trait. PMID:29242387

Latin America: Essays Interpretating Colonial Legacy

Directory of Open Access Journals (Sweden)

María Pia López

2013-12-01

Full Text Available A large part of the Latin–American literature of the 19th and 20th century tried to deal with the national question intertwining different dimensions: the weight of colonial legacy, the cultural peculiarity of the nation and the inner relations between social classes and ethnic groups. Thinking the nation implied, in any case, to think the difference and the conflict with others, as well as the inner conflict and the logic of local colonialism. Analyzing some of these essays that played a central role in such process of recasting the origin of the nation, the author moves around three main axes: the formulation of dualist writings (colonial/national; white /indigenous; civilization/wilderness, the issue of language (the language inherited from the colonial experience versus the multilingual nature of indigenous Latin American societies, and the hypothesis about the birth of the nation – appointed to different groups – and its normal functioning as legitimization of the order sprung from independences.

21 CFR 866.2180 - Manual colony counter.

Science.gov (United States)

2010-04-01

...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2180 Manual colony counter. (a) Identification. A manual colony counter is a device intended for medical purposes that consists...

Genetic Interaction Mapping in Schizosaccharomyces pombe Using the Pombe Epistasis Mapper (PEM) System and a ROTOR HDA Colony Replicating Robot in a 1536 Array Format.

Science.gov (United States)

Roguev, Assen; Xu, Jiewei; Krogan, Nevan

2018-02-01

This protocol describes an optimized high-throughput procedure for generating double deletion mutants in Schizosaccharomyces pombe using the colony replicating robot ROTOR HDA and the PEM (pombe epistasis mapper) system. The method is based on generating high-density colony arrays (1536 colonies per agar plate) and passaging them through a series of antidiploid and mating-type selection (ADS-MTS) and double-mutant selection (DMS) steps. Detailed program parameters for each individual replication step are provided. Using this procedure, batches of 25 or more screens can be routinely performed. © 2018 Cold Spring Harbor Laboratory Press.

Post-Colonialism Perspectives on Educational Competition

Science.gov (United States)

Yeh, Chuan-Rong

2016-01-01

Educational competition has always been the puzzle issue of educational researches. In this article, I analyze several aspects of educational competition within the perspective of post-colonialism discourse. In the political aspect, Taiwanese education is linked with political power, to present the post-colonial spirit by continuing dynastic…

Colony Development and Density-Dependent Processes in Breeding Grey Herons

Directory of Open Access Journals (Sweden)

Takeshi Shirai

2013-01-01

Full Text Available The density-dependent processes that limit the colony size of colonially breeding birds such as herons and egrets remain unclear, because it is difficult to monitor colonies from the first year of their establishment, and the most previous studies have considered mixed-species colonies. In the present study, single-species colonies of the Grey Heron (Ardea cinerea were observed from the first year of their establishment for 16 years in suburban Tokyo. Colony size increased after establishment, illustrating a saturation curve. The breeding duration (days from nest building to fledging by a pair increased, but the number of fledglings per nest decreased, with colony size. The reproductive season in each year began earlier, and there was greater variation in the timing of individual breeding when the colony size was larger. The prolonged duration until nestling feeding by early breeders of the colony suggests that herons at the beginning of the new breeding season exist in an unsteady state with one another, likely owing to interactions with immigrant individuals. Such density-dependent interference may affect reproductive success and limit the colony size of Grey Herons.

Queen promiscuity lowers disease within honeybee colonies

OpenAIRE

Seeley, Thomas D; Tarpy, David R

2006-01-01

Most species of social insects have singly mated queens, but in some species each queen mates with numerous males to create a colony with a genetically diverse worker force. The adaptive significance of polyandry by social insect queens remains an evolutionary puzzle. Using the honeybee (Apis mellifera), we tested the hypothesis that polyandry improves a colony's resistance to disease. We established colonies headed by queens that had been artificially inseminated by either one or 10 drones. ...

Multiscale modeling of bacterial colonies: how pili mediate the dynamics of single cells and cellular aggregates

Science.gov (United States)

Pönisch, Wolfram; Weber, Christoph A.; Juckeland, Guido; Biais, Nicolas; Zaburdaev, Vasily

2017-01-01

Neisseria gonorrhoeae is the causative agent of one of the most common sexually transmitted diseases, gonorrhea. Over the past two decades there has been an alarming increase of reported gonorrhea cases where the bacteria were resistant to the most commonly used antibiotics thus prompting for alternative antimicrobial treatment strategies. The crucial step in this and many other bacterial infections is the formation of microcolonies, agglomerates consisting of up to several thousands of cells. The attachment and motility of cells on solid substrates as well as the cell-cell interactions are primarily mediated by type IV pili, long polymeric filaments protruding from the surface of cells. While the crucial role of pili in the assembly of microcolonies has been well recognized, the exact mechanisms of how they govern the formation and dynamics of microcolonies are still poorly understood. Here, we present a computational model of individual cells with explicit pili dynamics, force generation and pili-pili interactions. We employ the model to study a wide range of biological processes, such as the motility of individual cells on a surface, the heterogeneous cell motility within the large cell aggregates, and the merging dynamics and the self-assembly of microcolonies. The results of numerical simulations highlight the central role of pili generated forces in the formation of bacterial colonies and are in agreement with the available experimental observations. The model can quantify the behavior of multicellular bacterial colonies on biologically relevant temporal and spatial scales and can be easily adjusted to include the geometry and pili characteristics of various bacterial species. Ultimately, the combination of the microbiological experimental approach with the in silico model of bacterial colonies might provide new qualitative and quantitative insights on the development of bacterial infections and thus pave the way to new antimicrobial treatments.

Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

NARCIS (Netherlands)

von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

2001-01-01

Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

Structural organisation and dynamics in king penguin colonies

Science.gov (United States)

Gerum, Richard; Richter, Sebastian; Fabry, Ben; Le Bohec, Céline; Bonadonna, Francesco; Nesterova, Anna; Zitterbart, Daniel P.

2018-04-01

During breeding, king penguins do not build nests, however they show strong territorial behaviour and keep a pecking distance to neighbouring penguins. Penguin positions in breeding colonies are highly stable over weeks and appear regularly spaced, but thus far no quantitative analysis of the structural order inside a colony has been performed. In this study, we use the radial distribution function to analyse the spatial coordinates of penguin positions. Coordinates are obtained from aerial images of two colonies that were observed for several years. Our data demonstrate that the structural order in king penguin colonies resembles a 2D liquid of particles with a Lennard-Jones-type interaction potential. We verify this using a molecular dynamics simulation with thermally driven particles, whereby temperature corresponds to penguin movements, the energy well depth ɛ of the attractive potential corresponds to the strength of the colony-forming behaviour, and the repulsive zone corresponds to the pecking radius. We can recapitulate the liquid disorder of the colony, as measured by the radial distribution function, when the particles have a temperature of several (1.4–10) \

Colonial army recruitment patterns and post-colonial Military Coups ...

African Journals Online (AJOL)

Since time immemorial, societies, states and state builders have been challenged and transformed by the need and quest for military manpower. European states relied on conscript armies to 'pacify' and retain colonies in parts of the non-European world. These facts underscore the meticulous attention paid by the British to ...

Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

Science.gov (United States)

Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

2011-06-01

Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

Single cell time-lapse analysis reveals that podoplanin enhances cell survival and colony formation capacity of squamous cell carcinoma cells.

Science.gov (United States)

Miyashita, Tomoyuki; Higuchi, Youichi; Kojima, Motohiro; Ochiai, Atsushi; Ishii, Genichiro

2017-01-06

Tumor initiating cells (TICs) are characterized by high clonal expansion capacity. We previously reported that podoplanin is a TIC-specific marker for the human squamous cell carcinoma cell line A431. The aim of this study is to explore the molecular mechanism underlying the high clonal expansion potential of podoplanin-positive A431cells using Fucci imaging. Single podoplanin-positive cells created large colonies at a significantly higher frequency than single podoplanin-negative cells, whereas no difference was observed between the two types of cells with respect to cell cycle status. Conversely, the cell death ratio of progenies derived from podoplanin-positive single cell was significantly lower than that of cells derived from podoplanin-negative cells. Single A431 cells, whose podoplanin expression was suppressed by RNA interference, exhibited increased cell death ratios and decreased frequency of large colony forming. Moreover, the frequency of large colony forming decreased significantly when podoplanin-positive single cells was treated with a ROCK (Rho-associated coiled-coil kinase) inhibitor, whereas no difference was observed in single podoplanin-negative cells. Our current study cleared that high clonal expansion capacity of podoplanin-positive TICs populations was the result of reduced cell death by podoplanin-mediated signaling. Therefore, podoplanin activity may be a therapeutic target in the treatment of squamous cell carcinomas.

Ant- and Ant-Colony-Inspired ALife Visual Art.

Science.gov (United States)

Greenfield, Gary; Machado, Penousal

2015-01-01

Ant- and ant-colony-inspired ALife art is characterized by the artistic exploration of the emerging collective behavior of computational agents, developed using ants as a metaphor. We present a chronology that documents the emergence and history of such visual art, contextualize ant- and ant-colony-inspired art within generative art practices, and consider how it relates to other ALife art. We survey many of the algorithms that artists have used in this genre, address some of their aims, and explore the relationships between ant- and ant-colony-inspired art and research on ant and ant colony behavior.

Detection and quantification of intracellular bacterial colonies by automated, high-throughput microscopy.

Science.gov (United States)

Ernstsen, Christina L; Login, Frédéric H; Jensen, Helene H; Nørregaard, Rikke; Møller-Jensen, Jakob; Nejsum, Lene N

2017-08-01

To target bacterial pathogens that invade and proliferate inside host cells, it is necessary to design intervention strategies directed against bacterial attachment, cellular invasion and intracellular proliferation. We present an automated microscopy-based, fast, high-throughput method for analyzing size and number of intracellular bacterial colonies in infected tissue culture cells. Cells are seeded in 48-well plates and infected with a GFP-expressing bacterial pathogen. Following gentamicin treatment to remove extracellular pathogens, cells are fixed and cell nuclei stained. This is followed by automated microscopy and subsequent semi-automated spot detection to determine the number of intracellular bacterial colonies, their size distribution, and the average number per host cell. Multiple 48-well plates can be processed sequentially and the procedure can be completed in one working day. As a model we quantified intracellular bacterial colonies formed by uropathogenic Escherichia coli (UPEC) during infection of human kidney cells (HKC-8). Urinary tract infections caused by UPEC are among the most common bacterial infectious diseases in humans. UPEC can colonize tissues of the urinary tract and is responsible for acute, chronic, and recurrent infections. In the bladder, UPEC can form intracellular quiescent reservoirs, thought to be responsible for recurrent infections. In the kidney, UPEC can colonize renal epithelial cells and pass to the blood stream, either via epithelial cell disruption or transcellular passage, to cause sepsis. Intracellular colonies are known to be clonal, originating from single invading UPEC. In our experimental setup, we found UPEC CFT073 intracellular bacterial colonies to be heterogeneous in size and present in nearly one third of the HKC-8 cells. This high-throughput experimental format substantially reduces experimental time and enables fast screening of the intracellular bacterial load and cellular distribution of multiple

The Role of Non-Foraging Nests in Polydomous Wood Ant Colonies.

Science.gov (United States)

Ellis, Samuel; Robinson, Elva J H

2015-01-01

A colony of red wood ants can inhabit more than one spatially separated nest, in a strategy called polydomy. Some nests within these polydomous colonies have no foraging trails to aphid colonies in the canopy. In this study we identify and investigate the possible roles of non-foraging nests in polydomous colonies of the wood ant Formica lugubris. To investigate the role of non-foraging nests we: (i) monitored colonies for three years; (ii) observed the resources being transported between non-foraging nests and the rest of the colony; (iii) measured the amount of extra-nest activity around non-foraging and foraging nests. We used these datasets to investigate the extent to which non-foraging nests within polydomous colonies are acting as: part of the colony expansion process; hunting and scavenging specialists; brood-development specialists; seasonal foragers; or a selfish strategy exploiting the foraging effort of the rest of the colony. We found that, rather than having a specialised role, non-foraging nests are part of the process of colony expansion. Polydomous colonies expand by founding new nests in the area surrounding the existing nests. Nests founded near food begin foraging and become part of the colony; other nests are not founded near food sources and do not initially forage. Some of these non-foraging nests eventually begin foraging; others do not and are abandoned. This is a method of colony growth not available to colonies inhabiting a single nest, and may be an important advantage of the polydomous nesting strategy, allowing the colony to expand into profitable areas.

Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

Science.gov (United States)

Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

2011-10-15

4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

Nomadic Research Practices in Early Childhood: Interrupting Racisms and Colonialisms

Directory of Open Access Journals (Sweden)

Veronica Pacini-Ketchabaw

2011-12-01

Full Text Available This paper considers how research practices on racialization in early childhood education might be reconceptualized when racialization is placed within relational intricacies and affects in multiple encounters. By foregrounding race and its emergence in multifarious, unpredictable ways in everyday encounters between human and non-human bodies, space, and discourse, the paper investigates how a movement toward research analyses that engage with both the materiality of race and its systemic and discursive formations might be used to constantly seek new ethical ways of responding to and acting against racisms and colonialism in early childhood.

Hong Kong architecture 1945-2015 from colonial to global

CERN Document Server

Xue, Charlie Q L

2016-01-01

This book focuses on the transformation from colonial to global – the formation, mechanism, events, works and people related to urban architecture. The book reveals hardships the city encountered in the 1950s and the glamour enjoyed in the 1980s. It depicts the public and private developments, and especially the public housing which has sheltered millions of residents. The author identifies the architects practising in the formative years and the representatives of a rising generation after the 1980s. Suffering from land shortage and a dense environment, the urban development of Hong Kong has in the past 70 years met the changing demands of fluctuating economic activities and a rising population. Architecture on the island has been shaped by social demands, the economy and technology. The buildings have been forged by the government, clients, planners, architects, many contractors and end-users. The built environment nurtures our life and is visual evidence of the way the city has developed. Hong Kong is a ...

Between Past and Present: The Sociopsychological Constructs of Colonialism, Coloniality and Postcolonialism.

Science.gov (United States)

Tomicic, Ana; Berardi, Filomena

2018-03-01

If one of the major aspirations of postcolonial theory is to re-establish a balance in the relationship between the (former) colonizer and the colonized by engaging the voices of the "subaltern", and on the other hand to illuminate how power relations of the present are embedded in history (Mills 2007), we argue that important theoretical insights might inform research by anchoring post-colonial theory within a sociopsychological framework. While there is a growing corpus of sociopsychological research articles focusing on how major geopolitical events and historical processes bear on people's lives, we aim to investigate the theoretical potential of postcolonial theory within the disciplines aiming at a sociopsychological approach. By focusing on the social dynamics of power imbalances, post-colonial theory finds its operational meaning: the feelings stemming from actions committed in the past are indeed crucial in determining reparatory attitudes and policies towards members of former colonized groups. Firstly, drawing from the sociopsychological scientific production related to consequences of colonial past, seen in recent years as a growing research interest in the field, we will explore patterns and trends through a thematic analysis of literature. Social Psychology as well as adjacent disciplines can greatly benefit from this theoretical fertilization, especially in the way post-colonial ideologies relate to the symbolic promotion versus exclusion of indigenous culture (Sengupta et al., International Journal of Intercultural Relations, 36(4), 506-517, 2012). Furthermore, by comparing and contrasting the ideological cosmologies relating to this particular topic, this study aims to establish the state of knowledge in the field, to identify how research methods and thematic fields are paired, to find "gaps" and create spaces for research that become integrative of postcolonial theory. While focusing on academic production, we also hope to contribute to develop

The effects of electrospun substrate-mediated cell colony morphology on the self-renewal of human induced pluripotent stem cells.

Science.gov (United States)

Maldonado, Maricela; Wong, Lauren Y; Echeverria, Cristina; Ico, Gerardo; Low, Karen; Fujimoto, Taylor; Johnson, Jed K; Nam, Jin

2015-05-01

The development of xeno-free, chemically defined stem cell culture systems has been a primary focus in the field of regenerative medicine to enhance the clinical application of pluripotent stem cells (PSCs). In this regard, various electrospun substrates with diverse physiochemical properties were synthesized utilizing various polymer precursors and surface treatments. Human induced pluripotent stem cells (IPSCs) cultured on these substrates were characterized by their gene and protein expression to determine the effects of the substrate physiochemical properties on the cells' self-renewal, i.e., proliferation and the maintenance of pluripotency. The results showed that surface chemistry significantly affected cell colony formation via governing the colony edge propagation. More importantly, when surface chemistry of the substrates was uniformly controlled by collagen conjugation, the stiffness of substrate was inversely related to the sphericity, a degree of three dimensionality in colony morphology. The differences in sphericity subsequently affected spontaneous differentiation of IPSCs during a long-term culture, implicating that the colony morphology is a deciding factor in the lineage commitment of PSCs. Overall, we show that the capability of controlling IPSC colony morphology by electrospun substrates provides a means to modulate IPSC self-renewal. Copyright © 2015 Elsevier Ltd. All rights reserved.

The onset of hemoglobin synthesis in spleens of irradiated mice after bone marrow transplantation

International Nuclear Information System (INIS)

Ponka, P.; Fuchs, O.; Borova, J.; Necas, E.

1977-01-01

Messenger RNA (mRNA) for globin was isolated from spleens of irradiated mice in which erythroid differentiation was induced by a bone marrow graft. The globin mRNA was isolated either by means of sucrose gradients of reticulocyte polysomal RNA or by affinity chromatography of total spleen RNA on poly (U)-sepharose. The globin mRNA was tested in a wheat embryo cell-free system. The appearance of mRNA in the spleen erythroid colonies was correlated with other parameters of erythroid differentiation such as globin synthesis, activity of delta-aminolevulinic acid synthetase and iron uptake. Poly(A) containing mRNA did appear already on the 3rd day after grafting. However, significant translational activity of globin mRNA could be demonstrated only one day later together with increase in globin synthesis and delta-aminolevulinic acid synthetase and enhanced iron uptake. In the second part of this study mouse spleen cells rich in erythroid elements were incubated with a specific heme synthesis inhibitor (isonicotinic acid hydrazide, INH) and the synthesis of 9 S RNA was estimated. It was found that a 40-minute incubation with INH reduced uridine incorporation into 9 S RNA fraction by about 40%. (author)

Colony strength and queen replacement in Melipona marginata (Apidae: Meliponini

Directory of Open Access Journals (Sweden)

A. de M. P. Kleinert

Full Text Available Physogastric queens of Melipona marginata were removed from their colonies in order to verify the acceptance of a new queen by workers. Colony strength was evaluated according to queen oviposition rate and comb diameters. Replacement was observed seven times. Its occurrence and speed related positively to colony strength, independently of queen's age. In weak colonies, queen replacement was observed only once, following colony population increase that occurred after introduction of combs from another colony. Worker oviposition after queen removal was observed three times: in a strong colony with virgin queens and males, and in two of the weak colonies. In the first two or three days of new queen oviposition, during which most of the eggs were eaten by the queen, worker oviposition preceded almost all provisioning and oviposition processes (POPs. After this period, worker oviposition decreased until it reached around 25% of the POPs. Daily oviposition rate of young queens decreased or was even interrupted by hatching of their first brood.

Colonial Bilingual Heritage and Post-Colonial Myths in Cameroon's ...

African Journals Online (AJOL)

Thus, the study traces and shows that an uncritical support of the existing school bilingualism, a aspect of the general political objective of national unity and integration, hinges on a fictitious collective post-colonial dream about using the bilingual heritage of French and English, and the cultures that lie behind them, ...

California gull chicks raised near colony edges have elevated stress levels

Science.gov (United States)

Herring, Garth; Ackerman, Joshua T.

2011-01-01

Coloniality in nesting birds represents an important life history strategy for maximizing reproductive success. Birds nesting near the edge of colonies tend to have lower reproductive success than individuals nesting near colony centers, and offspring of edge-nesting parents may be impaired relative to those of central-nesting parents. We used fecal corticosterone metabolites in California gull chicks (Larus californicus) to examine whether colony size or location within the colony influenced a chick's physiological condition. We found that chicks being raised near colony edges had higher fecal corticosterone metabolite concentrations than chicks raised near colony centers, but that colony size (ranging from 150 to 11,554 nests) had no influence on fecal corticosterone levels. Fecal corticosterone metabolite concentrations also increased with chick age. Our results suggest that similarly aged California gull chicks raised near colony edges may be more physiologically stressed, as indicated by corticosterone metabolites, than chicks raised near colony centers.

Elimination of clonogenic tumor cells from HL-60, Daudi, and U-937 cell lines by laser photoradiation therapy: implications for autologous bone marrow purging

International Nuclear Information System (INIS)

Gulliya, K.S.; Pervaiz, S.

1989-01-01

Laser photoradiation therapy was tested in an in vitro model for its efficacy in the elimination of non-Hodgkin's lymphoma cells. Results show that at 31.2 J/cm2 of laser light in the presence of 20 micrograms/mL of merocyanine 540 (MC540) there was greater than 5 log reduction in Burkitt's lymphoma (Daudi) cells. Similar tumor cell kill was obtained for leukemia (HL-60) cells at a laser light dose of 93.6 J/cm2. However, to obtain the same efficiency of killing for histiocytic lymphoma (U-937) cells, a higher dose of MC540 (25 micrograms/mL) was required. Clonogenic tumor stem cell colony formation was reduced by greater than 5 logs after laser photoradiation therapy. Under identical conditions for each cell line the percent survival for granulocyte-macrophage colony-forming units (CFU-GM, 45.9%, 40%, 17.5%), granulocyte/erythroid/macrophage/megakaryocyte (GEMM, 40.1%, 20.1%, 11.5%), colony-forming units (CFU-C, 16.2%, 9.1%, 1.8%), and erythroid burst-forming units (BFU-E, 33.4%, 17.8%, 3.9%) was significantly higher than the tumor cells. Mixing of gamma ray-irradiated normal marrow cells with tumor cells (1:1 and 10:1 ratio) did not interfere with the elimination of tumor cells. The effect of highly purified recombinant interferon alpha (rIFN) on laser photoradiation therapy of tumor cells was also investigated. In the presence of rIFN (30 to 3,000 U/mL), the viability of leukemic cells was observed to increase from 0% to 1.5% with a concurrent decrease in membrane polarization, suggesting an increase in fluidity of cell membrane in response to rIFN. However, at higher doses of rIFN (6,000 to 12,000 U/mL) this phenomenon was not observed. The viability of lymphoma cells remained unaffected at all doses of rIFN tested

Experimental Study for Automatic Colony Counting System Based Onimage Processing

Science.gov (United States)

Fang, Junlong; Li, Wenzhe; Wang, Guoxin

Colony counting in many colony experiments is detected by manual method at present, therefore it is difficult for man to execute the method quickly and accurately .A new automatic colony counting system was developed. Making use of image-processing technology, a study was made on the feasibility of distinguishing objectively white bacterial colonies from clear plates according to the RGB color theory. An optimal chromatic value was obtained based upon a lot of experiments on the distribution of the chromatic value. It has been proved that the method greatly improves the accuracy and efficiency of the colony counting and the counting result is not affected by using inoculation, shape or size of the colony. It is revealed that automatic detection of colony quantity using image-processing technology could be an effective way.

Colony collapse disorder: a descriptive study.

Directory of Open Access Journals (Sweden)

Dennis Vanengelsdorp

Full Text Available BACKGROUND: Over the last two winters, there have been large-scale, unexplained losses of managed honey bee (Apis mellifera L. colonies in the United States. In the absence of a known cause, this syndrome was named Colony Collapse Disorder (CCD because the main trait was a rapid loss of adult worker bees. We initiated a descriptive epizootiological study in order to better characterize CCD and compare risk factor exposure between populations afflicted by and not afflicted by CCD. METHODS AND PRINCIPAL FINDINGS: Of 61 quantified variables (including adult bee physiology, pathogen loads, and pesticide levels, no single measure emerged as a most-likely cause of CCD. Bees in CCD colonies had higher pathogen loads and were co-infected with a greater number of pathogens than control populations, suggesting either an increased exposure to pathogens or a reduced resistance of bees toward pathogens. Levels of the synthetic acaricide coumaphos (used by beekeepers to control the parasitic mite Varroa destructor were higher in control colonies than CCD-affected colonies. CONCLUSIONS/SIGNIFICANCE: This is the first comprehensive survey of CCD-affected bee populations that suggests CCD involves an interaction between pathogens and other stress factors. We present evidence that this condition is contagious or the result of exposure to a common risk factor. Potentially important areas for future hypothesis-driven research, including the possible legacy effect of mite parasitism and the role of honey bee resistance to pesticides, are highlighted.

Iridovirus and microsporidian linked to honey bee colony decline.

Science.gov (United States)

Bromenshenk, Jerry J; Henderson, Colin B; Wick, Charles H; Stanford, Michael F; Zulich, Alan W; Jabbour, Rabih E; Deshpande, Samir V; McCubbin, Patrick E; Seccomb, Robert A; Welch, Phillip M; Williams, Trevor; Firth, David R; Skowronski, Evan; Lehmann, Margaret M; Bilimoria, Shan L; Gress, Joanna; Wanner, Kevin W; Cramer, Robert A

2010-10-06

In 2010 Colony Collapse Disorder (CCD), again devastated honey bee colonies in the USA, indicating that the problem is neither diminishing nor has it been resolved. Many CCD investigations, using sensitive genome-based methods, have found small RNA bee viruses and the microsporidia, Nosema apis and N. ceranae in healthy and collapsing colonies alike with no single pathogen firmly linked to honey bee losses. We used Mass spectrometry-based proteomics (MSP) to identify and quantify thousands of proteins from healthy and collapsing bee colonies. MSP revealed two unreported RNA viruses in North American honey bees, Varroa destructor-1 virus and Kakugo virus, and identified an invertebrate iridescent virus (IIV) (Iridoviridae) associated with CCD colonies. Prevalence of IIV significantly discriminated among strong, failing, and collapsed colonies. In addition, bees in failing colonies contained not only IIV, but also Nosema. Co-occurrence of these microbes consistently marked CCD in (1) bees from commercial apiaries sampled across the U.S. in 2006-2007, (2) bees sequentially sampled as the disorder progressed in an observation hive colony in 2008, and (3) bees from a recurrence of CCD in Florida in 2009. The pathogen pairing was not observed in samples from colonies with no history of CCD, namely bees from Australia and a large, non-migratory beekeeping business in Montana. Laboratory cage trials with a strain of IIV type 6 and Nosema ceranae confirmed that co-infection with these two pathogens was more lethal to bees than either pathogen alone. These findings implicate co-infection by IIV and Nosema with honey bee colony decline, giving credence to older research pointing to IIV, interacting with Nosema and mites, as probable cause of bee losses in the USA, Europe, and Asia. We next need to characterize the IIV and Nosema that we detected and develop management practices to reduce honey bee losses.

Colony form variation of Bacillus pumilus E601 after cultured and neutron irradiation

International Nuclear Information System (INIS)

Chen Xiaoming; Wei Baoli; Zhang Jianguo

2008-01-01

The distribution of two colony forms of Bacillus pumilus E601 and the effect of neutron irradiation on the colony form were reported. The translucent and opaque colonies were cultured several generations to observe the proportion of two form colonies. The spores of opaque colony were irradiated at 80, 800 and 2000 Gy of fast neutron from CFBR-II pulse pile, and the survivors of opaque colony were irradiated again at the same doses. The results showed that: (1) Bacillus pumilus E601 observed two types of colony form: translucent and opaque colony; (2) the translucent colony could produce both translucent and opaque colonies in equal, while the opaque colony couldn't produce translucent colony generally; (3) neutron irradiation could affect the colony form distribution. The ratio of survival translucent colony was increased with the increase of the first neutron irradiation doses, and the second neutron irradiation also increased the ratio of translucent colony. It was concluded that the instability of translucent colony was the main reason to produce two colony forms of Bacillus pumilus E601. The strain of translucent colony had a stronger ability to resist neutron irradiation than the opaque colony. (authors)

Colony mapping: A new technique for monitoring crevice-nesting seabirds

Science.gov (United States)

Renner, H.M.; Renner, M.; Reynolds, J.H.; Harping, A.M.A.; Jones, I.L.; Irons, D.B.; Byrd, G.V.

2006-01-01

Monitoring populations of auklets and other crevice-nesting seabirds remains problematic, although numerous methods have been attempted since the mid-1960s. Anecdotal evidence suggests several large auklet colonies have recently decreased in both abundance and extent, concurrently with vegetation encroachment and succession. Quantifying changes in the geographical extent of auklet colonies may be a useful alternative to monitoring population size directly. We propose a standardized method for colony mapping using a randomized systematic grid survey with two components: a simple presence/absence survey and an auklet evidence density survey. A quantitative auklet evidence density index was derived from the frequency of droppings and feathers. This new method was used to map the colony on St. George Island in the southeastern Bering Sea and results were compared to previous colony mapping efforts. Auklet presence was detected in 62 of 201 grid cells (each grid cell = 2500 m2) by sampling a randomly placed 16 m2 plot in each cell; estimated colony area = 155 000 m2. The auklet evidence density index varied by two orders of magnitude across the colony and was strongly correlated with means of replicated counts of birds socializing on the colony surface. Quantitatively mapping all large auklet colonies is logistically feasible using this method and would provide an important baseline for monitoring colony status. Regularly monitoring select colonies using this method may be the best means of detecting changes in distribution and population size of crevice-nesting seabirds. ?? The Cooper Ornithological Society 2006.

Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

Science.gov (United States)

Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

2014-05-13

Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

Deconstructive Pedagogy and Ideological Demystification in Post-Colonial Pakistan

Science.gov (United States)

Mansoor, Asma; Malik, Samina

2016-01-01

With post-colonial Pakistan inheriting the British colonial ideological and governmental apparatus, the English literature curriculum implemented at the university level in Pakistan carried the interpellatory baggage of its colonial past. Our interdisciplinary exploration focuses on using deconstructive pedagogy to demystify and subvert the…

Critical evaluation of branch polarity and apical dominance as dictators of colony astogeny in a branching coral.

Directory of Open Access Journals (Sweden)

Lee Shaish

Full Text Available The high morphological resemblance between branching corals and trees, can lead to comparative studies on pattern formation traits, best exemplified in plants and in some cnidarians. Here, 81 branches of similar size of the hermatypic coral Stylophora pistillata were lopped of three different genets, their skeletons marked with alizarin red-S, and divided haphazardly into three morphometric treatment groups: (I upright position; (II horizontal position, intact tip; and (III horizontal position, cut tip. After 1 y of in-situ growth, the 45 surviving ramets were brought to the laboratory, their tissues removed and their architectures analyzed by 22 morphological parameters (MPs. We found that within 1 y, isolated branches developed into small coral colonies by growing new branches from all branch termini, in all directions. No architectural dissimilarity was assigned among the three studied genets of treatment I colonies. However, a major architectural disparity between treatment I colonies and colonies of treatments II and III was documented as the development of mirror structures from both sides of treatments II and III settings as compared to tip-borne architectures in treatment I colonies. We did not observe apical dominance since fragments grew equally from all branch sides without documented dominant polarity along branch axis. In treatment II colonies, no MP for new branches originating either from tips or from branch bases differed significantly. In treatment III colonies, growth from the cut tip areas was significantly lower compared to the base, again, suggesting lack of apical dominance in this species. Changes in branch polarity revealed genet associated plasticity, which in one of the studied genets, led to enhanced growth. Different genets exhibited canalization flexibility of growth patterns towards either lateral growth, or branch axis extension (skeletal weight and not porosity was measured. This study revealed that colony

The regulation of British colonial lunatic asylums and the origins of colonial psychiatry, 1860-1864.

Science.gov (United States)

Swartz, Sally

2010-05-01

In this paper I outline a brief period in the history of the British Empire, during which colonial lunatic asylum policy began to be formulated. I begin with a scandal that erupted in Jamaica and suggest that this set in motion processes that led to critical changes in asylum administration. The first of these processes was an audit of hospitals and asylums in the colonies. The results of the audit and the policy that emerged from it marked the beginning of systematic regulation of lunatic asylum practice across the British Empire. It revealed a formulation of policy that was intended to cut across the self-governing regimes that had up to this point been allowed to evolve. Drawing on the work of Michel Foucault and Nikolas Rose, I argue that the policy and the practices associated with it contribute to an understanding of the emergence of the psy-sciences in colonial settings. They illustrate the establishment of a panoptic gaze on previously neglected insane spaces. Systematic surveillance constituted government at a distance and made colonial lunacy administration a governable discursive space. The regulation of the medical officers, lunatic attendants, and hospital boards began the process of creating a professional psychiatric workforce. I conclude with a discussion of the implications and the mixed impact of this policy change for the mentally ill across the empire, over the ensuing decades.

Leisure, economy and colonial urbanism: Darjeeling, 1835-1930.

Science.gov (United States)

Bhattacharya, Nandini

2013-08-01

This article posits that the hill station of Darjeeling was a unique form of colonial urbanism. It shifts historiographical interest from major urban centres in colonial India (such as Bombay or Calcutta) and instead attempts a greater understanding of smaller urban centres. In the process, it also interrogates the category of hill stations, which have been understood as exotic and scenic sites rather than as towns that were integral to the colonial economy. In arguing that hill stations, particularly Darjeeling, were not merely the scenic and healthy 'other' of the clamorous, dirty and diseased plains of India, it refutes suggestions that the 'despoiling' or overcrowding of Darjeeling was incremental to the purposes of its establishment. Instead, it suggests that Darjeeling was part of the colonial mainstream; its urbanization and inclusion into the greater colonial economy was effected from the time of its establishment. Therefore, a constant tension between its exotic and its functional elements persisted throughout.

Is there a Space for Post-Colonial Theory in the Socio-Psychological Research on Consequences of Colonial Past?

Science.gov (United States)

Leone, Giovanna

2018-04-26

The focus of my commentary is two-fold. First, I discuss what appeared to me as the central theoretical focus of the article; the possibility to create a space, if at all, for integrating post-colonial theory into the broader research field of social and psychological studies of the consequences of colonial past. Second, I intend to show why, in my opinion, the methodological choices of the authors and the criteria adopted for corpus construction allowed for data that, although too thin to establishing the state of knowledge in the field of study on consequences of colonial past, is nevertheless very informative and thoughts-provoking. My conclusions suggest that this study is an innovative attempt at describing and grasping the results of a search guided by two among the more consolidated electronic datasets currently available for English-speaking scholars. However, this study may not easily understand which can be the space to integrate post-colonial theory in the field of research on consequences of colonial past. To better reach this aim, it is perhaps necessary to build another kind of corpus, open to other languages (starting from French) and focused also on other scientific products, as books or proceedings of congress. In addition, disciplinary boundaries have to be even more explored, starting from interdisciplinary studies on education and historical culture. In spite of these limitations, I am convinced that this innovative study by Tomicic and Berardi tackles issues of relevance to any serious effort towards reflecting on long-term consequences of colonial violence and opens up to valuable new research questions and methods, to be taken into serious account and further explored in future works.

Increase in Bacterial Colony Formation from a Permafrost Ice Wedge Dosed with a Tomitella biformata Recombinant Resuscitation-Promoting Factor Protein.

Science.gov (United States)

Puspita, Indun Dewi; Kitagawa, Wataru; Kamagata, Yoichi; Tanaka, Michiko; Nakatsu, Cindy H

2015-01-01

Resuscitation-promoting factor (Rpf) is a protein that has been found in a number of different Actinobacteria species and has been shown to promote the growth of active cells and resuscitate dormant (non-dividing) cells. We previously reported the biological activity of an Rpf protein in Tomitella biformata AHU 1821(T), an Actinobacteria isolated from a permafrost ice wedge. This protein is excreted outside the cell; however, few studies have investigated its contribution in environmental samples to the growth or resuscitation of bacteria other than the original host. Therefore, the aim of the present study was to determine whether Rpf from T. biformata impacted the cultivation of other bacteria from the permafrost ice wedge from which it was originally isolated. All experiments used recombinant Rpf proteins produced using a Rhodococcus erythropolis expression system. Dilutions of melted surface sterilized ice wedge samples mixed with different doses of the purified recombinant Rpf (rRpf) protein indicated that the highest concentration tested, 1250 pM, had a significantly (p permafrost sediments. The results of the present study demonstrated that rRpf not only promoted the growth of T. biformata from which it was isolated, but also enhanced colony formation by another Actinobacteria in an environmental sample.

Parent–offspring resemblance in colony-specific adult survival of cliff swallows

Science.gov (United States)

Brown, Charles R.; Roche, Erin A.; Brown, Mary Bomberger

2015-01-01

Survival is a key component of fitness. Species that occupy discrete breeding colonies with different characteristics are often exposed to varying costs and benefits associated with group size or environmental conditions, and survival is an integrative net measure of these effects. We investigated the extent to which survival probability of adult (≥1-year old) cliff swallows (Petrochelidon pyrrhonota) occupying different colonies resembled that of their parental cohort and thus whether the natal colony had long-term effects on individuals. Individuals were cross-fostered between colonies soon after hatching and their presence as breeders monitored at colonies in the western Nebraska study area for the subsequent decade. Colony-specific adult survival probabilities of offspring born and reared in the same colony, and those cross-fostered away from their natal colony soon after birth, were positively and significantly related to subsequent adult survival of the parental cohort from the natal colony. This result held when controlling for the effect of natal colony size and the age composition of the parental cohort. In contrast, colony-specific adult survival of offspring cross-fostered to a site was unrelated to that of their foster parent cohort or to the cohort of non-fostered offspring with whom they were reared. Adult survival at a colony varied inversely with fecundity, as measured by mean brood size, providing evidence for a survival–fecundity trade-off in this species. The results suggest some heritable variation in adult survival, likely maintained by negative correlations between fitness components. The study provides additional evidence that colonies represent non-random collections of individuals.

The Genesis of Public Relations in British Colonial Practice.

Science.gov (United States)

Smyth, Rosaleen

2001-01-01

Demonstrates how the British Colonial Office employed public relations strategies as they administered the British colony of Northern Rhodesia before, during, and after World War II. Demonstrates how civil servants in London and colonial officials implemented public relations policies, strategies, and tactics on an ad hoc basis, covering political…

Policing native pleasures: a colonial history.

Science.gov (United States)

Jabbar, Naheem

2012-12-01

The moral modality of colonial power is still with us when it comes to the recreation of sexual norms of traditional or feudal society. We can examine the emergent properties of colonial knowledge anew by exploring how the colonial regime's strategic attention of regulating brothels in India differed from the analytic of power Foucault described for sexuality in European society. It turns out that amongst other things, public anxieties about the failure of adaptation by South Asians are incapable of leaving sexuality aside as a key interpretive device for their culture. The British preoccupation with reproducing the dynamics of the bourgeois matrimonial market on foreign soil in the mid-nineteenth century similarly necessitated a sociological pretext for racial purity. However, the kind of knowledge a typical traveller and employee of the East India Company brought to the Victorian public from his own researches in the brothels and streets of colonial India, which revealed how popular prostitution was as a vice amongst the officer class, was also more than a welcome imaginary relief from Christian morality; it was an alternative vision of modernity. © London School of Economics and Political Science 2012.

Buckling instability in ordered bacterial colonies

Science.gov (United States)

Boyer, Denis; Mather, William; Mondragón-Palomino, Octavio; Orozco-Fuentes, Sirio; Danino, Tal; Hasty, Jeff; Tsimring, Lev S.

2011-04-01

Bacterial colonies often exhibit complex spatio-temporal organization. This collective behavior is affected by a multitude of factors ranging from the properties of individual cells (shape, motility, membrane structure) to chemotaxis and other means of cell-cell communication. One of the important but often overlooked mechanisms of spatio-temporal organization is direct mechanical contact among cells in dense colonies such as biofilms. While in natural habitats all these different mechanisms and factors act in concert, one can use laboratory cell cultures to study certain mechanisms in isolation. Recent work demonstrated that growth and ensuing expansion flow of rod-like bacteria Escherichia coli in confined environments leads to orientation of cells along the flow direction and thus to ordering of cells. However, the cell orientational ordering remained imperfect. In this paper we study one mechanism responsible for the persistence of disorder in growing cell populations. We demonstrate experimentally that a growing colony of nematically ordered cells is prone to the buckling instability. Our theoretical analysis and discrete-element simulations suggest that the nature of this instability is related to the anisotropy of the stress tensor in the ordered cell colony.

Buckling instability in ordered bacterial colonies

International Nuclear Information System (INIS)

Boyer, Denis; Mather, William; Mondragón-Palomino, Octavio; Danino, Tal; Hasty, Jeff; Orozco-Fuentes, Sirio; Tsimring, Lev S

2011-01-01

Bacterial colonies often exhibit complex spatio-temporal organization. This collective behavior is affected by a multitude of factors ranging from the properties of individual cells (shape, motility, membrane structure) to chemotaxis and other means of cell–cell communication. One of the important but often overlooked mechanisms of spatio-temporal organization is direct mechanical contact among cells in dense colonies such as biofilms. While in natural habitats all these different mechanisms and factors act in concert, one can use laboratory cell cultures to study certain mechanisms in isolation. Recent work demonstrated that growth and ensuing expansion flow of rod-like bacteria Escherichia coli in confined environments leads to orientation of cells along the flow direction and thus to ordering of cells. However, the cell orientational ordering remained imperfect. In this paper we study one mechanism responsible for the persistence of disorder in growing cell populations. We demonstrate experimentally that a growing colony of nematically ordered cells is prone to the buckling instability. Our theoretical analysis and discrete-element simulations suggest that the nature of this instability is related to the anisotropy of the stress tensor in the ordered cell colony

Mem and Cookie: The Colonial Kitchen in Malaysia and Singapore

Directory of Open Access Journals (Sweden)

Cecilia Leong-Salobir

2015-09-01

Full Text Available This paper examines the emergence of a distinctive colonial cuisine in the British colonies of Malaysia and Singapore beginning in the late nineteenth century. This colonial cuisine evolved over time and was a combination of culinary practices derived from European and Asian foodways, much of which came from colonial India. As in India, this acculturation developed through the reliance of colonizers on their domestic servants for food preparation. While domestic servants (as cooks, or known locally as “cookie” were generally represented as dirty, dishonest and lacking in intelligence according to colonial narratives, they were responsible for the preparation of food for the family. Asian cooks in the colonial home played a much more crucial role than the negative image painted of them by British colonizers and other historians. While the mem (short for memsahib, meaning mistress held the supervisory role of the household, it was the physical contribution of the domestic servants that enabled her to fulfill this function. The large number of servants employed enabled the mem to make the colonial home move seamlessly between the private domain of the home and the official venue for the empire’s tasks. The mem as the head of the household decided on the rituals and tasks that defined the colonial space as home, and as a bastion of white imperialism. In contrast, it was the cooks’ local knowledge that procured food. Most kitchens were fashioned according to the requirements of the servants and the cooks did all the cooking, usually preparing local dishes. The argument is that, had it not been for the servants’ input, the mems would have had to work harder. As it was, the work of the servants not only saved white labour, it helped shape colonial culture, despite the Britons’ best efforts to keep themselves socially distant. Colonial cuisine would not have developed with such distinctive features without the skills and local knowledge of

The psychology of colonialism: sex, age, and ideology in British India.

Science.gov (United States)

Nandy, A

1982-08-01

It is becoming more and more obvious that colonialism--as we have come to know it during the last two hundred years--cannot be identified with only economic gain and political power. In Manchuria, Japan consistently lost money, and for many years colonial Indochina, Algeria and Angola, instead of increasing the political power of France and Portugal, sapped it. This did not make Manchuria, Indochina, Algeria or Angola less important as colonies. Nor did it disprove the point that economic gain and political power are important motives in a colonial situation. It only showed that colonialism could be characterized by the search for economic and political advantage without concomitant real economic or political gains, and sometimes even with economic or political losses. This essay argues that the first differentia of colonialism is a state of mind in the colonizers and the colonized, a colonial consciousness which includes the sometimes unrealizable wish to make economic and political profits from the colonies, but other elements, too. The political economy of colonization is of course important, but the vulgarity and insanity of colonialism are principally expressed in the sphere of psychology. The following pages will explore some of these psychological contours of colonialism in the rulers and the ruled and try to define colonialism as a shared culture which may not always begin with the establishment of alien rule in a society and end with the departure of the alien rulers from the colony. The example I shall use will be that of India, where a colonial political economy began to operate seventy-five years before the full-blown ideology of British imperialism became dominant, and where thirty years after the formal ending of the raj, the ideology of colonialism is still triumphant in many sectors of life.

Synthetic quorum sensing in model microcapsule colonies

Science.gov (United States)

Shum, Henry; Balazs, Anna C.

2017-08-01

Biological quorum sensing refers to the ability of cells to gauge their population density and collectively initiate a new behavior once a critical density is reached. Designing synthetic materials systems that exhibit quorum sensing-like behavior could enable the fabrication of devices with both self-recognition and self-regulating functionality. Herein, we develop models for a colony of synthetic microcapsules that communicate by producing and releasing signaling molecules. Production of the chemicals is regulated by a biomimetic negative feedback loop, the “repressilator” network. Through theory and simulation, we show that the chemical behavior of such capsules is sensitive to both the density and number of capsules in the colony. For example, decreasing the spacing between a fixed number of capsules can trigger a transition in chemical activity from the steady, repressed state to large-amplitude oscillations in chemical production. Alternatively, for a fixed density, an increase in the number of capsules in the colony can also promote a transition into the oscillatory state. This configuration-dependent behavior of the capsule colony exemplifies quorum-sensing behavior. Using our theoretical model, we predict the transitions from the steady state to oscillatory behavior as a function of the colony size and capsule density.

Collaboration, Coproduction, and Code-Switching: Colonial Cinema and Postcolonial Archaeology

Directory of Open Access Journals (Sweden)

Nayoung Aimee Kwon

2012-12-01

Full Text Available This article reassesses the issue of colonial collaboration in the Japanese empire by examining the rise of cinematic coproductions between Japanese and Korean filmmakers. By the late 1930s, colonial Korea’s filmmaking industry had been fully subsumed into the Japanese film industry, and regulations were established that required all films to assimilate imperial policies. The colonial government’s active promotion of colonial “collaboration” and “coproduction” between the colonizers and the colonized ideologically worked to obfuscate these increasing restrictions in colonial film productions while producing complex and contentious desires across the colonial divide. The very concepts of “collaboration” and “coproduction” need to be redefined in light of increasingly complex imperial hierarchies and entanglements. Taking the concept of “code-switching” beyond its linguistic origins, this article argues that we must reassess texts of colonial collaboration and coproduction produced at a time when Korean film had to “code-switch” into Japanese—to linguistically, culturally, and politically align itself with the wartime empire. The article argues that recently excavated films from colonial and Cold War archives, such as Spring in the Korean Peninsula, offer a rare glimpse into repressed and contested histories and raise the broader conundrum of accessing and assessing uneasily commingled colonial pasts of Asian-Pacific nations in the ruins of postcolonial aftermath.

For the youth : juvenile delinquency, colonial civil society and the late colonial state in the Netherlands Indies, 1872-1942

NARCIS (Netherlands)

Dirks, Annelieke

2011-01-01

This dissertation project focuses on forced re-education policies for juvenile delinquents in the Netherlands Indies (now Indonesia) and uses this topic to show the interaction between a 'modernizing' Dutch colonial state and the growth of a colonial civil society, between approximately 1872 and

Different tolerances to chemical contaminants between unicellular and colonial morph of Microcystis aeruginosa: excluding the differences among different strains.

Science.gov (United States)

Li, Ming; Nkrumah, Philip Nti; Peng, Qiang

2015-03-21

In order to ascertain the different tolerances to chemical contaminants in one strain of Microcystis with different morphology, unicellular and colonial Microcystis in one strain was obtained from different conditions of light intensity and temperature. The samples were divided into 8 groups including control (no chemical addition), CuSO4, chloromycetin, and linear alkylbenzene sulfonatelas (LAS) treatments. The cell density, cell viability, superoxide dismutase (SOD), and malonaldehyde of Microcystis were analyzed. It was observed that cell density of both unicellular and colonial Microcystis increased from the beginning to day-5 in the control and the CuSO4 treatments. However, the growth of Microcystis was significantly inhibited in the culture with chloromycetin and LAS treatments. Notably, the inhibition rate was significantly high in unicellular Microcystis relative to the colonial Microcystis. The esterase activity in all the treatments decreased dramatically relating to the control. In addition, the esterase activity in colonial Microcystis was significantly higher than that of the unicellular Microcystis in all the treatments. Although there were no significant differences in activities of SOD between the two morphologies in the control treatments, in all the other treatments, significant differences were observed. The results proved that colony formation of Microcystis could be considered as a strategy in response to chemical stress. Copyright © 2014 Elsevier B.V. All rights reserved.

Morphological Diversity of the Colony Produced by Bacteria Proteus mirabilis

Science.gov (United States)

Nakahara, Akio; Shimada, Yuji; Wakita, Jun-ichi; Matsushita, Mitsugu; Matsuyama, Tohey

1996-08-01

Morphological changes of colonies have been investigatedfor a bacterial strain of Proteus mirabilis, which is a famous speciesfor producing concentric-ring-like colonies. It was found that colony patterns can be classified into three types,i.e., cyclic spreading, diffusion-limited growth (DLA-like)and three-dimensional growth (inside the agar medium) patterns. Cyclic spreading patterns can further be classifiedinto three subgroups, i.e., concentric-ring, homogeneous and spatiotemporal patterns. These subgroups were classified by examining the development of colony structure after colonies spread all over petri-dishes. Comparison of the results with thoseof another bacterial species Bacillus subtilis is also discussed.

Colonialism as a Broader Social Determinant of Health

Directory of Open Access Journals (Sweden)

Karina Czyzewski

2011-05-01

Full Text Available A proposed broader or Indigenized social determinants of health framework includes "colonialism" along with other global processes. What does it mean to understand Canadian colonialism as a distal determinant of Indigenous health? This paper reviews pertinent discourses surrounding Indigenous mental health in Canada.With an emphasis on the notion of intergenerational trauma, there are real health effects of social, political, and economic marginalization embodied within individuals, which can collectively affect entire communities. Colonialism can also be enacted and reinforced within Indigenous mental health discourse, thus influencing scholarly and popular perceptions. Addressing this distal determinant through policy work necessitates that improving Indigenous health is inherently related to improving these relationships, i.e. eliminating colonial relations, and increasing self-determination.

Social interactions in the central nest of Coptotermes formosanus juvenile colonies

Science.gov (United States)

Juvenile colonies of Coptotermes formosanus Shiraki were investigated to determine the social interactions among all individuals near the central nest of a colony. The behavioral repertoire of whole colonies of subterranean termites has yet to be identified because of their cryptic nests. Colonies w...

[Notes about other epidemics in Colonial Chile].

Science.gov (United States)

Laval, Enrique

2015-10-01

In chronicles or in the historiography of the Colony in Chile there are few references about epidemics different to smallpox; like typhus, typhoid fever, dysentery, etc. Almost all, fast spreading in the country and some with high lethality, which led to overflowing the capacity of hospitals in the Chilean colonial period.

Effects of x-ray and neutron irradiation on spherical colonies

International Nuclear Information System (INIS)

Aramaki, Ryoji

1980-01-01

Responses of in vitro cultured mammalian cells in spherical colonies to 200 kVp x-rays and D-T neutrons were studied using reproductive capacity as a criterion for survival. Cell lines used were FM3A, L5 and Chinese hamster V79. The spherical colonies exposed to x-rays exhibited two-component survival curves. All cells used were more radio-resistant in spherical colonies than in single cell suspensions. It was suggested that this difference in response was attributable to the presence of hypoxic cells in spherical colonies. Dose-modifying Factor (DMF), the ratios of D 0 of the second slopes of the curves for spherical colonies to those for single cells, were 1.6 for FM3A, 1.8 for L5, and 1.7 for Chinese hamster V79. The hypoxic cell fractions in spherical colonies for FM3A, L5, and Chinese hamster V79, were 0.1, 0.6 and 0.4, respectively, resulting in variations in cell survival in spherical colonies following x-radiation. No significant difference was observed between responses of spherical colonies and single cell suspensions to D-T neutrons. FM3A and Chinese hamster V79 showed two-component survival curves when irradiated with neutrons at 37 0 C, but not at 25 0 C. The repair of potentially lethal and sub-lethal damage was also investigated using FM3A in spherical colonies. No detectable repair of potentially lethal damage was observed for x-rays and D-T neutrons. The effect of neutron fractionation was considerably smaller for spherical colonies as compared to single cells. (author)

REVENUE FARMING AND IMPERIAL TRANSITION: AN ECONOMIC DIMENSION OF EARLY COLONIAL STATE FORMATION IN JAVA, C. 1800s-1820s

Directory of Open Access Journals (Sweden)

Abdul Wahid

2012-11-01

Full Text Available Revenue farming (pacht or verpachtingen in Dutch is a fiscal institution that existed in Java since the pre-colonial period. During the VOC period, the Dutch modified, institutionalized and &extended it as one of their fiscal institutions to solve human resource shortage and administrative barriers in collecting taxes from local population. For political and economic reasons the Dutch favored the Chinese as main partners in operating the system. The system was proven efficient to an extent that it collected substantial revenue contribution to the state exchequer. During the period of 'imperial'  transition from 1800s until 1820s, changing regimes in Java retained the system to finance their political agenda. This paper argues that revenue-farming system was the financial source for the Dutch in establishing a real colonial state in Java.

Isolation of endothelial colony-forming cells from blood samples collected from the jugular and cephalic veins of healthy adult horses.

Science.gov (United States)

Sharpe, Ashley N; Seeto, Wen J; Winter, Randolph L; Zhong, Qiao; Lipke, Elizabeth A; Wooldridge, Anne A

2016-10-01

OBJECTIVE To evaluate optimal isolation of endothelial colony-forming cells (ECFCs) from peripheral blood of horses. SAMPLE Jugular and cephalic venous blood samples from 17 adult horses. PROCEDURES Each blood sample was divided; isolation was performed with whole blood adherence (WBA) and density gradient centrifugation (DGC). Isolated cells were characterized by uptake of 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate-labeled acetylated low-density lipoprotein (DiI-Ac-LDL), vascular tubule formation, and expression of endothelial (CD34, CD105, vascular endothelial growth factor receptor-2, and von Willebrand factor) and hematopoietic (CD14) cell markers by use of indirect immunofluorescence assay (IFA) and flow cytometry. RESULTS Colonies with cobblestone morphology were isolated from 15 of 17 horses. Blood collected from the cephalic vein yielded colonies significantly more often (14/17 horses) than did blood collected from the jugular vein (8/17 horses). Of 14 cephalic blood samples with colonies, 13 were obtained with DGC and 8 with WBA. Of 8 jugular blood samples with colonies, 8 were obtained with DGC and 4 with WBA. Colony frequency (colonies per milliliter of blood) was significantly higher for cephalic blood samples and samples isolated with DGC. Cells formed vascular tubules, had uptake of DiI-Ac-LDL, and expressed endothelial markers by use of IFA and flow cytometry, which confirmed their identity as ECFCs. CONCLUSIONS AND CLINICAL RELEVANCE Maximum yield of ECFCs was obtained for blood samples collected from both the jugular and cephalic veins and use of DGC to isolate cells. Consistent yield of ECFCs from peripheral blood of horses will enable studies to evaluate diagnostic and therapeutic uses.

Delayed myelosuppression with acute exposure to hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and environmental degradation product hexahydro-1-nitroso-3,5-dinitro-1,3,5-triazine (MNX) in rats

Energy Technology Data Exchange (ETDEWEB)

Jaligama, Sridhar; Kale, Vijay M.; Wilbanks, Mitchell S. [Department of Toxicology, College of Pharmacy, University of Louisiana at Monroe, Monroe, LA 71209 (United States); Perkins, Edward J. [US Army Engineer Research and Development Center, Vicksburg, MS 39180 (United States); Meyer, Sharon A., E-mail: meyer@ulm.edu [Department of Toxicology, College of Pharmacy, University of Louisiana at Monroe, Monroe, LA 71209 (United States)

2013-02-01

Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), a widely used munitions compound, and hexahydro-1-nitroso-3,5-dinitro-1,3,5-triazine (MNX), its N-nitroso product of anaerobic microbial nitroreduction, are contaminants of military sites. Previous studies have shown MNX to be the most acutely toxic among the nitroreduced degradation products of RDX and to cause mild anemia at high dose. The present study compares hematotoxicity with acute oral exposure to MNX with parent RDX. Both RDX and MNX caused a modest decrease in blood hemoglobin and ∼ 50% loss of granulocytes (NOAELs = 47 mg/kg) in female Sprague–Dawley rats observed 14 days post-exposure. We explored the possibility that blood cell loss observed after 14 days was delayed in onset because of toxicity to bone marrow (BM) progenitors. RDX and MNX decreased granulocyte/macrophage-colony forming cells (GM-CFCs) at 14, but not 7, days (NOAELs = 24 mg/kg). The earliest observed time at which MNX decreased GM-CFCs was 10 days post-exposure. RDX and MNX likewise decreased BM burst-forming units-erythroid (BFU-Es) at 14, but not 7, days. Granulocyte–erythrocyte–monocyte–megakaryocyte (GEMM)-CFCs were unaffected by RDX and MNX at 7 days suggesting precursor depletion did not account for GM-CFC and BFU-E loss. MNX added to the culture media was without effect on GM-CFC formation indicating no direct inhibition. Flow cytometry showed no differential loss of BM multilineage progenitors (Thy1.1{sup +}) or erythroid (CD71{sup +}) precursors with MNX suggesting myeloid and erythroid lineages were comparably affected. Collectively, these data indicate that acute exposure to both RDX and MNX caused delayed suppression of myelo- and erythropoiesis with subsequent decrease of peripheral granulocytes and erythrocytes. Highlights: ► Acute oral exposure to munitions RDX causes myelosuppression. ► Environmental degradation product MNX is comparable in effect. ► RDX and MNX are cytotoxic to both myeloid and erythroid

Workers' Extra-Nest Behavioral Changes During Colony Fission in Dinoponera quadriceps (Santschi).

Science.gov (United States)

Medeiros, J; Araújo, A

2014-04-01

Ant colonies can reproduce by two strategies: independent foundation, wherein the queen starts a new colony alone, and dependent foundation, in which workers assist the queen. In the queenless species Dinoponera quadriceps (Santschi), the colony reproduces obligatorily by fission, a type of dependent foundation, but this process is not well understood. This study describes a colony fission event of D. quadriceps in the field and analyzes the influence of the fission process on workers' extra-nest behavior. Based on observations of workers outside the nest, five distinct stages were identified: monodomic stage, polydomic stage, split stage, conflict stage, and post-conflict stage. The colony was initially monodomic and then occupied a second nest before it split into two independent colonies, indicating a gradual and opportunistic dependent foundation. After the fission event, the daughter colony had aggressive conflicts with the parental colony, resulting in the latter's disappearance. Colony fission affected workers' extra-nest behavior by increasing the frequency of rubbing the gaster against the substrate (which probably has a chemical marking function) and by decreasing the frequency of foraging during the split stage. After the fission event, the number of foragers was halved and foragers remained nearer to the nest during extra-nest activity. The spatial closeness of the parental and daughter colonies led to competition that caused the extinction or migration of the parental colony. Intraspecific competition was indicated by foraging directionality at the colony level, whereby areas of neighbor colonies were avoided; this directionality was stronger while both colonies coexisted.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

BETWEEN MEN OF KNOWLEDGE, LETTERS AND SCIENCE: doctors and other curators in colonial Brazil

Directory of Open Access Journals (Sweden)

Ana Carolina de Carvalho Viotti

2014-06-01

Full Text Available In the centuries before the establishment of Portuguese court and, with them, the teaching and practice of essentially medicalactions in Brazil, there were many people and intercrossed understandingsurrounding the healing practices. In this article, the formation of therapeutic cognizance in the colonial scenario will be examined, a kind of knowledge which only could be formed by the interchange of ideas from the “Old World” and the needs – and possibilities – in the tropics.

Granulocyte colony-stimulating factor induces in vitro lymphangiogenesis

International Nuclear Information System (INIS)

Lee, Ae Sin; Kim, Dal; Wagle, Susbin Raj; Lee, Jung Eun; Jung, Yu Jin; Kang, Kyung Pyo; Lee, Sik; Park, Sung Kwang; Kim, Won

2013-01-01

Highlights: •G-CSF induces tube formation, migration and proliferation of lymphatic cells. •G-CSF increases phosphorylation of MAPK and Akt in lymphatic endothelial cells. •MAPK and Akt pathways are linked to G-CSF-induced in vitro lymphangiogenesis. •G-CSF increases sprouting of a lymphatic ring. •G-CSF produces peritoneal lymphangiogenesis. -- Abstract: Granulocyte-colony stimulating factor (G-CSF) is reported to induce differentiation in cells of the monocyte lineage and angiogenesis in vascular endothelial cells, but its effects on lymphangiogenesis is uncertain. Here we examined the effects and the mechanisms of G-CSF-induced lymphangiogenesis using human lymphatic endothelial cells (hLECs). Our results showed that G-CSF induced capillary-like tube formation, migration and proliferation of hLECs in a dose- and time-dependent manner and enhanced sprouting of thoracic duct. G-CSF increased phosphorylation of Akt and ERK1/2 in hLECs. Supporting the observations, specific inhibitors of phosphatidylinositol 3′-kinase and MAPK suppressed the G-CSF-induced in vitro lymphangiogenesis and sprouting. Intraperitoneal administration of G-CSF to mice also stimulated peritoneal lymphangiogenesis. These findings suggest that G-CSF is a lymphangiogenic factor

Indonesian Chinese in the Netherlands and the legacies of violence in colonial and post-colonial Indonesia

Directory of Open Access Journals (Sweden)

Alexander van der Meer

2017-04-01

Full Text Available After Indonesian independence in 1945, thousands of Indonesian Chinese repatriated to the Netherlands, the former colonizer. As opposed to other repatriates from Indonesia, who organized themselves into pressure groups and fought for a place in the national memory culture, the Indonesian Chinese in the Netherlands only formed strict socio-cultural associations and have generally stayed clear of identity politics. Usually, this divergence is attributed to the smooth integration and socio-economic success of the latter group, as well as to Chinese values, such as conflict avoidance.This article adds to this explanation by positing that this phenomenon has also been induced by the legacy of anti-Chinese violence in colonial and post-colonial Indonesia: respectively, Dutch discomfort to acknowledge the violent and discriminatory elements of its own colonial history, as well as a fear of offending the Indonesian government. Consequently, many Indonesian Chinese in the Netherlands have engaged in some form of public self-silencing.

Longevity of U cells of differentiated yeast colonies grown on respiratory medium depends on active glycolysis.

Science.gov (United States)

Čáp, Michal; Váchová, Libuše; Palková, Zdena

2015-01-01

Colonies of Saccharomyces cerevisiae laboratory strains pass through specific developmental phases when growing on solid respiratory medium. During entry into the so-called alkali phase, in which ammonia signaling is initiated, 2 prominent cell types are formed within the colonies: U cells in upper colony regions, which have a longevity phenotype and activate the expression of a large number of metabolic genes, and L cells in lower regions, which die more quickly and exhibit a starvation phenotype. Here, we performed a detailed analysis of the activities of enzymes of central carbon metabolism in lysates of both cell types and determined several fermentation end products, showing that previously reported expression differences are reflected in the different enzymatic capabilities of each cell type. Hence, U cells, despite being grown on respiratory medium, behave as fermenting cells, whereas L cells rely on respiratory metabolism and possess active gluconeogenesis. Using a spectrum of different inhibitors, we showed that glycolysis is essential for the formation, and particularly, the survival of U cells. We also showed that β-1,3-glucans that are released from the cell walls of L cells are the most likely source of carbohydrates for U cells.

Predation of artificial ground nests on white-tailed prairie dog colonies

Science.gov (United States)

Baker, B.W.; Stanley, T.R.; Sedgwick, J.A.

1999-01-01

Prairie dog (Cynomys spp.) colonies are unique to prairie and shrub-steppe landscapes. However, widespread eradication, habitat loss, and sylvatic plague (Yersinia pestis) have reduced their numbers by 98% since historical times. Birds associated with prairie dogs also are declining. Potential nest predators, such as coyotes (Canis latrans), swift foxes (Vulpes velox), and badgers (Taxidea taxus), may be attracted to colonies where a high concentration of prairie dogs serve as available prey. Increased abundance of small mammals, including prairie dogs, also may increase the risk of predation for birds nesting on colonies. Finally, because grazing by prairie dogs may decrease vegetation height and canopy cover, bird nests may be easier for predators to locate. In this study, we placed 1,444 artificial ground nests on and off 74 white-tailed prairie dog (C. leucurus) colonies to test the hypothesis that nest predation rates are higher on colonies than at nearby off sites (i.e., uncolonized habitat). We sampled colonies from 27 May to 16 July 1997 at the following 3 complexes: Coyote Basin, Utah and Colorado; Moxa Arch, Wyoming; and Shirley Basin, Wyoming. Differences in daily predation rates between colonies and paired off sites averaged 1.0% (P = 0.060). When converted to a typical 14-day incubation period, predation rates averaged 14% higher on colonies (57.7 ?? 2.7%; ?? ?? SE) than at off sites (50.4 ?? 3.1%). Comparisons of habitat variables on colonies to off sites showed percent canopy cover of vegetation was similar (P = 0.114), percent bare ground was higher on colonies (P 0.288). Although we found the risk of nest predation was higher on white-tailed prairie dog colonies than at off sites, fitness of birds nesting on colonies might depend on other factors that influence foraging success, reproductive success, or nestling survival.

Population regulation in Magellanic penguins: what determines changes in colony size?

Directory of Open Access Journals (Sweden)

Luciana M Pozzi

Full Text Available Seabirds are often studied at individual colonies, but the confounding effects of emigration and mortality processes in open populations may lead to inappropriate conclusions on the mechanisms underlying population changes. Magellanic penguin (Spheniscus magellanicus colonies of variable population sizes are distributed along the Argentine coastline. In recent decades, several population and distributional changes have occurred, with some colonies declining and others newly established or increasing. We integrated data of eight colonies scattered along ∼600 km in Northern Patagonia (from 41°26´S, 65°01´W to 45°11´S, 66°30´W, Rio Negro and Chubut provinces and conducted analysis in terms of their growth rates, production of young and of the dependence of those vital rates on colony age, size, and location. We contrasted population trends estimated from abundance data with those derived from population modeling to understand if observed growth rates were attainable under closed population scenarios. Population trends were inversely related to colony size, suggesting a density dependent growth pattern. All colonies located in the north--which were established during the last decades--increased at high rates, with the smallest, recently established colonies growing at the fastest rate. In central-southern Chubut, where colonies are the oldest, the largest breeding aggregations declined, but smaller colonies remained relatively stable. Results provided strong evidence that dispersal played a major role in driving local trends. Breeding success was higher in northern colonies, likely mediated by favorable oceanographic conditions. However, mean foraging distance and body condition of chicks at fledging were influenced by colony size. Recruitment of penguins in the northern area may have been triggered by a combination of density dependence, likely exacerbated by less favorable oceanographic conditions in the southern sector. Our results

Specters of Colonialism

DEFF Research Database (Denmark)

Muhr, Sara Louise; Azad, Salam

2013-01-01

at the same time they always are bound to fail to become ‘Swedish’ because of the same foreign origins. Although Swedish culture – partly by distancing itself from having a colonial past – has successfully built up an image of openness, we argue that without acknowledging and confronting the role...

Seabird colonies in the Melville Bay, Northwest Greenland

DEFF Research Database (Denmark)

Boertmann, David; Huffeldt, Nicholas Per

This report describes the results of a survey for breeding and colonial seabirds in a hitherto un-surveyed area of Northwest Greenland - the Melville Bay. The results shall be included as background data for oil spill sensitivity mapping, preparation of environmental impact assessments of petroleum...... activities in Baffin Bay and for the regulation (by the Greenland government) of petroleum activities. The survey showed, that compared to other coasts of West Greenland, the Melville Bay holds only few breeding colonies and low numbers of breeding seabirds. The most widespread and numerous species...... is the black guillemot followed by the glaucous gull. However, one colony is of national significance – Sabine Øer, with high numbers of breeding Arctic terns and Sabine’s gulls. Other noteworthy observations were puffins on Thom Ø and many new Iceland gull colonies that extended the known northern breeding...

Genetic diversity within honeybee colonies increases signal production by waggle-dancing foragers

Science.gov (United States)

Mattila, Heather R; Burke, Kelly M; Seeley, Thomas D

2008-01-01

Recent work has demonstrated considerable benefits of intracolonial genetic diversity for the productivity of honeybee colonies: single-patriline colonies have depressed foraging rates, smaller food stores and slower weight gain relative to multiple-patriline colonies. We explored whether differences in the use of foraging-related communication behaviour (waggle dances and shaking signals) underlie differences in foraging effort of genetically diverse and genetically uniform colonies. We created three pairs of colonies; each pair had one colony headed by a multiply mated queen (inseminated by 15 drones) and one colony headed by a singly mated queen. For each pair, we monitored the production of foraging-related signals over the course of 3 days. Foragers in genetically diverse colonies had substantially more information available to them about food resources than foragers in uniform colonies. On average, in genetically diverse colonies compared with genetically uniform colonies, 36% more waggle dances were identified daily, dancers performed 62% more waggle runs per dance, foragers reported food discoveries that were farther from the nest and 91% more shaking signals were exchanged among workers each morning prior to foraging. Extreme polyandry by honeybee queens enhances the production of worker–worker communication signals that facilitate the swift discovery and exploitation of food resources. PMID:18198143

Rethinking the Colonial State: Configurations of Power, Violence, and Agency

DEFF Research Database (Denmark)

Rud, Søren; Ivarsson, Søren

2017-01-01

The main theme of this special volume is the colonial state and its governmental practices. This chapter introduces and contextualizes the contributions by providing a brief induction to recent developments within the study of the colonial state. It then presents the contributions under three per...... perspectives which represent separate yet interrelated themes relevant for the understanding of the colonial state: practices, violence, and agency. Hereby, we also accentuate the value of a non-state-centric approach to the analysis of the colonial state....

COLONIAL AMERICAN LITERATURE: MARVELOUS WONDERS AND THE MEDIEVAL TRADITION IN LUSO-BRAZILIAN HISTORIOGRAPHICAL CHRONICLES COLONIAL American Literature: WONDERS maravilhoso e da tradição medieval NO LUSO-BRASILEIRA historiográfica CHRONICLES

Directory of Open Access Journals (Sweden)

Pedro Fonseca

1996-01-01

Full Text Available Este artigo apresenta uma analise interpretativa de certos aspectos do imaginário literário medieval e sua influência na formação tropológica das crônicas do Novo Mundo. A abordagem examina algumas das motivações estéticas e mentais da tradição medieval no discurso historiográfico luso-brasileiro colonial, principalmente em relação a alguns relatos de descobrimentos e ocupação inicial de terras brasileiras na América. This article presents an interpretative analysis of certain aspects of the medieval literary imaginary and its influence in the tropological formation of the New World chronicles. The approach examines some of the aesthetic and mental motivations of the medieval tradition in the colonial Luso-Brazilian historiographical discourse, principally in regards to some accounts of discoveries and initial occupation of Brazilian lands in America.  

Leisure, economy and colonial urbanism: Darjeeling, 1835–1930

Science.gov (United States)

BHATTACHARYA, NANDINI

2013-01-01

This article posits that the hill station of Darjeeling was a unique form of colonial urbanism. It shifts historiographical interest from major urban centres in colonial India (such as Bombay or Calcutta) and instead attempts a greater understanding of smaller urban centres. In the process, it also interrogates the category of hill stations, which have been understood as exotic and scenic sites rather than as towns that were integral to the colonial economy. In arguing that hill stations, particularly Darjeeling, were not merely the scenic and healthy ‘other’ of the clamorous, dirty and diseased plains of India, it refutes suggestions that the ‘despoiling’ or overcrowding of Darjeeling was incremental to the purposes of its establishment. Instead, it suggests that Darjeeling was part of the colonial mainstream; its urbanization and inclusion into the greater colonial economy was effected from the time of its establishment. Therefore, a constant tension between its exotic and its functional elements persisted throughout. PMID:24273391

The importance of confronting a colonial, patriarchal and racist past ...

African Journals Online (AJOL)

The importance of confronting a colonial, patriarchal and racist past in addressing post-apartheid sexual violence. ... It also needs to redress problems of social and economic inequality that exist in South Africa as hangovers from this country's colonial and apartheid-era past. Keywords: Zuma, rape, Kipling, colonialism, ...

Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

Science.gov (United States)

Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

2017-07-15

Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

The Colonial Situation: Complicities and Distinctions from the Surrealist Image

Directory of Open Access Journals (Sweden)

Pedro Pablo Gómez

2011-05-01

Full Text Available In this work, taking as baseline the thought of Aimé Césaire and Franz Fanon —keeping in mind the closeness of the Negritude movement with surrealism—, we propose to approach the modernity/coloniality problem, appealing to the denominated surrealist image of beauty. In the first part the colonial situation is approached, in the second the colonial situation from the logic of surrealist image, and in the third the possibility of a decolonial universal or pluriversal is raised. In general terms, exploring the existent link between the “surrealist image” and the colonial structure of modernity —that generates the denominated colonial situation—, we aspire to approach what could be a decolonial aesthetic that, as general problem, will be tackled in later works.

Historicizing “Korean Criminality”: Colonial Criminality in Twentieth Century Japan

Directory of Open Access Journals (Sweden)

Joel Matthews

2017-02-01

Full Text Available In the context of Japanese colonialism, this article examines the discourse of colonial criminality that came to epistemologically position the Korean colonial subject as criminal and therefore necessitating domination, surveillance and punishment. The discourse of colonial criminality stemmed from Japan's late nineteenth century epistemological commitment to imperialism and concomitant knowledge of law and the legality of colonial subjects. Through an analysis that historicizes the “criminal Korean” (futei senjin epithet in the prewar and the emergence of yami as a signifier of Korean economic criminality throughout the 1940s, this article illustrates how the racialization of Koreans in Japan was both framed in terms of crime and subversion, and how that criminality functioned as a justification for postcolonial legalized exclusion and discrimination.

Ant Larval Demand Reduces Aphid Colony Growth Rates in an Ant-Aphid Interaction

Directory of Open Access Journals (Sweden)

James M. Cook

2012-02-01

Full Text Available Ants often form mutualistic interactions with aphids, soliciting honeydew in return for protective services. Under certain circumstances, however, ants will prey upon aphids. In addition, in the presence of ants aphids may increase the quantity or quality of honeydew produced, which is costly. Through these mechanisms, ant attendance can reduce aphid colony growth rates. However, it is unknown whether demand from within the ant colony can affect the ant-aphid interaction. In a factorial experiment, we tested whether the presence of larvae in Lasius niger ant colonies affected the growth rate of Aphis fabae colonies. Other explanatory variables tested were the origin of ant colonies (two separate colonies were used and previous diet (sugar only or sugar and protein. We found that the presence of larvae in the ant colony significantly reduced the growth rate of aphid colonies. Previous diet and colony origin did not affect aphid colony growth rates. Our results suggest that ant colonies balance the flow of two separate resources from aphid colonies- renewable sugars or a protein-rich meal, depending on demand from ant larvae within the nest. Aphid payoffs from the ant-aphid interaction may change on a seasonal basis, as the demand from larvae within the ant colony waxes and wanes.

Assessment of Chronic Sublethal Effects of Imidacloprid on Honey Bee Colony Health

Science.gov (United States)

Dively, Galen P.; Embrey, Michael S.; Kamel, Alaa; Hawthorne, David J.; Pettis, Jeffery S.

2015-01-01

Here we present results of a three-year study to determine the fate of imidacloprid residues in hive matrices and to assess chronic sublethal effects on whole honey bee colonies fed supplemental pollen diet containing imidacloprid at 5, 20 and 100 μg/kg over multiple brood cycles. Various endpoints of colony performance and foraging behavior were measured during and after exposure, including winter survival. Imidacloprid residues became diluted or non-detectable within colonies due to the processing of beebread and honey and the rapid metabolism of the chemical. Imidacloprid exposure doses up to 100 μg/kg had no significant effects on foraging activity or other colony performance indicators during and shortly after exposure. Diseases and pest species did not affect colony health but infestations of Varroa mites were significantly higher in exposed colonies. Honey stores indicated that exposed colonies may have avoided the contaminated food. Imidacloprid dose effects was delayed later in the summer, when colonies exposed to 20 and 100 μg/kg experienced higher rates of queen failure and broodless periods, which led to weaker colonies going into the winter. Pooled over two years, winter survival of colonies averaged 85.7, 72.4, 61.2 and 59.2% in the control, 5, 20 and 100 μg/kg treatment groups, respectively. Analysis of colony survival data showed a significant dose effect, and all contrast tests comparing survival between control and treatment groups were significant, except for colonies exposed to 5 μg/kg. Given the weight of evidence, chronic exposure to imidacloprid at the higher range of field doses (20 to 100 μg/kg) in pollen of certain treated crops could cause negative impacts on honey bee colony health and reduced overwintering success, but the most likely encountered high range of field doses relevant for seed-treated crops (5 μg/kg) had negligible effects on colony health and are unlikely a sole cause of colony declines. PMID:25786127

Toxoplasmosis in a colony of New World monkeys

DEFF Research Database (Denmark)

Dietz, H.H.; Henriksen, P.; Bille-Hansen, Vivi

1997-01-01

In a colony of New World monkeys five tamarins (Saguinus oedipus, Saguinus labiatus and Leontopithecus rosal. rosal.), three marmosets (Callithrix jacchus and Callithrix pygmaea) and one saki (Pithecia pithecia) died suddenly. The colony comprised 16 marmosets, 10 tamarins and three sakis. The ma...

Anti-M Antibody Induced Prolonged Anemia Following Hemolytic Disease of the Newborn Due to Erythropoietic Suppression in 2 Siblings.

Science.gov (United States)

Ishida, Atsushi; Ohto, Hitoshi; Yasuda, Hiroyasu; Negishi, Yutaka; Tsuiki, Hideki; Arakawa, Takeshi; Yagi, Yoshihito; Uchimura, Daisuke; Miyazaki, Toru; Ohashi, Wataru; Takamoto, Shigeru

2015-08-01

Hemolytic disease of the newborn (HDN) arising from MNSs incompatibility is rare, with few reports of prolonged anemia and reticulocytopenia following HDN. We report the younger of 2 male siblings, both of whom had anti-M-induced HDN and anemia persisting for over a month. Peripheral reticulocytes remained inappropriately low for the degree of anemia, and they needed multiple red cell transfusions. Viral infections were ruled out. Corticosteroids were given for suspected pure red cell aplasia. Anemia and reticulocytopenia subsequently improved. Colony-forming unit erythroid assay revealed erythropoietic suppression of M antigen-positive erythroid precursor cells cultured with maternal or infant sera containing anti-M. In conclusion, maternal anti-M caused HDN and prolonged anemia by erythropoietic suppression in 2 siblings.

Abyssal fiction: common shares, colonial cleavages

Directory of Open Access Journals (Sweden)

Alexandre Montaury

2016-12-01

Full Text Available The paper aims to develop a reflection on the interaction between the legacies of colonialism and traditional symbolic and cultural practices in African Portuguese-speaking spaces. From a preliminary analysis of fictional texts of wide circulation in Brazil, aims to examine the cleavages, or “abyssal lines” that constitute experiences printed in the daily life of the former Portuguese colony of Cape Verde, Mozambique and Angola.---DOI: http://dx.doi.org/10.21881/abriluff.2016n17a378

Wintering Map for Honey Bee Colonies in El-Behera Governorate ...

African Journals Online (AJOL)

The geographical information system (GIS) has been used successfully in many studies to solve apicultural problems. The winter season is considered as a challenge for honey bee colonies due to the cold weather which cause the forfeiture of many colonies. The good wintering of honey bee colonies depends mainly on ...

No intracolonial nepotism during colony fissioning in honey bees

Science.gov (United States)

Rangel, Juliana; Mattila, Heather R.; Seeley, Thomas D.

2009-01-01

Most species of social insects have singly mated queens, but in some species each queen mates with numerous males to create a colony whose workers belong to multiple patrilines. This colony genetic structure creates a potential for intracolonial nepotism. One context with great potential for such nepotism arises in species, like honey bees, whose colonies reproduce by fissioning. During fissioning, workers might nepotistically choose between serving a young (sister) queen or the old (mother) queen, preferring the former if she is a full-sister but the latter if the young queen is only a half-sister. We examined three honeybee colonies that swarmed, and performed paternity analyses on the young (immature) queens and samples of workers who either stayed with the young queens in the nest or left with the mother queen in the swarm. For each colony, we checked whether patrilines represented by immature queens had higher proportions of staying workers than patrilines not represented by immature queens. We found no evidence of this. The absence of intracolonial nepotism during colony fissioning could be because the workers cannot discriminate between full-sister and half-sister queens when they are immature, or because the costs of behaving nepotistically outweigh the benefits. PMID:19692398

Military labour mobilisation in colonial Lesotho during World War II ...

African Journals Online (AJOL)

In 1940, Great Britain's wartime exploitation of the human and material resources of its colonial empire was extended to colonial Lesotho (then known as Basutoland). The aim of this article, therefore, is to trace the four-year military labour mobilisation process in that colony, with special attention to the timing, number and ...

The colonial context of Filipino American immigrants' psychological experiences.

Science.gov (United States)

David, E J R; Nadal, Kevin L

2013-07-01

Because of the long colonial history of Filipinos and the highly Americanized climate of postcolonial Philippines, many scholars from various disciplines have speculated that colonialism and its legacies may play major roles in Filipino emigration to the United States. However, there are no known empirical studies in psychology that specifically investigate whether colonialism and its effects have influenced the psychological experiences of Filipino American immigrants prior to their arrival in the United States. Further, there is no existing empirical study that specifically investigates the extent to which colonialism and its legacies continue to influence Filipino American immigrants' mental health. Thus, using interviews (N = 6) and surveys (N = 219) with Filipino American immigrants, two studies found that colonialism and its consequences are important factors to consider when conceptualizing the psychological experiences of Filipino American immigrants. Specifically, the findings suggest that (a) Filipino American immigrants experienced ethnic and cultural denigration in the Philippines prior to their U.S. arrival, (b) ethnic and cultural denigration in the Philippines and in the United States may lead to the development of colonial mentality (CM), and (c) that CM may have negative mental health consequences among Filipino American immigrants. The two studies' findings suggest that the Filipino American immigration experience cannot be completely captured by the voluntary immigrant narrative, as they provide empirical support to the notion that the Filipino American immigration experience needs to be understood in the context of colonialism and its most insidious psychological legacy- CM. PsycINFO Database Record (c) 2013 APA, all rights reserved.

Mass spectral molecular networking of living microbial colonies

NARCIS (Netherlands)

Watrous, J.; Roach, P.; Alexandrov, T.; Heath, B.S.; Yang, J.Y.; Kersten, R.D.; Voort, van der M.; Pogliano, K.; Gross, H.; Raaijmakers, J.; Moore, B.S.; Laskin, J.; Bandeira, N.; Dorrestein, P.C.

2012-01-01

Integrating the governing chemistry with the genomics and phenotypes of microbial colonies has been a “holy grail” in microbiology. This work describes a highly sensitive, broadly applicable, and cost-effective approach that allows metabolic profiling of live microbial colonies directly from a Petri

One Film, or Many?: The Multiple Texts of the Colonial Korean Film "Volunteer"

Directory of Open Access Journals (Sweden)

Jaekil Seo

2012-12-01

Full Text Available Until recently, studies on films from colonial Korea in the Japanese empire had to rely primarily on secondary texts, such as memoirs, journal and newspaper articles, and film reviews. The recent discovery of original film texts from archives in Japan, China, Russia, and elsewhere and their availability on DVD format, prompted an important turning point in the scholarship. However, juxtaposing these newly released DVD versions with other archival sources exposes significant differences among the existing versions of texts. For instance, a newly discovered script reveals that important segments are missing in the recently released DVD version of the propaganda film "Volunteer." There also exist important discrepancies in the dialogue among the original film script, the actual film version, the synopsis, and the Japanese subtitles. Some of the Korean-language dialogue, which might be interpreted as exhibiting some ambivalence toward Japanese imperial policies, was completely silenced through strategic omissions in the Japanese-language subtitles targeting Japanese audiences. Some Japanese-language translations of the script also exhibit drastic changes from the original Korean-language dialogue. Piecing together such fragmented and fraught linguistic dissonance found in the colonial archives, we can conjecture that viewers from the colony and the metropole of "Volunteer" may have consumed very different versions of the film. This article aims to examine the significance of such dissonance, which has only recently become audible in so-called films of transcolonial coproduction.

'Goodwill Ambassador': the Legacy of Dutch Colonial Films

Directory of Open Access Journals (Sweden)

Gerda Jansen Hendriks

2015-12-01

Full Text Available The article looks back at the films commissioned and produced by the Dutch governments about their colony in teh East-Indies between 1912 and 1962. The main focus is on the newsreels and documentaries about the colonial war between the Netherlands and Indonesia  from 1945 to 1949. The article reviews these films and the re-use of their footage in later television programs. The programs often look back at the colonial war in ways that go beyond the purpose of the original films and the article aims to show the methods that are used to do this.

Ant colony algorithm for clustering in portfolio optimization

Science.gov (United States)

Subekti, R.; Sari, E. R.; Kusumawati, R.

2018-03-01

This research aims to describe portfolio optimization using clustering methods with ant colony approach. Two stock portfolios of LQ45 Indonesia is proposed based on the cluster results obtained from ant colony optimization (ACO). The first portfolio consists of assets with ant colony displacement opportunities beyond the defined probability limits of the researcher, where the weight of each asset is determined by mean-variance method. The second portfolio consists of two assets with the assumption that each asset is a cluster formed from ACO. The first portfolio has a better performance compared to the second portfolio seen from the Sharpe index.

Colony-stimulating factor (CSF) radioimmunoassay: detection of a CSF subclass stimulating macrophage production

International Nuclear Information System (INIS)

Stanley, E.R.

1979-01-01

Colony-stimulating factors (CSFs) stimulate the differentiation of immature precursor cells to mature granulocytes and macrophages. Purified 125 I-labeled murine L cell CSF has been used to develop a radioimmunoassay (RIA) that detects a subclass of CSFs that stimulates macrophage production. Murine CSF preparations that contain this subclass of CSF compete for all of the CSF binding sites on anti-L cell CSF antibody. With the exception of mouse serum, which can contain inhibitors of the bioassay, there is complete correspondence between activities determined by RIA and those determined by bioassay. The RIA is slightly more sensitive than the bioassay, detecting approximately 0.3 fmol of purified L cell CSF. It can also detect this subclass of CSF in chickens, rats, and humans. In the mouse, the subclass is distinguished from other CSFs by a murine cell bioassay dose-response curve in which 90% of the response occurs over a 10-fold (rather than a 100-fold) increase in concentration, by stimulating the formations of colonies contaning a high proportion of mononuclear (rather than granulocytic) cells, and by certain physical characteristics

Disturbance driven colony fragmentation as a driver of a coral disease outbreak.

Directory of Open Access Journals (Sweden)

Marilyn E Brandt

Full Text Available In September of 2010, Brewer's Bay reef, located in St. Thomas (U.S. Virgin Islands, was simultaneously affected by abnormally high temperatures and the passage of a hurricane that resulted in the mass bleaching and fragmentation of its coral community. An outbreak of a rapid tissue loss disease among coral colonies was associated with these two disturbances. Gross lesion signs and lesion progression rates indicated that the disease was most similar to the Caribbean coral disease white plague type 1. Experiments indicated that the disease was transmissible through direct contact between colonies, and five-meter radial transects showed a clustered spatial distribution of disease, with diseased colonies being concentrated within the first meter of other diseased colonies. Disease prevalence and the extent to which colonies were bleached were both significantly higher on unattached colony fragments than on attached colonies, and disease occurred primarily on fragments found in direct contact with sediment. In contrast to other recent studies, disease presence was not related to the extent of bleaching on colonies. The results of this study suggest that colony fragmentation and contact with sediment played primary roles in the initial appearance of disease, but that the disease was capable of spreading among colonies, which suggests secondary transmission is possible through some other, unidentified mechanism.

Lysinibacillus fusiformis M5 Induces Increased Complexity in Bacillus subtilis 168 Colony Biofilms via Hypoxanthine.

Science.gov (United States)

Gallegos-Monterrosa, Ramses; Kankel, Stefanie; Götze, Sebastian; Barnett, Robert; Stallforth, Pierre; Kovács, Ákos T

2017-11-15

In recent years, biofilms have become a central subject of research in the fields of microbiology, medicine, agriculture, and systems biology, among others. The sociomicrobiology of multispecies biofilms, however, is still poorly understood. Here, we report a screening system that allowed us to identify soil bacteria which induce architectural changes in biofilm colonies when cocultured with Bacillus subtilis We identified the soil bacterium Lysinibacillus fusiformis M5 as an inducer of wrinkle formation in B. subtilis colonies mediated by a diffusible signaling molecule. This compound was isolated by bioassay-guided chromatographic fractionation. The elicitor was identified to be the purine hypoxanthine using mass spectrometry and nuclear magnetic resonance (NMR) spectroscopy. We show that the induction of wrinkle formation by hypoxanthine is not dependent on signal recognition by the histidine kinases KinA, KinB, KinC, and KinD, which are generally involved in phosphorylation of the master regulator Spo0A. Likewise, we show that hypoxanthine signaling does not induce the expression of biofilm matrix-related operons epsABCDEFGHIJKLMNO and tasA-sipW-tapA Finally, we demonstrate that the purine permease PbuO, but not PbuG, is necessary for hypoxanthine to induce an increase in wrinkle formation of B. subtilis biofilm colonies. Our results suggest that hypoxanthine-stimulated wrinkle development is not due to a direct induction of biofilm-related gene expression but rather is caused by the excess of hypoxanthine within B. subtilis cells, which may lead to cell stress and death. IMPORTANCE Biofilms are a bacterial lifestyle with high relevance regarding diverse human activities. Biofilms can be beneficial, for instance, in crop protection. In nature, biofilms are commonly found as multispecies communities displaying complex social behaviors and characteristics. The study of interspecies interactions will thus lead to a better understanding and use of biofilms as they

Radiosensitivity of CD4 and CD8 positive human T lymphocytes by an in vitro colony formation assay

International Nuclear Information System (INIS)

Nakamura, Nori; Kusunoki, Yoichiro; Akiyama, Mitoshi.

1989-12-01

The recent development of an in vitro lymphocyte colony assay provides a new opportunity to examine possible variations in human radiosensitivity using peripheral blood lymphocytes (PBL) in place of the hitherto used skin fibroblast assay. Our recent study showed that most of the colonies consisted of lymphocytes bearing CD4 or CD8 antigens. Since the fraction of CD4 + and CD8 + cells in PBL differs among individuals, it was suspected that individual radiosensitivity might be biased by the different subset frequencies if the dose-survival curves of the CD4 + and CD8 + cells differed. In the present study, CD4 + lymphocytes (helper/inducer T cells) and CD8 + lymphocytes (suppressor/cytotoxic T cells) were isolated from PBL and their dose-survival curves were determined. The results showed that the D 10 (the dose required to reduce the surviving fraction to 10 %) was quite similar for these two types of cells (3.13 ± 0.10 Gy [mean ±SD] for CD4 + , 3.34 ± 0.50 Gy for CD8 + and 3.07 ± 0.05 Gy for the unsorted cells), supporting the use of a whole PBL population for screening of individuals with altered radiosensitivity. (author)

Spread of plague among black-tailed prairie dogs is associated with colony spatial characteristics

Science.gov (United States)

Johnson, T.L.; Cully, J.F.; Collinge, S.K.; Ray, C.; Frey, C.M.; Sandercock, B.K.

2011-01-01

Sylvatic plague (Yersinia pestis) is an exotic pathogen that is highly virulent in black-tailed prairie dogs (Cynomys ludovicianus) and causes widespread colony losses and individual mortality rates >95%. We investigated colony spatial characteristics that may influence inter-colony transmission of plague at 3 prairie dog colony complexes in the Great Plains. The 4 spatial characteristics we considered include: colony size, Euclidean distance to nearest neighboring colony, colony proximity index, and distance to nearest drainage (dispersal) corridor. We used multi-state mark-recapture models to determine the relationship between these colony characteristics and probability of plague transmission among prairie dog colonies. Annual mapping of colonies and mark-recapture analyses of disease dynamics in natural colonies led to 4 main results: 1) plague outbreaks exhibited high spatial and temporal variation, 2) the site of initiation of epizootic plague may have substantially influenced the subsequent inter-colony spread of plague, 3) the long-term effect of plague on individual colonies differed among sites because of how individuals and colonies were distributed, and 4) colony spatial characteristics were related to the probability of infection at all sites although the relative importance and direction of relationships varied among sites. Our findings suggest that conventional prairie dog conservation management strategies, including promoting large, highly connected colonies, may need to be altered in the presence of plague. ?? 2011 The Wildlife Society.

Factors of honeybee colony performances on sunflower at apiary scale

Directory of Open Access Journals (Sweden)

Kretzschmar André

2017-11-01

Full Text Available An observatory of honeybee colonies (Apis mellifera, consisting of at least 200 colonies, divided into 10 apiaries of 20 colonies, was monitored for three years on sunflower honeyflow (2015–2017. The purpose of this observatory is to understand which factors control colony performance during sunflower honeyflow in south-western France. From the temporal dynamics of weight gain, statistical analysis reveals a hierarchy of factors. First, variability in apiary scale performance is an image of the effect of resource variability. But, in addition to this primordial factor, two other factors contribute very significantly to performance. On the one hand, the amount of capped brood and the number of bees at the time of the installation of the apiary: these two elements testify to the vitality of the colony. The second remarkable factor is the Varroa load, which strongly penalizes performance beyond a certain threshold. The negative effect of the Varroa load on the colony performance is minimized in case of abondant sunflower honey flow.

Generation of mutation hotspots in ageing bacterial colonies

DEFF Research Database (Denmark)

Sekowska, Agnieszka; Wendel, Sofie; Nørholm, Morten

How do ageing bacterial colonies generate adaptive mutants? Over a period of two months, we isolated on ageing colonies outgrowing mutants able to use a new carbon source, and sequenced their genomes. This allowed us to uncover exquisite details on the molecular mechanism behind their adaptation:...

Cormorants as visitors in the Vorsø colony

DEFF Research Database (Denmark)

Bregnballe, Thomas; Vinas, Marta Mas; Gregersen, Jens

2011-01-01

Like other seabirds Great Cormorants Phalacrocorax carbo sinensis are known to prospect in potential breeding colonies during their first years of life before they settle to breed. Based on daily resightings of colour-ringed cormorants in the old Vorsø colony we examined the difference between...

Monitoring of colonies and provisioning of rooks with nest material as a potential tool for stabilizing colonies and increasing nesting opportunities in the countryside. Project report

Directory of Open Access Journals (Sweden)

Slobodník Roman

2017-12-01

Full Text Available The rook is a species inhabiting open agricultural landscape whose non-active nests are also used by other bird species for nesting. It is the decline in rook colonies that has been posited as one of the reasons for decrease in the red-footed falcon (Falco vespertinus population in Slovakia since the 1970s. During the period from 2012 till 2016, four monitorings of rook colonies were carried out in south-western Slovakia (Diakovce, Nitrianska Osada, Sokolce and Tvrdošovce. In the colony at Tvrdošovce, supporting activity involving provisioning of rooks with nest material was under way from 2014 until 2016. While the colonies at Diakovce and Nitrianska Osada have been showing a slight decrease in the number of nesting rooks, despite larger interannual differences the colony at Sokolce has been showing an upward trend. The size of the colony at Tvrdošovce has been stable since the beginning of the supporting activity. This activity had a statistically significant positive effect on the width of rook nests. In 74 cases in the studied rook colonies we have recorded nesting by three other bird species – Eurasian kestrel (Falco tinnunculus 43.8%, western jackdaw (Corvus monedula 39.7% and long-eared owl (Asio otus 16.4%. In 2015 two female redfooted falcons were observed in the colony at Tvrdošovce.

From conquest to independence: the nigerian colonial experience

Directory of Open Access Journals (Sweden)

Tunde Oduwobi

2011-06-01

Full Text Available Este documento es un análisis panorámico de la imposición y el carácter de la administración colonial británica en Nigeria. Comienza por examinar los factores y circunstancias que facilitó la intrusión de los británicos en el área de nigeriano. El evento más importante en este desarrollo fue la conquista de los Lagos en 1851 y su incorporación formal como una colonia diez años más tarde en 1861. Simultáneamente, influencia británica propagación en el interior de Lagos y de la parte inferior del Níger. Tal, sin embargo, fue el personaje de la penetración británica que cuando en 1900 control político fue formalmente establecido sobre el área de nigeriano tomó forma tripartita de tres administraciones autónomas. Estos tres posteriormente se convirtió en amalgamados en 1914 para formar el estado de Nigeria; Sin embargo, no se borraron las tradiciones administrativas tripartitas y permanecieron como fuerzas latentes modificar el desarrollo histórico del país. Así, en el ocaso de la época colonial, nacionalismo nigeriano, desarrollando como lo fue terminar el colonialismo británico, se convirtió en adulterado negativamente por el nacionalismo étnico en los fuertes pilares de las tradiciones tripartitas fomentadas por el gobierno colonial británico. Por lo tanto el estado nigeriano surgió del colonialismo con el problema de forjar la unidad política.Palabras clave: Nigeria, colonialismo, independencia___________________________Abstract:This paper is a panoramic discussion of the imposition and character of colonial British administration in Nigeria. It begins by examining the factors and circumstances which facilitated the intrusion of the British in the Nigerian area. The most important event in this development was the conquest of the Lagos in 1851 and its formal incorporation as a colony ten years later in 1861. Concomitantly, British influence spread into the hinterland from Lagos and from the lower reaches of the

Heralding the Other: Sousa, Simulacra, and Settler Colonialism

Science.gov (United States)

Graham, Matthew C.

2016-01-01

This paper addresses the role of music and music education in the perpetuation of settler colonialism (a particular colonial configuration predicated on the expulsion of indigenous people and occupation of indigenous land) within the United States. Using Baudrillard's notion of simulacra, or "false truths," to look at racialized…

Honeybee colony marketing and its implications for queen rearing ...

African Journals Online (AJOL)

Honeybee colony marketing and its implications for queen rearing and beekeeping development in Werieleke ... Thus, colony marketing is an important venture in Werieleke district of Tigray region. ... EMAIL FULL TEXT EMAIL FULL TEXT

Endogenous Sheet-Averaged Tension Within a Large Epithelial Cell Colony.

Science.gov (United States)

Dumbali, Sandeep P; Mei, Lanju; Qian, Shizhi; Maruthamuthu, Venkat

2017-10-01

Epithelial cells form quasi-two-dimensional sheets that function as contractile media to effect tissue shape changes during development and homeostasis. Endogenously generated intrasheet tension is a driver of such changes, but has predominantly been measured in the presence of directional migration. The nature of epithelial cell-generated forces transmitted over supracellular distances, in the absence of directional migration, is thus largely unclear. In this report, we consider large epithelial cell colonies which are archetypical multicell collectives with extensive cell-cell contacts but with a symmetric (circular) boundary. Using the traction force imbalance method (TFIM) (traction force microscopy combined with physical force balance), we first show that one can determine the colony-level endogenous sheet forces exerted at the midline by one half of the colony on the other half with no prior assumptions on the uniformity of the mechanical properties of the cell sheet. Importantly, we find that this colony-level sheet force exhibits large variations with orientation-the difference between the maximum and minimum sheet force is comparable to the average sheet force itself. Furthermore, the sheet force at the colony midline is largely tensile but the shear component exhibits significantly more variation with orientation. We thus show that even an unperturbed epithelial colony with a symmetric boundary shows significant directional variation in the endogenous sheet tension and shear forces that subsist at the colony level.

An improved method for staining cell colonies in clonogenic assays.

Science.gov (United States)

Guda, Kishore; Natale, Leanna; Markowitz, Sanford D

2007-06-01

Clonogenic assay is a widely used experimental approach to test for the effects of drugs/genes on the growth and proliferative characteristics of cells in vitro. Accurate quantitation of treatment effects in clonogeneic assays depends on the ability to visualize and count cell colonies precisely. We report a novel method (referred as ETeB) for staining cell colonies grown on plastic and specially coated substrates like collagen. Using colon cancer cell lines grown on plastic and collagen, we compared the colony staining efficiencies of the widely used methylene blue, and Ethidium bromide (ETeB) stains. Results show that the ETeB protocol works well on plastic and is extremely effective for staining colonies on collagen when compared to methylene blue. The key features and advantages of ETeB technique are; (a) reduction in background for colonies grown on collagen and possibly other substrates, (b) the whole procedure takes less than a minute, (c) no post-stain washing step is required which eliminates colony losses for cell lines that are loosely adherent, (d) colony visualization and counting can be done immediately following the staining procedure using a standard UV illuminator and software, and (e) the method works across a wide variety of cell lines. The simplicity and robustness of this procedure should warrant its usage in both small and large-scale clonogenic experiments.

Redox state, reactive oxygen species and adaptive growth in colonial hydroids.

Science.gov (United States)

Blackstone, N W

2001-06-01

Colonial metazoans often encrust surfaces over which the food supply varies in time or space. In such an environment, adaptive colony development entails adjusting the timing and spacing of feeding structures and gastrovascular connections to correspond to this variable food supply. To investigate the possibility of such adaptive growth, within-colony differential feeding experiments were carried out using the hydroid Podocoryna carnea. Indeed, such colonies strongly exhibited adaptive growth, developing dense arrays of polyps (feeding structures) and gastrovascular connections in areas that were fed relative to areas that were starved, and this effect became more consistent over time. To investigate mechanisms of signaling between the food supply and colony development, measurements were taken of metabolic parameters that have been implicated in signal transduction in other systems, particularly redox state and levels of reactive oxygen species. Utilizing fluorescence microscopy of P. carnea cells in vivo, simultaneous measurements of redox state [using NAD(P)H] and hydrogen peroxide (using 2',7'-dichlorofluorescin diacetate) were taken. Both measures focused on polyp epitheliomuscular cells, since these exhibit the greatest metabolic activity. Colonies 3-5h after feeding were relatively oxidized, with low levels of peroxide, while colonies 24h after feeding were relatively reduced, with high levels of peroxide. The functional role of polyps in feeding and generating gastrovascular flow probably produced this dichotomy. Polyps 3-5h after feeding contract maximally, and this metabolic demand probably shifts the redox state in the direction of oxidation and diminishes levels of reactive oxygen species. In contrast, 24h after feeding, polyps are quiescent, and this lack of metabolic demand probably shifts the redox state in the direction of reduction and increases levels of reactive oxygen species. Within-colony differential feeding experiments were carried out on

Colonial Modernity and the African Worldview: Theorising and ...

African Journals Online (AJOL)

concept of hegemony and Jean and John Comaroff's concept of cultural and colonial encounters are used to assist in teasing out deeper meaning in the encounter between the Ndebele and the early Christian missionaries prior to inscription of settler colonialism in the area lying between the Limpopo and Zambezi Rivers.

Embodying colonial photography: remembering violence in Tabee Toean

NARCIS (Netherlands)

Bijl, P.

2011-01-01

This article is about bodily interactions with photographs. Taking an interview with a veteran from the Dutch colonial army filmed for the documentary Tabee Toean (1995) as its case study, it focuses on the ways in which this man frames these images of colonial warfare through three types of bodily

Colonial conquest in central Madagascar : who resisted what?

NARCIS (Netherlands)

Ellis, S.; Abbink, G.J.; Bruijn, M.E. de.; Walraven, van K.

2003-01-01

A rising against French colonial rule in central Madagascar (1895-1898) appeared in the 1970s as a good example of resistance to colonialism, sparked by France's occupation of Madagascar. Like many similar episodes in other parts of Africa, it was a history that appeared, in the light of later

Honeybee immunity and colony losses

Directory of Open Access Journals (Sweden)

F. Nazzi

2014-10-01

Full Text Available The decline of honeybee colonies and their eventual collapse is a widespread phenomenon in the Northern hemisphere of the globe, which severely limits the beekeeping industry. This dramatic event is associated with an enhanced impact of parasites and pathogens on honeybees, which is indicative of reduced immunocompetence. The parasitic mite Varroa destructor and the vectored viral pathogens appear to play a key-role in the induction of this complex syndrome. In particular, the Deformed Wing Virus (DWV is widespread and is now considered, along with Varroa, one of the major causes of bee colony losses. Several lines of evidence indicate that this mite/DWV association severely affects the immune system of honeybees and makes them more sensitive to the action of other stress factors. The molecular mechanisms underpinning these complex interactions are currently being investigated and the emerging information has allowed the development of a new functional model, describing how different stress factors may synergistically concur in the induction of bee immune alteration and health decline. This provides a new logical framework in which to interpret the proposed multifactorial origin of bee colony losses and sets the stage for a more comprehensive and integrated analysis of the effect that multiple stress agents may have on honeybees.

Sanitary and nutritional characterization of honeybee colonies in Eucalyptus grandis plantations

OpenAIRE

Invernizzi, C.; Santos, E.; García, E.; Daners, G.; Di Landro, R.; Saadoun, A.; Cabrera, C.

2011-01-01

In Uruguay, many beekeepers transport their colonies to Eucalyptus grandis plantations at the end of the summer and autumn, obtaining important honey harvests. However, at the end of the flowering period the colonies become extremely weakened undergoing high levels of mortality. Nutritional and health problems could explain the weakening of colonies. In order to find out the causes for this weakening, colonies of the same size were taken to an E. grandis plantation, split up in three groups d...

Colony Collapse Disorder (CCD) and bee age impact honey bee pathophysiology.

Science.gov (United States)

vanEngelsdorp, Dennis; Traynor, Kirsten S; Andree, Michael; Lichtenberg, Elinor M; Chen, Yanping; Saegerman, Claude; Cox-Foster, Diana L

2017-01-01

Honey bee (Apis mellifera) colonies continue to experience high annual losses that remain poorly explained. Numerous interacting factors have been linked to colony declines. Understanding the pathways linking pathophysiology with symptoms is an important step in understanding the mechanisms of disease. In this study we examined the specific pathologies associated with honey bees collected from colonies suffering from Colony Collapse Disorder (CCD) and compared these with bees collected from apparently healthy colonies. We identified a set of pathological physical characteristics that occurred at different rates in CCD diagnosed colonies prior to their collapse: rectum distension, Malpighian tubule iridescence, fecal matter consistency, rectal enteroliths (hard concretions), and venom sac color. The multiple differences in rectum symptomology in bees from CCD apiaries and colonies suggest effected bees had trouble regulating water. To ensure that pathologies we found associated with CCD were indeed pathologies and not due to normal changes in physical appearances that occur as an adult bee ages (CCD colonies are assumed to be composed mostly of young bees), we documented the changes in bees of different ages taken from healthy colonies. We found that young bees had much greater incidences of white nodules than older cohorts. Prevalent in newly-emerged bees, these white nodules or cellular encapsulations indicate an active immune response. Comparing the two sets of characteristics, we determined a subset of pathologies that reliably predict CCD status rather than bee age (fecal matter consistency, rectal distension size, rectal enteroliths and Malpighian tubule iridescence) and that may serve as biomarkers for colony health. In addition, these pathologies suggest that CCD bees are experiencing disrupted excretory physiology. Our identification of these symptoms is an important first step in understanding the physiological pathways that underlie CCD and factors

Colony Collapse Disorder (CCD and bee age impact honey bee pathophysiology.

Directory of Open Access Journals (Sweden)

Dennis vanEngelsdorp

Full Text Available Honey bee (Apis mellifera colonies continue to experience high annual losses that remain poorly explained. Numerous interacting factors have been linked to colony declines. Understanding the pathways linking pathophysiology with symptoms is an important step in understanding the mechanisms of disease. In this study we examined the specific pathologies associated with honey bees collected from colonies suffering from Colony Collapse Disorder (CCD and compared these with bees collected from apparently healthy colonies. We identified a set of pathological physical characteristics that occurred at different rates in CCD diagnosed colonies prior to their collapse: rectum distension, Malpighian tubule iridescence, fecal matter consistency, rectal enteroliths (hard concretions, and venom sac color. The multiple differences in rectum symptomology in bees from CCD apiaries and colonies suggest effected bees had trouble regulating water. To ensure that pathologies we found associated with CCD were indeed pathologies and not due to normal changes in physical appearances that occur as an adult bee ages (CCD colonies are assumed to be composed mostly of young bees, we documented the changes in bees of different ages taken from healthy colonies. We found that young bees had much greater incidences of white nodules than older cohorts. Prevalent in newly-emerged bees, these white nodules or cellular encapsulations indicate an active immune response. Comparing the two sets of characteristics, we determined a subset of pathologies that reliably predict CCD status rather than bee age (fecal matter consistency, rectal distension size, rectal enteroliths and Malpighian tubule iridescence and that may serve as biomarkers for colony health. In addition, these pathologies suggest that CCD bees are experiencing disrupted excretory physiology. Our identification of these symptoms is an important first step in understanding the physiological pathways that underlie CCD and

Growth pattern of the surface of fungus Aspergillus colony

Science.gov (United States)

Matsuura, Shu; Miyazima, Sasuke

1992-05-01

Aspergillus oryzae colonies were grown under various glucose concentrations, temperatures, and agar concentrations, and the effects on the pattern were investigated. Patterns of colony were found to vary from uniform to diffusion-limited aggregation type.

Diversity of cultivable bacteria involved in the formation of macroscopic microbial colonies (Cave silver on the walls of a cave in Slovenia

Directory of Open Access Journals (Sweden)

Blagajana Herzog Velikonja

2014-01-01

Full Text Available Karstic caves often support white, yellow, grey or pink microbial colonies that are termed ‘cave silver’ by speleologists. Using various sample pre-treatments and culture media, a wide variety of bacteria associated with these colonies were recovered from a cave in Slovenia, Pajsarjeva jama. Decreasing the inoculum size resulted in significant increases in viable counts, while pre-treatments had the opposite effect with the exception of microwave irradiation. While all growth media yielded viable counts, the maximal counts were observed on a low-nutrient TWA medium. Based on the 16S rRNA gene sequence of OTU representatives, the majority of the 80 isolates examined belonged to Streptomyces (25%, Micrococcus (16% and Rhodococcus (10% Other abundant groups were Pseudomonas (9%, Agrobacterium (8%, Lysobacter (6% and Paenibacillus (5%, while members of genera Microbacterium, Agrococcus, Arthrobacter, Bacillus, Kocuria, Oerskovia, Sphingomonas, Aerococcus, and Bosea represented a minor portion of cultivable diversity encountered. Members of Streptomyces and Agrobacterium were common to all samples. Although these microorganisms readily form colonies under laboratory conditions, they were unrelated to abundant environmental phylotypes recovered from same samples in a previous study. However, the comparative 16S rRNA analysis showed that microorganisms highly related to the ones obtained in this study were cultivated from other subterranean environments indicating that they might represent true microbial cave dwellers.

Microbiome of Trichodesmium Colonies from the North Pacific Subtropical Gyre

Directory of Open Access Journals (Sweden)

Mary R. Gradoville

2017-07-01

Full Text Available Filamentous diazotrophic Cyanobacteria of the genus Trichodesmium, often found in colonial form, provide an important source of new nitrogen to tropical and subtropical marine ecosystems. Colonies are composed of several clades of Trichodesmium in association with a diverse community of bacterial and eukaryotic epibionts. We used high-throughput 16S rRNA and nifH gene sequencing, carbon (C and dinitrogen (N2 fixation assays, and metagenomics to describe the diversity and functional potential of the microbiome associated with Trichodesmium colonies collected from the North Pacific Subtropical Gyre (NPSG. The 16S rRNA and nifH gene sequences from hand-picked colonies were predominantly (>99% from Trichodesmium Clade I (i.e., T. thiebautii, which is phylogenetically and ecologically distinct from the Clade III IMS101 isolate used in most laboratory studies. The bacterial epibiont communities were dominated by Bacteroidetes, Alphaproteobacteria, and Gammaproteobacteria, including several taxa with a known preference for surface attachment, and were relatively depleted in the unicellular Cyanobacteria and small photoheterotrophic bacteria that dominate NPSG surface waters. Sequencing the nifH gene (encoding a subcomponent of the nitrogenase enzyme identified non-Trichodesmium diazotrophs that clustered predominantly among the Cluster III nifH sequence-types that includes putative anaerobic diazotrophs. Trichodesmium colonies may represent an important habitat for these Cluster III diazotrophs, which were relatively rare in the surrounding seawater. Sequence analyses of nifH gene transcripts revealed several cyanobacterial groups, including heterocystous Richelia, associated with the colonies. Both the 16S rRNA and nifH datasets indicated strong differences between Trichodesmium epibionts and picoplankton in the surrounding seawater, and also between the epibionts inhabiting Trichodesmium puff and tuft colony morphologies. Metagenomic and 16S r

Simulation of Escherichia coli Dynamics in Biofilms and Submerged Colonies with an Individual-Based Model Including Metabolic Network Information.

Science.gov (United States)

Tack, Ignace L M M; Nimmegeers, Philippe; Akkermans, Simen; Hashem, Ihab; Van Impe, Jan F M

2017-01-01

Clustered microbial communities are omnipresent in the food industry, e.g., as colonies of microbial pathogens in/on food media or as biofilms on food processing surfaces. These clustered communities are often characterized by metabolic differentiation among their constituting cells as a result of heterogeneous environmental conditions in the cellular surroundings. This paper focuses on the role of metabolic differentiation due to oxygen gradients in the development of Escherichia coli cell communities, whereby low local oxygen concentrations lead to cellular secretion of weak acid products. For this reason, a metabolic model has been developed for the facultative anaerobe E. coli covering the range of aerobic, microaerobic, and anaerobic environmental conditions. This metabolic model is expressed as a multiparametric programming problem, in which the influence of low extracellular pH values and the presence of undissociated acid cell products in the environment has been taken into account. Furthermore, the developed metabolic model is incorporated in MICRODIMS, an in-house developed individual-based modeling framework to simulate microbial colony and biofilm dynamics. Two case studies have been elaborated using the MICRODIMS simulator: (i) biofilm growth on a substratum surface and (ii) submerged colony growth in a semi-solid mixed food product. In the first case study, the acidification of the biofilm environment and the emergence of typical biofilm morphologies have been observed, such as the mushroom-shaped structure of mature biofilms and the formation of cellular chains at the exterior surface of the biofilm. The simulations show that these morphological phenomena are respectively dependent on the initial affinity of pioneer cells for the substratum surface and the cell detachment process at the outer surface of the biofilm. In the second case study, a no-growth zone emerges in the colony center due to a local decline of the environmental pH. As a result

Simulation of Escherichia coli Dynamics in Biofilms and Submerged Colonies with an Individual-Based Model Including Metabolic Network Information

Directory of Open Access Journals (Sweden)

Ignace L. M. M. Tack

2017-12-01

Full Text Available Clustered microbial communities are omnipresent in the food industry, e.g., as colonies of microbial pathogens in/on food media or as biofilms on food processing surfaces. These clustered communities are often characterized by metabolic differentiation among their constituting cells as a result of heterogeneous environmental conditions in the cellular surroundings. This paper focuses on the role of metabolic differentiation due to oxygen gradients in the development of Escherichia coli cell communities, whereby low local oxygen concentrations lead to cellular secretion of weak acid products. For this reason, a metabolic model has been developed for the facultative anaerobe E. coli covering the range of aerobic, microaerobic, and anaerobic environmental conditions. This metabolic model is expressed as a multiparametric programming problem, in which the influence of low extracellular pH values and the presence of undissociated acid cell products in the environment has been taken into account. Furthermore, the developed metabolic model is incorporated in MICRODIMS, an in-house developed individual-based modeling framework to simulate microbial colony and biofilm dynamics. Two case studies have been elaborated using the MICRODIMS simulator: (i biofilm growth on a substratum surface and (ii submerged colony growth in a semi-solid mixed food product. In the first case study, the acidification of the biofilm environment and the emergence of typical biofilm morphologies have been observed, such as the mushroom-shaped structure of mature biofilms and the formation of cellular chains at the exterior surface of the biofilm. The simulations show that these morphological phenomena are respectively dependent on the initial affinity of pioneer cells for the substratum surface and the cell detachment process at the outer surface of the biofilm. In the second case study, a no-growth zone emerges in the colony center due to a local decline of the environmental p

Functional Differences Between Placental Micro- and Macrovascular Endothelial Colony-Forming Cells

Science.gov (United States)

Solomon, Ioana; O’Reilly, Megan; Ionescu, Lavinia; Alphonse, Rajesh S.; Rajabali, Saima; Zhong, Shumei; Vadivel, Arul; Shelley, W. Chris; Yoder, Mervin C.

2016-01-01

Alterations in the development of the placental vasculature can lead to pregnancy complications, such as preeclampsia. Currently, the cause of preeclampsia is unknown, and there are no specific prevention or treatment strategies. Further insight into the placental vasculature may aid in identifying causal factors. Endothelial colony-forming cells (ECFCs) are a subset of endothelial progenitor cells capable of self-renewal and de novo vessel formation in vitro. We hypothesized that ECFCs exist in the micro- and macrovasculature of the normal, term human placenta. Human placentas were collected from term pregnancies delivered by cesarean section (n = 16). Placental micro- and macrovasculature was collected from the maternal and fetal side of the placenta, respectively, and ECFCs were isolated and characterized. ECFCs were CD31+, CD105+, CD144+, CD146+, CD14−, and CD45−, took up 1,1′-dioctadecyl-3,3,3′,3′-tetramethyl-indocarbocyanine perchlorate-labeled acetylated low-density lipoprotein, and bound Ulex europaeus agglutinin 1. In vitro, macrovascular ECFCs had a greater potential to generate high-proliferative colonies and formed more complex capillary-like networks on Matrigel compared with microvascular ECFCs. In contrast, in vivo assessment demonstrated that microvascular ECFCs had a greater potential to form vessels. Macrovascular ECFCs were of fetal origin, whereas microvascular ECFCs were of maternal origin. ECFCs exist in the micro- and macrovasculature of the normal, term human placenta. Although macrovascular ECFCs demonstrated greater vessel and colony-forming potency in vitro, this did not translate in vivo, where microvascular ECFCs exhibited a greater vessel-forming ability. These important findings contribute to the current understanding of normal placental vascular development and may aid in identifying factors involved in preeclampsia and other pregnancy complications. Significance This research confirms that resident endothelial colony

Reproduction and recruitment in perennial colonies of the introduced wasp Vespula germanica.

Science.gov (United States)

Goodisman, M A; Matthews, R W; Spradbery, J P; Carew, M E; Crozier, R H

2001-01-01

We investigated the genetic structure of perennial colonies of the yellowjacket wasp (Vespula germanica) in its introduced range in Australia and New Zealand. The nuclear genotypes of 712 gynes from 21 colonies, 147 workers from 5 colonies, and 81 males from 4 colonies were assayed at three polymorphic microsatellite loci. The mitochondrial haplotypes of all wasps also were determined for a 450-bp region of the mtDNA using double-stranded conformational polymorphism (DSCP) analysis. We found that multiple reproductives were needed to explain the genotypes of gynes, workers, and males in 7 of 21, 2 of 5, and 2 of 4 colonies, respectively, and that nestmate relatedness of these three castes equaled 0.42, 0.16, and 0.22, respectively. The mitochondrial data revealed that all individuals shared the same mtDNA haplotype in 20 of the 21 colonies. However, in one colony, gynes and workers displayed multiple mtDNA haplotypes, indicating that nonnestmate recruitment had occurred. Overall the genetic structure within the majority of perennial colonies conformed to expectations based on the biology of V. germanica and kin selection theory for polygyne colonies; multiple reproductives successfully produced offspring and were recruited into their natal nests, thereby maintaining relatively high relatedness between interacting individuals.

Social Immunity: Emergence and Evolution of Colony-Level Disease Protection.

Science.gov (United States)

Cremer, Sylvia; Pull, Christopher D; Fürst, Matthias A

2018-01-07

Social insect colonies have evolved many collectively performed adaptations that reduce the impact of infectious disease and that are expected to maximize their fitness. This colony-level protection is termed social immunity, and it enhances the health and survival of the colony. In this review, we address how social immunity emerges from its mechanistic components to produce colony-level disease avoidance, resistance, and tolerance. To understand the evolutionary causes and consequences of social immunity, we highlight the need for studies that evaluate the effects of social immunity on colony fitness. We discuss the roles that host life history and ecology have on predicted eco-evolutionary dynamics, which differ among the social insect lineages. Throughout the review, we highlight current gaps in our knowledge and promising avenues for future research, which we hope will bring us closer to an integrated understanding of socio-eco-evo-immunology.

Indian Education in the American Colonies, 1607-1783.

Science.gov (United States)

Szasz, Margaret Connell

Indian schooling in colonial America was continuously immersed in the exchange between cultures that involved religion, land ownership, disease, alcohol, and warfare, and was molded by trade in furs and hides, and Indian slaves. In the past two decades American scholars have begun to reinterpret colonial North American Indian history and the…

Customized Computer Vision and Sensor System for Colony Recognition and Live Bacteria Counting in Agriculture

Directory of Open Access Journals (Sweden)

Gabriel M. ALVES

2016-06-01

Full Text Available This paper presents an arrangement based on a dedicated computer and charge-coupled device (CCD sensor system to intelligently allow the counting and recognition of colony formation. Microbes in agricultural environments are important catalysts of global carbon and nitrogen cycles, including the production and consumption of greenhouse gases in soil. Some microbes produce greenhouse gases such as carbon dioxide and nitrous oxide while decomposing organic matter in soil. Others consume methane from the atmosphere, helping to mitigate climate change. The magnitude of each of these processes is influenced by human activities and impacts the warming potential of Earth’s atmosphere. In this context, bacterial colony counting is important and requires sophisticated analysis methods. The method implemented in this study uses digital image processing techniques, including the Hough Transform for circular objects. The visual environment Borland Builder C++ was used for development, and a model for decision making was incorporated to aggregate intelligence. For calibration of the method a prepared illuminated chamber was used to enable analyses of the bacteria Escherichia coli, and Acidithiobacillus ferrooxidans. For validation, a set of comparisons were established between this smart method and the expert analyses. The results show the potential of this method for laboratory applications that involve the quantification and pattern recognition of bacterial colonies in solid culture environments.

Breeding site selection by colonial waterbirds given various ...

African Journals Online (AJOL)

The number of active colonial waterbird nests at a series of four small constructed wetlands in Cape Town was counted monthly from 1999 to 2008. In total 491 pairs belonging to 11 waterbird species were involved. Between 1997 and 2004 a number of different artificial structures were used to attract colonial waterbirds to ...

Continental-Scale Mapping of Adelie Penguin Colonies from Landsat Imagery

Science.gov (United States)

Schwaller, Mathew R.; Southwell, Colin; Emmerson, Louise

2013-01-01

Breeding distribution of the Adlie penguin, Pygoscelis adeliae, was surveyed with Landsat-7 Enhanced Thematic Mapper Plus (ETM+) data in an area covering approximately 330 of longitude along the coastline of Antarctica.An algorithm was designed to minimize radiometric noise and to retrieve Adlie penguin colony location and spatial extent from the ETM+data. In all, 9143 individual pixels were classified as belonging to an Adlie penguin colony class out of the entire dataset of 195 ETM+ scenes, where the dimension of each pixel is 30 m by 30 m,and each scene is approximately 180 km by 180 km. Pixel clustering identified a total of 187 individual Adlie penguin colonies, ranging in size from a single pixel (900 sq m) to a maximum of 875 pixels (0.788 sq km). Colony retrievals have a very low error of commission, on the order of 1% or less, and the error of omission was estimated to be 3% to 4% by population based on comparisons with direct observations from surveys across east Antarctica. Thus, the Landsat retrievals successfully located Adlie penguin colonies that accounted for 96 to 97% of the regional population used as ground truth. Geographic coordinates and the spatial extent of each colony retrieved from the Landsat data are available publically. Regional analysis found several areas where the Landsat retrievals suggest populations that are significantly larger than published estimates. Six Adlie penguin colonies were found that are believed to be previously unreported in the literature.

Lower virus infections in Varroa destructor-infested and uninfested brood and adult honey bees (Apis mellifera) of a low mite population growth colony compared to a high mite population growth colony.

Science.gov (United States)

Emsen, Berna; Hamiduzzaman, Mollah Md; Goodwin, Paul H; Guzman-Novoa, Ernesto

2015-01-01

A comparison was made of the prevalence and relative quantification of deformed wing virus (DWV), Israeli acute paralysis virus (IAPV), black queen cell virus (BQCV), Kashmir bee virus (KBV), acute bee paralysis virus (ABPV) and sac brood virus (SBV) in brood and adult honey bees (Apis mellifera) from colonies selected for high (HMP) and low (LMP) Varroa destructor mite population growth. Two viruses, ABPV and SBV, were never detected. For adults without mite infestation, DWV, IAPV, BQCV and KBV were detected in the HMP colony; however, only BQCV was detected in the LMP colony but at similar levels as in the HMP colony. With mite infestation, the four viruses were detected in adults of the HMP colony but all at higher amounts than in the LMP colony. For brood without mite infestation, DWV and IAPV were detected in the HMP colony, but no viruses were detected in the LMP colony. With mite infestation of brood, the four viruses were detected in the HMP colony, but only DWV and IAPV were detected and at lower amounts in the LMP colony. An epidemiological explanation for these results is that pre-experiment differences in virus presence and levels existed between the HMP and LMP colonies. It is also possible that low V. destructor population growth in the LMP colony resulted in the bees being less exposed to the mite and thus less likely to have virus infections. LMP and HMP bees may have also differed in susceptibility to virus infection.

Clonidine reduces norepinephrine and improves bone marrow function in a rodent model of lung contusion, hemorrhagic shock, and chronic stress.

Science.gov (United States)

Alamo, Ines G; Kannan, Kolenkode B; Ramos, Harry; Loftus, Tyler J; Efron, Philip A; Mohr, Alicia M

2017-03-01

Propranolol has been shown previously to restore bone marrow function and improve anemia after lung contusion/hemorrhagic shock. We hypothesized that daily clonidine administration would inhibit central sympathetic outflow and restore bone marrow function in our rodent model of lung contusion/hemorrhagic shock with chronic stress. Male Sprague-Dawley rats underwent 6 days of restraint stress after lung contusion/hemorrhagic shock during which the animals received clonidine (75 μg/kg) after the restraint stress. On postinjury day 7, we assessed urine norepinephrine, blood hemoglobin, plasma granulocyte colony stimulating factor, and peripheral blood mobilization of hematopoietic progenitor cells, as well as bone marrow cellularity and erythroid progenitor cell growth. The addition of clonidine to lung contusion/hemorrhagic shock with chronic restraint stress significantly decreased urine norepinephrine levels, improved bone marrow cellularity, restored erythroid progenitor colony growth, and improved hemoglobin (14.1 ± 0.6 vs 10.8 ± 0.6 g/dL). The addition of clonidine to lung contusion/hemorrhagic shock with chronic restraint stress significantly decreased hematopoietic progenitor cells mobilization and restored granulocyte colony stimulating factor levels. After lung contusion/hemorrhagic shock with chronic restraint stress, daily administration of clonidine restored bone marrow function and improved anemia. Alleviating chronic stress and decreasing norepinephrine is a key therapeutic target to improve bone marrow function after severe injury. Copyright © 2016 Elsevier Inc. All rights reserved.

Alexander von Humboldt's perceptions of colonial Spanish America.

Science.gov (United States)

Rebok, Sandra

2009-01-01

This study presents an in-depth analysis of Alexander von Humboldt's descriptions and critical comments on the colonial society of the different regions he visited during his well-known expedition through the Americas (1799-1804). The criticisms of colonialism that he expressed, reflecting his personal convictions, have already been the focal point of many studies, but Humboldt also was able to offer a more differentiated assessment through comparisons of regional and local traditions and developments. This essay focuses on his personal diaries, which offer many interesting comments on colonial societies. These considerations and impressions made during the expedition are of particular scholarly value since they were not subject to censorship of any kind.

Colonial Networks of Power: The Far Reaches of Systems

International Nuclear Information System (INIS)

Hecht, Gabrielle

2004-01-01

Thomas Hughes has shown the links which existed between politics and technological and economic changes. From this point of view, the relationship between colonialism and the development of nuclear systems is interesting. There is a significant continuity from the colonial Empires to the uranium supply networks. Americans and the British worked together to prospect and to exploit uranium deposits, in particular in South Africa. On their side, the French had similar activities in Madagascar, Gabon and Niger. In both cases, important post-colonial ties have been maintained based on techno-politics

Coinfection with Haemophilus influenzae promotes pneumococcal biofilm formation during experimental otitis media and impedes the progression of pneumococcal disease.

Science.gov (United States)

Weimer, Kristin E D; Armbruster, Chelsie E; Juneau, Richard A; Hong, Wenzhou; Pang, Bing; Swords, W Edward

2010-10-01

Otitis media is an extremely common pediatric infection and is mostly caused by bacteria that are carried within the nasopharyngeal microbiota. It is clear that most otitis media cases involve simultaneous infection with multiple agents. Chinchillas were infected with nontypeable Haemophilus influenzae, Streptococcus pneumoniae, or a combination of both organisms, and the course of disease was compared. In vitro experiments were also performed to address how coinfection impacts biofilm formation. The incidence of systemic disease was reduced in coinfected animals, compared with those infected with pneumococcus alone. Pneumococci were present within surface-attached biofilms in coinfected animals, and a greater proportion of translucent colony type was observed in the coinfected animals. Because this colony type has been associated with pneumococcal biofilms, the impact of coinfection on pneumococcal biofilm formation was investigated. The results clearly show enhanced biofilm formation in vitro by pneumococci in the presence of H. influenzae. Based on these data, we conclude that coinfection with H. influenzae facilitates pneumococcal biofilm formation and persistence on the middle ear mucosal surface. This enhanced biofilm persistence correlates with delayed emergence of opaque colony variants within the bacterial population and a resulting decrease in systemic infection.

A child of the empire: British sociology and colonialism, 1940s-1960s.

Science.gov (United States)

Steinmetz, George

2013-01-01

British sociology was established as an academic discipline between 1945 and 1965, just as the British Empire was gearing up for a new phase of developmental colonialism backed by the social and other sciences. Many parts of the emerging sociological discipline became entangled with colonialism. Key themes and methods in sociology and the staff of sociology departments emerged from this colonial context. Historians have tended to place postwar British sociology in the context of expanding higher education and the welfare state, and have overlooked this colonial constellation. The article reconstructs this forgotten moment of disciplinary founding and explores three of the factors that promoted colonial sociology: the Colonial Social Science Research Council, the so-called Asquith universities, and the social research institutes in the colonies; and the involvement of sociologists from the London School of Economics in training colonial officials. © 2013 Wiley Periodicals, Inc.

Colony shape as a genetic trait in the pattern-forming Bacillus mycoides

Directory of Open Access Journals (Sweden)

Pisaneschi Giuseppe

2002-11-01

Full Text Available Abstract Background Bacillus mycoides Flügge, a Gram-positive, non-motile soil bacterium assigned to Bacillus cereus group, grows on agar as chains of cells linked end to end, forming radial filaments curving clock- or counter-clockwise (SIN or DX morphotypes. The molecular mechanism causing asymmetric curving is not known: our working hypothesis considers regulation of filamentous growth as the prerequisite for these morphotypes. Results SIN and DX strains isolated from the environment were classified as B. mycoides by biochemical and molecular biology tests. Growth on agar of different hardness and nutrient concentration did not abolish colony patterns, nor was conversion between SIN and DX morphotypes ever noticed. A number of morphotype mutants, all originating from one SIN strain, were obtained. Some lost turn direction becoming fluffy, others became round and compact. All mutants lost wild type tight aggregation in liquid culture. Growth on agar was followed by microscopy, exploring the process of colony formation and details of cell divisions. A region of the dcw (division cell wall cluster, including ftsQ, ftsA, ftsZ and murC, was sequenced in DX and SIN strains as a basis for studying cell division. This confirmed the relatedness of DX and SIN strains to the B. cereus group. Conclusions DX and SIN asymmetric morphotypes stem from a close but not identical genomic context. Asymmetry is established early during growth on agar. Wild type bacilli construct mostly uninterrupted filaments with cells dividing at the free ends: they "walk" longer distances compared to mutants, where enhanced frequency of cell separation produces new growing edges resulting in round compact colonies.

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

Science.gov (United States)

Lin, Sabrina; Fonteno, Shawn; Satish, Shruthi; Bhanu, Bir; Talbot, Prue

2010-01-01

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer software. Video bioinformatics is a powerful quantitative approach for extracting spatio-temporal data from video images using computer software to perform dating mining and analysis. In this article, we introduce a video bioinformatics method for quantifying the growth of human embryonic stem cells (hESC) by analyzing time-lapse videos collected in a Nikon BioStation CT incubator equipped with a camera for video imaging. In our experiments, hESC colonies that were attached to Matrigel were filmed for 48 hours in the BioStation CT. To determine the rate of growth of these colonies, recipes were developed using CL-Quant software which enables users to extract various types of data from video images. To accurately evaluate colony growth, three recipes were created. The first segmented the image into the colony and background, the second enhanced the image to define colonies throughout the video sequence accurately, and the third measured the number of pixels in the colony over time. The three recipes were run in sequence on video data collected in a BioStation CT to analyze the rate of growth of individual hESC colonies over 48 hours. To verify the truthfulness of the CL-Quant recipes, the same data were analyzed manually using Adobe Photoshop software. When the data obtained using the CL-Quant recipes and Photoshop were compared, results were virtually identical, indicating the CL-Quant recipes were truthful. The method described here could be applied to any video data to measure growth rates of hESC or other cells that grow in colonies. In addition, other video bioinformatics recipes can be developed in the future for other cell processes such as migration, apoptosis, and cell adhesion. PMID:20495527

Inhibition of Blumeria graminis germination and germling development within colonies of oat mildew

DEFF Research Database (Denmark)

Carver, T.L.W.; Roberts, P.C.; Thomas, B.J.

2001-01-01

Germination by Blumeria graminis. DC Speer ff. spp. avenae, hordei and tritici, was greatly suppressed when conidia fell within colonies of ff. spp. avenae or hordei established on susceptible oat or barley, respectively. On healthy oat or barley, and when distant from powdery mildew, colonies. all...... ff. spp. formed normal appressoria. This was also true When conidia germinated within established barley mildew colonies. Within barley mildew colonies, appressoria of f. sp. hordei penetrated epidermal cells formed haustoria more frequently than appressoria distant from colonies. Similarly, ff. spp....... avenae and tritici, normally unable to infect barley. frequently penetrated epidermal cells subtending established barley mildew colonies. Thus, colony, establishment induced barley epidermal cell accessibility, even to non-pathogenic ff. spp, In contrast. when all three ff. spp. germinated within...

Contribution of Arctic seabird-colony ammonia to atmospheric particles and cloud-albedo radiative effect

Science.gov (United States)

Croft, B.; Wentworth, G. R.; Martin, R. V.; Leaitch, W. R.; Murphy, J. G.; Murphy, B. N.; Kodros, J. K.; Abbatt, J. P. D.; Pierce, J. R.

2016-01-01

The Arctic region is vulnerable to climate change and able to affect global climate. The summertime Arctic atmosphere is pristine and strongly influenced by natural regional emissions, which have poorly understood climate impacts related to atmospheric particles and clouds. Here we show that ammonia from seabird-colony guano is a key factor contributing to bursts of newly formed particles, which are observed every summer in the near-surface atmosphere at Alert, Nunavut, Canada. Our chemical-transport model simulations indicate that the pan-Arctic seabird-influenced particles can grow by sulfuric acid and organic vapour condensation to diameters sufficiently large to promote pan-Arctic cloud-droplet formation in the clean Arctic summertime. We calculate that the resultant cooling tendencies could be large (about −0.5 W m−2 pan-Arctic-mean cooling), exceeding −1 W m−2 near the largest seabird colonies due to the effects of seabird-influenced particles on cloud albedo. These coupled ecological–chemical processes may be susceptible to Arctic warming and industrialization. PMID:27845764

Economic mobility in a colonial and post-colonial economy: the case of Indonesia.

NARCIS (Netherlands)

van Leeuwen, Bas; Földvári, Peter

2016-01-01

Despite a consensus about the main factors influencing economic mobility in Indonesia, such as labor-market opportunities and childhood circumstances, virtually nothing is known about how these factors increased economic standing in the colonial and postcolonial periods. The use of height data as a

“Colony, Empire, and De-colonization” in Taiwanese Film History

Directory of Open Access Journals (Sweden)

Mamie Misawa

2014-08-01

Full Text Available A consideration of Taiwanese cinema during the Japanese colonial period must take into context the unique political history of Taiwan. This paper will first explain the larger current of research related to this political context and situate itself in relation to the observations and findings of others. This paper will then introduce the focus of the author’s research under the theme of this section, "Colony, Empire, and Post-colonialism,” illustrating an argument about the production and the reception of films by the Taiwanese during the colonial period. Lastly, this paper will also note the possibility of "de-colonization from the bottom up" in the “post-war” Taiwanese film market.

Revisiting the effect of colonial institutions on comparative economic development.

Directory of Open Access Journals (Sweden)

Valentina A Assenova

Full Text Available European settler mortality has been proposed as an instrument to predict the causal effect of colonial institutions on differences in economic development. We examine the relationship between mortality, temperature, and economic development in former European colonies in Asia, Africa, and the Americas. We find that (i European settler mortality rates increased with regional temperatures and (ii economic output decreased with regional temperatures. Conditioning on the continent of settlement and accounting for colonies that were not independent as of 1900 undermines the causal effect of colonial institutions on comparative economic development. Our findings run counter to the institutions hypothesis of economic development, showing instead that geography affected both historic mortality rates and present-day economic output.

The Historical Taboo: Colonial Discourses and Postcolonial Identities in Belgium

Directory of Open Access Journals (Sweden)

Bobineau Julien

2017-06-01

Full Text Available This article examines so-called colonial discourses in Belgium related to the former Sub-Saharan colony owned by Leopold II of Belgium which today is known as the Democratic Republic of Congo (DR Congo or the Congo-Kinshasa. Having introduced the colonial history of the DR Congo from the 15th century until 1910, the study starts with a discussion of Van den Braembussche’s concept of a ‘historical taboo’ and four ways of engaging with such implicit interdictions. Finally, an empirical analysis of colonial discourses in Belgium from the 1890s until today will be presented in conjunction with Belgium’s linguistic-cultural division, taking into account age-related divergence.

Impact of chronic neonicotinoid exposure on honeybee colony performance and queen supersedure.

Directory of Open Access Journals (Sweden)

Christoph Sandrock

Full Text Available BACKGROUND: Honeybees provide economically and ecologically vital pollination services to crops and wild plants. During the last decade elevated colony losses have been documented in Europe and North America. Despite growing consensus on the involvement of multiple causal factors, the underlying interactions impacting on honeybee health and colony failure are not fully resolved. Parasites and pathogens are among the main candidates, but sublethal exposure to widespread agricultural pesticides may also affect bees. METHODOLOGY/PRINCIPAL FINDINGS: To investigate effects of sublethal dietary neonicotinoid exposure on honeybee colony performance, a fully crossed experimental design was implemented using 24 colonies, including sister-queens from two different strains, and experimental in-hive pollen feeding with or without environmentally relevant concentrations of thiamethoxam and clothianidin. Honeybee colonies chronically exposed to both neonicotinoids over two brood cycles exhibited decreased performance in the short-term resulting in declining numbers of adult bees (-28% and brood (-13%, as well as a reduction in honey production (-29% and pollen collections (-19%, but colonies recovered in the medium-term and overwintered successfully. However, significantly decelerated growth of neonicotinoid-exposed colonies during the following spring was associated with queen failure, revealing previously undocumented long-term impacts of neonicotinoids: queen supersedure was observed for 60% of the neonicotinoid-exposed colonies within a one year period, but not for control colonies. Linked to this, neonicotinoid exposure was significantly associated with a reduced propensity to swarm during the next spring. Both short-term and long-term effects of neonicotinoids on colony performance were significantly influenced by the honeybees' genetic background. CONCLUSIONS/SIGNIFICANCE: Sublethal neonicotinoid exposure did not provoke increased winter losses. Yet

Derivation of guidelines for uranium residual radioactive material in soil at the Colonie Site, Colonie, New York

International Nuclear Information System (INIS)

Dunning, D.

1996-05-01

Residual radioactive material guidelines for uranium in soil were derived for the Colonie site located in Colonie, New York. This site has been designated for remedial action under the Formerly Utilized Sites Remedial Action Program (FUSRAP) of the U.S. Department of Energy (DOE). The site became contaminated with radioactive material as a result of operations conducted by National Lead (NL) Industries from 1958 to 1984; these activities included brass foundry operations, electroplating of metal products, machining of various components using depleted uranium, and limited work with small amounts of enriched uranium and thorium. The Colonie site comprises the former NL Industries property, now designated the Colonie Interim Storage Site (CISS), and 56 vicinity properties contaminated by fallout from airborne emissions; 53 of the vicinity properties were previously remediated between 1984 and 1988. In 1984, DOE accepted ownership of the CISS property from NL Industries. Residual radioactive material guidelines for individual radionuclides and total uranium were derived on the basis of the requirement that the 50-year committed effective dose equivalent to a hypothetical individual who lives or works in the immediate vicinity of the site should not exceed a dose of 30 mrem/yr following remedial action for the current use and likely future use scenarios or a dose of 100 mrem/yr for less likely future use scenarios. The DOE residual radioactive material guideline computer code, RESRAD, was used in this evaluation; RESRAD implements the methodology described in the DOE manual for establishing residual radioactive material guidelines

Food preparation in colonial America. A Bicentennial study.

Science.gov (United States)

Bennion, M

1976-07-01

Both regional and national influences have pervaded America's culinary arts from colonial times until the present. In the South, for instance, indigenous foods, such as sweet potatoes--as well as an abundance of fruits and fowl--were commonly served. In the North, maple sirup was a New England product, as was codfish. Throughout the colonies, corn was easily grown and became a staple. Immigrants from the Old World brought their recipes to meld or adapt to conditions they met here. Recounted also is the unfolding of an American cuisine, especially in the southern colonies as it evolved from European food preparation practices. Cooking was done in great fireplaces, with equipment designed to fit. Meat was generally boiled or stewed in pots hung in the fireplace, although it might be slow-roasted on a hand-turned spit. Hot breads, the hallmark of southern cooking, date from colonial days. In the Noth, the Dutch farmer's wife developed real skill in using flour from home-grown wheat and rye, creating pancakes, waffles, doughnuts, crullers, and so on. After the first hard winter, food in New England became more plentiful. Boston brown bread was made from corn, wheat, or rye and probably sweetened with maple sirup. Imports of coffee, tea, and spices from the Orient and fruit from the tropics were later added to the cuisine. Colonial Americans understood well the art of food preparation and appreciated the taste of well prepared, well seasoned dishes.

An artificial bee colony algorithm for the capacitated vehicle routing problem

DEFF Research Database (Denmark)

Szeto, W.Y.; Wu, Yongzhong; Ho, Sin C.

2011-01-01

This paper introduces an artificial bee colony heuristic for solving the capacitated vehicle routing problem. The artificial bee colony heuristic is a swarm-based heuristic, which mimics the foraging behavior of a honey bee swarm. An enhanced version of the artificial bee colony heuristic is also...... proposed to improve the solution quality of the original version. The performance of the enhanced heuristic is evaluated on two sets of standard benchmark instances, and compared with the original artificial bee colony heuristic. The computational results show that the enhanced heuristic outperforms...

Lower Virus Infections in Varroa destructor-Infested and Uninfested Brood and Adult Honey Bees (Apis mellifera) of a Low Mite Population Growth Colony Compared to a High Mite Population Growth Colony

Science.gov (United States)

Emsen, Berna; Hamiduzzaman, Mollah Md.; Goodwin, Paul H.; Guzman-Novoa, Ernesto

2015-01-01

A comparison was made of the prevalence and relative quantification of deformed wing virus (DWV), Israeli acute paralysis virus (IAPV), black queen cell virus (BQCV), Kashmir bee virus (KBV), acute bee paralysis virus (ABPV) and sac brood virus (SBV) in brood and adult honey bees (Apis mellifera) from colonies selected for high (HMP) and low (LMP) Varroa destructor mite population growth. Two viruses, ABPV and SBV, were never detected. For adults without mite infestation, DWV, IAPV, BQCV and KBV were detected in the HMP colony; however, only BQCV was detected in the LMP colony but at similar levels as in the HMP colony. With mite infestation, the four viruses were detected in adults of the HMP colony but all at higher amounts than in the LMP colony. For brood without mite infestation, DWV and IAPV were detected in the HMP colony, but no viruses were detected in the LMP colony. With mite infestation of brood, the four viruses were detected in the HMP colony, but only DWV and IAPV were detected and at lower amounts in the LMP colony. An epidemiological explanation for these results is that pre-experiment differences in virus presence and levels existed between the HMP and LMP colonies. It is also possible that low V. destructor population growth in the LMP colony resulted in the bees being less exposed to the mite and thus less likely to have virus infections. LMP and HMP bees may have also differed in susceptibility to virus infection. PMID:25723540

A critical number of workers in a honeybee colony triggers investment in reproduction.

Science.gov (United States)

Smith, Michael L; Ostwald, Madeleine M; Loftus, J Carter; Seeley, Thomas D

2014-10-01

Social insect colonies, like individual organisms, must decide as they develop how to allocate optimally their resources among survival, growth, and reproduction. Only when colonies reach a certain state do they switch from investing purely in survival and growth to investing also in reproduction. But how do worker bees within a colony detect that their colony has reached the state where it is adaptive to begin investing in reproduction? Previous work has shown that larger honeybee colonies invest more in reproduction (i.e., the production of drones and queens), however, the term 'larger' encompasses multiple colony parameters including number of adult workers, size of the nest, amount of brood, and size of the honey stores. These colony parameters were independently increased in this study to test which one(s) would increase a colony's investment in reproduction via males. This was assayed by measuring the construction of drone comb, the special type of comb in which drones are reared. Only an increase in the number of workers stimulated construction of drone comb. Colonies with over 4,000 workers began building drone comb, independent of the other colony parameters. These results show that attaining a critical number of workers is the key parameter for honeybee colonies to start to shift resources towards reproduction. These findings are relevant to other social systems in which a group's members must adjust their behavior as a function of the group's size.

A critical number of workers in a honeybee colony triggers investment in reproduction

Science.gov (United States)

Smith, Michael L.; Ostwald, Madeleine M.; Loftus, J. Carter; Seeley, Thomas D.

2014-10-01

Social insect colonies, like individual organisms, must decide as they develop how to allocate optimally their resources among survival, growth, and reproduction. Only when colonies reach a certain state do they switch from investing purely in survival and growth to investing also in reproduction. But how do worker bees within a colony detect that their colony has reached the state where it is adaptive to begin investing in reproduction? Previous work has shown that larger honeybee colonies invest more in reproduction (i.e., the production of drones and queens), however, the term `larger' encompasses multiple colony parameters including number of adult workers, size of the nest, amount of brood, and size of the honey stores. These colony parameters were independently increased in this study to test which one(s) would increase a colony's investment in reproduction via males. This was assayed by measuring the construction of drone comb, the special type of comb in which drones are reared. Only an increase in the number of workers stimulated construction of drone comb. Colonies with over 4,000 workers began building drone comb, independent of the other colony parameters. These results show that attaining a critical number of workers is the key parameter for honeybee colonies to start to shift resources towards reproduction. These findings are relevant to other social systems in which a group's members must adjust their behavior as a function of the group's size.

Theoretical and Experimental Study of Bacterial Colony Growth in 3D

Science.gov (United States)

Shao, Xinxian; Mugler, Andrew; Nemenman, Ilya

2014-03-01

Bacterial cells growing in liquid culture have been well studied and modeled. However, in nature, bacteria often grow as biofilms or colonies in physically structured habitats. A comprehensive model for population growth in such conditions has not yet been developed. Based on the well-established theory for bacterial growth in liquid culture, we develop a model for colony growth in 3D in which a homogeneous colony of cells locally consume a diffusing nutrient. We predict that colony growth is initially exponential, as in liquid culture, but quickly slows to sub-exponential after nutrient is locally depleted. This prediction is consistent with our experiments performed with E. coli in soft agar. Our model provides a baseline to which studies of complex growth process, such as such as spatially and phenotypically heterogeneous colonies, must be compared.

Animal Bodies, Colonial Subjects: (ReLocating Animality in Decolonial Thought

Directory of Open Access Journals (Sweden)

Billy-Ray Belcourt

2014-12-01

Full Text Available In this paper, I argue that animal domestication, speciesism, and other modern human-animal interactions in North America are possible because of and through the erasure of Indigenous bodies and the emptying of Indigenous lands for settler-colonial expansion. That is, we cannot address animal oppression or talk about animal liberation without naming and subsequently dismantling settler colonialism and white supremacy as political machinations that require the simultaneous exploitation and/or erasure of animal and Indigenous bodies. I begin by re-framing animality as a politics of space to suggest that animal bodies are made intelligible in the settler imagination on stolen, colonized, and re-settled Indigenous lands. Thinking through Andrea Smith’s logics of white supremacy, I then re-center anthropocentrism as a racialized and speciesist site of settler coloniality to re-orient decolonial thought toward animality. To critique the ways in which Indigenous bodies and epistemologies are at stake in neoliberal re-figurings of animals as settler citizens, I reject the colonial politics of recognition developed in Sue Donaldson and Will Kymlicka’s recent monograph, Zoopolis: A Political Theory of Animal Rights (Oxford University Press 2011 because it militarizes settler-colonial infrastructures of subjecthood and governmentality. I then propose a decolonized animal ethic that finds legitimacy in Indigenous cosmologies to argue that decolonization can only be reified through a totalizing disruption of those power apparatuses (i.e., settler colonialism, anthropocentrism, white supremacy, and neoliberal pluralism that lend the settler state sovereignty, normalcy, and futurity insofar as animality is a settler-colonial particularity.

Delayed globin synthesis leads to excess heme and the macrocytic anemia of Diamond Blackfan anemia and del(5q) myelodysplastic syndrome.

Science.gov (United States)

Yang, Zhantao; Keel, Siobán B; Shimamura, Akiko; Liu, Li; Gerds, Aaron T; Li, Henry Y; Wood, Brent L; Scott, Bart L; Abkowitz, Janis L

2016-05-11

Diamond Blackfan anemia (DBA) and myelodysplastic syndrome (MDS) with isolated del(5q) are severe macrocytic anemias; although both are associated with impaired ribosome assembly, why the anemia occurs is not known. We cultured marrow cells from DBA (n = 3) and del(5q) MDS (n = 6) patients and determined how heme (a toxic chemical) and globin (a protein) are coordinated. We show that globin translation initiates slowly, whereas heme synthesis proceeds normally. This results in insufficient globin protein, excess heme and excess reactive oxygen species in early erythroid precursors, and CFU-E (colony-forming unit-erythroid)/proerythroblast cell death. The cells that can more rapidly and effectively export heme or can slow heme synthesis preferentially survive and appropriately mature. Consistent with these observations, treatment with 10 μM succinylacetone, a specific inhibitor of heme synthesis, improved the erythroid cell output of DBA and del(5q) MDS marrow cultures by 68 to 95% (P = 0.03 to 0.05), whereas the erythroid cell output of concurrent control marrow cultures decreased by 4 to 13%. Our studies demonstrate that erythropoiesis fails when heme exceeds globin. Our data further suggest that therapies that decrease heme synthesis (or facilitate heme export) could improve the red blood cell production of persons with DBA, del(5q) MDS, and perhaps other macrocytic anemias. Copyright © 2016, American Association for the Advancement of Science.

“The Other”in Feminism and Post-colonialism

Institute of Scientific and Technical Information of China (English)

袁飞

2015-01-01

“The other” is one of the key terms of Western literary theory. The political critique of “the other” is most obvious in feminism and post-colonialism. This essay intends to ilustrate their different application of “the other”. With the enrichment of its concept, feminists and post-colonial theorists tend to emphasize difference, fighting against sexism or racism.

Past penguin colony responses to explosive volcanism on the Antarctic Peninsula

Science.gov (United States)

Roberts, Stephen J.; Monien, Patrick; Foster, Louise C.; Loftfield, Julia; Hocking, Emma P.; Schnetger, Bernhard; Pearson, Emma J.; Juggins, Steve; Fretwell, Peter; Ireland, Louise; Ochyra, Ryszard; Haworth, Anna R.; Allen, Claire S.; Moreton, Steven G.; Davies, Sarah J.; Brumsack, Hans-Jürgen; Bentley, Michael J.; Hodgson, Dominic A.

2017-04-01

Changes in penguin populations on the Antarctic Peninsula have been linked to several environmental factors, but the potentially devastating impact of volcanic activity has not been considered. Here we use detailed biogeochemical analyses to track past penguin colony change over the last 8,500 years on Ardley Island, home to one of the Antarctic Peninsula's largest breeding populations of gentoo penguins. The first sustained penguin colony was established on Ardley Island c. 6,700 years ago, pre-dating sub-fossil evidence of Peninsula-wide occupation by c. 1,000 years. The colony experienced five population maxima during the Holocene. Overall, we find no consistent relationships with local-regional atmospheric and ocean temperatures or sea-ice conditions, although the colony population maximum, c. 4,000-3,000 years ago, corresponds with regionally elevated temperatures. Instead, at least three of the five phases of penguin colony expansion were abruptly ended by large eruptions from the Deception Island volcano, resulting in near-complete local extinction of the colony, with, on average, 400-800 years required for sustainable recovery.

Eosinophilic spleen colonies are produced in rat-marrow-transplanted but not in murine-marrow-transplanted mice

International Nuclear Information System (INIS)

Szabo, L.G.; Kelemen, E.

1988-01-01

Differential counts of about 5000 splenic clusters and colonies developing in whole-body-irradiated mice and rats were made, using semi-serial histological sections prepared 9 to 12 d after transplantation with bone marrow haemopoietic cells. The investigated mouse and rat spleens were from syngeneically, allogeneically, or xenogeneically transplanted recipients. Splenic eosinophil clusters were always found when rat eosinophil-producing progenitors were present in the inoculum, whereas murine inocula failed to produce splenic eosinophilic clusters even in the syngeneic mouse. The limiting factor in the production pf splenic eosinophilic clusters was the appropriate donor progenitor/committed stem cell itself. Changes in the percentages of eosinophil clusters with the number of injected cells and with increased doses of irradiation, as well as formation of rat eosinophil colonies in mice, as against mainly clusters in rats, themselves show that regulatory mechanisms of the recipients also play a role. These regulatory mechanisms cannot be attributed to the splenic microenvironment. (author)

Investigation of multimodal forward scatter phenotyping from bacterial colonies

Science.gov (United States)

Kim, Huisung

A rapid, label-free, and elastic light scattering (ELS) based bacterial colony phenotyping technology, bacterial rapid detection using optical scattering technology (BARDOT) provides a successful classification of several bacterial genus and species. For a thorough understanding of the phenomena and overcoming the limitations of the previous design, five additional modalities from a bacterial colony: 3D morphology, spatial optical density (OD) distribution, spectral forward scattering pattern, spectral OD, and surface backward reflection pattern are proposed to enhance the classification/identification ratio, and the feasibilities of each modality are verified. For the verification, three different instruments: integrated colony morphology analyzer (ICMA), multi-spectral BARDOT (MS-BARDOT) , and multi-modal BARDOT (MM-BARDOT) are proposed and developed. The ICMA can measure 3D morphology and spatial OD distribution of the colony simultaneously. A commercialized confocal displacement meter is used to measure the profiles of the bacterial colonies, together with a custom built optical density measurement unit to interrogate the biophysics behind the collective behavior of a bacterial colony. The system delivers essential information related to the quantitative growth dynamics (height, diameter, aspect ratio, optical density) of the bacterial colony, as well as, a relationship in between the morphological characteristics of the bacterial colony and its forward scattering pattern. Two different genera: Escherichia coli O157:H7 EDL933, and Staphylococcus aureus ATCC 25923 are selected for the analysis of the spatially resolved growth dynamics, while, Bacillus spp. such as B. subtilis ATCC 6633, B. cereus ATCC 14579, B. thuringiensis DUP6044, B. polymyxa B719W, and B. megaterium DSP 81319, are interrogated since some of the Bacillus spp. provides strikingly different characteristics of ELS patterns, and the origin of the speckle patterns are successfully correlated with

Mathematical Modeling the Geometric Regularity in Proteus Mirabilis Colonies

Science.gov (United States)

Zhang, Bin; Jiang, Yi; Minsu Kim Collaboration

Proteus Mirabilis colony exhibits striking spatiotemporal regularity, with concentric ring patterns with alternative high and low bacteria density in space, and periodicity for repetition process of growth and swarm in time. We present a simple mathematical model to explain the spatiotemporal regularity of P. Mirabilis colonies. We study a one-dimensional system. Using a reaction-diffusion model with thresholds in cell density and nutrient concentration, we recreated periodic growth and spread patterns, suggesting that the nutrient constraint and cell density regulation might be sufficient to explain the spatiotemporal periodicity in P. Mirabilis colonies. We further verify this result using a cell based model.

Creating Central Sulawesi. Mission Intervention, Colonialism and ‘Multiculturality’

Directory of Open Access Journals (Sweden)

J. Coté

2011-01-01

Full Text Available Creating Central Sulawesi: Mission Intervention, Colonialism and ‘Multiculturality’Central Sulawesi provides an example of how, under colonialism, non-state bodies contributed to the creation of new political identities in the Indonesian archipelago, and how the modern Indonesian state came to be based on these. Arguably, at the beginning of the twentieth century, the region was poised to be incorporated into the structure of one or other of the existing powerful Central and Southern Sulawesi political entities. As such, as just another ‘region’ in the sprawling archipelagic colony subjected to standard colonial policy, it should have been readily incorporated into the Indonesian state, albeit through the ‘Sulawesi Permesta’. Instead, in seeking to establish what one writer has described as a ‘volkskerk’ [people’s church], the ‘Poso mission’ established with colonial support by the Nederlandsche Zendinggenootschap [Netherlands Missionary Society] in 1892, was instrumental in defining new religious, cultural and linguistic boundaries. These acted to effectively isolate the Pamona people from adjacent Christian communities established by other missionary endeavours; from their Islamic neighbours and, arguably, from the ‘nation’. As elsewhere in the archipelago, the subsequent process of this region’s reintegration has formed part of the difficult postcolonial legacy inherited by the Indonesian nation.

Temnothorax rugatulus ant colonies consistently vary in nest structure across time and context.

Directory of Open Access Journals (Sweden)

Nicholas DiRienzo

Full Text Available A host of animals build architectural constructions. Such constructions frequently vary with environmental and individual/colony conditions, and their architecture directly influences behavior and fitness. The nests of ant colonies drive and enable many of their collective behaviors, and as such are part of their 'extended phenotype'. Since ant colonies have been recently shown to differ in behavior and life history strategy, we ask whether colonies differ in another trait: the architecture of the constructions they create. We allowed Temnothorax rugatulus rock ants, who create nests by building walls within narrow rock gaps, to repeatedly build nest walls in a fixed crevice but under two environmental conditions. We find that colonies consistently differ in their architecture across environments and over nest building events. Colony identity explained 12-40% of the variation in nest architecture, while colony properties and environmental conditions explained 5-20%, as indicated by the condition and marginal R2 values. When their nest boxes were covered, which produced higher humidity and lower airflow, colonies built thicker, longer, and heavier walls. Colonies also built more robust walls when they had more brood, suggesting a protective function of wall thickness. This is, to our knowledge, the first study to explicitly investigate the repeatability of nestbuilding behavior in a controlled environment. Our results suggest that colonies may face tradeoffs, perhaps between factors such as active vs. passive nest defense, and that selection may act on individual construction rules as a mechanisms to mediate colony-level behavior.

The challenges of sustainable development in post-colonial African ...

African Journals Online (AJOL)

The challenges of sustainable development in post-colonial African states: a review of Adamu Usman's Sieged. ... This paper discusses and contributes to debates on the critical governance challenges faced by post-colonial African states such as bribery and corruption, lack of democratic and participatory governance, ...

Variation in Symbiodinium ITS2 sequence assemblages among coral colonies.

Science.gov (United States)

Stat, Michael; Bird, Christopher E; Pochon, Xavier; Chasqui, Luis; Chauka, Leonard J; Concepcion, Gregory T; Logan, Dan; Takabayashi, Misaki; Toonen, Robert J; Gates, Ruth D

2011-01-05

Endosymbiotic dinoflagellates in the genus Symbiodinium are fundamentally important to the biology of scleractinian corals, as well as to a variety of other marine organisms. The genus Symbiodinium is genetically and functionally diverse and the taxonomic nature of the union between Symbiodinium and corals is implicated as a key trait determining the environmental tolerance of the symbiosis. Surprisingly, the question of how Symbiodinium diversity partitions within a species across spatial scales of meters to kilometers has received little attention, but is important to understanding the intrinsic biological scope of a given coral population and adaptations to the local environment. Here we address this gap by describing the Symbiodinium ITS2 sequence assemblages recovered from colonies of the reef building coral Montipora capitata sampled across Kāne'ohe Bay, Hawai'i. A total of 52 corals were sampled in a nested design of Coral Colony(Site(Region)) reflecting spatial scales of meters to kilometers. A diversity of Symbiodinium ITS2 sequences was recovered with the majority of variance partitioning at the level of the Coral Colony. To confirm this result, the Symbiodinium ITS2 sequence diversity in six M. capitata colonies were analyzed in much greater depth with 35 to 55 clones per colony. The ITS2 sequences and quantitative composition recovered from these colonies varied significantly, indicating that each coral hosted a different assemblage of Symbiodinium. The diversity of Symbiodinium ITS2 sequence assemblages retrieved from individual colonies of M. capitata here highlights the problems inherent in interpreting multi-copy and intra-genomically variable molecular markers, and serves as a context for discussing the utility and biological relevance of assigning species names based on Symbiodinium ITS2 genotyping.

Disrupting the Coloniality of Being: Toward De-Colonial Ontologies in Philosophy of Education

Science.gov (United States)

Richardson, Troy A.

2012-01-01

This essay works to bridge conversations in philosophy of education with decolonial theory. The author considers Margonis' (1999, 2011a, b) use of Rousseau (1979) and Heidegger (1962) in developing an ontological attitude that counters social hierarchies and promotes anti-colonial relations. While affirming this effort, the essay outlines a…

Image steganalysis using Artificial Bee Colony algorithm

Science.gov (United States)

Sajedi, Hedieh

2017-09-01

Steganography is the science of secure communication where the presence of the communication cannot be detected while steganalysis is the art of discovering the existence of the secret communication. Processing a huge amount of information takes extensive execution time and computational sources most of the time. As a result, it is needed to employ a phase of preprocessing, which can moderate the execution time and computational sources. In this paper, we propose a new feature-based blind steganalysis method for detecting stego images from the cover (clean) images with JPEG format. In this regard, we present a feature selection technique based on an improved Artificial Bee Colony (ABC). ABC algorithm is inspired by honeybees' social behaviour in their search for perfect food sources. In the proposed method, classifier performance and the dimension of the selected feature vector depend on using wrapper-based methods. The experiments are performed using two large data-sets of JPEG images. Experimental results demonstrate the effectiveness of the proposed steganalysis technique compared to the other existing techniques.

Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

Science.gov (United States)

Lane, Courtney E; Benton, Michael G

2015-12-01

A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

Uniting Christian Students� Association�s pilgrimage to overcome colonial racism: A southern African postcolonial missiological dialogue

Directory of Open Access Journals (Sweden)

R.W. (Reggie Nel

2015-03-01

Full Text Available World Christianity has been enriched by Christian student movements such as the Uniting Christian Students� Association (UCSA from South Africa. This article, based on my recent doctoral research, starts with the affirmation of the ambiguous relations of these movements with colonial racism. However, faced with new challenges in a postcolonial context, there are key impulses to be gained by an inter-subjective, but also interdisciplinary dialogue with these movements as they negotiate their calling. By focussing on one movement within the southern African context, UCSA, in particular its formation and development since the demise of apartheid in South Africa, the article aims to present an attempt to understand the missionary praxis of UCSA through a postcolonial missiological matrix. The article draws on the theological disciplines of missiology, systematic theology, church history, contextual theology, as well as the methodologies in non-theologic disciplines like sociology, in particular social movement studies, and history. The findings show, amongst others, a growing complexity in relation to its agency, how it frames its world and also how it used its authoritative sources to discern its calling. The article closes with some key insights and pointers relevant for faith communities in their mission to overcome colonial racism.Intradisciplinary and/or interdisciplinary implications: The teaching and research in missiology and systematic theology in how the challenge of colonial racism is addressed, methodologically.

Hematological measurements in rats flown on Spacelab shuttle SL-3

International Nuclear Information System (INIS)

Lange, R.D.; Andrews, R.B.; Gibson, L.A.; Congdon, C.C.; Wright, P.; Dunn, C.D.R.; Jones, J.B.

1987-01-01

Previous studies have shown that a decrease in red cell mass occurs in astronauts, and some studies indicate a leukocytosis occurs. A life science module housing young and mature rats was flown on shuttle mission Spacelab 3 (SL-3), and the results of hematology studies of flight and control rats are presented. Statistically significant increases in the hematocrit, red blood cell counts, and hemoglobin determinations, together with a mild neutrophilia and lymphopenia, were found in flight animals. No significant changes were found in bone marrow and spleen cell differentials or erythropoietin determinations. Clonal assays demonstrated an increased erythroid colony formation of flight animal bone marrow cells at erythropoietin doses of 0.02 and 1.0 U/ml but not 0.20 U/ml. These results agree with some but vary from other previously published studies. Erythropoietin assays performed by radioimmunoassay and clonal studies were performed for the first time

Trichuris trichiura in a post-Colonial Brazilian mummy

Directory of Open Access Journals (Sweden)

Rafaella Bianucci

2015-02-01

Full Text Available Trichuris trichiura is a soil-transmitted helminth which is prevalent in warm, moist, tropical and subtropical regions of the world with poor sanitation. Heavy whipworm can result either in Trichuris dysenteric syndrome - especially in children - or in a chronic colitis. In heavy infections, worms can spread proximally and may cause ileitis. Here we provide first microscopic evidence for a T. trichiura adult worm embedded in the rectum of a post-Colonial Brazilian adult mummy. During Colonial and post-Colonial times, many European chroniclers described a parasitic disease named Maculo whose symptomatology coincides with heavy helminthiasis. Based on our findings and on comparison of ancient textual evidence with modern description of heavy whipworm, we feel confident in considering that the two syndromes are expressions of the same pathological condition.

Parachemistries: Colonial chemopolitics in a zone of contest.

Science.gov (United States)

Mukharji, Projit Bihari

2016-12-01

The globalization of modern chemistry through European colonialism resulted, by the end of the nineteenth century, in the emergence of a number of parachemical knowledges. Parachemistries were bodies of non-European knowledge which came to be related to modern chemistry within particular historical milieux. Their relationship with modern chemistry was not necessarily epistemic and structural, but historical and performative. Actual historically located intellectuals posited their relationship. Such relationships were not merely abstract intellectual exercises; at a time when the practical uses of modern chemistry in statecraft were growing, the existence of these rival, competing parachemical knowledges challenged modern chemistry's regulatory deployments. Colonial locations emerged then not as mere 'contact zones', but as 'zones of conflict' where colonial chemopolitics was interrupted by the continued legitimacy and practice of parachemistries such as rasayana, kimiya, and neidan.

Queen introduction into the queenright honey bee colony

Directory of Open Access Journals (Sweden)

Antonín Přidal

2010-01-01

Full Text Available One of the actual elementary biologic principles of the introduction of queen is that the recipient co­lo­ny has to be queenless. We accidentally found that a queen can be accepted also in queenright co­lo­ny with using of the queen excluder. Therefore, we conducted two experiments with the introduction of queen in queenright colony.Under defined conditions of the experiment and with application of the queen excluder as a separator of queens we successfully introduced queen in the queenright colony. This result is discussed in relation to the general principle that a queen should be introduced only in a queenless colony. It is possible that there are some exceptions advert to the existence of some unknown biologic patterns in the honey bee biology and pheromones.

Development rate and brood production in haplo- and pleometrotic colonies of Oecophylla smaragdina

DEFF Research Database (Denmark)

Offenberg, Joachim; Peng, Renkang; Nielsen, Mogens Gissel

2012-01-01

Pleometrosis (colony founding by multiple queens) may improve life history characteristics that are important for early colony survival. When queens unite their initial brood, the number of workers present when incipient colonies open may be higher than for single queen colonies. Further, the time...... until the first worker emerges may shorten. For territorial species and species that rob brood from neighbouring colonies, a faster production of more workers may improve the chance of surviving intraspecific competition. In this study, the time from the nuptial flight to the emergence of the first...

Observation of microorganism colonies using a scanning-laser-beam pH-sensing microscope

International Nuclear Information System (INIS)

Nakao, M.; Inoue, S.; Oishi, R.; Yoshinobu, T.; Iwasaki, H.

1995-01-01

The extracellular pH-distribution of colonies of Saccharomyces cerevisiae (yeast) and Escherichia coli (E. coli) were observed using a newly-developed scanning-laser-beam pH-sensing microscope. Colonies were incubated either on top of agarose plates or between the pH-sensing surface and the agar. In the latter case, colony growth was observed in-situ. The colonies could be observed within a period as short as 8 h for E. coli. The pH-distribution profiles by the colonies were found to be very sharp, in agreement with simulation results. (author)

Absent Histories and Absent Images: Photographs, Museums and the Colonial Past

Directory of Open Access Journals (Sweden)

Elizabeth Edwards

2015-04-01

Full Text Available Based on research in a range of UK museums, this paper explores the visibility and invisibility of the photographic legacy of colonial relations and the representation of the colonial past in museum galleries. It explores the conditions of the ‘invisibility’ and ‘disavowal’ of the colonial past in the historical narrative developed by museums, and the anxieties that cluster around such narratives in a postcolonial and multicultural society. The paper argues that the photographic legacy of the colonial past offers a way into those histories, but it is one that can only be realized through the critical engagement with photographs themselves and the work they might be made to do in museums. As an example, it examines the active and complex role of photographs played in the galleries of the British Empire and Commonwealth Museum, Bristol. It concludes that the failure of museums to integrate colonial pasts into their narratives has worked against the wider liberal agendas to which museums subscribe, and that photographic invisibility is both a symptom of and metaphor for the ‘invisibility’ of the colonial past.

Hybrid Bee Ant Colony Algorithm for Effective Load Balancing And ...

African Journals Online (AJOL)

PROF. OLIVER OSUAGWA

Ant Colony algorithm is used in this hybrid Bee Ant Colony algorithm to solve load balancing issues ... Genetic Algorithm (MO-GA) for dynamic job scheduling that .... Information Networking and Applications Workshops. [7]. M. Dorigo & T.

Conflict and conflict resolution in Africa: Engaging the colonial factor

African Journals Online (AJOL)

maintaining colonial-style approaches to African conflicts at the expense of a ... Educational Leadership at the College of Education and Human Services, University of .... Colonial rule was the antithesis of democracy, because it was premised.

Colonial Military Intelligence in the Zulu Rebellion, 1906 | Thompson ...

African Journals Online (AJOL)

In the Zulu Rebellion of 1906, the Natal Militia defeated the Zulu rebels without British imperial forces having to intervene in the conflict. The colonial forces were well adapted to the local circumstances, but in one important respect they drew heavily on imperial experience, namely military field intelligence. Colonial military ...

A catalog of Louisiana's nesting seabird colonies

Science.gov (United States)

Fontenot, William R.; Cardiff, Steve W.; DeMay, Richard A.; Dittmann, Donna L.; Hartley, Stephen B.; Jeske, Clinton W.; Lorenz, Nicole; Michot, Thomas C.; Purrington, Robert Dan; Seymour, Michael; Vermillion, William G.

2012-01-01

Summarizing his colonial nesting waterbird survey experiences along the northern coast of the Gulf of Mexico in a paper presented to the Colonial Waterbird Group of the Waterbird Society (Portnoy 1978), bird biologist John W. Portnoy stated, “This huge concentration of nesting waterbirds, restricted almost entirely to the wetlands and estuaries of southern Louisiana, is unmatched in all of North America; for example, a 1975 inventory of wading birds along the Atlantic Coast from Maine to Florida [Custer and Osborn, in press], tallied 250,000 breeding [waterbirds] of 14 species, in contrast with the 650,000 birds of 15 species just from Sabine Pass to Mobile Bay.” The “650,000 birds” to which Portnoy referred, were tallied by him in a 1976 survey of coastal Louisiana, Mississippi, and Alabama (see below, under “Major Surveys” section). According to the National Atlas of Coastal Waterbird Colonies in the Contiguous United States: 1976-82 (Spendelow and Patton 1988), the percentages of the total U.S. populations of Laughing Gull (11%), Forster's Tern (52%), Royal Tern (16%), Sandwich Tern (77%), and Black Skimmer (44%) which annually nest in Louisiana are significant – perhaps crucially so in the cases of Forster's Tern, Sandwich Tern, and Black Skimmer. Nearly three decades after Spendelow and Patton's determinations above, coastal Louisiana still stands out as the major center of colonial wading bird and seabird nesting in all of the United States. Within those three intervening decades, however, the

Effect of a home-made pollen substitute on honey bee colony development

NARCIS (Netherlands)

Steen, van der J.J.M.

2007-01-01

In 2001 and 2002, studies were conducted on a pollen substitute formulated for easy home preparation. Tests were done with free flying honey bee colonies. In 2001, pollen supply was restricted with pollen traps in 9 experimental colonies. Colonies were then equally divided among three treatments:

The Future Lunar Flora Colony

Science.gov (United States)

Goel, E. G.; Guven, U. G.

2017-10-01

A constructional design for the primary establishment for a lunar colony using the micrometeorite rich soil is proposed. It highlights the potential of lunar regolith combined with Earth technology for water and oxygen for human outposts on the Moon.

Changes in learning and foraging behaviour within developing bumble bee (Bombus terrestris colonies.

Directory of Open Access Journals (Sweden)

Lisa J Evans

Full Text Available Organisation in eusocial insect colonies emerges from the decisions and actions of its individual members. In turn, these decisions and actions are influenced by the individual's behaviour (or temperament. Although there is variation in the behaviour of individuals within a colony, we know surprisingly little about how (or indeed if the types of behaviour present in a colony change over time. Here, for the first time, we assessed potential changes in the behavioural type of foragers during colony development. Using an ecologically relevant foraging task, we measured the decision speed and learning ability of bumble bees (Bombus terrestris at different stages of colony development. We determined whether individuals that forage early in the colony life cycle (the queen and early emerging workers behaved differently from workers that emerge and forage at the end of colony development. Whilst we found no overall change in the foraging behaviour of workers with colony development, there were strong differences in foraging behaviour between queens and their workers. Queens appeared to forage more cautiously than their workers and were also quicker to learn. These behaviours could allow queens to maximise their nectar collecting efficiency whilst avoiding predation. Because the foundress queen is crucial to the survival and success of a bumble bee colony, more efficient foraging behaviour in queens may have strong adaptive value.

Queen-worker caste ratio depends on colony size in the pharaoh ant (Monomorium pharaonis)

DEFF Research Database (Denmark)

Schmidt, Anna Mosegaard; Linksvayer, Timothy Arnold; Boomsma, Jacobus Jan

2011-01-01

The success of an ant colony depends on the simultaneous presence of reproducing queens and nonreproducing workers in a ratio that will maximize colony growth and reproduction. Despite its presumably crucial role, queen–worker caste ratios (the ratio of adult queens to workers) and the factors...... affecting this variable remain scarcely studied. Maintaining polygynous pharaoh ant (Monomorium pharaonis) colonies in the laboratory has provided us with the opportunity to experimentally manipulate colony size, one of the key factors that can be expected to affect colony level queen–worker caste ratios...... species with budding colonies may adaptively adjust caste ratios to ensure rapid growth....

African Economic Development and Colonial Legacies

Directory of Open Access Journals (Sweden)

Gareth Austin

2010-03-01

Full Text Available This article reviews how colonial rule and African actions during the colonial period affected the resources and institutional settings for subsequent economic development south of the Sahara. The issue is seen from the perspective of the dynamics of development in what was in 1900 an overwhelmingly land-abundant region characterised by shortages of labour and capital, by perhaps surprisingly extensive indigenous market activities and by varying but often low levels of political centralisation. The differential impact of French and British rule is explored, but it is argued that a bigger determinant of the differential evolution of poverty, welfare and structural change was the contrast between “settler” and “peasant” economies.

YfiBNR mediates cyclic di-GMP dependent small colony variant formation and persistence in Pseudomonas aeruginosa.

Directory of Open Access Journals (Sweden)

Jacob G Malone

2010-03-01

Full Text Available During long-term cystic fibrosis lung infections, Pseudomonas aeruginosa undergoes genetic adaptation resulting in progressively increased persistence and the generation of adaptive colony morphotypes. This includes small colony variants (SCVs, auto-aggregative, hyper-adherent cells whose appearance correlates with poor lung function and persistence of infection. The SCV morphotype is strongly linked to elevated levels of cyclic-di-GMP, a ubiquitous bacterial second messenger that regulates the transition between motile and sessile, cooperative lifestyles. A genetic screen in PA01 for SCV-related loci identified the yfiBNR operon, encoding a tripartite signaling module that regulates c-di-GMP levels in P. aeruginosa. Subsequent analysis determined that YfiN is a membrane-integral diguanylate cyclase whose activity is tightly controlled by YfiR, a small periplasmic protein, and the OmpA/Pal-like outer-membrane lipoprotein YfiB. Exopolysaccharide synthesis was identified as the principal downstream target for YfiBNR, with increased production of Pel and Psl exopolysaccharides responsible for many characteristic SCV behaviors. An yfi-dependent SCV was isolated from the sputum of a CF patient. Consequently, the effect of the SCV morphology on persistence of infection was analyzed in vitro and in vivo using the YfiN-mediated SCV as a representative strain. The SCV strain exhibited strong, exopolysaccharide-dependent resistance to nematode scavenging and macrophage phagocytosis. Furthermore, the SCV strain effectively persisted over many weeks in mouse infection models, despite exhibiting a marked fitness disadvantage in vitro. Exposure to sub-inhibitory concentrations of antibiotics significantly decreased both the number of suppressors arising, and the relative fitness disadvantage of the SCV mutant in vitro, suggesting that the SCV persistence phenotype may play a more important role during antimicrobial chemotherapy. This study establishes Yfi

Targeted removal of ant colonies in ecological experiments, using hot water.

Science.gov (United States)

Tschinkel, Walter R; King, Joshua R

2007-01-01

Ecological experiments on fire ants cannot, or should not, use poison baits to eliminate the fire ants because such baits are not specific to fire ants, or even to ants. Hot water is an extremely effective and specific killing agent for fire ant colonies, but producing large amounts of hot water in the field, and making the production apparatus mobile have been problematical. The construction and use of a charcoal-fired kiln made from a 55-gal. oil drum lined with a sand-fireclay mixture is described. An automobile heater fan powered from a 12-v battery provided a draft. Dual bilge pumps pumped water from a large tank through a long coil of copper tubing within the kiln to produce 4 to 5 l. of hot water per min. The hot water was collected in 20 l. buckets and poured into fire ant nests previously opened by piercing with a stick. The entire assembly was transported in and operated from the back of a pickup truck. Five experimental plots containing 32 to 38 colonies of the fire ant, Solenopsis invicta, Buren (Hymenoptera: Formicidae), were treated with hot water over a period of two years. All colonies on the treatment plots were treated twice with hot water early in 2004, reducing their numbers to zero. However new colonies were formed, and mature colonies expanded into the plots. A third treatment was made in the spring of 2005, after which fire ant populations were suppressed for over a year. Whereas the 5 control plots contained a total of 166 mostly large colonies, the 5 treatment plots contained no live colonies at all. Averaged over a two-year period, a 70% reduction in total number of colonies was achieved (P ants.

Mem y cookie: la cocina colonial en Malasia y Singapur

OpenAIRE

Leong-Salobir, Cecilia; Arriola, Carmen

2015-01-01

Resumen Este trabajo examina el surgimiento de una cocina colonial distintiva en las colonias británicas de Malasia y Singapur desde finales del siglo XIX. La cocina colonial evolucionó con el tiempo y fue una combinación de prácticas culinarias derivadas de costumbres alimentarias europeas y asiáticas, muchas de las cuales llegaron de la India colonial. Al igual que en India, esta aculturación se desarrolló debido a la dependencia de los colonizadores de sus sirvientes domésticos para la pre...

The influence of gender- and age-related differences in the radiosensitivity of hematopoietic progenitor cells detected in steady-state human peripheral blood

International Nuclear Information System (INIS)

Kato, Kengo; Kashiwakura, Ikuo; Kuwabara, Mikinori

2011-01-01

To investigate the importance of gender and aging on the individual radiosensitivity of lineage-committed myeloid hematopoietic stem/progenitor cells (HSPCs) detected in mononuclear cells (MNCs) of steady-state human peripheral blood (PB), the clonogenic survival of HPCs, including colony-forming unit-granulocyte macrophage; burst-forming unit-erythroid; colony-forming unit-granulocyte-erythroid-macrophage-megakaryocyte cells derived from MNCs exposed to 0.5 Gy and 2 Gy X-irradiation were estimated. MNCs were prepared from the buffy-coats of 59 healthy individual blood donors. The results showed that large individual differences exist in the number of HSPCs, as well as in the surviving fraction of cells. Furthermore, the number of progenitor cells strongly correlated with their surviving fraction, suggesting that the radiosensitivity of hematopoietic progenitor cells decreases with the number of cells in the 10 5 cells population. A statistically significant negative correlation was observed between the surviving fraction observed at a dose of 0.5 Gy and the age of an individual, however, none of these correlations were observed after 2 Gy irradiation. No statistically significant difference was observed in individual radiosensitivity between males and females at either radiation dose. The present results indicated a correlation between the individual responsiveness of HSPCs to ionizing irradiation, especially to low dose irradiation, and aging. (author)

Spatial heterogeneity as a genetic mixing mechanism in highly philopatric colonial seabirds.

Science.gov (United States)

Cristofari, Robin; Trucchi, Emiliano; Whittington, Jason D; Vigetta, Stéphanie; Gachot-Neveu, Hélène; Stenseth, Nils Christian; Le Maho, Yvon; Le Bohec, Céline

2015-01-01

How genetic diversity is maintained in philopatric colonial systems remains unclear, and understanding the dynamic balance of philopatry and dispersal at all spatial scales is essential to the study of the evolution of coloniality. In the King penguin, Aptenodytes patagonicus, return rates of post-fledging chicks to their natal sub-colony are remarkably high. Empirical studies have shown that adults return year after year to their previous breeding territories within a radius of a few meters. Yet, little reliable data are available on intra- and inter-colonial dispersal in this species. Here, we present the first fine-scale study of the genetic structure in a king penguin colony in the Crozet Archipelago. Samples were collected from individual chicks and analysed at 8 microsatellite loci. Precise geolocation data of hatching sites and selective pressures associated with habitat features were recorded for all sampling locations. We found that despite strong natal and breeding site fidelity, king penguins retain a high degree of panmixia and genetic diversity. Yet, genetic structure appears markedly heterogeneous across the colony, with higher-than-expected inbreeding levels, and local inbreeding and relatedness hotspots that overlap predicted higher-quality nesting locations. This points towards heterogeneous population structure at the sub-colony level, in which fine-scale environmental features drive local philopatric behaviour, while lower-quality patches may act as genetic mixing mechanisms at the colony level. These findings show how a lack of global genetic structuring can emerge from small-scale heterogeneity in ecological parameters, as opposed to the classical model of homogeneous dispersal. Our results also emphasize the importance of sampling design for estimation of population parameters in colonial seabirds, as at high spatial resolution, basic genetic features are shown to be location-dependent. Finally, this study stresses the importance of

Spatial heterogeneity as a genetic mixing mechanism in highly philopatric colonial seabirds.

Directory of Open Access Journals (Sweden)

Robin Cristofari

Full Text Available How genetic diversity is maintained in philopatric colonial systems remains unclear, and understanding the dynamic balance of philopatry and dispersal at all spatial scales is essential to the study of the evolution of coloniality. In the King penguin, Aptenodytes patagonicus, return rates of post-fledging chicks to their natal sub-colony are remarkably high. Empirical studies have shown that adults return year after year to their previous breeding territories within a radius of a few meters. Yet, little reliable data are available on intra- and inter-colonial dispersal in this species. Here, we present the first fine-scale study of the genetic structure in a king penguin colony in the Crozet Archipelago. Samples were collected from individual chicks and analysed at 8 microsatellite loci. Precise geolocation data of hatching sites and selective pressures associated with habitat features were recorded for all sampling locations. We found that despite strong natal and breeding site fidelity, king penguins retain a high degree of panmixia and genetic diversity. Yet, genetic structure appears markedly heterogeneous across the colony, with higher-than-expected inbreeding levels, and local inbreeding and relatedness hotspots that overlap predicted higher-quality nesting locations. This points towards heterogeneous population structure at the sub-colony level, in which fine-scale environmental features drive local philopatric behaviour, while lower-quality patches may act as genetic mixing mechanisms at the colony level. These findings show how a lack of global genetic structuring can emerge from small-scale heterogeneity in ecological parameters, as opposed to the classical model of homogeneous dispersal. Our results also emphasize the importance of sampling design for estimation of population parameters in colonial seabirds, as at high spatial resolution, basic genetic features are shown to be location-dependent. Finally, this study stresses the

Parasites and Pathogens of the Honeybee (Apis mellifera and Their Influence on Inter-Colonial Transmission.

Directory of Open Access Journals (Sweden)

Nadège Forfert

Full Text Available Pathogens and parasites may facilitate their transmission by manipulating host behavior. Honeybee pathogens and pests need to be transferred from one colony to another if they are to maintain themselves in a host population. Inter-colony transmission occurs typically through honeybee workers not returning to their home colony but entering a foreign colony ("drifting". Pathogens might enhance drifting to enhance transmission to new colonies. We here report on the effects infection by ten honeybee viruses and Nosema spp., and Varroa mite infestation on honeybee drifting. Genotyping of workers collected from colonies allowed us to identify genuine drifted workers as well as source colonies sending out drifters in addition to sink colonies accepting them. We then used network analysis to determine patterns of drifting. Distance between colonies in the apiary was the major factor explaining 79% of drifting. None of the tested viruses or Nosema spp. were associated with the frequency of drifting. Only colony infestation with Varroa was associated with significantly enhanced drifting. More specifically, colonies with high Varroa infestation had a significantly enhanced acceptance of drifters, although they did not send out more drifting workers. Since Varroa-infested colonies show an enhanced attraction of drifting workers, and not only those infected with Varroa and its associated pathogens, infestation by Varroa may also facilitate the uptake of other pests and parasites.

Countering Coloniality in Educational Research: From Ownership to Answerability

Science.gov (United States)

Patel, Lisa

2014-01-01

In this theoretical article, I argue for a relational stance on learning as a way of reckoning with educational research as part of the settler colonial structure of the United States. Because of my geopolitical location to the United States as a settler colony, I begin by contrasting the stances of anticolonial and decolonial. I then analyze the…

Decreased "ineffective erythropoiesis" preserves polycythemia in mice under long-term hypoxia.

Science.gov (United States)

Harada, Tomonori; Tsuboi, Isao; Hirabayashi, Yukio; Kosaku, Kazuhiro; Naito, Michiko; Hara, Hiroyuki; Inoue, Tohru; Aizawa, Shin

2015-05-01

Hypoxia induces innumerable changes in humans and other animals, including an increase in peripheral red blood cells (polycythemia) caused by the activation of erythropoiesis mediated by increased erythropoietin (EPO) production. However, the elevation of EPO is limited and levels return to normal ranges under normoxia within 5-7 days of exposure to hypoxia, whereas polycythemia continues for as long as hypoxia persists. We investigated erythropoiesis in bone marrow and spleens from mouse models of long-term normobaric hypoxia (10 % O2) to clarify the mechanism of prolonged polycythemia in chronic hypoxia. The numbers of erythroid colony-forming units (CFU-E) in the spleen remarkably increased along with elevated serum EPO levels indicating the activation of erythropoiesis during the first 7 days of hypoxia. After 14 days of hypoxia, the numbers of CFU-E returned to normoxic levels, whereas polycythemia persisted for >140 days. Flow cytometry revealed a prolonged increase in the numbers of TER119-positive cells (erythroid cells derived from pro-erythroblasts through mature erythrocyte stages), especially the TER119 (high) CD71 (high) population, in bone marrow. The numbers of annexin-V-positive cells among the TER119-positive cells particularly declined under chronic hypoxia, suggesting that the numbers of apoptotic cells decrease during erythroid cell maturation. Furthermore, RT-PCR analysis showed that the RNA expression of BMP-4 and stem cell factor that reduces apoptotic changes during erythroid cell proliferation and maturation was increased in bone marrow under hypoxia. These findings indicated that decreased apoptosis of erythroid cells during erythropoiesis contributes to polycythemia in mice during chronic exposure to long-term hypoxia.

Pathogens as Predictors of Honey Bee Colony Strength in England and Wales.

Science.gov (United States)

Budge, Giles E; Pietravalle, Stéphane; Brown, Mike; Laurenson, Lynn; Jones, Ben; Tomkies, Victoria; Delaplane, Keith S

2015-01-01

Inspectors with the UK National Bee Unit were asked for 2007-2008 to target problem apiaries in England and Wales for pathogen screening and colony strength measures. Healthy colonies were included in the sampling to provide a continuum of health conditions. A total of 406 adult bee samples was screened and yielded 7 viral, 1 bacterial, and 2 microsporidial pathogens and 1 ectoparasite (Acarapis woodi). In addition, 108 samples of brood were screened and yielded 4 honey bee viruses. Virus prevalence varied from common (deformed wing virus, black queen cell virus) to complete absence (Israeli acute paralysis virus). When colonies were forced into one of two classes, strong or weak, the weak colonies contained more pathogens in adult bees. Among observed pathogens, only deformed wing virus was able to predict colony strength. The effect was negative such that colonies testing positive for deformed wing virus were likely to have fewer combs of bees or brood. This study constitutes the first record for Nosema ceranae in Great Britain. These results contribute to the growing body of evidence linking pathogens to poor honey bee health.

Indigenous education during the pre-colonial period in Southern Africa

African Journals Online (AJOL)

... process was intimately integrated with the social, cultural, artistic, religious and recreational life of the indigenous peoples. This article discusses different forms of indigenous education that existed in Southern Africa during the pre-colonial period. Keywords: Pre-colonial period, indigenous education, indigenous people,

Thermally adapted design strategy of colonial houses in Surabaya

Science.gov (United States)

Antaryama, I. G. N.; Ekasiwi, S. N. N.; Mappajaya, A.; Ulum, M. S.

2018-03-01

Colonial buildings, including houses, have been considered as a representation of climate-responsive architecture. The design was thought to be a hybrid model of Dutch and tropical architecture. It was created by way of reinventing tropical and Dutch architecture design principles, and expressed in a new form, i.e. neither resembling Dutch nor tropical building. Aside from this new image, colonial house does show good climatic responses. Previous researches on colonial house generally focus on qualitative assessment of climate performance of the building. Yet this kind of study tends to concentrate on building elements, e.g. wall, window, etc. The present study is designed to give more complete picture of architecture design strategy of the house by exploring and analysing thermal performance of colonial buildings and their related architecture design strategies. Field measurements are conducted during the dry season in several colonial building in Surabaya. Air temperature and humidity are both taken, representing internal and external thermal conditions of the building. These data are then evaluated to determine thermal performance of the house. Finally, various design strategies are examined in order to reveal their significant contributions to its thermal performance. Results of the study in Surabaya confirm findings of the previous researches that are conducted in other locations, which stated that thermal performance of the house is generally good. Passive design strategies such as mass effect and ventilation play an important role in determining performance of the building.

FluG affects secretion in colonies of Aspergillus niger.

Science.gov (United States)

Wang, Fengfeng; Krijgsheld, Pauline; Hulsman, Marc; de Bekker, Charissa; Müller, Wally H; Reinders, Marcel; de Vries, Ronald P; Wösten, Han A B

2015-01-01

Colonies of Aspergillus niger are characterized by zonal heterogeneity in growth, sporulation, gene expression and secretion. For instance, the glucoamylase gene glaA is more highly expressed at the periphery of colonies when compared to the center. As a consequence, its encoded protein GlaA is mainly secreted at the outer part of the colony. Here, multiple copies of amyR were introduced in A. niger. Most transformants over-expressing this regulatory gene of amylolytic genes still displayed heterogeneous glaA expression and GlaA secretion. However, heterogeneity was abolished in transformant UU-A001.13 by expressing glaA and secreting GlaA throughout the mycelium. Sequencing the genome of UU-A001.13 revealed that transformation had been accompanied by deletion of part of the fluG gene and disrupting its 3' end by integration of a transformation vector. Inactivation of fluG in the wild-type background of A. niger also resulted in breakdown of starch under the whole colony. Asexual development of the ∆fluG strain was not affected, unlike what was previously shown in Aspergillus nidulans. Genes encoding proteins with a signal sequence for secretion, including part of the amylolytic genes, were more often downregulated in the central zone of maltose-grown ∆fluG colonies and upregulated in the intermediate part and periphery when compared to the wild-type. Together, these data indicate that FluG of A. niger is a repressor of secretion.

Energy Colonialism Powers the Ongoing Unnatural Disaster in Puerto Rico

Directory of Open Access Journals (Sweden)

Catalina M. de Onís

2018-01-01

Full Text Available On September 20, 2017, Hurricane María made landfall in Puerto Rico. Blasting the Caribbean archipelago with 155-mile/h winds, this, in many ways, unnatural disaster exposed the brutal consequences of energy colonialism and an extractivist economy, as well as ongoing and increasing advocacy for decentralized solar infrastructure by many local residents and other renewables supporters. This paper argues that acknowledging colonial power relations and their consequences is essential for studying the interplay of energy systems, environments, and actors. To support this claim, this essay outlines Puerto Rico’s history as a US colony by focusing on key policies and their implications; examines openings for and barriers to decentralized, community solar in Puerto Rico; and concludes by discussing future research directions on just energy transitions and the imperative of uprooting colonialism and agitating for community self-determination and energy justice in these transformations.

Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

Science.gov (United States)

Kim, Kyunghoon; Kim, Jung Kyung

2015-08-26

Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

Globalization as Continuing Colonialism: Critical Global Citizenship Education in an Unequal World

Science.gov (United States)

Mikander, Pia

2016-01-01

In an unequal world, education about global inequality can be seen as a controversial but necessary topic for social science to deal with. Even though the world no longer consists of colonies and colonial powers, many aspects of the global economy follow the same patterns as during colonial times, with widening gaps between the world's richest and…

Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

Energy Technology Data Exchange (ETDEWEB)

Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

2009-12-11

The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

International Nuclear Information System (INIS)

Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

2009-01-01

The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

Viral prevalence increases with regional colony abundance in honey bee drones (Apis mellifera L).

Science.gov (United States)

Forfert, Nadège; Natsopoulou, Myrsini E; Paxton, Robert J; Moritz, Robin F A

2016-10-01

Transmission among colonies is a central feature for the epidemiology of honey bee pathogens. High colony abundance may promote transmission among colonies independently of apiary layout, making colony abundance a potentially important parameter determining pathogen prevalence in populations of honey bees. To test this idea, we sampled male honey bees (drones) from seven distinct drone congregation areas (DCA), and used their genotypes to estimate colony abundance at each site. A multiplex ligation dependent probe amplification assay (MLPA) was used to assess the prevalence of ten viruses, using five common viral targets, in individual drones. There was a significant positive association between colony abundance and number of viral infections. This result highlights the potential importance of high colony abundance for pathogen prevalence, possibly because high population density facilitates pathogen transmission. Pathogen prevalence in drones collected from DCAs may be a useful means of estimating the disease status of a population of honey bees during the mating season, especially for localities with a large number of wild or feral colonies. Copyright © 2016 Elsevier B.V. All rights reserved.

Phosphate-Catalyzed Hydrogen Peroxide Formation from Agar, Gellan, and κ-Carrageenan and Recovery of Microbial Cultivability via Catalase and Pyruvate.

Science.gov (United States)

Kawasaki, Kosei; Kamagata, Yoichi

2017-11-01

Previously, we reported that when agar is autoclaved with phosphate buffer, hydrogen peroxide (H 2 O 2 ) is formed in the resulting medium (PT medium), and the colony count on the medium inoculated with environmental samples becomes much lower than that on a medium in which agar and phosphate are autoclaved separately (PS medium) (T. Tanaka et al., Appl Environ Microbiol 80:7659-7666, 2014, https://doi.org/10.1128/AEM.02741-14). However, the physicochemical mechanisms underlying this observation remain largely unknown. Here, we determined the factors affecting H 2 O 2 formation in agar. The H 2 O 2 formation was pH dependent: H 2 O 2 was formed at high concentrations in an alkaline or neutral phosphate buffer but not in an acidic buffer. Ammonium ions enhanced H 2 O 2 formation, implying the involvement of the Maillard reaction catalyzed by phosphate. We found that other gelling agents (e.g., gellan and κ-carrageenan) also produced H 2 O 2 after being autoclaved with phosphate. We then examined the cultivability of microorganisms from a fresh-water sample to test whether catalase and pyruvate, known as H 2 O 2 scavengers, are effective in yielding high colony counts. The colony count on PT medium was only 5.7% of that on PS medium. Catalase treatment effectively restored the colony count of PT medium (to 106% of that on PS medium). In contrast, pyruvate was not as effective as catalase: the colony count on sodium pyruvate-supplemented PT medium was 58% of that on PS medium. Given that both catalase and pyruvate can remove H 2 O 2 from PT medium, these observations indicate that although H 2 O 2 is the main cause of reduced colony count on PT medium, other unknown growth-inhibiting substances that cannot be removed by pyruvate (but can be by catalase) may also be involved. IMPORTANCE The majority of bacteria in natural environments are recalcitrant to laboratory culture techniques. Previously, we demonstrated that one reason for this is the formation of high H 2 O

Pathogen prevalence and abundance in honey bee colonies involved in almond pollination.

Science.gov (United States)

Cavigli, Ian; Daughenbaugh, Katie F; Martin, Madison; Lerch, Michael; Banner, Katie; Garcia, Emma; Brutscher, Laura M; Flenniken, Michelle L

Honey bees are important pollinators of agricultural crops. Since 2006, US beekeepers have experienced high annual honey bee colony losses, which may be attributed to multiple abiotic and biotic factors, including pathogens. However, the relative importance of these factors has not been fully elucidated. To identify the most prevalent pathogens and investigate the relationship between colony strength and health, we assessed pathogen occurrence, prevalence, and abundance in Western US honey bee colonies involved in almond pollination. The most prevalent pathogens were Black queen cell virus (BQCV), Lake Sinai virus 2 (LSV2), Sacbrood virus (SBV), Nosema ceranae , and trypanosomatids. Our results indicated that pathogen prevalence and abundance were associated with both sampling date and beekeeping operation, that prevalence was highest in honey bee samples obtained immediately after almond pollination, and that weak colonies had a greater mean pathogen prevalence than strong colonies.

Combating Varroa destructor in Honeybee Colonies Using Flumethrin or Fluvalinate

Directory of Open Access Journals (Sweden)

A. Gregorc

2007-01-01

Full Text Available Mite mortality in two apiaries, one with 32 and the other with 15 honeybee (Apis mellifera carnica colonies, was recorded prior to and after flumethrin or fluvalinate treatments and after a control, oxalic-acid application. During the 42- and 51-day pre-treatment periods, the average daily natural mite drop was 0.04 (± 0.04 and 2.82 (± 2.19, respectively, which represents 1.09% (± 1.06 and 3.84% (± 3.04 of the total number of mites found during the experiment. The flumethrin or fluvalinate applications resulted in an average mite mortality at the two apiaries of 214.46 (± 260.02 and 4,098.64 (± 2,508.31. The treatments resulted in a 19.11% (± 14.62 and a 39.28% (± 10.47 reduction in the number of mites in slightly infested colonies and 94.30% (± 4.26 and 96.24% (± 3.14 in highly infested colonies. The difference in treatment efficacy between both apiaries was significant (P < 0.001 and indicates that fluvalinate and flumethrin are highly efficacious in dealing with highly infested honeybee colonies with sealed brood. The importance of effective mite control in colonies with a high level of natural mite mortality is discussed in this study.

Honey bees as indicators of radionuclide contamination: exploring colony variability and temporal contaminant accumulation

International Nuclear Information System (INIS)

Haarmann, T.K.

1997-01-01

Two aspects of using honey bees, Apis mellifera, as indicators of environmental radionuclide contamination were investigated: colony variability and temporal contaminant accumulation. Two separate field experiments were conducted in areas with bioavailable radionuclide contamination. Bees were collected from colonies, analysed for concentrations of radionuclides, and the results were compared using graphical and statistical methods. The first experiment indicates that generally a low variability exists between samples collected within the same colony. A higher variability exists between samples collected from adjacent colonies. Levels of tritium and sodium-22 found in samples taken from similar colonies were inconsistent, while levels of cobalt-57, cobalt-60 and manganese-54 were consistent. A second experiment investigated the accumulation of radionuclides over time by comparing colonies that had been in the study area for different periods of time. This experiment demonstrated that there is indeed a significant accumulation of radionuclides within colonies

Pathogenesis of varroosis at the level of the honey bee (Apis mellifera) colony.

Science.gov (United States)

Wegener, J; Ruhnke, H; Scheller, K; Mispagel, S; Knollmann, U; Kamp, G; Bienefeld, K

2016-01-01

The parasitic mite Varroa destructor, in interaction with different viruses, is the main cause of honey bee colony mortality in most parts of the world. Here we studied how effects of individual-level parasitization are reflected by the bee colony as a whole. We measured disease progression in an apiary of 24 hives with differing degree of mite infestation, and investigated its relationship to 28 biometrical, physiological and biochemical indicators. In early summer, when the most heavily infested colonies already showed reduced growth, an elevated ratio of brood to bees, as well as a strong presence of phenoloxidase/prophenoloxidase in hive bees were found to be predictors of the time of colony collapse. One month later, the learning performance of worker bees as well as the activity of glucose oxidase measured from head extracts were significantly linked to the timing of colony collapse. Colonies at the brink of collapse were characterized by reduced weight of winter bees and a strong increase in their relative body water content. Our data confirm the importance of the immune system, known from studies of individually-infested bees, for the pathogenesis of varroosis at colony level. However, they also show that single-bee effects cannot always be extrapolated to the colony as a whole. This fact, together with the prominent role of colony-level factors like the ratio between brood and bees for disease progression, stress the importance of the superorganismal dimension of Varroa research. Copyright © 2016 Elsevier Ltd. All rights reserved.

The legacy of empire: post-colonial immigrants in Western Europe

NARCIS (Netherlands)

van Amersfoort, H.

2008-01-01

In the literature regarding immigration and immigrants in the various West European states, the label post-colonial migration and/or post-colonial immigrants is regularly used. The use of such a general label suggests that there is a fundamental similarity between this kind of migrations setting it

Analysis of Colonial Currency

Science.gov (United States)

Kurkowski, Michael; Cangany, Catherine; Jordan, Louis; Manukyan, Khachatur; Schultz, Zachary; Wiescher, Michael

2017-09-01

This project entailed studying the cellulose in paper, the ink, colorants, and other materials used to produce American colonial currency. The technique primarily used in this project was X-Ray Fluorescence Spectroscopy (XRF). XRF mapping was used to provide both elemental analysis of large-scale objects as well as microscopic examination of individual pigment particles in ink, in addition to the inorganic additives used to prepare paper. The combination of elemental mapping with Fourier Transform Infrared (FTIR) and Raman Spectroscopies permits an efficient analysis of the currency. These spectroscopic methods help identify the molecular composition of the pigments. This combination of atomic and molecular analytical techniques provided an in-depth characterization of the paper currency on the macro, micro, and molecular levels. We have identified several of pigments that were used in the preparation of inks and colorants. Also, different inorganic crystals, such as alumina-silicates, have been detected in different papers. The FTIR spectroscopy allowed us to determine the type of cellulose fiber used in the production of paper currency. Our future research will be directed toward revealing important historical relationships between currencies printed throughout the colonies. ISLA Da Vinci Grant.

A Generalized Ant Colony Algorithm for Job一shop Scheduling Problem

Directory of Open Access Journals (Sweden)

ZHANG Hong-Guo

2017-02-01

Full Text Available Aiming at the problem of ant colony algorithm for solving Job一shop scheduling problem. Considering the complexity of the algorithm that uses disjunctive graph to describe the relationship between workpiece processing. To solve the problem of optimal solution，a generalized ant colony algorithm is proposed. Under the premise of considering constrained relationship between equipment and process，the pheromone update mechanism is applied to solve Job-shop scheduling problem，so as to improve the quality of the solution. In order to improve the search efficiency，according to the state transition rules of ant colony algorithm，this paper makes a detailed study on the selection and improvement of the parameters in the algorithm，and designs the pheromone update strategy. Experimental results show that a generalized ant colony algorithm is more feasible and more effective. Compared with other algorithms in the literature，the results prove that the algorithm improves in computing the optimal solution and convergence speed.

Colonial adventures in tropical agriculture

NARCIS (Netherlands)

Buelens, Frans; Frankema, Ewout

2016-01-01

How profitable were foreign investments in plantation agriculture in the Netherlands Indies during the late colonial era? We use a new dataset of monthly quoted stock prices and dividends of international companies at the Brussels stock exchange to estimate the returns to investment in tropical

Education of the Peasantry in Zimbabwe as Internal Colonialism

Directory of Open Access Journals (Sweden)

Munyaradzi Hwami

2014-05-01

Full Text Available This article utilizes internal colonial analyses to explore and understand the difficult educational conditions students from peasantry background experience in Zimbabwe’s universities. The article proposes that the subordinate position and related educational experiences of peasantry students since the year 2000 are exploitative and to the advantage of the elite to such an extent that peasants are an internal colony. The analysis is informed by critical anti-colonial perspectives that observe the hegemonic tendencies of global and local capital in collusion with dictatorial elite nationalists. By use of a critical interpretive case study of purposefully sampled students and other relevant members of the university community from one public university, disturbing student experiences were excavated. Student narratives and experiences were analyzed using the constant comparative method and led to the conclusion that there is internal colonialism in Zimbabwe where an alliance of the state and the local and global corporate world are colluding to maintain their economic and political dominance. The article challenges those in education and academics that there is need for the decolonization of education by first identifying contemporary hegemonic forces and recognizing students from the peasantry as victims of the emerging kleptocratic capitalism.

Honeybee Colony Vibrational Measurements to Highlight the Brood Cycle.

Directory of Open Access Journals (Sweden)

Martin Bencsik

Full Text Available Insect pollination is of great importance to crop production worldwide and honey bees are amongst its chief facilitators. Because of the decline of managed colonies, the use of sensor technology is growing in popularity and it is of interest to develop new methods which can more accurately and less invasively assess honey bee colony status. Our approach is to use accelerometers to measure vibrations in order to provide information on colony activity and development. The accelerometers provide amplitude and frequency information which is recorded every three minutes and analysed for night time only. Vibrational data were validated by comparison to visual inspection data, particularly the brood development. We show a strong correlation between vibrational amplitude data and the brood cycle in the vicinity of the sensor. We have further explored the minimum data that is required, when frequency information is also included, to accurately predict the current point in the brood cycle. Such a technique should enable beekeepers to reduce the frequency with which visual inspections are required, reducing the stress this places on the colony and saving the beekeeper time.

Lessons in modularity: the evolutionary ecology of colonial invertebrates