A hanging drop culture method to study terminal erythroid differentiation.
Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak
2005-10-01
To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.
THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA
DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
1994-01-01
Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using
International Nuclear Information System (INIS)
Porter, P.N.; Ogawa, M.
1982-01-01
Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture
International Nuclear Information System (INIS)
Kreja, Ludwika; Baltschukat, Klaus; Nothdurft, Wilhelm
1989-01-01
The radiosensitivity of the early erythroid progenitor cells (BFU-E) and the progenitor cells of the stroma (CFU-F) in canine bone marrow was studied under steady-state conditions by in vitro irradiation with 280 kV X-rays. The dose-effect relationship for colony formation was determined for BFU-E obtained from the iliac crest marrow, and for CFU-F in bone marrow collected from the iliac crest and the humerus of adult beagles. The BFU-E were adequately stimulated with serum from lethally irradiated dogs to obtain a source of BPA (burst-promoting activity). The BFU-E proved to be extremely radiosensitive, (the survival curve was exponential (D o 15.3 ± 1.8 cGY)). Buffy-coat leukocytes separated from bone marrow leukocytes obtained by aspiration were an optimum source of CFU-F. A curve was fitted to data obtained for CFU-F obtained from iliac crest or humerus, resulting in D o = 241 ± 38 cGY and an extrapolation number n = 1.38 ± 0.62 or D o = 261 ± 40 cGY and n = 1.04 ± 0.42, respectively. (author)
Reduction of erythroid progenitors in protein-energy malnutrition.
Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio
2007-02-01
Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.
Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming
2017-05-01
Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.
DEFF Research Database (Denmark)
Järås, Marcus; Johnels, Petra; Agerstam, Helena
2009-01-01
OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...
International Nuclear Information System (INIS)
Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.
1991-01-01
These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase
Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T
1987-02-01
The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.
Erythropoiesis in the aged mouse. I. Response to stimulation in vivo
International Nuclear Information System (INIS)
Udupa, K.B.; Lipschitz, D.A.
1984-01-01
Changes in erythropoiesis with age were studied by examining the hematocrit increase in response to hypoxia in aged mice and by assessing the change in erythropoiesis following the injection of erythropoietin in young and old polycythemic mice. The increase in hematocrit after exposure to hypoxia was more variable and generally lower in old mice than in young mice. When erythropoietin was injected into polycythemic animals, the increase in differentiated erythroid cells and 59 Fe incorporation into erythroid marrow and peripheral blood cells was significantly lower in old mice than in young mice. In contrast to differentiated erythroid cells, there was less evidence of a reduced response to simulation of the more primitive erythroid progenitor cells of aged animals. The early undifferentiated erythroid progenitor, burst-forming units, did not decrease when either young or aged mice were made polycythemic, and no change following erythropoietin injection was noted. Polycythemia suppressed the late-differentiated erythroid progenitor, erythroid colony-forming units, to a greater extent in aged animals, but when erythropoietin was injected, the percent increase over the subsequent 24 hours was identical to that in young mice. These observations indicate a reduced erythropoietic capacity with age, the abnormality being most obvious in the more mature erythroid precursors
Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.
Directory of Open Access Journals (Sweden)
Abigail A Lamikanra
2009-12-01
Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that
International Nuclear Information System (INIS)
Mutzl, J.
1978-01-01
This burst protection device controls forces to be expected in an accident by resolving them into axial (vertical) and radial (horizontal) components, which are taken by a large number of elements stressed in tension. The steam raising unit is surrounded by a containment, but remains easily accessible. The containment consists of a steel jacket, lid and floor. Several cylindrical sections above one another form the steel jacket, which surrounds the steam raising unit with an intermediate insulating layer of concrete. The insulating concrete cylinder is of several times the thickness of the steel jacket, and also consists of cylindrical sections. An outer supporting ring for the lid and floor of the containment have outside diameters which project beyond the jacket. Prestressed circumferential vertical tension ropes between the supporting ring and floor take any additional tensional forces. The lid is domed with downward curvature towards the upper boiler dome. Internal bursting forces produce compressive stresses in the lid, which thus pass along its outside diameter into the surrounding ring. The lid, which is devided along one diameter, makes dismantling and access to the boiler easy even with a central steam pipe going upwards. The floor of the burst protection is also the floor of the steam raising unit. It is of several times the thickness of the tube floor, which, with its spacing above the floor forms the usual inlet and outlet space for the reactor cooling water. The main coolant pump installed there is driven by an external motor through a floor penetration. (HP) [de
Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.
2010-01-01
Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494
Eskola, M; Bäckman, S; Möttönen, S; Kekomäki, R
2015-04-01
Total colony-forming cells from thawed cord blood units (CBUs) include megakaryocytic colony-forming units (CFU-Mks), which survive the freezing process. The aim of this study was to evaluate whether different megakaryocytic progenitors from unseparated CBUs survive the freezing process and a short-term liquid culture. Thawed samples of CBUs were cultured in liquid medium. During the cultures, serial samples were drawn to assess the growth of different megakaryocytic progenitors in a semisolid collagen medium with identical cytokines as in the liquid medium. Megakaryocytic cells were detected using immunohistochemistry and flow cytometry. In suspension culture, the megakaryocytic progenitors almost completely lost the ability to generate large (burst-forming unit-like, BFU-like) megakaryocytic colonies in semisolid cultures (large colonies, median count per chamber d0: 7.25 vs. d7: 1.5; P culture in suspension resulted in the decline of small colonies as well (d7: 16.0 vs. d14: 5.75; P = 0.0088). Total CFU-Mk count declined from 23.3 (range 12.5-34.0) at d0 to 7.25 (range 1.0-13.5) at d14 (P culture after a short suspension culture. Small CFU-Mks were observed throughout the cultures. It may be that the BFU-Mk colonies matured and acquired CFU-Mk behaviour. © 2014 International Society of Blood Transfusion.
International Nuclear Information System (INIS)
Kreja, L.; Weinsheimer, W.; Nothdurft, W.
1991-01-01
The in vitro radiation response to 280-kV x-rays (does rate 72 cGy/min) of multipotent hemopoietic progenitor cells, mixed colony-forming units (CFU-mix), from canine bone marrow was assayed and compared to the radiation response characteristics of early erythroid progenitors, erythroid burst-forming units (BFU-E). To improve the colony-forming efficiency, the effect of various bone marrow cell separation techniques on colony formation of both progenitors was examined. The separation of bone marrow aspirates by discontinuous buoyant gradient centrifugation using the lymphocyte separation medium Lymphoprep with a density of 1.070 g/ml allowed the establishment of reproducible survival curves. The survival curves for both progenitors were strictly exponential, and CFU-mix were found to be more radiosensitive (D0 = 12 ± 2 cGy) than BFU-E (D0 = 16 ± 2 cGy)
Riley, Zachary A; Terry, Mary E; Mendez-Villanueva, Alberto; Litsey, Jane C; Enoka, Roger M
2008-06-01
Bursts of activity in the surface electromyogram (EMG) during a sustained contraction have been interpreted as corresponding to the transient recruitment of motor units, but this association has never been confirmed. The current study compared the timing of trains of action potentials discharged by single motor units during a sustained contraction with the bursts of activity detected in the surface EMG signal. The 20 motor units from 6 subjects [recruitment threshold, 35.3 +/- 11.3% maximal voluntary contraction (MVC) force] that were detected with fine wire electrodes discharged 2-9 trains of action potentials (7.2 +/- 5.6 s in duration) when recruited during a contraction that was sustained at a force below its recruitment threshold (target force, 25.4 +/- 10.6% MVC force). High-pass filtering the bipolar surface EMG signal improved its correlation with the single motor unit signal. An algorithm applied to the surface EMG was able to detect 75% of the trains of motor unit action potentials. The results indicate that bursts of activity in the surface EMG during a constant-force contraction correspond to the transient recruitment of higher-threshold motor units in healthy individuals, and these results could assist in the diagnosis and design of treatment in individuals who demonstrate deficits in motor unit activation.
Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.
Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A
2004-10-01
A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.
Study on cosmic gamma bursts in the ''KONUS'' experiment
International Nuclear Information System (INIS)
Mazets, E.P.; Golenetskij, S.V.; Il'inskij, V.N.; Panov, V.N.; Aptekar', R.L.; Gur'yan, Yu.A.; Sokolov, I.A.; Sokolova, Z.Ya.; Kharitonova, T.V.
1979-01-01
Made are the investigations of cosmic gamma bursts with the help of the ''Konus'' apparatus, positioned on the ''Venera 11'' and ''Venera 12'' automatic interplanetary stations. 37 gamma bursts have been recorded in the energy range from 50 to 150 keV during the observation period from September to December 1978. Time profiles of bursts on 4, 9 and 24.11.1978 are presented. For the most events the time of burst increase and decrease constitute parts and units of seconds. Differential energy spectra are measured for all recorded bursts. In many cases the spectrum shape is similar to the grade one with the 1.5-2.3 index. In a graphical form built up are the integral distributions of gamma bursts appearence frequency in dependence on their intensity and maximum capacity in the burst peak. Galaxy coordinates of the 17-teen bursts, for which a simple localization is possible, are put on the celestial sphere map. The type of the integral distributions and the source distribution about the celestial sphere show that the gamma burst sources are whithin the Galaxy
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
International Nuclear Information System (INIS)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun
2012-01-01
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2012-11-15
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice
International Nuclear Information System (INIS)
Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.
1981-01-01
The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)
Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation
International Nuclear Information System (INIS)
Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella
2010-01-01
Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment
Directory of Open Access Journals (Sweden)
Ruth Merkle
2016-08-01
Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in
Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit
2015-01-01
We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632
Studies of globin gene expression in differentiating erythroid cells
International Nuclear Information System (INIS)
Sullivan, T.D.
1985-01-01
The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation
Methane bursts as a trigger for intermittent lake-forming climates on post-Noachian Mars
Kite, Edwin S.; Gao, Peter; Goldblatt, Colin; Mischna, Michael A.; Mayer, David P.; Yung, Yuk L.
2017-10-01
Lakes existed on Mars later than 3.6 billion years ago, according to sedimentary evidence for deltaic deposition. The observed fluviolacustrine deposits suggest that individual lake-forming climates persisted for at least several thousand years (assuming dilute flow). But the lake watersheds’ little-weathered soils indicate a largely dry climate history, with intermittent runoff events. Here we show that these observational constraints, although inconsistent with many previously proposed triggers for lake-forming climates, are consistent with a methane burst scenario. In this scenario, chaotic transitions in mean obliquity drive latitudinal shifts in temperature and ice loading that destabilize methane clathrate. Using numerical simulations, we find that outgassed methane can build up to atmospheric levels sufficient for lake-forming climates, if methane clathrate initially occupies more than 4% of the total volume in which it is thermodynamically stable. Such occupancy fractions are consistent with methane production by water-rock reactions due to hydrothermal circulation on early Mars. We further estimate that photochemical destruction of atmospheric methane curtails the duration of individual lake-forming climates to less than a million years, consistent with observations. We conclude that methane bursts represent a potential pathway for intermittent excursions to a warm, wet climate state on early Mars.
King, Andrew
2007-05-15
I consider various possibilities for making gamma-ray bursts, particularly from close binaries. In addition to the much-studied neutron star+neutron star and black hole+neutron star cases usually considered good candidates for short-duration bursts, there are also other possibilities. In particular, neutron star+massive white dwarf has several desirable features. These systems are likely to produce long-duration gamma-ray bursts (GRBs), in some cases definitely without an accompanying supernova, as observed recently. This class of burst would have a strong correlation with star formation and occur close to the host galaxy. However, rare members of the class need not be near star-forming regions and could have any type of host galaxy. Thus, a long-duration burst far from any star-forming region would also be a signature of this class. Estimates based on the existence of a known progenitor suggest that this type of GRB may be quite common, in agreement with the fact that the absence of a supernova can only be established in nearby bursts.
Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F
2018-06-15
In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.
Rio, B; Parent-Massin, D; Lautraite, S; Hoellinger, H
1997-02-01
The diphenyl-ether herbicides exert their phytotoxic activity by preventing chlorophyll formation in plants as a result of inhibition of protoporphyrinogen oxidase. This enzyme is the last step of the common pathway for chlorophyll and haem biosynthesis. The aim of this work is to determine whether herbicide inhibitors of plant protoporphyrinogen oxidase could act on the human protoporphyrinogen oxidase involved in haemoglobin synthesis and cause heamatologic diseases. Human erythroblastic progenitors (BFU-E/CFU-E: Burst Forming Unit-Erythroid and Colony Forming Unit-Erythroid) were exposed to oxyfluorfen, a diphenyl-ether herbicide in the presence of erythropoietin, and the haematoxicity evaluated in vitro by scoring the development of BFU-E/CFU-E colonies after 7 and 14 days of culture. The toxic effect on differentiation has been evaluated using four criteria: morphology, total protein, total porphyrin, and haemoglobin content. The study of BFU-E/CFU-E proliferation and differentiation showed a cytotoxic effect of oxyfluorfen only at very high concentrations. In contrast, haemoglobin synthesis can be inhibited by concentration of oxyfluorfen (10(-4) M) that have no adverse effect on cellular proliferation.
A study of the temporal and spectral characteristics of gamma ray bursts
International Nuclear Information System (INIS)
Norris, J.
1983-05-01
Gamma-ray burst data obtained from the ISEE-3 Gamma Ray Burst Spectrometer and the Solar Maximum Mission's Hard X-ray Burst Spectrometer (HXRBS) were analyzed to yield information on burst temporal and spectral characteristics. A Monte Carlo approach was used to simulate the HXRBS response to candidate spectral models. At energies above about 100 keV, the spectra are well fit by exponential forms. At lower energies, 30 keV to 60 keV, depressions below the model continua are apparent in some bursts. The depressions are not instrumental or data-reduction artifacts. The event selection criterion of the ISEE-3 experiment is based on the time to accumulate a present number of photons rather than the photon count per unit time and is consequently independent of event duration for a given burst intensity, unlike most conventional systems. As a result, a significantly greater percentage of fast, narrow events have been detected. The ratio of count rates from two ISEE-3 detectors indicates that bursts with durations or aprox. one second have much softer spectra than longer bursts
Acute erythroid neoplastic proliferations. A biological study based on 62 patients.
Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad
2002-02-01
The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was
Burst suppression probability algorithms: state-space methods for tracking EEG burst suppression
Chemali, Jessica; Ching, ShiNung; Purdon, Patrick L.; Solt, Ken; Brown, Emery N.
2013-10-01
Objective. Burst suppression is an electroencephalogram pattern in which bursts of electrical activity alternate with an isoelectric state. This pattern is commonly seen in states of severely reduced brain activity such as profound general anesthesia, anoxic brain injuries, hypothermia and certain developmental disorders. Devising accurate, reliable ways to quantify burst suppression is an important clinical and research problem. Although thresholding and segmentation algorithms readily identify burst suppression periods, analysis algorithms require long intervals of data to characterize burst suppression at a given time and provide no framework for statistical inference. Approach. We introduce the concept of the burst suppression probability (BSP) to define the brain's instantaneous propensity of being in the suppressed state. To conduct dynamic analyses of burst suppression we propose a state-space model in which the observation process is a binomial model and the state equation is a Gaussian random walk. We estimate the model using an approximate expectation maximization algorithm and illustrate its application in the analysis of rodent burst suppression recordings under general anesthesia and a patient during induction of controlled hypothermia. Main result. The BSP algorithms track burst suppression on a second-to-second time scale, and make possible formal statistical comparisons of burst suppression at different times. Significance. The state-space approach suggests a principled and informative way to analyze burst suppression that can be used to monitor, and eventually to control, the brain states of patients in the operating room and in the intensive care unit.
Erythroid cells in vitro: from developmental biology to blood transfusion products.
Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni
2009-07-01
Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.
TMEM14C is required for erythroid mitochondrial heme metabolism.
Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H
2014-10-01
The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.
International Nuclear Information System (INIS)
Kato, Kengo; Kashiwakura, Ikuo; Kuwabara, Mikinori
2011-01-01
To investigate the importance of gender and aging on the individual radiosensitivity of lineage-committed myeloid hematopoietic stem/progenitor cells (HSPCs) detected in mononuclear cells (MNCs) of steady-state human peripheral blood (PB), the clonogenic survival of HPCs, including colony-forming unit-granulocyte macrophage; burst-forming unit-erythroid; colony-forming unit-granulocyte-erythroid-macrophage-megakaryocyte cells derived from MNCs exposed to 0.5 Gy and 2 Gy X-irradiation were estimated. MNCs were prepared from the buffy-coats of 59 healthy individual blood donors. The results showed that large individual differences exist in the number of HSPCs, as well as in the surviving fraction of cells. Furthermore, the number of progenitor cells strongly correlated with their surviving fraction, suggesting that the radiosensitivity of hematopoietic progenitor cells decreases with the number of cells in the 10 5 cells population. A statistically significant negative correlation was observed between the surviving fraction observed at a dose of 0.5 Gy and the age of an individual, however, none of these correlations were observed after 2 Gy irradiation. No statistically significant difference was observed in individual radiosensitivity between males and females at either radiation dose. The present results indicated a correlation between the individual responsiveness of HSPCs to ionizing irradiation, especially to low dose irradiation, and aging. (author)
International Nuclear Information System (INIS)
Yamaguchi, Masaru; Ebina, Satoko; Kashiwakura, Ikuo
2013-01-01
Arterial cord blood (CB) acid-base status and gas values, such as pH, PCO 2 , PO 2 , HCO 3 - and base excess, provide useful information on the fetal and neonatal condition. However, it remains unknown whether these values affect the radiosensitivity of fetal/neonatal hematopoiesis. The present study evaluated the relationship between arterial CB acid-base status, gas values, and the radiosensitivity of CB hematopoietic stem/progenitor cells (HSPCs). A total of 25 CB units were collected. The arterial CB acid-base status and gas values were measured within 30 min of delivery. The CD34 + HSPCs obtained from CB were exposed to 2 Gy X-irradiation, and then assayed for colony-forming unit-granulocyte-macrophage, burst-forming unit-erythroid (BFU-E), and colony-forming unit-granulocyte erythroid, macrophage and megakaryocyte cells. Acid-base status and gas values for PCO 2 and HCO 3 - showed a statistically significant negative correlation with the surviving fraction of BFU-E. In addition, a significant positive correlation was observed between gestational age and PCO 2 . Moreover, the surviving fraction of BFU-E showed a significant negative correlation with gestational age. Thus, HSPCs obtained from CB with high PCO 2 /HCO 3 - levels were sensitive to X-irradiation, which suggests that the status of arterial PCO 2 /HCO 3 - influences the radiosensitivity of fetal/neonatal hematopoiesis, especially erythropoiesis. (author)
Energy Technology Data Exchange (ETDEWEB)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.
International Nuclear Information System (INIS)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-01-01
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation
Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.
Directory of Open Access Journals (Sweden)
Shlomi Toobiak
Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.
Enhancement of erythroid colony growth in culture by hemin
International Nuclear Information System (INIS)
Porter, P.N.; Meints, R.H.; Mesner, K.
1979-01-01
Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells
International Nuclear Information System (INIS)
Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)
Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells
Energy Technology Data Exchange (ETDEWEB)
Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna
2017-01-01
are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark
Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu
2018-04-01
During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.
Stimulus induced bursts in severe postanoxic encephalopathy.
Tjepkema-Cloostermans, Marleen C; Wijers, Elisabeth T; van Putten, Michel J A M
2016-11-01
To report on a distinct effect of auditory and sensory stimuli on the EEG in comatose patients with severe postanoxic encephalopathy. In two comatose patients admitted to the Intensive Care Unit (ICU) with severe postanoxic encephalopathy and burst-suppression EEG, we studied the effect of external stimuli (sound and touch) on the occurrence of bursts. In patient A bursts could be induced by either auditory or sensory stimuli. In patient B bursts could only be induced by touching different facial regions (forehead, nose and chin). When stimuli were presented with relatively long intervals, bursts persistently followed the stimuli, while stimuli with short intervals (encephalopathy can be induced by external stimuli, resulting in stimulus-dependent burst-suppression. Stimulus induced bursts should not be interpreted as prognostic favourable EEG reactivity. Copyright © 2016 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Urnov, A.M.
1980-01-01
In the popular form the consideration is given to the modern state tasks and results of X-ray spectrometry of solar bursts. The operation of X-ray spectroheliograph is described. Results of spectral and polarization measurings of X-ray radiation of one powerful solar burst are presented. The conclusion has been drawn that in the process of burst development three characteristic stages may be distingwished: 1) the initial phase; just in this period processes which lead to observed consequences-electromagnetic and corpuscular radiation are born; 2) the impulse phase, or the phase of maximum, is characterised by sharp increase of radiation flux. During this phase the main energy content emanates and some volumes of plasma warm up to high temperatures; 3) the phase of burst damping, during which plasma cools and reverts to the initial condition
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria
2017-10-20
The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.
Bmi-1 Regulates Extensive Erythroid Self-Renewal
Directory of Open Access Journals (Sweden)
Ah Ram Kim
2015-06-01
Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.
International Nuclear Information System (INIS)
Watanabe, T.; Oishi, M.
1987-01-01
A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed
PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.
Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C
2017-05-01
Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.
Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S
2012-01-01
Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited
Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A
1998-06-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and
Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun
1998-01-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited
Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.
Directory of Open Access Journals (Sweden)
Eyayu Belay
Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.
Stanislavsky, A.; Volvach, Ya.; Konovalenko, A.; Koval, A.
2017-08-01
In this paper a new sight on the study of solar bursts historically called drift pairs (DPs) is presented. Having a simple morphology on dynamic spectra of radio records (two short components separated in time, and often they are very similar) and discovered at the dawn of radio astronomy, their features remain unexplained totally up to now. Generally, the DPs are observed during the solar storms of type III bursts, but not every storm of type III bursts is linked with DPs. Detected by ground-based instruments at decameter and meter wavelengths, the DP bursts are limited in frequency bandwidth. They can drift from high frequencies to low ones and vice versa. Their frequency drift rate may be both lower and higher than typical rates of type III bursts at the same frequency range. The development of low-frequency radio telescopes and data processing provide additional possibilities in the research. In this context the fresh analysis of DPs, made from recent observations in the summer campaign of 2015, are just considered. Their study was implemented by updated tools of the UTR-2 radio telescope at 9-33 MHz. During 10-12 July of 2015, DPs forming the longest patterns on dynamic spectra are about 7% of the total number of recorded DPs. Their marvelous resemblance in frequency drift rates with the solar S-bursts is discussed.
Survey and evaluation of mutations in the human KLF1 transcription unit.
Gnanapragasam, Merlin Nithya; Crispino, John D; Ali, Abdullah M; Weinberg, Rona; Hoffman, Ronald; Raza, Azra; Bieker, James J
2018-04-26
Erythroid Krüppel-like Factor (EKLF/KLF1) is an erythroid-enriched transcription factor that plays a global role in all aspects of erythropoiesis, including cell cycle control and differentiation. We queried whether its mutation might play a role in red cell malignancies by genomic sequencing of the KLF1 transcription unit in cell lines, erythroid neoplasms, dysplastic disorders, and leukemia. In addition, we queried published databases from a number of varied sources. In all cases we only found changes in commonly notated SNPs. Our results suggest that if there are mutations in KLF1 associated with erythroid malignancies, they are exceedingly rare.
Bursts from the very early universe
International Nuclear Information System (INIS)
Silk, J.; Stodolsky, L.
2006-01-01
Bursts of weakly interacting particles such as neutrinos or even more weakly interacting particles such as wimps and gravitons from the very early universe would offer a much deeper 'look back time' to early epochs than is possible with photons. We consider some of the issues related to the existence of such bursts and their detectability. Characterizing the burst rate by a probability P per Hubble four-volume we find, for events in the radiation-dominated era, that the natural unit of description is the present intensity of the CMB times P. The existence of such bursts would make the observation of phenomena associated with very early times in cosmology at least conceptually possible. One might even hope to probe the transplanckian epoch if complexes more weakly interacting than the graviton can exist. Other conceivable applications include the potential detectability of the formation of 'pocket universes' in a multiverse
Directory of Open Access Journals (Sweden)
Ryo Kurita
Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.
Bursts from the very early universe
Energy Technology Data Exchange (ETDEWEB)
Silk, J. [Department of Physics, University of Oxford, Oxford OX1 3RH (United Kingdom); Stodolsky, L. [Max-Planck-Institut fuer Physik, Foehringer Ring 6, 80805 Munich (Germany)]. E-mail: les@mppmu.mpg.de
2006-07-27
Bursts of weakly interacting particles such as neutrinos or even more weakly interacting particles such as wimps and gravitons from the very early universe would offer a much deeper 'look back time' to early epochs than is possible with photons. We consider some of the issues related to the existence of such bursts and their detectability. Characterizing the burst rate by a probability P per Hubble four-volume we find, for events in the radiation-dominated era, that the natural unit of description is the present intensity of the CMB times P. The existence of such bursts would make the observation of pheno associated with very early times in cosmology at least conceptually possible. One might even hope to probe the transplanckian epoch if complexes more weakly interacting than the graviton can exist. Other conceivable applications include the potential detectability of the formation of 'pocket universes' in a multiverse.
Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu
2012-08-01
Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
A New Clue in the Mystery of Fast Radio Bursts
Kohler, Susanna
2017-06-01
The origin of the mysterious fast radio bursts has eluded us for more than a decade. With the help of a particularly cooperative burst, however, scientists may finally be homing in on the answer to this puzzle.A Burst RepeatsThe host of FRB 121102 is placed in context in this Gemini image. [Gemini Observatory/AURA/NSF/NRC]More than 20 fast radio bursts rare and highly energetic millisecond-duration radio pulses have been observed since the first was discovered in 2007. FRB 121102, however, is unique in its behavior: its the only one of these bursts to repeat. The many flashes observed from FRB 121102 allowed us for the first time to follow up on the burst and hunt for its location.Earlier this year, this work led to the announcement that FRB 121102s host galaxy has been identified: a dwarf galaxy located at a redshift of z = 0.193 (roughly 3 billion light-years away). Now a team of scientists led by Cees Bassa (ASTRON, the Netherlands Institute for Radio Astronomy) has performed additional follow-up to learn more about this host and what might be causing the mysterious flashes.Hubble observation of the host galaxy. The object at the bottom right is a reference star. The blue ellipse marks the extended diffuse emission of the galaxy, the red circle marks the centroid of the star-forming knot, and the white cross denotes the location of FRB 121102 ad the associated persistent radio source. [Adapted from Bassa et al. 2017]Host ObservationsBassa and collaborators used the Hubble Space Telescope, the Spitzer Space Telecsope, and the Gemini North telecsope in Hawaii to obtain optical, near-infrared, and mid-infrared observations of FRB 121102s host galaxy.The authors determined that the galaxy is a dim, irregular, low-metallicity dwarf galaxy. Its resolved, revealing a bright star-forming region roughly 4,000 light-years across in the galaxys outskirts. Intriguingly, the persistent radio source associated with FRB 121102 falls directly within that star-forming knot
Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang
2017-07-01
Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.
Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice
Directory of Open Access Journals (Sweden)
Ibrahim Mansur
2016-01-01
Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.
Implications of fast radio bursts for superconducting cosmic strings
Energy Technology Data Exchange (ETDEWEB)
Yu, Yun-Wei [Institute of Astrophysics, Central China Normal University, 152 Luoyu Road, Wuhan 430079 (China); Cheng, Kwong-Sang [Department of Physics, The University of Hong Kong, Pokfulam Road, Hong Kong (China); Shiu, Gary; Tye, Henry, E-mail: yuyw@phy.ccnu.edu.cn, E-mail: hrspksc@hku.hk, E-mail: shiu@ust.hk, E-mail: iastye@ust.hk [Department of Physics and Institute for Advanced Study, The Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong (China)
2014-11-01
Highly beamed, short-duration electromagnetic bursts could be produced by superconducting cosmic string (SCS) loops oscillating in cosmic magnetic fields. We demonstrated that the basic characteristics of SCS bursts such as the electromagnetic frequency and the energy release could be consistently exhibited in the recently discovered fast radio bursts (FRBs). Moreover, it is first showed that the redshift distribution of the FRBs can also be well accounted for by the SCS burst model. Such agreements between the FRBs and SCS bursts suggest that the FRBs could originate from SCS bursts and thus they could provide an effective probe to study SCSs. The obtained values of model parameters indicate that the loops generating the FRBs have a small length scale and they are mostly formed in the radiation-dominated cosmological epoch.
Implications of fast radio bursts for superconducting cosmic strings
International Nuclear Information System (INIS)
Yu, Yun-Wei; Cheng, Kwong-Sang; Shiu, Gary; Tye, Henry
2014-01-01
Highly beamed, short-duration electromagnetic bursts could be produced by superconducting cosmic string (SCS) loops oscillating in cosmic magnetic fields. We demonstrated that the basic characteristics of SCS bursts such as the electromagnetic frequency and the energy release could be consistently exhibited in the recently discovered fast radio bursts (FRBs). Moreover, it is first showed that the redshift distribution of the FRBs can also be well accounted for by the SCS burst model. Such agreements between the FRBs and SCS bursts suggest that the FRBs could originate from SCS bursts and thus they could provide an effective probe to study SCSs. The obtained values of model parameters indicate that the loops generating the FRBs have a small length scale and they are mostly formed in the radiation-dominated cosmological epoch
Bursting of a bubble confined in between two plates
Murano, Mayuko; Kimono, Natsuki; Okumura, Ko
2015-11-01
Rupture of liquid thin films, driven by surface tension, has attracted interests of scientists for many years. It is also a daily phenomenon familiar to everyone in the form of the bursting of soap films. In recent years, many studies in confined geometries (e.g. in a Hele-Shaw cell) have revealed physical mechanisms of the dynamics of bubbles and drops. As for a liquid film sandwiched in between another liquid immiscible to the film liquid in the Hele-Shaw cell, it is reported that the thin film bursts at a constant speed and the speed depends on the viscosity of the surrounding liquid when the film is less viscous, although a rim is not formed at the bursting tip; this is because the circular symmetry of the hole in the bursting film is lost. Here, we study the bursting speed of a thin film sandwiched between air instead of the surrounding liquid in the Hele-Shaw cell to seek different scaling regimes. By measuring the bursting velocity and the film thickness of an air bubble with a high speed camera, we have found a new scaling law in viscous regime. This research was partly supported by ImPACT Program of Council for Science, Technology and Innovation (Cabinet Office, Government of Japan).
Discovery of the short gamma-ray burst GRB 050709.
Villasenor, J S; Lamb, D Q; Ricker, G R; Atteia, J-L; Kawai, N; Butler, N; Nakagawa, Y; Jernigan, J G; Boer, M; Crew, G B; Donaghy, T Q; Doty, J; Fenimore, E E; Galassi, M; Graziani, C; Hurley, K; Levine, A; Martel, F; Matsuoka, M; Olive, J-F; Prigozhin, G; Sakamoto, T; Shirasaki, Y; Suzuki, M; Tamagawa, T; Vanderspek, R; Woosley, S E; Yoshida, A; Braga, J; Manchanda, R; Pizzichini, G; Takagishi, K; Yamauchi, M
2005-10-06
Gamma-ray bursts (GRBs) fall into two classes: short-hard and long-soft bursts. The latter are now known to have X-ray and optical afterglows, to occur at cosmological distances in star-forming galaxies, and to be associated with the explosion of massive stars. In contrast, the distance scale, the energy scale and the progenitors of the short bursts have remained a mystery. Here we report the discovery of a short-hard burst whose accurate localization has led to follow-up observations that have identified the X-ray afterglow and (for the first time) the optical afterglow of a short-hard burst; this in turn led to the identification of the host galaxy of the burst as a late-type galaxy at z = 0.16 (ref. 10). These results show that at least some short-hard bursts occur at cosmological distances in the outskirts of galaxies, and are likely to be caused by the merging of compact binaries.
DEFF Research Database (Denmark)
Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio
2015-01-01
Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...
Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm
2015-01-01
Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.
Neutron stars as X-ray burst sources. II. Burst energy histograms and why they burst
International Nuclear Information System (INIS)
Baan, W.A.
1979-01-01
In this work we explore some of the implications of a model for X-ray burst sources where bursts are caused by Kruskal-Schwarzschild instabilities at the magnetopause of an accreting and rotating neutron star. A number of simplifying assumptions are made in order to test the model using observed burst-energy histograms for the rapid burster MXB 1730--335. The predicted histograms have a correct general shape, but it appears that other effects are important as well, and that mode competition, for instance, may suppress the histograms at high burst energies. An explanation is ventured for the enhancement in the histogram at the highest burst energies, which produces the bimodal shape in high accretion rate histograms. Quantitative criteria are given for deciding when accreting neutron stars are steady sources or burst sources, and these criteria are tested using the X-ray pulsars
The new intermediate long-bursting source XTE J1701-407
DEFF Research Database (Denmark)
Falanga, M.; Cumming, A.; Bozzo, E.
2009-01-01
functions with e-folding times of tau(1) = 40 +/- 3 s and tau(2) = 221 +/- 9 s. The bursts occurred at a persistent luminosity of L-per = 8.3 x 10(36) erg s(-1) (approximate to 2.2% of the Eddington luminosity). For the intermediate long-burst, the mass accretion rate per unit area onto the neutron star...
Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan
2015-12-01
Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.
The Fermi Gamma-ray Burst Monitor Instrument
International Nuclear Information System (INIS)
Bhat, P. N.; Briggs, M. S.; Connaughton, V.; Paciesas, W. S.; Preece, R. D.; Meegan, C. A.; Lichti, G. G.; Diehl, R.; Greiner, J.; Kienlin, A. von; Fishman, G. J.; Kouveliotou, C.; Kippen, R. M.
2009-01-01
The Fermi Gamma-ray Space Telescope launched on June 11, 2008 carries two experiments onboard--the Large Area Telescope (LAT) and the Gamma-ray Burst Monitor (GBM). The primary mission of the GBM instrument is to support the LAT in observing γ-ray bursts (GRBs) by providing low-energy measurements with high temporal and spectral resolution as well as rapid burst locations over a large field-of-view (≥8 sr). The GBM will complement the LAT measurements by observing GRBs in the energy range 8 keV to 40 MeV, the region of the spectral turnover in most GRBs. The GBM detector signals are processed by the onboard digital processing unit (DPU). We describe some of the hardware features of the DPU and its expected limitations during intense triggers.
Forming a constant density medium close to long gamma-ray burst
Marle, A.J.; Langer, N.; Achterberg, A; Garia-Segura, G.
2006-01-01
Aims. The progenitor stars of long Gamma-Ray Bursts (GRBs) are thought to be Wolf-Rayet stars, which generate a massive and energetic wind. Nevertheless, about 25 percent of all GRB afterglows light curves indicate a constant density medium close to the exploding star. We explore various ways to
Burst-suppression is reactive to photic stimulation in comatose children with acquired brain injury
DEFF Research Database (Denmark)
Nita, Dragos A.; Moldovan, Mihai; Sharma, Roy
2016-01-01
reactivity. We quantified reactivity by measuring the change in the burst ratio (fraction of time in burst) following photic stimulation. Results: Photic stimulation evoked bursts in all patients, resulting in a transient increase in the burst ratio, while the mean heart rate remained unchanged......Objective: Burst-suppression is an electroencephalographic pattern observed during coma. In individuals without known brain pathologies undergoing deep general anesthesia, somatosensory stimulation transiently increases the occurrence of bursts. We investigated the reactivity of burst......-suppression in children with acquired brain injury. Methods: Intensive care unit electroencephalographic monitoring recordings containing burst-suppression were obtained from 5 comatose children with acquired brain injury of various etiologies. Intermittent photic stimulation was performed at 1 Hz for 1 min to assess...
The role of tumor suppressor p15Ink4b in the regulation of hematopoietic progenitor cell fate
International Nuclear Information System (INIS)
Humeniuk, R; Rosu-Myles, M; Fares, J; Koller, R; Bies, J; Wolff, L
2013-01-01
Epigenetic silencing of the tumor suppressor gene p15Ink4b (CDKN2B) is a frequent event in blood disorders like acute myeloid leukemia and myelodysplastic syndromes. The molecular function of p15Ink4b in hematopoietic differentiation still remains to be elucidated. Our previous study demonstrated that loss of p15Ink4b in mice results in skewing of the differentiation pattern of the common myeloid progenitor towards the myeloid lineage. Here, we investigated a function of p15Ink4b tumor suppressor gene in driving erythroid lineage commitment in hematopoietic progenitors. It was found that p15Ink4b is expressed more highly in committed megakaryocyte–erythroid progenitors than granulocyte–macrophage progenitors. More importantly, mice lacking p15Ink4b have lower numbers of primitive red cell progenitors and a severely impaired response to 5-fluorouracil- and phenylhydrazine-induced hematopoietic stress. Introduction of p15Ink4b into multipotential progenitors produced changes at the molecular level, including activation of mitogen-activated protein kinase/extracellular signal-regulated kinase (MEK/ERK) signaling, increase GATA-1, erythropoietin receptor (EpoR) and decrease Pu1, GATA-2 expression. These changes rendered cells more permissive to erythroid commitment and less permissive to myeloid commitment, as demonstrated by an increase in early burst-forming unit-erythroid formation with concomitant decrease in myeloid colonies. Our results indicate that p15Ink4b functions in hematopoiesis, by maintaining proper lineage commitment of progenitors and assisting in rapid red blood cells replenishment following stress
Possible galactic origin of. gamma. -ray bursts
Energy Technology Data Exchange (ETDEWEB)
Manchanda, R K; Ramsden, D [Southampton Univ. (UK). Dept. of Physics
1977-03-31
It is stated that extragalactic models for the origin of non-solar ..gamma..-ray bursts include supernova bursts in remote galaxies, and the collapse of the cores of active stars, whilst galactic models are based on flare stars, thermonuclear explosions in neutron stars and the sudden accretion of cometary gas on to neutron stars. The acceptability of any of these models may be tested by the observed size spectrum of the ..gamma..-ray bursts. The extragalactic models predict a power law spectrum with number index -1.5, whilst for the galactic models the number index will be -1. Experimental data on ..gamma..-ray bursts is, however, still meagre, and so far only 44 confirmed events have been recorded by satellite-borne instruments. The number spectrum of the observed ..gamma..-ray bursts indicates that the observed distribution for events with an energy < 10/sup -4/ erg/cm/sup 2/ is flat; this makes the choice of any model completely arbitrary. An analysis of the observed ..gamma..-ray events is here presented that suggests very interesting possibilities for their origin. There appears to be a preferred mean energy for ..gamma..-ray bursts; some 90% of the recorded events show a mean energy between 5 x 10/sup -5/ and 5 x 10/sup -4/ erg/cm/sup 2/, contrary to the predicted characteristics of the number spectrum of various models. A remarkable similarity is found between the distribution of ..gamma..-ray bursts and that of supernova remnants, suggesting a genetic relationship between the two and the galactic origin of the ..gamma..-ray bursts, and the burst source could be identified with completely run down neutron stars, formed during supernova explosions.
DEFF Research Database (Denmark)
White, Mitchell R; Crouch, Erika; Vesona, Jenny
2005-01-01
of IAV with SP-D in vitro strongly increases neutrophil respiratory burst responses to the virus. Several factors are shown to modify this apparent proinflammatory effect of SP-D. Although multimeric forms of SP-D show dose-dependent augmentation of respiratory burst responses, trimeric, single-arm forms...... of IAV while reducing the respiratory burst response to virus....
High sensitivity neutron bursts detecting system
International Nuclear Information System (INIS)
Shyam, A.; Kaushik, T.C.; Srinivasan, M.; Kulkarni, L.V.
1993-01-01
Technique and instrumentation to detect multiplicity of fast neutrons, emitted in sharp bursts, has been developed. A bank of 16 BF 3 detectors, in an appropriate thermalising assembly, efficiency ∼ 16%, is used to detect neutron bursts. The output from this setup, through appropriate electronics, is divided into two paths. The first is directly connected to a computer controlled scalar. The second is connected to another similar scalar through a delay time unit (DTU). The DTU design is such that once it is triggered by a count pulse than it does not allow any counts to be recorded for a fixed dead time set at ∼ 100 μs. The difference in counts recorded directly and through DTU gives the total number of neutrons produced in bursts. This setup is being used to study lattice cracking, anomalous effects in solid deuterium systems and various reactor physics experiments. (author). 3 refs., 1 fig
Directory of Open Access Journals (Sweden)
Deepti Jain
2015-06-01
Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.
Recent achievements in the field of gamma-ray bursts
International Nuclear Information System (INIS)
Lu Tan; Dai Zigao
2001-01-01
Recent progresses in the field of gamma-ray bursts is briefly introduced. Gamma-ray bursts are the most energetic explosion since the Big Bang of the universe. Within a few tens of seconds, the energy released in gamma-ray bursts could be several hundred times larger than that released form the sun in its whole life (about 10 billion years). The authors will first briefly discuss the observational facts, based on which the authors will discuss the standard fireball model, the dynamical behavior and evolution of gamma-ray bursts and their afterglows. Then, various observational phenomena that contradict the standard model are given and the importance of these post-standard effects are pointed out. The questions related to the energy source of gamma-ray bursts are still unanswered, and other important questions also remain to be solved
A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review
Directory of Open Access Journals (Sweden)
Pablo Manresa
2017-12-01
Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.
Spike Bursts from an Excitable Optical System
Rios Leite, Jose R.; Rosero, Edison J.; Barbosa, Wendson A. S.; Tredicce, Jorge R.
Diode Lasers with double optical feedback are shown to present power drop spikes with statistical distribution controllable by the ratio of the two feedback times. The average time between spikes and the variance within long time series are studied. The system is shown to be excitable and present bursting of spikes created with specific feedback time ratios and strength. A rate equation model, extending the Lang-Kobayashi single feedback for semiconductor lasers proves to match the experimental observations. Potential applications to construct network to mimic neural systems having controlled bursting properties in each unit will be discussed. Brazilian Agency CNPQ.
MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B
Directory of Open Access Journals (Sweden)
Dongsheng Wang
2018-03-01
Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.
Limits of the memory coefficient in measuring correlated bursts
Jo, Hang-Hyun; Hiraoka, Takayuki
2018-03-01
Temporal inhomogeneities in event sequences of natural and social phenomena have been characterized in terms of interevent times and correlations between interevent times. The inhomogeneities of interevent times have been extensively studied, while the correlations between interevent times, often called correlated bursts, are far from being fully understood. For measuring the correlated bursts, two relevant approaches were suggested, i.e., memory coefficient and burst size distribution. Here a burst size denotes the number of events in a bursty train detected for a given time window. Empirical analyses have revealed that the larger memory coefficient tends to be associated with the heavier tail of the burst size distribution. In particular, empirical findings in human activities appear inconsistent, such that the memory coefficient is close to 0, while burst size distributions follow a power law. In order to comprehend these observations, by assuming the conditional independence between consecutive interevent times, we derive the analytical form of the memory coefficient as a function of parameters describing interevent time and burst size distributions. Our analytical result can explain the general tendency of the larger memory coefficient being associated with the heavier tail of burst size distribution. We also find that the apparently inconsistent observations in human activities are compatible with each other, indicating that the memory coefficient has limits to measure the correlated bursts.
Light Dawns on Dark Gamma-ray Bursts
2010-12-01
[1] Gamma-ray bursts lasting longer than two seconds are referred to as long bursts and those with a shorter duration are known as short bursts. Long bursts, which were observed in this study, are associated with the supernova explosions of massive young stars in star-forming galaxies. Short bursts are not well understood, but are thought to originate from the merger of two compact objects such as neutron stars. [2] The Gamma-Ray burst Optical and Near-infrared Detector (GROND) was designed and built at the Max-Planck Institute for Extraterrestrial Physics in collaboration with the Tautenburg Observatory, and has been fully operational since August 2007. [3] Other studies relating to dark gamma-ray bursts have been released. Early this year, astronomers used the Subaru Telescope to observe a single gamma-ray burst, from which they hypothesised that dark gamma-ray bursts may indeed be a separate sub-class that form through a different mechanism, such as the merger of binary stars. In another study published last year using the Keck Telescope, astronomers studied the host galaxies of 14 dark GRBs, and based on the derived low redshifts they infer dust as the likely mechanism to create the dark bursts. In the new work reported here, 39 GRBs were studied, including nearly 20 dark bursts, and it is the only study in which no prior assumptions have been made and the amount of dust has been directly measured. [4] Because the afterglow light of very distant bursts is redshifted due to the expansion of the Universe, the light that left the object was originally bluer than the light we detect when it gets to Earth. Since the reduction of light intensity by dust is greater for blue and ultraviolet light than for red, this means that the overall dimming effect of dust is greater for the more distant gamma-ray bursts. This is why GROND's ability to observe near-infrared radiation makes such a difference. More information This research is presented in a paper to appear in the
ARE ULTRA-LONG GAMMA-RAY BURSTS DIFFERENT?
Energy Technology Data Exchange (ETDEWEB)
Boër, M.; Gendre, B. [CNRS-ARTEMIS, Boulevard de l' Observatoire, CS 34229, 06304 Nice Cedex 4 (France); Stratta, G., E-mail: michel.boer@unice.fr [Università degli Studi di Urbino Carlo Bo, I-61029 Urbino (Italy)
2015-02-10
The discovery of a number of gamma-ray bursts (GRBs) with duration exceeding 1000 s has opened the debate on whether these bursts form a new class of sources, the so-called ultra-long GRBs, or if they are rather the tail of the distribution of the standard long GRB duration. Using the long GRB sample detected by Swift, we investigate the statistical properties of long GRBs and compare them with the ultra-long burst properties. We compute the burst duration of long GRBs using the start epoch of the so-called ''steep decay'' phase detected with Swift/XRT. We discuss also the differences observed in their spectral properties. We find that ultra-long GRBs are statistically different from the standard long GRBs with typical burst duration less than 100-500 s, for which a Wolf-Rayet star progenitor is usually invoked. Together with the presence of a thermal emission component we interpret this result as indication that the usual long GRB progenitor scenario cannot explain the extreme duration of ultra-long GRBs, their energetics, as well as the mass reservoir and size that can feed the central engine for such a long time.
International Nuclear Information System (INIS)
Yamagami, Takamasa
1985-01-01
Ballon experiments for searching gamma-ray burst were carried out by employing rotating-cross modulation collimators. From a very long observation of total 315 hours during 1975 to 1979, three gamma-ray intensity anomalies were observed which were speculated as a gamma-ray burst. As for the first gamma-ray intensity anomaly observed in 1975, the burst source could be located precisely but the source, heavenly body, could not be specified. Gamma-ray burst source estimation was made by analyzing distribution of burst source in the celestial sphere, burst size distribution, and burst peak. Using the above-mentioned data together with previously published ones, apparent inconsistency was found between the observed results and the adopted theory that the source was in the Galaxy, and this inconsistency was found due to the different time profiles of the burst observed with instruments of different efficiency. It was concluded by these analysis results that employment of logN - logP (relation between burst frequency and burst count) was better than that of logN - logS (burst size) in the examination of gamma-ray burst because the former was less uncertain than the latter. Analyzing the author's observed gamma-ray burst data and the related published data, it was clarified that the burst distribution was almost P -312 for the burst peak value larger than 10 -6 erg/cm 2 .sec. The author could indicate that the calculated celestial distribution of burst source was consistent with the observed results by the derivation using the logN - logP relationship and that the burst larger than 10 -6 erg/cm 2 .sec happens about one thousand times a year, about ten times of the previous value. (Takagi, S.)
Directory of Open Access Journals (Sweden)
Ikuta T
2013-12-01
Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to
Bifurcation structure of a model of bursting pancreatic cells
DEFF Research Database (Denmark)
Mosekilde, Erik; Lading, B.; Yanchuk, S.
2001-01-01
One- and two-dimensional bifurcation studies of a prototypic model of bursting oscillations in pancreatic P-cells reveal a squid-formed area of chaotic dynamics in the parameter plane, with period-doubling bifurcations on one side of the arms and saddle-node bifurcations on the other. The transit......One- and two-dimensional bifurcation studies of a prototypic model of bursting oscillations in pancreatic P-cells reveal a squid-formed area of chaotic dynamics in the parameter plane, with period-doubling bifurcations on one side of the arms and saddle-node bifurcations on the other....... The transition from this structure to the so-called period-adding structure is found to involve a subcritical period-doubling bifurcation and the emergence of type-III intermittency. The period-adding transition itself is not smooth but consists of a saddle-node bifurcation in which (n + 1)-spike bursting...
Polarimetry of the Fast Radio Burst Source FRB121102
Michilli, Daniele; Seymour, Andrew; Hessels, Jason W. T.; Spitler, Laura; Gajjar, Vishal; Archibald, Anne; Bower, Geoffrey C.; Chatterjee, Shami; Cordes, Jim; Gourdji, Kelly; Heald, George; Kaspi, Victoria; Law, Casey; Sobey, Charlotte
2018-01-01
Fast radio bursts (FRBs) are millisecond-duration radio flashes of presumably extragalactic origin. FRB121102 is the only FRB known to repeat and the only one with a precise localization. It is co-located with a persistent radio source inside a star-forming region in a dwarf galaxy at z=0.2. While the persistent source is compatible with either a low-luminosity accreting black hole or a very energetic nebula and supernova remnant, the source of the bursts is still a mystery. We present new bursts from FRB121102 detected at relatively high radio frequencies of ~5GHz. These observations allow us to investigate the polarization properties of the bursts, placing new constraints on the environment of FRB121102.
Swift pointing and gravitational-wave bursts from gamma-ray burst events
International Nuclear Information System (INIS)
Sutton, Patrick J; Finn, Lee Samuel; Krishnan, Badri
2003-01-01
The currently accepted model for gamma-ray burst phenomena involves the violent formation of a rapidly rotating solar-mass black hole. Gravitational waves should be associated with the black-hole formation, and their detection would permit this model to be tested. Even upper limits on the gravitational-wave strength associated with gamma-ray bursts could constrain the gamma-ray burst model. This requires joint observations of gamma-ray burst events with gravitational and gamma-ray detectors. Here we examine how the quality of an upper limit on the gravitational-wave strength associated with gamma-ray bursts depends on the relative orientation of the gamma-ray-burst and gravitational-wave detectors, and apply our results to the particular case of the Swift Burst-Alert Telescope (BAT) and the LIGO gravitational-wave detectors. A result of this investigation is a science-based 'figure of merit' that can be used, together with other mission constraints, to optimize the pointing of the Swift telescope for the detection of gravitational waves associated with gamma-ray bursts
Fine structure near the starting frequency of solar type III radio bursts
Energy Technology Data Exchange (ETDEWEB)
Benz, A.O.; Zlobec, P.; Jaeggi, M.
1982-06-01
We have systematically analyzed the period in time and frequency adjacent to the beginning of type III bursts digitally recorded at Bleien during the second half of 1980. A surprisingly high percentage (10%, possibly more than 20%) of the type III bursts show fine structure in the form of narrow-banded spikes of 0.05 s and less duration, which form clusters of relatively large bandwidth. These spikes are not totally polarized (contrary to claims in the literature) and they are uniformly distributed over the disk. Individual spikes often show highly variable polarization, which may even change sense. The average degree of polarization of the clouds has a wider distribution than that of the associated type III bursts, but generally the same sign. Spikes are considerably different from type I bursts.
Directory of Open Access Journals (Sweden)
Zita Garate
2015-12-01
Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.
Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.
Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali
2017-03-01
Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.
Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells
International Nuclear Information System (INIS)
Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.
1987-01-01
The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes
MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral
Short duration gamma ray bursts
Indian Academy of Sciences (India)
Observations have revealed that long bursts, with recorded afterglow, tend to reside in the star forming regions of normal galaxies. Moreover, GRB 980425 ... observer is negligible due to the special relativistic time dilation. However, because of deceleration, eventually Γ−1 > θj and thereafter, sideways expansion becomes.
Quantum key based burst confidentiality in optical burst switched networks.
Balamurugan, A M; Sivasubramanian, A
2014-01-01
The optical burst switching (OBS) is an emergent result to the technology concern that could achieve a feasible network in future. They are endowed with the ability to meet the bandwidth requirement of those applications that require intensive bandwidth. There are more domains opening up in the OBS that evidently shows their advantages and their capability to face the future network traffic. However, the concept of OBS is still far from perfection facing issues in case of security threat. The transfer of optical switching paradigm to optical burst switching faces serious downfall in the fields of burst aggregation, routing, authentication, dispute resolution, and quality of service (QoS). This paper deals with employing RC4 (stream cipher) to encrypt and decrypt bursts thereby ensuring the confidentiality of the burst. Although the use of AES algorithm has already been proposed for the same issue, by contrasting the two algorithms under the parameters of burst encryption and decryption time, end-to-end delay, it was found that RC4 provided better results. This paper looks to provide a better solution for the confidentiality of the burst in OBS networks.
Quantum Key Based Burst Confidentiality in Optical Burst Switched Networks
Directory of Open Access Journals (Sweden)
A. M. Balamurugan
2014-01-01
Full Text Available The optical burst switching (OBS is an emergent result to the technology concern that could achieve a feasible network in future. They are endowed with the ability to meet the bandwidth requirement of those applications that require intensive bandwidth. There are more domains opening up in the OBS that evidently shows their advantages and their capability to face the future network traffic. However, the concept of OBS is still far from perfection facing issues in case of security threat. The transfer of optical switching paradigm to optical burst switching faces serious downfall in the fields of burst aggregation, routing, authentication, dispute resolution, and quality of service (QoS. This paper deals with employing RC4 (stream cipher to encrypt and decrypt bursts thereby ensuring the confidentiality of the burst. Although the use of AES algorithm has already been proposed for the same issue, by contrasting the two algorithms under the parameters of burst encryption and decryption time, end-to-end delay, it was found that RC4 provided better results. This paper looks to provide a better solution for the confidentiality of the burst in OBS networks.
Directory of Open Access Journals (Sweden)
Laurie A Steiner
Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.
No supernovae detected in two long-duration gamma-ray bursts.
Watson, D; Fynbo, J P U; Thöne, C C; Sollerman, J
2007-05-15
There is strong evidence that long-duration gamma-ray bursts (GRBs) are produced during the collapse of a massive star. In the standard version of the collapsar model, a broad-lined and luminous Type Ic core-collapse supernova (SN) accompanies the GRB. This association has been confirmed in observations of several nearby GRBs. Recent observations show that some long-duration GRBs are different. No SN emission accompanied the long-duration GRBs 060505 and 060614 down to limits fainter than any known Type Ic SN and hundreds of times fainter than the archetypal SN 1998bw that accompanied GRB 980425. Multi-band observations of the early afterglows, as well as spectroscopy of the host galaxies, exclude the possibility of significant dust obscuration. Furthermore, the bursts originated in star-forming galaxies, and in the case of GRB 060505, the burst was localized to a compact star-forming knot in a spiral arm of its host galaxy. We find that the properties of the host galaxies, the long duration of the bursts and, in the case of GRB 060505, the location of the burst within its host, all imply a massive stellar origin. The absence of an SN to such deep limits therefore suggests a new phenomenological type of massive stellar death.
Fusion of ZMYND8 and RELA genes in acute erythroid leukemia
DEFF Research Database (Denmark)
Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim
2013-01-01
Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...
Spectra of gamma-ray bursts at high energies
International Nuclear Information System (INIS)
Matz, S.M.
1986-01-01
Between 1980 February and 1983 August the Gamma-Ray Spectrometer (GRS) on the Solar Maximum Mission satellite (SMM) observed 71 gamma-ray bursts. These events form a representative subset of the class of classical gamma-ray bursts. Since their discovery more than 15 years ago, hundreds of gamma-ray bursts have been detected; however, most observations have been limited to an energy range of roughly 30 keV-1 MeV. The large sensitive area and spectral range of the GRS allow, for the first time, an investigation of the high energy (>1 MeV) behavior of a substantial number of gamma-ray bursts. It is found that high-energy emission is seen in a large fraction of all events and that the data are consistent with all bursts emitting to at least 5 MeV with no cut-offs. Further, no burst spectrum measured by GRS has a clear high-energy cut-off. The high-energy emission can be a significant part of the total burst energy on the average about 30% of the observed energy above 30 keV is contained in the >1 MeV photons. The fact that the observations are consistent with the presence of high-energy emission in all events implies a limit on the preferential beaming of high-energy photons, from any mechanism. Single-photon pair-production in a strong magnetic field produces such beaming; assuming that the low-energy emission is isotropic, the data imply an upper limit of 1 x 10 12 G on the typical magnetic field at burst radiation sites
Parvovirus B19 integration into human CD36+ erythroid progenitor cells.
Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik
2017-11-01
The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P
2013-01-01
Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository
THE FERMI-GBM X-RAY BURST MONITOR: THERMONUCLEAR BURSTS FROM 4U 0614+09
International Nuclear Information System (INIS)
Linares, M.; Chakrabarty, D.; Connaughton, V.; Bhat, P. N.; Briggs, M. S.; Preece, R.; Jenke, P.; Kouveliotou, C.; Wilson-Hodge, C. A.; Van der Horst, A. J.; Camero-Arranz, A.; Finger, M.; Paciesas, W. S.; Beklen, E.; Von Kienlin, A.
2012-01-01
Thermonuclear bursts from slowly accreting neutron stars (NSs) have proven difficult to detect, yet they are potential probes of the thermal properties of the NS interior. During the first year of a systematic all-sky search for X-ray bursts using the Gamma-ray Burst Monitor aboard the Fermi Gamma-ray Space Telescope we have detected 15 thermonuclear bursts from the NS low-mass X-ray binary 4U 0614+09 when it was accreting at nearly 1% of the Eddington limit. We measured an average burst recurrence time of 12 ± 3 days (68% confidence interval) between 2010 March and 2011 March, classified all bursts as normal duration bursts and placed a lower limit on the recurrence time of long/intermediate bursts of 62 days (95% confidence level). We discuss how observations of thermonuclear bursts in the hard X-ray band compare to pointed soft X-ray observations and quantify such bandpass effects on measurements of burst radiated energy and duration. We put our results for 4U 0614+09 in the context of other bursters and briefly discuss the constraints on ignition models. Interestingly, we find that the burst energies in 4U 0614+09 are on average between those of normal duration bursts and those measured in long/intermediate bursts. Such a continuous distribution in burst energy provides a new observational link between normal and long/intermediate bursts. We suggest that the apparent bimodal distribution that defined normal and long/intermediate duration bursts during the last decade could be due to an observational bias toward detecting only the longest and most energetic bursts from slowly accreting NSs.
Fuzzy-Based Adaptive Hybrid Burst Assembly Technique for Optical Burst Switched Networks
Directory of Open Access Journals (Sweden)
Abubakar Muhammad Umaru
2014-01-01
Full Text Available The optical burst switching (OBS paradigm is perceived as an intermediate switching technology for future all-optical networks. Burst assembly that is the first process in OBS is the focus of this paper. In this paper, an intelligent hybrid burst assembly algorithm that is based on fuzzy logic is proposed. The new algorithm is evaluated against the traditional hybrid burst assembly algorithm and the fuzzy adaptive threshold (FAT burst assembly algorithm via simulation. Simulation results show that the proposed algorithm outperforms the hybrid and the FAT algorithms in terms of burst end-to-end delay, packet end-to-end delay, and packet loss ratio.
Burst protected nuclear reactor plant with PWR
International Nuclear Information System (INIS)
Harand, E.; Michel, E.
1978-01-01
In the PWR, several integrated components from the steam raising unit and the main coolant pump are grouped around the reactor pressure vessel in a multiloop circuit and in a vertical arrangement. For safety reasons all primary circuit components and pipelines are situated in burst protection covers. To reduce the area of the plant straight tube steam raising units with forced circulation are used as steam raising units. The boiler pumps are connected to the vertical tubes and to the pressure vessel via double pipelines made as twin chamber pipes. (DG) [de
Coronal mass ejections and solar radio bursts
International Nuclear Information System (INIS)
Kundu, M.R.
1990-01-01
The properties of coronal mass ejection (CME) events and their radio signatures are discussed. These signatures are mostly in the form of type II and type IV burst emissions. Although type II bursts are temporally associated with CMEs, it is shown that there is no spatial relationship between them. Type II's associated with CMEs have in most cases a different origin, and they are not piston-driven by CMEs. Moving type IV and type II bursts can be associated with slow CMEs with speeds as low as 200 km/s, contrary to the earlier belief that only CMEs with speeds >400 km/s are associated with radio bursts. A specific event has been discussed in which the CME and type IV burst has nearly the same speed and direction, but the type II burst location was behind the CME and its motion was transverse. The speed and motion of the type II burst strongly suggest that the type II shock was decoupled from the CME and was probably due to a flare behind the limb. Therefore only the type IV source could be directly associated with the slow CME. The electrons responsble for the type IV emission could be produced in the flare or in the type II and then become trapped in a plasmoid associated with the CME. The reconnected loop could then move outwards as in the usual palsmoid model. Alternatively, the type IV emission could be interpreted as due to electrons produced by acceleration in wave turbulence driven by currents in the shock front driven by the CME. The lower-hybrid model Lampe and Papadopoulos (1982), which operates at both fast and slow mode shocks, could be applied to this situation. (author). 31 refs., 12 figs
An origin for short gamma-ray bursts unassociated with current star formation.
Barthelmy, S D; Chincarini, G; Burrows, D N; Gehrels, N; Covino, S; Moretti, A; Romano, P; O'Brien, P T; Sarazin, C L; Kouveliotou, C; Goad, M; Vaughan, S; Tagliaferri, G; Zhang, B; Antonelli, L A; Campana, S; Cummings, J R; D'Avanzo, P; Davies, M B; Giommi, P; Grupe, D; Kaneko, Y; Kennea, J A; King, A; Kobayashi, S; Melandri, A; Meszaros, P; Nousek, J A; Patel, S; Sakamoto, T; Wijers, R A M J
2005-12-15
Two short (gamma-ray bursts (GRBs) have recently been localized and fading afterglow counterparts detected. The combination of these two results left unclear the nature of the host galaxies of the bursts, because one was a star-forming dwarf, while the other was probably an elliptical galaxy. Here we report the X-ray localization of a short burst (GRB 050724) with unusual gamma-ray and X-ray properties. The X-ray afterglow lies off the centre of an elliptical galaxy at a redshift of z = 0.258 (ref. 5), coincident with the position determined by ground-based optical and radio observations. The low level of star formation typical for elliptical galaxies makes it unlikely that the burst originated in a supernova explosion. A supernova origin was also ruled out for GRB 050709 (refs 3, 31), even though that burst took place in a galaxy with current star formation. The isotropic energy for the short bursts is 2-3 orders of magnitude lower than that for the long bursts. Our results therefore suggest that an alternative source of bursts--the coalescence of binary systems of neutron stars or a neutron star-black hole pair--are the progenitors of short bursts.
On burst-and-coast swimming performance in fish-like locomotion
International Nuclear Information System (INIS)
Chung, M-H
2009-01-01
Burst-and-coast swimming performance in fish-like locomotion is studied via two-dimensional numerical simulation. The numerical method used is the collocated finite-volume adaptive Cartesian cut-cell method developed previously. The NACA00xx airfoil shape is used as an equilibrium fish-body form. Swimming in a burst-and-coast style is computed assuming that the burst phase is composed of a single tail-beat. Swimming efficiency is evaluated in terms of the mass-specific cost of transport instead of the Froude efficiency. The effects of the Reynolds number (based on the body length and burst time), duty cycle and fineness ratio (the body length over the largest thickness) on swimming performance (momentum capacity and the mass-specific cost of transport) are studied quantitatively. The results lead to a conclusion consistent with previous findings that a larval fish seldom swims in a burst-and-coast style. Given mass and swimming speed, a fish needs the least cost if it swims in a burst-and-coast style with a fineness ratio of 8.33. This energetically optimal fineness ratio is larger than that derived from the simple hydromechanical model proposed in literature. The calculated amount of energy saving in burst-and-coast swimming is comparable with the real-fish estimation in the literature. Finally, the predicted wake-vortex structures of both continuous and burst-and-coast swimming are biologically relevant.
On burst-and-coast swimming performance in fish-like locomotion.
Chung, M-H
2009-09-01
Burst-and-coast swimming performance in fish-like locomotion is studied via two-dimensional numerical simulation. The numerical method used is the collocated finite-volume adaptive Cartesian cut-cell method developed previously. The NACA00xx airfoil shape is used as an equilibrium fish-body form. Swimming in a burst-and-coast style is computed assuming that the burst phase is composed of a single tail-beat. Swimming efficiency is evaluated in terms of the mass-specific cost of transport instead of the Froude efficiency. The effects of the Reynolds number (based on the body length and burst time), duty cycle and fineness ratio (the body length over the largest thickness) on swimming performance (momentum capacity and the mass-specific cost of transport) are studied quantitatively. The results lead to a conclusion consistent with previous findings that a larval fish seldom swims in a burst-and-coast style. Given mass and swimming speed, a fish needs the least cost if it swims in a burst-and-coast style with a fineness ratio of 8.33. This energetically optimal fineness ratio is larger than that derived from the simple hydromechanical model proposed in literature. The calculated amount of energy saving in burst-and-coast swimming is comparable with the real-fish estimation in the literature. Finally, the predicted wake-vortex structures of both continuous and burst-and-coast swimming are biologically relevant.
Bifurcation structure of a model of bursting pancreatic cells
DEFF Research Database (Denmark)
Mosekilde, Erik; Lading, B.; Yanchuk, S.
2001-01-01
. The transition from this structure to the so-called period-adding structure is found to involve a subcritical period-doubling bifurcation and the emergence of type-III intermittency. The period-adding transition itself is not smooth but consists of a saddle-node bifurcation in which (n + 1)-spike bursting...... behavior is born, slightly overlapping with a subcritical period-doubling bifurcation in which n-spike bursting behavior loses its stability.......One- and two-dimensional bifurcation studies of a prototypic model of bursting oscillations in pancreatic P-cells reveal a squid-formed area of chaotic dynamics in the parameter plane, with period-doubling bifurcations on one side of the arms and saddle-node bifurcations on the other...
QKD-Based Secured Burst Integrity Design for Optical Burst Switched Networks
Balamurugan, A. M.; Sivasubramanian, A.; Parvathavarthini, B.
2016-03-01
The field of optical transmission has undergone numerous advancements and is still being researched mainly due to the fact that optical data transmission can be done at enormous speeds. It is quite evident that people prefer optical communication when it comes to large amount of data involving its transmission. The concept of switching in networks has matured enormously with several researches, architecture to implement and methods starting with Optical circuit switching to Optical Burst Switching. Optical burst switching is regarded as viable solution for switching bursts over networks but has several security vulnerabilities. However, this work exploited the security issues associated with Optical Burst Switching with respect to integrity of burst. This proposed Quantum Key based Secure Hash Algorithm (QKBSHA-512) with enhanced compression function design provides better avalanche effect over the conventional integrity algorithms.
The genesis of period-adding bursting without bursting-chaos in the Chay model
International Nuclear Information System (INIS)
Yang Zhuoqin; Lu Qishao; Li Li
2006-01-01
According to the period-adding firing patterns without chaos observed in neuronal experiments, the genesis of the period-adding 'fold/homoclinic' bursting sequence without bursting-chaos is explored by numerical simulation, fast/slow dynamics and bifurcation analysis of limit cycle in the neuronal Chay model. It is found that each periodic bursting, from period-1 to 7, is separately generated by the corresponding periodic spiking pattern through two period-doubling bifurcations, except for the period-1 bursting occurring via a Hopf bifurcation. Consequently, it can be revealed that this period-adding bursting bifurcation without chaos has a compound bifurcation structure with transitions from spiking to bursting, which is closely related to period-doubling bifurcations of periodic spiking in essence
ESTIMATION OF BURSTS LENGTH AND DESIGN OF A FIBER DELAY LINE BASED OBS ROUTER
Directory of Open Access Journals (Sweden)
RICHA AWASTHI
2017-03-01
Full Text Available The demand for higher bandwidth is increasing day by day and this ever growing demand cannot be catered to with current electronic technology. Thus new communication technology like optical communication needs to be used. In the similar context OBS (optical burst switching is considered as next generation data transfer technology. In OBS information is transmitted in forms of optical bursts of variable lengths. However, contention among the bursts is a major problem in OBS system, and for contention resolution defection routing is mostly preferred. However, deflection routing increases delay. In this paper, it is shown that the arrival of very large bursts is rare event, and for moderate burst length the buffering of contending burst can provide very effective solution. However, in case of arrival of large bursts deflection can be used.
Spitler, L G; Scholz, P; Hessels, J W T; Bogdanov, S; Brazier, A; Camilo, F; Chatterjee, S; Cordes, J M; Crawford, F; Deneva, J; Ferdman, R D; Freire, P C C; Kaspi, V M; Lazarus, P; Lynch, R; Madsen, E C; McLaughlin, M A; Patel, C; Ransom, S M; Seymour, A; Stairs, I H; Stappers, B W; van Leeuwen, J; Zhu, W W
2016-03-10
Fast radio bursts are millisecond-duration astronomical radio pulses of unknown physical origin that appear to come from extragalactic distances. Previous follow-up observations have failed to find additional bursts at the same dispersion measure (that is, the integrated column density of free electrons between source and telescope) and sky position as the original detections. The apparent non-repeating nature of these bursts has led to the suggestion that they originate in cataclysmic events. Here we report observations of ten additional bursts from the direction of the fast radio burst FRB 121102. These bursts have dispersion measures and sky positions consistent with the original burst. This unambiguously identifies FRB 121102 as repeating and demonstrates that its source survives the energetic events that cause the bursts. Additionally, the bursts from FRB 121102 show a wide range of spectral shapes that appear to be predominantly intrinsic to the source and which vary on timescales of minutes or less. Although there may be multiple physical origins for the population of fast radio bursts, these repeat bursts with high dispersion measure and variable spectra specifically seen from the direction of FRB 121102 support an origin in a young, highly magnetized, extragalactic neutron star.
Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.
Sherazi, Syed Furqan Haider; Butt, Zeeshan
2012-09-01
AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.
The genesis of period-adding bursting without bursting-chaos in the Chay model
International Nuclear Information System (INIS)
Yang Zhuoqin; Lu Qishao; Li Li
2006-01-01
According to the period-adding firing patterns without chaos observed in neuronal experiments, the genesis of the period-adding 'fold/homoclinic' bursting sequence without bursting-chaos is explored by numerical simulation, fast/slow dynamics and bifurcation analysis of limit cycle in the neuronal Chay model. It is found that each periodic bursting, from period-1 to period-7, is separately generated by the corresponding periodic spiking pattern through two period-doubling bifurcations, except for the period-1 bursting occurring via a Hopf bifurcation. Consequently, it can be revealed that this period-adding bursting bifurcation without chaos has a compound bifurcation structure with transitions from spiking to bursting, which is closely related to period-doubling bifurcations of periodic spiking in essence
INVESTIGATION OF PRIMORDIAL BLACK HOLE BURSTS USING INTERPLANETARY NETWORK GAMMA-RAY BURSTS
Energy Technology Data Exchange (ETDEWEB)
Ukwatta, T. N. [Director' s Postdoctoral Fellow, Space and Remote Sensing (ISR-2), Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Hurley, K. [University of California, Berkeley, Space Sciences Laboratory, 7 Gauss Way, Berkeley, CA 94720-7450 (United States); MacGibbon, J. H. [Department of Physics, University of North Florida, Jacksonville, FL 32224 (United States); Svinkin, D. S.; Aptekar, R. L.; Golenetskii, S. V.; Frederiks, D. D.; Pal' shin, V. D. [Ioffe Physical Technical Institute, St. Petersburg, 194021 (Russian Federation); Goldsten, J. [Applied Physics Laboratory, Johns Hopkins University, Laurel, MD 20723 (United States); Boynton, W. [Department of Planetary Sciences, University of Arizona, Tucson, AZ 85721 (United States); Kozyrev, A. S. [Space Research Institute, 84/32, Profsoyuznaya, Moscow 117997 (Russian Federation); Rau, A.; Kienlin, A. von; Zhang, X. [Max-Planck-Institut für extraterrestrische Physik, Giessenbachstrasse, Postfach 1312, Garching, D-85748 (Germany); Connaughton, V. [University of Alabama in Huntsville, NSSTC, 320 Sparkman Drive, Huntsville, AL 35805 (United States); Yamaoka, K. [Department of Physics and Mathematics, Aoyama Gakuin University, 5-10-1 Fuchinobe, Sagamihara, Kanagawa 229-8558 (Japan); Ohno, M. [Department of Physics, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Ohmori, N. [Department of Applied Physics, University of Miyazaki, 1-1 Gakuen kibanadai-nishi, Miyazaki-shi, Miyazaki 889-2192 (Japan); Feroci, M. [INAF/IAPS-Roma, via Fosso del Cavaliere 100, I-00133, Roma (Italy); Frontera, F., E-mail: tilan@lanl.gov [Department of Physics and Earth Science, University of Ferrara, via Saragat 1, I-44122 Ferrara (Italy); and others
2016-07-20
The detection of a gamma-ray burst (GRB) in the solar neighborhood would have very important implications for GRB phenomenology. The leading theories for cosmological GRBs would not be able to explain such events. The final bursts of evaporating primordial black holes (PBHs), however, would be a natural explanation for local GRBs. We present a novel technique that can constrain the distance to GRBs using detections from widely separated, non-imaging spacecraft. This method can determine the actual distance to the burst if it is local. We applied this method to constrain distances to a sample of 36 short-duration GRBs detected by the Interplanetary Network (IPN) that show observational properties that are expected from PBH evaporations. These bursts have minimum possible distances in the 10{sup 13}–10{sup 18} cm (7–10{sup 5} au) range, which are consistent with the expected PBH energetics and with a possible origin in the solar neighborhood, although none of the bursts can be unambiguously demonstrated to be local. Assuming that these bursts are real PBH events, we estimate lower limits on the PBH burst evaporation rate in the solar neighborhood.
International Nuclear Information System (INIS)
Gardner, L.C.; Cox, T.M.
1988-01-01
Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation
Energy Technology Data Exchange (ETDEWEB)
Jaligama, Sridhar; Kale, Vijay M.; Wilbanks, Mitchell S. [Department of Toxicology, College of Pharmacy, University of Louisiana at Monroe, Monroe, LA 71209 (United States); Perkins, Edward J. [US Army Engineer Research and Development Center, Vicksburg, MS 39180 (United States); Meyer, Sharon A., E-mail: meyer@ulm.edu [Department of Toxicology, College of Pharmacy, University of Louisiana at Monroe, Monroe, LA 71209 (United States)
2013-02-01
Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), a widely used munitions compound, and hexahydro-1-nitroso-3,5-dinitro-1,3,5-triazine (MNX), its N-nitroso product of anaerobic microbial nitroreduction, are contaminants of military sites. Previous studies have shown MNX to be the most acutely toxic among the nitroreduced degradation products of RDX and to cause mild anemia at high dose. The present study compares hematotoxicity with acute oral exposure to MNX with parent RDX. Both RDX and MNX caused a modest decrease in blood hemoglobin and ∼ 50% loss of granulocytes (NOAELs = 47 mg/kg) in female Sprague–Dawley rats observed 14 days post-exposure. We explored the possibility that blood cell loss observed after 14 days was delayed in onset because of toxicity to bone marrow (BM) progenitors. RDX and MNX decreased granulocyte/macrophage-colony forming cells (GM-CFCs) at 14, but not 7, days (NOAELs = 24 mg/kg). The earliest observed time at which MNX decreased GM-CFCs was 10 days post-exposure. RDX and MNX likewise decreased BM burst-forming units-erythroid (BFU-Es) at 14, but not 7, days. Granulocyte–erythrocyte–monocyte–megakaryocyte (GEMM)-CFCs were unaffected by RDX and MNX at 7 days suggesting precursor depletion did not account for GM-CFC and BFU-E loss. MNX added to the culture media was without effect on GM-CFC formation indicating no direct inhibition. Flow cytometry showed no differential loss of BM multilineage progenitors (Thy1.1{sup +}) or erythroid (CD71{sup +}) precursors with MNX suggesting myeloid and erythroid lineages were comparably affected. Collectively, these data indicate that acute exposure to both RDX and MNX caused delayed suppression of myelo- and erythropoiesis with subsequent decrease of peripheral granulocytes and erythrocytes. Highlights: ► Acute oral exposure to munitions RDX causes myelosuppression. ► Environmental degradation product MNX is comparable in effect. ► RDX and MNX are cytotoxic to both myeloid and erythroid
Gamma Ray Bursts - Observations
Gehrels, N.; Cannizzo, J. K.
2010-01-01
We are in an exciting period of discovery for gamma-ray bursts. The Swift observatory is detecting 100 bursts per year, providing arcsecond localizations and sensitive observations of the prompt and afterglow emission. The Fermi observatory is observing 250 bursts per year with its medium-energy GRB instrument and about 10 bursts per year with its high-energy LAT instrument. In addition, rapid-response telescopes on the ground are providing new capabilities to study optical emission during the prompt phase and spectral signatures of the host galaxies. The combined data set is enabling great advances in our understanding of GRBs including afterglow physics, short burst origin, and high energy emission.
Stimulus-dependent modulation of spike burst length in cat striate cortical cells.
DeBusk, B C; DeBruyn, E J; Snider, R K; Kabara, J F; Bonds, A B
1997-07-01
Burst activity, defined by groups of two or more spikes with intervals of cats. Bursting varied broadly across a population of 507 simple and complex cells. Half of this population had > or = 42% of their spikes contained in bursts. The fraction of spikes in bursts did not vary as a function of average firing rate and was stationary over time. Peaks in the interspike interval histograms were found at both 3-5 ms and 10-30 ms. In many cells the locations of these peaks were independent of firing rate, indicating a quantized control of firing behavior at two different time scales. The activity at the shorter time scale most likely results from intrinsic properties of the cell membrane, and that at the longer scale from recurrent network excitation. Burst frequency (bursts per s) and burst length (spikes per burst) both depended on firing rate. Burst frequency was essentially linear with firing rate, whereas burst length was a nonlinear function of firing rate and was also governed by stimulus orientation. At a given firing rate, burst length was greater for optimal orientations than for nonoptimal orientations. No organized orientation dependence was seen in bursts from lateral geniculate nucleus cells. Activation of cortical contrast gain control at low response amplitudes resulted in no burst length modulation, but burst shortening at optimal orientations was found in responses characterized by supersaturation. At a given firing rate, cortical burst length was shortened by microinjection of gamma-aminobutyric acid (GABA), and bursts became longer in the presence of N-methyl-bicuculline, a GABA(A) receptor blocker. These results are consistent with a model in which responses are reduced at nonoptimal orientations, at least in part, by burst shortening that is mediated by GABA. A similar mechanism contributes to response supersaturation at high contrasts via recruitment of inhibitory responses that are tuned to adjacent orientations. Burst length modulation can serve
Heterogeneity in Short Gamma-Ray Bursts
Norris, Jay P.; Gehrels Neil; Scargle, Jeffrey D.
2011-01-01
We analyze the Swift/BAT sample of short gamma-ray bursts, using an objective Bayesian Block procedure to extract temporal descriptors of the bursts' initial pulse complexes (IPCs). The sample comprises 12 and 41 bursts with and without extended emission (EE) components, respectively. IPCs of non-EE bursts are dominated by single pulse structures, while EE bursts tend to have two or more pulse structures. The medians of characteristic timescales - durations, pulse structure widths, and peak intervals - for EE bursts are factors of approx 2-3 longer than for non-EE bursts. A trend previously reported by Hakkila and colleagues unifying long and short bursts - the anti-correlation of pulse intensity and width - continues in the two short burst groups, with non-EE bursts extending to more intense, narrower pulses. In addition we find that preceding and succeeding pulse intensities are anti-correlated with pulse interval. We also examine the short burst X-ray afterglows as observed by the Swift/XRT. The median flux of the initial XRT detections for EE bursts (approx 6 X 10(exp -10) erg / sq cm/ s) is approx > 20 x brighter than for non-EE bursts, and the median X-ray afterglow duration for EE bursts (approx 60,000 s) is approx 30 x longer than for non-EE bursts. The tendency for EE bursts toward longer prompt-emission timescales and higher initial X-ray afterglow fluxes implies larger energy injections powering the afterglows. The longer-lasting X-ray afterglows of EE bursts may suggest that a significant fraction explode into more dense environments than non-EE bursts, or that the sometimes-dominant EE component efficiently p()wers the afterglow. Combined, these results favor different progenitors for EE and non-EE short bursts.
HETEROGENEITY IN SHORT GAMMA-RAY BURSTS
International Nuclear Information System (INIS)
Norris, Jay P.; Gehrels, Neil; Scargle, Jeffrey D.
2011-01-01
We analyze the Swift/BAT sample of short gamma-ray bursts, using an objective Bayesian Block procedure to extract temporal descriptors of the bursts' initial pulse complexes (IPCs). The sample is comprised of 12 and 41 bursts with and without extended emission (EE) components, respectively. IPCs of non-EE bursts are dominated by single pulse structures, while EE bursts tend to have two or more pulse structures. The medians of characteristic timescales-durations, pulse structure widths, and peak intervals-for EE bursts are factors of ∼2-3 longer than for non-EE bursts. A trend previously reported by Hakkila and colleagues unifying long and short bursts-the anti-correlation of pulse intensity and width-continues in the two short burst groups, with non-EE bursts extending to more intense, narrower pulses. In addition, we find that preceding and succeeding pulse intensities are anti-correlated with pulse interval. We also examine the short burst X-ray afterglows as observed by the Swift/X-Ray Telescope (XRT). The median flux of the initial XRT detections for EE bursts (∼6x10 -10 erg cm -2 s -1 ) is ∼>20x brighter than for non-EE bursts, and the median X-ray afterglow duration for EE bursts (∼60,000 s) is ∼30x longer than for non-EE bursts. The tendency for EE bursts toward longer prompt-emission timescales and higher initial X-ray afterglow fluxes implies larger energy injections powering the afterglows. The longer-lasting X-ray afterglows of EE bursts may suggest that a significant fraction explode into denser environments than non-EE bursts, or that the sometimes-dominant EE component efficiently powers the afterglow. Combined, these results favor different progenitors for EE and non-EE short bursts.
BurstMem: A High-Performance Burst Buffer System for Scientific Applications
Energy Technology Data Exchange (ETDEWEB)
Wang, Teng [Auburn University, Auburn, Alabama; Oral, H Sarp [ORNL; Wang, Yandong [Auburn University, Auburn, Alabama; Settlemyer, Bradley W [ORNL; Atchley, Scott [ORNL; Yu, Weikuan [Auburn University, Auburn, Alabama
2014-01-01
The growth of computing power on large-scale sys- tems requires commensurate high-bandwidth I/O system. Many parallel file systems are designed to provide fast sustainable I/O in response to applications soaring requirements. To meet this need, a novel system is imperative to temporarily buffer the bursty I/O and gradually flush datasets to long-term parallel file systems. In this paper, we introduce the design of BurstMem, a high- performance burst buffer system. BurstMem provides a storage framework with efficient storage and communication manage- ment strategies. Our experiments demonstrate that BurstMem is able to speed up the I/O performance of scientific applications by up to 8.5 on leadership computer systems.
Directory of Open Access Journals (Sweden)
Liang Cheng
2015-01-01
Full Text Available Given the increase in mining depth and intensity, tunnel failure as a result of rock burst has become an important issue in the field of mining engineering in China. Based on the Composite Rock-Bolt Bearing Structure, which is formed due to the interaction of the bolts driven into the surrounding rock, this paper analyzes a rock burst prevention mechanism, establishes a mechanical model in burst-prone ground, deduces the strength calculation formula of the Composite Rock-Bolt Bearing Structure in burst-prone ground, and confirms the rock burst prevention criterion of the Composite Rock-Bolt Bearing Structure. According to the rock burst prevention criterion, the amount of the influence on rock burst prevention ability from the surrounding rock parameters and bolt support parameters is discussed.
Kohler, Susanna
2018-03-01
What happens to a neutron stars accretion disk when its surface briefly explodes? A new instrument recently deployed at the International Space Station (ISS) is now watching bursts from neutron stars and reporting back.Deploying a New X-Ray MissionLaunch of NICER aboard a Falcon 9 rocket in June 2017. [NASA/Tony Gray]In early June of 2017, a SpaceX Dragon capsule on a Falcon 9 rocket launched on a resupply mission to the ISS. The pressurized interior of the Dragon contained the usual manifest of crew supplies, spacewalk equipment, and vehicle hardware. But the unpressurized trunk of the capsule held something a little different: the Neutron star Interior Composition Explorer (NICER).In the two weeks following launch, NICER was extracted from the SpaceX Dragon capsule and installed on the ISS. And by the end of the month, the instrument was already collecting its first data set: observations of a bright X-ray burst from Aql X-1, a neutron star accreting matter from a low-mass binary companion.Impact of BurstsNICERs goal is to provide a new view of neutron-star physics at X-ray energies of 0.212 keV a window that allows us to explore bursts of energy that neutron stars sometimes emit from their surfaces.Artists impression of an X-ray binary, in which a compact object accretes material from a companion star. [ESA/NASA/Felix Mirabel]In X-ray burster systems, hydrogen- and helium-rich material from a low-mass companion star piles up in an accretion disk around the neutron star. This material slowly funnels onto the neutron stars surface, forming a layer that gravitationally compresses and eventually becomes so dense and hot that runaway nuclear fusion ignites.Within seconds, the layer of material is burned up, producing a burst of emission from the neutron star that outshines even the inner regions of the hot accretion disk. Then more material funnels onto the neutron star and the process begins again.Though we have a good picture of the physics that causes these bursts
Prevention and forecasting of rock burst hazards in coal mines
Energy Technology Data Exchange (ETDEWEB)
Lin-ming Dou; Cai-ping Lu; Zong-long Mu; Ming-shi Gao [China University of Mining & Technology, Xuzhou (China). State Key Laboratory for Coal Resource and Mine Safety
2009-09-15
Rock bursts signify extreme behavior in coal mine strata and severely threaten the safety of the lives of miners, as well as the effectiveness and productivity of miners. In our study, an elastic-plastic-brittle model for the deformation and failure of coal/rock was established through theoretical analyses, laboratory experiments and field testing, simulation and other means, which perfectly predict sudden and delayed rock bursts. Based on electromagnetic emission (EME), acoustic emission (AE) and microseismic (MS) effects in the process from deformation until impact rupture of coal-rock combination samples, a multi-parameter identification of premonitory technology was formed, largely depending on these three forms of emission. Thus a system of classification for forecasting rock bursts in space and time was established. We have presented the intensity weakening theory for rock bursts and a strong-soft-strong (3S) structural model for controlling the impact on rock surrounding roadways, with the objective of laying a theoretical foundation and establishing references for parameters for the weakening control of rock bursts. For the purpose of prevention, key technical parameters of directional hydraulic fracturing are revealed. Based on these results, as well as those from deep-hole controlled blasting in coal seams and rock, integrated control techniques were established and anti-impact hydraulic props, suitable for roadways subject to hazards from rockbursts have also been developed. These technologies have been widely used in most coal mines in China, subject to these hazards and have achieved remarkable economic and social benefits. 28 refs., 9 figs., 1 tab.
A search for optical bursts from the repeating fast radio burst FRB 121102
Hardy, L. K.; Dhillon, V. S.; Spitler, L. G.; Littlefair, S. P.; Ashley, R. P.; De Cia, A.; Green, M. J.; Jaroenjittichai, P.; Keane, E. F.; Kerry, P.; Kramer, M.; Malesani, D.; Marsh, T. R.; Parsons, S. G.; Possenti, A.; Rattanasoon, S.; Sahman, D. I.
2017-12-01
We present a search for optical bursts from the repeating fast radio burst FRB 121102 using simultaneous observations with the high-speed optical camera ULTRASPEC on the 2.4-m Thai National Telescope and radio observations with the 100-m Effelsberg Radio Telescope. A total of 13 radio bursts were detected, but we found no evidence for corresponding optical bursts in our 70.7-ms frames. The 5σ upper limit to the optical flux density during our observations is 0.33 mJy at 767 nm. This gives an upper limit for the optical burst fluence of 0.046 Jy ms, which constrains the broad-band spectral index of the burst emission to α ≤ -0.2. Two of the radio pulses are separated by just 34 ms, which may represent an upper limit on a possible underlying periodicity (a rotation period typical of pulsars), or these pulses may have come from a single emission window that is a small fraction of a possible period.
International Nuclear Information System (INIS)
Ehstulin, I.V.
1980-01-01
A brief consideration is being given to the history of cosmic gamma burst discovery and modern knowledge of their properties. The time dependence of gamma bursts is described and their possible sources are discussed
Detection circuit for gamma-ray burst
International Nuclear Information System (INIS)
Murakami, Hiroyuki; Yamagami, Takamasa; Mori, Kunishiro; Uchiyama, Sadayuki.
1982-01-01
A new gamma-ray burst detection system is described. The system was developed as an environmental monitor of an accelerator, and can be used as the burst detection system. The system detects the arrival time of burst. The difference between the arrival times detected at different places will give information on the burst source. The frequency of detecting false burst was estimated, and the detection limit under the estimated frequency of false burst was also calculated. Decision whether the signal is false or true burst was made by the statistical treatment. (Kato, T.)
Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M
1981-01-01
Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...
Solar microwave bursts - A review
Kundu, M. R.; Vlahos, L.
1982-01-01
Observational and theoretical results on the physics of microwave bursts that occur in the solar atmosphere are reviewed. Special attention is given to the advances made in burst physics over the last few years with the great improvement in spatial and time resolution, especially with instruments like the NRAO three-element interferometer, the Westerbork Synthesis Radio Telescope, and more recently the Very Large Array. Observations made on the preflare build-up of an active region at centimeter wavelengths are reviewed. Three distinct phases in the evolution of cm bursts, namely the impulsive phase, the post-burst phase, and the gradual rise and fall, are discussed. Attention is also given to the flux density spectra of centimeter bursts. Descriptions are given of observations of fine structures with temporal resolution of 10-100 ms in the intensity profiles of cm-wavelength bursts. High spatial resolution observations are analyzed, with special reference to the one- and two-dimensional maps of cm burst sources.
Bo, Jiang; Hao, Weidong; Hu, Zhihong; Liu, Fuguo
2015-12-01
In order to solve the problem of over temperature tube-burst caused by oxide scale shedding and blocking tubes of high temperature reheater of a 200MW super high pressure power plant boiler, this paper expounds the mechanism of scale forming and shedding, and analyzes the probable causes of the tube-burst failure. The results show that the root cause of scale forming is that greater steam extraction flow after reforming of the second extraction leads to less steam flow into reheater, which causes over temperature to some of the heated tubes; and the root cause of scale shedding is that long term operation in AGC-R mode brings about great fluctuations of unit load, steam temperature and pressure, accelerating scale shedding. In conclusion, preventive measures are drawn up considering the operation mode of the unit.
Optical observations of Gamma-Ray Bursts
International Nuclear Information System (INIS)
Hjorth, J.; Pian, E.; Fynbo, J.P.U.
2004-01-01
We briefly review the status and recent progress in the field of optical observations of gamma-ray burst afterglows. We will focus on the fundamental observational evidence for the relationship between gamma-ray bursts and the final evolutionary phases of massive stars. In particular, we will address (i) gamma-ray burst host galaxies, (ii) optically dark gamma-ray burst afterglows, (iii) the gamma-ray burst-supernova connection, and (iv) the relation between X-ray flashes, gamma-ray bursts, and supernovae
International Nuclear Information System (INIS)
Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.
1982-01-01
Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)
Solar Radio Bursts and Space Weather
Gopalswamy, Natchimuthuk,
2012-01-01
Radio bursts from the Sun are produced by electron accelerated to relativistic energies by physical processes on the Sun such as solar flares and coronal mass ejections (CMEs). The radio bursts are thus good indicators of solar eruptions. Three types of nonthermal radio bursts are generally associated with CMEs. Type III bursts due to accelerated electrons propagating along open magnetic field lines. The electrons are thought to be accelerated at the reconnection region beneath the erupting CME, although there is another view that the electrons may be accelerated at the CME-driven shock. Type II bursts are due to electrons accelerated at the shock front. Type II bursts are also excellent indicators of solar energetic particle (SEP) events because the same shock is supposed accelerate electrons and ions. There is a hierarchical relationship between the wavelength range of type /I bursts and the CME kinetic energy. Finally, Type IV bursts are due to electrons trapped in moving or stationary structures. The low frequency stationary type IV bursts are observed occasionally in association with very fast CMEs. These bursts originate from flare loops behind the erupting CME and hence indicate tall loops. This paper presents a summary of radio bursts and their relation to CMEs and how they can be useful for space weather predictions.
Connecting protein and mRNA burst distributions for stochastic models of gene expression
International Nuclear Information System (INIS)
Elgart, Vlad; Jia, Tao; Fenley, Andrew T; Kulkarni, Rahul
2011-01-01
The intrinsic stochasticity of gene expression can lead to large variability in protein levels for genetically identical cells. Such variability in protein levels can arise from infrequent synthesis of mRNAs which in turn give rise to bursts of protein expression. Protein expression occurring in bursts has indeed been observed experimentally and recent studies have also found evidence for transcriptional bursting, i.e. production of mRNAs in bursts. Given that there are distinct experimental techniques for quantifying the noise at different stages of gene expression, it is of interest to derive analytical results connecting experimental observations at different levels. In this work, we consider stochastic models of gene expression for which mRNA and protein production occurs in independent bursts. For such models, we derive analytical expressions connecting protein and mRNA burst distributions which show how the functional form of the mRNA burst distribution can be inferred from the protein burst distribution. Additionally, if gene expression is repressed such that observed protein bursts arise only from single mRNAs, we show how observations of protein burst distributions (repressed and unrepressed) can be used to completely determine the mRNA burst distribution. Assuming independent contributions from individual bursts, we derive analytical expressions connecting means and variances for burst and steady-state protein distributions. Finally, we validate our general analytical results by considering a specific reaction scheme involving regulation of protein bursts by small RNAs. For a range of parameters, we derive analytical expressions for regulated protein distributions that are validated using stochastic simulations. The analytical results obtained in this work can thus serve as useful inputs for a broad range of studies focusing on stochasticity in gene expression
International Nuclear Information System (INIS)
Della Bianca, V.; Grzeskowiak, M.; Lissandrini, D.; Rossi, F.
1991-01-01
The results presented in this paper demonstrate that in human neutrophils phagocytosis of C3b/bi and IgG-opsonized yeast particles is associated with activation of phospholipase D and that this reaction is the main source of diglycerides. The demonstration is based upon the following findings: (1) the challenge of neutrophils with these opsonized particles was followed by a rapid formation of [3H]alkyl-phosphatidic acid [( 3H]alkyl-PA) and [3H]alkyl-diglyceride [( 3H]alkyl-DG) in cells labeled with [3H]alkyl-lyso-phosphatidylcholine; (2) in the presence of ethanol [3H]alkyl-phosphatidylethanol was formed, and accumulation of [3H]alkyl-PA and [3H]alkyl-DG was depressed; (3) propranolol, by inhibiting the dephosphorylation of [3H]alkyl-PA, completely inhibited the accumulation of [3H]alkyl-DG and depressed by about 75% the formation of diglyceride mass. Evidence is also presented that phagocytosis of C3b/bi and IgG-opsonized yeast particles and associated respiratory burst can take place independently of diglyceride formation and of the activity of this second messenger on protein kinase C. In fact: (a) propranolol while completely inhibited the formation of diglyceride mass did not modify either the phagocytosis or respiratory burst; (b) these two processes were insensitive to staurosporine
International Nuclear Information System (INIS)
Gu Hua-Guang; Chen Sheng-Gen; Li Yu-Ye
2015-01-01
We investigated the synchronization dynamics of a coupled neuronal system composed of two identical Chay model neurons. The Chay model showed coexisting period-1 and period-2 bursting patterns as a parameter and initial values are varied. We simulated multiple periodic and chaotic bursting patterns with non-(NS), burst phase (BS), spike phase (SS), complete (CS), and lag synchronization states. When the coexisting behavior is near period-2 bursting, the transitions of synchronization states of the coupled system follows very complex transitions that begins with transitions between BS and SS, moves to transitions between CS and SS, and to CS. Most initial values lead to the CS state of period-2 bursting while only a few lead to the CS state of period-1 bursting. When the coexisting behavior is near period-1 bursting, the transitions begin with NS, move to transitions between SS and BS, to transitions between SS and CS, and then to CS. Most initial values lead to the CS state of period-1 bursting but a few lead to the CS state of period-2 bursting. The BS was identified as chaos synchronization. The patterns for NS and transitions between BS and SS are insensitive to initial values. The patterns for transitions between CS and SS and the CS state are sensitive to them. The number of spikes per burst of non-CS bursting increases with increasing coupling strength. These results not only reveal the initial value- and parameter-dependent synchronization transitions of coupled systems with coexisting behaviors, but also facilitate interpretation of various bursting patterns and synchronization transitions generated in the nervous system with weak coupling strength. (paper)
International Nuclear Information System (INIS)
Teegarden, B.J.
1982-01-01
A review of recent results in gamma-ray burst spectroscopy is given. Particular attention is paid to the recent discovery of emission and absorption features in the burst spectra. These lines represent the strongest evidence to date that gamma-ray bursts originate on or near neutron stars. Line parameters give information on the temperature, magnetic field and possibly the gravitational potential of the neutron star. The behavior of the continuum spectrum is also discussed. A remarkably good fit to nearly all bursts is obtained with a thermal-bremsstrahlung-like continuum. Significant evolution is observed of both the continuum and line features within most events
A search for dispersed radio bursts in archival Parkes Multibeam Pulsar Survey data
Bagchi, Manjari; Nieves, Angela Cortes; McLaughlin, Maura
2012-10-01
A number of different classes of potentially extra-terrestrial bursts of radio emission have been observed in surveys with the Parkes 64-m radio telescope, including 'rotating radio transients', the 'Lorimer burst' and 'perytons'. Rotating radio transients are radio pulsars which are best detectable in single-pulse searches. The Lorimer burst is a highly dispersed isolated radio burst with properties suggestive of extragalactic origin. Perytons share the frequency-swept nature of the rotating radio transients and Lorimer burst, but unlike these events appear in all 13 beams of the Parkes multibeam receiver and are probably a form of peculiar radio frequency interference. In order to constrain these and other radio source populations further, we searched the archival Parkes Multibeam Pulsar Survey data for events similar to any of these. We did not find any new rotating radio transients or bursts like the Lorimer burst. We did, however, discover four peryton-like events. Similar to the perytons, these four bursts are highly dispersed, detected in all 13 beams of the Parkes multibeam receiver, and have pulse widths between 20 and 30 ms. Unlike perytons, these bursts are not associated with atmospheric events like rain or lightning. These facts may indicate that lightning was not responsible for the peryton phenomenon. Moreover, the lack of highly dispersed celestial signals is the evidence that the Lorimer burst is unlikely to belong to a cosmological source population.
Analysis of historic bursts and burst detection in water supply areas of different size
Bakker, M.; Trietsch, E.A.; Vreeburg, J.H.G.; Rietveld, L.C.
2014-01-01
Pipe bursts in water distribution networks lead to water losses and a risk of damaging the urban environment. We studied hydraulic data and customer contact records of 44 real bursts for a better understanding of the phenomena. We found that most bursts were reported to the water company shortly
Lin, Da-Bin; Huang, Bao-Quan; Liu, Tong; Gu, Wei-Min; Mu, Hui-Jun; Liang, En-Wei
2018-01-01
Central engines of gamma-ray bursts (GRBs) may be intermittent and launch several episodes of ejecta separated by a long quiescent interval. In this scenario, an external shock is formed due to the propagation of the first launched ejecta into the circum-burst medium and the later launched ejecta may interact with the external shock at a later period. Owing to the internal dissipation, the later launched ejecta may be observed at a later time (t jet). In this paper, we study the relation of t b and t jet, where t b is the collision time of the later launched ejecta with the formed external shock. It is found that the relation of t b and t jet depends on the bulk Lorentz factor (Γjet) of the later launched ejecta and the density (ρ) of the circum-burst medium. If the value of Γjet or ρ is low, the t b would be significantly larger than t jet. However, the t b ∼ t jet can be found if the value of Γjet or ρ is significantly large. Our results can explain the large lag of the optical emission relative to the γ-ray/X-ray emission in GRBs, e.g., GRB 111209A. For GRBs with a precursor, our results suggest that the energy injection into the external shock and thus more than one external-reverse shock may appear in the main prompt emission phase. According to our model, we estimate the Lorentz factor of the second launched ejecta in GRB 160625B.
Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G
1996-01-01
Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.
Fermi/GAMMA-RAY BURST MONITOR OBSERVATIONS OF SGR J0501+4516 BURSTS
International Nuclear Information System (INIS)
Lin Lin; Zhang Shuangnan; Kouveliotou, Chryssa; Baring, Matthew G.; Van der Horst, Alexander J.; Finger, Mark H.; Guiriec, Sylvain; Preece, Robert; Chaplin, Vandiver; Bhat, Narayan; Woods, Peter M.; Goegues, Ersin; Kaneko, Yuki; Scargle, Jeffrey; Granot, Jonathan; Von Kienlin, Andreas; Watts, Anna L.; Wijers, Ralph A. M. J.; Gehrels, Neil; Harding, Alice
2011-01-01
We present our temporal and spectral analyses of 29 bursts from SGR J0501+4516, detected with the gamma-ray burst monitor on board the Fermi Gamma-ray Space Telescope during 13 days of the source's activation in 2008 (August 22- September 3). We find that the T 90 durations of the bursts can be fit with a log-normal distribution with a mean value of ∼123 ms. We also estimate for the first time event durations of soft gamma repeater (SGR) bursts in photon space (i.e., using their deconvolved spectra) and find that these are very similar to the T 90 values estimated in count space (following a log-normal distribution with a mean value of ∼124 ms). We fit the time-integrated spectra for each burst and the time-resolved spectra of the five brightest bursts with several models. We find that a single power law with an exponential cutoff model fits all 29 bursts well, while 18 of the events can also be fit with two blackbody functions. We expand on the physical interpretation of these two models and we compare their parameters and discuss their evolution. We show that the time-integrated and time-resolved spectra reveal that E peak decreases with energy flux (and fluence) to a minimum of ∼30 keV at F = 8.7 x 10 -6 erg cm -2 s -1 , increasing steadily afterward. Two more sources exhibit a similar trend: SGRs J1550-5418 and 1806-20. The isotropic luminosity, L iso , corresponding to these flux values is roughly similar for all sources (0.4-1.5 x 10 40 erg s -1 ).
International Nuclear Information System (INIS)
Barlow, P.
1983-01-01
By experiment, it has been shown by other workers that there is a reduction in the creep ductility of Zircaloy 4 in the α+β phase transition region. Results from single rod burst tests also show a reduction in burst strain in the α+β phase region. In this report it is shown theoretically that for single rod burst tests in the presence of circumferential temperature gradients, the temperature dependence of the mean burst strain is not determined by temperature variations in creep ductility, but is governed by the temperature sensitivity of the creep strain rate, which is shown to be a maximum in the α+β phase transition region. To demonstrate this effect, the mean clad strain at burst was calculated for creep straining at different temperature levels in the α, α+β and β phase regions. Cross-pin temperature gradients were applied which produced strain variations around the clad which were greatest in the α+β phase region. The mean strain at burst was determined using a maximum local burst strain (i.e. a creep ductility) which is independent of temperature. By assuming cross-pin temperature gradients which are typical of those observed during burst tests, then the calculated mean burst strain/burst temperature relationship gave good agreement with experiment. The calculations also show that when circumferential temperature differences are present, the calculated mean strain at burst is not sensitive to variations in the magnitude of the assumed creep ductility. This reduces the importance of the assumed burst criterion in the calculations. Hence a temperature independent creep ductility (e.g. 100% local strain) is adequate as a burst criterion for calculations under PWR LOCA conditions. (author)
Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.
Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired
Analysis of forming limit in tube hydroforming
International Nuclear Information System (INIS)
Kim, Chan Il; Yang, Seung Hang; Kim, Young Suk
2013-01-01
The automotive industry has shown increasing interest in tube hydroforming. Despite many automobile structural parts being produced from cylindrical tubes, failures frequently occur during tube hydroforming under improper forming conditions. These problems include wrinkling, buckling, folding back, and bursting. We perform analytical studies to determine forming limits in tube hydroforming and demonstrate how these forming limits are influenced by the loading path. Theoretical results for the forming limits of wrinkling and bursting are compared with experimental results for an aluminum tube.
Observations of short gamma-ray bursts.
Fox, Derek B; Roming, Peter W A
2007-05-15
We review recent observations of short-hard gamma-ray bursts and their afterglows. The launch and successful ongoing operations of the Swift satellite, along with several localizations from the High-Energy Transient Explorer mission, have provoked a revolution in short-burst studies: first, by quickly providing high-quality positions to observers; and second, via rapid and sustained observations from the Swift satellite itself. We make a complete accounting of Swift-era short-burst localizations and proposed host galaxies, and discuss the implications of these observations for the distances, energetics and environments of short bursts, and the nature of their progenitors. We then review the physical modelling of short-burst afterglows: while the simplest afterglow models are inadequate to explain the observations, there have been several notable successes. Finally, we address the case of an unusual burst that threatens to upset the simple picture in which long bursts are due to the deaths of massive stars, and short bursts to compact-object merger events.
X-ray bursts: Observation versus theory
Lewin, W. H. G.
1981-01-01
Results of various observations of common type I X-ray bursts are discussed with respect to the theory of thermonuclear flashes in the surface layers of accreting neutron stars. Topics covered include burst profiles; irregular burst intervals; rise and decay times and the role of hydrogen; the accuracy of source distances; accuracy in radii determination; radius increase early in the burst; the super Eddington limit; temperatures at burst maximum; and the role of the magnetic field.
Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan
2015-01-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...
Wolf-Rayet stars as gamma-ray burst progenitors
Langer, N.; van Marle, A. -J; Yoon, S.C.
2010-01-01
It became clear in the last few years that long gamma-ray bursts are associated with the endpoints of massive star evolution. They occur in star forming regions at cosmological distances (Jakobsson et al., 2005), and are associated with supernova-type energies. The collapsar model explains gamma-ray
Secured Hash Based Burst Header Authentication Design for Optical Burst Switched Networks
Balamurugan, A. M.; Sivasubramanian, A.; Parvathavarthini, B.
2017-12-01
The optical burst switching (OBS) is a promising technology that could meet the fast growing network demand. They are featured with the ability to meet the bandwidth requirement of applications that demand intensive bandwidth. OBS proves to be a satisfactory technology to tackle the huge bandwidth constraints, but suffers from security vulnerabilities. The objective of this proposed work is to design a faster and efficient burst header authentication algorithm for core nodes. There are two important key features in this work, viz., header encryption and authentication. Since the burst header is an important in optical burst switched network, it has to be encrypted; otherwise it is be prone to attack. The proposed MD5&RC4-4S based burst header authentication algorithm runs 20.75 ns faster than the conventional algorithms. The modification suggested in the proposed RC4-4S algorithm gives a better security and solves the correlation problems between the publicly known outputs during key generation phase. The modified MD5 recommended in this work provides 7.81 % better avalanche effect than the conventional algorithm. The device utilization result also shows the suitability of the proposed algorithm for header authentication in real time applications.
International Nuclear Information System (INIS)
Gulliya, K.S.; Pervaiz, S.
1989-01-01
Laser photoradiation therapy was tested in an in vitro model for its efficacy in the elimination of non-Hodgkin's lymphoma cells. Results show that at 31.2 J/cm2 of laser light in the presence of 20 micrograms/mL of merocyanine 540 (MC540) there was greater than 5 log reduction in Burkitt's lymphoma (Daudi) cells. Similar tumor cell kill was obtained for leukemia (HL-60) cells at a laser light dose of 93.6 J/cm2. However, to obtain the same efficiency of killing for histiocytic lymphoma (U-937) cells, a higher dose of MC540 (25 micrograms/mL) was required. Clonogenic tumor stem cell colony formation was reduced by greater than 5 logs after laser photoradiation therapy. Under identical conditions for each cell line the percent survival for granulocyte-macrophage colony-forming units (CFU-GM, 45.9%, 40%, 17.5%), granulocyte/erythroid/macrophage/megakaryocyte (GEMM, 40.1%, 20.1%, 11.5%), colony-forming units (CFU-C, 16.2%, 9.1%, 1.8%), and erythroid burst-forming units (BFU-E, 33.4%, 17.8%, 3.9%) was significantly higher than the tumor cells. Mixing of gamma ray-irradiated normal marrow cells with tumor cells (1:1 and 10:1 ratio) did not interfere with the elimination of tumor cells. The effect of highly purified recombinant interferon alpha (rIFN) on laser photoradiation therapy of tumor cells was also investigated. In the presence of rIFN (30 to 3,000 U/mL), the viability of leukemic cells was observed to increase from 0% to 1.5% with a concurrent decrease in membrane polarization, suggesting an increase in fluidity of cell membrane in response to rIFN. However, at higher doses of rIFN (6,000 to 12,000 U/mL) this phenomenon was not observed. The viability of lymphoma cells remained unaffected at all doses of rIFN tested
Cheng, Liang; Zhang, Yidong; Ji, Ming; Cui, Mantang; Zhang, Kai; Zhang, Minglei
2015-01-01
Given the increase in mining depth and intensity, tunnel failure as a result of rock burst has become an important issue in the field of mining engineering in China. Based on the Composite Rock-Bolt Bearing Structure, which is formed due to the interaction of the bolts driven into the surrounding rock, this paper analyzes a rock burst prevention mechanism, establishes a mechanical model in burst-prone ground, deduces the strength calculation formula of the Composite Rock-Bolt Bearing Structur...
International Nuclear Information System (INIS)
Rubin, P.; Wheeler, K.T.; Keng, P.C.; Gregory, P.K.; Croizat, H.
1981-01-01
KHT tumor cells were mixed with mouse bone marrow to simulate a sample of bone marrow containing metastatic tumor cells. This mixture was separated into a bone marrow fraction and a tumor cell fraction by centrifugal elutriation. Elutriation did not change the transplantability of the bone marrow stem cells as measured by a spleen colony assay and an in vitro erythroid burst forming unit assay. The tumorogenicity of the KHT cells was similarly unaffected by elutriation. The data showed that bone marrow cells could be purified to less than 1 tumor cell in more than 10 6 bone marrow cells. Therefore, purification of bone marrow removed prior to lethal radiation-drug combined therapy for subsequent autologous transplantation appears to be feasible using modifications of this method if similar physical differences between human metastatic tumor cells and human bone marrow cells exist. This possibility is presently being explored
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Rock bursts. 57.3461 Section 57.3461 Mineral...-Underground Only § 57.3461 Rock bursts. (a) Operators of mines which have experienced a rock burst shall— (1) Within twenty four hours report to the nearest MSHA office each rock burst which: (i) Causes persons to...
Christensen, Kim; Oomen, Roel; Renò, Roberto
2016-01-01
The Drift Burst Hypothesis postulates the existence of short-lived locally explosive trends in the price paths of financial assets. The recent US equity and Treasury flash crashes can be viewed as two high profile manifestations of such dynamics, but we argue that drift bursts of varying magnitude are an expected and regular occurrence in financial markets that can arise through established mechanisms such as feedback trading. At a theoretical level, we show how to build drift bursts into the...
Spatiotemporal chaos from bursting dynamics
International Nuclear Information System (INIS)
Berenstein, Igal; De Decker, Yannick
2015-01-01
In this paper, we study the emergence of spatiotemporal chaos from mixed-mode oscillations, by using an extended Oregonator model. We show that bursting dynamics consisting of fast/slow mixed mode oscillations along a single attractor can lead to spatiotemporal chaotic dynamics, although the spatially homogeneous solution is itself non-chaotic. This behavior is observed far from the Hopf bifurcation and takes the form of a spatiotemporal intermittency where the system locally alternates between the fast and the slow phases of the mixed mode oscillations. We expect this form of spatiotemporal chaos to be generic for models in which one or several slow variables are coupled to activator-inhibitor type of oscillators
X-ray bursts observed with JEM-X
DEFF Research Database (Denmark)
Brandt, Søren Kristian; Chenevez, Jérôme; Lund, Niels
2006-01-01
We report on the search for X-ray bursts in the JEM-X X-ray monitor on INTEGRAL during the first two years of operations. More than 350 bursts from 25 different type-I X-ray burst sources were found.......We report on the search for X-ray bursts in the JEM-X X-ray monitor on INTEGRAL during the first two years of operations. More than 350 bursts from 25 different type-I X-ray burst sources were found....
Bursts and shocks in a continuum shell model
DEFF Research Database (Denmark)
Andersen, Ken Haste; Bohr, Tomas; Jensen, M.H.
1998-01-01
We study a burst event, i.e., the evolution of an initial condition having support only in a finite interval of k-space, in the continuum shell model due to Parisi. We show that the continuum equation without forcing or dissipation can be explicitly written in characteristic form and that the right...
UWB dual burst transmit driver
Dallum, Gregory E [Livermore, CA; Pratt, Garth C [Discovery Bay, CA; Haugen, Peter C [Livermore, CA; Zumstein, James M [Livermore, CA; Vigars, Mark L [Livermore, CA; Romero, Carlos E [Livermore, CA
2012-04-17
A dual burst transmitter for ultra-wideband (UWB) communication systems generates a pair of precisely spaced RF bursts from a single trigger event. An input trigger pulse produces two oscillator trigger pulses, an initial pulse and a delayed pulse, in a dual trigger generator. The two oscillator trigger pulses drive a gated RF burst (power output) oscillator. A bias driver circuit gates the RF output oscillator on and off and sets the RF burst packet width. The bias driver also level shifts the drive signal to the level that is required for the RF output device.
Monitoring burst (M-burst) — A novel framework of failure localization in all-optical mesh networks
Ali, Mohammed L.; Ho, Pin-Han; Wu, Bin; Tapolcai, Janos; Shihada, Basem
2011-01-01
Achieving instantaneous and precise failure localization in all-optical wavelength division multiplexing (WDM) networks has been an attractive feature of network fault management systems, and is particularly important when failure-dependent protection is employed. The paper introduces a novel framework of real-time failure localization in all-optical WDM mesh networks, called monitoring-burst (m-burst), which aims to initiate a graceful compromise between consumed monitoring resources and monitoring delay. Different from any previously reported solution, the proposed m-burst framework has a single monitoring node (MN) which launches optical bursts along a set of pre-defined close-loop routes, called monitoring cycles (m-cycles), to probe the links along the m-cycles. Bursts along different m-cycles are kept non-overlapping through any link of the network. By identifying the lost bursts due to single link failure events only, the MN can unambiguously localize the failed link in at least 3-connected networks. We will justify the feasibility and applicability of the proposed m-burst framework in the scenario of interest. To avoid possible collision among optical bursts launched by the MN, we define the problem of collision-free scheduling and formulate it into an integer linear program (ILP) in order to minimize the monitoring delay. Numerical results demonstrate the effectiveness of the proposed framework and the proposed solution.
Monitoring burst (M-burst) — A novel framework of failure localization in all-optical mesh networks
Ali, Mohammed L.
2011-10-10
Achieving instantaneous and precise failure localization in all-optical wavelength division multiplexing (WDM) networks has been an attractive feature of network fault management systems, and is particularly important when failure-dependent protection is employed. The paper introduces a novel framework of real-time failure localization in all-optical WDM mesh networks, called monitoring-burst (m-burst), which aims to initiate a graceful compromise between consumed monitoring resources and monitoring delay. Different from any previously reported solution, the proposed m-burst framework has a single monitoring node (MN) which launches optical bursts along a set of pre-defined close-loop routes, called monitoring cycles (m-cycles), to probe the links along the m-cycles. Bursts along different m-cycles are kept non-overlapping through any link of the network. By identifying the lost bursts due to single link failure events only, the MN can unambiguously localize the failed link in at least 3-connected networks. We will justify the feasibility and applicability of the proposed m-burst framework in the scenario of interest. To avoid possible collision among optical bursts launched by the MN, we define the problem of collision-free scheduling and formulate it into an integer linear program (ILP) in order to minimize the monitoring delay. Numerical results demonstrate the effectiveness of the proposed framework and the proposed solution.
Gamma-Ray Bursts from Neutron Star Kicks
Huang, Y. F.; Dai, Z. G.; Lu, T.; Cheng, K. S.; Wu, X. F.
2003-09-01
The idea that gamma-ray bursts might be a phenomenon associated with neutron star kicks was first proposed by Dar & Plaga. Here we study this mechanism in more detail and point out that the neutron star should be a high-speed one (with proper motion larger than ~1000 km s-1). It is shown that the model agrees well with observations in many aspects, such as the energetics, the event rate, the collimation, the bimodal distribution of durations, the narrowly clustered intrinsic energy, and the association of gamma-ray bursts with supernovae and star-forming regions. We also discuss the implications of this model on the neutron star kick mechanism and suggest that the high kick speed was probably acquired as the result of the electromagnetic rocket effect of a millisecond magnetar with an off-centered magnetic dipole.
A new gamma-ray burst classification scheme from GRB 060614.
Gehrels, N; Norris, J P; Barthelmy, S D; Granot, J; Kaneko, Y; Kouveliotou, C; Markwardt, C B; Mészáros, P; Nakar, E; Nousek, J A; O'Brien, P T; Page, M; Palmer, D M; Parsons, A M; Roming, P W A; Sakamoto, T; Sarazin, C L; Schady, P; Stamatikos, M; Woosley, S E
2006-12-21
Gamma-ray bursts (GRBs) are known to come in two duration classes, separated at approximately 2 s. Long-duration bursts originate from star-forming regions in galaxies, have accompanying supernovae when these are near enough to observe and are probably caused by massive-star collapsars. Recent observations show that short-duration bursts originate in regions within their host galaxies that have lower star-formation rates, consistent with binary neutron star or neutron star-black hole mergers. Moreover, although their hosts are predominantly nearby galaxies, no supernovae have been so far associated with short-duration GRBs. Here we report that the bright, nearby GRB 060614 does not fit into either class. Its approximately 102-s duration groups it with long-duration GRBs, while its temporal lag and peak luminosity fall entirely within the short-duration GRB subclass. Moreover, very deep optical observations exclude an accompanying supernova, similar to short-duration GRBs. This combination of a long-duration event without an accompanying supernova poses a challenge to both the collapsar and the merging-neutron-star interpretations and opens the door to a new GRB classification scheme that straddles both long- and short-duration bursts.
Carlo-Stella, Carmelo; Di Nicola, Massimo; Magni, Michele; Longoni, Paolo; Milanesi, Marco; Stucchi, Claudio; Cleris, Loredana; Formelli, Franca; Gianni, Massimo A
2002-11-01
Defibrotide is a polydeoxyribonucleotide, which significantly reduces the expression of adhesion molecules on endothelial cells. We investigated the activity of Defibrotide alone or in combination with recombinant human granulocyte colony-stimulating factor (rhG-CSF) to mobilize peripheral blood progenitor cells (PBPCs) in BALB/c mice. A 5-day treatment with Defibrotide alone (1-15 mg/mouse/day) had no effect on WBC counts, frequencies and absolute numbers of total circulating colony-forming cells (CFCs), i.e., granulocyte-macrophage colony-forming units, erythroid burst-forming units, and multilineage colony-forming units. As compared with mock-injected mice, administration of rhG-CSF alone (5 micro g/mouse/day) for 5 days significantly (P Defibrotide (15 mg/mouse/day) and rhG-CSF significantly (P Defibrotide plus rhG-CSF resulted in a significant increase (P Defibrotide/rhG-CSF-mobilized mononuclear cells rescued 43% and 71% of recipient mice, respectively. Experiments of CFC homing performed in lethally irradiated or nonirradiated recipients showed that marrow homing of transplanted PBPCs was reduced by 3-fold in Defibrotide-treated animals as compared with mock-injected mice (P Defibrotide might be because of an effect on PBPC trafficking. In conclusion, our data demonstrate that Defibrotide synergizes with rhG-CSF and significantly increases the mobilization of a broad spectrum of PBPCs, including primitive and committed progenitor cells. These data might have relevant implications for autologous and allogeneic anticancer therapy in humans.
Localization of Gamma-Ray Bursts Using the Fermi Gamma-Ray Burst Monitor
Connaughton, V.; Briggs, M.S.; Goldstein, A.; Meegan, C.A.; Paciesas, W.S.; Preece, R.D.; Wilson-Hodge, C.A.; Gibby, M.H.; Greiner, J.; Gruber, D.; Jenke, P.; Kippen, R.M.; Pelassa, V.; Xiong, S.; Yu, H-F.; Bhat, P.N.; Burgess, J.M.; Byrne, D.; Fitzpatrick, G.; Foley, S.; Giles, M.M.; Guiriec, S.; van der Horst, A.J.; von Kienlin, A.; McBreen, S.; McGlynn, S.; Tierney, D.; Zhang, B..B.
2015-01-01
The Fermi Gamma-ray Burst Monitor (GBM) has detected over 1400 gamma-ray bursts (GRBs) since it began science operations in 2008 July. We use a subset of over 300 GRBs localized by instruments such as Swift, the Fermi Large Area Telescope, INTEGRAL, and MAXI, or through triangulations from the
International Nuclear Information System (INIS)
Itoh, Hiroko; Nakata, Fukuyoshi; Sasaki, Hiroyuki; Ito, Hitoshi
2013-01-01
Reishi has been used for a roborant or the elixir of life from ancient times. In the present study, the preventive effects of Reishi on hematopoietic suppression from X-ray irradiation in mice were investigated. 5.0 Gy-irradiated mice induced the decrease of red blood cell, platelet, white blood cell, granulocytes, the index of spleen and thymus, and the number of spleen cells. Oral administration of Reishi tended to decrease these damage on hematopoiesis, and reticuloendothelial system. Reishi enhanced the degree of spleen cells-mediated sheep red blood cells (SRBC) hemolysis (quantitative hemolysis of SRBC). Reishi augmented the level of erythroid burst-forming cell (BFU-E), and accelerated the recovery of the number of BFU-E in X-irradiated mice, although Reishi did not influence red blood cell counts and colony-forming unit-erythropoetin dependent (CFU-E) number. A significant elevation in the CFU-GM (granulocytes-macrophages) level was observed. Histological examinations revealed that Reishi accerelated the hematopoietic recovery and decrease on damage of spleen and thymus. (author)
Directory of Open Access Journals (Sweden)
Jian-Guo Ren
2010-09-01
Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel
The afterglow of GRB 050709 and the nature of the short-hard gamma-ray bursts.
Fox, D B; Frail, D A; Price, P A; Kulkarni, S R; Berger, E; Piran, T; Soderberg, A M; Cenko, S B; Cameron, P B; Gal-Yam, A; Kasliwal, M M; Moon, D-S; Harrison, F A; Nakar, E; Schmidt, B P; Penprase, B; Chevalier, R A; Kumar, P; Roth, K; Watson, D; Lee, B L; Shectman, S; Phillips, M M; Roth, M; McCarthy, P J; Rauch, M; Cowie, L; Peterson, B A; Rich, J; Kawai, N; Aoki, K; Kosugi, G; Totani, T; Park, H-S; MacFadyen, A; Hurley, K C
2005-10-06
The final chapter in the long-standing mystery of the gamma-ray bursts (GRBs) centres on the origin of the short-hard class of bursts, which are suspected on theoretical grounds to result from the coalescence of neutron-star or black-hole binary systems. Numerous searches for the afterglows of short-hard bursts have been made, galvanized by the revolution in our understanding of long-duration GRBs that followed the discovery in 1997 of their broadband (X-ray, optical and radio) afterglow emission. Here we present the discovery of the X-ray afterglow of a short-hard burst, GRB 050709, whose accurate position allows us to associate it unambiguously with a star-forming galaxy at redshift z = 0.160, and whose optical lightcurve definitively excludes a supernova association. Together with results from three other recent short-hard bursts, this suggests that short-hard bursts release much less energy than the long-duration GRBs. Models requiring young stellar populations, such as magnetars and collapsars, are ruled out, while coalescing degenerate binaries remain the most promising progenitor candidates.
Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage
Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.
2013-01-01
Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...
Expression of assayable residual stem cell damage in erythroid differentiation
International Nuclear Information System (INIS)
Huebner, G.E.; Miller, M.E.; Cronkite, E.P.
1985-01-01
In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)
Therapeutic burst-suppression coma in pediatric febrile refractory status epilepticus.
Lin, Jainn-Jim; Chou, Cheng-Che; Lan, Shih-Yun; Hsiao, Hsiang-Ju; Wang, Yu; Chan, Oi-Wa; Hsia, Shao-Hsuan; Wang, Huei-Shyong; Lin, Kuang-Lin
2017-09-01
Evidence for the beneficial effect of therapeutic burst-suppression coma in pediatric patients with febrile refractory status epilepticus is limited, and the clinical outcomes of this treatment strategy are largely unknown. Therefore, the aim of this study was to explore the outcomes of therapeutic burst-suppression coma in a series of children with febrile refractory status epilepticus. We retrospectively reviewed consecutive pediatric patients with febrile refractory status epilepticus admitted to our pediatric intensive care unit between January 2000 and December 2013. The clinical characteristics were analyzed. Thirty-five patients (23 boys; age range: 1-18years) were enrolled, of whom 28 (80%) developed super-refractory status epilepticus. All of the patients received the continuous administration of intravenous antiepileptic drugs for febrile refractory status epilepticus, and 26 (74.3%) achieved therapeutic burst-suppression coma. All of the patients received mechanical ventilatory support, and 26 (74.3%) received inotropic agents. Eight (22.9%) patients died within 1month. The neurologically functional outcomes at 6months were good in six (27.3%) of the 22 survivors, of whom two returned to clinical baseline. The patients with therapeutic burst-suppression coma were significantly associated with hemodynamic support than the patients with electrographic seizures control (p=0.03), and had a trend of higher 1-month mortality rate, worse 6months outcomes, and a longer duration of hospitalization. Our results suggest that therapeutic burst-suppression coma to treat febrile refractory status epilepticus may lead to an increased risk of hemodynamic instability and a trend of worse outcomes. Copyright © 2017 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.
Morgan, Edward
The possibly transient X-ray Source in the globular cluster NGC 6652 has been seen by BeppoSax and the ASM on RXTE to undergo X-ray bursts, possibly Type I. Very little is known about this X-ray source, and confirmation of its bursts type-I nature would identify it as a neutron star binary. Type I bursts in 6 other sources have been shown to exhibit intervals of millisecond ocsillation that most likely indicate the neutron star spin period. Radius-expansion bursts can reveal information about the mass and size of the neutron star. We propose to use the ASM to trigger an observation of this source to maximize the probability of catching a burst in the PCA.
Transitions to Synchrony in Coupled Bursting Neurons
Dhamala, Mukeshwar; Jirsa, Viktor K.; Ding, Mingzhou
2004-01-01
Certain cells in the brain, for example, thalamic neurons during sleep, show spike-burst activity. We study such spike-burst neural activity and the transitions to a synchronized state using a model of coupled bursting neurons. In an electrically coupled network, we show that the increase of coupling strength increases incoherence first and then induces two different transitions to synchronized states, one associated with bursts and the other with spikes. These sequential transitions to synchronized states are determined by the zero crossings of the maximum transverse Lyapunov exponents. These results suggest that synchronization of spike-burst activity is a multi-time-scale phenomenon and burst synchrony is a precursor to spike synchrony.
Transitions to synchrony in coupled bursting neurons
International Nuclear Information System (INIS)
Dhamala, Mukeshwar; Jirsa, Viktor K.; Ding Mingzhou
2004-01-01
Certain cells in the brain, for example, thalamic neurons during sleep, show spike-burst activity. We study such spike-burst neural activity and the transitions to a synchronized state using a model of coupled bursting neurons. In an electrically coupled network, we show that the increase of coupling strength increases incoherence first and then induces two different transitions to synchronized states, one associated with bursts and the other with spikes. These sequential transitions to synchronized states are determined by the zero crossings of the maximum transverse Lyapunov exponents. These results suggest that synchronization of spike-burst activity is a multi-time-scale phenomenon and burst synchrony is a precursor to spike synchrony
The Second SWIFT Burst Alert Telescope (BAT) Gamma-Ray Burst Catalog
Sakamoto, T.; Barthelmy, S. D.; Baumgartner, W. H.; Cummings, J. R.; Fenimore, E. E.; Gehrels, N.; Krimm, H. A.; Markwardt, C. B.; Palmer, D. M.; Parsons, A. M.;
2012-01-01
We present the second Swift Burst Alert Telescope (BAT) catalog of gamma-ray bursts. (GRBs), which contains 476 bursts detected by the BAT between 2004 December 19 and 2009 December 21. This catalog (hereafter the BAT2 catalog) presents burst trigger time, location, 90% error radius, duration, fluence, peak flux, time-averaged spectral parameters and time-resolved spectral parameters measured by the BAT. In the correlation study of various observed parameters extracted from the BAT prompt emission data, we distinguish among long-duration GRBs (L-GRBs), short-duration GRBs (S-GRBs), and short-duration GRBs with extended emission (S-GRBs with E.E.) to investigate differences in the prompt emission properties. The fraction of L-GRBs, S-GRBs and S-GRBs with E.E. in the catalog are 89%, 8% and 2% respectively. We compare the BAT prompt emission properties with the BATSE, BeppoSAX and HETE-2 GRB samples.. We also correlate the observed prompt emission properties with the redshifts for the GRBs with known redshift. The BAT T(sub 90) and T(sub 50) durations peak at 70 s and 30 s, respectively. We confirm that the spectra of the BAT S-GRBs are generally harder than those of the L-GRBs.
Proteomic analysis reveals heat shock protein 70 has a key role in polycythemia Vera.
Gallardo, Miguel; Barrio, Santiago; Fernandez, Marisol; Paradela, Alberto; Arenas, Alicia; Toldos, Oscar; Ayala, Rosa; Albizua, Enriqueta; Jimenez, Ana; Redondo, Santiago; Garcia-Martin, Rosa Maria; Gilsanz, Florinda; Albar, Juan Pablo; Martinez-Lopez, Joaquin
2013-11-19
JAK-STAT signaling through the JAK2V617F mutation is central to the pathogenesis of myeloproliferative neoplasms (MPN). However, other events could precede the JAK2 mutation. The aim of this study is to analyze the phenotypic divergence between polycytemia vera (PV) and essential thrombocytemia (ET) to find novel therapeutics targets by a proteomic and functional approach to identify alternative routes to JAK2 activation. Through 2D-DIGE and mass spectrometry of granulocyte protein from 20 MPN samples, showed differential expression of HSP70 in PV and ET besides other 60 proteins. Immunohistochemistry of 46 MPN bone marrow samples confirmed HSP70 expression. The median of positive granulocytes was 80% in PV (SD 35%) vs. 23% in ET (SD 34.25%). In an ex vivo model KNK437 was used as an inhibition model assay of HSP70, showed dose-dependent inhibition of cell growth and burst formation unit erythroid (BFU-E) in PV and ET, increased apoptosis in the erythroid lineage, and decreased pJAK2 signaling, as well as a specific siRNA for HSP70. These data suggest a key role for HSP70 in proliferation and survival of the erythroid lineage in PV, and may represent a potential therapeutic target in MPN, especially in PV.
Stellar Sources of Gamma-ray Bursts
Luchkov, B. I.
2011-01-01
Correlation analysis of Swift gamma-ray burst coordinates and nearby star locations (catalog Gliese) reveals 4 coincidences with good angular accuracy. The random probability is 4\\times 10^{-5}, so evidencing that coincident stars are indeed gamma-ray burst sources. Some additional search of stellar gamma-ray bursts is discussed.
A NEW CLASS OF GAMMA-RAY BURSTS FROM STELLAR DISRUPTIONS BY INTERMEDIATE-MASS BLACK HOLES
International Nuclear Information System (INIS)
Gao, H.; Lu, Y.; Zhang, S. N.
2010-01-01
It has been argued that the long gamma-ray burst (GRB) of GRB 060614 without an associated supernova (SN) has challenged the current classification and fuel model for long GRBs, and thus a tidal disruption model has been proposed to account for such an event. Since it is difficult to detect SNe for long GRBs at high redshift, the absence of an SN association cannot be regarded as the solid criterion for a new classification of long GRBs similar to GRB 060614, called GRB 060614-type bursts. Fortunately, we now know that there is an obvious periodic substructure observed in the prompt light curve of GRB 060614. We thus use such periodic substructure as a potential criterion to categorize some long GRBs into a new class of bursts, which might have been fueled by an intermediate-mass black hole (IMBH) gulping a star, rather than a massive star collapsing to form a black hole. Therefore, the second criterion to recognize for this new class of bursts is whether they fit the tidal disruption model. From a total of 328 Swift GRBs with accurately measured durations and without SN association, we find 25 GRBs satisfying the criteria for GRB 060614-type bursts: seven of them are with known redshifts and 18 with unknown redshifts. These new bursts are ∼6% of the total Swift GRBs, which are clustered into two subclasses: Type I and Type II with considerably different viscous parameters of accretion disks formed by tidally disrupting their different progenitor stars. We suggest that the two different kinds of progenitors are solar-type stars and white dwarfs: the progenitors for four Type I bursts with viscous parameter of around 0.1 are solar-type stars, and the progenitors for 21 Type II bursts with viscous parameter of around 0.3 are white dwarfs. The potential applications of this new class of GRBs as cosmic standard candles are discussed briefly.
Neutrino burst identification in underground detectors
International Nuclear Information System (INIS)
Fulgione, W.; Mengotti-Silva, N.; Panaro, L.
1996-01-01
We discuss the problem of neutrino burst identification in underground ν-telescopes. First the usual statistical analysis based on the time structure of the events is reviewed, with special attention to the statistical significance of burst candidates. Next, we propose a second level analysis that can provide independent confirmation of burst detection. This exploits the spatial distribution of the single events of a burst candidate, and uses the formalism of the entropy of information. Examples of both techniques are shown, based on the LVD experiment at Gran Sasso. (orig.)
Swift: A gamma ray burst MIDEX
International Nuclear Information System (INIS)
Barthelmy, Scott
2001-01-01
Swift is a first of its kind multiwavelength transient observatory for gamma-ray burst astronomy. It has the optimum capabilities for the next breakthroughs in determining the origin of gamma-ray bursts and their afterglows as well as using bursts to probe the early Universe. Swift will also perform the first sensitive hard X-ray survey of the sky. The mission is being developed by an international collaboration and consists of three instruments, the Burst Alert Telescope (BAT), the X-ray Telescope (XRT), and the Ultraviolet and Optical Telescope (UVOT). The BAT, a wide-field gamma-ray detector, will detect ∼1 gamma-ray burst per day with a sensitivity 5 times that of BATSE. The sensitive narrow-field XRT and UVOT will be autonomously slewed to the burst location in 20 to 70 seconds to determine 0.3-5.0 arcsec positions and perform optical, UV, and X-ray spectrophotometry. On-board measurements of redshift will also be done for hundreds of bursts. Swift will incorporate superb, low-cost instruments using existing flight-spare hardware and designs. Strong education/public outreach and follow-up programs will help to engage the public and astronomical community. Swift has been selected by NASA for development and launch in late 2003
Larghero, Jérôme; Gervais, Nathalie; Cassinat, Bruno; Rain, Jean-Didier; Schlageter, Marie-Hélène; Padua, Rose Ann; Chomienne, Christine; Rousselot, Philippe
2005-05-01
Polycythemia vera (PV) is an acquired myeloproliferative disorder with primary expansion of the red cell mass leading to an increased risk of thrombosis and less frequently to myelofibrosis and secondary acute leukemia. Standard therapies include cytoreduction with either phlebotomy or chemotherapeutic agents and antithrombotic drugs. Because long-term exposure to cytotoxic chemotherapy may increase the risk of acute transformation, new therapeutic options are needed. Tipifarnib is a nonpeptidomimetic inhibitor of farnesyl transferase that was developed as a potential inhibitor of RAS signaling. In the present study we report that tipifarnib used at pharmacologically achievable concentrations strongly inhibits the erythroid burst-forming unit (BFU-E) autonomous growth that characterizes patients with PV. Moreover, at low tipifarnib concentrations (0.15 muM), the inhibitory effect was preferentially observed in PV BFU-E progenitors and not in normal BFU-E progenitors and was not rescued by erythropoietin (EPO). Thus tipifarnib may specifically target PV stem cells and may be of clinical interest in the treatment of patients with PV.
vanderHorst, A. J.; Kouveliotou, C.; Gorgone, N. M.; Kaneko, Y.; Baring, M. G.; Guiriec, S.; Gogus, E,; Granot, J.; Watts, A. L.; Lin, L.;
2012-01-01
We have performed detailed temporal and time-integrated spectral analysis of 286 bursts from SGR J1550-5418 detected with the Fermi Gamma-ray Burst Monitor (GBM) in 2009 January, resulting in the largest uniform sample of temporal and spectral properties of SGR J1550-5418 bursts. We have used the combination of broadband and high time-resolution data provided with GBM to perform statistical studies for the source properties.We determine the durations, emission times, duty cycles, and rise times for all bursts, and find that they are typical of SGR bursts. We explore various models in our spectral analysis, and conclude that the spectra of SGR J15505418 bursts in the 8-200 keV band are equally well described by optically thin thermal bremsstrahlung (OTTB), a power law (PL) with an exponential cutoff (Comptonized model), and two blackbody (BB) functions (BB+BB). In the spectral fits with the Comptonized model, we find a mean PL index of -0.92, close to the OTTB index of -1. We show that there is an anti-correlation between the Comptonized E(sub peak) and the burst fluence and average flux. For the BB+BBfits, we find that the fluences and emission areas of the two BB functions are correlated. The low-temperature BB has an emission area comparable to the neutron star surface area, independent of the temperature, while the high temperature BB has a much smaller area and shows an anti-correlation between emission area and temperature.We compare the properties of these bursts with bursts observed from other SGR sources during extreme activations, and discuss the implications of our results in the context of magnetar burst models.
A direct localization of a fast radio burst and its host.
Chatterjee, S; Law, C J; Wharton, R S; Burke-Spolaor, S; Hessels, J W T; Bower, G C; Cordes, J M; Tendulkar, S P; Bassa, C G; Demorest, P; Butler, B J; Seymour, A; Scholz, P; Abruzzo, M W; Bogdanov, S; Kaspi, V M; Keimpema, A; Lazio, T J W; Marcote, B; McLaughlin, M A; Paragi, Z; Ransom, S M; Rupen, M; Spitler, L G; van Langevelde, H J
2017-01-04
Fast radio bursts are astronomical radio flashes of unknown physical nature with durations of milliseconds. Their dispersive arrival times suggest an extragalactic origin and imply radio luminosities that are orders of magnitude larger than those of all known short-duration radio transients. So far all fast radio bursts have been detected with large single-dish telescopes with arcminute localizations, and attempts to identify their counterparts (source or host galaxy) have relied on the contemporaneous variability of field sources or the presence of peculiar field stars or galaxies. These attempts have not resulted in an unambiguous association with a host or multi-wavelength counterpart. Here we report the subarcsecond localization of the fast radio burst FRB 121102, the only known repeating burst source, using high-time-resolution radio interferometric observations that directly image the bursts. Our precise localization reveals that FRB 121102 originates within 100 milliarcseconds of a faint 180-microJansky persistent radio source with a continuum spectrum that is consistent with non-thermal emission, and a faint (twenty-fifth magnitude) optical counterpart. The flux density of the persistent radio source varies by around ten per cent on day timescales, and very long baseline radio interferometry yields an angular size of less than 1.7 milliarcseconds. Our observations are inconsistent with the fast radio burst having a Galactic origin or its source being located within a prominent star-forming galaxy. Instead, the source appears to be co-located with a low-luminosity active galactic nucleus or a previously unknown type of extragalactic source. Localization and identification of a host or counterpart has been essential to understanding the origins and physics of other kinds of transient events, including gamma-ray bursts and tidal disruption events. However, if other fast radio bursts have similarly faint radio and optical counterparts, our findings imply that
INTEGRAL monitoring of unusually long X-ray bursts
DEFF Research Database (Denmark)
of the accreted material, these bursts may be explained by either the unstable burning of a large pile of mixed hydrogen and helium, or the ignition of a thick pure helium layer. Long duration bursts are particularly expected at very low accretion rates and make possible to study the transition from a hydrogen......Thermonuclear bursts on the surface of accreting neutron stars in low mass X-ray binaries have been studied for many years and have in a few cases confirmed theoretical models of nuclear ignition and burning mechanisms. The large majority of X-ray bursts last less than 100s. A good number......-rich bursting regime to a pure helium regime. Moreover, a handful of long bursts have shown, before the extended decay phase, an initial spike similar to a normal short X-ray burst. Such twofold bursts might be a sort of link between short and super-bursts, where the premature ignition of a carbon layer could...
Bursting synchronization in scale-free networks
International Nuclear Information System (INIS)
Batista, C.A.S.; Batista, A.M.; Pontes, J.C.A. de; Lopes, S.R.; Viana, R.L.
2009-01-01
Neuronal networks in some areas of the brain cortex present the scale-free property, i.e., the neuron connectivity is distributed according to a power-law, such that neurons are more likely to couple with other already well-connected ones. Neuron activity presents two timescales, a fast one related to action-potential spiking, and a slow timescale in which bursting takes place. Some pathological conditions are related with the synchronization of the bursting activity in a weak sense, meaning the adjustment of the bursting phase due to coupling. Hence it has been proposed that an externally applied time-periodic signal be applied in order to control undesirable synchronized bursting rhythms. We investigated this kind of intervention using a two-dimensional map to describe neurons with spiking-bursting activity in a scale-free network.
BATSE/OSSE Rapid Burst Response
National Research Council Canada - National Science Library
Matz, S. M; Grove, J. E; Johnson, W. N; Kurfess, J. D; Share, G. H; Fishman, G. J; Meegan, Charles A
1995-01-01
...) slew the OSSE detectors to burst locations determined on-board by BATSE. This enables OSSE to make sensitive searches for prompt and delayed post-burst line and continuum emission above 50 keV...
Some polarization features of solar microwave bursts
Energy Technology Data Exchange (ETDEWEB)
Uralov, A M; Nefed' ev, V P [AN SSSR, Irkutsk. Sibirskij Inst. Zemnogo Magnetizma Ionosfery i Rasprostraneniya Radiovoln
1977-01-01
Consequences of the thermal microwave burst model proposed earlier have been considered. According to the model the centimeter burst is generated at the heat propagation to the upper atmosphere. The polarization features of the burst are explained: a change of the polarization sign in a frequency range, a rapid change of the polarization sign in the development of a burst at a fixed frequency, a lack of time coincidence of the moments of the burst maximum of the polarization and of the total flux. From the model the consequences are obtained, which are still not confirmed by experiment. An ordinary-type wave prevails in the burst radiation, in the course of which the polarization degree falls on the ascending branch of bursts development. At the change of the polarization sign at the fixed frequency prior to the sign change an ordinary-type wave should be present in excess and later an extreordinary type wave.
Network and external perturbation induce burst synchronisation in cat cerebral cortex
Lameu, Ewandson L.; Borges, Fernando S.; Borges, Rafael R.; Batista, Antonio M.; Baptista, Murilo S.; Viana, Ricardo L.
2016-05-01
The brain of mammals are divided into different cortical areas that are anatomically connected forming larger networks which perform cognitive tasks. The cat cerebral cortex is composed of 65 areas organised into the visual, auditory, somatosensory-motor and frontolimbic cognitive regions. We have built a network of networks, in which networks are connected among themselves according to the connections observed in the cat cortical areas aiming to study how inputs drive the synchronous behaviour in this cat brain-like network. We show that without external perturbations it is possible to observe high level of bursting synchronisation between neurons within almost all areas, except for the auditory area. Bursting synchronisation appears between neurons in the auditory region when an external perturbation is applied in another cognitive area. This is a clear evidence that burst synchronisation and collective behaviour in the brain might be a process mediated by other brain areas under stimulation.
Gamma Ray Bursts-Afterglows and Counterparts
Fishman, Gerald J
1998-01-01
Several breakthrough discoveries were made last year of x-ray, optical and radio afterglows and counterparts to gamma-ray bursts, and a redshift has been associated with at least one of these. These discoveries were made possible by the fast, accurate gamma-ray burst locations of the BeppoSAX satellite. It is now generally believed that the burst sources are at cosmological distances and that they represent the most powerful explosions in the Universe. These observations also open new possibilities for the study of early star formation, the physics of extreme conditions and perhaps even cosmology. This session will concentrate on recent x-ray, optical and radio afterglow observations of gamma-ray bursts, associated redshift measurements, and counterpart observations. Several review and theory talks will also be presented, along with a summary of the astrophysical implications of the observations. There will be additional poster contributions on observations of gamma-ray burst source locations at wavelengths other than gamma rays. Posters are also solicited that describe new observational capabilities for rapid follow-up observations of gamma-ray bursts.
Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S
2015-07-01
Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.
Energy Technology Data Exchange (ETDEWEB)
Van der Horst, A. J.; Finger, M. H. [Universities Space Research Association, NSSTC, Huntsville, AL 35805 (United States); Kouveliotou, C. [Space Science Office, VP62, NASA/Marshall Space Flight Center, Huntsville, AL 35812 (United States); Gorgone, N. M. [Connecticut College, New London, CT 06320 (United States); Kaneko, Y.; Goegues, E.; Lin, L. [Sabanc Latin-Small-Letter-Dotless-I University, Orhanl Latin-Small-Letter-Dotless-I -Tuzla, Istanbul 34956 (Turkey); Baring, M. G. [Department of Physics and Astronomy, Rice University, MS-108, P.O. Box 1892, Houston, TX 77251 (United States); Guiriec, S.; Bhat, P. N.; Chaplin, V. L.; Goldstein, A. [University of Alabama, Huntsville, CSPAR, Huntsville, AL 35805 (United States); Granot, J. [Racah Institute of Physics, Hebrew University, Jerusalem 91904 (Israel); Watts, A. L. [Astronomical Institute ' Anton Pannekoek' , University of Amsterdam, Postbus 94249, 1090 GE Amsterdam (Netherlands); Bissaldi, E.; Gruber, D. [Max Planck Institute for Extraterrestrial Physics, Giessenbachstrasse, Postfach 1312, 85748 Garching (Germany); Gehrels, N.; Harding, A. K. [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Gibby, M. H.; Giles, M. M., E-mail: A.J.VanDerHorst@uva.nl [Jacobs Technology, Inc., Huntsville, AL (United States); and others
2012-04-20
We have performed detailed temporal and time-integrated spectral analysis of 286 bursts from SGR J1550-5418 detected with the Fermi Gamma-ray Burst Monitor (GBM) in 2009 January, resulting in the largest uniform sample of temporal and spectral properties of SGR J1550-5418 bursts. We have used the combination of broadband and high time-resolution data provided with GBM to perform statistical studies for the source properties. We determine the durations, emission times, duty cycles, and rise times for all bursts, and find that they are typical of SGR bursts. We explore various models in our spectral analysis, and conclude that the spectra of SGR J1550-5418 bursts in the 8-200 keV band are equally well described by optically thin thermal bremsstrahlung (OTTB), a power law (PL) with an exponential cutoff (Comptonized model), and two blackbody (BB) functions (BB+BB). In the spectral fits with the Comptonized model, we find a mean PL index of -0.92, close to the OTTB index of -1. We show that there is an anti-correlation between the Comptonized E{sub peak} and the burst fluence and average flux. For the BB+BB fits, we find that the fluences and emission areas of the two BB functions are correlated. The low-temperature BB has an emission area comparable to the neutron star surface area, independent of the temperature, while the high-temperature BB has a much smaller area and shows an anti-correlation between emission area and temperature. We compare the properties of these bursts with bursts observed from other SGR sources during extreme activations, and discuss the implications of our results in the context of magnetar burst models.
High-energy emission from gamma-ray bursts
International Nuclear Information System (INIS)
Nolan, P.L.; Share, G.H.; Matz, S.; Chupp, E.L.; Forrest, D.J.; Rieger, E.
1984-01-01
We discuss broad-band continuum spectroscopy of 17 gamma-ray bursts above 0.3 MeV. The spectra were fitted by 3 trial functions, none of which provided an adequate fit to all the spectra. Most were too hard for a thermal bremsstarhlung function. Harder functional forms, such as thermal synchrotron or power-law, provide better fits for most of the spectra. The strong emission observed above 1 MeV raises some interesting theoretical questions
International Nuclear Information System (INIS)
Gaipa, G; Bugarin, C; Cianci, P; Sarno, J; Bonaccorso, P; Biondi, A; Selicorni, A
2015-01-01
Germline mutations in genes coding for molecules involved in the RAS/RAF/MEK/ERK pathway are the hallmarks of a newly classified family of autosomal dominant syndromes termed RASopathies. Myeloproliferative disorders (MPDs), in particular, juvenile myelomonocytic leukemia, can lead to potentially severe complications in children with Noonan syndrome (NS). We studied 27 children with NS or other RASopathies and 35 age-matched children as control subjects. Peripheral blood (PB) cells from these patients were studied for in vitro colony-forming units (CFUs) activity, as well as for intracellular phosphosignaling. Higher spontaneous growth of both burst-forming units-erythroid (BFU-E) and CFU-granulocyte/macrophage (CFU-GM) colonies from RAS-mutated patients were observed as compared with control subjects. We also observed a significantly higher amount of GM-colony-stimulating factor-induced p-ERK in children with RASopathies. Our findings demonstrate for the first time that PB cells isolated from children suffering from NS or other RASopathies without MPD display enhanced BFU-E and CFU-GM colony formation in vitro. The biological significance of these findings clearly awaits further studies. Collectively, our data provide a basis for further investigating of only partially characterized hematological alterations present in children suffering from RASopathies, and may provide new markers for progression toward malignant MPD in these patients
The host galaxy and optical light curve of the gamma-ray burst GRB 980703
DEFF Research Database (Denmark)
Holland, S.; Fynbo, J.P.U.; Hjorth, J.
2001-01-01
We present deep HST/STIS and ground-based photometry of the host galaxy of the gamma-ray burst GRB 980703 taken 17, 551, 710, and 716 days after the burst. We find that the host is a blue, slightly over-luminous galaxy with V-gal = 23.00 +/-0.10, (V - R)(gal) = 0.43 +/-0.13, and a centre...... 980703 with any special features in the host. The host galaxy appears to be a typical example of a compact star forming galaxy similar to those found in the Hubble Deep Field North. The R-band light curve of the optical afterglow associated with this gamma-ray burst is consistent with a single power...
THE FIVE YEAR FERMI/GBM MAGNETAR BURST CATALOG
Energy Technology Data Exchange (ETDEWEB)
Collazzi, A. C. [SciTec, Inc., 100 Wall Street, Princeton, NJ 08540 (United States); Kouveliotou, C.; Horst, A. J. van der; Younes, G. A. [Department of Physics, The George Washington University, 725 21st Street NW, Washington, DC 20052 (United States); Kaneko, Y.; Göğüş, E. [Sabancı University, Orhanlı-Tuzla, İstanbul 34956 (Turkey); Lin, L. [François Arago Centre, APC, 10 rue Alice Domon et Léonie Duquet, F-75205 Paris (France); Granot, J. [Department of Natural Sciences, The Open University of Israel, 1 University Road, P.O. Box 808, Raanana 43537 (Israel); Finger, M. H. [Universities Space Research Association, NSSTC, 320 Sparkman Drive, Huntsville, AL 35805 (United States); Chaplin, V. L. [School of Medicine, Vanderbilt University, 1161 21st Avenue S, Nashville, TN 37232 (United States); Huppenkothen, D. [Center for Data Science, New York University, 726 Broadway, 7th Floor, New York, NY 10003 (United States); Watts, A. L. [Anton Pannekoek Institute, University of Amsterdam, Postbus 94249, 1090 GE Amsterdam (Netherlands); Kienlin, A. von [Max-Planck-Institut für extraterrestrische Physik, Giessenbachstrasse 1, D-85748 Garching (Germany); Baring, M. G. [Department of Physics and Astronomy, Rice University, MS-108, P.O. Box 1892, Houston, TX 77251 (United States); Gruber, D. [Planetarium Südtirol, Gummer 5, I-39053 Karneid (Italy); Bhat, P. N. [CSPAR, University of Alabama in Huntsville, 320 Sparkman Drive, Huntsville, AL 35899 (United States); Gibby, M. H., E-mail: acollazzi@scitec.com [Jacobs Technology, Inc., Huntsville, AL (United States); and others
2015-05-15
Since launch in 2008, the Fermi Gamma-ray Burst Monitor (GBM) has detected many hundreds of bursts from magnetar sources. While the vast majority of these bursts have been attributed to several known magnetars, there is also a small sample of magnetar-like bursts of unknown origin. Here, we present the Fermi/GBM magnetar catalog, providing the results of the temporal and spectral analyses of 440 magnetar bursts with high temporal and spectral resolution. This catalog covers the first five years of GBM magnetar observations, from 2008 July to 2013 June. We provide durations, spectral parameters for various models, fluences, and peak fluxes for all the bursts, as well as a detailed temporal analysis for SGR J1550–5418 bursts. Finally, we suggest that some of the bursts of unknown origin are associated with the newly discovered magnetar 3XMM J185246.6+0033.7.
Hierarchic Analysis Method to Evaluate Rock Burst Risk
Directory of Open Access Journals (Sweden)
Ming Ji
2015-01-01
Full Text Available In order to reasonably evaluate the risk of rock bursts in mines, the factors impacting rock bursts and the existing grading criterion on the risk of rock bursts were studied. By building a model of hierarchic analysis method, the natural factors, technology factors, and management factors that influence rock bursts were analyzed and researched, which determined the degree of each factor’s influence (i.e., weight and comprehensive index. Then the grade of rock burst risk was assessed. The results showed that the assessment level generated by the model accurately reflected the actual risk degree of rock bursts in mines. The model improved the maneuverability and practicability of existing evaluation criteria and also enhanced the accuracy and science of rock burst risk assessment.
EDGE: explorer of diffuse emission and gamma-ray burst explosions
den Herder, J.W.; Piro, L.; Ohashi, T.; Amati, L.; Atteia, J.; Barthelmy, S.D.; Barbera, M.; Barret, D.; Basso, S.; de Boer, M.; Borgani, S.; Boyarskiy, O.; Branchini, E.; Branduardi-Raymont, G.; Briggs, M.; Brunetti, G.; Budtz-Jorgensenf, C.; Burrows, D.N.; Campana, S.; Caroli, E.; Chincarini, G.; Christensen, F.; Cocchi, M.; Comastri, A.; Corsi, A.; Cotroneo, V.; Conconi, P.; Colasanti, L.; Cusamano, G.; Rosa, A.; Del Santo, M.; Ettori, S.; Ezoe, Y.; Ferrari, L.; Feroci, M.; Finger, M.; Fishman, G.; Fujimoto, R.; Galeazzi, M.; Galli, A.; Gatti, F.; Gehrels, N.; Gendre, B.; Ghirlanda, G.; Ghisellini, G.; Giommi, P.; Girardi, M.; Guzzo, L.; Haardt, F.; Hepburn, I.; Hermsen, W.; Hoevers, H.; Holland, A.; in 't Zand, J.J.M.; Ishisaki, Y.; Kawahara, H.; Kawai, N.; Kaastra, J.; Kippen, M.; de Korte, P.A.J.; Kouveliotou, C.; Kusenko, A.; Labanti, C.; Lieu, R.; Macculi, C.; Makishima, K.; Matt, G.; Mazotta, P.; McCammon, D.; Méndez, M.; Mineo, T.; Mitchell, S.; Mitsuda, K.; Molendi, S.; Moscardini, L.; Mushotzky, R.; Natalucci, L.; Nicastro, F.; O'Brien, P.; Osborne, J.; Paerels, F.; Page, M.; Paltani, S.; Pareschi, G.; Perinati, E.; Perola, C.; Ponman, T.; Rasmussen, A.; Roncarelli, M.; Rosati, P.; Ruchayskiy, O.; Quadrini, E.; Sakurai, I.; Salvaterra, R.; Sasaki, S.; Wijers, R.; et al., [Unknown
2007-01-01
How structures of various scales formed and evolved from the early Universe up to present time is a fundamental question of astrophysics. EDGE will trace the cosmic history of the baryons from the early generations of massive stars by Gamma-Ray Burst (GRB) explosions, through the period of galaxy
Observation of gamma-ray bursts with GINGA
International Nuclear Information System (INIS)
Murakami, Toshio; Fujii, Masami; Nishimura, Jun
1989-01-01
Gamma-ray Burst Detector System (GBD) on board the scientific satellite 'GINGA' which was launched on Feb. 5, 1987, was realized as an international cooperation between ISAS and LANL. It has recorded more than 40 Gamma-Ray Burst candidates during 20 months observation. Although many observational evidences were accumulated in past 20 years after the discovery of gamma-ray burst by LANL scientists, there are not enough evidence to determine the origin and the production mechanism of the gamma-ray burst. GBD consists of a proportional counter and a NaI scintillation counter so that it became possible to observe energy spectrum of the gamma-ray burst with high energy resolution over wide range of energy (1.5-380 keV) together with high time resolution. As the result of observation, the following facts are obtained: (1) A large fraction of observed gamma-ray bursts has a long X-ray tail after the harder part of gamma-ray emission has terminated. (2) Clear spectral absorption features with harmonic in energy was observed in some of the energy spectrum of gamma-ray bursts. These evidences support the hypothesis that the strongly magnetized neutron star is the origin of gamma-ray burst. (author)
Swift Burst Alert Telescope (BAT) Instrument Response
International Nuclear Information System (INIS)
Parsons, A.; Barthelmy, S.; Cummings, J.; Gehrels, N.; Hullinger, D.; Krimm, H.; Markwardt, C.; Tueller, J.; Fenimore, E.; Palmer, D.; Sato, G.; Takahashi, T.; Nakazawa, K.; Okada, Y.; Takahashi, H.; Suzuki, M.; Tashiro, M.
2004-01-01
The Burst Alert Telescope (BAT), a large coded aperture instrument with a wide field-of-view (FOV), provides the gamma-ray burst triggers and locations for the Swift Gamma-Ray Burst Explorer. In addition to providing this imaging information, BAT will perform a 15 keV - 150 keV all-sky hard x-ray survey based on the serendipitous pointings resulting from the study of gamma-ray bursts, and will also monitor the sky for transient hard x-ray sources. For BAT to provide spectral and photometric information for the gamma-ray bursts, the transient sources and the all-sky survey, the BAT instrument response must be determined to an increasingly greater accuracy. This paper describes the spectral models and the ground calibration experiments used to determine the BAT response to an accuracy suitable for gamma-ray burst studies
Czech Academy of Sciences Publication Activity Database
Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.
2007-01-01
Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007
Variability in fluence and spectrum of high-energy photon bursts produced by lightning leaders
Celestin , Sebastien; Xu , Wei; Pasko , Victor P.
2015-01-01
International audience; In this paper, we model the production and acceleration of thermal runaway electrons during negative corona flash stages of stepping lightning leaders and the corresponding terrestrial gamma ray flashes (TGFs) or negative cloud-to-ground (−CG) lightning-produced X-ray bursts in a unified fashion. We show how the source photon spectrum and fluence depend on the potential drop formed in the lightning leader tip region during corona flash and how the X-ray burst spectrum ...
Recent results of zebra patterns in solar radio bursts
International Nuclear Information System (INIS)
Chernov, Gennady P.
2010-01-01
This review covers the most recent experimental results and theoretical research on zebra patterns (ZPs) in solar radio bursts. The basic attention is given to events with new peculiar elements of zebra patterns received over the last few years. All new properties are considered in light of both what was known earlier and new theoretical models. Large-scale ZPs consisting of small-scale fiber bursts could be explained by simultaneous inclusion of two mechanisms when whistler waves 'highlight' the levels of double plasma resonance (DPR). A unique fine structure was observed in the event on 2006 December 13: spikes in absorption formed dark ZP stripes against the absorptive type III-like bursts. The spikes in absorption can appear in accordance with well known mechanisms of absorptive bursts. The additional injection of fast particles filled the loss-cone (breaking the loss-cone distribution), and the generation of the continuum was quenched at these moments. The maximum absorptive effect occurs at the DPR levels. The parameters of millisecond spikes are determined by small dimensions of the particle beams and local scale heights in the radio source. Thus, the DPR model helps to understand several aspects of unusual elements of ZPs. However, the simultaneous existence of several tens of the DPR levels in the corona is impossible for any realistic profile of the plasma density and magnetic field. Three new theories of ZPs are examined. The formation of eigenmodes of transparency and opacity during the propagation of radio waves through regular coronal inhomogeneities is the most natural and promising mechanism. Two other models (nonlinear periodic space - charge waves and scattering of fast protons on ion-sound harmonics) could happen in large radio bursts. (invited reviews)
Brdar, Vedran; Kopp, Joachim; Liu, Jia
2017-03-01
Many theories of dark matter (DM) predict that DM particles can be captured by stars via scattering on ordinary matter. They subsequently condense into a DM core close to the center of the star and eventually annihilate. In this work, we trace DM capture and annihilation rates throughout the life of a massive star and show that this evolution culminates in an intense annihilation burst coincident with the death of the star in a core collapse supernova. The reason is that, along with the stellar interior, also its DM core heats up and contracts, so that the DM density increases rapidly during the final stages of stellar evolution. We argue that, counterintuitively, the annihilation burst is more intense if DM annihilation is a p -wave process than for s -wave annihilation because in the former case, more DM particles survive until the supernova. If among the DM annihilation products are particles like dark photons that can escape the exploding star and decay to standard model particles later, the annihilation burst results in a flash of gamma rays accompanying the supernova. For a galactic supernova, this "dark gamma-ray burst" may be observable in the Čerenkov Telescope Array.
A short gamma-ray burst apparently associated with an elliptical galaxy at redshift z = 0.225.
Gehrels, N; Sarazin, C L; O'Brien, P T; Zhang, B; Barbier, L; Barthelmy, S D; Blustin, A; Burrows, D N; Cannizzo, J; Cummings, J R; Goad, M; Holland, S T; Hurkett, C P; Kennea, J A; Levan, A; Markwardt, C B; Mason, K O; Meszaros, P; Page, M; Palmer, D M; Rol, E; Sakamoto, T; Willingale, R; Angelini, L; Beardmore, A; Boyd, P T; Breeveld, A; Campana, S; Chester, M M; Chincarini, G; Cominsky, L R; Cusumano, G; de Pasquale, M; Fenimore, E E; Giommi, P; Gronwall, C; Grupe, D; Hill, J E; Hinshaw, D; Hjorth, J; Hullinger, D; Hurley, K C; Klose, S; Kobayashi, S; Kouveliotou, C; Krimm, H A; Mangano, V; Marshall, F E; McGowan, K; Moretti, A; Mushotzky, R F; Nakazawa, K; Norris, J P; Nousek, J A; Osborne, J P; Page, K; Parsons, A M; Patel, S; Perri, M; Poole, T; Romano, P; Roming, P W A; Rosen, S; Sato, G; Schady, P; Smale, A P; Sollerman, J; Starling, R; Still, M; Suzuki, M; Tagliaferri, G; Takahashi, T; Tashiro, M; Tueller, J; Wells, A A; White, N E; Wijers, R A M J
2005-10-06
Gamma-ray bursts (GRBs) come in two classes: long (> 2 s), soft-spectrum bursts and short, hard events. Most progress has been made on understanding the long GRBs, which are typically observed at high redshift (z approximately 1) and found in subluminous star-forming host galaxies. They are likely to be produced in core-collapse explosions of massive stars. In contrast, no short GRB had been accurately (burst GRB 050509B. Its position on the sky is near a luminous, non-star-forming elliptical galaxy at a redshift of 0.225, which is the location one would expect if the origin of this GRB is through the merger of neutron-star or black-hole binaries. The X-ray afterglow was weak and faded below the detection limit within a few hours; no optical afterglow was detected to stringent limits, explaining the past difficulty in localizing short GRBs.
BURST AND OUTBURST CHARACTERISTICS OF MAGNETAR 4U 0142+61
Energy Technology Data Exchange (ETDEWEB)
Göğüş, Ersin; Chakraborty, Manoneeta; Kaneko, Yuki [Sabancı University, Orhanlı-Tuzla, İstanbul 34956 (Turkey); Lin, Lin [Department of Astronomy, Beijing Normal University, Beijing 100875 (China); Roberts, Oliver J. [School of Physics, University College Dublin, Stillorgan Road, Belfield, Dublin 4 (Ireland); Gill, Ramandeep; Granot, Jonathan [Department of Natural Sciences, The Open University of Israel, 1 University Road, P.O. Box 808, Ranana 43537 (Israel); Horst, Alexander J. van der; Kouveliotou, Chryssa; Younes, George [Department of Physics, The George Washington University, Washington, DC 20052 (United States); Watts, Anna L. [Anton Pannekoek Institute for Astronomy, University of Amsterdam, Postbus 94249, NL-1090 GE Amsterdam (Netherlands); Baring, Matthew [Department of Physics and Astronomy, Rice University, MS-108, P.O. Box 1892, Houston, TX 77251 (United States); Huppenkothen, Daniela [Center for Data Science, New York University, 726 Broadway, 7th Floor, NY 10003 (United States)
2017-01-20
We have compiled the most comprehensive burst sample from magnetar 4U 0142+61, comprising 27 bursts from its three burst-active episodes in 2011, 2012 and the latest one in 2015 observed with Swift /Burst Alert Telescope and Fermi /Gamma-ray Burst Monitor. Bursts from 4U 0142+61 morphologically resemble typical short bursts from other magnetars. However, 4U 0142+61 bursts are less energetic compared to the bulk of magnetar bursts. We uncovered an extended tail emission following a burst on 2015 February 28, with a thermal nature, cooling over a timescale of several minutes. During this tail emission, we also uncovered pulse peak phase aligned X-ray bursts, which could originate from the same underlying mechanism as that of the extended burst tail, or an associated and spatially coincident but different mechanism.
Bursting synchronization in clustered neuronal networks
International Nuclear Information System (INIS)
Yu Hai-Tao; Wang Jiang; Deng Bin; Wei Xi-Le
2013-01-01
Neuronal networks in the brain exhibit the modular (clustered) property, i.e., they are composed of certain subnetworks with differential internal and external connectivity. We investigate bursting synchronization in a clustered neuronal network. A transition to mutual-phase synchronization takes place on the bursting time scale of coupled neurons, while on the spiking time scale, they behave asynchronously. This synchronization transition can be induced by the variations of inter- and intracoupling strengths, as well as the probability of random links between different subnetworks. Considering that some pathological conditions are related with the synchronization of bursting neurons in the brain, we analyze the control of bursting synchronization by using a time-periodic external signal in the clustered neuronal network. Simulation results show a frequency locking tongue in the driving parameter plane, where bursting synchronization is maintained, even in the presence of external driving. Hence, effective synchronization suppression can be realized with the driving parameters outside the frequency locking region. (interdisciplinary physics and related areas of science and technology)
Self-regulation of turbulence bursts and transport barriers
International Nuclear Information System (INIS)
Floriani, E; Ciraolo, G; Ghendrih, Ph; Sarazin, Y; Lima, R
2013-01-01
The interplay between turbulent bursts and transport barriers is analyzed with a simplified model of interchange turbulence in magnetically confined plasmas. The turbulent bursts spread into the transport barriers and, depending on the competing magnitude of the burst and stopping capability of the barrier, can burn through. Simulations of two models of transport barriers are presented: a hard barrier where interchange turbulence modes are stable in a prescribed region and a soft barrier with external plasma biasing. The response of the transport barriers to the non-linear perturbations of the turbulent bursts, addressed in a predator–prey approach, indicates that the barriers monitor an amplification factor of the turbulent bursts, with amplification smaller than one for most bursts and, in some cases, amplification factors that can significantly exceed unity. The weak barriers in corrugated profiles and magnetic structures, as well as the standard barriers, are characterized by these transmission properties, which then regulate the turbulent burst transport properties. The interplays of barriers and turbulent bursts are modeled as competing stochastic processes. For different classes of the probability density function (PDF) of these processes, one can predict the heavy tail properties of the bursts downstream from the barrier, either exponential for a leaky barrier, or with power laws for a tight barrier. The intrinsic probing of the transport barriers by the turbulent bursts thus gives access to the properties of the barriers. The main stochastic variables are the barrier width and the spreading distance of the turbulent bursts within the barrier, together with their level of correlation. One finds that in the case of a barrier with volumetric losses, such as radiation or particle losses as addressed in our present simulations, the stochastic model predicts a leaky behavior with an exponential PDF of escaping turbulent bursts in agreement with the simulation
The γ-ray burst-detection system of SPI
International Nuclear Information System (INIS)
Lichti, G.G.; Georgii, R.; Kienlin, A. von; Schoenfelder, V.; Wunderer, C.; Jung, H.-J.; Hurley, K.
2000-01-01
The determination of precise locations of γ-ray bursts is a crucial task of γ-ray astronomy. Although γ-ray burst locations can be obtained nowadays from single experiments (BATSE, COMPTEL, BeppoSax) the location of bursts via triangulation using the interplanetary network is still important because not all bursts will be located precisely enough by these single instruments. In order to get location accuracies down to arcseconds via triangulation one needs long baselines. At the beginning of the next decade several spacecrafts which explore the outer planetary system (the Mars-Surveyor-2001 Orbiter and probably Ulysses) will carry γ-ray burst instruments. INTEGRAL as a near-earth spacecraft is the ideal counterpart for these satellites. The massive anticoincidence shield of the INTEGRAL-spectrometer SPI allows the measurement of γ-ray bursts with a high sensitivity. Estimations have shown that with SPI some hundred γ-ray bursts per year on the 5σ level can be measured. This is equivalent to the BATSE sensitivity. We describe the γ-ray burst-detection system of SPI, present its technical features and assess the scientific capabilities
Directory of Open Access Journals (Sweden)
Schmidt Enrico K
2004-05-01
Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.
High-latitude Pc 1 bursts arising in the dayside boundary layer region
International Nuclear Information System (INIS)
Hansen, H.J.; Fraser, B.J.; Menk, F.W.; Hu, Y.D.; Newell, P.T.; Meng, C.I.; Morris, R.J.
1992-01-01
Dayside Pc 1 geomagnetic pulsation bursts have been studied using a three-station array of induction magnetometers located at high latitudes. Associated magnetic variations in the form of solitary pulses often lead the Pc 1 bursts by 1 to 2 min. These pulses are typically associated with riometer absorption events and consequently the precipitation of fluxes of keV electrons. The Pc 1 bursts are interpreted as resulting from ion cyclotron waves which have propagated to the ionosphere from the equatorial boundary layer region. The associated boundary layer ions, identified by the low-altitude DMSP F7 satellite, range between 1 and 5 keV in energy. These particles are considered to be the most likely free energy source for the ion cyclotron waves. It is considered that such resonant ions enter the magnetosphere via the cleft and cusp because this enables a prenoon time of occurrence of most of the observations to be explained. Measured time delays of 40 to 120 s between the associated riometer absorption and Pc 2 bursts are consistent with an ion cyclotron wave generations region located in the equatorial magnetosphere
Balloon observation of gamma-ray burst
International Nuclear Information System (INIS)
Nishimura, Jun; Fujii, Masami; Yamagami, Takamasa; Oda, Minoru; Ogawara, Yoshiaki
1978-01-01
Cosmic gamma-ray burst is an interesting high energy astrophysical phenomenon, but the burst mechanism has not been well understood. Since 1975, long duration balloon flight has been conducted to search for gamma-ray bursts and to determine the source locations. A rotating cross-modulation collimator was employed to determine the locations of sources, and four NaI(Tl) scintillation counters were employed to detect hard X-ray with energy from 20 to 200 keV. The balloon light was performed at altitude of 8.3 mb from September 28, 1977, and the observation time of 79 hours was achieved. In this experiment, the monitor counter was not mounted. The count increase was observed at 16 h 22 m 31 s JST on October 1, 1977. The event disappeared after 1 sec. The total flux is estimated to be 1.6 x 10 -6 erg/cm 2 sec at the top of the atmosphere. When this event was observed, the solar-terrestrial environment was also quiet. Thus, this event was attributed to a small gamma-ray burst. Unfortunately, the duration of the burst was so short that the position of the burst source was not able to be determined. (Yoshimori, M.)
International Nuclear Information System (INIS)
Correia, E.
1983-01-01
A review on the statistical studies of solar burst parameters at X-rays and microwaves, as well as an analysis of the limits caused by instrumental sensitivity and their effect on the form of the distributions and on the establishment of boundary conditions for solar flare phenomena are presented. A study on the statistical behaviour of events observed with high sensitivity at hard X-rays with the HXRBS experiment (SMM) was performed. Maxima have been formed in the parameters distribution, which may be related to intrinsic characteristics of the source-regions. This result seems to confirm searly studies which indicated the influence of the sensitivity limits. Assuming the maxima of the distributions as real, it was possible to establish boundary conditions for the mechanisms of primary energy release. The principal condition establishes that solar bursts can be interpreted as a superposition of primary explosions. The statistical analysis permitted the estimate of a value for the amount of energy in a primary explosion, making use of adjustments of Poisson functions. The value found is consistent with values derived directly from ultra-fast time structures observed in bursts. Assuming an empirical pulse shape for the primary burst and the superposition condition, simulations of bursts have been successfully obtained. (Author) [pt
Multiple energetic injections in a strong spike-like solar burst
International Nuclear Information System (INIS)
Kaufmann, P.; Correia, E.; Costa, J.E.R.; Dennis, B.R.; Brown, J.C.
1983-01-01
An intense and fast spike-like solar burst was observed with high sensitivity in microwaves and hard X-rays, on December 18, 1980, at 19h 21m 20s U.T. It is shown that the burst was built up of short time scale structures superimposed on an underlying gradual emission, the time evolution of which showed remarkable proportionality between hard X-ray and microwave fluxes. The finer time structures were best defined at mm-microwaves. At the peak of the event the finer structures repeat energy 30-60 ms, (displaying an equivalent repetition rate of 16-20 s -1 ). The more showly varying component with a time scale of about 1 second was identified in microwaves and hard X-rays throughout the burst duration. Similarly to what has been found for mm-microwave burst emission, it is suggested that X-ray fluxes might also be proportional to the repetition rate of basic units of energy injection (quasi-quantized). It is estimated that one such injection produces a pulse of hard X-ray photons with about 4 x 10 21 erg, for epsilon > or aprox. 25 KeV. This figure is used to estimate the relevant parameters of one primary energy release site both in the case where hard X-rays are produced primarily by thick-target bremsstrahlung, and when they are purely thermal, and also discuss the relation of this figure to global energy considerations. It is found, in particular, that a thick-target interpretation only becomes possible if individual pulses have durations larger than 0.2s. (Author) [pt
Frequency of fast, narrow γ-ray bursts
International Nuclear Information System (INIS)
Norris, J.P.; Maryland Univ., College Park; Cline, T.L.; Desai, U.D.; Teegarden, B.J.
1984-01-01
The paper describes the existence of two γ-ray burst populations detected by the ISEE-3 experiment. Data from the distribution of 123 Venera 13 and 14 events (60 detected by both spacecraft) also suggests two γ-ray burst populations in each experiment sample, the domains separated with a minimum near 1 or 2 s. The authors point out that the results of the Goddard ISEE-3 γ-ray burst spectrometer actually enhance the appearance of two burst populations suggested in the Venera data. (author)
The X-ray Telescope for the SWIFT Gamma-Ray Burst Mission
International Nuclear Information System (INIS)
Wells, A.; Abbey, A.F.; Beardmore, A.; Mukerjee, K.; Osborne, J.P.; Watson, D.J.; Willingale, R.; Burrows, D. N.; Hill, J. E.; Nousek, J.A.; Miles, B.J.; Mori, K.; Morris, D.C.; Zugger, M.; Chincarini, G.; Campana, S.; Citterio, O.; Moretti, A.; Tagliaferri, G.; Bosworth, J.
2004-01-01
The X-ray Telescope (XRT) for the SWIFT mission, built by the international consortium from Pennsylvania State University (United States), University of Leicester (UK) and Osservatorio Astronomico di Brera (Italy), is already installed on the SWIFT spacecraft. The XRT has two key functions on SWIFT; to determine locations of GRBs to better than 5 arc seconds within 100 seconds of initial detection of a burst and to measure spectra and light curves of the X-ray afterglow over around four orders of magnitude of decay in the afterglow intensity. This paper summarises the XRT performance, operating modes and sensitivity for the detection of prompt and extended X-ray afterglows from gamma-ray bursts. The performance characteristics have been determined from data taken during the ground calibration campaign at MPE's Panter facility in September 2002
Directory of Open Access Journals (Sweden)
Sébastien ePaquette
2013-08-01
Full Text Available The Musical Emotional Bursts (MEB consist of 80 brief musical executions expressing basic emotional states (happiness, sadness and fear and neutrality. These musical bursts were designed to be the musical analogue of the Montreal Affective Voices (MAV – a set of brief non-verbal affective vocalizations portraying different basic emotions. The MEB consist of short (mean duration: 1.6 sec improvisations on a given emotion or of imitations of a given MAV stimulus, played on a violin (n:40 or a clarinet (n:40. The MEB arguably represent a primitive form of music emotional expression, just like the MAV represent a primitive form of vocal, nonlinguistic emotional expression. To create the MEB, stimuli were recorded from 10 violinists and 10 clarinetists, and then evaluated by 60 participants. Participants evaluated 240 stimuli (30 stimuli x 4 [3 emotions + neutral] x 2 instruments by performing either a forced-choice emotion categorization task, a valence rating task or an arousal rating task (20 subjects per task; 40 MAVs were also used in the same session with similar task instructions. Recognition accuracy of emotional categories expressed by the MEB (n:80 was lower than for the MAVs but still very high with an average percent correct recognition score of 80.4%. Highest recognition accuracies were obtained for happy clarinet (92.0% and fearful or sad violin (88.0% each MEB stimuli. The MEB can be used to compare the cerebral processing of emotional expressions in music and vocal communication, or used for testing affective perception in patients with communication problems.
Ohteru, Shoko; Kishine, Keiji
The Burst ACK scheme enhances effective throughput by reducing ACK overhead when a transmitter sends sequentially multiple data frames to a destination. IEEE 802.11e is one such example. The size of the data frame body and the number of burst data frames are important burst transmission parameters that affect throughput. The larger the burst transmission parameters are, the better the throughput under error-free conditions becomes. However, large data frame could reduce throughput under error-prone conditions caused by signal-to-noise ratio (SNR) deterioration. If the throughput can be calculated from the burst transmission parameters and error rate, the appropriate ranges of the burst transmission parameters could be narrowed down, and the necessary buffer size for storing transmit data or received data temporarily could be estimated. In this paper, we present a method that features a simple algorithm for estimating the effective throughput from the burst transmission parameters and error rate. The calculated throughput values agree well with the measured ones for actual wireless boards based on the IEEE 802.11-based original MAC protocol. We also calculate throughput values for larger values of the burst transmission parameters outside the assignable values of the wireless boards and find the appropriate values of the burst transmission parameters.
Optimal Codes for the Burst Erasure Channel
Hamkins, Jon
2010-01-01
Deep space communications over noisy channels lead to certain packets that are not decodable. These packets leave gaps, or bursts of erasures, in the data stream. Burst erasure correcting codes overcome this problem. These are forward erasure correcting codes that allow one to recover the missing gaps of data. Much of the recent work on this topic concentrated on Low-Density Parity-Check (LDPC) codes. These are more complicated to encode and decode than Single Parity Check (SPC) codes or Reed-Solomon (RS) codes, and so far have not been able to achieve the theoretical limit for burst erasure protection. A block interleaved maximum distance separable (MDS) code (e.g., an SPC or RS code) offers near-optimal burst erasure protection, in the sense that no other scheme of equal total transmission length and code rate could improve the guaranteed correctible burst erasure length by more than one symbol. The optimality does not depend on the length of the code, i.e., a short MDS code block interleaved to a given length would perform as well as a longer MDS code interleaved to the same overall length. As a result, this approach offers lower decoding complexity with better burst erasure protection compared to other recent designs for the burst erasure channel (e.g., LDPC codes). A limitation of the design is its lack of robustness to channels that have impairments other than burst erasures (e.g., additive white Gaussian noise), making its application best suited for correcting data erasures in layers above the physical layer. The efficiency of a burst erasure code is the length of its burst erasure correction capability divided by the theoretical upper limit on this length. The inefficiency is one minus the efficiency. The illustration compares the inefficiency of interleaved RS codes to Quasi-Cyclic (QC) LDPC codes, Euclidean Geometry (EG) LDPC codes, extended Irregular Repeat Accumulate (eIRA) codes, array codes, and random LDPC codes previously proposed for burst erasure
Great microwave bursts and hard X-rays from solar flares
International Nuclear Information System (INIS)
Wiehl, H.J.; Batchelor, D.A.; Crannell, C.J.; Dennis, B.R.; Price, P.N.
1983-06-01
The microwave and hard X-ray charateristics of 13 solar flares that produced microwave fluxes greater than 500 Solar Flux Units were analyzed. These Great Microwave Bursts were observed in the frequency range from 3 to 35 GHz at Berne, and simultaneous hard X-ray observations were made in the energy range from 30 to 500 keV with the Hard X-Ray Burst Spectrometer on the Solar Maximum Mission spacecraft. The principal aim of this analysis is to determine whether or not the same distribution of energetic electrons can explain both emissions. Correlations were found between respective temporal characteristics and, for the first time, between microwave and hard X-ray spectral characteristics. A single-temperature and a multi-temperature model from the literature were tested for consistency with the coincident X-ray and microwave spectra at microwave burst maximum. Four events are inconsistent with both of the models tested, and neither of the models attempts to explain the high-frequency part of the microwave spectrum. A model in which the emissions above and below the peak frequency originate in two different parts of a diverging magnetic loop is proposed. With this model the entire microwave spectrum of all but one of the events is explained
Gamma-Ray Bursts: 4th Huntsville Symposium. Proceedings
International Nuclear Information System (INIS)
Meegan, C.A.; Preece, R.D.; Koshut, T.M.
1998-01-01
These proceedings represent papers presented at the Fourth Huntsville Gamma-Ray Bursts Symposium held in September, 1997 in Huntsville, Alabama, USA. This conference occurred at a crucial time in the history of the gamma-ray burst research. In early 1997, 30 years after the detection of the first gamma-ray burst by the Vela satellites, counterparts to bursts were finally detected at optical and radio wavelengths. The symposium attracted about 200 scientists from 16 countries. Some of the topics discussed include gamma-ray burst spectra, x-ray observations, optical observations, radio observations, host galaxies, shocks and afterglows and models of gamma-ray bursts. There were 183 papers presented, out of these, 16 have been abstracted for the Energy Science and Technology database
X-ray echoes from gamma-ray bursts
International Nuclear Information System (INIS)
Dermer, C.D.; Hurley, K.C.; Hartmann, D.H.
1991-01-01
The identification of an echo of reflected radiation in time histories of gamma-ray burst spectra can provide important information about the existence of binary companions or accretion disks in gamma-ray burst systems. Because of the nature of Compton scattering, the spectrum of the echo will be attenuated at gamma-ray energies compared with the spectrum of the primary burst emission. The expected temporal and spectral signatures of the echo and a search for such echoes are described, and implications for gamma-ray burst models are discussed. 35 refs
Gamma-ray burst observations: the present situation
International Nuclear Information System (INIS)
Vedrenne, G.
1984-01-01
Recent results in gamma ray burst investigations concerning the spectral variability on a short time scale, precise locations, and the discovery of optical flashes in gamma ray burst positions on archival plates are presented. The implications of optical and X-ray observations of gamma ray burst error boxes are also discussed. 72 references
Detecting pipe bursts by monitoring water demand
Bakker, M.; Vreeburg, J.H.G.; Van der Roer, M.; Sperber, V.
2012-01-01
An algorithm which compares measured and predicted water demands to detect pipe bursts was developed and tested on three data sets of water demand and reported pipe bursts of three years. The algorithm proved to be able to detect bursts where the water loss exceeds 30% of the average water demand in
Fine structure in fast drift storm bursts
International Nuclear Information System (INIS)
McConnell, D.; Ellis, G.R.A.
1981-01-01
Recent observations with high time resolution of fast drift storm (FDS) solar bursts are described. A new variety of FDS bursts characterised by intensity maxima regularly placed in the frequency domain is reported. Possible interpretations of this are mentioned and the implications of the short duration of FDS bursts are discussed. (orig.)
Erythropoietin Receptor Signaling Is Membrane Raft Dependent
McGraw, Kathy L.; Fuhler, Gwenny M.; Johnson, Joseph O.; Clark, Justine A.; Caceres, Gisela C.; Sokol, Lubomir; List, Alan F.
2012-01-01
Upon erythropoietin (Epo) engagement, Epo-receptor (R) homodimerizes to activate JAK2 and Lyn, which phosphorylate STAT5. Although recent investigations have identified key negative regulators of Epo-R signaling, little is known about the role of membrane localization in controlling receptor signal fidelity. Here we show a critical role for membrane raft (MR) microdomains in creation of discrete signaling platforms essential for Epo-R signaling. Treatment of UT7 cells with Epo induced MR assembly and coalescence. Confocal microscopy showed that raft aggregates significantly increased after Epo stimulation (mean, 4.3±1.4(SE) vs. 25.6±3.2 aggregates/cell; p≤0.001), accompanied by a >3-fold increase in cluster size (p≤0.001). Raft fraction immunoblotting showed Epo-R translocation to MR after Epo stimulation and was confirmed by fluorescence microscopy in Epo stimulated UT7 cells and primary erythroid bursts. Receptor recruitment into MR was accompanied by incorporation of JAK2, Lyn, and STAT5 and their activated forms. Raft disruption by cholesterol depletion extinguished Epo induced Jak2, STAT5, Akt and MAPK phosphorylation in UT7 cells and erythroid progenitors. Furthermore, inhibition of the Rho GTPases Rac1 or RhoA blocked receptor recruitment into raft fractions, indicating a role for these GTPases in receptor trafficking. These data establish a critical role for MR in recruitment and assembly of Epo-R and signal intermediates into discrete membrane signaling units. PMID:22509308
In vitro reinforcement of hippocampal bursting: a search for Skinner's atoms of behavior.
Stein, L; Xue, B G; Belluzzi, J D
1994-01-01
A novel "in vitro reinforcement" paradigm was used to investigate Skinner's (1953) hypotheses (a) that operant behavior is made up of infinitesimal "response elements" or "behavioral atoms" and (b) that these very small units, and not whole responses, are the functional units of reinforcement. Our tests are based on the assumption that behavioral atoms may plausibly be represented at the neural level by individual cellular responses. As a first approach, we attempted to reinforce the bursting...
Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.
Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem
2016-12-01
In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.
Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle
International Nuclear Information System (INIS)
Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella
2012-01-01
Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.
Bursting Bubbles from Combustion of Thermoplastic Materials in Microgravity
Butler, K. B.
1999-01-01
Many thermoplastic materials in common use for a wide range of applications, including spacecraft, develop bubbles internally as they burn due to chemical reactions taking place within the bulk. These bubbles grow and migrate until they burst at the surface, forceably ejecting volatile gases and, occasionally, molten fuel. In experiments in normal gravity, Kashiwagi and Ohlemiller observed vapor jets extending a few centimeters from the surface of a radiatively heated polymethylmethacrylate (PMMA) sample, with some molten material ejected into the gas phase. These physical phenomena complicated the combustion process considerably. In addition to the non-steady release of volatiles, the depth of the surface layer affected by oxygen was increased, attributed to the roughening of the surface by bursting events. The ejection of burning droplets in random directions presents a potential fire hazard unique to microgravity. In microgravity combustion experiments on nylon Velcro fasteners and on polyethylene wire insulation, the presence of bursting fuel vapor bubbles was associated with the ejection of small particles of molten fuel as well as pulsations of the flame. For the nylon fasteners, particle velocities were higher than 30 cm/sec. The droplets burned robustly until all fuel was consumed, demonstrating the potential for the spread of fire in random directions over an extended distance. The sequence of events for a bursting bubble has been photographed by Newitt et al.. As the bubble reaches the fluid surface, the outer surface forms a dome while the internal bubble pressure maintains a depression at the inner interface. Liquid drains from the dome until it breaks into a cloud of droplets on the order of a few microns in size. The bubble gases are released rapidly, generating vortices in the quiescent surroundings and transporting the tiny droplets. The depression left by the escaping gases collapses into a central jet, which rises with a high velocity and may
Bursting neurons and ultrasound avoidance in crickets
Directory of Open Access Journals (Sweden)
Gary eMarsat
2012-07-01
Full Text Available Decision making in invertebrates often relies on simple neural circuits composed of only a few identified neurons. The relative simplicity of these circuits makes it possible to identify the key computation and neural properties underlying decisions. In this review, we summarize recent research on the neural basis of ultrasound avoidance in crickets, a response that allows escape from echolocating bats. The key neural property shaping behavioral output is high-frequency bursting of an identified interneuron, AN2, which carries information about ultrasound stimuli from receptor neurons to the brain. AN2's spike train consists of clusters of spikes –bursts– that may be interspersed with isolated, non-burst spikes. AN2 firing is necessary and sufficient to trigger avoidance steering but only high-rate firing, such as occurs in bursts, evokes this response. AN2 bursts are therefore at the core of the computation involved in deciding whether or not to steer away from ultrasound. Bursts in AN2 are triggered by synaptic input from nearly synchronous bursts in ultrasound receptors. Thus the population response at the very first stage of sensory processing –the auditory receptor- already differentiates the features of the stimulus that will trigger a behavioral response from those that will not. Adaptation, both intrinsic to AN2 and within ultrasound receptors, scales the burst-generating features according to the stimulus statistics, thus filtering out background noise and ensuring that bursts occur selectively in response to salient peaks in ultrasound intensity. Furthermore AN2’s sensitivity to ultrasound varies adaptively with predation pressure, through both developmental and evolutionary mechanisms. We discuss how this key relationship between bursting and the triggering of avoidance behavior is also observed in other invertebrate systems such as the avoidance of looming visual stimuli in locusts or heat avoidance in beetles.
International Nuclear Information System (INIS)
Lobzin, Vasili V.; Cairns, Iver H.; Robinson, Peter A.; Steward, Graham; Patterson, Garth
2010-01-01
Major space weather events such as solar flares and coronal mass ejections are usually accompanied by solar radio bursts, which can potentially be used for real-time space weather forecasts. Type II radio bursts are produced near the local plasma frequency and its harmonic by fast electrons accelerated by a shock wave moving through the corona and solar wind with a typical speed of ∼1000 km s -1 . The coronal bursts have dynamic spectra with frequency gradually falling with time and durations of several minutes. This Letter presents a new method developed to detect type II coronal radio bursts automatically and describes its implementation in an extended Automated Radio Burst Identification System (ARBIS 2). Preliminary tests of the method with spectra obtained in 2002 show that the performance of the current implementation is quite high, ∼80%, while the probability of false positives is reasonably low, with one false positive per 100-200 hr for high solar activity and less than one false event per 10000 hr for low solar activity periods. The first automatically detected coronal type II radio burst is also presented.
INTEGRAL monitoring of unusually long X-ray bursts
DEFF Research Database (Denmark)
Chenevez, Jérôme; Falanga, M.; Kuulkers, E.
2008-01-01
of exceptional burst events lasting more than ~10 minutes. Half of the dozen so-called intermediate long bursts registered so far have been observed by INTEGRAL. The goal is to derive a comprehensive picture of the relationship between the nuclear ignition processes and the accretion states of the system leading...... up to such long bursts. Depending on the composition of the accreted material, these bursts may be explained by either the unstable burning of a large pile of mixed hydrogen and helium, or the ignition of a thick pure helium layer. Intermediate long bursts are particularly expected to occur at very...
Observation of cosmic gamma ray burst by Hinotori
International Nuclear Information System (INIS)
Okudaira, Kiyoaki; Yoshimori, Masato; Hirashima, Yo; Kondo, Ichiro.
1982-01-01
The solar gamma ray detecor (SGR) on Hinotori has no collimator, and the collimator of a hard X-ray monitor is not effective for gamma ray with energy more than 100 KeV. Accordingly, the detection system can detect cosmic gamma ray burst, and two bursts were observed. The first burst was detected on February 28, 1981, and the source of the burst was in the direction of 81 degree from Venus. The time profile and the spectrum were observed. In July 21, 1981, the second burst was detected. The time profile obtained with the SGR was compared with those of PVO (Pioneer Venus Orbiter) and LASL-ISEE. The time difference among the data of time profiles indicated that the source of the burst was not the sun. The spectrum was also measured. (Kato, T.)
Advances in gamma-ray burst astronomy
International Nuclear Information System (INIS)
Cline, T.L.; Desai, U.D.
1976-01-01
Work at Goddard is presently being carried out in three major areas of gamma-ray burst research: (1) A pair of simultaneously operating 0.8-m 2 burst detectors were successfully balloon-borne at locations 800 miles apart on 9 May, 1975, each to atmospheric depths of 3 to 4 g cm -2 , for a 20-h period of coincident data coverage. This experiment investigates the size spectrum of bursts in the 10 -7 to 10 -6 erg cm -2 size region where dozens of events per day are expected on a -1.5 index integral power-law extrapolation. Considerable separation in latitude was used to avoid possible atmospheric and auroral secondary effects. Its results are not yet available. (2) A deep-space burst detector, the first spacecraft instrument built specifically for gamma-ray burst studies, was recently successfully integrated into the Helios-B space probe. Its use at distances of up to 2 AU will make possible the first high-resolution directional study of gamma-ray burst source locations. Similar modifications to several other space vehicles are also being prepared. (3) The gamma-ray instrument on the IMP-7 satellite is presently the most sensitive burst detector still operating in orbit. Its results have shown that all measured event-average energy spectra are consistent with being alike. Using this characteristic spectrum to select IMP-7 candidate events of smaller size than those detected using other spacecraft in coincidence, a size spectrum is constructed which fits the -1.5 index power law down to 2.5 x 10 -5 erg cm -2 per event, at an occurrence rate of about once per month. (Auth.)
Thermonuclear burst oscillations: where firestorms meet fundamental physics.
CERN. Geneva
2017-01-01
Neutron stars offer a unique environment in which to develop and test theories of the strong force. Densities in neutron star cores can reach up to ten times the density of a normal atomic nucleus, and the stabilising effect of gravitational confinement permits long-timescale weak interactions. This generates matter that is neutron-rich, and opens up the possibility of stable states of strange matter, something that can only exist in neutron stars. Strong force physics is encoded in the Equation of State (EOS), the pressure-density relation, which links to macroscopic observables such as mass M and radius R via the stellar structure equations. By measuring and inverting the M-R relation we can recover the EOS and diagnose the underlying dense matter physics. One very promising technique for simultaneous measurement of M and R exploits hotspots (burst oscillations) that form on the neutron star surface when material accreted from a companion star undergoes a thermonuclear explosion (a Type I X-ray burst). As ...
Balamurugan, A. M.; Sivasubramanian, A.
2014-06-01
The Optical Burst Switching (OBS) is an emergent result to the technology issue that could achieve a viable network in future. They have the ability to meet the bandwidth requisite of those applications that call for intensive bandwidth. The field of optical transmission has undergone numerous advancements and is still being researched mainly due to the fact that optical data transmission can be done at enormous speeds. The concept of OBS is still far from perfection facing issues in case of security threat. The transfer of optical switching paradigm to optical burst switching faces serious downfall in the fields of burst aggregation, routing, authentication, dispute resolution and quality of service (QoS). This paper proposes a framework based on QKD based secure edge router architecture design to provide burst confidentiality. The QKD protocol offers high level of confidentiality as it is indestructible. The design architecture was implemented in FPGA using diverse models and the results were taken. The results show that the proposed model is suitable for real time secure routing applications of the Optical burst switched networks.
3rd Interplanetary Network Gamma-Ray Burst Website
Hurley, Kevin
1998-05-01
We announce the opening of the 3rd Interplanetary Network web site at http://ssl.berkeley.edu/ipn3/index.html This site presently has four parts: 1. A bibliography of over 3000 publications on gamma-ray bursts, 2. IPN data on all bursts triangulated up to February 1998, 3. A master list showing which spacecraft observed which bursts, 4. Preliminary IPN data on the latest bursts observed.
International Nuclear Information System (INIS)
Hurley, K.; Briggs, M. S.; Kippen, R. M.; Kouveliotou, C.; Fishman, G.; Meegan, C.; Cline, T.; Trombka, J.; McClanahan, T.; Boynton, W.; Starr, R.; McNutt, R.; Boer, M.
2011-01-01
We present Interplanetary Network localization information for 343 gamma-ray bursts observed by the Burst and Transient Source Experiment (BATSE) between the end of the 4th BATSE catalog and the end of the Compton Gamma-Ray Observatory (CGRO) mission, obtained by analyzing the arrival times of these bursts at the Ulysses, Near Earth Asteroid Rendezvous (NEAR), and CGRO spacecraft. For any given burst observed by CGRO and one other spacecraft, arrival time analysis (or t riangulation ) results in an annulus of possible arrival directions whose half-width varies between 11 arcsec and 21 0 , depending on the intensity, time history, and arrival direction of the burst, as well as the distance between the spacecraft. This annulus generally intersects the BATSE error circle, resulting in an average reduction of the area of a factor of 20. When all three spacecraft observe a burst, the result is an error box whose area varies between 1 and 48,000 arcmin 2 , resulting in an average reduction of the BATSE error circle area of a factor of 87.
Dynamic encoding of natural luminance sequences by LGN bursts.
Directory of Open Access Journals (Sweden)
Nicholas A Lesica
2006-07-01
Full Text Available In the lateral geniculate nucleus (LGN of the thalamus, visual stimulation produces two distinct types of responses known as tonic and burst. Due to the dynamics of the T-type Ca(2+ channels involved in burst generation, the type of response evoked by a particular stimulus depends on the resting membrane potential, which is controlled by a network of modulatory connections from other brain areas. In this study, we use simulated responses to natural scene movies to describe how modulatory and stimulus-driven changes in LGN membrane potential interact to determine the luminance sequences that trigger burst responses. We find that at low resting potentials, when the T channels are de-inactivated and bursts are relatively frequent, an excitatory stimulus transient alone is sufficient to evoke a burst. However, to evoke a burst at high resting potentials, when the T channels are inactivated and bursts are relatively rare, prolonged inhibitory stimulation followed by an excitatory transient is required. We also observe evidence of these effects in vivo, where analysis of experimental recordings demonstrates that the luminance sequences that trigger bursts can vary dramatically with the overall burst percentage of the response. To characterize the functional consequences of the effects of resting potential on burst generation, we simulate LGN responses to different luminance sequences at a range of resting potentials with and without a mechanism for generating bursts. Using analysis based on signal detection theory, we show that bursts enhance detection of specific luminance sequences, ranging from the onset of excitatory sequences at low resting potentials to the offset of inhibitory sequences at high resting potentials. These results suggest a dynamic role for burst responses during visual processing that may change according to behavioral state.
Formation of Radio Type II Bursts During a Multiple Coronal Mass Ejection Event
Al-Hamadani, Firas; Pohjolainen, Silja; Valtonen, Eino
2017-12-01
We study the solar event on 27 September 2001 that consisted of three consecutive coronal mass ejections (CMEs) originating from the same active region, which were associated with several periods of radio type II burst emission at decameter-hectometer (DH) wavelengths. Our analysis shows that the first radio burst originated from a low-density environment, formed in the wake of the first, slow CME. The frequency-drift of the burst suggests a low-speed burst driver, or that the shock was not propagating along the large density gradient. There is also evidence of band-splitting within this emission lane. The origin of the first shock remains unclear, as several alternative scenarios exist. The second shock showed separate periods of enhanced radio emission. This shock could have originated from a CME bow shock, caused by the fast and accelerating second or third CME. However, a shock at CME flanks is also possible, as the density depletion caused by the three CMEs would have affected the emission frequencies and hence the radio source heights could have been lower than usual. The last type II burst period showed enhanced emission in a wider bandwidth, which was most probably due to the CME-CME interaction. Only one shock that could reliably be associated with the investigated CMEs was observed to arrive near Earth.
Low-Frequency Type III Bursts and Solar Energetic Particle Events
Gopalswamy, Nat; Makela, Pertti
2010-01-01
We analyzed the coronal mass ejections (CMEs), flares, and type 11 radio bursts associated with a set of six low frequency (15 min) normally used to define these bursts. All but one of the type III bursts was not associated with a type 11 burst in the metric or longer wavelength domains. The burst without type 11 burst also lacked a solar energetic particle (SEP) event at energies >25 MeV. The 1-MHz duration of the type III burst (28 min) is near the median value of type III durations found for gradual SEP events and ground level enhancement (GLE) events. Yet, there was no sign of SEP events. On the other hand, two other type III bursts from the same active region had similar duration but accompanied by WAVES type 11 bursts; these bursts were also accompanied by SEP events detected by SOHO/ERNE. The CMEs were of similar speeds and the flares are also of similar size and duration. This study suggests that the type III burst duration may not be a good indicator of an SEP event.
PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia
DEFF Research Database (Denmark)
Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta
2004-01-01
markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...
Testing and Improving the Luminosity Relations for Gamma-Ray Bursts
Collazzi, Andrew C.
2012-01-01
Gamma Ray Bursts (GRBs) have several luminosity relations where a measurable property of a burst light curve or spectrum is correlated with the burst luminosity. These luminosity relations are calibrated for the fraction of bursts with spectroscopic redshifts and hence the known luminosities. GRBs have thus become known as a type of "standard candle” where standard candle is meant in the usual sense that luminosities can be derived from measurable properties of the bursts. GRBs can therefore be used for the same cosmology applications as Type Ia supernovae, including the construction of the Hubble Diagram and measuring massive star formation rate. The greatest disadvantage of using GRBs as standard candles is that their accuracy is lower than desired. With the recent advent of GRBs as a new standard candle, every effort must be made to test and improve the distance measures. Here, methods are employed to do just that. First, generalized forms of two tests are performed on the luminosity relations. All the luminosity relations pass one of these tests, and all but two pass the other. Even with this failure, redundancies in using multiple luminosity relations allows all the luminosity relations to retain value. Next, the "Firmani relation” is shown to have poorer accuracy than first advertised. It is also shown to be derivable from two other luminosity relations. For these reasons, the Firmani relation is useless for cosmology. The Amati relation is then revisited and shown to be an artifact of a combination of selection effects. Therefore, the Amati relation is also not good for cosmology. Fourthly, the systematic errors involved in measuring a luminosity indicator (Epeak) are measured. The result is an irreducible systematic error of 28%. Finally, the work concludes with a discussion about the impact of the work and the future of GRB luminosity relations.
New decoding methods of interleaved burst error-correcting codes
Nakano, Y.; Kasahara, M.; Namekawa, T.
1983-04-01
A probabilistic method of single burst error correction, using the syndrome correlation of subcodes which constitute the interleaved code, is presented. This method makes it possible to realize a high capability of burst error correction with less decoding delay. By generalizing this method it is possible to obtain probabilistic method of multiple (m-fold) burst error correction. After estimating the burst error positions using syndrome correlation of subcodes which are interleaved m-fold burst error detecting codes, this second method corrects erasure errors in each subcode and m-fold burst errors. The performance of these two methods is analyzed via computer simulation, and their effectiveness is demonstrated.
Measurements of hard cosmic X-rays with special reference to burst phenomena
International Nuclear Information System (INIS)
Mills, J.S.
1978-06-01
The bulk of this work is concerned with the development and subsequent flights of two balloon-borne gamma-burst detectors. The first was a 1 m 2 device which accumulated a total of 13 1/2 hours flying time at a latitude of 40 0 . The second was a large 7 m 2 detector which was flown from Alice Springs, N. Australia. Both detectors were sensitive to 50 keV to 2 MeV X-rays. The results of these flights are discussed with particular reference to the origin of gamma-bursts. The nature of X-ray bursts is also discussed, together with the results of observations by Experiment F on Ariel V, of the region of the sky centred on the rapid burster MXB1730-335. The last chapter is concerned with the development of a large area hard X-ray detector. This device is designed to be built in modular form and have a total collecting area up to 1 m 2 . It is sensitive to X-rays in the range 20 to 200 keV and is collimated by a tantalum honeycomb which has a field of view of 2 0 FWHM. A small version of this detector was flown on the same platform as the large burst detector. (author)
Flash photoionization of gamma-ray burst environments
Band, David L.; Hartmann, Dieter H.
1992-01-01
The H-alpha line emission that a flash-photoionized region emits is calculated. Archival transients, as well as various theoretical predictions, suggest that there may be significant ionizing flux. The limits on the line flux which might be observable indicate that the density must be fairly high for the recombination radiation to be observable. The intense burst radiation is insufficient to melt the dust which will be present in such a dense medium. This dust may attenuate the observable line emission, but does not attenuate the ionizing radiation before it ionizes the neutral medium surrounding the burst source. The dust can also produce a light echo. If there are indeed gamma-ray bursts in dense clouds, then it is possible that the burst was triggered by Bondi-Hoyle accretion from the dense medium, although it is unlikely on statistical grounds that all bursts occur in clouds.
The supernova-gamma-ray burst-jet connection.
Hjorth, Jens
2013-06-13
The observed association between supernovae and gamma-ray bursts represents a cornerstone in our understanding of the nature of gamma-ray bursts. The collapsar model provides a theoretical framework for this connection. A key element is the launch of a bipolar jet (seen as a gamma-ray burst). The resulting hot cocoon disrupts the star, whereas the (56)Ni produced gives rise to radioactive heating of the ejecta, seen as a supernova. In this discussion paper, I summarize the observational status of the supernova-gamma-ray burst connection in the context of the 'engine' picture of jet-driven supernovae and highlight SN 2012bz/GRB 120422A--with its luminous supernova but intermediate high-energy luminosity--as a possible transition object between low-luminosity and jet gamma-ray bursts. The jet channel for supernova explosions may provide new insights into supernova explosions in general.
Long X-ray burst monitoring with INTEGRAL
DEFF Research Database (Denmark)
X-ray bursts are thermonuclear explosions on the surface of accreting neutron stars in low mass X-ray binary systems. In the frame of the INTEGRAL observational Key Programme over the Galactic Center a good number of the known X-ray bursters are frequently being monitored. An international...... collaboration lead by the JEM-X team at the Danish National Space Center has proposed to exploit the improved sensitivity of the INTEGRAL instruments to investigate the observational properties and physics up to high energies of exceptional burst events lasting between a few tens of minutes and several hours....... Of special interest are low luminosity bursting sources that exhibit X-ray bursts of very different durations allowing to study the transition from a hydrogen-rich bursting regime to a pure helium regime and from helium burning to carbon burning. I will present results obtained from INTEGRAL archive data...
DEFF Research Database (Denmark)
Klose, S.; Stecklum, B.; Masetti, N.
2000-01-01
We report near-infrared and optical follow-up observations of the afterglow of the GRB 000418 starting 2.5 days after the occurrence of the burst and extending over nearly 7 weeks. GRB 000418 represents the second case for which the afterglow was initially identified by observations in the near......) bursts are associated with events in star-forming regions....
Frequency chirping during a fishbone burst
International Nuclear Information System (INIS)
Marchenko, V.S.; Reznik, S.N.
2011-01-01
It is shown that frequency chirping during fishbone activity can be attributed to the reactive torque exerted on the plasma during the instability burst, which slows down plasma rotation inside the q = 1 surface and reduces the mode frequency in the lab frame. Estimates show that the peak value of this torque can exceed the neutral beam torque in modern tokamaks. The simple line-broadened quasilinear burst model (Berk et al 1995 Nucl. Fusion 35 1661), properly adapted for the fishbone case, is capable of reproducing the key features of the bursting mode. (letter)
Simulating X-ray bursts during a transient accretion event
Johnston, Zac; Heger, Alexander; Galloway, Duncan K.
2018-06-01
Modelling of thermonuclear X-ray bursts on accreting neutron stars has to date focused on stable accretion rates. However, bursts are also observed during episodes of transient accretion. During such events, the accretion rate can evolve significantly between bursts, and this regime provides a unique test for burst models. The accretion-powered millisecond pulsar SAX J1808.4-3658 exhibits accretion outbursts every 2-3 yr. During the well-sampled month-long outburst of 2002 October, four helium-rich X-ray bursts were observed. Using this event as a test case, we present the first multizone simulations of X-ray bursts under a time-dependent accretion rate. We investigate the effect of using a time-dependent accretion rate in comparison to constant, averaged rates. Initial results suggest that using a constant, average accretion rate between bursts may underestimate the recurrence time when the accretion rate is decreasing, and overestimate it when the accretion rate is increasing. Our model, with an accreted hydrogen fraction of X = 0.44 and a CNO metallicity of ZCNO = 0.02, reproduces the observed burst arrival times and fluences with root mean square (rms) errors of 2.8 h, and 0.11× 10^{-6} erg cm^{-2}, respectively. Our results support previous modelling that predicted two unobserved bursts and indicate that additional bursts were also missed by observations.
Review of GRANAT observations of gamma-ray bursts
DEFF Research Database (Denmark)
Terekhov, O.; Denissenko, D.; Sunyaev, R.
1995-01-01
The GRANAT observatory was launched into a high apogee orbit on 1 December, 1989. Three instruments onboard GRANAT - PHEBUS, WATCH and SIGMA are able to detect gamma-ray bursts in a very broad energy range from 6 keV up to 100 MeV. Over 250 gamma-ray bursts were detected. We discuss the results...... of the observations of the time histories and spectral evolution of the detected events provided by the different instruments in different energy ranges. Short Gamma-Ray Bursts ( 2 s) events. Evidence of the existence...... of four differently behaving componenents in gamma-ray burst spectra is discussed. Statistical properties of the gamma-ray burst sources based on the 5 years of observations with (∼ 10−6 erg/cm2) sensitivity as well as the results of high sensitivity (∼ 10−8 erg/cm2) search for Gamma-Ray Bursts within...
Near stellar sources of gamma-ray bursts
Luchkov, B. I.; Markin, P. D.
2012-01-01
Correlation analysis of gamma-ray burst coordinates and nearby stars, registered on 2008-2011, revealed 5 coincidences with angular accuracy better than 0.1 degree. The random probability is $7\\times 10^{-7}$, so evidencing that coincident stars are indeed gamma-ray burst sources. The proposed method should be continued in order to provide their share in common balance of cosmic gamma-ray bursts.
Functional Imaging of Human Vestibular Cortex Activity Elicited by Skull Tap and Auditory Tone Burst
Noohi, Fatemeh; Kinnaird, Catherine; Wood, Scott; Bloomberg, Jacob; Mulavara, Ajitkumar; Seidler, Rachael
2014-01-01
The aim of the current study was to characterize the brain activation in response to two modes of vestibular stimulation: skull tap and auditory tone burst. The auditory tone burst has been used in previous studies to elicit saccular Vestibular Evoked Myogenic Potentials (VEMP) (Colebatch & Halmagyi 1992; Colebatch et al. 1994). Some researchers have reported that airconducted skull tap elicits both saccular and utricle VEMPs, while being faster and less irritating for the subjects (Curthoys et al. 2009, Wackym et al., 2012). However, it is not clear whether the skull tap and auditory tone burst elicit the same pattern of cortical activity. Both forms of stimulation target the otolith response, which provides a measurement of vestibular function independent from semicircular canals. This is of high importance for studying the vestibular disorders related to otolith deficits. Previous imaging studies have documented activity in the anterior and posterior insula, superior temporal gyrus, inferior parietal lobule, pre and post central gyri, inferior frontal gyrus, and the anterior cingulate cortex in response to different modes of vestibular stimulation (Bottini et al., 1994; Dieterich et al., 2003; Emri et al., 2003; Schlindwein et al., 2008; Janzen et al., 2008). Here we hypothesized that the skull tap elicits the similar pattern of cortical activity as the auditory tone burst. Subjects put on a set of MR compatible skull tappers and headphones inside the 3T GE scanner, while lying in supine position, with eyes closed. All subjects received both forms of the stimulation, however, the order of stimulation with auditory tone burst and air-conducted skull tap was counterbalanced across subjects. Pneumatically powered skull tappers were placed bilaterally on the cheekbones. The vibration of the cheekbone was transmitted to the vestibular cortex, resulting in vestibular response (Halmagyi et al., 1995). Auditory tone bursts were also delivered for comparison. To validate
Gamma-Ray Burst Host Galaxies Have "Normal" Luminosities.
Schaefer
2000-04-10
The galactic environment of gamma-ray bursts can provide good evidence about the nature of the progenitor system, with two old arguments implying that the burst host galaxies are significantly subluminous. New data and new analysis have now reversed this picture: (1) Even though the first two known host galaxies are indeed greatly subluminous, the next eight hosts have absolute magnitudes typical for a population of field galaxies. A detailed analysis of the 16 known hosts (10 with redshifts) shows them to be consistent with a Schechter luminosity function with R*=-21.8+/-1.0, as expected for normal galaxies. (2) Bright bursts from the Interplanetary Network are typically 18 times brighter than the faint bursts with redshifts; however, the bright bursts do not have galaxies inside their error boxes to limits deeper than expected based on the luminosities for the two samples being identical. A new solution to this dilemma is that a broad burst luminosity function along with a burst number density varying as the star formation rate will require the average luminosity of the bright sample (>6x1058 photons s-1 or>1.7x1052 ergs s-1) to be much greater than the average luminosity of the faint sample ( approximately 1058 photons s-1 or approximately 3x1051 ergs s-1). This places the bright bursts at distances for which host galaxies with a normal luminosity will not violate the observed limits. In conclusion, all current evidence points to gamma-ray burst host galaxies being normal in luminosity.
Cosmology and the Subgroups of Gamma-ray Bursts
Directory of Open Access Journals (Sweden)
A. Mészáros
2011-01-01
Full Text Available Both short and intermediate gamma-ray bursts are distributed anisotropically in the sky (Mészáros, A. et al. ApJ, 539, 98 (2000, Vavrek, R. et al. MNRAS, 391, 1 741 (2008. Hence, in the redshift range, where these bursts take place, the cosmological principle is in doubt. It has already been noted that short bursts should be mainly at redshifts smaller than one (Mészáros, A. et al. Gamma-ray burst: Sixth Huntsville Symp., AIP, Vol. 1 133, 483 (2009; Mészáros, A. et al. Baltic Astron., 18, 293 (2009. Here we show that intermediate bursts should be at redshifts up to three.
Type III Radio Burst Duration and SEP Events
Gopalswamy, N.; Makela, P.; Xie, H.
2010-01-01
Long-duration (>15 min), low-frequency (25 MeV. The 1-MHz duration of the type III burst (28 rein) is near the median value of type III durations found for gradual SEP events and ground level enhancement (GLE) events. Yet, there was no sign of SEP events. On the other hand, two other type III bursts from the same active region had similar duration but accompanied by WAVES type 11 bursts; these bursts were also accompanied by SEP events detected by SOHO/ERNE. This study suggests that the type III burst duration may not be a good indicator of an SEP event, consistent with the statistical study of Cliver and Ling (2009, ApJ ).
DEFF Research Database (Denmark)
Toft, P; Christiansen, K; Tønnesen, Else Kirstine
1997-01-01
Following cardiac surgery with cardiopulmonary bypass (CPB), activated granulocytes may be involved with ischaemia/ reperfusion injury. The purpose of this study was to investigate whether steroids could reduce the oxidative burst activity of granulocytes, the expression of adhesion molecules...... on granulocytes and improve clinical outcome. Sixteen patients undergoing open heart surgery participated in the study. Eight were randomized to receive methylprednisolone (30 mg/kg intravenously) at the start of anaesthesia while eight patients served as a control group. The oxidative burst was measured flow...... not improve the weaning from the ventilator or reduce the stay in the intensive-care unit. In conclusion, treatment with steroids prevented hyperthermia following open heart surgery with CPB and reduced capillary leak during ECC. Methylprednisolone, however, did not reduce the oxidative burst activity...
Galloway, Duncan K.; Psaltis, Dimitrios; Chakrabarty, Deepto; Muno, Michael P.
2003-06-01
We investigate the limitations of thermonuclear X-ray bursts as a distance indicator for the weakly magnetized accreting neutron star 4U 1728-34. We measured the unabsorbed peak flux of 81 bursts in public data from the Rossi X-Ray Timing Explorer (RXTE). The distribution of peak fluxes was bimodal: 66 bursts exhibited photospheric radius expansion (presumably reaching the local Eddington limit) and were distributed about a mean bolometric flux of 9.2×10-8ergscm-2s-1, while the remaining (non-radius expansion) bursts reached 4.5×10-8ergscm-2s-1, on average. The peak fluxes of the radius expansion bursts were not constant, exhibiting a standard deviation of 9.4% and a total variation of 46%. These bursts showed significant correlations between their peak flux and the X-ray colors of the persistent emission immediately prior to the burst. We also found evidence for quasi-periodic variation of the peak fluxes of radius expansion bursts, with a timescale of ~=40 days. The persistent flux observed with RXTE/ASM over 5.8 yr exhibited quasi-periodic variability on a similar timescale. We suggest that these variations may have a common origin in reflection from a warped accretion disk. Once the systematic variation of the peak burst fluxes is subtracted, the residual scatter is only ~=3%, roughly consistent with the measurement uncertainties. The narrowness of this distribution strongly suggests that (1) the radiation from the neutron star atmosphere during radius expansion episodes is nearly spherically symmetric and (2) the radius expansion bursts reach a common peak flux that may be interpreted as a standard candle intensity. Adopting the minimum peak flux for the radius expansion bursts as the Eddington flux limit, we derive a distance for the source of 4.4-4.8 kpc (assuming RNS=10 km), with the uncertainty arising from the probable range of the neutron star mass MNS=1.4-2 Msolar.
DEFF Research Database (Denmark)
Toft, P; Christiansen, K; Tønnesen, Else Kirstine
1997-01-01
on granulocytes and improve clinical outcome. Sixteen patients undergoing open heart surgery participated in the study. Eight were randomized to receive methylprednisolone (30 mg/kg intravenously) at the start of anaesthesia while eight patients served as a control group. The oxidative burst was measured flow...... not improve the weaning from the ventilator or reduce the stay in the intensive-care unit. In conclusion, treatment with steroids prevented hyperthermia following open heart surgery with CPB and reduced capillary leak during ECC. Methylprednisolone, however, did not reduce the oxidative burst activity...
Let-7 microRNAs are developmentally regulated in circulating human erythroid cells
Directory of Open Access Journals (Sweden)
Reed Christopher
2009-11-01
Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.
Soap films burst like flapping flags.
Lhuissier, Henri; Villermaux, Emmanuel
2009-07-31
When punctured, a flat soap film bursts by opening a hole driven by liquid surface tension. The hole rim does not, however, remain smooth but soon develops indentations at the tip of which ligaments form, ultimately breaking and leaving the initially connex film into a mist of disjointed drops. We report on original observations showing that these indentations result from a flaglike instability between the film and the surrounding atmosphere inducing an oscillatory motion out of its plane. Just like a flag edge flaps in the wind, the film is successively accelerated on both sides perpendicularly to its plane, inducing film thickness modulations and centrifuging liquid ligaments that finally pinch off to form the observed spray. This effect exemplifies how the dynamics of fragile objects such as thin liquid films is sensitive to their embedding medium.
Effervescence in champagne and sparkling wines: From bubble bursting to droplet evaporation
Séon, T.; Liger-Belair, G.
2017-01-01
When a bubble reaches an air-liquid interface, it ruptures, projecting a multitude of tiny droplets in the air. Across the oceans, an estimated 1018 to 1020 bubbles burst every second, and form the so called sea spray, a major player in earth's climate system. At a smaller scale, in a glass of champagne about a million bubbles nucleate on the wall, rise towards the surface and burst, giving birth to a particular aerosol that holds a concentrate of wine aromas. Based on the model experiment of a single bubble bursting in simple liquids, we depict each step of this effervescence, from bubble bursting to drop evaporation. In particular, we propose simple scaling laws for the jet velocity and the top drop size. We unravel experimentally the intricate roles of bubble shape, capillary waves, gravity, and liquid properties in the jet dynamics and the drop detachment. We demonstrate how damping action of viscosity produces faster and smaller droplets and more generally how liquid properties enable to control the bubble bursting aerosol characteristics. In this context, the particular case of Champagne wine aerosol is studied in details and the key features of this aerosol are identified. We demonstrate that compared to a still wine, champagne fizz drastically enhances the transfer of liquid into the atmosphere. Conditions on bubble radius and wine viscosity that optimize aerosol evaporation are provided. These results pave the way towards the fine tuning of aerosol characteristics and flavor release during sparkling wine tasting, a major issue of the sparkling wine industry.
von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.
1999-01-01
Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors
Directory of Open Access Journals (Sweden)
Taras A Gritsun
Full Text Available A typical property of isolated cultured neuronal networks of dissociated rat cortical cells is synchronized spiking, called bursting, starting about one week after plating, when the dissociated cells have sufficiently sent out their neurites and formed enough synaptic connections. This paper is the third in a series of three on simulation models of cultured networks. Our two previous studies [26], [27] have shown that random recurrent network activity models generate intra- and inter-bursting patterns similar to experimental data. The networks were noise or pacemaker-driven and had Izhikevich-neuronal elements with only short-term plastic (STP synapses (so, no long-term potentiation, LTP, or depression, LTD, was included. However, elevated pre-phases (burst leaders and after-phases of burst main shapes, that usually arise during the development of the network, were not yet simulated in sufficient detail. This lack of detail may be due to the fact that the random models completely missed network topology .and a growth model. Therefore, the present paper adds, for the first time, a growth model to the activity model, to give the network a time dependent topology and to explain burst shapes in more detail. Again, without LTP or LTD mechanisms. The integrated growth-activity model yielded realistic bursting patterns. The automatic adjustment of various mutually interdependent network parameters is one of the major advantages of our current approach. Spatio-temporal bursting activity was validated against experiment. Depending on network size, wave reverberation mechanisms were seen along the network boundaries, which may explain the generation of phases of elevated firing before and after the main phase of the burst shape.In summary, the results show that adding topology and growth explain burst shapes in great detail and suggest that young networks still lack/do not need LTP or LTD mechanisms.
Deep searches for broadband extended gravitational-wave emission bursts by heterogeneous computing
van Putten, Maurice H. P. M.
2017-09-01
We present a heterogeneous search algorithm for broadband extended gravitational-wave emission, expected from gamma-ray bursts and energetic core-collapse supernovae. It searches the (f,\\dot{f})-plane for long-duration bursts by inner engines slowly exhausting their energy reservoir by matched filtering on a graphics processor unit (GPU) over a template bank of millions of 1 s duration chirps. Parseval's theorem is used to predict the standard deviation σ of the filter output, taking advantage of the near-Gaussian noise in the LIGO S6 data over 350-2000 Hz. Tails exceeding a multiple of σ are communicated back to a central processing unit. This algorithm attains about 65% efficiency overall, normalized to the fast Fourier transform. At about one million correlations per second over data segments of 16 s duration (N=2^{16} samples), better than real-time analysis is achieved on a cluster of about a dozen GPUs. We demonstrate its application to the capture of high-frequency hardware LIGO injections. This algorithm serves as a starting point for deep all-sky searches in both archive data and real-time analysis in current observational runs.
Relativistic motion in gamma-ray bursts
International Nuclear Information System (INIS)
Krolik, J.H.; Pier, E.A.
1991-01-01
Three fundamental problems affect models of gamma-ray bursts, i.e., the energy source, the ability of high-energy photons to escape the radiation region, and the comparative weakness of X-ray emission. It is indicated that relativistic bulk motion of the gamma-ray-emitting plasma generically provides a solution to all three of these problems. Results show that, if the plasma that produces gamma-ray bursts has a bulk relativistic velocity with Lorentz factor gamma of about 10, several of the most troubling problems having to do with gamma-ray bursts are solved. 42 refs
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.
Directory of Open Access Journals (Sweden)
Gloria Bua
Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells
Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio
2016-01-01
The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771
FAST RADIO BURSTS AND RADIO TRANSIENTS FROM BLACK HOLE BATTERIES
Energy Technology Data Exchange (ETDEWEB)
Mingarelli, Chiara M. F. [TAPIR, MC 350-17, California Institute of Technology, Pasadena, CA 91125 (United States); Levin, Janna [Institute for Strings, Cosmology and Astroparticle Physics (ISCAP), Columbia University, New York, NY 10027 (United States); Lazio, T. Joseph W. [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States)
2015-12-01
Most black holes (BHs) will absorb a neutron star (NS) companion fully intact without tidal disruption, suggesting the pair will remain dark to telescopes. Even without tidal disruption, electromagnetic (EM) luminosity is generated from the battery phase of the binary when the BH interacts with the NS magnetic field. Originally, the luminosity was expected to be in high-energy X-rays or gamma-rays, however, we conjecture that some of the battery power is emitted in the radio bandwidth. While the luminosity and timescale are suggestive of fast radio bursts (FRBs; millisecond-scale radio transients) NS–BH coalescence rates are too low to make these a primary FRB source. Instead, we propose that the transients form a FRB sub-population, distinguishable by a double peak with a precursor. The rapid ramp-up in luminosity manifests as a precursor to the burst which is 20%–80% as luminous given 0.5 ms timing resolution. The main burst arises from the peak luminosity before the merger. The post-merger burst follows from the NS magnetic field migration to the BH, causing a shock. NS–BH pairs are especially desirable for ground-based gravitational wave (GW) observatories since the pair might not otherwise be detected, with EM counterparts greatly augmenting the scientific leverage beyond the GW signal. The EM signal’s ability to break degeneracies in the parameters encoded in the GW and probe the NS magnetic field strength is quite valuable, yielding insights into open problems in NS magnetic field decay.
FAST RADIO BURSTS AND RADIO TRANSIENTS FROM BLACK HOLE BATTERIES
International Nuclear Information System (INIS)
Mingarelli, Chiara M. F.; Levin, Janna; Lazio, T. Joseph W.
2015-01-01
Most black holes (BHs) will absorb a neutron star (NS) companion fully intact without tidal disruption, suggesting the pair will remain dark to telescopes. Even without tidal disruption, electromagnetic (EM) luminosity is generated from the battery phase of the binary when the BH interacts with the NS magnetic field. Originally, the luminosity was expected to be in high-energy X-rays or gamma-rays, however, we conjecture that some of the battery power is emitted in the radio bandwidth. While the luminosity and timescale are suggestive of fast radio bursts (FRBs; millisecond-scale radio transients) NS–BH coalescence rates are too low to make these a primary FRB source. Instead, we propose that the transients form a FRB sub-population, distinguishable by a double peak with a precursor. The rapid ramp-up in luminosity manifests as a precursor to the burst which is 20%–80% as luminous given 0.5 ms timing resolution. The main burst arises from the peak luminosity before the merger. The post-merger burst follows from the NS magnetic field migration to the BH, causing a shock. NS–BH pairs are especially desirable for ground-based gravitational wave (GW) observatories since the pair might not otherwise be detected, with EM counterparts greatly augmenting the scientific leverage beyond the GW signal. The EM signal’s ability to break degeneracies in the parameters encoded in the GW and probe the NS magnetic field strength is quite valuable, yielding insights into open problems in NS magnetic field decay
Herbivore derived fatty acid-amides elicit reactive oxygen species burst in plants
The formation of a reactive oxygen species (ROS) burst is a central response of plants to many forms of stress including pathogen attack, several abiotic stresses, damage and insect infestation. These ROS act as a direct defense as well as signaling and regulatory molecules. Perception of microbe or...
THE FERMI –GBM THREE-YEAR X-RAY BURST CATALOG
Energy Technology Data Exchange (ETDEWEB)
Jenke, P. A. [CSPAR, SPA University of Alabama in Huntsville, Huntsville, AL 35805 (United States); Linares, M. [Instituto de Astrofísica de Canarias, c/Vía Láctea s/n, E-38205 La Laguna, Tenerife (Spain); Connaughton, V.; Camero-Arranz, A.; Finger, M. H. [Universities Space Research Association, Huntsville, AL 35805 (United States); Beklen, E. [Department of Physics, Suleyman Demirel University, 32260, Isparta (Turkey); Wilson-Hodge, C. A. [Marshall Space Flight Center, Huntsville, AL 35812 (United States)
2016-08-01
The Fermi Gamma-ray Burst Monitor (GBM) is an all-sky gamma-ray monitor well known in the gamma-ray burst (GRB) community. Although GBM excels in detecting the hard, bright extragalactic GRBs, its sensitivity above 8 keV and its all-sky view make it an excellent instrument for the detection of rare, short-lived Galactic transients. In 2010 March, we initiated a systematic search for transients using GBM data. We conclude this phase of the search by presenting a three-year catalog of 1084 X-ray bursts. Using spectral analysis, location, and spatial distributions we classified the 1084 events into 752 thermonuclear X-ray bursts, 267 transient events from accretion flares and X-ray pulses, and 65 untriggered gamma-ray bursts. All thermonuclear bursts have peak blackbody temperatures broadly consistent with photospheric radius expansion (PRE) bursts. We find an average rate of 1.4 PRE bursts per day, integrated over all Galactic bursters within about 10 kpc. These include 33 and 10 bursts from the ultra-compact X-ray binaries 4U 0614+09 and 2S 0918-549, respectively. We discuss these recurrence times and estimate the total mass ejected by PRE bursts in our Galaxy.
DEFF Research Database (Denmark)
Christensen, Kim; Oomen, Roel; Renò, Roberto
are an expected and regular occurrence in financial markets that can arise through established mechanisms such as feedback trading. At a theoretical level, we show how to build drift bursts into the continuous-time Itô semi-martingale model in such a way that the fundamental arbitrage-free property is preserved......, currencies and commodities. We find that the majority of identified drift bursts are accompanied by strong price reversals and these can therefore be regarded as “flash crashes” that span brief periods of severe market disruption without any material longer term price impacts....
Multiparameter Monitoring and Prevention of Fault-Slip Rock Burst
Directory of Open Access Journals (Sweden)
Shan-chao Hu
2017-01-01
Full Text Available Fault-slip rock burst is one type of the tectonic rock burst during mining. A detailed understanding of the precursory information of fault-slip rock burst and implementation of monitoring and early warning systems, as well as pressure relief measures, are essential to safety production in deep mines. This paper first establishes a mechanical model of stick-slip instability in fault-slip rock bursts and then reveals the failure characteristics of the instability. Then, change rule of mining-induced stress and microseismic signals before the occurrence of fault-slip rock burst are proposed, and multiparameter integrated early warning methods including mining-induced stress and energy are established. Finally, pressure relief methods targeting large-diameter boreholes and coal seam infusion are presented in accordance with the occurrence mechanism of fault-slip rock burst. The research results have been successfully applied in working faces 2310 of the Suncun Coal Mine, and the safety of the mine has been enhanced. These research results improve the theory of fault-slip rock burst mechanisms and provide the basis for prediction and forecasting, as well as pressure relief, of fault-slip rock bursts.
Relativistic effects in gamma-ray bursts
International Nuclear Information System (INIS)
Eriksen, Erik; Groen, Oeyvind
1999-01-01
According to recent models of the sources of gamma-ray bursts the extremely energetic emission is caused by shells expanding with ultrarelativistic velocity. With the recent identification of optical sources at the positions of some gamma-ray bursts these ''fireball'' models have acquired an actuality that invites to use them as a motivating application when teaching special relativity. We demonstrate several relativistic effects associated with these models which are very pronounced due to the great velocity of the shell. For example a burst lasting for a month in the rest frame of an element of the shell lasts for a few seconds only, in the rest frame of our detector. It is shown how the observed properties of a burst are modified by aberration and the Doppler effect. The apparent luminosity as a function of time is calculated. Modifications due to the motion of the star away from the observer are calculated. (Author)
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Different types of bursting calcium oscillations in non-excitable cells
International Nuclear Information System (INIS)
Perc, Matjaz; Marhl, Marko
2003-01-01
In the paper different types of bursting Ca 2+ oscillations are presented. We analyse bursting behaviour in four recent mathematical models for Ca 2+ oscillations in non-excitable cells. Separately, regular, quasi-periodic, and chaotic bursting Ca 2+ oscillations are classified into several subtypes. The classification is based on the dynamics of separated fast and slow subsystems, the so-called fast-slow burster analysis. For regular bursting Ca 2+ oscillations two types of bursting are specified: Point-Point and Point-Cycle bursting. In particular, the slow passage effect, important for the Hopf-Hopf and SubHopf-SubHopf bursting subtypes, is explained by local divergence calculated for the fast subsystem. Quasi-periodic bursting Ca 2+ oscillations can be found in only one of the four studied mathematical models and appear via a homoclinic bifurcation with a homoclinic torus structure. For chaotic bursting Ca 2+ oscillations, we found that bursting patterns resulting from the period doubling root to chaos considerably differ from those appearing via intermittency and have to be treated separately. The analysis and classification of different types of bursting Ca 2+ oscillations provides better insight into mechanisms of complex intra- and intercellular Ca 2+ signalling. This improves our understanding of several important biological phenomena in cellular signalling like complex frequency-amplitude signal encoding and synchronisation of intercellular signal transduction between coupled cells in tissue
Solar energetic particles and radio burst emission
Directory of Open Access Journals (Sweden)
Miteva Rositsa
2017-01-01
Full Text Available We present a statistical study on the observed solar radio burst emission associated with the origin of in situ detected solar energetic particles. Several proton event catalogs in the period 1996–2016 are used. At the time of appearance of the particle origin (flare and coronal mass ejection we identified radio burst signatures of types II, III and IV by inspecting dynamic radio spectral plots. The information from observatory reports is also accounted for during the analysis. The occurrence of solar radio burst signatures is evaluated within selected wavelength ranges during the solar cycle 23 and the ongoing 24. Finally, we present the burst occurrence trends with respect to the intensity of the proton events and the location of their solar origin.
Bright x-ray flares in gamma-ray burst afterglows.
Burrows, D N; Romano, P; Falcone, A; Kobayashi, S; Zhang, B; Moretti, A; O'brien, P T; Goad, M R; Campana, S; Page, K L; Angelini, L; Barthelmy, S; Beardmore, A P; Capalbi, M; Chincarini, G; Cummings, J; Cusumano, G; Fox, D; Giommi, P; Hill, J E; Kennea, J A; Krimm, H; Mangano, V; Marshall, F; Mészáros, P; Morris, D C; Nousek, J A; Osborne, J P; Pagani, C; Perri, M; Tagliaferri, G; Wells, A A; Woosley, S; Gehrels, N
2005-09-16
Gamma-ray burst (GRB) afterglows have provided important clues to the nature of these massive explosive events, providing direct information on the nearby environment and indirect information on the central engine that powers the burst. We report the discovery of two bright x-ray flares in GRB afterglows, including a giant flare comparable in total energy to the burst itself, each peaking minutes after the burst. These strong, rapid x-ray flares imply that the central engines of the bursts have long periods of activity, with strong internal shocks continuing for hundreds of seconds after the gamma-ray emission has ended.
Fast radio bursts as giant pulses from young rapidly rotating pulsars
Lyutikov, Maxim; Burzawa, Lukasz; Popov, Sergei B.
2016-10-01
We discuss possible association of fast radio bursts (FRBs) with supergiant pulses emitted by young pulsars (ages ˜ tens to hundreds of years) born with regular magnetic field but very short - few milliseconds - spin periods. We assume that FRBs are extra-Galactic events coming from distances d ≲ 100 Mpc and that most of the dispersion measure (DM) comes from the material in the freshly ejected SNR shell. We then predict that for a given burst the DM should decrease with time and that FRBs are not expected to be seen below ˜300 MHz due to free-free absorption in the expanding ejecta. A supernova might have been detected years before the burst; FRBs are mostly associated with star-forming galaxies. The model requires that some pulsars are born with very fast spins, of the order of few milliseconds. The observed distribution of spin-down powers dot{E} in young energetic pulsars is consistent with equal birth rate per decade of dot{E}. Accepting this injection distribution and scaling the intrinsic brightness of FRBs with dot{E}, we predict the following properties of a large sample of FRBs: (I) the brightest observed events come from a broad distribution in distances; (II) for repeating bursts brightness either remains nearly constant (if the spin-down time is longer than the age of the pulsar) or decreases with time otherwise; in the latter case DM ∝ dot{E}.
Neutrino bursts and gravitational waves experiments
Energy Technology Data Exchange (ETDEWEB)
Castagnoli, C; Galeotti, P; Saavedra, O [Consiglio Nazionale delle Ricerche, Turin (Italy). Lab. di Cosmo-Geofisica
1978-05-01
Several experiments have been performed in many countries to observe gravitational waves or neutrino bursts. Since their simultaneous emission may occur in stellar collapse, the authors evaluate the effect of neutrino bursts on gravitational wave antennas and suggest the usefulness of a time correlation among the different detectors.
Broadband Spectral Investigations of Magnetar Bursts
Kırmızıbayrak, Demet; Şaşmaz Muş, Sinem; Kaneko, Yuki; Göğüş, Ersin
2017-09-01
We present our broadband (2-250 keV) time-averaged spectral analysis of 388 bursts from SGR J1550-5418, SGR 1900+14, and SGR 1806-20 detected with the Rossi X-ray Timing Explorer (RXTE) here and as a database in a companion web-catalog. We find that two blackbody functions (BB+BB), the sum of two modified blackbody functions (LB+LB), the sum of a blackbody function and a power-law function (BB+PO), and a power law with a high-energy exponential cutoff (COMPT) all provide acceptable fits at similar levels. We performed numerical simulations to constrain the best fitting model for each burst spectrum and found that 67.6% of burst spectra with well-constrained parameters are better described by the Comptonized model. We also found that 64.7% of these burst spectra are better described with the LB+LB model, which is employed in the spectral analysis of a soft gamma repeater (SGR) for the first time here, than with the BB+BB and BB+PO models. We found a significant positive lower bound trend on photon index, suggesting a decreasing upper bound on hardness, with respect to total flux and fluence. We compare this result with bursts observed from SGR and AXP (anomalous X-ray pulsar) sources and suggest that the relationship is a distinctive characteristic between the two. We confirm a significant anticorrelation between burst emission area and blackbody temperature, and find that it varies between the hot and cool blackbody temperatures differently than previously discussed. We expand on the interpretation of our results in the framework of a strongly magnetized neutron star.
Broadband Spectral Investigations of Magnetar Bursts
Energy Technology Data Exchange (ETDEWEB)
Kırmızıbayrak, Demet; Şaşmaz Muş, Sinem; Kaneko, Yuki; Göğüş, Ersin, E-mail: demetk@sabanciuniv.edu [Faculty of Engineering and Natural Sciences, Sabancı University, Orhanlı Tuzla, Istanbul 34956 (Turkey)
2017-09-01
We present our broadband (2–250 keV) time-averaged spectral analysis of 388 bursts from SGR J1550−5418, SGR 1900+14, and SGR 1806−20 detected with the Rossi X-ray Timing Explorer ( RXTE ) here and as a database in a companion web-catalog. We find that two blackbody functions (BB+BB), the sum of two modified blackbody functions (LB+LB), the sum of a blackbody function and a power-law function (BB+PO), and a power law with a high-energy exponential cutoff (COMPT) all provide acceptable fits at similar levels. We performed numerical simulations to constrain the best fitting model for each burst spectrum and found that 67.6% of burst spectra with well-constrained parameters are better described by the Comptonized model. We also found that 64.7% of these burst spectra are better described with the LB+LB model, which is employed in the spectral analysis of a soft gamma repeater (SGR) for the first time here, than with the BB+BB and BB+PO models. We found a significant positive lower bound trend on photon index, suggesting a decreasing upper bound on hardness, with respect to total flux and fluence. We compare this result with bursts observed from SGR and AXP (anomalous X-ray pulsar) sources and suggest that the relationship is a distinctive characteristic between the two. We confirm a significant anticorrelation between burst emission area and blackbody temperature, and find that it varies between the hot and cool blackbody temperatures differently than previously discussed. We expand on the interpretation of our results in the framework of a strongly magnetized neutron star.
Sources of type III solar microwave bursts
Directory of Open Access Journals (Sweden)
Zhdanov D.A.
2016-06-01
Full Text Available Microwave fine structures allow us to study plasma evolution in an energy release region. The Siberian Solar Radio Telescope (SSRT is a unique instrument designed to examine fine structures at 5.7 GHz. A complex analysis of data from RATAN-600, 4–8 GHz spectropolarimeter, and SSRT, simultaneously with EUV data, made it possible to localize sources of III type microwave bursts in August 10, 2011 event within the entire frequency band of burst occurrence, as well as to determine the most probable region of primary energy release. To localize sources of III type bursts from RATAN-600 data, an original method for data processing has been worked out. At 5.7 GHz, the source of bursts was determined along two coordinates, whereas at 4.5, 4.7, 4.9, 5.1, 5.3, 5.5, and 6.0 GHz, their locations were identified along one coordinate. The size of the burst source at 5.1 GHz was found to be maximum as compared to those at other frequencies.
Gamma-ray bursts from stellar remnants - Probing the universe at high redshift
Wijers, R.A.M.J.; Bloom, J.S.; Bagla, J.S.; Natarajan, P.
1998-01-01
A gamma-ray burst (GRB) releases an amount of energy similar to that of a supernova explosion, which combined with its rapid variability suggests an origin related to neutron stars or black holes. Since these compact stellar remnants form from the most massive stars not long after their birth, GRBs
CT findings predictive of neurological deficits in throracolumbar burst fractures
Energy Technology Data Exchange (ETDEWEB)
Moon, Tae Yong; Jeong, Hee Seok; Jeong, Yeo Jin [Pusan National University and Research Institute for Convergence of Biomedical Science and Technology, Dept. of Radiology, Pusan National University Yangsan Hospital, Yangsan (Korea, Republic of); Lee, In Sook [Dept. of Radiology, Pusan National University Hospital, Busan (Korea, Republic of)
2016-09-15
To determine the computed tomography (CT) findings predictive of neurological deficits in thoracolumbar spine injuries. One hundred two patients with thoracolumbar spinal burst fractures, after excluding the patients with brain and cervical cord injuries and unconsciousness, who underwent consecutive spine 128-multidetector CT scan formed the study group. The neurological findings were clinically classified as no deficit (n = 58), complete deficit with paraplegia (n = 22), and incomplete deficit with either motor or sensory impairment (n = 22). The following four CT imaging parameters were analyzed: the level of the main burst fracture as the cord (n = 44) and the cauda equina (n = 58) levels; the extent of canal encroachment as central canal ratios (CCRs) below 0.5 (n = 43) and above 0.5 (n = 59); the degree of laminar fracture as no fracture (n = 33), linear fracture (n = 7), separated fracture (n = 27), and displaced fracture (n = 35); fractured vertebra counted as single (n = 53) and multiple (n = 49). Complete neurological deficit was associated with injuries at the cord level (p = 0.000) and displaced laminar fractures (p = 0.000); incomplete neurological deficit was associated with CCRs below 0.5 (p = 0.000) and multiple vertebral injuries (p = 0.002). CT scan can provide additional findings predictive of neurological deficits in thoracolumbar spinal burst fractures.
Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S
2015-11-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.
The afterglow and elliptical host galaxy of the short gamma-ray burst GRB 050724.
Berger, E; Price, P A; Cenko, S B; Gal-Yam, A; Soderberg, A M; Kasliwal, M; Leonard, D C; Cameron, P B; Frail, D A; Kulkarni, S R; Murphy, D C; Krzeminski, W; Piran, T; Lee, B L; Roth, K C; Moon, D-S; Fox, D B; Harrison, F A; Persson, S E; Schmidt, B P; Penprase, B E; Rich, J; Peterson, B A; Cowie, L L
2005-12-15
Despite a rich phenomenology, gamma-ray bursts (GRBs) are divided into two classes based on their duration and spectral hardness--the long-soft and the short-hard bursts. The discovery of afterglow emission from long GRBs was a watershed event, pinpointing their origin to star-forming galaxies, and hence the death of massive stars, and indicating an energy release of about 10(51) erg. While theoretical arguments suggest that short GRBs are produced in the coalescence of binary compact objects (neutron stars or black holes), the progenitors, energetics and environments of these events remain elusive despite recent localizations. Here we report the discovery of the first radio afterglow from the short burst GRB 050724, which unambiguously associates it with an elliptical galaxy at a redshift z = 0.257. We show that the burst is powered by the same relativistic fireball mechanism as long GRBs, with the ejecta possibly collimated in jets, but that the total energy release is 10-1,000 times smaller. More importantly, the nature of the host galaxy demonstrates that short GRBs arise from an old (> 1 Gyr) stellar population, strengthening earlier suggestions and providing support for coalescing compact object binaries as the progenitors.
Focused Study of Thermonuclear Bursts on Neutron Stars
Chenevez, Jérôme
2009-05-01
X-ray bursters form a class of Low Mass X-Ray Binaries where accreted material from a donor star undergoes rapid thermonuclear burning in the surface layers of a neutron star. The flux released can temporarily exceed the Eddington limit and drive the photosphere to large radii. Such photospheric radius expansion bursts likely eject nuclear burning ashes into the interstellar medium, and may make possible the detection of photoionization edges. Indeed, theoretical models predict that absorption edges from 58Fe at 9.2 keV, 60Zn and 62Zn at 12.2 keV should be detectable by the future missions Simbol-X and NuSTAR. A positive detection would thus probe the nuclear burning as well as the gravitational redshift from the neutron star. Moreover, likely observations of atomic X-ray spectral components reflected from the inner accretion disk have been reported. The high spectral resolution capabilities of the focusing X-ray telescopes may therefore make possible to differentiate between the potential interpretations of the X-ray bursts spectral features.
Powerful Radio Burst Indicates New Astronomical Phenomenon
2007-09-01
Astronomers studying archival data from an Australian radio telescope have discovered a powerful, short-lived burst of radio waves that they say indicates an entirely new type of astronomical phenomenon. Region of Strong Radio Burst Visible-light (negative greyscale) and radio (contours) image of Small Magellanic Cloud and area where burst originated. CREDIT: Lorimer et al., NRAO/AUI/NSF Click on image for high-resolution file ( 114 KB) "This burst appears to have originated from the distant Universe and may have been produced by an exotic event such as the collision of two neutron stars or the death throes of an evaporating black hole," said Duncan Lorimer, Assistant Professor of Physics at West Virginia University (WVU) and the National Radio Astronomy Observatory (NRAO). The research team led by Lorimer consists of Matthew Bailes of Swinburne University in Australia, Maura McLaughlin of WVU and NRAO, David Narkevic of WVU, and Fronefield Crawford of Franklin and Marshall College in Lancaster, Pennsylvania. The astronomers announced their findings in the September 27 issue of the online journal Science Express. The startling discovery came as WVU undergraduate student David Narkevic re-analyzed data from observations of the Small Magellanic Cloud made by the 210-foot Parkes radio telescope in Australia. The data came from a survey of the Magellanic Clouds that included 480 hours of observations. "This survey had sought to discover new pulsars, and the data already had been searched for the type of pulsating signals they produce," Lorimer said. "We re-examined the data, looking for bursts that, unlike the usual ones from pulsars, are not periodic," he added. The survey had covered the Magellanic Clouds, a pair of small galaxies in orbit around our own Milky Way Galaxy. Some 200,000 light-years from Earth, the Magellanic Clouds are prominent features in the Southern sky. Ironically, the new discovery is not part of these galaxies, but rather is much more distant
Ballerina - pirouettes in search of gamma bursts
DEFF Research Database (Denmark)
Brandt, Søren Kristian; Lund, Niels; Pedersen, Henrik
1999-01-01
The cosmological origin of gamma ray bursts has now been established with reasonable certainty, Many more bursts will need to be studied to establish the typical distance scale, and to map out the large diversity in properties which have been indicated by the first handful of events. We are propo...... are proposing Ballerina, a small satellite to provide accurate positions and new data on the gamma-ray bursts. We anticipate a detection rate an order of magnitude larger than obtained from Beppo-SAX....
Beam On Target (BOT) Produces Gamma Ray Burst (GRB) Fireballs and Afterglows
Greyber, H. D.
1997-12-01
Unlike the myriads of ad hoc models that have been offered to explain GRB, the BOT process is simply the very common process used worldwide in accelerator laboratories to produce gamma rays. The Strong Magnetic Field (SMF) model postulates an extremely intense, highly relativistic current ring formed during the original gravitational collapse of a distant galaxy when the plasma cloud was permeated by a primordial magnetic field. GRB occur when solid matter (asteroid, white dwarf, neutron star, planet) falls rapidly through the Storage Ring beam producing a very strongly collimated electromagnetic shower, and a huge amount of matter from the target, in the form of a giant, hot, expanding plasma cloud, or ``Fireball,'' is blown off. BOT satisfies all the ``severe constraints imposed on the source of this burst --'' concluded by the CGRO team (Sommer et al, Astrophys. J. 422 L63 (1994)) for the huge intense burst GRB930131, whereas neutron star merger models are ``difficult to reconcile.'' BOT expects the lowest energy gamma photons to arrive very slightly later than higher energy photons due to the time for the shower to penetrate the target. The millisecond spikes in bursts are due to the slender filaments of current that make up the Storage Ring beam. Delayed photons can be explained by a broken target ``rock.'' See H. Greyber in the book ``Compton Gamma Ray Observatory,'' AIP Conf. Proc. 280, 569 (1993).
Aliasing of the Schumann resonance background signal by sprite-associated Q-bursts
Guha, Anirban; Williams, Earle; Boldi, Robert; Sátori, Gabriella; Nagy, Tamás; Bór, József; Montanyà, Joan; Ortega, Pascal
2017-12-01
The Earth's naturally occurring Schumann resonances (SR) are composed of a quasi-continuous background component and a larger-amplitude, short-duration transient component, otherwise called 'Q-burst' (Ogawa et al., 1967). Sprites in the mesosphere are also known to accompany the energetic positive ground flashes that launch the Q-bursts (Boccippio et al., 1995). Spectra of the background Schumann Resonances (SR) require a natural stabilization period of ∼10-12 min for the three conspicuous modal parameters to be derived from Lorentzian fitting. Before the spectra are computed and the fitting process is initiated, the raw time series data need to be properly filtered for local cultural noise, narrow band interference as well as for large transients in the form of global Q-bursts. Mushtak and Williams (2009) describe an effective technique called Isolated Lorentzian (I-LOR), in which, the contributions from local cultural and various other noises are minimized to a great extent. An automated technique based on median filtering of time series data has been developed. These special lightning flashes are known to have greater contribution in the ELF range (below 1 kHz) compared to general negative CG strikes (Huang et al., 1999; Cummer et al., 2006). The global distributions of these Q-bursts have been studied by Huang et al. (1999) Rhode Island, USA by wave impedance methods from single station ELF measurements at Rhode Island, USA and from Japan Hobara et al. (2006). The present work aims to demonstrate the effect of Q-bursts on SR background spectra using GPS time-stamped observation of TLEs. It is observed that the Q-bursts selected for the present work do alias the background spectra over a 5-s period, though the amplitudes of these Q-bursts are far below the background threshold of 16 Core Standard Deviation (CSD) so that they do not strongly alias the background spectra of 10-12 min duration. The examination of one exceptional Q-burst shows that appreciable
Harvey-Girard, Erik; Lewis, John; Maler, Leonard
2010-04-28
Weakly electric fish can enhance the detection and localization of important signals such as those of prey in part by cancellation of redundant spatially diffuse electric signals due to, e.g., their tail bending. The cancellation mechanism is based on descending input, conveyed by parallel fibers emanating from cerebellar granule cells, that produces a negative image of the global low-frequency signals in pyramidal cells within the first-order electrosensory region, the electrosensory lateral line lobe (ELL). Here we demonstrate that the parallel fiber synaptic input to ELL pyramidal cell undergoes long-term depression (LTD) whenever both parallel fiber afferents and their target cells are stimulated to produce paired burst discharges. Paired large bursts (4-4) induce robust LTD over pre-post delays of up to +/-50 ms, whereas smaller bursts (2-2) induce weaker LTD. Single spikes (either presynaptic or postsynaptic) paired with bursts did not induce LTD. Tetanic presynaptic stimulation was also ineffective in inducing LTD. Thus, we have demonstrated a form of anti-Hebbian LTD that depends on the temporal correlation of burst discharge. We then demonstrated that the burst-induced LTD is postsynaptic and requires the NR2B subunit of the NMDA receptor, elevation of postsynaptic Ca(2+), and activation of CaMKIIbeta. A model incorporating local inhibitory circuitry and previously identified short-term presynaptic potentiation of the parallel fiber synapses further suggests that the combination of burst-induced LTD, presynaptic potentiation, and local inhibition may be sufficient to explain the generation of the negative image and cancellation of redundant sensory input by ELL pyramidal cells.
International Nuclear Information System (INIS)
Demuynck, H.; Dexter, T.M.; Testa, N.G.; Pettengell, R.; Campos, E. de
1992-01-01
After treatment of patients with intermediate or high grade non-Hodgkin lymphoma with chemotherapy plus G-CSF the numbers of haemopoietic progenitor cells in the circulation increased to a mean of 226-fold for mixed CFC (Mix-CFC), 278-fold for GM-CFC and 29-fold for erythroid burst forming unit (BFU-E). The mean increase was modest (7-12-fold) for patients treated with chemotherapy alone. Peripheral blood mononuclear cells harvested at the time of the peak in the numbers of progenitors, or 2-4 days before the peak, seeded onto irradiated marrow stroma in vitro, repopulated the stroma and generated active haemopoiesis at least as effectively as bone marrow cells on a cell per cell basis. This is in contrast to the poor repopulating capacity of pretreatment blood. The results indicate that not only the progenitor cells, but also the repopulating stem cells migrated into the blood after chemotherapy plus G-CSF in sufficient numbers to allow harvesting and successful grafting without the possible complication of late haemopoietic failure. (author)
Presence of calreticulin mutations in JAK2-negative polycythemia vera.
Broséus, Julien; Park, Ji-Hye; Carillo, Serge; Hermouet, Sylvie; Girodon, François
2014-12-18
Calreticulin (CALR) mutations have been reported in Janus kinase 2 (JAK2)- and myeloproliferative leukemia (MPL)-negative essential thrombocythemia and primary myelofibrosis. In contrast, no CALR mutations have ever been reported in the context of polycythemia vera (PV). Here, we describe 2 JAK2(V617F)-JAK2(exon12)-negative PV patients who presented with a CALR mutation in peripheral granulocytes at the time of diagnosis. In both cases, the CALR mutation was a 52-bp deletion. Single burst-forming units-erythroid (BFU-E) from 1 patient were grown in vitro and genotyped: the same CALR del 52-bp mutation was noted in 31 of the 37 colonies examined; 30 of 31 BFU-E were heterozygous for CALR del 52 bp, and 1 of 31 BFU-E was homozygous for CALR del 52 bp. In summary, although unknown mutations leading to PV cannot be ruled out, our results suggest that CALR mutations can be associated with JAK2-negative PV. © 2014 by The American Society of Hematology.
Beta burst dynamics in Parkinson's disease OFF and ON dopaminergic medication.
Tinkhauser, Gerd; Pogosyan, Alek; Tan, Huiling; Herz, Damian M; Kühn, Andrea A; Brown, Peter
2017-11-01
Exaggerated basal ganglia beta activity (13-35 Hz) is commonly found in patients with Parkinson's disease and can be suppressed by dopaminergic medication, with the degree of suppression being correlated with the improvement in motor symptoms. Importantly, beta activity is not continuously elevated, but fluctuates to give beta bursts. The percentage number of longer beta bursts in a given interval is positively correlated with clinical impairment in Parkinson's disease patients. Here we determine whether the characteristics of beta bursts are dependent on dopaminergic state. Local field potentials were recorded from the subthalamic nucleus of eight Parkinson's disease patients during temporary lead externalization during surgery for deep brain stimulation. The recordings took place with the patient quietly seated following overnight withdrawal of levodopa and after administration of levodopa. Beta bursts were defined by applying a common amplitude threshold and burst characteristics were compared between the two drug conditions. The amplitude of beta bursts, indicative of the degree of local neural synchronization, progressively increased with burst duration. Treatment with levodopa limited this evolution leading to a relative increase of shorter, lower amplitude bursts. Synchronization, however, was not limited to local neural populations during bursts, but also, when such bursts were cotemporaneous across the hemispheres, was evidenced by bilateral phase synchronization. The probability of beta bursts and the proportion of cotemporaneous bursts were reduced by levodopa. The percentage number of longer beta bursts in a given interval was positively related to motor impairment, while the opposite was true for the percentage number of short duration beta bursts. Importantly, the decrease in burst duration was also correlated with the motor improvement. In conclusion, we demonstrate that long duration beta bursts are associated with an increase in local and
Chimera states in bursting neurons
Bera, Bidesh K.; Ghosh, Dibakar; Lakshmanan, M.
2015-01-01
We study the existence of chimera states in pulse-coupled networks of bursting Hindmarsh-Rose neurons with nonlocal, global and local (nearest neighbor) couplings. Through a linear stability analysis, we discuss the behavior of stability function in the incoherent (i.e. disorder), coherent, chimera and multi-chimera states. Surprisingly, we find that chimera and multi-chimera states occur even using local nearest neighbor interaction in a network of identical bursting neurons alone. This is i...
US Army Nuclear Burst Detection System (NBDS)
International Nuclear Information System (INIS)
Glaser, R.F.
1980-07-01
The Nuclear Burst Detection System (NBDS) was developed to meet the Army requirements of an unattended, automatic nuclear burst reporting system. It provides pertinent data for battlefield commanders on a timely basis with high reliability
Prospective identification of erythroid elements in cultured peripheral blood.
Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P
1999-04-01
We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.
X-ray bursts from GX 17+2: a new approach
International Nuclear Information System (INIS)
Sztajno, M.; Langmeier, A.; Truemper, J.; Pietsch, W.; Paradijs, J. van; Lewin, W.H.G.; Massachusetts Inst. of Tech., Cambridge
1986-01-01
The detection of two X-ray bursts from GX 17+2 is reported; a short one (lasting about 10s), and a long one (which lasted about 5 min). These bursts reached a maximum intensity of only about 40 per cent above the persistent flux level. Like previous long bursts observed from GX 17+2 the long burst showed little softening during its decay, and it is difficult at first glance to classify it as either a type 1 or a type 2 burst. Following the recent results of two of the authors a time-dependent spectral analysis of these bursts has been made. (author)
Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow
International Nuclear Information System (INIS)
Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.
1976-01-01
The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors
International Nuclear Information System (INIS)
Hurley, K.
1989-01-01
This paper reviews the essential aspects of the gamma-ray burst (GRB) phenomenon, with emphasis on the more recent results. GRBs are introduced by their time histories, which provide some evidence for a compact object origin. The energy spectra of bursts are presented and they are seen to demonstrate practically unambiguously that the origin of some GRBs involves neutron stars. Counterpart searches are reviewed briefly and the statistical properties of bursters treated. This paper presents a review of the three known repeating bursters (the Soft Gamma Repeaters). Extragalactic and galactic models are discussed and future prospects are assessed
Solar Type II Radio Bursts and IP Type II Events
Cane, H. V.; Erickson, W. C.
2005-01-01
We have examined radio data from the WAVES experiment on the Wind spacecraft in conjunction with ground-based data in order to investigate the relationship between the shocks responsible for metric type II radio bursts and the shocks in front of coronal mass ejections (CMEs). The bow shocks of fast, large CMEs are strong interplanetary (IP) shocks, and the associated radio emissions often consist of single broad bands starting below approx. 4 MHz; such emissions were previously called IP type II events. In contrast, metric type II bursts are usually narrowbanded and display two harmonically related bands. In addition to displaying complete dynamic spectra for a number of events, we also analyze the 135 WAVES 1 - 14 MHz slow-drift time periods in 2001-2003. We find that most of the periods contain multiple phenomena, which we divide into three groups: metric type II extensions, IP type II events, and blobs and bands. About half of the WAVES listings include probable extensions of metric type II radio bursts, but in more than half of these events, there were also other slow-drift features. In the 3 yr study period, there were 31 IP type II events; these were associated with the very fastest CMEs. The most common form of activity in the WAVES events, blobs and bands in the frequency range between 1 and 8 MHz, fall below an envelope consistent with the early signatures of an IP type II event. However, most of this activity lasts only a few tens of minutes, whereas IP type II events last for many hours. In this study we find many examples in the radio data of two shock-like phenomena with different characteristics that occur simultaneously in the metric and decametric/hectometric bands, and no clear example of a metric type II burst that extends continuously down in frequency to become an IP type II event. The simplest interpretation is that metric type II bursts, unlike IP type II events, are not caused by shocks driven in front of CMEs.
Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio
2016-07-15
Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.
Leader neurons in population bursts of 2D living neural networks
International Nuclear Information System (INIS)
Eckmann, J-P; Zbinden, Cyrille; Jacobi, Shimshon; Moses, Elisha; Marom, Shimon
2008-01-01
Eytan and Marom (2006 J. Neurosci. 26 8465-76) recently showed that the spontaneous bursting activity of rat neuron cultures includes 'first-to-fire' cells that consistently fire earlier than others. Here, we analyze the behavior of these neurons in long-term recordings of spontaneous activity of rat hippocampal and rat cortical neuron cultures from three different laboratories. We identify precursor events that may either subside ('aborted bursts') or can lead to a full-blown burst ('pre-bursts'). We find that the activation in the pre-burst typically has a first neuron ('leader'), followed by a localized response in its neighborhood. Locality is diminished in the bursts themselves. The long-term dynamics of the leaders is relatively robust, evolving with a half-life of 23-34 h. Stimulation of the culture alters the leader distribution, but the distribution stabilizes within about 1 h. We show that the leaders carry information about the identity of the burst, as measured by the signature of the number of spikes per neuron in a burst. The number of spikes from leaders in the first few spikes of a precursor event is furthermore shown to be predictive with regard to the transition into a burst (pre-burst versus aborted burst). We conclude that the leaders play a role in the development of the bursts and conjecture that they are part of an underlying sub-network that is excited first and then acts as a nucleation center for the burst
Impulsive EUV bursts observed in C IV with OSO-8
International Nuclear Information System (INIS)
Grant Athay, R.; White, O.R.; Lites, B.W.
1980-01-01
Time sequences of profiles of the lambda 1548 line of C IV containing 51 EUV bursts observed in or near active regions are analyzed to determine the brightness. Doppler shift and line broadening characteristics of the bursts. The bursts have mean lifetimes of approximately 150s, and mean increases in brightness at burst maximum of four-fold as observed with a field of view of 2'' x 20''. Mean burst diameters are estimated to be 3'', or smaller. All but three of the bursts show Doppler shift with velocities sometimes exceeding 75 km s -1 ; 31 are dominated by red shifts and 17 are dominated by blue shifts. Approximately half of the latter group have red-shifted precursors. We interpret the bursts as prominence material, such as surges and coronal rain, moving through the field of view of the spectrometer. (orig.)
Multiparameter Monitoring and Prevention of Fault-Slip Rock Burst
Hu, Shan-chao; Tan, Yun-liang; Ning, Jian-guo; Guo, Wei-Yao; Liu, Xue-sheng
2017-01-01
Fault-slip rock burst is one type of the tectonic rock burst during mining. A detailed understanding of the precursory information of fault-slip rock burst and implementation of monitoring and early warning systems, as well as pressure relief measures, are essential to safety production in deep mines. This paper first establishes a mechanical model of stick-slip instability in fault-slip rock bursts and then reveals the failure characteristics of the instability. Then, change rule of mining-i...
PHYSICAL CONSTRAINTS ON FAST RADIO BURSTS
Energy Technology Data Exchange (ETDEWEB)
Luan, Jing; Goldreich, Peter, E-mail: jingluan@caltech.edu [California Institute of Technology, Pasadena, CA 91125 (United States)
2014-04-20
Fast radio bursts (FRBs) are isolated, ms radio pulses with dispersion measure (DM) of order 10{sup 3} pc cm{sup –3}. Galactic candidates for the DM of high latitude bursts detected at GHz frequencies are easily dismissed. DM from bursts emitted in stellar coronas are limited by free-free absorption and those from H II regions are bounded by the nondetection of associated free-free emission at radio wavelengths. Thus, if astronomical, FRBs are probably extragalactic. FRB 110220 has a scattering tail of ∼5.6 ± 0.1 ms. If the electron density fluctuations arise from a turbulent cascade, the scattering is unlikely to be due to propagation through the diffuse intergalactic plasma. A more plausible explanation is that this burst sits in the central region of its host galaxy. Pulse durations of order ms constrain the sizes of FRB sources implying high brightness temperatures that indicates coherent emission. Electric fields near FRBs at cosmological distances would be so strong that they could accelerate free electrons from rest to relativistic energies in a single wave period.
PHYSICAL CONSTRAINTS ON FAST RADIO BURSTS
International Nuclear Information System (INIS)
Luan, Jing; Goldreich, Peter
2014-01-01
Fast radio bursts (FRBs) are isolated, ms radio pulses with dispersion measure (DM) of order 10 3 pc cm –3 . Galactic candidates for the DM of high latitude bursts detected at GHz frequencies are easily dismissed. DM from bursts emitted in stellar coronas are limited by free-free absorption and those from H II regions are bounded by the nondetection of associated free-free emission at radio wavelengths. Thus, if astronomical, FRBs are probably extragalactic. FRB 110220 has a scattering tail of ∼5.6 ± 0.1 ms. If the electron density fluctuations arise from a turbulent cascade, the scattering is unlikely to be due to propagation through the diffuse intergalactic plasma. A more plausible explanation is that this burst sits in the central region of its host galaxy. Pulse durations of order ms constrain the sizes of FRB sources implying high brightness temperatures that indicates coherent emission. Electric fields near FRBs at cosmological distances would be so strong that they could accelerate free electrons from rest to relativistic energies in a single wave period
IDENTIFICATION OF BURSTING WATER MASER FEATURES IN ORION KL
International Nuclear Information System (INIS)
Hirota, Tomoya; Honma, Mareki; Kim, Mi Kyoung; Kobayashi, Hideyuki; Shibata, Katsunori M.; Tsuboi, Masato; Fujisawa, Kenta; Kawaguchi, Noriyuki; Imai, Hiroshi; Omodaka, Toshihiro; Shimoikura, Tomomi; Yonekura, Yoshinori
2011-01-01
In 2011 February, a burst event of the H 2 O maser in Orion KL (Kleinmann-Low object) has started after a 13 year silence. This is the third time such phenomena has been detected in Orion KL, followed by the events in 1979-1985 and 1998. We have carried out astrometric observations of the bursting H 2 O maser features in Orion KL with the VLBI Exploration of Radio Astrometry (VERA), a Japanese very long baseline interferometry network dedicated for astrometry. The total flux of the bursting feature at the local standard of rest (LSR) velocity of 7.58 km s -1 reaches 4.4 x 10 4 Jy in 2011 March. The intensity of the bursting feature is three orders of magnitude larger than that of the same velocity feature in the quiescent phase in 2006. Two months later, another new feature appears at the LSR velocity of 6.95 km s -1 in 2011 May, separated by 12 mas north of the 7.58 km s -1 feature. Thus, the current burst occurs at two spatially different features. The bursting masers are elongated along the northwest-southeast direction as reported in the previous burst in 1998. We determine the absolute positions of the bursting features for the first time ever with a submilliarcsecond (mas) accuracy. Their positions are coincident with the shocked molecular gas called the Orion Compact Ridge. We tentatively detect the absolute proper motions of the bursting features toward the southwest direction. It is most likely that the outflow from the radio source I or another young stellar object interacting with the Compact Ridge is a possible origin of the H 2 O maser burst.
Thalamic neuron models encode stimulus information by burst-size modulation
Directory of Open Access Journals (Sweden)
Daniel Henry Elijah
2015-09-01
Full Text Available Thalamic neurons have been long assumed to fire in tonic mode during perceptive states, and in burst mode during sleep and unconsciousness. However, recent evidence suggests that bursts may also be relevant in the encoding of sensory information. Here we explore the neural code of such thalamic bursts. In order to assess whether the burst code is generic or whether it depends on the detailed properties of each bursting neuron, we analyzed two neuron models incorporating different levels of biological detail. One of the models contained no information of the biophysical processes entailed in spike generation, and described neuron activity at a phenomenological level. The second model represented the evolution of the individual ionic conductances involved in spiking and bursting, and required a large number of parameters. We analyzed the models' input selectivity using reverse correlation methods and information theory. We found that n-spike bursts from both models transmit information by modulating their spike count in response to changes to instantaneous input features, such as slope, phase, amplitude, etc. The stimulus feature that is most efficiently encoded by bursts, however, need not coincide with one of such classical features. We therefore searched for the optimal feature among all those that could be expressed as a linear transformation of the time-dependent input current. We found that bursting neurons transmitted 6 times more information about such more general features. The relevant events in the stimulus were located in a time window spanning ~100 ms before and ~20 ms after burst onset. Most importantly, the neural code employed by the simple and the biologically realistic models was largely the same, implying that the simple thalamic neuron model contains the essential ingredients that account for the computational properties of the thalamic burst code. Thus, our results suggest the n-spike burst code is a general property of
Thalamic neuron models encode stimulus information by burst-size modulation.
Elijah, Daniel H; Samengo, Inés; Montemurro, Marcelo A
2015-01-01
Thalamic neurons have been long assumed to fire in tonic mode during perceptive states, and in burst mode during sleep and unconsciousness. However, recent evidence suggests that bursts may also be relevant in the encoding of sensory information. Here, we explore the neural code of such thalamic bursts. In order to assess whether the burst code is generic or whether it depends on the detailed properties of each bursting neuron, we analyzed two neuron models incorporating different levels of biological detail. One of the models contained no information of the biophysical processes entailed in spike generation, and described neuron activity at a phenomenological level. The second model represented the evolution of the individual ionic conductances involved in spiking and bursting, and required a large number of parameters. We analyzed the models' input selectivity using reverse correlation methods and information theory. We found that n-spike bursts from both models transmit information by modulating their spike count in response to changes to instantaneous input features, such as slope, phase, amplitude, etc. The stimulus feature that is most efficiently encoded by bursts, however, need not coincide with one of such classical features. We therefore searched for the optimal feature among all those that could be expressed as a linear transformation of the time-dependent input current. We found that bursting neurons transmitted 6 times more information about such more general features. The relevant events in the stimulus were located in a time window spanning ~100 ms before and ~20 ms after burst onset. Most importantly, the neural code employed by the simple and the biologically realistic models was largely the same, implying that the simple thalamic neuron model contains the essential ingredients that account for the computational properties of the thalamic burst code. Thus, our results suggest the n-spike burst code is a general property of thalamic neurons.
[Update on the biology of heme synthesis in erythroid cells].
Fujiwara, Tohru; Harigae, Hideo
2015-02-01
Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.
Galactic distribution of X-ray burst sources
International Nuclear Information System (INIS)
Lewin, W.H.G.; Hoffman, J.A.; Doty, J.; Clark, G.W.; Swank, J.H.; Becker, R.H.; Pravdo, S.H.; Serlemitsos, P.J.
1977-01-01
It is stated that 18 X-ray burst sources have been observed to date, applying the following definition for these bursts - rise times of less than a few seconds, durations of seconds to minutes, and recurrence in some regular pattern. If single burst events that meet the criteria of rise time and duration, but not recurrence are included, an additional seven sources can be added. A sky map is shown indicating their positions. The sources are spread along the galactic equator and cluster near low galactic longitudes, and their distribution is different from that of the observed globular clusters. Observations based on the SAS-3 X-ray observatory studies and the Goddard X-ray Spectroscopy Experiment on OSO-9 are described. The distribution of the sources is examined and the effect of uneven sky exposure on the observed distribution is evaluated. It has been suggested that the bursts are perhaps produced by remnants of disrupted globular clusters and specifically supermassive black holes. This would imply the existence of a new class of unknown objects, and at present is merely an ad hoc method of relating the burst sources to globular clusters. (U.K.)
On Burst Detection and Prediction in Retweeting Sequence
2015-05-22
We conduct a comprehensive empirical analysis of a large microblogging dataset collected from the Sina Weibo and report our observations of burst...whether and how accurate we can predict bursts using classifiers based on the extracted features. Our empirical study of the Sina Weibo data shows the...feasibility of burst prediction using appropriately extracted features and classic classifiers. 1 Introduction Microblogging, such as Twitter and Sina
LAT Onboard Science: Gamma-Ray Burst Identification
International Nuclear Information System (INIS)
Kuehn, Frederick; Hughes, Richard; Smith, Patrick; Winer, Brian; Bonnell, Jerry; Norris, Jay; Ritz, Steven; Russell, James
2007-01-01
The main goal of the Large Area Telescope (LAT) onboard science program is to provide quick identification and localization of Gamma Ray Bursts (GRB) onboard the LAT for follow-up observations by other observatories. The GRB identification and localization algorithm will provide celestial coordinates with an error region that will be distributed via the Gamma ray burst Coordinate Network (GCN). We present results that show our sensitivity to bursts as characterized using Monte Carlo simulations of the GLAST observatory. We describe and characterize the method of onboard track determination and the GRB identification and localization algorithm. Onboard track determination is considerably different than in the on-ground case, resulting in a substantially altered point spread function. The algorithm contains tunable parameters which may be adjusted after launch when real bursts characteristics at very high energies have been identified
Gamma-ray burst polarimeter (GAP)
International Nuclear Information System (INIS)
Mihara, Tatehiro; Murakami, Toshio; Yonetoku, Daisuke; Gunji, Shuichi; Kubo, Shin
2013-01-01
The gamma-ray burst polarimeter (GAP: GAmma-ray burst Polarimeter), which had been almost handcrafted by scientists, has succeeded in working normally in interplanetary space, and in detecting the polarization of the gamma-ray from a mysterious astronomical object 'gamma-ray burst'. It is the first result of the detectors in the world exclusively aiming at detecting gamma-ray polarization. We mainly describe the hardware of our GAP equipment and show the method of preparing equipment to work in the cosmic space with a tight budget. The mechanical structure, the electronic circuits, the software on the equipment, the data analysis on the earth, and the scientific results gained by the observation just over one year, are presented after explaining the principle of gamma-ray polarization detection. Our design to protect equipment against mechanical shock and cosmic radiation may provide useful information for future preparation of compact satellite. (J.P.N.)
Multifrequency Observations of Gamma-Ray Burst
Greiner, J.
1995-01-01
Neither a flaring nor a quiescent counterpart to a gamma-ray burst has yet been convincingly identified at any wavelength region. The present status of the search for counterparts of classical gamma-ray bursts is given. Particular emphasis is put on the search for flaring counterparts, i.e. emission during or shortly after the gamma-ray emission.
Directory of Open Access Journals (Sweden)
Ali Dehghanifard
2012-07-01
Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.
Gamma Ray Bursts and the Birth of Black Holes
Gehrels, Neil
2009-01-01
Black holes have been predicted since the 1940's from solutions of Einstein's general relativity field equation. There is strong evidence of their existence from astronomical observations, but their origin has remained an open question of great interest. Gamma-ray bursts may the clue. They are powerful explosions, visible to high redshift, and appear to be the birth cries of black holes. The Swift and Fermi missions are two powerful NASA observatories currently in orbit that are discovering how gamma-ray bursts work. Evidence is building that the long and short duration subcategories of GRBs have very different origins: massive star core collapse to a black hole for long bursts and binary neutron star coalescence to a black hole for short bursts. The similarity to Type II and Ia supernovae originating from young and old stellar progenitors is striking. Bursts are tremendously luminous and are providing a new tool to study the high redshift universe. One Swift burst at z=8.3 is the most distant object known in the universe. The talk will present the latest gamma-ray burst results from Swift and Fermi and will highlight what they are teaching us about black holes and jet outflows.
Observational properties of cosmic gamma-ray bursts
International Nuclear Information System (INIS)
Mazets, E.P.
1986-01-01
A brief overview of the major observational results obtained in gamma-ray burst studies is presented. Also discussed is to what extent the thermonuclear model, which appears at present to be the most plausible, can account for the observed properties of the bursts. The investigation of gamma-ray bursts should cover observations of the time histories of events, energy spectra, and their variablility, source localization, and inspection of the localization regions during the active and quiescent phases of the source in other wavelengths, as well as, evaluation of the statistical distributions of the data obtained
An extreme magneto-ionic environment associated with the fast radio burst source FRB 121102
Michilli, D.; Seymour, A.; Hessels, J. W. T.; Spitler, L. G.; Gajjar, V.; Archibald, A. M.; Bower, G. C.; Chatterjee, S.; Cordes, J. M.; Gourdji, K.; Heald, G. H.; Kaspi, V. M.; Law, C. J.; Sobey, C.; Adams, E. A. K.; Bassa, C. G.; Bogdanov, S.; Brinkman, C.; Demorest, P.; Fernandez, F.; Hellbourg, G.; Lazio, T. J. W.; Lynch, R. S.; Maddox, N.; Marcote, B.; McLaughlin, M. A.; Paragi, Z.; Ransom, S. M.; Scholz, P.; Siemion, A. P. V.; Tendulkar, S. P.; van Rooy, P.; Wharton, R. S.; Whitlow, D.
2018-01-01
Fast radio bursts are millisecond-duration, extragalactic radio flashes of unknown physical origin. The only known repeating fast radio burst source—FRB 121102—has been localized to a star-forming region in a dwarf galaxy at redshift 0.193 and is spatially coincident with a compact, persistent radio source. The origin of the bursts, the nature of the persistent source and the properties of the local environment are still unclear. Here we report observations of FRB 121102 that show almost 100 per cent linearly polarized emission at a very high and variable Faraday rotation measure in the source frame (varying from +1.46 × 105 radians per square metre to +1.33 × 105 radians per square metre at epochs separated by seven months) and narrow (below 30 microseconds) temporal structure. The large and variable rotation measure demonstrates that FRB 121102 is in an extreme and dynamic magneto-ionic environment, and the short durations of the bursts suggest a neutron star origin. Such large rotation measures have hitherto been observed only in the vicinities of massive black holes (larger than about 10,000 solar masses). Indeed, the properties of the persistent radio source are compatible with those of a low-luminosity, accreting massive black hole. The bursts may therefore come from a neutron star in such an environment or could be explained by other models, such as a highly magnetized wind nebula or supernova remnant surrounding a young neutron star.
Heuristic burst detection method using flow and pressure measurements
Bakker, M.; Vreeburg, J.H.G.; Roer, Van de M.; Rietveld, L.C.
2014-01-01
Pipe bursts in a drinking water distribution system lead to water losses, interruption of supply, and damage to streets and houses due to the uncontrolled water flow. To minimize the negative consequences of pipe bursts, an early detection is necessary. This paper describes a heuristic burst
IGR J17254-3257, a new bursting neutron star
DEFF Research Database (Denmark)
Chenevez, Jérôme; Falanga, M.; Kuulkers, E.
2007-01-01
Aims. The study of the observational properties of uncommonly long bursts from low luminosity sources is important when investigating the transition from a hydrogen - rich bursting regime to a pure helium regime and from helium burning to carbon burning as predicted by current burst theories. On ...
The development of a burst criterion for zircaloy fuel cladding under LOCA conditions
International Nuclear Information System (INIS)
Neitzel, H.J.; Rossinger, H.E.
1980-02-01
A burst criterion model, which assumes that deformation is controlled by steady-state creep, has been developed for a thin-walled cladding, in this case Zircaloy-4, subjected to a differential pressure and high temperature. The creep equation is integrated to obtain a burst time at the singularity of the strain. Once the burst time is known, the burst temperature and burst pressure can be calculated from the known temperature and pressure histories. A further relationship between burst stress and burst temperature is used to calculate the burst strain. Comparison with measured burst data shows good agreement between theory and experiment was found that, if the heating rate is constant, the burst temperature increases with decreasing stress, and that, if the stress level is constant, the burst temperature increases with increasing heating rate. It was also found that anisotropy alters the burst temperature and burst strain, and that test conditions in the α-Zr temperature range have no influence on the burst data. (auth)
A short form of the neonatal intensive care unit family needs inventory
Directory of Open Access Journals (Sweden)
Elisabete Alves
2016-02-01
Full Text Available ABSTRACT OBJECTIVE: The identification of parental needs in Neonatal Intensive Care Units is essential to design and implement family-centered care. This article aims to validate the Neonatal Intensive Care Units Family Needs Inventory for the Portuguese population, and to propose a Short Form. METHODS: A linguistic adaptation of the Neonatal Intensive Care Units Family Needs Inventory, a self-report scale with 56-items, was performed. The instrument was administered to 211 parents of infants hospitalized in all level III Neonatal Intensive Care Units in the North of Portugal, 15-22 days after admission (July of 2013-June of 2014. The number of items needed to achieve reliability close to 0.8 was calculated using by the Spearman-Brown formula. The global goodness of fit of the scale was evaluated using the comparative fit index. Construct validity was assessed through association of each dimension score with socio-demographic and obstetric characteristics. RESULTS: Exploratory factor analysis revealed two dimensions, one focused on parents' needs and another on the infant's needs. To compose the Short Form Inventory, items with ceiling effect were eliminated and 22 items were submitted to confirmatory analysis, which supported the existence of two dimensions (CFI = 0.925. The Short Form showed a high degree of reliability (alpha ≥ 0.76. Less educated and older parents more frequently attributed a significantly higher importance to parent-centered needs, while parents of multiples revealed a tendency to value infant-centered needs. CONCLUSIONS: The Short Form of the Neonatal Intensive Care Units Family Needs Inventory is a brief, simple, and valid instrument with a high degree of reliability. Further studies are needed to explore associations with practices of family-centered care.
Bursts generate a non-reducible spike-pattern code
Directory of Open Access Journals (Sweden)
Hugo G Eyherabide
2009-05-01
Full Text Available On the single-neuron level, precisely timed spikes can either constitute firing-rate codes or spike-pattern codes that utilize the relative timing between consecutive spikes. There has been little experimental support for the hypothesis that such temporal patterns contribute substantially to information transmission. Using grasshopper auditory receptors as a model system, we show that correlations between spikes can be used to represent behaviorally relevant stimuli. The correlations reflect the inner structure of the spike train: a succession of burst-like patterns. We demonstrate that bursts with different spike counts encode different stimulus features, such that about 20% of the transmitted information corresponds to discriminating between different features, and the remaining 80% is used to allocate these features in time. In this spike-pattern code, the "what" and the "when" of the stimuli are encoded in the duration of each burst and the time of burst onset, respectively. Given the ubiquity of burst firing, we expect similar findings also for other neural systems.
Internally consistent gamma ray burst time history phenomenology
International Nuclear Information System (INIS)
Cline, T.L.
1985-01-01
A phenomenology for gamma ray burst time histories is outlined. Order of their generally chaotic appearance is attempted, based on the speculation that any one burst event can be represented above 150 keV as a superposition of similarly shaped increases of varying intensity. The increases can generally overlap, however, confusing the picture, but a given event must at least exhibit its own limiting characteristic rise and decay times if the measurements are made with instruments having adequate temporal resolution. Most catalogued observations may be of doubtful or marginal utility to test this hypothesis, but some time histories from Helios-2, Pioneer Venus Orbiter and other instruments having one-to several-millisecond capabilities appear to provide consistency. Also, recent studies of temporally resolved Solar Maximum Mission burst energy spectra are entirely compatible with this picture. The phenomenology suggested here, if correct, may assist as an analytic tool for modelling of burst processes and possibly in the definition of burst source populations
What can NuSTAR do for X-ray bursts?
DEFF Research Database (Denmark)
Chenevez, Jérôme; Tomsick, John; Chakrabarty, Deepto
2012-01-01
burning are ejected in the burst expansion wind. We have investigated the possibility of observing with NuSTAR some X-ray bursters selected for their high burst rate and trend to exhibit so-called superexpansion bursts. Our main ambition is to detect the photoionization edges associated with the ejected...
Evolution of the polarization of the optical afterglow of the gamma-ray burst GRB030329.
Greiner, Jochen; Klose, Sylvio; Reinsch, Klaus; Schmid, Hans Martin; Sari, Re'em; Hartmann, Dieter H; Kouveliotou, Chryssa; Rau, Arne; Palazzi, Eliana; Straubmeier, Christian; Stecklum, Bringfried; Zharikov, Sergej; Tovmassian, Gaghik; Bärnbantner, Otto; Ries, Christoph; Jehin, Emmanuel; Henden, Arne; Kaas, Anlaug A; Grav, Tommy; Hjorth, Jens; Pedersen, Holger; Wijers, Ralph A M J; Kaufer, Andreas; Park, Hye-Sook; Williams, Grant; Reimer, Olaf
2003-11-13
The association of a supernova with GRB030329 strongly supports the 'collapsar' model of gamma-ray bursts, where a relativistic jet forms after the progenitor star collapses. Such jets cannot be spatially resolved because gamma-ray bursts lie at cosmological distances; their existence is instead inferred from 'breaks' in the light curves of the afterglows, and from the theoretical desire to reduce the estimated total energy of the burst by proposing that most of it comes out in narrow beams. Temporal evolution of the polarization of the afterglows may provide independent evidence for the jet structure of the relativistic outflow. Small-level polarization ( approximately 1-3 per cent) has been reported for a few bursts, but its temporal evolution has yet to be established. Here we report polarimetric observations of the afterglow of GRB030329. We establish the polarization light curve, detect sustained polarization at the per cent level, and find significant variability. The data imply that the afterglow magnetic field has a small coherence length and is mostly random, probably generated by turbulence, in contrast with the picture arising from the high polarization detected in the prompt gamma-rays from GRB021206 (ref. 18).
Effect of wear on the burst strength of l-80 steel casing
International Nuclear Information System (INIS)
Irawan, S; Bharadwaj, A M; Temesgen, B; Karuppanan, S; Abdullah, M Z B
2015-01-01
Casing wear has recently become one of the areas of research interest in the oil and gas industry especially in extended reach well drilling. The burst strength of a worn out casing is one of the significantly affected mechanical properties and is yet an area where less research is done The most commonly used equations to calculate the resulting burst strength after wear are Barlow, the initial yield burst, the full yield burst and the rupture burst equations. The objective of this study was to estimate casing burst strength after wear through Finite Element Analysis (FEA). It included calculation and comparison of the different theoretical bursts pressures with the simulation results along with effect of different wear shapes on L-80 casing material. The von Misses stress was used in the estimation of the burst pressure. The result obtained shows that the casing burst strength decreases as the wear percentage increases. Moreover, the burst strength value of the casing obtained from the FEA has a higher value compared to the theoretical burst strength values. Casing with crescent shaped wear give the highest burst strength value when simulated under nonlinear analysis. (paper)
Bubble bursting at an interface
Kulkarni, Varun; Sajjad, Kumayl; Anand, Sushant; Fezzaa, Kamel
2017-11-01
Bubble bursting is crucial to understanding the life span of bubbles at an interface and more importantly the nature of interaction between the bulk liquid and the outside environment from the point of view of chemical and biological material transport. The dynamics of the bubble as it rises from inside the liquid bulk to its disappearance on the interface after bursting is an intriguing process, many aspects of which are still being explored. In our study, we make detailed high speed imaging measurements to examine carefully the hole initiation and growth in bursting bubbles that unearth some interesting features of the process. Previous analyses available in literature are revisited based on our novel experimental visualizations. Using a combination of experiments and theory we investigate the role of various forces during the rupturing process. This work aims to further our current knowledge of bubble dynamics at an interface with an aim of predicting better the bubble evolution from its growth to its eventual integration with the liquid bulk.
Functional Imaging of Human Vestibular Cortex Activity Elicited by Skull Tap and Auditory Tone Burst
Noohi, F.; Kinnaird, C.; Wood, S.; Bloomberg, J.; Mulavara, A.; Seidler, R.
2016-01-01
The current study characterizes brain activation in response to two modes of vestibular stimulation: skull tap and auditory tone burst. The auditory tone burst has been used in previous studies to elicit either the vestibulo-spinal reflex (saccular-mediated colic Vestibular Evoked Myogenic Potentials (cVEMP)), or the ocular muscle response (utricle-mediated ocular VEMP (oVEMP)). Some researchers have reported that air-conducted skull tap elicits both saccular and utricle-mediated VEMPs, while being faster and less irritating for the subjects. However, it is not clear whether the skull tap and auditory tone burst elicit the same pattern of cortical activity. Both forms of stimulation target the otolith response, which provides a measurement of vestibular function independent from semicircular canals. This is of high importance for studying otolith-specific deficits, including gait and balance problems that astronauts experience upon returning to earth. Previous imaging studies have documented activity in the anterior and posterior insula, superior temporal gyrus, inferior parietal lobule, inferior frontal gyrus, and the anterior cingulate cortex in response to different modes of vestibular stimulation. Here we hypothesized that skull taps elicit similar patterns of cortical activity as the auditory tone bursts, and previous vestibular imaging studies. Subjects wore bilateral MR compatible skull tappers and headphones inside the 3T GE scanner, while lying in the supine position, with eyes closed. Subjects received both forms of the stimulation in a counterbalanced fashion. Pneumatically powered skull tappers were placed bilaterally on the cheekbones. The vibration of the cheekbone was transmitted to the vestibular system, resulting in the vestibular cortical response. Auditory tone bursts were also delivered for comparison. To validate our stimulation method, we measured the ocular VEMP outside of the scanner. This measurement showed that both skull tap and auditory
The development of a burst criterion for Zircaloy fuel cladding under LOCA conditions
International Nuclear Information System (INIS)
Neitzel, H.J.; Rosinger, H.E.
1980-10-01
A burst criterion model, which assumes that deformation is controlled by steady-state creep, has been developed for a thin-walled cladding, in this case Zircaloy-4, subjected to a differential pressure and high temperature. The creep equation is integrated to obtain a burst time at the singularity of the strain. Once that urst time is known, the burst temperature and burst pressure can be calculated from the known temperature and pressure histories. A further relationship between burst stress and burst temperature is used to calculate the burst strain. Comparison with measured burst data shows good agreement between theory and experiment. It was found that, if the heating rate is constant, the burst temperature increases with decreasing stress, and that, if the stress level is constant, the burst temperature increases with increasing heating rate. It was also found that anisotropy alters the burst temperature and burst strain, and that thest conditions in the α-Zr temperature range have no influence on the burst data. (orig.) [de
Voltage interval mappings for an elliptic bursting model
Wojcik, Jeremy; Shilnikov, Andrey
2013-01-01
We employed Poincar\\'e return mappings for a parameter interval to an exemplary elliptic bursting model, the FitzHugh-Nagumo-Rinzel model. Using the interval mappings, we were able to examine in detail the bifurcations that underlie the complex activity transitions between: tonic spiking and bursting, bursting and mixed-mode oscillations, and finally, mixed-mode oscillations and quiescence in the FitzHugh-Nagumo-Rinzel model. We illustrate the wealth of information, qualitative and quantitati...
Supernova sheds light on gamma-ray bursts
2003-01-01
On 29 March the HETE-II satellite detected the most violent explosion in the universe to date - an enormous burst of gamma rays. Observers across the world recorded and studied the event. It appears to prove that gamma ray bursts originate in supernovae (1 page)
Observation of L-bursts of Jupiter decameter waves
International Nuclear Information System (INIS)
Imai, Kazumasa; Tomisawa, Ichiro
1978-01-01
The Jupiter decameter waves are the only information source which can be obtained on the earth for the investigation of dynamics concerning the generation of plasma waves in the magnetosphere of Jupiter. The emission of Jupiter decameter waves is modulated by the satellite Io considerably. It is observed that the emission of decameter waves fluctuated much in course of time. The duration time of bursts is 1 to 10 sec and 1 to 50 msec for L-bursts and S-bursts, respectively. The simultaneous observations were conducted at two locations from August, 1977, and at three locations from December, 1977, for searching the source of L-bursts. The relation between the appearance frequency of L-bursts and S-bursts and Io phase and system 3 longitude is explained. The observation points were Sugadaira, Chofu and Toyokawa, The minimum detectable flux density by the wave receiving network is 10 -21 W/m 2 .Hz. Concerning the observed results, the locations of observed events on the Io phase and the system 3 longitude are shown. The analytical results on the L-bursts of the main source and the early source are explained, taking ten events. The analysed dynamic cross-correlation and the spectrum analysis of the decameter intensity are shown. The relation between the origin and the emission mechanism was investigated, considering the observed data and the evaluation mentioned above for the main source and early source, and the clue was obtained to solve the riddle of emission mechanism. (Nakai, Y.)
Studying the formation of non-linear bursts in fully turbulent channel flows
Encinar, Miguel P.; Jimenez, Javier
2017-11-01
Linear transient growth has been suggested as a possible explanation for the intermittent behaviour, or `bursting', in shear flows with a stable mean velocity profile. Analysing fully non-linear DNS databases yields a similar Orr+lift-up mechanism, but acting on spatially localised wave packets rather than on monochromatic infinite wavetrains. The Orr mechanism requires the presence of backwards-leaning wall-normal velocity perturbations as initial condition, but the linear theory fails to clarify how these perturbations are formed. We investigate the latter in a time-resolved wavelet-filtered turbulent channel database, which allows us to assign an amplitude and an inclination angle to a flow region of selected size. This yields regions that match the dynamics of linear Orr for short times. We find that a short streamwise velocity (u) perturbation (i.e. a streak meander) consistently appears before the burst, but disappears before the burst reaches its maximum amplitude. Lift-up then generates a longer streamwise velocity perturbation. The initial streamwise velocity is also found to be backwards-leaning, contrary to the averaged energy-containing scales, which are known to be tilted forward. Funded by the ERC COTURB project.
High spectral resolution measurements of a solar flare hard X-ray burst
International Nuclear Information System (INIS)
Lin, R.P.; Schwartz, R.A.; NASA, Goddard Space Flight Center, Greenbelt, MD)
1987-01-01
Observations are reported of an intense solar flare hard X-ray burst on June 27, 1980, made with a balloon-borne array of liquid nitrogen-cooled Ge detector which provided unprecedented spectral resolution (no more than 1 keV FWHM). The hard X-ray spectra throughout the impulsive phase burst fitted well to a double power-law form, and emission from an isothermal 0.1-1 billion K plasma can be specifically excluded. The temporal variations of the spectrum indicate that the hard X-ray burst is made up of two superposed components: individual spikes lasting about 3-15 sec, which have a hard spectrum and a break energy of 30-65 keV; and a slowly varying component characterized by a soft spectrum with a constant low-energy slope and a break energy which increases from 25 kev to at least 100 keV through the event. The double power-law shape indicates that DC electric field acceleration, similar to that occurring in the earth's auroral zone, may be the source of the energetic electrons which produce the hard X-ray emission. 39 references
Walker, Aisha L.; Ofori-Acquah, Solomon
2016-01-01
The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...
Detection of gamma-ray bursts from Andromeda
International Nuclear Information System (INIS)
Bulik, Tomasz; Coppi, Paolo S.; Lamb, Donald Q.
1996-01-01
If gamma-ray bursts originate in a corona around the Milky Way, it should also be possible to detect them from a similar corona around Andromeda. Adopting a simple model of high velocity neutron star corona, we evaluate the ability of instruments on existing missions to detect an excess of bursts toward Andromeda. We also calculate the optimal properties of an instrument designed to detect such an excess. We find that if the bursts radiate isotropically, an experiment with a sampling distance d max > or approx. 500 kpc could detect a significant excess of bursts in the direction of Andromeda in a few years of observation. If the radiation is beamed along the neutron star's direction of motion, an experiment with d max > or approx. 800 kpc would detect such an excess in a similar amount of time, provided that the width of the beam is greater than 10 deg. Lack of an excess toward Andromeda would therefore be compelling evidence that the bursts are cosmological in origin if made by an instrument at least 50 times more sensitive than BATSE, given current constraints on Galactic corona models. Comparisons with detailed dynamical calculations of the spatial distribution of high velocity neutron stars in the coronae around the Milky Way and Andromeda confirm these conclusions
Scientific Applications Performance Evaluation on Burst Buffer
Markomanolis, George S.
2017-10-19
Parallel I/O is an integral component of modern high performance computing, especially in storing and processing very large datasets, such as the case of seismic imaging, CFD, combustion and weather modeling. The storage hierarchy includes nowadays additional layers, the latest being the usage of SSD-based storage as a Burst Buffer for I/O acceleration. We present an in-depth analysis on how to use Burst Buffer for specific cases and how the internal MPI I/O aggregators operate according to the options that the user provides during his job submission. We analyze the performance of a range of I/O intensive scientific applications, at various scales on a large installation of Lustre parallel file system compared to an SSD-based Burst Buffer. Our results show a performance improvement over Lustre when using Burst Buffer. Moreover, we show results from a data hierarchy library which indicate that the standard I/O approaches are not enough to get the expected performance from this technology. The performance gain on the total execution time of the studied applications is between 1.16 and 3 times compared to Lustre. One of the test cases achieved an impressive I/O throughput of 900 GB/s on Burst Buffer.
Fast Radio Bursts with Extended Gamma-Ray Emission?
International Nuclear Information System (INIS)
Murase, Kohta; Mészáros, Peter; Fox, Derek B.
2017-01-01
We consider some general implications of bright γ -ray counterparts to fast radio bursts (FRBs). We show that even if these manifest in only a fraction of FRBs, γ -ray detections with current satellites (including Swift ) can provide stringent constraints on cosmological FRB models. If the energy is drawn from the magnetic energy of a compact object such as a magnetized neutron star, the sources should be nearby and be very rare. If the intergalactic medium is responsible for the observed dispersion measure, the required γ -ray energy is comparable to that of the early afterglow or extended emission of short γ -ray bursts. While this can be reconciled with the rotation energy of compact objects, as expected in many merger scenarios, the prompt outflow that yields the γ -rays is too dense for radio waves to escape. Highly relativistic winds launched in a precursor phase, and forming a wind bubble, may avoid the scattering and absorption limits and could yield FRB emission. Largely independent of source models, we show that detectable radio afterglow emission from γ -ray bright FRBs can reasonably be anticipated. Gravitational wave searches can also be expected to provide useful tests.
Physical characterization of the Skua fast burst assembly
International Nuclear Information System (INIS)
Paternoster, R.; Bounds, J.; Sanchez, R.; Miko, D.
1994-01-01
In this paper we discuss the system design and ongoing efforts to characterize the machine physics and operating properties of the Skua fast burst assembly. The machine is currently operating up to prompt critical while we await approval for super-prompt burst operations. Efforts have centered on characterizing neutron kinetic properties, comparing calculated and measured temperature coefficients and power distributions, improving the burst reproducibility, examining the site-wide dose characteristics, and fitting the machine with cooling and filtration systems
Multi-Index Monitoring and Evaluation on Rock Burst in Yangcheng Mine
Directory of Open Access Journals (Sweden)
Yunliang Tan
2015-01-01
Full Text Available Based on the foreboding information monitoring of the energy released in the developing process of rock burst, prediction system for rock burst can be established. By using microseismic method, electromagnetic radiation method, and drilling bits method, rock burst in Yangcheng Mine was monitored, and a system of multi-index monitoring and evaluation on rock burst was established. Microseismic monitoring and electromagnetic radiation monitoring were early warning method, and drilling bits monitoring was burst region identification method. There were three identifying indexes: silence period in microseismic monitoring, rising period of the intensity, and rising period of pulse count in electromagnetic radiation monitoring. If there is identified burst risk in the workface, drilling bits method was used to ascertain the burst region, and then pressure releasing methods were carried out to eliminate the disaster.
International Nuclear Information System (INIS)
Burns, Eric; Briggs, Michael S.; Connaughton, Valerie; Zhang, Bin-Bin; Lien, Amy; Goldstein, Adam; Pelassa, Veronique; Troja, Eleonora
2016-01-01
Compact binary system mergers are expected to generate gravitational radiation detectable by ground-based interferometers. A subset of these, the merger of a neutron star with another neutron star or a black hole, are also the most popular model for the production of short gamma-ray bursts (GRBs). The Swift Burst Alert Telescope (BAT) and the Fermi Gamma-ray Burst Monitor (GBM) trigger on short GRBs (SGRBs) at rates that reflect their relative sky exposures, with the BAT detecting 10 per year compared to about 45 for GBM. We examine the SGRB populations detected by Swift BAT and Fermi GBM. We find that the Swift BAT triggers on weaker SGRBs than Fermi GBM, providing they occur close to the center of the BAT field of view, and that the Fermi GBM SGRB detection threshold remains flatter across its field of view. Overall, these effects combine to give the instruments the same average sensitivity, and account for the SGRBs that trigger one instrument but not the other. We do not find any evidence that the BAT and GBM are detecting significantly different populations of SGRBs. Both instruments can detect untriggered SGRBs using ground searches seeded with time and position. The detection of SGRBs below the on-board triggering sensitivities of Swift BAT and Fermi GBM increases the possibility of detecting and localizing the electromagnetic counterparts of gravitational wave (GW) events seen by the new generation of GW detectors
Energy Technology Data Exchange (ETDEWEB)
Burns, Eric; Briggs, Michael S. [University of Alabama in Huntsville, 320 Sparkman Drive, Huntsville, AL 35805 (United States); Connaughton, Valerie [Universities Space Research Association, Science and Technology Institute, 320 Sparkman Drive, Huntsville, AL 35805 (United States); Zhang, Bin-Bin [Center for Space Plasma and Aeronomic Research (CSPAR), University of Alabama in Huntsville, Huntsville, AL 35899 (United States); Lien, Amy [Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Goldstein, Adam [NASA Postdoctoral Program, Space Science Office, VP62, NASA/Marshall Space Flight Center, Huntsville, AL 35812 (United States); Pelassa, Veronique [Smithsonian Astrophysical Observatory, P.O. Box 97, Amado, AZ 85645 (United States); Troja, Eleonora, E-mail: eb0016@uah.edu [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States)
2016-02-20
Compact binary system mergers are expected to generate gravitational radiation detectable by ground-based interferometers. A subset of these, the merger of a neutron star with another neutron star or a black hole, are also the most popular model for the production of short gamma-ray bursts (GRBs). The Swift Burst Alert Telescope (BAT) and the Fermi Gamma-ray Burst Monitor (GBM) trigger on short GRBs (SGRBs) at rates that reflect their relative sky exposures, with the BAT detecting 10 per year compared to about 45 for GBM. We examine the SGRB populations detected by Swift BAT and Fermi GBM. We find that the Swift BAT triggers on weaker SGRBs than Fermi GBM, providing they occur close to the center of the BAT field of view, and that the Fermi GBM SGRB detection threshold remains flatter across its field of view. Overall, these effects combine to give the instruments the same average sensitivity, and account for the SGRBs that trigger one instrument but not the other. We do not find any evidence that the BAT and GBM are detecting significantly different populations of SGRBs. Both instruments can detect untriggered SGRBs using ground searches seeded with time and position. The detection of SGRBs below the on-board triggering sensitivities of Swift BAT and Fermi GBM increases the possibility of detecting and localizing the electromagnetic counterparts of gravitational wave (GW) events seen by the new generation of GW detectors.
Swift-BAT: The First Year of Gamma-Ray Burst Detections
Krimm, Hans A.
2006-01-01
The Burst Alert Telescope (BAT) on the Swift has been detecting gamma-ray bursts (GRBs) since Dec. 17,2004 and automated burst alerts have been distributed since Feb. 14,2005. Since commissioning the BAT has triggered on more than 100 GRBs, nearly all of which have been followed up by the narrow-field instruments on Swift through automatic repointing, and by ground and other satellite telescopes after rapid notification. Within seconds of a trigger the BAT produces and relays to the ground a position good to three arc minutes and a four channel light curve. A full ten minutes of event data follows on subsequent ground station passes. The burst archive has allowed us to determine ensemble burst parameters such as fluence, peak flux and duration. An overview of the properties of BAT bursts and BAT'S performance as a burst monitor will be presented in this talk. BAT is a coded aperture imaging system with a wide (approx.2 sr) field of view consisting of a large coded mask located 1 m above a 5200 cm2 array of 32.768 CdZnTe detectors. All electronics and other hardware systems on the BAT have been operating well since commissioning and there is no sign of any degradation on orbit. The flight and ground software have proven similarly robust and allow the real time localization of all bursts and the rapid derivation of burst light curves, spectra and spectral fits on the ground.
International Nuclear Information System (INIS)
Thorne, K.S.; Braginsky, V.B.
1976-01-01
It is likely that supermassive black holes (Mapprox. =10 6 to 10 10 M/sub sun/) exist in the nuclei of many quasars and galaxies. The collapse which forms these holes and subsequent collisions between them should produce strong, broad-band bursts of gravitational waves: for a source of mass M at the Hubble distance of approx.10 10 light-years, the dimensionless amplitude would be h approx. 2 x 10 -17 x (M/10 6 M/sub sun/), and the duration of the burst would be tauapprox. (90 s) x (M/10 6 M/sub sun/). Such bursts might arrive at Earth as often as 50 times per year: or as rarely as once each 300 years. The detection of such bursts may be possible within the next few years using dual-frequency Doppler tracking of interplanetary spacecraft
Frequency dependent characteristics of solar impulsive radio bursts
International Nuclear Information System (INIS)
Das, T.K.; Das Gupta, M.K.
1983-01-01
An investigation was made of the impulsive radio bursts observed in the frequency range 0.245 to 35 GHz. Important results obtained are: (i) Simple type 1 bursts with intensities 0 to 10 f.u. and simple type 2 bursts with intensities 10 to 500 f.u. are predominant in the frequency ranges 1.415 to 4.995 GHz and 4.995 to 8.8 GHz, respectively; (ii) With maxima around 2.7 GHz and 4 GHz for the first and second types respectively, the durations of the radio bursts decrease gradually both towards lower and higher frequencies; (iii) As regards occurrences, the first type dominates in the southern solar hemisphere peaking around 8.8 GHz, whereas the second type favours the north with no well-defined maximum in any frequency; (iv) Both types prefer the eastern hemisphere, the peak occurrences being around 8.8 GHz and 5 GHz for the two successive types, respectively; (c) The spectra of impulsive radio bursts are generally of the inverted U-type with the maximum emission intensity between 5 and 15 GHz. (author)
Ion burst event in the earth's dayside magnetosheath
International Nuclear Information System (INIS)
Paschalidis, N.P.; Krimigis, S.M.; Sibeck, D.G.; McEntire, R.W.; Zanetti, L.J.; Sarris, E.T.; Christon, S.P.
1991-01-01
The MEPA instrument on the AMPTE/CCE Spacecraft provided ion angular distributions as rapidly as every 6 sec for H, He, and O at energies of 10 keV to 2 MeV in the dayside magnetosheath within 8.75 R E , the CCE apogee. In this report the authors discuss a burst of energetic particles in the subsolar magnetosheath and its association with rapid changes in the local magnetic field direction in such a way that the magnetic field connected the spacecraft to the magnetopause during the enhancement. They find that magnetosheath angular distributions outside the burst peaked at 90 degree pitch angles, whereas during the burst they exhibited field aligned streaming either parallel or antiparallel to the magnetic field combined with a clear earthward gradient. The clear earthward gradients at E ≥ 10 KeV, the streaming, and the slope change in the burst-time magnetosheath spectrum at ∼10 KeV suggest magnetospheric source for the burst-time ≥ 10 KeV ions and heated solar wind for E < 10 KeV
Fuzzy correlations of gamma-ray bursts
International Nuclear Information System (INIS)
Hartmann, D.H.; Linder, E.V.; Blumenthal, G.R.
1991-01-01
The origin of gamma-ray bursts is not known, both in the sense of the nature of the source emitting the radiation and literally, the position of the burst on the sky. Lacking unambiguously identified counterparts in any wavelength band studied to date, statistical approaches are required to determine the burster distance scale. Angular correlation analysis is one of the most powerful tools in this regard. However, poor detector resolution gives large localization errors, effectively beam smearing the positions. The resulting fuzzy angular correlation function is investigated and the generic isotropization that smearing induces on any intrinsic clustering is discussed. In particular, the extent to which gamma-ray burst observations by the BATSE detector aboard the Gamma-Ray Observatory might recover an intrinsic source correlation is investigated. 16 refs
Accelerating Science with the NERSC Burst Buffer Early User Program
Energy Technology Data Exchange (ETDEWEB)
Bhimji, Wahid [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Bard, Debbie [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Romanus, Melissa [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Rutgers Univ., New Brunswick, NJ (United States); Paul, David [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Ovsyannikov, Andrey [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Friesen, Brian [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Bryson, Matt [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Correa, Joaquin [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Lockwood, Glenn K. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Tsulaia, Vakho [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Byna, Suren [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Farrell, Steve [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Gursoy, Doga [Argonne National Lab. (ANL), Argonne, IL (United States). Advanced Photon Source (APS); Daley, Chris [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Beckner, Vince [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Van Straalen, Brian [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Trebotich, David [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Tull, Craig [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Weber, Gunther H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Wright, Nicholas J. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Antypas, Katie [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Prabhat, none [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)
2016-01-01
NVRAM-based Burst Buffers are an important part of the emerging HPC storage landscape. The National Energy Research Scientific Computing Center (NERSC) at Lawrence Berkeley National Laboratory recently installed one of the first Burst Buffer systems as part of its new Cori supercomputer, collaborating with Cray on the development of the DataWarp software. NERSC has a diverse user base comprised of over 6500 users in 700 different projects spanning a wide variety of scientific computing applications. The use-cases of the Burst Buffer at NERSC are therefore also considerable and diverse. We describe here performance measurements and lessons learned from the Burst Buffer Early User Program at NERSC, which selected a number of research projects to gain early access to the Burst Buffer and exercise its capability to enable new scientific advancements. To the best of our knowledge this is the first time a Burst Buffer has been stressed at scale by diverse, real user workloads and therefore these lessons will be of considerable benefit to shaping the developing use of Burst Buffers at HPC centers.
Kuwahara, Hiroyuki
2015-11-04
A main source of gene expression noise in prokaryotes is translational bursting. It arises from efficient translation of mRNAs with low copy numbers, which makes the production of protein copies highly variable and pulsatile. To obtain analytical solutions, previous models to capture this noise source had to assume translation to be initiation-limited, representing the burst size by a specific type of a long-tail distribution. However, there is increasing evidence suggesting that the initiation is not the rate-limiting step in certain settings, for example, under stress conditions. Here, to overcome the limitations imposed by the initiation-limited assumption, we present a new analytical approach that can evaluate biological consequences of the protein burst size with a general distribution. Since our new model can capture the contribution of other factors to the translational noise, it can be used to analyze the effects of gene expression noise in more general settings. We used this new model to analytically analyze the connection between the burst size and the stability of gene expression processes in various settings. We found that the burst size with different distributions can lead to quantitatively and qualitatively different stability characteristics of protein abundance and can have non-intuitive effects. By allowing analysis of how the stability of gene expression processes changes based on various distributions of translational noise, our analytical approach is expected to enable deeper insights into the control of cell fate decision-making, the evolution of cryptic genetic variations, and fine-tuning of gene circuits.
The sample of INTEGRAL SPI-ACS gamma-ray bursts
International Nuclear Information System (INIS)
Rau, A.; Kienlin, A. von; Licht, G.G.; Hurley, K.
2005-01-01
The anti-coincidence system of the spectrometer on board INTEGRAL is operated as a nearly omni directional gamma-ray burst detector above ∼ 75 KeV. During the elapsed mission time 324 burst candidates were detected. As part of the 3rd Interplanetary Network of gamma-ray detectors the cosmic origin of 115 burst was confirmed. Here we present a preliminary analysis of the SPI-ACS gamma-ray burst sample. In particular we discuss the origin of a significant population of short events (duration < 0.2 s) and a possible method for a flux calibration of the data
Coupled hydro-neutronic calculations for fast burst reactor accidents
International Nuclear Information System (INIS)
Paternoster, R.; Kimpland, R.; Jaegers, P.; McGhee, J.
1994-01-01
Methods are described for determining the fully coupled neutronic/hydrodynamic response of fast burst reactors (FBR) under disruptive accident conditions. Two code systems, PAD (1 -D Lagrangian) and NIKE-PAGOSA (3-D Eulerian) were used to accomplish this. This is in contrast to the typical methodology that computes these responses by either single point kinetics or in a decoupled manner. This methodology is enabled by the use of modem supercomputers (CM-200). Two examples of this capability are presented: an unreflected metal fast burst assembly, and a reflected fast burst assembly typical of the Skua or SPR-III class of fast burst reactor
Gamma Ray Burst Discoveries by the Swift Mission
Gehrels, Neil
2006-01-01
Gamma-ray bursts are among the most fascinating occurrences in the cosmos. They are thought to be the birth cries of black holes throughout the universe. The NASA swift mission is an innovative new multiwavelength observatory designed to determine the origin of bursts and use them to probe the early Universe. Swift is now in orbit since November 20, 2004 and all hardware is performing well. A new-technology wide-field gamma-ray camera is detecting a hundred bursts per year. sensitive narrow-field X-ray and uv/optical telescopes, built in collaboration with UK and Italian partners, are pointed at the burst location in 50-100 sec by an autonomously controlled "swift" spacecraft. For each burst, arcsec positions are determined and optical/UV/X-ray/gamma-ray spectrophotometry performed. Information is also rapidly sent to the ground to a team of more than 50 observers at telescopes around the world. The first year of findings from the mission will be presented. There has been a break-through in the longstanding mystery of short GRBs; they appear to be caused by merging neutron stars. High redshift bursts have been detected leading to a better understanding of star formation rates and distant galaxy environments. GRBs have been found with giant X-ray flares occurring in their afterglow.
Gamma Ray Burst Discoveries by the Swift Mission
Gehrels, Neil
2006-04-01
Gamma-ray bursts are among the most fascinating occurrences in the cosmos. They are thought to be the birth cries of black holes throughout the universe. The NASA Swift mission is an innovative new multiwavelength observatory designed to determine the origin of bursts and use them to probe the early Universe. Swift is now in orbit since November 20, 2004 and all hardware is performing well. A new-technology wide-field gamma-ray camera is detecting a hundred bursts per year. Sensitive narrow-field X-ray and UV/optical telescopes, built in collaboration with UK and Italian partners, are pointed at the burst location in 50-100 sec by an autonomously controlled ``swift'' spacecraft. For each burst, arcsec positions are determined and optical/UV/X-ray/gamma-ray spectrophotometry performed. Information is also rapidly sent to the ground to a team of more than 50 observers at telescopes around the world. The first year of findings from the mission will be presented. There has been a break-through in the long-standing mystery of short GRBs; they appear to be caused by merging neutron stars. High redshift bursts have been detected leading to a better understanding of star formation rates and distant galaxy environments. GRBs have been found with giant X-ray flares occurring in their afterglow.
Probing Intrinsic Properties of Short Gamma-Ray Bursts with Gravitational Waves.
Fan, Xilong; Messenger, Christopher; Heng, Ik Siong
2017-11-03
Progenitors of short gamma-ray bursts are thought to be neutron stars coalescing with their companion black hole or neutron star, which are one of the main gravitational wave sources. We have devised a Bayesian framework for combining gamma-ray burst and gravitational wave information that allows us to probe short gamma-ray burst luminosities. We show that combined short gamma-ray burst and gravitational wave observations not only improve progenitor distance and inclination angle estimates, they also allow the isotropic luminosities of short gamma-ray bursts to be determined without the need for host galaxy or light-curve information. We characterize our approach by simulating 1000 joint short gamma-ray burst and gravitational wave detections by Advanced LIGO and Advanced Virgo. We show that ∼90% of the simulations have uncertainties on short gamma-ray burst isotropic luminosity estimates that are within a factor of two of the ideal scenario, where the distance is known exactly. Therefore, isotropic luminosities can be confidently determined for short gamma-ray bursts observed jointly with gravitational waves detected by Advanced LIGO and Advanced Virgo. Planned enhancements to Advanced LIGO will extend its range and likely produce several joint detections of short gamma-ray bursts and gravitational waves. Third-generation gravitational wave detectors will allow for isotropic luminosity estimates for the majority of the short gamma-ray burst population within a redshift of z∼1.
Spatial-temporal variation of low-frequency earthquake bursts near Parkfield, California
Wu, Chunquan; Guyer, Robert; Shelly, David R.; Trugman, D.; Frank, William; Gomberg, Joan S.; Johnson, P.
2015-01-01
Tectonic tremor (TT) and low-frequency earthquakes (LFEs) have been found in the deeper crust of various tectonic environments globally in the last decade. The spatial-temporal behaviour of LFEs provides insight into deep fault zone processes. In this study, we examine recurrence times from a 12-yr catalogue of 88 LFE families with ∼730 000 LFEs in the vicinity of the Parkfield section of the San Andreas Fault (SAF) in central California. We apply an automatic burst detection algorithm to the LFE recurrence times to identify the clustering behaviour of LFEs (LFE bursts) in each family. We find that the burst behaviours in the northern and southern LFE groups differ. Generally, the northern group has longer burst duration but fewer LFEs per burst, while the southern group has shorter burst duration but more LFEs per burst. The southern group LFE bursts are generally more correlated than the northern group, suggesting more coherent deep fault slip and relatively simpler deep fault structure beneath the locked section of SAF. We also found that the 2004 Parkfield earthquake clearly increased the number of LFEs per burst and average burst duration for both the northern and the southern groups, with a relatively larger effect on the northern group. This could be due to the weakness of northern part of the fault, or the northwesterly rupture direction of the Parkfield earthquake.
Arachidonic acid triggers an oxidative burst in leukocytes
Directory of Open Access Journals (Sweden)
Pompeia C.
2003-01-01
Full Text Available The change in cellular reducing potential, most likely reflecting an oxidative burst, was investigated in arachidonic acid- (AA stimulated leukocytes. The cells studied included the human leukemia cell lines HL-60 (undifferentiated and differentiated into macrophage-like and polymorphonuclear-like cells, Jurkat and Raji, and thymocytes and macrophages from rat primary cultures. The oxidative burst was assessed by nitroblue tetrazolium reduction. AA increased the oxidative burst until an optimum AA concentration was reached and the burst decreased thereafter. In the leukemia cell lines, optimum concentration ranged from 200 to 400 µM (up to 16-fold, whereas in rat cells it varied from 10 to 20 µM. Initial rates of superoxide generation were high, decreasing steadily and ceasing about 2 h post-treatment. The continuous presence of AA was not needed to stimulate superoxide generation. It seems that the NADPH oxidase system participates in AA-stimulated superoxide production in these cells since the oxidative burst was stimulated by NADPH and inhibited by N-ethylmaleimide, diphenyleneiodonium and superoxide dismutase. Some of the effects of AA on the oxidative burst may be due to its detergent action. There apparently was no contribution of other superoxide-generating systems such as xanthine-xanthine oxidase, cytochromes P-450 and mitochondrial electron transport chain, as assessed by the use of inhibitors. Eicosanoids and nitric oxide also do not seem to interfere with the AA-stimulated oxidative burst since there was no systematic effect of cyclooxygenase, lipoxygenase or nitric oxide synthase inhibitors, but lipid peroxides may play a role, as indicated by the inhibition of nitroblue tetrazolium reduction promoted by tocopherol.
Nahra, Henry; Ghosn, Louis; Christiansen, Eric; Davis, B. Alan; Keddy, Chris; Rodriquez, Karen; Miller, Joshua; Bohl, William
2011-01-01
Metallic pressure tanks used in space missions are inherently vulnerable to hypervelocity impacts from micrometeoroids and orbital debris; thereby knowledge of impact damage and its effect on the tank integrity is crucial to a spacecraft risk assessment. This paper describes tests that have been performed to assess the effects of hypervelocity impact (HVI) damage on Titanium alloy (Ti-6Al-4V) pressure vessels burst pressure and characteristics. The tests consisted of a pair of HVI impact tests on water-filled Ti-6Al-4V tanks (water being used as a surrogate to the actual propellant) and subsequent burst tests as well as a burst test on an undamaged control tank. The tanks were placed behind Aluminum (Al) shields and then each was impacted with a 7 km/s projectile. The resulting impact debris plumes partially penetrated the Ti-6Al-4V tank surfaces resulting in a distribution of craters. During the burst tests, the tank that failed at a lower burst pressure did appear to have the failure initiating at a crater site with observed spall cracks. A fracture mechanics analysis showed that the tanks failure at the impact location may have been due to a spall crack that formed upon impact of a fragmentation on the Titanium surface. This result was corroborated with a finite element analysis from calculated Von-Mises and hoop stresses.
The velocities of type II solar radio bursts
International Nuclear Information System (INIS)
Tlamicha, A.; Karlicky, M.
1976-01-01
A list is presented of type II radio bursts identified at Ondrejov between January 1973 and December 1974 in the frequency range of the dynamic spectrum 70 to 810 MHz. The velocities of shock waves in the individual cases of type II bursts are given using the fourfold Newkirk model. Some problems associated with type II radio bursts and with the propagation of the shock wave into the interplanetary space and into the region of the Earth are also discussed. (author)
Revisiting the dispersion measure of fast radio bursts associated with gamma-ray burst afterglows
Energy Technology Data Exchange (ETDEWEB)
Yu, Yun-Wei, E-mail: yuyw@mail.ccnu.edu.cn [Institute of Astrophysics, Central China Normal University, Wuhan 430079 (China)
2014-12-01
Some fast radio bursts (FRBs) are expected to be associated with the afterglow emission of gamma-ray bursts (GRBs), while a short-lived, supermassive neutron star (NS) forms during the GRBs. I investigate the possible contributions to the dispersion measure (DM) of the FRBs from the GRB ejecta and the wind blown from the precollapsing NS. On the one hand, sometimes an internal X-ray plateau afterglow could be produced by the NS wind, which indicates that a great number of electron-positron pairs are carried by the wind. If the pair-generation radius satisfies a somewhat rigorous condition, the relativistic and dense wind would contribute a high DM to the associated FRB, which can be comparable to and even exceed the DM contributed by the intergalactic medium. On the other hand, if the wind only carries a Goldreich-Julian particle flux, its DM contribution would become negligible; meanwhile, the internal plateau afterglow would not appear. Alternatively, the FRB should be associated with a GRB afterglow produced by the GRB external shock, i.e., an energy-injection-caused shallow-decay afterglow or a normal single-power-law afterglow if the impulsive energy release of the GRB is high enough. In the latter case, the DM contributed by the high-mass GRB ejecta could be substantially important, in particular, for an environment of main-sequence stellar wind. In summary, a careful assessment on the various DM contributors could be required for the cosmological application of the expected FRB-GRB association. The future DM measurements of GRB-associated FRBs could provide a constraint on the physics of NS winds.
Revisiting the dispersion measure of fast radio bursts associated with gamma-ray burst afterglows
International Nuclear Information System (INIS)
Yu, Yun-Wei
2014-01-01
Some fast radio bursts (FRBs) are expected to be associated with the afterglow emission of gamma-ray bursts (GRBs), while a short-lived, supermassive neutron star (NS) forms during the GRBs. I investigate the possible contributions to the dispersion measure (DM) of the FRBs from the GRB ejecta and the wind blown from the precollapsing NS. On the one hand, sometimes an internal X-ray plateau afterglow could be produced by the NS wind, which indicates that a great number of electron-positron pairs are carried by the wind. If the pair-generation radius satisfies a somewhat rigorous condition, the relativistic and dense wind would contribute a high DM to the associated FRB, which can be comparable to and even exceed the DM contributed by the intergalactic medium. On the other hand, if the wind only carries a Goldreich-Julian particle flux, its DM contribution would become negligible; meanwhile, the internal plateau afterglow would not appear. Alternatively, the FRB should be associated with a GRB afterglow produced by the GRB external shock, i.e., an energy-injection-caused shallow-decay afterglow or a normal single-power-law afterglow if the impulsive energy release of the GRB is high enough. In the latter case, the DM contributed by the high-mass GRB ejecta could be substantially important, in particular, for an environment of main-sequence stellar wind. In summary, a careful assessment on the various DM contributors could be required for the cosmological application of the expected FRB-GRB association. The future DM measurements of GRB-associated FRBs could provide a constraint on the physics of NS winds.
The LASL gamma-ray burst astronomy program
International Nuclear Information System (INIS)
Klebesadel, R.W.; Evans, W.D.; Laros, J.G.
1981-01-01
Gamma-ray burst observations performed by LASL began with the identification and initial report of the phenomenon from data acquired by the Vela satellites. The Vela instruments have recorded responses to 73 gamma-ray bursts over a ten-year interval, and are continuing to contribute toward these observations. Similar instrumentation was included aboard the NRL SOLRAD 11 spacecraft. These performed well but suffered an early demise. Recently, the LASL gamma-ray burst astronomy program has been enhanced through the implementation of experiments aboard the Pioneer Venus Orbiter and ISEF-C spacecraft. Both of these experiments are continuing to contribute data vital to trigonometric directional analyses. (orig.)
Gamma ray bursts observed with WATCH‐EURECA
DEFF Research Database (Denmark)
Brandt, Søren; Lund, Niels; Castro-Tirado, A. J.
1994-01-01
The WATCH wide field x‐ray monitor has the capability of independently locating bright Gamma Ray Bursts to 1° accuracy. We report the preliminary positions of 12 Gamma Ray Bursts observed with the WATCH monitor flown on the ES spacecraft EURECA during its 11 month mission. Also the recurrence...
The metallicity and dust content of a redshift 5 gamma-ray burst host galaxy
DEFF Research Database (Denmark)
Sparre, M.; Hartoog, O. E.; Krühler, T.
2014-01-01
Observations of the afterglows of long gamma-ray bursts (GRBs) allow the study of star-forming galaxies across most of cosmic history. Here we present observations of GRB 111008A from which we can measure metallicity, chemical abundance patterns, dust-to-metals ratio and extinction of the GRB host...
Gamma ray bursts: Current status of observations and theory
International Nuclear Information System (INIS)
Meegan, C.A.
1990-04-01
Gamma ray bursts display a wide range of temporal and spectral characteristics, but typically last several seconds and emit most of their energy in a low energy, gamma ray region. The burst sources appear to be isotropically distributed on the sky. Several lines of evidence suggest magnetic neutron stars as sources for bursts. A variety of energy sources and emission mechanisms are proposed
Infrared and X-ray bursts from the rapid burster
International Nuclear Information System (INIS)
Apparao, K.M.V.; Chitre, S.M.
1979-01-01
Studies on sudden bursts from the cosmic X-ray sources are reported. The processes occuring from the rise in luminosity of an x-ray source to its collapse are described. Records of the x-ray burst from the globular cluster NGC 6624 and the 'Rapid Burster' are shown. The Infra-red bursts from the Rapid Burster are also explained. (A.K.)
THE SECOND SWIFT BURST ALERT TELESCOPE GAMMA-RAY BURST CATALOG
International Nuclear Information System (INIS)
Sakamoto, T.; Baumgartner, W. H.; Cummings, J. R.; Krimm, H. A.; Barthelmy, S. D.; Gehrels, N.; Markwardt, C. B.; Parsons, A. M.; Tueller, J.; Fenimore, E. E.; Palmer, D. M.; Sato, G.; Stamatikos, M.; Ukwatta, T. N.; Zhang, B.
2011-01-01
We present the second Swift Burst Alert Telescope (BAT) catalog of gamma-ray bursts (GRBs), which contains 476 bursts detected by the BAT between 2004 December 19 and 2009 December 21. This catalog (hereafter the BAT2 catalog) presents burst trigger time, location, 90% error radius, duration, fluence, peak flux, time-averaged spectral parameters, and time-resolved spectral parameters measured by the BAT. In the correlation study of various observed parameters extracted from the BAT prompt emission data, we distinguish among long-duration GRBs (L-GRBs), short-duration GRBs (S-GRBs), and short-duration GRBs with extended emission (S-GRBs with E.E.) to investigate differences in the prompt emission properties. The fraction of L-GRBs, S-GRBs, and S-GRBs with E.E. in the catalog are 89%, 8%, and 2%, respectively. We compare the BAT prompt emission properties with the BATSE, BeppoSAX, and HETE-2 GRB samples. We also correlate the observed prompt emission properties with the redshifts for the GRBs with known redshift. The BAT T 90 and T 50 durations peak at 70 s and 30 s, respectively. We confirm that the spectra of the BAT S-GRBs are generally harder than those of the L-GRBs. The time-averaged spectra of the BAT S-GRBs with E.E. are similar to those of the L-GRBs. Whereas, the spectra of the initial short spikes of the S-GRBs with E.E. are similar to those of the S-GRBs. We show that the BAT GRB samples are significantly softer than the BATSE bright GRBs and that the time-averaged E obs peak of the BAT GRBs peaks at 80 keV, which is significantly lower energy than those of the BATSE sample, which peak at 320 keV. The time-averaged spectral properties of the BAT GRB sample are similar to those of the HETE-2 GRB samples. By time-resolved spectral analysis, we find that only 10% of the BAT observed photon indices are outside the allowed region of the synchrotron shock model. We see no obvious observed trend in the BAT T 90 and the observed spectra with redshifts. The T 90
On the Nature of the Gamma-ray Bursts
Directory of Open Access Journals (Sweden)
Kyung-Ai Hong
1987-12-01
Full Text Available Review of the γ-ray burst phenomena are presented. History of the γ-ray bursts, characteristics, and three radiation mechanisms of thermal bremsstrahlung, thermal synchrotron, and inverse Compton scattering processes are considered.
Unusual X-ray burst profiles from 4U/MXB 1636-53
Sztajno, M.; Truemper, J.; Pietsch, W.; Van Paradijs, J.; Stollman, G.
1985-01-01
During a one day Exosat observation eight X-ray bursts from 4U/MXB 1636-53 are observed. Four of these were very unusual. Their peak fluxes were relatively low, and they showed a distinct double peak in their bolometric flux profiles. These new double-peaked bursts are unexplained by presently available models of X-ray bursts. It is possible that the energy release in these bursts proceeds in two 'steps'. The burst profiles are not the result of an expansion and subsequent contraction of the photosphere of the neutron star. Thus, they are very different from previously observed bursts which do show a double peak in certain energy ranges but not in their bolometric flux profiles; these are satisfactorily explained in terms of photospheric radius expansion and contraction. The anticorrelation between the apparent blackbody radius and blackbody temperature is discussed in terms of the nonPlanckian character of burst spectra and it is concluded that the model calculations reported by London, Taam, and Howard in 1984 give a reasonable first-order description of the observed apparent radius changes in X-ray bursts.
Critical Dynamics of Burst Instabilities in the Portevin-Le Chatelier Effect
International Nuclear Information System (INIS)
D'Anna, Gianfranco; Nori, Franco
2000-01-01
We investigate the Portevin-Le Chatelier effect (PLC), by compressing Al-Mg alloys in a very large deformation range, and interpret the results from the viewpoint of phase transitions and critical phenomena. The system undergoes two dynamical phase transitions between intermittent (or ''jerky'') and ''laminar'' plastic dynamic phases. Near these two dynamic critical points, the order parameter 1/τ of the PLC effect exhibits large fluctuations, and ''critical slowing down'' (i.e., the number τ of bursts, or plastic instabilities, per unit time slows down considerably)
NICER Detection of Strong Photospheric Expansion during a Thermonuclear X-Ray Burst from 4U 1820–30
Keek, L.; Arzoumanian, Z.; Chakrabarty, D.; Chenevez, J.; Gendreau, K. C.; Guillot, S.; Güver, T.; Homan, J.; Jaisawal, G. K.; LaMarr, B.; Lamb, F. K.; Mahmoodifar, S.; Markwardt, C. B.; Okajima, T.; Strohmayer, T. E.; in ’t Zand, J. J. M.
2018-04-01
The Neutron Star Interior Composition Explorer (NICER) on the International Space Station (ISS) observed strong photospheric expansion of the neutron star in 4U 1820–30 during a Type I X-ray burst. A thermonuclear helium flash in the star’s envelope powered a burst that reached the Eddington limit. Radiation pressure pushed the photosphere out to ∼200 km, while the blackbody temperature dropped to 0.45 keV. Previous observations of similar bursts were performed with instruments that are sensitive only above 3 keV, and the burst signal was weak at low temperatures. NICER's 0.2–12 keV passband enables the first complete detailed observation of strong expansion bursts. The strong expansion lasted only 0.6 s, and was followed by moderate expansion with a 20 km apparent radius, before the photosphere finally settled back down at 3 s after the burst onset. In addition to thermal emission from the neutron star, the NICER spectra reveal a second component that is well fit by optically thick Comptonization. During the strong expansion, this component is six times brighter than prior to the burst, and it accounts for 71% of the flux. In the moderate expansion phase, the Comptonization flux drops, while the thermal component brightens, and the total flux remains constant at the Eddington limit. We speculate that the thermal emission is reprocessed in the accretion environment to form the Comptonization component, and that changes in the covering fraction of the star explain the evolution of the relative contributions to the total flux.
DETECTING THE SUPERNOVA BREAKOUT BURST IN TERRESTRIAL NEUTRINO DETECTORS
International Nuclear Information System (INIS)
Wallace, Joshua; Burrows, Adam; Dolence, Joshua C.
2016-01-01
We calculate the distance-dependent performance of a few representative terrestrial neutrino detectors in detecting and measuring the properties of the ν e breakout burst light curve in a Galactic core-collapse supernova. The breakout burst is a signature phenomenon of core collapse and offers a probe into the stellar core through collapse and bounce. We examine cases of no neutrino oscillations and oscillations due to normal and inverted neutrino-mass hierarchies. For the normal hierarchy, other neutrino flavors emitted by the supernova overwhelm the ν e signal, making a detection of the breakout burst difficult. For the inverted hierarchy (IH), some detectors at some distances should be able to see the ν e breakout burst peak and measure its properties. For the IH, the maximum luminosity of the breakout burst can be measured at 10 kpc to accuracies of ∼30% for Hyper-Kamiokande (Hyper-K) and ∼60% for the Deep Underground Neutrino Experiment (DUNE). Super-Kamiokande (Super-K) and Jiangmen Underground Neutrino Observatory (JUNO) lack the mass needed to make an accurate measurement. For the IH, the time of the maximum luminosity of the breakout burst can be measured in Hyper-K to an accuracy of ∼3 ms at 7 kpc, in DUNE to ∼2 ms at 4 kpc, and JUNO and Super-K can measure the time of maximum luminosity to an accuracy of ∼2 ms at 1 kpc. Detector backgrounds in IceCube render a measurement of the ν e breakout burst unlikely. For the IH, a measurement of the maximum luminosity of the breakout burst could be used to differentiate between nuclear equations of state
Rock Burst Mechanics: Insight from Physical and Mathematical Modelling
Directory of Open Access Journals (Sweden)
J. Vacek
2008-01-01
Full Text Available Rock burst processes in mines are studied by many groups active in the field of geomechanics. Physical and mathematical modelling can be used to better understand the phenomena and mechanisms involved in the bursts. In the present paper we describe both physical and mathematical models of a rock burst occurring in a gallery of a coal mine.For rock bursts (also called bumps to occur, the rock has to possess certain particular rock burst properties leading to accumulation of energy and the potential to release this energy. Such materials may be brittle, or the rock burst may arise at the interfacial zones of two parts of the rock, which have principally different material properties (e.g. in the Poíbram uranium mines.The solution is based on experimental and mathematical modelling. These two methods have to allow the problem to be studied on the basis of three presumptions:· the solution must be time dependent,· the solution must allow the creation of cracks in the rock mass,· the solution must allow an extrusion of rock into an open space (bump effect.
Characteristics of shock-associated fast-drift kilometric radio bursts
Macdowall, R. J.; Kundu, M. R.; Stone, R. G.
1987-01-01
The existence of a class of fast-drift, shock-associated (SA), kilometric radio bursts which occur at the time of metric type II emission and which are not entirely the kilometric continuation of metric type III bursts has been reported previously (Cane et al., 1981). In this paper unambiguous SA event criteria are established for the purpose of statistically comparing SA events with conventional kilometric type III bursts. Applying these criteria to all long-duration, fast-drift bursts observed by the ISEE-3 spacecraft during a 28-month interval, it is found that more than 70 percent of the events satisfying the criteria are associated with the radio signatures of coronal shocks. If a given event is associated with a metric type II or type IV burst, it is 13 times more likely to satisfy the SA criteria than an event associated only with metric type III activity.
Gamma-ray bursts observed by the watch experiment
DEFF Research Database (Denmark)
Lund, Niels; Brandt, Søren; Castro-Tirado, A. J.
1991-01-01
After two years in orbit the WATCH instruments on the GRANAT space observatory have localized seven gamma burst sources with better than 1° accuracy. In several cases, follow‐up observations with Schmidt telescopes have been made within a few days. Some of the bursts have also been detected...... by the distant space probes PVO and ULYSSES and there are, therefore, good prospects for obtaining much improved positions using the burst arrival times. The existence of the almost concurrent Schmidt plates could then become particularly interesting....
Gamma-ray burst theory after Swift.
Piran, Tsvi; Fan, Yi-Zhong
2007-05-15
Afterglow observations in the pre-Swift era confirmed to a large extend the relativistic blast wave model for gamma-ray bursts (GRBs). Together with the observations of properties of host galaxies and the association with (type Ic) SNe, this has led to the generally accepted collapsar origin of long GRBs. However, most of the afterglow data was collected hours after the burst. The X-ray telescope and the UV/optical telescope onboard Swift are able to slew to the direction of a burst in real time and record the early broadband afterglow light curves. These observations, and in particular the X-ray observations, resulted in many surprises. While we have anticipated a smooth transition from the prompt emission to the afterglow, many observed that early light curves are drastically different. We review here how these observations are changing our understanding of GRBs.
Interaction function of coupled bursting neurons
International Nuclear Information System (INIS)
Shi Xia; Zhang Jiadong
2016-01-01
The interaction functions of electrically coupled Hindmarsh–Rose (HR) neurons for different firing patterns are investigated in this paper. By applying the phase reduction technique, the phase response curve (PRC) of the spiking neuron and burst phase response curve (BPRC) of the bursting neuron are derived. Then the interaction function of two coupled neurons can be calculated numerically according to the PRC (or BPRC) and the voltage time course of the neurons. Results show that the BPRC is more and more complicated with the increase of the spike number within a burst, and the curve of the interaction function oscillates more and more frequently with it. However, two certain things are unchanged: ϕ = 0, which corresponds to the in-phase synchronization state, is always the stable equilibrium, while the anti-phase synchronization state with ϕ = 0.5 is an unstable equilibrium. (paper)
Type III bursts in interplanetary space - Fundamental or harmonic?
Dulk, G. A.; Steinberg, J. L.; Hoang, S.
1984-01-01
ISEE-3 spacecraft observation of 120 relatively simple, isolated bursts in the 30-1980 kHz range are the basis of the present study of Type III bursts in the solar wind. Several characteristics are identified for many of these bursts which imply that the mode of emission changes from predominantly fundamental plasma radiation during the rise phase to predominantly second harmonic during decay. The fundamental emission begins in time coincidence with the start of Langmuir waves, confirming the conventional belief in these waves' causation of Type III bursts. Attention is given to the characteristics of fundamental components, by comparison to harmonics, at km-wavelengths.
A polarized fast radio burst at low Galactic latitude
Petroff, E.; Kasliwal, M.; Ravi, V.
2017-01-01
We report on the discovery of a new fast radio burst (FRB), FRB 150215, with the Parkes radio telescope on 2015 February 15. The burst was detected in real time with a dispersion measure (DM) of 1105.6 ± 0.8 pc cm^(−3), a pulse duration of 2.8 ^(+1.2)_(−0.5)ms, and a measured peak flux density assuming that the burst was at beam centre of 0.7 ^(+0.2)_(−0.1) Jy. The FRB originated at a Galactic longitude and latitude of 24.66°, 5.28° and 25° away from the Galactic Center. The burst was found t...
Phase-locking of bursting neuronal firing to dominant LFP frequency components.
Constantinou, Maria; Elijah, Daniel H; Squirrell, Daniel; Gigg, John; Montemurro, Marcelo A
2015-10-01
Neuronal firing in the hippocampal formation relative to the phase of local field potentials (LFP) has a key role in memory processing and spatial navigation. Firing can be in either tonic or burst mode. Although bursting neurons are common in the hippocampal formation, the characteristics of their locking to LFP phase are not completely understood. We investigated phase-locking properties of bursting neurons using simulations generated by a dual compartmental model of a pyramidal neuron adapted to match the bursting activity in the subiculum of a rat. The model was driven with stochastic input signals containing a power spectral profile consistent with physiologically relevant frequencies observed in LFP. The single spikes and spike bursts fired by the model were locked to a preferred phase of the predominant frequency band where there was a peak in the power of the driving signal. Moreover, the preferred phase of locking shifted with increasing burst size, providing evidence that LFP phase can be encoded by burst size. We also provide initial support for the model results by analysing example data of spontaneous LFP and spiking activity recorded from the subiculum of a single urethane-anaesthetised rat. Subicular neurons fired single spikes, two-spike bursts and larger bursts that locked to a preferred phase of either dominant slow oscillations or theta rhythms within the LFP, according to the model prediction. Both power-modulated phase-locking and gradual shift in the preferred phase of locking as a function of burst size suggest that neurons can use bursts to encode timing information contained in LFP phase into a spike-count code. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
Observations of the highest energy gamma-rays from gamma-ray bursts
International Nuclear Information System (INIS)
Dingus, Brenda L.
2001-01-01
EGRET has extended the highest energy observations of gamma-ray bursts to GeV gamma rays. Such high energies imply the fireball that is radiating the gamma-rays has a bulk Lorentz factor of several hundred. However, EGRET only detected a few gamma-ray bursts. GLAST will likely detect several hundred bursts and may extend the maximum energy to a few 100 GeV. Meanwhile new ground based detectors with sensitivity to gamma-ray bursts are beginning operation, and one recently reported evidence for TeV emission from a burst
Stress Effects on Stop Bursts in Five Languages
Directory of Open Access Journals (Sweden)
Marija Tabain
2016-11-01
Full Text Available This study examines the effects of stress on the stop burst in five languages differing in number of places of articulation, as reflected in burst duration, spectral centre of gravity, and spectral standard deviation. The languages studied are English (three places of articulation /p t k/, the Indonesian language Makasar (four places /p t c k/, and the Central Australian languages Pitjantjatjara, Warlpiri (both five places /p t ʈ c k/, and Arrernte (six places /p t̪ t ʈ c k/. We find that languages differ in how they manifest stress on the consonant, with Makasar not showing any effect of stress at all, and Warlpiri showing an effect on burst duration, but not on the spectral measures. For the other languages, the velar /k/ has a “darker” quality (i.e., lower spectral centre of gravity, and/or a less diffuse spectrum (i.e., lower standard deviation under stress; while the alveolar /t/ has a “lighter” quality under stress. In addition, the dental /t̪/ has a more diffuse spectrum under stress. We suggest that this involves enhancement of the features [grave] and [diffuse] under stress, with velars being [+grave] and [–diffuse], alveolars being [–grave], and dentals being [+diffuse]. We discuss the various possible spectral effects of enhancement of these features. Finally, in the languages with five or six places of articulation, the stop burst is longer only for the palatal /c/ and the velar /k/, which have intrinsically long burst durations, and not for the anterior coronals /t̪ t ʈ/, which have intrinsically short burst durations. We suggest that in these systems, [burst duration] is a feature that separates these two groups of consonants.
Fermi/GBM Observations of SGRJ0501 + 4516 Bursts
Lin, Lin; Kouveliotou, Chryssa; Baring, Matthew G.; van der Horst, Alexander J.; Guiriec, Sylvain; Woods, Peter M.; Goegues, Ersin; Kaneko, Yuki; Scargle, Jeffrey; Granot, Jonathan;
2011-01-01
We present our temporal and spectral analyses of 29 bursts from SGRJ0501+4516, detected with the Gamma-ray Burst Monitor onboard the Fermi Gamma-ray Space Telescope during the 13 days of the source activation in 2008 (August 22 to September 3). We find that the T(sub 90) durations of the bursts can be fit with a log-normal distribution with a mean value of approx. 123 ms. We also estimate for the first time event durations of Soft Gamma Repeater (SGR) bursts in photon space (i.e., using their deconvolved spectra) and find that these are very similar to the T(sub 90)s estimated in count space (following a log-normal distribution with a mean value of approx. 124 ms). We fit the time-integrated spectra for each burst and the time-resolved spectra of the five brightest bursts with several models. We find that a single power law with an exponential cutoff model fits all 29 bursts well, while 18 of the events can also be fit with two black body functions. We expand on the physical interpretation of these two models and we compare their parameters and discuss their evolution. We show that the time-integrated and time-resolved spectra reveal that E(sub peak) decreases with energy flux (and fluence) to a minimum of approx. 30 keV at F = 8.7 x 10(exp -6)erg/sq cm/s, increasing steadily afterwards. Two more sources exhibit a similar trend: SGRs J1550 - 5418 and 1806 - 20. The isotropic luminosity, L(sub iso), corresponding to these flux values is roughly similar for all sources (0.4 - l.5 x 10(exp 40) erg/s.
Polarization of a periodic solar microwave burst
Energy Technology Data Exchange (ETDEWEB)
Kaufmann, P [Universidade Mackenzie, Sao Paulo (Brazil). Centro de Radio-Astronomia e Astrofisica
1976-09-01
No fluctuations in polarization have been found during a 7 GHz solar burst showing 17s periodic pulses in intensity. Polarization effects can be produced by the propagation media in the active centre, which are not affected directly by the burst source, but situated more deeply than the observed heights at that microwave frequency.
The host galaxy of a fast radio burst.
Keane, E F; Johnston, S; Bhandari, S; Barr, E; Bhat, N D R; Burgay, M; Caleb, M; Flynn, C; Jameson, A; Kramer, M; Petroff, E; Possenti, A; van Straten, W; Bailes, M; Burke-Spolaor, S; Eatough, R P; Stappers, B W; Totani, T; Honma, M; Furusawa, H; Hattori, T; Morokuma, T; Niino, Y; Sugai, H; Terai, T; Tominaga, N; Yamasaki, S; Yasuda, N; Allen, R; Cooke, J; Jencson, J; Kasliwal, M M; Kaplan, D L; Tingay, S J; Williams, A; Wayth, R; Chandra, P; Perrodin, D; Berezina, M; Mickaliger, M; Bassa, C
2016-02-25
In recent years, millisecond-duration radio signals originating in distant galaxies appear to have been discovered in the so-called fast radio bursts. These signals are dispersed according to a precise physical law and this dispersion is a key observable quantity, which, in tandem with a redshift measurement, can be used for fundamental physical investigations. Every fast radio burst has a dispersion measurement, but none before now have had a redshift measurement, because of the difficulty in pinpointing their celestial coordinates. Here we report the discovery of a fast radio burst and the identification of a fading radio transient lasting ~6 days after the event, which we use to identify the host galaxy; we measure the galaxy's redshift to be z = 0.492 ± 0.008. The dispersion measure and redshift, in combination, provide a direct measurement of the cosmic density of ionized baryons in the intergalactic medium of ΩIGM = 4.9 ± 1.3 per cent, in agreement with the expectation from the Wilkinson Microwave Anisotropy Probe, and including all of the so-called 'missing baryons'. The ~6-day radio transient is largely consistent with the radio afterglow of a short γ-ray burst, and its existence and timescale do not support progenitor models such as giant pulses from pulsars, and supernovae. This contrasts with the interpretation of another recently discovered fast radio burst, suggesting that there are at least two classes of bursts.
Burst Test Qualification Analysis of DWPF Canister-Plug Weld
International Nuclear Information System (INIS)
Gupta, N.K.; Gong, Chung.
1995-02-01
The DWPF canister closure system uses resistance welding for sealing the canister nozzle and plug to ensure leak tightness. The welding group at SRTC is using the burst test to qualify this seal weld in lieu of the shear test in ASME B ampersand PV Code, Section IX, paragraph QW-196. The burst test is considered simpler and more appropriate than the shear test for this application. Although the geometry, loading and boundary conditions are quite different in the two tests, structural analyses show similarity in the failure mode of the shear test in paragraph QW-196 and the burst test on the DWPF canister nozzle Non-linear structural analyses are performed using finite element techniques to study the failure mode of the two tests. Actual test geometry and realistic stress strain data for the 304L stainless steel and the weld material are used in the analyses. The finite element models are loaded until failure strains are reached. The failure modes in both tests are shear at the failure points. Based on these observations, it is concluded that the use of a burst test in lieu of the shear test for qualifying the canister-plug weld is acceptable. The burst test analysis for the canister-plug also yields the burst pressures which compare favorably with the actual pressure found during burst tests. Thus, the analysis also provides an estimate of the safety margins in the design of these vessels
X-Ray Spectral Characteristics of Ginga Gamma-Ray Bursts
International Nuclear Information System (INIS)
Strohmayer, T.E.; Fenimore, E.E.; Murakami, T.; Yoshida, A.
1998-01-01
We have investigated the spectral characteristics of a sample of bright gamma-ray bursts detected with the gamma-ray burst sensors aboard the satellite Ginga. This instrument employed a proportional and scintillation counter to provide sensitivity to photons in the 2 endash 400 keV region and as such provided a unique opportunity to characterize the largely unexplored X-ray properties of gamma-ray bursts. The photon spectra of the Ginga bursts are well described by a low-energy slope, a bend energy, and a high-energy slope. In the energy range where they can be compared, this result is consistent with burst spectral analyses obtained from the BATSE experiment aboard the Compton Gamma-Ray Observatory. However, below 20 keV we find evidence for a positive spectral number index in approximately 40% of our burst sample, with some evidence for a strong rolloff at lower energies in a few events. There is a correlation (Pearson's r = -0.62) between the low-energy slope and the bend energy. We find that the distribution of spectral bend energies extends below 10 keV. There has been some concern in cosmological models of gamma-ray bursts (GRBs) that the bend energy covers only a small dynamic range. Our result extends the observed dynamic range, and, since we observe bend energies down to the limit of our instrument, perhaps observations have not yet limited the range. The Ginga trigger range was virtually the same as that of BATSE, yet we find a different range of fit parameters. One possible explanation might be that GRBs have two break energies, one often in the 50 endash 500 keV range and the other near 5 keV. Both BATSE and Ginga fit with only a single break energy, so BATSE tends to find breaks near the center of its energy range, and we tend to find breaks in our energy range. The observed ratio of energy emitted in the X-rays relative to the gamma rays can be much larger than a few percent and, in fact, is sometimes larger than unity. The average for our 22 bursts
BACODINE/3rd Interplanetary Network burst localization
International Nuclear Information System (INIS)
Hurley, K.; Barthelmy, S.; Butterworth, P.; Cline, T.; Sommer, M.; Boer, M.; Niel, M.; Kouveliotou, C.; Fishman, G.; Meegan, C.
1996-01-01
Even with only two widely separated spacecraft (Ulysses and GRO), 3rd Interplanetary Network (IPN) localizations can reduce the areas of BATSE error circles by two orders of magnitude. Therefore it is useful to disseminate them as quickly as possible following BATSE bursts. We have implemented a system which transmits the light curves of BACODINE/BATSE bursts directly by e-mail to UC Berkeley immediately after detection. An automatic e-mail parser at Berkeley watches for these notices, determines the Ulysses crossing time window, and initiates a search for the burst data on the JPL computer as they are received. In ideal cases, it is possible to retrieve the Ulysses data within a few hours of a burst, generate an annulus of arrival directions, and e-mail it out to the astronomical community by local nightfall. Human operators remain in this loop, but we are developing a fully automated routine which should remove them, at least for intense events, and reduce turn-around times to an absolute minimum. We explain the current operations, the data types used, and the speed/accuracy tradeoffs
Gamma-ray bursts from black hole accretion disks
International Nuclear Information System (INIS)
Strong, I.B.
1975-01-01
The suggestion was first made more than a year ago that gamma-ray bursts might originate in the neighborhood of black holes, based on some rather circumstantial evidence linking Cygnus X-1, the prime black-hole candidate, with two of the then-known gamma-ray bursts. Since then additional evidence makes the idea still more plausible. The evidence is summarized briefly, a physical model for production of gamma-ray bursts is given, and several of the more interesting consequences of such an origin are pointed out. (orig.) [de
Wijers, Ralph A M J; Woosley, Stan
2012-01-01
Cosmic gamma ray bursts (GRBs) have fascinated scientists and the public alike since their discovery in the late 1960s. Their story is told here by some of the scientists who participated in their discovery and, after many decades of false starts, solved the problem of their origin. Fourteen chapters by active researchers in the field present a detailed history of the discovery, a comprehensive theoretical description of GRB central engine and emission models, a discussion of GRB host galaxies and a guide to how GRBs can be used as cosmological tools. Observations are grouped into three sets from the satellites CGRO, BeppoSAX and Swift, and followed by a discussion of multi-wavelength observations. This is the first edited volume on GRB astrophysics that presents a fully comprehensive review of the subject. Utilizing the latest research, Gamma-ray Bursts is an essential desktop companion for graduate students and researchers in astrophysics.
V/V(max) test applied to SMM gamma-ray bursts
Matz, S. M.; Higdon, J. C.; Share, G. H.; Messina, D. C.; Iadicicco, A.
1992-01-01
We have applied the V/V(max) test to candidate gamma-ray bursts detected by the Gamma-Ray Spectrometer (GRS) aboard the SMM satellite to examine quantitatively the uniformity of the burst source population. For a sample of 132 candidate bursts identified in the GRS data by an automated search using a single uniform trigger criterion we find average V/V(max) = 0.40 +/- 0.025. This value is significantly different from 0.5, the average for a uniform distribution in space of the parent population of burst sources; however, the shape of the observed distribution of V/V(max) is unusual and our result conflicts with previous measurements. For these reasons we can currently draw no firm conclusion about the distribution of burst sources.
Ablation of silicon with bursts of femtosecond laser pulses
Gaudiuso, Caterina; Kämmer, Helena; Dreisow, Felix; Ancona, Antonio; Tünnermann, Andreas; Nolte, Stefan
2016-03-01
We report on an experimental investigation of ultrafast laser ablation of silicon with bursts of pulses. The pristine 1030nm-wavelength 200-fs pulses were split into bursts of up to 16 sub-pulses with time separation ranging from 0.5ps to 4080ps. The total ablation threshold fluence was measured depending on the burst features, finding that it strongly increases with the number of sub-pulses for longer sub-pulse delays, while a slowly increasing trend is observed for shorter separation time. The ablation depth per burst follows two different trends according to the time separation between the sub-pulses, as well as the total threshold fluence. For delays shorter than 4ps it decreases with the number of pulses, while for time separations longer than 510ps, deeper craters were achieved by increasing the number of subpulses in the burst, probably due to a change of the effective penetration depth.
A polarized fast radio burst at low Galactic latitude
Petroff, E.; Burke-Spolaor, S.; Keane, E. F.; McLaughlin, M. A.; Miller, R.; Andreoni, I.; Bailes, M.; Barr, E. D.; Bernard, S. R.; Bhandari, S.; Bhat, N. D. R.; Burgay, M.; Caleb, M.; Champion, D.; Chandra, P.; Cooke, J.; Dhillon, V. S.; Farnes, J. S.; Hardy, L. K.; Jaroenjittichai, P.; Johnston, S.; Kasliwal, M.; Kramer, M.; Littlefair, S. P.; Macquart, J. P.; Mickaliger, M.; Possenti, A.; Pritchard, T.; Ravi, V.; Rest, A.; Rowlinson, A.; Sawangwit, U.; Stappers, B.; Sullivan, M.; Tiburzi, C.; van Straten, W.; ANTARES Collaboration; Albert, A.; André, M.; Anghinolfi, M.; Anton, G.; Ardid, M.; Aubert, J.-J.; Avgitas, T.; Baret, B.; Barrios-Martí, J.; Basa, S.; Bertin, V.; Biagi, S.; Bormuth, R.; Bourret, S.; Bouwhuis, M. C.; Bruijn, R.; Brunner, J.; Busto, J.; Capone, A.; Caramete, L.; Carr, J.; Celli, S.; Chiarusi, T.; Circella, M.; Coelho, J. A. B.; Coleiro, A.; Coniglione, R.; Costantini, H.; Coyle, P.; Creusot, A.; Deschamps, A.; de Bonis, G.; Distefano, C.; di Palma, I.; Donzaud, C.; Dornic, D.; Drouhin, D.; Eberl, T.; El Bojaddaini, I.; Elsässer, D.; Enzenhöfer, A.; Felis, I.; Fusco, L. A.; Galatà, S.; Gay, P.; Geißelsöder, S.; Geyer, K.; Giordano, V.; Gleixner, A.; Glotin, H.; Grégoire, T.; Gracia-Ruiz, R.; Graf, K.; Hallmann, S.; van Haren, H.; Heijboer, A. J.; Hello, Y.; Hernández-Rey, J. J.; Hößl, J.; Hofestädt, J.; Hugon, C.; Illuminati, G.; James, C. W.; de Jong, M.; Jongen, M.; Kadler, M.; Kalekin, O.; Katz, U.; Kießling, D.; Kouchner, A.; Kreter, M.; Kreykenbohm, I.; Kulikovskiy, V.; Lachaud, C.; Lahmann, R.; Lefèvre, D.; Leonora, E.; Lotze, M.; Loucatos, S.; Marcelin, M.; Margiotta, A.; Marinelli, A.; Martínez-Mora, J. A.; Mathieu, A.; Mele, R.; Melis, K.; Michael, T.; Migliozzi, P.; Moussa, A.; Mueller, C.; Nezri, E.; Pǎvǎlaş, G. E.; Pellegrino, C.; Perrina, C.; Piattelli, P.; Popa, V.; Pradier, T.; Quinn, L.; Racca, C.; Riccobene, G.; Roensch, K.; Sánchez-Losa, A.; Saldaña, M.; Salvadori, I.; Samtleben, D. F. E.; Sanguineti, M.; Sapienza, P.; Schnabel, J.; Seitz, T.; Sieger, C.; Spurio, M.; Stolarczyk, Th.; Taiuti, M.; Tayalati, Y.; Trovato, A.; Tselengidou, M.; Turpin, D.; Tönnis, C.; Vallage, B.; Vallée, C.; van Elewyck, V.; Vivolo, D.; Vizzoca, A.; Wagner, S.; Wilms, J.; Zornoza, J. D.; Zúñiga, J.; H.E.S.S. Collaboration; Abdalla, H.; Abramowski, A.; Aharonian, F.; Ait Benkhali, F.; Akhperjanian, A. G.; Andersson, T.; Angüner, E. O.; Arrieta, M.; Aubert, P.; Backes, M.; Balzer, A.; Barnard, M.; Becherini, Y.; Tjus, J. Becker; Berge, D.; Bernhard, S.; Bernlöhr, K.; Blackwell, R.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Bregeon, J.; Brun, F.; Brun, P.; Bryan, M.; Bulik, T.; Capasso, M.; Casanova, S.; Cerruti, M.; Chakraborty, N.; Chalme-Calvet, R.; Chaves, R. C. G.; Chen, A.; Chevalier, J.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Condon, B.; Conrad, J.; Cui, Y.; Davids, I. D.; Decock, J.; Degrange, B.; Deil, C.; Devin, J.; Dewilt, P.; Dirson, L.; Djannati-Ataï, A.; Domainko, W.; Donath, A.; Drury, L. O'c.; Dubus, G.; Dutson, K.; Dyks, J.; Edwards, T.; Egberts, K.; Eger, P.; Ernenwein, J.-P.; Eschbach, S.; Farnier, C.; Fegan, S.; Fernandes, M. V.; Fiasson, A.; Fontaine, G.; Förster, A.; Funk, S.; Füßling, M.; Gabici, S.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Gottschall, D.; Goyal, A.; Grondin, M.-H.; Hadasch, D.; Hahn, J.; Haupt, M.; Hawkes, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hinton, J. A.; Hofmann, W.; Hoischen, C.; Holler, M.; Horns, D.; Ivascenko, A.; Jacholkowska, A.; Jamrozy, M.; Janiak, M.; Jankowsky, D.; Jankowsky, F.; Jingo, M.; Jogler, T.; Jouvin, L.; Jung-Richardt, I.; Kastendieck, M. A.; Katarzyński, K.; Kerszberg, D.; Khélifi, B.; Kieffer, M.; King, J.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Kraus, M.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lau, J.; Lees, J.-P.; Lefaucheur, J.; Lefranc, V.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Leser, E.; Lohse, T.; Lorentz, M.; Liu, R.; López-Coto, R.; Lypova, I.; Marandon, V.; Marcowith, A.; Mariaud, C.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; Meintjes, P. J.; Meyer, M.; Mitchell, A. M. W.; Moderski, R.; Mohamed, M.; Mohrmann, L.; Morâ, K.; Moulin, E.; Murach, T.; de Naurois, M.; Niederwanger, F.; Niemiec, J.; Oakes, L.; O'Brien, P.; Odaka, H.; Öttl, S.; Ohm, S.; Ostrowski, M.; Oya, I.; Padovani, M.; Panter, M.; Parsons, R. D.; Pekeur, N. W.; Pelletier, G.; Perennes, C.; Petrucci, P.-O.; Peyaud, B.; Piel, Q.; Pita, S.; Poon, H.; Prokhorov, D.; Prokoph, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Reimer, A.; Reimer, O.; Renaud, M.; Reyes, R. De Los; Rieger, F.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Salek, D.; Sanchez, D. A.; Santangelo, A.; Sasaki, M.; Schlickeiser, R.; Schulz, A.; Schüssler, F.; Schwanke, U.; Schwemmer, S.; Settimo, M.; Seyffert, A. S.; Shafi, N.; Shilon, I.; Simoni, R.; Sol, H.; Spanier, F.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tibaldo, L.; Tiziani, D.; Tluczykont, M.; Trichard, C.; Tuffs, R.; Uchiyama, Y.; Walt, D. J. Van Der; van Eldik, C.; van Rensburg, C.; van Soelen, B.; Vasileiadis, G.; Veh, J.; Venter, C.; Viana, A.; Vincent, P.; Vink, J.; Voisin, F.; Völk, H. J.; Vuillaume, T.; Wadiasingh, Z.; Wagner, S. J.; Wagner, P.; Wagner, R. M.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Yang, R.; Zabalza, V.; Zaborov, D.; Zacharias, M.; Zanin, R.; Zdziarski, A. A.; Zech, A.; Zefi, F.; Ziegler, A.; Żywucka, N.
2017-08-01
We report on the discovery of a new fast radio burst (FRB), FRB 150215, with the Parkes radio telescope on 2015 February 15. The burst was detected in real time with a dispersion measure (DM) of 1105.6 ± 0.8 pc cm-3, a pulse duration of 2.8^{+1.2}_{-0.5} ms, and a measured peak flux density assuming that the burst was at beam centre of 0.7^{+0.2}_{-0.1} Jy. The FRB originated at a Galactic longitude and latitude of 24.66°, 5.28° and 25° away from the Galactic Center. The burst was found to be 43 ± 5 per cent linearly polarized with a rotation measure (RM) in the range -9 < RM < 12 rad m-2 (95 per cent confidence level), consistent with zero. The burst was followed up with 11 telescopes to search for radio, optical, X-ray, γ-ray and neutrino emission. Neither transient nor variable emission was found to be associated with the burst and no repeat pulses have been observed in 17.25 h of observing. The sightline to the burst is close to the Galactic plane and the observed physical properties of FRB 150215 demonstrate the existence of sight lines of anomalously low RM for a given electron column density. The Galactic RM foreground may approach a null value due to magnetic field reversals along the line of sight, a decreased total electron column density from the Milky Way, or some combination of these effects. A lower Galactic DM contribution might explain why this burst was detectable whereas previous searches at low latitude have had lower detection rates than those out of the plane.
Diagnostics from three rising submillimeter bursts
International Nuclear Information System (INIS)
Zhou, Ai-Hua; Li, Jian-Ping; Wang, Xin-Dong
2016-01-01
In this paper we investigate three novel rising submillimeter (THz) bursts that occurred sequentially in Super Active Region NOAA 10486. The average rising rate of the flux density above 200 GHz is only 20 sfu GHz −1 (corresponding to spectral index α of 1.6) for the THz spectral components of the 2003 October 28 and November 4 bursts, but it attained values of 235 sfu GHz −1 (α = 4.8) in the 2003 November 2 burst. The steeply rising THz spectrum can be produced by a population of highly relativistic electrons with a low-energy cutoff of 1 MeV, but it only requires a low-energy cutoff of 30 keV for the two slowly rising THz bursts, via gyrosynchrotron (GS) radiation based on our numerical simulations of burst spectra in the magnetic dipole field case. The electron density variation is much larger in the THz source than in the microwave (MW) source. It is interesting that the THz source radius decreased by 20%–50% during the decay phase for the three events, but the MW source increased by 28% for the 2003 November 2 event. In the paper we will present a formula that can be used to calculate the energy released by ultrarelativistic electrons, taking the relativistic correction into account for the first time. We find that the energy released by energetic electrons in the THz source exceeds that in the MW source due to the strong GS radiation loss in the THz range, although the modeled THz source area is 3–4 orders smaller than the modeled MW source one. The total energies released by energetic electrons via the GS radiation in radio sources are estimated, respectively, to be 5.2 × 10 33 , 3.9 × 10 33 and 3.7 × 10 32 erg for the October 28, November 2 and 4 bursts, which are 131, 76 and 4 times as large as the thermal energies of 2.9 × 10 31 , 2.1 × 10 31 and 5.2 × 10 31 erg estimated from soft X-ray GOES observations. (paper)
Properties of gamma-ray burst time profiles using pulse decomposition analysis
Energy Technology Data Exchange (ETDEWEB)
Lee, A.
2000-02-08
The time profiles of many gamma-ray bursts consist of distinct pulses, which offers the possibility of characterizing the temporal structure of these bursts using a relatively small set of pulse shape parameters. This pulse decomposition analysis has previously been performed on a small sample of bright long bursts using binned data from BATSE, which comes in several data types, and on a sample of short bursts using the BATSE Time-Tagged Event (TTE) data type. The authors have developed an interactive pulse-fitting program using the phenomenological pulse model of Norris, et. al. and a maximum-likelihood fitting routine. They have used this program to analyze the Time-to-Spill (TTS) data for all bursts observed by BATSE up through trigger number 2000, in all energy channels for which TTS data is available. They present statistical information on the attributes of pulses comprising these bursts, including relations between pulse characteristics through the course of a burst. They carry out simulations to determine the biases that their procedures may introduce. They find that pulses tend to have shorter rise times than decay times, and tend to be narrower and peak earlier at higher energies. They also find that pulse brightness, pulse width, and pulse hardness ratios do not evolve monotonically within bursts, but that the ratios of pulse rise times to decay times tends to decrease with time within bursts.
Intrinsic and cosmological signatures in gamma-ray burst time profiles: Time dilation
Energy Technology Data Exchange (ETDEWEB)
Lee, A.
2000-02-08
The time profiles of many gamma-ray bursts consist of distinct pulses, which offers the possibility of characterizing the temporal structure of these bursts using a relatively small set of pulse shape parameters. The authors have used a pulse decomposition procedure to analyze the Time-to-Spill (TTS) data for all bursts observed by BATSE up through trigger number 2000, in all energy channels for which TTS data is available. The authors obtain amplitude, rise and decay timescales, a pulse shape parameter, and the fluencies of individual pulses in all of the bursts. The authors investigate the correlations between brightness measures (amplitude and fluence) and timescale measures (pulse width and separation) which may result from cosmological time dilation of bursts, or from intrinsic properties of burst sources or from selection effects. The effects of selection biases are evaluated through simulations. The correlations between these parameters among pulses within individual bursts give a measure of the intrinsic effects while the correlations among bursts could result both from intrinsic and cosmological effects. The authors find that timescales tend to be shorter in bursts with higher peak fluxes, as expected from cosmological time dilation effects, but also find that there are non-cosmological effects contributing to this inverse correlation. The authors find that timescales tend to be longer in bursts with higher total fluences, contrary to what is expected from cosmological effects. The authors also find that peak fluxes and total fluences of bursts are uncorrelated, indicating that they cannot both be good distance indicators for bursts.
Fast Radio Burst/Gamma-Ray Burst Cosmography
Gao, He; Li, Zhuo; Zhang, Bing
2014-06-01
Recently, both theoretical arguments and observational evidence suggested that a small fraction of fast radio bursts (FRBs) could be associated with gamma-ray bursts (GRBs). If such FRB/GRB association systems are commonly detected in the future, the combination of dispersion measures (DM) derived from FRBs and redshifts derived from GRBs makes these systems a plausible tool to conduct cosmography. We quantify uncertainties in deriving the redshift-dependent DM_{IGM} as a function of z and test how well dark energy models can be constrained with Monte Carlo simulations. We show that with several tens of FRB/GRB systems potentially detected in a decade or so, one may reach reasonable constraints on wCDM models. When combined with Type Ia supernova (SN Ia) data, unprecedented constraints on the dark energy equation of state may be achieved, thanks to the prospects of detecting FRB/GRB systems at relatively high redshifts. The ratio between the mean value \\lt {DM_IGM} (z)\\gt and luminosity distance (D L(z)) is insensitive to dark energy models. This gives the prospect of applying SN Ia data to calibrate \\lt {DM_IGM} (z)\\gt using a relatively small sample of FRB/GRB systems, allowing a reliable constraint on the baryon inhomogeneity distribution as a function of redshift. The methodology developed in this paper can also be applied if the FRB redshifts can be measured by other means. Some caveats of putting this method into practice are also discussed.
Fast radio burst/gamma-ray burst cosmography
International Nuclear Information System (INIS)
Gao, He; Zhang, Bing; Li, Zhuo
2014-01-01
Recently, both theoretical arguments and observational evidence suggested that a small fraction of fast radio bursts (FRBs) could be associated with gamma-ray bursts (GRBs). If such FRB/GRB association systems are commonly detected in the future, the combination of dispersion measures (DM) derived from FRBs and redshifts derived from GRBs makes these systems a plausible tool to conduct cosmography. We quantify uncertainties in deriving the redshift-dependent DM IGM as a function of z and test how well dark energy models can be constrained with Monte Carlo simulations. We show that with several tens of FRB/GRB systems potentially detected in a decade or so, one may reach reasonable constraints on wCDM models. When combined with Type Ia supernova (SN Ia) data, unprecedented constraints on the dark energy equation of state may be achieved, thanks to the prospects of detecting FRB/GRB systems at relatively high redshifts. The ratio between the mean value
Fast radio burst/gamma-ray burst cosmography
Energy Technology Data Exchange (ETDEWEB)
Gao, He; Zhang, Bing [Department of Physics and Astronomy, University of Nevada Las Vegas, NV 89154 (United States); Li, Zhuo, E-mail: gaohe@physics.unlv.edu, E-mail: zhang@physics.unlv.edu, E-mail: zhuo.li@pku.edu.cn [Department of Astronomy, School of Physics, Peking University, Beijing 100871 (China)
2014-06-20
Recently, both theoretical arguments and observational evidence suggested that a small fraction of fast radio bursts (FRBs) could be associated with gamma-ray bursts (GRBs). If such FRB/GRB association systems are commonly detected in the future, the combination of dispersion measures (DM) derived from FRBs and redshifts derived from GRBs makes these systems a plausible tool to conduct cosmography. We quantify uncertainties in deriving the redshift-dependent DM{sub IGM} as a function of z and test how well dark energy models can be constrained with Monte Carlo simulations. We show that with several tens of FRB/GRB systems potentially detected in a decade or so, one may reach reasonable constraints on wCDM models. When combined with Type Ia supernova (SN Ia) data, unprecedented constraints on the dark energy equation of state may be achieved, thanks to the prospects of detecting FRB/GRB systems at relatively high redshifts. The ratio between the mean value
Detection of pseudo gamma-ray bursts of long duration
International Nuclear Information System (INIS)
Frontera, F.; Fuligni, F.; Morelli, E.; Pizzichini, G.; Ventura, G.
1981-01-01
It is known that the counting rate of both Na I and Cs I hard X-ray detectors can have intense enhancements of brief (< 1 s) duration, which appear like very short cosmic gamma-ray bursts but probably are due to phosphorescence in the detector itself. Unfortunately, this problem is not limited to short bursts. We present here three much longer (up to 80 s) pseudo-gamma-ray bursts observed during a transatlantic balloon flight. We conclude that detections of gamma-ray bursts (and probably also of hard X-ray source flares) based only on a rate increase by a single scintillator should always be confirmed by at least one other instrument. (orig.)
A Fast Radio Burst Host Galaxy
Keane, E. F.; Johnston, S.; Bhandari, S.; Barr, E.; Bhat, N. D. R.; Burgay, M.; Caleb, M.; Flynn, C.; Jameson, A.; Kramer, M.; Petroff, E.; Possenti, A.; van Straten, W.; Bailes, M.; Burke-Spolaor, S.
2016-01-01
In recent years, millisecond duration radio signals originating from distant galaxies appear to have been discovered in the so-called Fast Radio Bursts. These signals are dispersed according to a precise physical law and this dispersion is a key observable quantity which, in tandem with a redshift measurement, can be used for fundamental physical investigations. While every fast radio burst has a dispersion measurement, none before now have had a redshift measurement, due to the difficulty in...
COSMOLOGICAL IMPLICATIONS OF FAST RADIO BURST/GAMMA-RAY BURST ASSOCIATIONS
Energy Technology Data Exchange (ETDEWEB)
Deng, Wei; Zhang, Bing, E-mail: deng@physics.unlv.edu, E-mail: zhang@physics.unlv.edu [Department of Physics and Astronomy, University of Nevada Las Vegas, Las Vegas, NV 89154 (United States)
2014-03-10
If a small fraction of fast radio bursts (FRBs) are associated with gamma-ray bursts (GRBs), as recently suggested by Zhang, the combination of redshift measurements of GRBs and dispersion measure (DM) measurements of FRBs opens a new window to study cosmology. At z < 2 where the universe is essentially fully ionized, detections of FRB/GRB pairs can give an independent measurement of the intergalactic medium portion of the baryon mass fraction, Ω {sub b} f {sub IGM}, of the universe. If a good sample of FRB/GRB associations are discovered at higher redshifts, the free electron column density history can be mapped, which can be used to probe the reionization history of both hydrogen and helium in the universe. We apply our formulation to GRBs 101011A and 100704A that each might have an associated FRB, and constrained Ω {sub b} f {sub IGM} to be consistent with the value derived from other methods. The methodology developed here is also applicable, if the redshifts of FRBs not associated with GRBs can be measured by other means.
COSMOLOGICAL IMPLICATIONS OF FAST RADIO BURST/GAMMA-RAY BURST ASSOCIATIONS
International Nuclear Information System (INIS)
Deng, Wei; Zhang, Bing
2014-01-01
If a small fraction of fast radio bursts (FRBs) are associated with gamma-ray bursts (GRBs), as recently suggested by Zhang, the combination of redshift measurements of GRBs and dispersion measure (DM) measurements of FRBs opens a new window to study cosmology. At z < 2 where the universe is essentially fully ionized, detections of FRB/GRB pairs can give an independent measurement of the intergalactic medium portion of the baryon mass fraction, Ω b f IGM , of the universe. If a good sample of FRB/GRB associations are discovered at higher redshifts, the free electron column density history can be mapped, which can be used to probe the reionization history of both hydrogen and helium in the universe. We apply our formulation to GRBs 101011A and 100704A that each might have an associated FRB, and constrained Ω b f IGM to be consistent with the value derived from other methods. The methodology developed here is also applicable, if the redshifts of FRBs not associated with GRBs can be measured by other means
Frequency Chirping during a Fishbone Burst
Energy Technology Data Exchange (ETDEWEB)
Marchenko, V.; Reznik, S., E-mail: march@kinr.kiev.ua [Institute for Nuclear Research, Kyiv (Ukraine)
2012-09-15
Full text: It is shown that gradual (more than a factor of two, in some cases - down to zero in the lab frame) reduction of the mode frequency (the so called frequency chirping) can be attributed to the reactive torque exerted on the plasma during the fishbone instability burst, which slows down the plasma rotation inside the q = 1 surface and reduces the mode frequency in the lab frame, while frequency in the plasma frame remains constant. This torque arises due to imbalance between the power transfered to the mode by energeric ions and the power of the mode dissipation by thermal species. Estimates show that the peak value of this torque exceeds the neutral beam torque in modern tokamaks and in ITER. The line-broadened quasilinear burst model, properly adapted for the fishbone case, is capable of reproducing the key features of the bursting mode. (author)
Gamma-Ray Bursts: A Radio Perspective
Directory of Open Access Journals (Sweden)
Poonam Chandra
2016-01-01
Full Text Available Gamma-ray bursts (GRBs are extremely energetic events at cosmological distances. They provide unique laboratory to investigate fundamental physical processes under extreme conditions. Due to extreme luminosities, GRBs are detectable at very high redshifts and potential tracers of cosmic star formation rate at early epoch. While the launch of Swift and Fermi has increased our understanding of GRBs tremendously, many new questions have opened up. Radio observations of GRBs uniquely probe the energetics and environments of the explosion. However, currently only 30% of the bursts are detected in radio bands. Radio observations with upcoming sensitive telescopes will potentially increase the sample size significantly and allow one to follow the individual bursts for a much longer duration and be able to answer some of the important issues related to true calorimetry, reverse shock emission, and environments around the massive stars exploding as GRBs in the early Universe.
Imaging assessment of vertebral burst fracture
International Nuclear Information System (INIS)
Ding Jianlin; Liang Lihua; Wang Yujia
2006-01-01
Objective: To investigate the diagnostic value of radiography, CT and MRI in diagnosis of vertebral burst fracture. Methods: 51 patients with vertebral burst fracture were evaluated with X-ray, CT and MRI, including 3 cases in cervical vertebra, 18 cases in thoracic vertebra, and 30 cases in lumbar vertebra. The imaging features were comparatively studied. Results: Radiography showed decreased height of the vertebral body, increased antero-posterior diameter and the transverse diameter, and/or the widened interpedicle distance, the inter-spinous distance, as well as the bony fragment inserted into the vertebral canal in 28 cases(54.90%). X-ray findings similar to the compression fracture were revealed in 20 cases(39.21%). And missed diagnosis was made in 3 cases (5.88%). CT clearly demon-strated the vertebral body vertically or transversely burst crack in 49 cases (96.07%); bony fragment inserted into the vertebral canal and narrowed vertebral canal in 35 cases(68. 62% ); fracture of spinal appendix in 22 cases(43.14%). Meanwhile MRI showed abnormal signals within the spinal cord in 35 cases (68.62%),injured intervertebral disk in 29 cases(56.86% ), extradural hematoma in 12 cases(23.52% ) and torn posterior longitudinal ligament in 6 cases (11.76%). Conclusions: Radiography is the routine examination, while with limited diagnostic value in vertebral burst fracture. These patients who have nervous symptoms with simple compression fracture or unremarkable on X-ray should receive the CT or MRI examination. CT is better than MRI in demonstrating the fracture and the displaced bony fragment, while MRI is superior to CT in showing nervous injuries. CT and MRI will provide comprehensive information guiding clinical treatment of vertebral burst fracture. (authors)
A POSSIBLE CONNECTION BETWEEN FAST RADIO BURSTS AND GAMMA-RAY BURSTS
International Nuclear Information System (INIS)
Zhang, Bing
2014-01-01
The physical nature of fast radio bursts (FRBs), a new type of cosmological transient discovered recently, is not known. It has been suggested that FRBs can be produced when a spinning supra-massive neutron star loses centrifugal support and collapses to a black hole. Here, we suggest that such implosions can happen in supra-massive neutron stars shortly (hundreds to thousands of seconds) after their births, and an observational signature of such implosions may have been observed in the X-ray afterglows of some long and short gamma-ray bursts (GRBs). Within this picture, a small fraction of FRBs would be physically connected to GRBs. We discuss possible multi-wavelength electromagnetic signals and gravitational wave signals that might be associated with FRBs, and propose an observational campaign to unveil the physical nature of FRBs. In particular, we strongly encourage a rapid radio follow-up observation of GRBs starting from 100 s after a GRB trigger
DEPENDENCE OF X-RAY BURST MODELS ON NUCLEAR REACTION RATES
Energy Technology Data Exchange (ETDEWEB)
Cyburt, R. H.; Keek, L.; Schatz, H. [National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI 48824 (United States); Amthor, A. M. [Department of Physics and Astronomy, Bucknell University, Lewisburg, PA 17837 (United States); Heger, A.; Meisel, Z.; Smith, K. [Joint Institute for Nuclear Astrophysics (JINA), Michigan State University, East Lansing, MI 48824 (United States); Johnson, E. [Department of Physics and Astronomy, Michigan State University, East Lansing, MI 48824 (United States)
2016-10-20
X-ray bursts are thermonuclear flashes on the surface of accreting neutron stars, and reliable burst models are needed to interpret observations in terms of properties of the neutron star and the binary system. We investigate the dependence of X-ray burst models on uncertainties in (p, γ ), ( α , γ ), and ( α , p) nuclear reaction rates using fully self-consistent burst models that account for the feedbacks between changes in nuclear energy generation and changes in astrophysical conditions. A two-step approach first identified sensitive nuclear reaction rates in a single-zone model with ignition conditions chosen to match calculations with a state-of-the-art 1D multi-zone model based on the Kepler stellar evolution code. All relevant reaction rates on neutron-deficient isotopes up to mass 106 were individually varied by a factor of 100 up and down. Calculations of the 84 changes in reaction rate with the highest impact were then repeated in the 1D multi-zone model. We find a number of uncertain reaction rates that affect predictions of light curves and burst ashes significantly. The results provide insights into the nuclear processes that shape observables from X-ray bursts, and guidance for future nuclear physics work to reduce nuclear uncertainties in X-ray burst models.
Postillumination burst of carbon dioxide in crassalacean Acid metabolism plants.
Crews, C E; Vines, H M; Black, C C
1975-04-01
Immediately following exposure to light, a postillumination burst of CO(2) has been detected in Crassulacean acid metabolism plants. A detailed study with pineapple (Ananas comosus) leaves indicates that the postillumination burst changes its amplitude and kinetics during the course of a day. In air, the postillumination burst in pineapple leaves generally is exhibited as two peaks. The postillumination burst is sensitive to atmospheric CO(2) and O(2) concentrations as well as to the light intensity under which plants are grown. We propose that the CO(2) released in the first postillumination burst peak is indicative of photorespiration since it is sensitive to either O(2) or CO(2) concentration while the second CO(2) evolution peak is likely due to decarboxylation of organic acids involved in Crassulacean acid metabolism.In marked contrast to other higher plants, the postillumination burst in Crassulacean acid metabolism plants can be equal to or greater than the rate of photosynthesis. Photosynthesis in pineapple leaves also varies throughout a day. Both photosynthesis and the postillumination burst have a daily variation which apparently is a complex function of degree of leaf acidity, growth light intensity, ambient gas phase, and the time a plant has been exposed to a given gas.
Quark-Nova Explosion inside a Collapsar: Application to Gamma Ray Bursts
Directory of Open Access Journals (Sweden)
Rachid Ouyed
2009-01-01
Full Text Available If a quark-nova occurs inside a collapsar, the interaction between the quark-nova ejecta (relativistic iron-rich chunks and the collapsar envelope leads to features indicative of those observed in Gamma Ray Bursts. The quark-nova ejecta collides with the stellar envelope creating an outward moving cap (Γ∼ 1–10 above the polar funnel. Prompt gamma-ray burst emission from internal shocks in relativistic jets (following accretion onto the quark star becomes visible after the cap becomes optically thin. Model features include (i precursor activity (optical, X-ray, γ-ray, (ii prompt γ-ray emission, and (iii afterglow emission. We discuss SN-less long duration GRBs, short hard GRBs (including association and nonassociation with star forming regions, dark GRBs, the energetic X-ray flares detected in Swift GRBs, and the near-simultaneous optical and γ-ray prompt emission observed in GRBs in the context of our model.
Burst mode trigger of STEREO in situ measurements
Jian, L. K.; Russell, C. T.; Luhmann, J. G.; Curtis, D.; Schroeder, P.
2013-06-01
Since the launch of the STEREO spacecraft, the in situ instrument suites have continued to modify their burst mode trigger in order to optimize the collection of high-cadence magnetic field, solar wind, and suprathermal electron data. This report reviews the criteria used for the burst mode trigger and their evolution with time. From 2007 to 2011, the twin STEREO spacecraft observed 236 interplanetary shocks, and 54% of them were captured by the burst mode trigger. The capture rate increased remarkably with time, from 30% in 2007 to 69% in 2011. We evaluate the performance of multiple trigger criteria and investigate why some of the shocks were missed by the trigger. Lessons learned from STEREO are useful for future missions, because the telemetry bandwidth needed to capture the waveforms of high frequency but infrequent events would be unaffordable without an effective burst mode trigger.
Multi-Index Monitoring and Evaluation on Rock Burst in Yangcheng Mine
Tan, Yunliang; Yin, Yanchun; Gu, Shitan; Tian, Zhiwei
2015-01-01
Based on the foreboding information monitoring of the energy released in the developing process of rock burst, prediction system for rock burst can be established. By using microseismic method, electromagnetic radiation method, and drilling bits method, rock burst in Yangcheng Mine was monitored, and a system of multi-index monitoring and evaluation on rock burst was established. Microseismic monitoring and electromagnetic radiation monitoring were early warning method, and drilling bits moni...
Directory of Open Access Journals (Sweden)
Josephine Wesely
2017-01-01
Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.
Optimal detection of burst events in gravitational wave interferometric observatories
International Nuclear Information System (INIS)
Vicere, Andrea
2002-01-01
We consider the problem of detecting a burst signal of unknown shape in the data from gravitational wave interferometric detectors. We introduce a statistic which generalizes the excess power statistic proposed first by Flanagan and Hughes, and then extended by Anderson et al. to the multiple detector case. The statistic that we propose is shown to be optimal for an arbitrary noise spectral characteristic, under the two hypotheses that the noise is Gaussian, albeit colored, and that the prior for the signal is uniform. The statistic derivation is based on the assumption that a signal affects only N parallel samples in the data stream, but that no other information is a priori available, and that the value of the signal at each sample can be arbitrary. This is the main difference from previous works, where different assumptions were made, such as a signal distribution uniform with respect to the metric induced by the (inverse) noise correlation matrix. The two choices are equivalent if the noise is white, and in that limit the two statistics do indeed coincide. In the general case, we believe that the statistic we propose may be more appropriate, because it does not reflect the characteristics of the noise affecting the detector on the supposed distribution of the gravitational wave signal. Moreover, we show that the proposed statistic can be easily implemented in its exact form, combining standard time-series analysis tools which can be efficiently implemented. We generalize this version of an excess power statistic to the multiple detector case, considering first a noise uncorrelated among the different instruments, and then including the effect of correlated noise. We discuss exact and approximate forms of the statistic; the choice depends on the characteristics of the noise and on the assumed length of the burst event. As an example, we show the sensitivity of the network of interferometers to a δ-function burst
Observation of neutron bursts in saturation of titanium with deuterium by means of D2O electrolysis
International Nuclear Information System (INIS)
Artyukhov, V.I.; Bystritskij, V.M.; Gilev, A.I.
1991-01-01
The paper describes a correlation experiment on investigation of low-temperature nuclear dd-fusion during saturation of titanium with deuterium through electrolysis of heavy water D 2 O. The experiments with cathodes of chemically pure titanium and of titanium coated with a 0.4μm nickel layer (mass of titanium 26 g) were carried out. Emission of neutrons in the form of separate bursts was observed in the experiments with the nickel-coated cathode. The neutron emission density in the burst was found to be I n =(3.6±0.9)x10 4 s -1 . 17 refs.; 6 figs
Soudan 2 muons in coincidence with BATSE bursts
International Nuclear Information System (INIS)
DeMuth, D.M.; Marshak, M.L.; Wagner, G.L.
1994-01-01
We explore the possibilities of statistically significant temporal and spatial coincidences between underground muons at Soudan 2 and Gamma Ray Bursts at the GRO-BATSE detector. Our search uses data from the April 91 to March 92 BATSE burst catalog to seek correlations within a 100 second window of coincidence. Sixteen of 180 BATSE triggers have temporally and spatially coincident muons in the Soudan 2 detector. We estimate the chance probability of each coincidence assuming the null hypothesis on the basis of a study of the multiplicities of spatially coincident muons observed over a two day period centered on the time of burst
Bursting Smoke as an Infrared Countermeasure
Amarjit Singh; P. J. Kamale; S. A. Joshi; L. K. Bankar
1998-01-01
This paper describes the experimental setup for the evaluation of bursting smoke for anti-infrared role using SR-5000 spectroradiometer and a source of IR radiation (8-13 micrometer) using cadmium-mercury-telluride (CMI) detector cooled by liquid nitrogen. The particle size and shape of the powders used in the bursting smokes were determined microscopically using Carl Zeiss Jena Neophot- 21. Highest attenuation of 97 -lOO percent was produced for about 12 s using a mixture of bronze fl...
Nature of gamma-ray burst sources
International Nuclear Information System (INIS)
Ventura, J.
1983-01-01
Observational evidence suggests that gamma ray bursts have a local galactic origin involving neutron stars. In this light we make a critical review of physics of the thermonuclear runaway model placing emphasis on self-consistency. We further show that some of the proposed models can be observationally excluded in the light of existing data from the Einstein Observatory. The possibility of gamma bursts arising in low mass binaries is finally discussed in the light of evolutionary scenarios leading to low luminosity systems
International Nuclear Information System (INIS)
Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.
1986-01-01
Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells
Bursting oscillations, bifurcation and synchronization in neuronal systems
Energy Technology Data Exchange (ETDEWEB)
Wang Haixia [School of Science, Nanjing University of Science and Technology, Nanjing 210094 (China); Wang Qingyun, E-mail: drwangqy@gmail.com [Department of Dynamics and Control, Beihang University, Beijing 100191 (China); Lu Qishao [Department of Dynamics and Control, Beihang University, Beijing 100191 (China)
2011-08-15
Highlights: > We investigate bursting oscillations and related bifurcation in the modified Morris-Lecar neuron. > Two types of fast-slow bursters are analyzed in detail. > We show the properties of some crucial bifurcation points. > Synchronization transition and the neural excitability are explored in the coupled bursters. - Abstract: This paper investigates bursting oscillations and related bifurcation in the modified Morris-Lecar neuron. It is shown that for some appropriate parameters, the modified Morris-Lecar neuron can exhibit two types of fast-slow bursters, that is 'circle/fold cycle' bursting and 'subHopf/homoclinic' bursting with class 1 and class 2 neural excitability, which have different neuro-computational properties. By means of the analysis of fast-slow dynamics and phase plane, we explore bifurcation mechanisms associated with the two types of bursters. Furthermore, the properties of some crucial bifurcation points, which can determine the type of the burster, are studied by the stability and bifurcation theory. In addition, we investigate the influence of the coupling strength on synchronization transition and the neural excitability in two electrically coupled bursters with the same bursting type. More interestingly, the multi-time-scale synchronization transition phenomenon is found as the coupling strength varies.
Instrument Response Modeling and Simulation for the GLAST Burst Monitor
International Nuclear Information System (INIS)
Kippen, R. M.; Hoover, A. S.; Wallace, M. S.; Pendleton, G. N.; Meegan, C. A.; Fishman, G. J.; Wilson-Hodge, C. A.; Kouveliotou, C.; Lichti, G. G.; Kienlin, A. von; Steinle, H.; Diehl, R.; Greiner, J.; Preece, R. D.; Connaughton, V.; Briggs, M. S.; Paciesas, W. S.; Bhat, P. N.
2007-01-01
The GLAST Burst Monitor (GBM) is designed to provide wide field of view observations of gamma-ray bursts and other fast transient sources in the energy range 10 keV to 30 MeV. The GBM is composed of several unshielded and uncollimated scintillation detectors (twelve NaI and two BGO) that are widely dispersed about the GLAST spacecraft. As a result, reconstructing source locations, energy spectra, and temporal properties from GBM data requires detailed knowledge of the detectors' response to both direct radiation as well as that scattered from the spacecraft and Earth's atmosphere. This full GBM instrument response will be captured in the form of a response function database that is derived from computer modeling and simulation. The simulation system is based on the GEANT4 Monte Carlo radiation transport simulation toolset, and is being extensively validated against calibrated experimental GBM data. We discuss the architecture of the GBM simulation and modeling system and describe how its products will be used for analysis of observed GBM data. Companion papers describe the status of validating the system
Spikes matter for phase-locked bursting in inhibitory neurons
Jalil, Sajiya; Belykh, Igor; Shilnikov, Andrey
2012-03-01
We show that inhibitory networks composed of two endogenously bursting neurons can robustly display several coexistent phase-locked states in addition to stable antiphase and in-phase bursting. This work complements and enhances our recent result [Jalil, Belykh, and Shilnikov, Phys. Rev. EPLEEE81539-375510.1103/PhysRevE.81.045201 81, 045201(R) (2010)] that fast reciprocal inhibition can synchronize bursting neurons due to spike interactions. We reveal the role of spikes in generating multiple phase-locked states and demonstrate that this multistability is generic by analyzing diverse models of bursting networks with various fast inhibitory synapses; the individual cell models include the reduced leech heart interneuron, the Sherman model for pancreatic beta cells, and the Purkinje neuron model.
Recent results from the gamma-ray burst studies in the KONUS experiment
International Nuclear Information System (INIS)
Mazets, E.P.; Golenetskii, S.V.
1981-01-01
Observations of 85 gamma bursts by the KONUS instruments on the Venera 11 and Venera 12 spacecraft in the period September 1978 to May 1979 inclusive have provided proof of a galactic localization of the gamma-burst sources based on an analysis of the log N-log S plot and the revealed anisotropy in the angular distribution of sources over the celestial sphere. Evaluation of the energy released in the sources yields 10 40 -10 41 erg. There apparently exist several types of gamma bursts differing in time profile, duration and shape of their energy spectrum. In some cases, extensive evolution of the energy spectrum is observed during a burst. The discovery of a flaring X-ray pulsar in Dorado has provided the first observational evidence for a connection of gamma bursts with neutron stars. Repeated short bursts from this source have revealed for the first time the recurrent features of this phenomenon. Repeated bursts have been detected from one more source in the short burst class. The data obtained thus far impose a number of restrictions on the applicability of many theoretical suggestions concerning the nature of the gamma bursts. The most plausible model for the gamma-burst source appears to be a binary with a neutron star with strongly non-stationary accretion involving, possibly, non-stationary thermonuclear fusion of matter falling onto the surface of a degenerate star. (orig.)
FAST TCP over optical burst switched networks: Modeling and stability analysis
Shihada, Basem; El-Ferik, Sami; Ho, Pin-Han
2013-01-01
congestion-control mechanism in bufferless Optical Burst Switched Networks (OBS). The paper first shows that random burst contentions are essential to stabilize the network, but cause throughput degradation in FAST TCP flows when a burst with all the packets
Very high-energy gamma rays from gamma-ray bursts.
Chadwick, Paula M
2007-05-15
Very high-energy (VHE) gamma-ray astronomy has undergone a transformation in the last few years, with telescopes of unprecedented sensitivity having greatly expanded the source catalogue. Such progress makes the detection of a gamma-ray burst at the highest energies much more likely than previously. This paper describes the facilities currently operating and their chances for detecting gamma-ray bursts, and reviews predictions for VHE gamma-ray emission from gamma-ray bursts. Results to date are summarized.
FPGA Implementation of Burst-Mode Synchronization for SOQSPK-TG
2014-06-01
is normalized to π. The proposed burst-mode architecture is written in VHDL and verified using Modelsim. The VHDL design is implemented on a Xilinx...Document Number: SET 2014-0043 412TW-PA-14298 FPGA Implementation of Burst-Mode Synchronization for SOQSPK-TG June 2014 Final Report Test...To) 9/11 -- 8/14 4. TITLE AND SUBTITLE FPGA Implementation of Burst-Mode Synchronization for SOQSPK-TG 5a. CONTRACT NUMBER: W900KK-11-C-0032 5b
ESA's Integral detects closest cosmic gamma-ray burst
2004-08-01
5 August 2004 A gamma-ray burst detected by ESA's Integral gamma-ray observatory on 3 December 2003 has been thoroughly studied for months by an armada of space and ground-based observatories. Astronomers have now concluded that this event, called GRB 031203, is the closest cosmic gamma-ray burst on record, but also the faintest. This also suggests that an entire population of sub-energetic gamma-ray bursts has so far gone unnoticed... Gamma ray burst model hi-res Size hi-res: 22 KB Credits: CXC/M. Weiss Artist impression of a low-energy gamma-ray burst This illustration describes a model for a gamma-ray burst, like the one detected by Integral on 3 December 2003 (GRB 031203). A jet of high-energy particles from a rapidly rotating black hole interacts with surrounding matter. Observations with Integral on 3 December 2003 and data on its afterglow, collected afterwards with XMM-Newton, Chandra and the Very Large Array telescope, show that GRB 031203 radiated only a fraction of the energy of normal gamma-ray bursts. Like supernovae, gamma-ray bursts are thought to be produced by the collapse of the core of a massive star. However, while the process leading to supernovae is relatively well understood, astronomers still do not know what happens when a core collapses to form a black hole. The discovery of 'under-energetic' gamma-ray bursts, like GRB 031203, should provide valuable clues as to links between supernovae, black holes and gamma-ray bursts. Lo-res JPG (22 Kb) Hi-res TIFF (5800 Kb) Cosmic gamma-ray bursts (GRBs) are flashes of gamma rays that can last from less than a second to a few minutes and occur at random positions in the sky. A large fraction of them is thought to result when a black hole is created from a dying star in a distant galaxy. Astronomers believe that a hot disc surrounding the black hole, made of gas and matter falling onto it, somehow emits an energetic beam parallel to the axis of rotation. According to the simplest picture, all GRBs
Lebon, Benoit; Nguyen, Minh Quan; Peixinho, Jorge; Shadloo, Mostafa Safdari; Hadjadj, Abdellah
2018-03-01
We report the results of a combined experimental and numerical study of specific finite-amplitude disturbances for transition to turbulence in the flow through a circular pipe with a sudden expansion. The critical amplitude thresholds for localized turbulent patch downstream of the expansion scale with the Reynolds number with a power law exponent of -2.3 for experiments and -2.8 for simulations. A new mechanism for the periodic bursting of the recirculation region is uncovered where the asymmetric recirculation flow develops a periodic dynamics: a secondary recirculation breaks the symmetry along the pipe wall and bursts into localized turbulence, which travels downstream and relaminarises. Flow visualizations show a simple flow pattern of three waves forming, growing, and bursting.
Study on Monitoring Rock Burst through Drill Pipe Torque
Directory of Open Access Journals (Sweden)
Zhonghua Li
2015-01-01
Full Text Available This paper presents a new method to identify the danger of rock burst from the response of drill pipe torque during drilling process to overcome many defects of the conventional volume of drilled coal rubble method. It is based on the relationship of rock burst with coal stress and coal strength. Through theoretic analysis, the change mechanism of drill pipe torque and the relationship of drill pipe torque with coal stress, coal strength, and drilling speed are investigated. In light of the analysis, a new device for testing drill pipe torque is developed and a series of experiments is performed under different conditions; the results show that drill pipe torque linearly increases with the increase of coal stress and coal strength; the faster the drilling speed, the larger the drill pipe torque, and vice versa. When monitoring rock burst by drill pipe torque method, the index of rock burst is regarded as a function in which coal stress index and coal strength index are principal variables. The results are important for the forecast of rock burst in coal mine.
Analysis of Burst Observations by GLAST's LAT Detector
International Nuclear Information System (INIS)
Band, David L.; Digel, Seth W.
2004-01-01
Analyzing data from GLAST's Large Area Telescope (LAT) will require sophisticated techniques. The PSF and effective area are functions of both photon energy and the position in the field-of-view. During most of the mission the observatory will survey the sky continuously, and thus, the LAT will detect each count from a source at a different detector orientation; each count requires its own response function! The likelihood as a function of celestial position and photon energy will be the foundation of the standard analysis techniques. However, the 20 MeV-300 GeV emission at the time of the ∼ 100 keV burst emission (timescale of ∼ 10 s) can be isolated and analyzed because essentially no non-burst counts are expected within a PSF radius of the burst location during the burst. Both binned and unbinned (in energy) spectral fitting will be possible. Longer timescale afterglow emission will require the likelihood analysis that will be used for persistent sources
Analyses of resource reservation schemes for optical burst switching networks
Solanska, Michaela; Scholtz, Lubomir; Ladanyi, Libor; Mullerova, Jarmila
2017-12-01
With growing demands of Internet Protocol services for transmission capacity and speed, the Optical Burst Switching presents the solution for future high-speed optical networks. Optical Burst Switching is a technology for transmitting large amounts of data bursts through a transparent optical switching network. To successfully transmit bursts over OBS network and reach the destination node, resource reservation schemes have to be implemented to allocate resources and configure optical switches for that burst at each node. The one-way resource reservation schemes and the performance evaluation of reservation schemes are presented. The OBS network model is performed using OMNeT++ simulation environment. During the reservation of network resources, the optical cross-connect based on semiconductor optical amplifier is used as the core node. Optical switches based on semiconductor optical amplifiers are a promising technology for high-speed optical communication networks.
On the Directivity of Low-Frequency Type IV Radio Bursts
Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.
2016-01-01
An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.
Understanding the Generation of Network Bursts by Adaptive Oscillatory Neurons
Directory of Open Access Journals (Sweden)
Tanguy Fardet
2018-02-01
Full Text Available Experimental and numerical studies have revealed that isolated populations of oscillatory neurons can spontaneously synchronize and generate periodic bursts involving the whole network. Such a behavior has notably been observed for cultured neurons in rodent's cortex or hippocampus. We show here that a sufficient condition for this network bursting is the presence of an excitatory population of oscillatory neurons which displays spike-driven adaptation. We provide an analytic model to analyze network bursts generated by coupled adaptive exponential integrate-and-fire neurons. We show that, for strong synaptic coupling, intrinsically tonic spiking neurons evolve to reach a synchronized intermittent bursting state. The presence of inhibitory neurons or plastic synapses can then modulate this dynamics in many ways but is not necessary for its appearance. Thanks to a simple self-consistent equation, our model gives an intuitive and semi-quantitative tool to understand the bursting behavior. Furthermore, it suggests that after-hyperpolarization currents are sufficient to explain bursting termination. Through a thorough mapping between the theoretical parameters and ion-channel properties, we discuss the biological mechanisms that could be involved and the relevance of the explored parameter-space. Such an insight enables us to propose experimentally-testable predictions regarding how blocking fast, medium or slow after-hyperpolarization channels would affect the firing rate and burst duration, as well as the interburst interval.
Results of using engineering and technological measures for rock burst prevention. [USSR
Energy Technology Data Exchange (ETDEWEB)
Kulikov, A P; Nechaev, A V; Khmara, O I
1980-01-01
The paper evaluates methods for rock burst forecasting and rock burst prevention used in the Donbass, Kuzbass, Karaganda and Pechora basins. Forecasting methods are based on measuring the initial velocity of gas flow from test boreholes and/or quantity ratio of drillings leaving a test borehole and monitoring seismoacoustic signals. Number of working faces at which each of the methods for rock burst forecasting is used is given. Methods for rock burst prevention are comparatively evaluated: explosive fracturing of rocks in seam roof or seam floor, fluid injection (water and surfactants), drilling destressing boreholes, cutting destressing slots using cutting machines or water jets, mining protective coal seams first for reducing rock burst hazard in protected coal seams, using narrow web coal cutter loaders, remote control of coal cutters at working faces with extremely high rock burst hazard, using mining schemes which reduce rock burst hazards (e.g. long pillar mining system). From 1976 to 1979 number of rock bursts in underground coal mines in the USSR decreased by 5 times in comparison to the period 1961 to 1965. (3 refs.) (In Russian)
High repetition rate burst-mode spark gap
International Nuclear Information System (INIS)
Faltens, A.; Reginato, L.; Hester, R.; Chesterman, A.; Cook, E.; Yokota, T.; Dexter, W.
1978-01-01
Results are presented on the design and testing of a pressurized gas blown spark gap switch capable of high repetition rates in a burst mode of operation. The switch parameters which have been achieved are as follows: 220-kV, 42-kA, a five pulse burst at 1-kHz, 12-ns risetime, 2-ns jitter at a pulse width of 50-ns
The many phases of gamma-ray burst afterglows
Leventis, K.
2013-01-01
Gamma-ray bursts are the brightest sources in the universe. Their afterglows have been observed for about 15 years now, and their study has greatly advanced our understanding of these, mysterious until recently, events. In a way, gamma-ray bursts can be seen as huge cosmic bombs which convert
Localised Microwave Bursts During ELMs on MAST
Directory of Open Access Journals (Sweden)
Freethy Simon
2015-01-01
Full Text Available Bursts of microwave emission are observed during ELM events on the Mega Ampère Spherical Tokamak. In agreement with observations on other machines, these bursts are up to 3 orders of magnitude more intense than the thermal background, but are electron cyclotron in nature. The peak in microwave emission is ~20μ before the peak in midplane Dα emission. Using the Synthetic Aperture Microwave Imaging radiometer, we are able to demonstrate that these bursts are often highly spatially localised and preferentially occur at the tokamak midplane. It is hypothesised that the localisation is a result of Doppler resonance broadening for electron Bernstein waves and the high perpendicular electron energies could be the result of pitch angle scattering in high collisionality regions of the plasma.
BudBurst Buddies: A New Tool for Engaging the Youngest Citizen Scientists
Gardiner, L. S.; Henderson, S.; Ward, D.
2010-12-01
BudBurst Buddies (www.budburstbuddies.org) introduces elementary school age children to the science of observing plants and the timing of phenological (life cycle) events. BudBurst Buddies is a new part of the Project BudBurst national citizen science initiative (www.budburst.org), which allows individuals to engage in the scientific process, contributing to a better understanding of climate change while increasing public awareness of phenology and the impacts of climate change on plants. As a first step towards engaging the next generation of citizen scientists, BudBurst Buddies provides the opportunity for children to gain experience with scientific research and increases awareness of how plants change throughout the year. Children can participate in BudBurst Buddies on their own, with their families, or in formal or informal education settings. Each child who participates creates a journal about a plant of his or her choosing, makes observations of the plant over the growing season and submits findings online, earning an official BudBurst Buddies certificate. An online storybook for kids tells how two children, Lily and Sage, observed plants in their neighborhood and became BudBurst Buddies. This presentation will provide an overview of the BudBurst Buddies newly developed resources. BudBurst Buddies is a part of Project BudBurst, a national citizen science program coordinated by the National Ecological Observatory Network (NEON) and the Chicago Botanic Garden. Funding for this resource was provided by NEON, NSF, NASA, and the National Geographic Education Foundation.
The galactic position dependence of fast radio bursts and the discovery of FRB011025
Energy Technology Data Exchange (ETDEWEB)
Burke-Spolaor, Sarah [California Institute of Technology, 1200 E California Blvd, Pasadena, CA (United States); Bannister, Keith W., E-mail: sarahbspolaor@gmail.com [CSIRO Astronomy and Space Sciences, P.O. Box 76, Epping NSW 1710 (Australia)
2014-09-01
We report the detection of a dispersed fast radio burst (FRB) in archival intermediate-latitude Parkes Radio Telescope data. The burst appears to be of the same physical origin as the four purported extragalactic FRBs reported by Thornton et al. This burst's arrival time precedes the Thornton et al. bursts by 10 years. We consider that this survey, and many other archival low-latitude (|gb| < 30°) pulsar surveys, have been searched for FRBs but produced fewer detections than the comparatively brief Thornton et al. search. Such a rate dependence on Galactic position could provide critical supporting evidence for an extragalactic origin for FRBs. To test this, we form an analytic expression to account for Galactic position and survey setup in FRB rate predictions. Employing a sky temperature, scattering, and dispersion model of the Milky Way, we compute the expected number of FRBs if they are isotropically distributed on the sky with respect to the Galactic position (i.e., local), and if they are of extragalactic origin. We demonstrate that the relative detection rates reject a local origin with a confidence of 99.96% (∼3.6σ). The extragalactic predictions provide a better agreement; however, there are still strong discrepancies with the low-latitude detection rate at a confidence of 99.69% (∼2.9σ). However, for the extragalactic population, the differences in predicted versus detected population may be accounted for by a number of factors, which we discuss.
The galactic position dependence of fast radio bursts and the discovery of FRB011025
International Nuclear Information System (INIS)
Burke-Spolaor, Sarah; Bannister, Keith W.
2014-01-01
We report the detection of a dispersed fast radio burst (FRB) in archival intermediate-latitude Parkes Radio Telescope data. The burst appears to be of the same physical origin as the four purported extragalactic FRBs reported by Thornton et al. This burst's arrival time precedes the Thornton et al. bursts by 10 years. We consider that this survey, and many other archival low-latitude (|gb| < 30°) pulsar surveys, have been searched for FRBs but produced fewer detections than the comparatively brief Thornton et al. search. Such a rate dependence on Galactic position could provide critical supporting evidence for an extragalactic origin for FRBs. To test this, we form an analytic expression to account for Galactic position and survey setup in FRB rate predictions. Employing a sky temperature, scattering, and dispersion model of the Milky Way, we compute the expected number of FRBs if they are isotropically distributed on the sky with respect to the Galactic position (i.e., local), and if they are of extragalactic origin. We demonstrate that the relative detection rates reject a local origin with a confidence of 99.96% (∼3.6σ). The extragalactic predictions provide a better agreement; however, there are still strong discrepancies with the low-latitude detection rate at a confidence of 99.69% (∼2.9σ). However, for the extragalactic population, the differences in predicted versus detected population may be accounted for by a number of factors, which we discuss.
Progress with the Konus-W gamma-ray burst spectrometer on GGS-Wind
International Nuclear Information System (INIS)
Mazets, E. P.; Aptekar, R. L.; Frederiks, D. D.; Golenetskii, S. V.; Ilynskii, V. N.; Terekhov, M. M.; Cline, T. L.; Butterworth, P. S.; Stilwell, D. E.
1996-01-01
The cosmic gamma-ray burst spectrometer Konus-W has been successfully making observations for nearly one year, since the launch of the GGS-Wind spacecraft. The instrument consists of two large scintillator units of size and shape very nearly the same as the spectroscopy detectors on CGRO BATSE. These face towards the ecliptic poles so as to survey the sky in a moderately uniform fashion. At least 114 gamma ray bursts have triggered the system in the first 330 days of operation, yielding detailed time histories and spectra. A large number of additional events are seen in the background mode at much coarser resolution. These observations can be combined with those of the Interplanetary Network to reduce the total area of the segmented annular source fields derived from several degrees to about one degree in length, although the data cannot obtained from this spacecraft in the rapid turnaround mode needed to benefit the BACODINE system. The Konus spectra can be summarized presently as providing little indication of the frequent occurrence of major spectral features
International Nuclear Information System (INIS)
Dingle, B.; Carpenter, D.L.
1981-01-01
A new type of wave-induced electron precipitation event has been identified. During observations at conjugate stations Siple, Antarctica, and Roberval, Canada (L-4.2), VLF noise bursts were found to be associated on a one-to-one basis with amplitude perturbations of subionispheric radio propagation. The amplitude perturbations are attributed to patches of enhanced ionization that extended below approx.80 km in the nighttime ionosphere and that were produced by precipitating electron bursts. Similar amplitude perturbations seen previously were correlated with whistlers that propagated within the plasmasphere. For the new events the driving waves were structured collections of rising elements that propagated just beyond the plasmapause at roughly 5-min intervals over a several-hour period. These noise bursts were of relatively long duration (approx.10 s) and strong intensity (inferred to be >30 pT at the equator). Triggering of the noise bursts appears to have been mostly by whistlers but changed in character with time. Some later bursts had narrowband precursors at constant frequencies possibly locked to power line harmonic radiation. The burst initiation characteristics suggest the existence of a variable threshold for rapid temporal growth in the magnetosphere controlled by the trapped electron dynamics. The temporal signatures of the amplitude perturbations show that precipitation was maintained over multiple bounces of the trapped magnetospheric electrons. In some cases these signatures include a new undershoot effect during the recovery phase lasting 2--5 min. This effect may have been related to cutoff of background drizzle precipitation. Precipitation effects were observed on both long (approx.10 Mm) and short (approx.1/2 Mm) subionospheric paths and were monitored simultaneously at the conjugate stations. Similarities in the perturbation signatures on long and short paths suggest that the form of the signatures was governed by ionospheric changes
Magnetized hypermassive neutron-star collapse: a central engine for short gamma-ray bursts.
Shibata, Masaru; Duez, Matthew D; Liu, Yuk Tung; Shapiro, Stuart L; Stephens, Branson C
2006-01-27
A hypermassive neutron star (HMNS) is a possible transient formed after the merger of a neutron-star binary. In the latest axisymmetric magnetohydrodynamic simulations in full general relativity, we find that a magnetized HMNS undergoes "delayed" collapse to a rotating black hole (BH) as a result of angular momentum transport via magnetic braking and the magnetorotational instability. The outcome is a BH surrounded by a massive, hot torus with a collimated magnetic field. The torus accretes onto the BH at a quasisteady accretion rate [FORMULA: SEE TEXT]; the lifetime of the torus is approximately 10 ms. The torus has a temperature [FORMULA: SEE TEXT], leading to copious ([FORMULA: SEE TEXT]) thermal radiation that could trigger a fireball. Therefore, the collapse of a HMNS is a promising scenario for generating short-duration gamma-ray bursts and an accompanying burst of gravitational waves and neutrinos.
Probing the Cosmic Gamma-Ray Burst Rate with Trigger Simulations of the Swift Burst Alert Telescope
Lien, Amy; Sakamoto, Takanori; Gehrels, Neil; Palmer, David M.; Barthelmy, Scott D.; Graziani, Carlo; Cannizzo, John K.
2013-01-01
The gamma-ray burst (GRB) rate is essential for revealing the connection between GRBs, supernovae and stellar evolution. Additionally, the GRB rate at high redshift provides a strong probe of star formation history in the early universe. While hundreds of GRBs are observed by Swift, it remains difficult to determine the intrinsic GRB rate due to the complex trigger algorithm of Swift. Current studies of the GRB rate usually approximate the Swift trigger algorithm by a single detection threshold. However, unlike the previously own GRB instruments, Swift has over 500 trigger criteria based on photon count rate and additional image threshold for localization. To investigate possible systematic biases and explore the intrinsic GRB properties, we develop a program that is capable of simulating all the rate trigger criteria and mimicking the image threshold. Our simulations show that adopting the complex trigger algorithm of Swift increases the detection rate of dim bursts. As a result, our simulations suggest bursts need to be dimmer than previously expected to avoid over-producing the number of detections and to match with Swift observations. Moreover, our results indicate that these dim bursts are more likely to be high redshift events than low-luminosity GRBs. This would imply an even higher cosmic GRB rate at large redshifts than previous expectations based on star-formation rate measurements, unless other factors, such as the luminosity evolution, are taken into account. The GRB rate from our best result gives a total number of 4568 +825 -1429 GRBs per year that are beamed toward us in the whole universe.
Spatial variation in automated burst suppression detection in pharmacologically induced coma.
An, Jingzhi; Jonnalagadda, Durga; Moura, Valdery; Purdon, Patrick L; Brown, Emery N; Westover, M Brandon
2015-01-01
Burst suppression is actively studied as a control signal to guide anesthetic dosing in patients undergoing medically induced coma. The ability to automatically identify periods of EEG suppression and compactly summarize the depth of coma using the burst suppression probability (BSP) is crucial to effective and safe monitoring and control of medical coma. Current literature however does not explicitly account for the potential variation in burst suppression parameters across different scalp locations. In this study we analyzed standard 19-channel EEG recordings from 8 patients with refractory status epilepticus who underwent pharmacologically induced burst suppression as medical treatment for refractory seizures. We found that although burst suppression is generally considered a global phenomenon, BSP obtained using a previously validated algorithm varies systematically across different channels. A global representation of information from individual channels is proposed that takes into account the burst suppression characteristics recorded at multiple electrodes. BSP computed from this representative burst suppression pattern may be more resilient to noise and a better representation of the brain state of patients. Multichannel data integration may enhance the reliability of estimates of the depth of medical coma.
Method of separation of celestial gamma-ray bursts from solar flares
International Nuclear Information System (INIS)
Chuang, K.W.; White, R.S.; Klebesadel, R.W.; Laros, J.G.
1991-01-01
We recently discovered 217 ''new'' celestial gamma-ray burst candidates from the ''new'' burst search of the PVO real time data base. 1 The burst search covered the time period from September 1978 to July 1988. Sixty were confirmed by at lest on other spacecraft, e.g., ISEE-3, V-11, V-12, etc. None triggered the PVO high time resolution memory. In this paper we describe a new algorithm based ont eh relationship between time width T w and hardness ratio HR, to distinguish cosmic gamma-ray bursts from solar flares without knowing the directions of the events. The criteria for identification as a gamma-ray burst candidate are: If T ww ≤a then HR≥bT w , or T w >a then HR>c. Otherwise, the event is a solar flare candidate. Here, a, b, and c are parameter which differ for different gamma-ray burst detectors. For PVO, a=18.8 s, b=(1.38/18.8) s -1 , and c=1.38. This algorithm was tested with 83 triggered and 60 nontriggered confirmed gamma-ray burst and 30 confirmed solar flares from PVO
Elastic-plastic failure analysis of pressure burst tests of thin toroidal shells
International Nuclear Information System (INIS)
Jones, D.P.; Holliday, J.E.; Larson, L.D.
1998-07-01
This paper provides a comparison between test and analysis results for bursting of thin toroidal shells. Testing was done by pressurizing two toroidal shells until failure by bursting. An analytical criterion for bursting is developed based on good agreement between structural instability predicted by large strain-large displacement elastic-plastic finite element analysis and observed burst pressure obtained from test. The failures were characterized by loss of local stability of the membrane section of the shells consistent with the predictions from the finite element analysis. Good agreement between measured and predicted burst pressure suggests that incipient structural instability as calculated by an elastic-plastic finite element analysis is a reasonable way to calculate the bursting pressure of thin membrane structures
BALLERINA - Pirouettes in search of gamma burst sources
International Nuclear Information System (INIS)
Brandt, Soeren; Lund, Niels
1999-01-01
The cosmological origin of gamma-ray bursts (GRBs) has now been established with reasonable certainty. Many more bursts will need to be studied to establish the typical distance scale, and to map out the large variability in properties, which have been indicated by the first handful of events. We are proposing BALLERINA, a small satellite to provide accurate gamma burst positions at a rate an order of magnitude larger than from Beppo-SAX. On the experimental side, it remains a challenge to ensure the earliest detection of the X-ray afterglow. The mission proposed here allows for the first time systematic studies of the soft X-ray emission in the time interval from only a few minutes after the onset of the burst to a few hours later. In addition to positions of GRBs with accuracy better than 1'reported to the ground within a few minutes of the burst, essential for follow-up work, BALLERINA will on its own provide observations in an uncharted region of parameter space. Secondary objectives of the BALLERINA mission includes observations of the earliest phases of the outbursts of X-ray novae and other X-ray transients. BALLERINA is one of four missions currently under study for the Danish Small Satellite Program. The selection will be announced in 1999 for a planned launch in 2002-2003
Heating of aluminum by SPR-III burst
International Nuclear Information System (INIS)
Judd, S.V.
1987-01-01
Real time temperature measurements were made on an aluminum cylinder exposed to radiation bursts at SPR-III at neutron levels from 10 11 cm -2 to 4.5 x 10 14 cm -2 . Precision thermistors and high speed A/D converters were used to measure temperature with .0025 degree C resolution at 20ms intervals following the burst. Temperature data is presented as a function of neutron fluence
Detection Techniques of Microsecond Gamma-Ray Bursts Using Ground-based Telescopes
International Nuclear Information System (INIS)
Krennrich, F.; Le Bohec, S.; Weekes, T. C.
2000-01-01
Gamma-ray observations above 200 MeV are conventionally made by satellite-based detectors. The EGRET detector on the Compton Gamma Ray Observatory has provided good sensitivity for the detection of bursts lasting for more than 200 ms. Theoretical predictions of high-energy gamma-ray bursts produced by quantum mechanical decay of primordial black holes (Hawking) suggest the emission of bursts on shorter timescales. The final stage of a primordial black hole results in a burst of gamma rays, peaking around 250 MeV and lasting for 1/10 of a microsecond or longer depending on particle physics. In this work we show that there is an observational window using ground-based imaging Cerenkov detectors to measure gamma-ray burst emission at energies E>200 MeV. This technique, with a sensitivity for bursts lasting nanoseconds to several microseconds, is based on the detection of multiphoton-initiated air showers. (c) (c) 2000. The American Astronomical Society
FAST TCP over optical burst switched networks: Modeling and stability analysis
Shihada, Basem
2013-04-01
FAST TCP is important for promoting data-intensive applications since it can cleverly react to both packet loss and delay for detecting network congestion. This paper provides a continuous time model and extensive stability analysis of FAST TCP congestion-control mechanism in bufferless Optical Burst Switched Networks (OBS). The paper first shows that random burst contentions are essential to stabilize the network, but cause throughput degradation in FAST TCP flows when a burst with all the packets from a single round is dropped. Second, it shows that FAST TCP is vulnerable to burst delay and fails to detect network congestion due to the little variation of round-trip time, thus unstable. Finally it shows that introducing extra delays by implementing burst retransmission stabilizes FAST TCP over OBS. The paper proves that FAST TCP is not stable over barebone OBS. However, it is locally, exponentially, and asymptotically stable over OBS with burst retransmission.
Project BudBurst: Continental-scale citizen science for all seasons
Henderson, S.; Newman, S. J.; Ward, D.; Havens-Young, K.; Alaback, P.; Meymaris, K.
2011-12-01
Project BudBurst's (budburst.org) recent move to the National Ecological Observatory Network (NEON) has benefitted both programs. NEON has been able to use Project BudBurst as a testbed to learn best practices, network with experts in the field, and prototype potential tools for engaging people in continental-scale ecology as NEON develops its citizen science program. Participation in Project BudBurst has grown significantly since the move to NEON. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide the opportunity for students and interested laypersons to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants at a continental-scale; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch in February, this on-line educational and data-entry program, engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent. Thus far, thousands of participants from all 50 states have submitted data. This presentation will provide an overview of Project BudBurst and will report on the results of the 2010 field campaign and discuss plans to expand Project BudBurst in 2012 including the use of mobile phones applications for data collection and reporting from the field. Project BudBurst is co-managed by the National Ecological Observatory Network and the Chicago
Directory of Open Access Journals (Sweden)
Sreoshi Chatterjee
Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.
Production of fine structures in type III solar radio bursts due to turbulent density profiles
International Nuclear Information System (INIS)
Loi, Shyeh Tjing; Cairns, Iver H.; Li, Bo
2014-01-01
Magnetic reconnection events in the corona release energetic electron beams along open field lines, and the beams generate radio emission at multiples of the electron plasma frequency f p to produce type III solar radio bursts. Type III bursts often exhibit irregularities in the form of flux modulations with frequency and/or local temporal advances and delays, and a type IIIb burst represents the extreme case where a type III burst is fragmented into a chain of narrowband features called striae. Remote and in situ spacecraft measurements have shown that density turbulence is ubiquitous in the corona and solar wind, and often exhibits a Kolmogorov power spectrum. In this work, we numerically investigate the effects of one-dimensional macroscopic density turbulence (along the beam direction) on the behavior of type III bursts, and find that this turbulence produces stria-like fine structures in the dynamic spectra of both f p and 2 f p radiation. Spectral and temporal fine structures in the predicted type III emission are produced by variations in the scattering path lengths and group speeds of radio emission, and in the locations and sizes of emitting volumes. Moderate turbulence levels yield flux enhancements with much broader half-power bandwidths in f p than 2 f p emission, possibly explaining the often observed type IIIb-III harmonic pairs as being where intensifications in 2 f p radiation are not resolved observationally. Larger turbulence levels producing trough-peak regions in the plasma density profile may lead to broader, resolvable intensifications in 2 f p radiation, which may account for the type IIIb-IIIb pairs that are sometimes observed.
Burst Mode Composite Photography for Dynamic Physics Demonstrations
Lincoln, James
2018-01-01
I am writing this article to raise awareness of burst mode photography as a fun and engaging way for teachers and students to experience physics demonstration activities. In the context of digital photography, "burst mode" means taking multiple photographs per second, and this is a feature that now comes standard on most digital…
Reliability of COPVs Accounting for Margin of Safety on Design Burst
Murthy, Pappu L.N.
2012-01-01
In this paper, the stress rupture reliability of Carbon/Epoxy Composite Overwrapped Pressure Vessels (COPVs) is examined utilizing the classic Phoenix model and accounting for the differences between the design and the actual burst pressure, and the liner contribution effects. Stress rupture life primarily depends upon the fiber stress ratio which is defined as the ratio of stress in fibers at the maximum expected operating pressure to actual delivered fiber strength. The actual delivered fiber strength is calculated using the actual burst pressures of vessels established through burst tests. However, during the design phase the actual burst pressure is generally not known and to estimate the reliability of the vessels calculations are usually performed based upon the design burst pressure only. Since the design burst is lower than the actual burst, this process yields a much higher value for the stress ratio and consequently a conservative estimate for the reliability. Other complications arise due to the fact that the actual burst pressure and the liner contributions have inherent variability and therefore must be treated as random variables in order to compute the stress rupture reliability. Furthermore, the model parameters, which have to be established based on stress rupture tests of subscale vessels or coupons, have significant variability as well due to limited available data and hence must be properly accounted for. In this work an assessment of reliability of COPVs including both parameter uncertainties and physical variability inherent in liner and overwrap material behavior is made and estimates are provided in terms of degree of uncertainty in the actual burst pressure and the liner load sharing.
Different Types of X-Ray Bursts from GRS 1915+105 and Their Origin
Yadav, J. S.; Rao, A. R.; Agrawal, P. C.; Paul, B.; Seetha, S.; Kasturirangan, K.
1999-06-01
We report X-ray observations of the Galactic X-ray transient source GRS 1915+105 with the pointed proportional counters of the Indian X-ray Astronomy Experiment (IXAE) onboard the Indian satellite IRS-P3, which show remarkable richness in temporal variability. The observations were carried out on 1997 June 12-29 and August 7-10, in the energy range of 2-18 keV and revealed the presence of very intense X-ray bursts. All the observed bursts have a slow exponential rise, a sharp linear decay, and broadly can be put in two classes: irregular and quasi-regular bursts in one class, and regular bursts in the other. The regular bursts are found to have two distinct timescales and to persist over extended durations. There is a strong correlation between the preceding quiescent time and the burst duration for the quasi-regular and irregular bursts. No such correlation is found for the regular bursts. The ratio of average flux during the burst time to the average flux during the quiescent phase is high and variable for the quasi-regular and irregular bursts, while it is low and constant for the regular bursts. We present a comprehensive picture of the various types of bursts observed in GRS 1915+105 in the light of the recent theories of advective accretion disks. We suggest that the peculiar bursts that we have seen are characteristic of the change of state of the source. The source can switch back and forth between the low-hard state and the high-soft state near critical accretion rates in a very short timescale, giving rise to the irregular and quasi-regular bursts. The fast timescale for the transition of the state is explained by invoking the appearance and disappearance of the advective disk in its viscous timescale. The periodicity of the regular bursts is explained by matching the viscous timescale with the cooling timescale of the postshock region. A test of the model is presented using the publicly available 13-60 keV RXTE/PCA data for irregular and regular bursts
Classifying LISA gravitational wave burst signals using Bayesian evidence
International Nuclear Information System (INIS)
Feroz, Farhan; Graff, Philip; Hobson, Michael P; Lasenby, Anthony; Gair, Jonathan R
2010-01-01
We consider the problem of characterization of burst sources detected by the Laser Interferometer Space Antenna (LISA) using the multi-modal nested sampling algorithm, MultiNest. We use MultiNest as a tool to search for modelled bursts from cosmic string cusps, and compute the Bayesian evidence associated with the cosmic string model. As an alternative burst model, we consider sine-Gaussian burst signals, and show how the evidence ratio can be used to choose between these two alternatives. We present results from an application of MultiNest to the last round of the Mock LISA Data Challenge, in which we were able to successfully detect and characterize all three of the cosmic string burst sources present in the release data set. We also present results of independent trials and show that MultiNest can detect cosmic string signals with signal-to-noise ratio (SNR) as low as ∼7 and sine-Gaussian signals with SNR as low as ∼8. In both cases, we show that the threshold at which the sources become detectable coincides with the SNR at which the evidence ratio begins to favour the correct model over the alternative.
BudBurst Buddies: Introducing Young Citizen Scientists to Plants and Environmental Change
Ward, D.; Gardiner, L. S.; Henderson, S.
2011-12-01
As part of Project BudBurst, the BudBurst Buddies recently moved to the National Ecological Network (NEON) as part of its Education and Public Engagement efforts. The BudBurst Buddies (www.budburstbuddies.org) were created to engage elementary school age children in the science of observing plants and the timing of phenological (life cycle) events. BudBurst Buddies is a part of the Project BudBurst national citizen science initiative (www.budburst.org), which allows individuals to engage in the scientific process, contributing to a better understanding of climate change while increasing public awareness of phenology and the impacts of climate change on plants. As a first step towards engaging the next generation of citizen scientists, BudBurst Buddies provides the opportunity for children to gain experience with scientific research and increases awareness of how plants change throughout the year. Hundreds of young students have participated in the inaugural year of BudBurst Buddies. Children can participate in BudBurst Buddies on their own, with their families, or in formal or informal education settings. The program was recently highlighted by education staff at the New York Hall of Science and numerous classrooms have been implementing this resource as part of their curriculum. Each child who participates creates a journal about a plant of his or her choosing, makes observations of the plant over the growing season and submits findings online, earning an official BudBurst Buddies certificate. An online storybook for kids tells how two children, Lily and Sage, observed plants in their neighborhood and became BudBurst Buddies. This presentation will provide an overview of the BudBurst Buddies resources including a new implementation guide and will also share feedback from the first year of implementation.
Solar Flares, Type III Radio Bursts, Coronal Mass Ejections, and Energetic Particles
Cane, Hilary V.; Erickson, W. C.; Prestage, N. P.; White, Nicholas E. (Technical Monitor)
2002-01-01
In this correlative study between greater than 20 MeV solar proton events, coronal mass ejections (CMEs), flares, and radio bursts it is found that essentially all of the proton events are preceded by groups of type III bursts and all are preceded by CMEs. These type III bursts (that are a flare phenomenon) usually are long-lasting, intense bursts seen in the low-frequency observations made from space. They are caused by streams of electrons traveling from close to the solar surface out to 1 AU. In most events the type III emissions extend into, or originate at, the time when type II and type IV bursts are reported (some 5 to 10 minutes after the start of the associated soft X-ray flare) and have starting frequencies in the 500 to approximately 100 MHz range that often get lower as a function of time. These later type III emissions are often not reported by ground-based observers, probably because of undue attention to type II bursts. It is suggested to call them type III-1. Type III-1 bursts have previously been called shock accelerated (SA) events, but an examination of radio dynamic spectra over an extended frequency range shows that the type III-1 bursts usually start at frequencies above any type II burst that may be present. The bursts sometimes continue beyond the time when type II emission is seen and, furthermore, sometimes occur in the absence of any type II emission. Thus the causative electrons are unlikely to be shock accelerated and probably originate in the reconnection regions below fast CMEs. A search did not find any type III-1 bursts that were not associated with CMEs. The existence of low-frequency type III bursts proves that open field lines extend from within 0.5 radius of the Sun into the interplanetary medium (the bursts start above 100 MHz, and such emission originates within 0.5 solar radius of the solar surface). Thus it is not valid to assume that only closed field lines exist in the flaring regions associated with CMEs and some
Operational experiences with automated acoustic burst classification by neural networks
International Nuclear Information System (INIS)
Olma, B.; Ding, Y.; Enders, R.
1996-01-01
Monitoring of Loose Parts Monitoring System sensors for signal bursts associated with metallic impacts of loose parts has proved as an useful methodology for on-line assessing the mechanical integrity of components in the primary circuit of nuclear power plants. With the availability of neural networks new powerful possibilities for classification and diagnosis of burst signals can be realized for acoustic monitoring with the online system RAMSES. In order to look for relevant burst signals an automated classification is needed, that means acoustic signature analysis and assessment has to be performed automatically on-line. A back propagation neural network based on five pre-calculated signal parameter values has been set up for identification of different signal types. During a three-month monitoring program of medium-operated check valves burst signals have been measured and classified separately according to their cause. The successful results of the three measurement campaigns with an automated burst type classification are presented. (author)
The voice conveys specific emotions: evidence from vocal burst displays.
Simon-Thomas, Emiliana R; Keltner, Dacher J; Sauter, Disa; Sinicropi-Yao, Lara; Abramson, Anna
2009-12-01
Studies of emotion signaling inform claims about the taxonomic structure, evolutionary origins, and physiological correlates of emotions. Emotion vocalization research has tended to focus on a limited set of emotions: anger, disgust, fear, sadness, surprise, happiness, and for the voice, also tenderness. Here, we examine how well brief vocal bursts can communicate 22 different emotions: 9 negative (Study 1) and 13 positive (Study 2), and whether prototypical vocal bursts convey emotions more reliably than heterogeneous vocal bursts (Study 3). Results show that vocal bursts communicate emotions like anger, fear, and sadness, as well as seldom-studied states like awe, compassion, interest, and embarrassment. Ancillary analyses reveal family-wise patterns of vocal burst expression. Errors in classification were more common within emotion families (e.g., 'self-conscious,' 'pro-social') than between emotion families. The three studies reported highlight the voice as a rich modality for emotion display that can inform fundamental constructs about emotion.
Imaging spectroscopy of type U and J solar radio bursts with LOFAR
Reid, Hamish A. S.; Kontar, Eduard P.
2017-10-01
Context. Radio U-bursts and J-bursts are signatures of electron beams propagating along magnetic loops confined to the corona. The more commonly observed type III radio bursts are signatures of electron beams propagating along magnetic loops that extend into interplanetary space. Given the prevalence of solar magnetic flux to be closed in the corona, why type III bursts are more frequently observed than U-bursts or J-bursts is an outstanding question. Aims: We use Low-Frequency Array (LOFAR) imaging spectroscopy between 30-80 MHz of low-frequency U-bursts and J-bursts, for the first time, to understand why electron beams travelling along coronal loops produce radio emission less often. Radio burst observations provide information not only about the exciting electron beams but also about the structure of large coronal loops with densities that are too low for standard extreme ultraviolet (EUV) or X-ray analysis. Methods: We analysed LOFAR images of a sequence of two J-bursts and one U-burst. The different radio source positions were used to model the spatial structure of the guiding magnetic flux tube and then deduce the energy range of the exciting electron beams without the assumption of a standard density model. We also estimated the electron density along the magnetic flux rope and compared it to coronal models. Results: The radio sources infer a magnetic loop that is 1 solar radius in altitude with the highest frequency sources starting around 0.6 solar radii. Electron velocities were found between 0.13 c and 0.24 c with the front of the electron beam travelling faster than the back of the electron beam. The velocities correspond to energy ranges within the beam from 0.7-11 keV to 0.7-43 keV. The density along the loop is higher than typical coronal density models and the density gradient is smaller. Conclusions: We found that a more restrictive range of accelerated beam and background plasma parameters can result in U-bursts or J-bursts, causing type III
Relationship between type III-V radio and hard X-ray bursts
International Nuclear Information System (INIS)
Stewart, R.T.
1978-01-01
Type III-V radio bursts are found to be closely associated with impulsive hard X-ray bursts. Probably 0.1% to 1% of the fast electrons in the X-ray source region escape to heights >0.1 solar radii in the corona and excite the type III-V burst. (Auth.)
Comparison of different methods for erythroid differentiation in the K562 cell line.
Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein
2016-08-01
To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.
Light speed variation from gamma ray burst GRB 160509A
Directory of Open Access Journals (Sweden)
Haowei Xu
2016-09-01
Full Text Available It is postulated in Einstein's relativity that the speed of light in vacuum is a constant for all observers. However, the effect of quantum gravity could bring an energy dependence of light speed. Even a tiny speed variation, when amplified by the cosmological distance, may be revealed by the observed time lags between photons with different energies from astrophysical sources. From the newly detected long gamma ray burst GRB 160509A, we find evidence to support the prediction for a linear form modification of light speed in cosmological space.
Light speed variation from gamma ray burst GRB 160509A
Energy Technology Data Exchange (ETDEWEB)
Xu, Haowei [School of Physics, State Key Laboratory of Nuclear Physics and Technology, Peking University, Beijing 100871 (China); Ma, Bo-Qiang, E-mail: mabq@pku.edu.cn [School of Physics, State Key Laboratory of Nuclear Physics and Technology, Peking University, Beijing 100871 (China); Collaborative Innovation Center of Quantum Matter, Beijing (China); Center for High Energy Physics, Peking University, Beijing 100871 (China); Center for History and Philosophy of Science, Peking University, Beijing 100871 (China)
2016-09-10
It is postulated in Einstein's relativity that the speed of light in vacuum is a constant for all observers. However, the effect of quantum gravity could bring an energy dependence of light speed. Even a tiny speed variation, when amplified by the cosmological distance, may be revealed by the observed time lags between photons with different energies from astrophysical sources. From the newly detected long gamma ray burst GRB 160509A, we find evidence to support the prediction for a linear form modification of light speed in cosmological space.
Peculiarities of frequency dependence of type 3 solar radio bursts duration
International Nuclear Information System (INIS)
Tsybko, Ya.G.
1989-01-01
From the averaged data of type 3 bursts at the fixed frequencies in the range 12.5-25 MHz and out of this limit it is concluded that there exist two branges of the burst duration dependence on the frequency. This splitting allows to distinguish bursts occurring at the fundamental and the second harmonics of the plasma frequency decreasing with height in the solar corona. The type 3b radiation is characterized by a separate diagram of the mean duration versus frequency of the stria-bursts at the fundamental harmonic
Fokker-Planck simulation study of Alfven eigenmode burst
International Nuclear Information System (INIS)
Todo, Y.; Watanabe, T.; Park, Hyoung-Bin; Sato, T.
2001-01-01
Recurrent bursts of toroidicity-induced Alfven eigenmodes (TAEs) are reproduced with a Fokker-Planck-magnetohydrodynamic simulation where a fast-ion source and slowing down are incorporated self-consistently. The bursts take place at regular time intervals and the behaviors of all the TAEs are synchronized. The fast-ion transport due to TAE activity spatially broadens the classical fast-ion distribution and significantly reduces its peak value. Only a small change of the distribution takes place with each burst, leading to loss of a small fraction of the fast ions. The system stays close to the marginal stability state established through the interplay of the fast-ion source, slowing down, and TAE activity. (author)
Analysis of the Swift Gamma-Ray Bursts duration
International Nuclear Information System (INIS)
Horvath, I.; Veres, P.; Balazs, L. G.; Kelemen, J.; Bagoly, Z.; Tusnady, G.
2008-01-01
Two classes of gamma-ray bursts have been identified in the BATSE catalogs characterized by durations shorter and longer than about 2 seconds. There are, however, some indications for the existence of a third type of burst. Swift satellite detectors have different spectral sensitivity than pre-Swift ones for gamma-ray bursts. Therefore it is worth to reanalyze the durations and their distribution and also the classification of GRBs. Using The First BAT Catalog the maximum likelihood estimation was used to analyzed the duration distribution of GRBs. The three log-normal fit is significantly (99.54% probability) better than the two for the duration distribution. Monte-Carlo simulations also confirm this probability (99.2%).
Effect of low-dose irradiation on pregnant mouse haemopoiesis
International Nuclear Information System (INIS)
Weinberg, S.R.; McCarthy, E.G.; MacVittie, T.J.; Baum, S.J.
1981-01-01
The effects of low-dose gamma radiation to haemopoietic progenitor cell compartments of the marrow and spleen of virgin female mice and pregnant mice were studied. Microplasma clot cultures were used to assess burst-forming uniterythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) activity, and double-layer agar cultures were established to evaluate granulocyte-macrophage colony-forming cell (GM-CFC) and macrophage colony-forming cell (M-CFC). The apparent shift in maternal erythropoiesis from the bone marrow to the enlarged spleen was reflected by an increase in CFU-E and BFU-E per spleen and a concomitant decrease in CFU-E and BFU-E per femur. Whereas maternal GM-CFC values per femur increased 36%, maternal GM-CFC per spleen increased by 172% compared to virgin values. Total-body irradiation to the day-10.5 pregnant mouse caused a further suppression of day-14.5 medullary erythropoiesis (i.e. decreased CFU-E values) compared to the virgin female mouse. An ability of the maternal spleen to support further compensatory erythropoiesis following increasing doses of radiation was demonstrated. Four days after 1.0 Gy exposure, maternal values for GM-CFC per femur or spleen decreased to nonirradiated virgin mice values. M-CFC per maternal femur decreased to nonirradiated virgin mice values. M-CFC per maternal femur decreased following 1.5 Gy, but M-CFC per spleen appeared to be unaffected with doses from 0.5 to 2.0 Gy. (author)
A Unified Model for Repeating and Non-repeating Fast Radio Bursts
International Nuclear Information System (INIS)
Bagchi, Manjari
2017-01-01
The model that fast radio bursts (FRBs) are caused by plunges of asteroids onto neutron stars can explain both repeating and non-repeating bursts. If a neutron star passes through an asteroid belt around another star, there would be a series of bursts caused by a series of asteroid impacts. Moreover, the neutron star would cross the same belt repetitively if it were in a binary with the star hosting the asteroid belt, leading to a repeated series of bursts. I explore the properties of neutron star binaries that could lead to the only known repeating FRB so far (FRB121102). In this model, the next two epochs of bursts are expected around 2017 February 27 and 2017 December 18. On the other hand, if the asteroid belt is located around the neutron star itself, then a chance fall of an asteroid from that belt onto the neutron star would lead to a non-repeating burst. Even a neutron star grazing an asteroid belt can lead to a non-repeating burst caused by just one asteroid plunge during the grazing. This is possible even when the neutron star is in a binary with the asteroid-hosting star, if the belt and the neutron star orbit are non-coplanar.
A Unified Model for Repeating and Non-repeating Fast Radio Bursts
Energy Technology Data Exchange (ETDEWEB)
Bagchi, Manjari, E-mail: manjari@imsc.res.in [The Institute of Mathematical Sciences (IMSc-HBNI), 4th Cross Road, CIT Campus, Taramani, Chennai 600113 (India)
2017-04-01
The model that fast radio bursts (FRBs) are caused by plunges of asteroids onto neutron stars can explain both repeating and non-repeating bursts. If a neutron star passes through an asteroid belt around another star, there would be a series of bursts caused by a series of asteroid impacts. Moreover, the neutron star would cross the same belt repetitively if it were in a binary with the star hosting the asteroid belt, leading to a repeated series of bursts. I explore the properties of neutron star binaries that could lead to the only known repeating FRB so far (FRB121102). In this model, the next two epochs of bursts are expected around 2017 February 27 and 2017 December 18. On the other hand, if the asteroid belt is located around the neutron star itself, then a chance fall of an asteroid from that belt onto the neutron star would lead to a non-repeating burst. Even a neutron star grazing an asteroid belt can lead to a non-repeating burst caused by just one asteroid plunge during the grazing. This is possible even when the neutron star is in a binary with the asteroid-hosting star, if the belt and the neutron star orbit are non-coplanar.
A. N. Afanasiev
2009-01-01
This paper addresses the fine structure of solar decametric type II radio bursts in the form of drifting narrowband fibres on the dynamic spectrum. Observations show that this structure appears in those events where there is a coronal mass ejection (CME) traveling in the near-solar space ahead of the shock wave responsible for the radio burst. The diversity in observed morphology of fibres and values of their parameters implies that the fibres may be caused by different formation mechanisms. ...
Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.
Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong
2017-02-03
Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.
Energy Technology Data Exchange (ETDEWEB)
Keek, L. [X-ray Astrophysics Laboratory, Astrophysics Science Division, NASA/GSFC, Greenbelt, MD 20771 (United States); Heger, A., E-mail: laurens.keek@nasa.gov [Monash Center for Astrophysics, School of Physics and Astronomy, Monash University, Victoria, 3800 (Australia)
2017-06-20
Thermonuclear flashes of hydrogen and helium accreted onto neutron stars produce the frequently observed Type I X-ray bursts. It is the current paradigm that almost all material burns in a burst, after which it takes hours to accumulate fresh fuel for the next burst. In rare cases, however, bursts are observed with recurrence times as short as minutes. We present the first one-dimensional multi-zone simulations that reproduce this phenomenon. Bursts that ignite in a relatively hot neutron star envelope leave a substantial fraction of the fuel unburned at shallow depths. In the wake of the burst, convective mixing events driven by opacity bring this fuel down to the ignition depth on the observed timescale of minutes. There, unburned hydrogen mixes with the metal-rich ashes, igniting to produce a subsequent burst. We find burst pairs and triplets, similar to the observed instances. Our simulations reproduce the observed fraction of bursts with short waiting times of ∼30%, and demonstrate that short recurrence time bursts are typically less bright and of shorter duration.
Detection of bursts in neuronal spike trains by the mean inter-spike interval method
Institute of Scientific and Technical Information of China (English)
Lin Chen; Yong Deng; Weihua Luo; Zhen Wang; Shaoqun Zeng
2009-01-01
Bursts are electrical spikes firing with a high frequency, which are the most important property in synaptic plasticity and information processing in the central nervous system. However, bursts are difficult to identify because bursting activities or patterns vary with phys-iological conditions or external stimuli. In this paper, a simple method automatically to detect bursts in spike trains is described. This method auto-adaptively sets a parameter (mean inter-spike interval) according to intrinsic properties of the detected burst spike trains, without any arbitrary choices or any operator judgrnent. When the mean value of several successive inter-spike intervals is not larger than the parameter, a burst is identified. By this method, bursts can be automatically extracted from different bursting patterns of cultured neurons on multi-electrode arrays, as accurately as by visual inspection. Furthermore, significant changes of burst variables caused by electrical stimulus have been found in spontaneous activity of neuronal network. These suggest that the mean inter-spike interval method is robust for detecting changes in burst patterns and characteristics induced by environmental alterations.
Rock Burst Monitoring by Integrated Microseismic and Electromagnetic Radiation Methods
Li, Xuelong; Wang, Enyuan; Li, Zhonghui; Liu, Zhentang; Song, Dazhao; Qiu, Liming
2016-11-01
For this study, microseismic (MS) and electromagnetic radiation (EMR) monitoring systems were installed in a coal mine to monitor rock bursts. The MS system monitors coal or rock mass ruptures in the whole mine, whereas the EMR equipment monitors the coal or rock stress in a small area. By analysing the MS energy, number of MS events, and EMR intensity with respect to rock bursts, it has been shown that the energy and number of MS events present a "quiet period" 1-3 days before the rock burst. The data also show that the EMR intensity reaches a peak before the rock burst and this EMR intensity peak generally corresponds to the MS "quiet period". There is a positive correlation between stress and EMR intensity. Buckling failure of coal or rock depends on the rheological properties and occurs after the peak stress in the high-stress concentration areas in deep mines. The MS "quiet period" before the rock burst is caused by the heterogeneity of the coal and rock structures, the transfer of high stress into internal areas, locked patches, and self-organized criticality near the stress peak. This study increases our understanding of coal and rock instability in deep mines. Combining MS and EMR to monitor rock burst could improve prediction accuracy.
Spike and burst coding in thalamocortical relay cells.
Directory of Open Access Journals (Sweden)
Fleur Zeldenrust
2018-02-01
Full Text Available Mammalian thalamocortical relay (TCR neurons switch their firing activity between a tonic spiking and a bursting regime. In a combined experimental and computational study, we investigated the features in the input signal that single spikes and bursts in the output spike train represent and how this code is influenced by the membrane voltage state of the neuron. Identical frozen Gaussian noise current traces were injected into TCR neurons in rat brain slices as well as in a validated three-compartment TCR model cell. The resulting membrane voltage traces and spike trains were analyzed by calculating the coherence and impedance. Reverse correlation techniques gave the Event-Triggered Average (ETA and the Event-Triggered Covariance (ETC. This demonstrated that the feature selectivity started relatively long before the events (up to 300 ms and showed a clear distinction between spikes (selective for fluctuations and bursts (selective for integration. The model cell was fine-tuned to mimic the frozen noise initiated spike and burst responses to within experimental accuracy, especially for the mixed mode regimes. The information content carried by the various types of events in the signal as well as by the whole signal was calculated. Bursts phase-lock to and transfer information at lower frequencies than single spikes. On depolarization the neuron transits smoothly from the predominantly bursting regime to a spiking regime, in which it is more sensitive to high-frequency fluctuations. The model was then used to elucidate properties that could not be assessed experimentally, in particular the role of two important subthreshold voltage-dependent currents: the low threshold activated calcium current (IT and the cyclic nucleotide modulated h current (Ih. The ETAs of those currents and their underlying activation/inactivation states not only explained the state dependence of the firing regime but also the long-lasting concerted dynamic action of the two
Observations of gamma-ray bursts
International Nuclear Information System (INIS)
Strong, I.B.; Klebesadel, R.W.; Evans, W.D.
1975-01-01
Observational data on gamma-ray bursts are reviewed. Information is grouped into temporal properties, energy fluxes and spectral properties, and directions and distributions of the sources in space. (BJG)
Cosmological Gamma-Ray Bursts and Hypernovae Conclusively Linked
2003-06-01
with the UVES spectrograph at the 8.2-m VLT KUEYEN telescope at the ESO Paranal Observatory (Chile). The corresponding distance is about 2,650 million light-years. This is the nearest normal GRB ever detected, therefore providing the long-awaited opportunity to test the many hypotheses and models which have been proposed since the discovery of the first GRBs in the late 1960's. With this specific aim, the ESO-lead team of astronomers [1] now turned to two other powerful instruments at the ESO Very Large Telescope (VLT), the multi-mode FORS1 and FORS2 camera/spectrographs. Over a period of one month, until May 1, 2003, spectra of the fading object were obtained at regular rate, securing a unique set of observational data that documents the physical changes in the remote object in unsurpassed detail. The hypernova connection Based on a careful study of these spectra, the astronomers are now presenting their interpretation of the GRB 030329 event in a research paper appearing in the international journal "Nature" on Thursday, June 19. Under the prosaic title "A very energetic supernova associated with the gamma-ray burst of 29 March 2003", no less than 27 authors from 17 research institutes, headed by Danish astronomer Jens Hjorth conclude that there is now irrefutable evidence of a direct connection between the GRB and the "hypernova" explosion of a very massive, highly evolved star. This is based on the gradual "emergence" with time of a supernova-type spectrum, revealing the extremely violent explosion of a star. With velocities well in excess of 30,000 km/sec (i.e., over 10% of the velocity of light), the ejected material is moving at record speed, testifying to the enormous power of the explosion. Hypernovae are rare events and they are probably caused by explosion of stars of the so-called "Wolf-Rayet" type [4]. These WR-stars were originally formed with a mass above 25 solar masses and consisted mostly of hydrogen. Now in their WR-phase, having stripped themselves
Thermonuclear model for γ-ray bursts
International Nuclear Information System (INIS)
Woosley, S.E.
1981-01-01
The evolution of magnetized neutron stars with field strengths of approx. 10 12 gauss that are accreting mass onto kilometer-sized polar regions at a rate of approx. 13 M 0 yr -1 is examined. Based on the results of one-dimensional calculations, one finds that stable hydrogen burning, mediated by the hot CNO-cycle, will lead to a critical helium mass in the range 10 20 to 10 22 g km -2 . Owing to the extreme degeneracy of the electron gas providing pressure support, helium burning occurs as a violent thermonuclear runaway which may propagate either as a convective deflagration (Type I burst) or as a detonation wave (Type II burst). Complete combustion of helium into 56 Ni releases from 10 38 to 10 40 erg km -2 and pushes hot plasma with β > 1 above the surface of the neutron star. Rapid expansion of the plasma channels a substantial fraction of the explosion energy into magnetic field stress. Spectral properties are expected to be complex with emission from both thermal and non-thermal processes. The hard γ-outburst of several seconds softens as the event proceeds and is followed by a period, typically of several minutes duration, of softer x-ray emission as the subsurface ashes of the thermonuclear explosion cool. In this model, most γ-ray bursts currently being observed are located at a distance of several hundred parsecs and should recur on a timescale of months to centuries with convective deflagrations (Type I bursts) being the more common variety. An explanation for Jacobson-like transients is also offered
DPLL implementation in carrier acquisition and tracking for burst DS-CDMA receivers.
Guan, Yun-feng; Zhang, Zhao-yang; Lai, Li-feng
2003-01-01
This paper presents the architectures, algorithms, and implementation considerations of the digital phase locked loop (DPLL) used for burst-mode packet DS-CDMA receivers. As we know, carrier offset is a rather challenging problem in CDMA system. According to different applications, different DPLL forms should be adopted to correct different maximum carrier offset in CDMA systems. One classical DPLL and two novel DPLL forms are discussed in the paper. The acquisition range of carrier offset can be widened by using the two novel DPLL forms without any performance degradation such as longer acquisition time or larger variance of the phase error. The maximum acquisition range is 1/(4T), where T is the symbol period. The design can be implemented by FPGA directly.
Are There Multiple Populations of Fast Radio Bursts?
Palaniswamy, Divya; Li, Ye; Zhang, Bing
2018-02-01
The repeating FRB 121102 (the “repeater”) shows repetitive bursting activities and was localized in a host galaxy at z = 0.193. On the other hand, despite dozens of hours of telescope time spent on follow-up observations, no other fast radio bursts (FRBs) have been observed to repeat. Yet, it has been speculated that the repeater is the prototype of FRBs, and that other FRBs should show similar repeating patterns. Using the published data, we compare the repeater with other FRBs in the observed time interval (Δt)–flux ratio (S i /S i+1) plane. We find that whereas other FRBs occupy the upper (large S i /S i+1) and right (large Δt) regions of the plane due to the non-detections of other bursts, some of the repeater bursts fall into the lower left region of the plot (short interval and small flux ratio) excluded by the non-detection data of other FRBs. The trend also exists even if one only selects those bursts detectable by the Parkes radio telescope. If other FRBs were similar to the repeater, our simulations suggest that the probability that none of them have been detected to repeat with the current searches would be ∼(10‑4–10‑3). We suggest that the repeater is not representative of the entire FRB population, and that there is strong evidence of more than one population of FRBs.
Long gamma-ray bursts and core-collapse supernovae have different environments.
Fruchter, A S; Levan, A J; Strolger, L; Vreeswijk, P M; Thorsett, S E; Bersier, D; Burud, I; Castro Cerón, J M; Castro-Tirado, A J; Conselice, C; Dahlen, T; Ferguson, H C; Fynbo, J P U; Garnavich, P M; Gibbons, R A; Gorosabel, J; Gull, T R; Hjorth, J; Holland, S T; Kouveliotou, C; Levay, Z; Livio, M; Metzger, M R; Nugent, P E; Petro, L; Pian, E; Rhoads, J E; Riess, A G; Sahu, K C; Smette, A; Tanvir, N R; Wijers, R A M J; Woosley, S E
2006-05-25
When massive stars exhaust their fuel, they collapse and often produce the extraordinarily bright explosions known as core-collapse supernovae. On occasion, this stellar collapse also powers an even more brilliant relativistic explosion known as a long-duration gamma-ray burst. One would then expect that these long gamma-ray bursts and core-collapse supernovae should be found in similar galactic environments. Here we show that this expectation is wrong. We find that the gamma-ray bursts are far more concentrated in the very brightest regions of their host galaxies than are the core-collapse supernovae. Furthermore, the host galaxies of the long gamma-ray bursts are significantly fainter and more irregular than the hosts of the core-collapse supernovae. Together these results suggest that long-duration gamma-ray bursts are associated with the most extremely massive stars and may be restricted to galaxies of limited chemical evolution. Our results directly imply that long gamma-ray bursts are relatively rare in galaxies such as our own Milky Way.