WorldWideScience

Sample records for erythroid burst-forming units

  1. In vitro studies of the sensitivity of canine bone-marrow erythroid burst-forming units (BFU-E) and fibroblast colony-forming units (CFU-F) to X-irradiation

    International Nuclear Information System (INIS)

    Kreja, Ludwika; Baltschukat, Klaus; Nothdurft, Wilhelm

    1989-01-01

    The radiosensitivity of the early erythroid progenitor cells (BFU-E) and the progenitor cells of the stroma (CFU-F) in canine bone marrow was studied under steady-state conditions by in vitro irradiation with 280 kV X-rays. The dose-effect relationship for colony formation was determined for BFU-E obtained from the iliac crest marrow, and for CFU-F in bone marrow collected from the iliac crest and the humerus of adult beagles. The BFU-E were adequately stimulated with serum from lethally irradiated dogs to obtain a source of BPA (burst-promoting activity). The BFU-E proved to be extremely radiosensitive, (the survival curve was exponential (D o 15.3 ± 1.8 cGY)). Buffy-coat leukocytes separated from bone marrow leukocytes obtained by aspiration were an optimum source of CFU-F. A curve was fitted to data obtained for CFU-F obtained from iliac crest or humerus, resulting in D o = 241 ± 38 cGY and an extrapolation number n = 1.38 ± 0.62 or D o = 261 ± 40 cGY and n = 1.04 ± 0.42, respectively. (author)

  2. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

  3. Loss of the ability to generate large burst-forming unit-like megakaryocytic colonies from thawed cord blood in semisolid cultures after short term suspension culture.

    Science.gov (United States)

    Eskola, M; Bäckman, S; Möttönen, S; Kekomäki, R

    2015-04-01

    Total colony-forming cells from thawed cord blood units (CBUs) include megakaryocytic colony-forming units (CFU-Mks), which survive the freezing process. The aim of this study was to evaluate whether different megakaryocytic progenitors from unseparated CBUs survive the freezing process and a short-term liquid culture. Thawed samples of CBUs were cultured in liquid medium. During the cultures, serial samples were drawn to assess the growth of different megakaryocytic progenitors in a semisolid collagen medium with identical cytokines as in the liquid medium. Megakaryocytic cells were detected using immunohistochemistry and flow cytometry. In suspension culture, the megakaryocytic progenitors almost completely lost the ability to generate large (burst-forming unit-like, BFU-like) megakaryocytic colonies in semisolid cultures (large colonies, median count per chamber d0: 7.25 vs. d7: 1.5; P culture in suspension resulted in the decline of small colonies as well (d7: 16.0 vs. d14: 5.75; P = 0.0088). Total CFU-Mk count declined from 23.3 (range 12.5-34.0) at d0 to 7.25 (range 1.0-13.5) at d14 (P culture after a short suspension culture. Small CFU-Mks were observed throughout the cultures. It may be that the BFU-Mk colonies matured and acquired CFU-Mk behaviour. © 2014 International Society of Blood Transfusion.

  4. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  5. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  6. Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage

    DEFF Research Database (Denmark)

    Järås, Marcus; Johnels, Petra; Agerstam, Helena

    2009-01-01

    OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...

  7. Reduction of erythroid progenitors in protein-energy malnutrition.

    Science.gov (United States)

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  8. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    International Nuclear Information System (INIS)

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.

    1991-01-01

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

  9. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra

    2009-12-01

    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  10. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.

    1979-01-01

    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  11. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  12. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  13. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  14. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  15. Erythroid cells in vitro: from developmental biology to blood transfusion products.

    Science.gov (United States)

    Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

    2009-07-01

    Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

  16. Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

    International Nuclear Information System (INIS)

    Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

  17. Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

  18. The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

    International Nuclear Information System (INIS)

    Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

    1981-01-01

    The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

  19. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  20. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

    2017-01-01

    are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

  1. Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

    Science.gov (United States)

    Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

    2018-06-15

    In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

  2. Expression of assayable residual stem cell damage in erythroid differentiation

    International Nuclear Information System (INIS)

    Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

    1985-01-01

    In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

  3. Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

    Science.gov (United States)

    Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

    2010-01-01

    Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

  4. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.

    Science.gov (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A

    2004-10-01

    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  5. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

    2010-01-01

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  6. Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

    2017-07-15

    Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  8. [Update on the biology of heme synthesis in erythroid cells].

    Science.gov (United States)

    Fujiwara, Tohru; Harigae, Hideo

    2015-02-01

    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  9. Prospective identification of erythroid elements in cultured peripheral blood.

    Science.gov (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P

    1999-04-01

    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  10. Survey and evaluation of mutations in the human KLF1 transcription unit.

    Science.gov (United States)

    Gnanapragasam, Merlin Nithya; Crispino, John D; Ali, Abdullah M; Weinberg, Rona; Hoffman, Ronald; Raza, Azra; Bieker, James J

    2018-04-26

    Erythroid Krüppel-like Factor (EKLF/KLF1) is an erythroid-enriched transcription factor that plays a global role in all aspects of erythropoiesis, including cell cycle control and differentiation. We queried whether its mutation might play a role in red cell malignancies by genomic sequencing of the KLF1 transcription unit in cell lines, erythroid neoplasms, dysplastic disorders, and leukemia. In addition, we queried published databases from a number of varied sources. In all cases we only found changes in commonly notated SNPs. Our results suggest that if there are mutations in KLF1 associated with erythroid malignancies, they are exceedingly rare.

  11. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  12. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  13. Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

    Science.gov (United States)

    Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

    2002-02-01

    The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

  14. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria

    2017-10-20

    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  15. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

    Directory of Open Access Journals (Sweden)

    Eyayu Belay

    Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

  16. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    2015-06-01

    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  17. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ruth Merkle

    2016-08-01

    Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

  18. A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Pablo Manresa

    2017-12-01

    Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

  19. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  20. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  1. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.

    1987-01-01

    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  2. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  3. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

    Science.gov (United States)

    Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

    2017-05-01

    Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

  4. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    Science.gov (United States)

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  5. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Science.gov (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  6. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  7. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  8. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

    NARCIS (Netherlands)

    Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

  9. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

    1982-01-01

    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  10. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  11. Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

    OpenAIRE

    Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

    2013-01-01

    Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

  12. Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

    OpenAIRE

    Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

    1981-01-01

    Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

  13. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  14. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  15. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren

    2010-09-01

    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  16. Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

    Science.gov (United States)

    Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

    2018-04-01

    During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

  17. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  18. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

    Science.gov (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

    2017-07-01

    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

    2007-01-01

    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  20. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  1. Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

    Science.gov (United States)

    Sherazi, Syed Furqan Haider; Butt, Zeeshan

    2012-09-01

    AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

  2. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  3. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

    Science.gov (United States)

    Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

    2017-11-01

    The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  6. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  7. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

    Science.gov (United States)

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-02-03

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

  8. Comparison of different methods for erythroid differentiation in the K562 cell line.

    Science.gov (United States)

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  9. Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

    Science.gov (United States)

    Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

    2016-12-01

    In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  11. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

    2012-01-01

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  12. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  13. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  14. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  15. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  16. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  17. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  18. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

    1999-01-01

    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  19. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  20. Biosynthesis of heme in immature erythroid cells. The regulatory step for heme formation in the human erythron

    International Nuclear Information System (INIS)

    Gardner, L.C.; Cox, T.M.

    1988-01-01

    Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation

  1. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

    Science.gov (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

    2017-03-01

    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  2. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  3. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  4. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K

    2011-01-01

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  5. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.

    Science.gov (United States)

    Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A

    2010-10-28

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.

  6. Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

    Science.gov (United States)

    Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

    2015-12-01

    Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

    Science.gov (United States)

    Ha, Ae Wha; Kim, Woo Kyoung

    2017-06-01

    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  8. No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

    Science.gov (United States)

    Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

    2017-07-20

    Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Erythropoiesis in the aged mouse. I. Response to stimulation in vivo

    International Nuclear Information System (INIS)

    Udupa, K.B.; Lipschitz, D.A.

    1984-01-01

    Changes in erythropoiesis with age were studied by examining the hematocrit increase in response to hypoxia in aged mice and by assessing the change in erythropoiesis following the injection of erythropoietin in young and old polycythemic mice. The increase in hematocrit after exposure to hypoxia was more variable and generally lower in old mice than in young mice. When erythropoietin was injected into polycythemic animals, the increase in differentiated erythroid cells and 59 Fe incorporation into erythroid marrow and peripheral blood cells was significantly lower in old mice than in young mice. In contrast to differentiated erythroid cells, there was less evidence of a reduced response to simulation of the more primitive erythroid progenitor cells of aged animals. The early undifferentiated erythroid progenitor, burst-forming units, did not decrease when either young or aged mice were made polycythemic, and no change following erythropoietin injection was noted. Polycythemia suppressed the late-differentiated erythroid progenitor, erythroid colony-forming units, to a greater extent in aged animals, but when erythropoietin was injected, the percent increase over the subsequent 24 hours was identical to that in young mice. These observations indicate a reduced erythropoietic capacity with age, the abnormality being most obvious in the more mature erythroid precursors

  10. PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

    Directory of Open Access Journals (Sweden)

    Schmidt Enrico K

    2004-05-01

    Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

  11. Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

    Science.gov (United States)

    Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

    1996-01-01

    Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

  12. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    International Nuclear Information System (INIS)

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-01-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

  13. Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

    Directory of Open Access Journals (Sweden)

    Josephine Wesely

    2017-01-01

    Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

  14. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Zita Garate

    2015-12-01

    Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  15. Generation and Characterization of Erythroid Cells from Human Embryonic Stem Cells and Induced Pluripotent Stem Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Kai-Hsin Chang

    2011-01-01

    Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.

  16. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  17. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.

  18. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  19. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  20. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  1. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    International Nuclear Information System (INIS)

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-01-01

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway

  2. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  3. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  4. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  5. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  6. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  8. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  9. The negative impact of Wnt signaling on megakaryocyte and primitive erythroid progenitors derived from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Prasuna Paluru

    2014-03-01

    Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.

  10. Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice.

    Science.gov (United States)

    Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D

    2010-04-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

  11. Inhibition of erythroid cell growth by allogeneic murine lymphocytes. Evidence for a synergism between lymph node cells and thymocytes

    International Nuclear Information System (INIS)

    Blomgren, H.; Jacobsson, H.

    1974-01-01

    Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay

  12. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  13. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  14. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

    Directory of Open Access Journals (Sweden)

    Sreoshi Chatterjee

    Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

  15. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    Science.gov (United States)

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

  16. Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow

    International Nuclear Information System (INIS)

    Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.

    1976-01-01

    The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors

  17. Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

    Science.gov (United States)

    Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

    2011-06-01

    Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

  18. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  19. In vitro studies on the radiosensitivity of multipotent hemopoietic progenitors in canine bone marrow

    International Nuclear Information System (INIS)

    Kreja, L.; Weinsheimer, W.; Nothdurft, W.

    1991-01-01

    The in vitro radiation response to 280-kV x-rays (does rate 72 cGy/min) of multipotent hemopoietic progenitor cells, mixed colony-forming units (CFU-mix), from canine bone marrow was assayed and compared to the radiation response characteristics of early erythroid progenitors, erythroid burst-forming units (BFU-E). To improve the colony-forming efficiency, the effect of various bone marrow cell separation techniques on colony formation of both progenitors was examined. The separation of bone marrow aspirates by discontinuous buoyant gradient centrifugation using the lymphocyte separation medium Lymphoprep with a density of 1.070 g/ml allowed the establishment of reproducible survival curves. The survival curves for both progenitors were strictly exponential, and CFU-mix were found to be more radiosensitive (D0 = 12 ± 2 cGy) than BFU-E (D0 = 16 ± 2 cGy)

  20. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

    NARCIS (Netherlands)

    von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

    2001-01-01

    Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

  1. Hemolytic disease of the fetus and newborn due to anti-Ge3: combined antibody-dependent hemolysis and erythroid precursor cell growth inhibition.

    Science.gov (United States)

    Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A

    2008-10-01

    The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.

  2. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  3. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  4. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-01-01

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  5. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  6. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  7. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  8. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  9. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    Science.gov (United States)

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  10. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  11. Catalase overexpression prevents nuclear factor erythroid 2-related factor 2 stimulation of renal angiotensinogen gene expression, hypertension, and kidney injury in diabetic mice.

    Science.gov (United States)

    Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D

    2014-10-01

    This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  12. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2–Mediated Protection in Human Primary Alveolar Type II Cells in Smokers

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.

    2016-01-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  13. Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2.

    Science.gov (United States)

    Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan

    2018-01-01

    Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

    2004-01-01

    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  15. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  16. The nuclear factor-erythroid 2-related factor/heme oxygenase-1 axis is critical for the inflammatory features of type 2 diabetes-associated osteoarthritis.

    Science.gov (United States)

    Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie

    2017-09-01

    Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Lo, Raymond; Matthews, Jason

    2013-01-01

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  18. Evaluation of effects of various drugs on platelet functions using phorbol 12-myristate 13-acetate-induced megakaryocytic human erythroid leukemia cells

    Directory of Open Access Journals (Sweden)

    Tada T

    2016-09-01

    Full Text Available Tomoki Tada,1 Kensaku Aki,2 Wataru Oboshi,1,3 Kazuyoshi Kawazoe,4 Toshiyuki Yasui,5 Eiji Hosoi2 1Subdivision of Biomedical Laboratory Sciences, Graduate School of Health Sciences, Tokushima University, 2Department of Cells and Immunity Analytics, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, 3Department of Medical Technology, Kagawa Prefectural University of Health Sciences, Kagawa, 4Department of Clinical Pharmacy Practice Pedagogy, Institute of Biomedical Sciences, 5Department of Reproductive and Menopausal Medicine, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, Japan Background: The hyperfunction and activation of platelets have been strongly implicated in the development and recurrence of arterial occlusive disease, and various antiplatelet drugs are used to treat and prevent such diseases. New antiplatelet drugs and many other drugs have been developed, but some drugs may have adverse effects on platelet functions. Objective: The aim of this study was to establish an evaluation method for evaluating the effect and adverse effect of various drugs on platelet functions. Materials and methods: Human erythroid leukemia (HEL cells were used after megakaryocytic differentiation with phorbol 12-myristate 13-acetate as an alternative to platelets. Drugs were evaluated by changes in intracellular Ca2+ concentration ([Ca2+]i mobilization in Fura2-loaded phorbol 12-myristate 13-acetate-induced HEL cells. Aspirin and cilostazol were selected as antiplatelet drugs and ibuprofen and sodium valproate as other drugs. Results: There was a positive correlation between [Ca2+]i and platelet aggregation induced by thrombin. Aspirin (5.6–560 µM and cilostazol (5–10 µM significantly inhibited thrombin-induced increases in [Ca2+]i in a concentration-dependent manner. On the other hand, ibuprofen (8–200 µM and sodium valproate (50–1,000 µg/mL also significantly inhibited

  19. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Science.gov (United States)

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  20. A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

    Science.gov (United States)

    Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

    2015-04-01

    We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

  1. Interface unit

    NARCIS (Netherlands)

    Keyson, D.V.; Freudenthal, A.; De Hoogh, M.P.A.; Dekoven, E.A.M.

    2001-01-01

    The invention relates to an interface unit comprising at least a display unit for communication with a user, which is designed for being coupled with a control unit for at least one or more parameters in a living or working environment, such as the temperature setting in a house, which control unit

  2. The separation of a mixture of bone marrow stem cells from tumor cells: an essential step for autologous bone marrow transplantation

    International Nuclear Information System (INIS)

    Rubin, P.; Wheeler, K.T.; Keng, P.C.; Gregory, P.K.; Croizat, H.

    1981-01-01

    KHT tumor cells were mixed with mouse bone marrow to simulate a sample of bone marrow containing metastatic tumor cells. This mixture was separated into a bone marrow fraction and a tumor cell fraction by centrifugal elutriation. Elutriation did not change the transplantability of the bone marrow stem cells as measured by a spleen colony assay and an in vitro erythroid burst forming unit assay. The tumorogenicity of the KHT cells was similarly unaffected by elutriation. The data showed that bone marrow cells could be purified to less than 1 tumor cell in more than 10 6 bone marrow cells. Therefore, purification of bone marrow removed prior to lethal radiation-drug combined therapy for subsequent autologous transplantation appears to be feasible using modifications of this method if similar physical differences between human metastatic tumor cells and human bone marrow cells exist. This possibility is presently being explored

  3. Involvement of placental/umbilical cord blood acid-base status and gas values on the radiosensitivity of human fetal/neonatal hematopoietic stem/progenitor cells

    International Nuclear Information System (INIS)

    Yamaguchi, Masaru; Ebina, Satoko; Kashiwakura, Ikuo

    2013-01-01

    Arterial cord blood (CB) acid-base status and gas values, such as pH, PCO 2 , PO 2 , HCO 3 - and base excess, provide useful information on the fetal and neonatal condition. However, it remains unknown whether these values affect the radiosensitivity of fetal/neonatal hematopoiesis. The present study evaluated the relationship between arterial CB acid-base status, gas values, and the radiosensitivity of CB hematopoietic stem/progenitor cells (HSPCs). A total of 25 CB units were collected. The arterial CB acid-base status and gas values were measured within 30 min of delivery. The CD34 + HSPCs obtained from CB were exposed to 2 Gy X-irradiation, and then assayed for colony-forming unit-granulocyte-macrophage, burst-forming unit-erythroid (BFU-E), and colony-forming unit-granulocyte erythroid, macrophage and megakaryocyte cells. Acid-base status and gas values for PCO 2 and HCO 3 - showed a statistically significant negative correlation with the surviving fraction of BFU-E. In addition, a significant positive correlation was observed between gestational age and PCO 2 . Moreover, the surviving fraction of BFU-E showed a significant negative correlation with gestational age. Thus, HSPCs obtained from CB with high PCO 2 /HCO 3 - levels were sensitive to X-irradiation, which suggests that the status of arterial PCO 2 /HCO 3 - influences the radiosensitivity of fetal/neonatal hematopoiesis, especially erythropoiesis. (author)

  4. Generating Units

    Data.gov (United States)

    Department of Homeland Security — Generating Units are any combination of physically connected generators, reactors, boilers, combustion turbines, and other prime movers operated together to produce...

  5. The role of tumor suppressor p15Ink4b in the regulation of hematopoietic progenitor cell fate

    International Nuclear Information System (INIS)

    Humeniuk, R; Rosu-Myles, M; Fares, J; Koller, R; Bies, J; Wolff, L

    2013-01-01

    Epigenetic silencing of the tumor suppressor gene p15Ink4b (CDKN2B) is a frequent event in blood disorders like acute myeloid leukemia and myelodysplastic syndromes. The molecular function of p15Ink4b in hematopoietic differentiation still remains to be elucidated. Our previous study demonstrated that loss of p15Ink4b in mice results in skewing of the differentiation pattern of the common myeloid progenitor towards the myeloid lineage. Here, we investigated a function of p15Ink4b tumor suppressor gene in driving erythroid lineage commitment in hematopoietic progenitors. It was found that p15Ink4b is expressed more highly in committed megakaryocyte–erythroid progenitors than granulocyte–macrophage progenitors. More importantly, mice lacking p15Ink4b have lower numbers of primitive red cell progenitors and a severely impaired response to 5-fluorouracil- and phenylhydrazine-induced hematopoietic stress. Introduction of p15Ink4b into multipotential progenitors produced changes at the molecular level, including activation of mitogen-activated protein kinase/extracellular signal-regulated kinase (MEK/ERK) signaling, increase GATA-1, erythropoietin receptor (EpoR) and decrease Pu1, GATA-2 expression. These changes rendered cells more permissive to erythroid commitment and less permissive to myeloid commitment, as demonstrated by an increase in early burst-forming unit-erythroid formation with concomitant decrease in myeloid colonies. Our results indicate that p15Ink4b functions in hematopoiesis, by maintaining proper lineage commitment of progenitors and assisting in rapid red blood cells replenishment following stress

  6. The influence of gender- and age-related differences in the radiosensitivity of hematopoietic progenitor cells detected in steady-state human peripheral blood

    International Nuclear Information System (INIS)

    Kato, Kengo; Kashiwakura, Ikuo; Kuwabara, Mikinori

    2011-01-01

    To investigate the importance of gender and aging on the individual radiosensitivity of lineage-committed myeloid hematopoietic stem/progenitor cells (HSPCs) detected in mononuclear cells (MNCs) of steady-state human peripheral blood (PB), the clonogenic survival of HPCs, including colony-forming unit-granulocyte macrophage; burst-forming unit-erythroid; colony-forming unit-granulocyte-erythroid-macrophage-megakaryocyte cells derived from MNCs exposed to 0.5 Gy and 2 Gy X-irradiation were estimated. MNCs were prepared from the buffy-coats of 59 healthy individual blood donors. The results showed that large individual differences exist in the number of HSPCs, as well as in the surviving fraction of cells. Furthermore, the number of progenitor cells strongly correlated with their surviving fraction, suggesting that the radiosensitivity of hematopoietic progenitor cells decreases with the number of cells in the 10 5 cells population. A statistically significant negative correlation was observed between the surviving fraction observed at a dose of 0.5 Gy and the age of an individual, however, none of these correlations were observed after 2 Gy irradiation. No statistically significant difference was observed in individual radiosensitivity between males and females at either radiation dose. The present results indicated a correlation between the individual responsiveness of HSPCs to ionizing irradiation, especially to low dose irradiation, and aging. (author)

  7. Unit Manning

    National Research Council Canada - National Science Library

    McGinniss, Mike

    2003-01-01

    .... This decision combines two crucial initiatives: first, transforming the Army from an individual soldier replacement system to a unit manning system that enhances cohesion and keeps trained soldiers, leaders, and commanders together longer, thereby...

  8. Detector Unit

    CERN Multimedia

    1960-01-01

    Original detector unit of the Instituut voor Kernfysisch Onderzoek (IKO) BOL project. This detector unit shows that silicon detectors for nuclear physics particle detection were already developed and in use in the 1960's in Amsterdam. Also the idea of putting 'strips' onto the silicon for high spatial resolution of a particle's impact on the detector were implemented in the BOL project which used 64 of these detector units. The IKO BOL project with its silicon particle detectors was designed, built and operated from 1965 to roughly 1977. Detector Unit of the BOL project: These detectors, notably the ‘checkerboard detector’, were developed during the years 1964-1968 in Amsterdam, The Netherlands, by the Natuurkundig Laboratorium of the N.V. Philips Gloeilampen Fabrieken. This was done in close collaboration with the Instituut voor Kernfysisch Onderzoek (IKO) where the read-out electronics for their use in the BOL Project was developed and produced.

  9. Drilling unit

    Energy Technology Data Exchange (ETDEWEB)

    Umanchik, N P; Demin, A V; Khrustalev, N N; Linnik, G N; Lovchev, S V; Rozin, M M; Sidorov, R V; Sokolov, S I; Tsaregradskiy, Yu P

    1981-01-01

    A drilling unit is proposed which includes a hydraulic lifter, hydraulic multiple-cylinder pump with valve distribution and sectional drilling pump with separators of the working and flushing fluid. In order to reduce metal consumption and the overall dimensions of the drilling unit, the working cavity of each cylinder of the hydraulic multiple-cylinder pump is equipped with suction and injection valves and is hydraulically connected to the working cavity by one of the sections of the drilling pump.

  10. Effects of a diphenyl-ether herbicide, oxyfluorfen, on human BFU-E/CFU-E development and haemoglobin synthesis.

    Science.gov (United States)

    Rio, B; Parent-Massin, D; Lautraite, S; Hoellinger, H

    1997-02-01

    The diphenyl-ether herbicides exert their phytotoxic activity by preventing chlorophyll formation in plants as a result of inhibition of protoporphyrinogen oxidase. This enzyme is the last step of the common pathway for chlorophyll and haem biosynthesis. The aim of this work is to determine whether herbicide inhibitors of plant protoporphyrinogen oxidase could act on the human protoporphyrinogen oxidase involved in haemoglobin synthesis and cause heamatologic diseases. Human erythroblastic progenitors (BFU-E/CFU-E: Burst Forming Unit-Erythroid and Colony Forming Unit-Erythroid) were exposed to oxyfluorfen, a diphenyl-ether herbicide in the presence of erythropoietin, and the haematoxicity evaluated in vitro by scoring the development of BFU-E/CFU-E colonies after 7 and 14 days of culture. The toxic effect on differentiation has been evaluated using four criteria: morphology, total protein, total porphyrin, and haemoglobin content. The study of BFU-E/CFU-E proliferation and differentiation showed a cytotoxic effect of oxyfluorfen only at very high concentrations. In contrast, haemoglobin synthesis can be inhibited by concentration of oxyfluorfen (10(-4) M) that have no adverse effect on cellular proliferation.

  11. Qing brick tea (QBT) aqueous extract protects monosodium glutamate-induced obese mice against metabolic syndrome and involves up-regulation Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) antioxidant pathway.

    Science.gov (United States)

    Gao, Wenqi; Xiao, Changyi; Hu, Jun; Chen, Biaoxin; Wang, Chunyan; Cui, Bangping; Deng, Pengyi; Yang, Jian; Deng, Zhifang

    2018-04-18

    Qing brick tea (QBT), traditional and popular beverage for Chinese people, is an important post-fermentation dark tea. Our present study was performed to investigate the ameliorative effects of QBT aqueous extract on metabolic syndrome (Mets) in monosodium glutamate-induced obese mice and the potential mechanisms. Monosodium glutamate-induced obese mice were used to evaluate the anti-Mets effects of QBT. Content levels of malonaldehyde (MDA), reactive oxygen species (ROS) and protein carbonylation, antioxidant enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione reductase (GR) in the skeletal muscle were assessed by commercial kits, respectively. Western blot and Q-PCR were used to detect the expressions of Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) signaling pathway and downstream antioxidant factors. In addition, activity of AKT signaling and expression of glucose transporter type 4 (GLUT4) in the skeletal muscle were investigated by western blot. QBT treatment limited gain of body weight, waistline and LEE index, improved insulin resistance and glucose intolerance, reduced lipid level in MSG mice. Content levels of MDA, ROS and protein carbonylation in skeletal muscle of QBT group were significantly improved compared to those of MSG mice. The antioxidant enzyme activities of SOD, GPx, CAT, and GR were increased in skeletal muscle of MSG mice intervened with QBT. After 20-week QBT treatment, Nrf2 signaling pathway and downstream antioxidant factors were both increased in the skeletal muscle. In addition, QBT treatment improved insulin signaling by preferentially augmenting AKT signaling, as well as increased the protein expression of GLUT4 in the skeletal muscle. Our results showed that QBT intake was effective in protecting monosodium glutamate-induced obese mice against metabolic syndrome and involved in the Nrf2 signaling pathway in the skeletal muscle. Copyright © 2018

  12. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    International Nuclear Information System (INIS)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-01-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  13. Dual-energy precursor and nuclear erythroid-related factor 2 activator treatment additively improve redox glutathione levels and neuron survival in aging and Alzheimer mouse neurons upstream of reactive oxygen species.

    Science.gov (United States)

    Ghosh, Debolina; LeVault, Kelsey R; Brewer, Gregory J

    2014-01-01

    To determine whether glutathione (GSH) loss or increased reactive oxygen species (ROS) are more important to neuron loss, aging, and Alzheimer's disease (AD), we stressed or boosted GSH levels in neurons isolated from aging 3xTg-AD neurons compared with those from age-matched nontransgenic (non-Tg) neurons. Here, using titrating with buthionine sulfoximine, an inhibitor of γ-glutamyl cysteine synthetase (GCL), we observed that GSH depletion increased neuronal death of 3xTg-AD cultured neurons at increasing rates across the age span, whereas non-Tg neurons were resistant to GSH depletion until old age. Remarkably, the rate of neuron loss with ROS did not increase in old age and was the same for both genotypes, which indicates that cognitive deficits in the AD model were not caused by ROS. Therefore, we targeted for neuroprotection activation of the redox sensitive transcription factor, nuclear erythroid-related factor 2 (Nrf2) by 18 alpha glycyrrhetinic acid to stimulate GSH synthesis through GCL. This balanced stimulation of a number of redox enzymes restored the lower levels of Nrf2 and GCL seen in 3xTg-AD neurons compared with those of non-Tg neurons and promoted translocation of Nrf2 to the nucleus. By combining the Nrf2 activator together with the NADH precursor, nicotinamide, we increased neuron survival against amyloid beta stress in an additive manner. These stress tests and neuroprotective treatments suggest that the redox environment is more important for neuron survival than ROS. The dual neuroprotective treatment with nicotinamide and an Nrf2 inducer indicates that these age-related and AD-related changes are reversible. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Andrographolide stimulates p38 mitogen-activated protein kinase-nuclear factor erythroid-2-related factor 2-heme oxygenase 1 signaling in primary cerebral endothelial cells for definite protection against ischemic stroke in rats.

    Science.gov (United States)

    Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong

    2016-04-01

    Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could

  15. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    Energy Technology Data Exchange (ETDEWEB)

    Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  16. [Conservation Units.

    Science.gov (United States)

    Texas Education Agency, Austin.

    Each of the six instructional units deals with one aspect of conservation: forests, water, rangeland, minerals (petroleum), and soil. The area of the elementary school curriculum with which each correlates is indicated. Lists of general and specific objectives are followed by suggested teaching procedures, including ideas for introducing the…

  17. Microcontroller Unit

    International Nuclear Information System (INIS)

    Tulaev, A.B.

    1994-01-01

    The general purpose micro controller unit based on 8-bit single-chip microcomputer of the MCS-51 family is described. The controller has the data and program memories, a serial interface and an external bus for functional I/O extensions. The controller consists of a microcomputer chip, up to 4 ROM-RAM chips and 10 SSI and MSI chips, and it measures 160x120 mm. Both hardware and software micro system debugging tools are described. (author). 8 refs., 1 fig., 1 tab

  18. Solar unit

    Energy Technology Data Exchange (ETDEWEB)

    Sukhanov, A M; Trushevskiy, S N; Tveryanovich, E V

    1982-01-01

    A solar unit is proposed which contains an inclined solar collector with supply and outlet pipelines, the first of which is connected to the source of a heat carrier, while the second is connected through the valve to the tank for collecting heated heat carrier equipped with a device for recovery. In order to improve the effectiveness of heating the heat carrier, it additionally contains a concentrator of solar radiation and a device for maintaining a level of the heat carrier in the collector in the zone of the focal spot of the concentrator, while the heat pipeline is connected to the source of the heat carrier with the help of a device for maintaining the level of the heat carrier.

  19. Termination unit

    Science.gov (United States)

    Traeholt, Chresten [Frederiksberg, DK; Willen, Dag [Klagshamn, SE; Roden, Mark [Newnan, GA; Tolbert, Jerry C [Carrollton, GA; Lindsay, David [Carrollton, GA; Fisher, Paul W [Heiskell, TN; Nielsen, Carsten Thidemann [Jaegerspris, DK

    2014-01-07

    This invention relates to a termination unit comprising an end-section of a cable. The end section of the cable defines a central longitudinal axis and comprising end-parts of N electrical phases, an end-part of a neutral conductor and a surrounding thermally insulation envelope adapted to comprising a cooling fluid. The end-parts of the N electrical phases and the end-part of the neutral conductor each comprising at least one electrical conductor and being arranged in the cable concentrically around a core former with a phase 1 located relatively innermost, and phase N relatively outermost in the cable, phase N being surrounded by the neutral conductor, electrical insulation being arrange between neighboring electrical phases and between phase N and the neutral conductor, and wherein the end-parts of the neutral conductor and the electrical phases each comprise a contacting surface electrically connected to at least one branch current lead to provide an electrical connection: The contacting surfaces each having a longitudinal extension, and being located sequentially along the longitudinal extension of the end-section of the cable. The branch current leads being individually insulated from said thermally insulation envelope by individual electrical insulators.

  20. Termination unit

    Energy Technology Data Exchange (ETDEWEB)

    Traeholt, Chresten; Willen, Dag; Roden, Mark; Tolbert, Jerry C.; Lindsay, David; Fisher, Paul W.; Nielsen, Carsten Thidemann

    2016-05-03

    Cable end section comprises end-parts of N electrical phases/neutral, and a thermally-insulation envelope comprising cooling fluid. The end-parts each comprises a conductor and are arranged with phase 1 innermost, N outermost surrounded by the neutral, electrical insulation being between phases and N and neutral. The end-parts comprise contacting surfaces located sequentially along the longitudinal extension of the end-section. A termination unit has an insulating envelope connected to a cryostat, special parts at both ends comprising an adapter piece at the cable interface and a closing end-piece terminating the envelope in the end-section. The special parts houses an inlet and/or outlet for cooling fluid. The space between an inner wall of the envelope and a central opening of the cable is filled with cooling fluid. The special part at the end connecting to the cryostat houses an inlet or outlet, splitting cooling flow into cable annular flow and termination annular flow.

  1. SI units in radiology

    Energy Technology Data Exchange (ETDEWEB)

    Iyer, P S [Bhabha Atomic Research Centre, Bombay (India). Div. of Radiation Protection

    1978-11-01

    The proposal of the International Commission on Radiation Units and Measurements that the special units of radiation and radioactivity-roentgen, rad, rem and curie-be replaced by the International System (SI) of Units has been accepted by international bodies. This paper reviews the resons for introducing the new units and their features. The relation between the special units and the corresponding SI units is discussed with examples. In spite of anticipated difficulties, the commission recommends a smooth and efficient changeover to the SI units in ten years.

  2. Unit Cost Compendium Calculations

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Unit Cost Compendium (UCC) Calculations raw data set was designed to provide for greater accuracy and consistency in the use of unit costs across the USEPA...

  3. United States housing, 2012

    Science.gov (United States)

    Delton Alderman

    2013-01-01

    Provides current and historical information on housing market in the United States. Information includes trends for housing permits and starts, housing completions for single and multifamily units, and sales and construction. This report will be updated annually.

  4. United Cerebral Palsy

    Science.gov (United States)

    ... your local affiliate Find your local affiliate United Cerebral Palsy United Cerebral Palsy (UCP) is a trusted resource for individuals with Cerebral Palsy and other disabilities and their networks. Individuals with ...

  5. Malaria Treatment (United States)

    Science.gov (United States)

    ... Providers, Emergency Consultations, and General Public. Contact Us Malaria Treatment (United States) Recommend on Facebook Tweet Share Compartir Treatment of Malaria: Guidelines For Clinicians (United States) Download PDF version ...

  6. Delayed myelosuppression with acute exposure to hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and environmental degradation product hexahydro-1-nitroso-3,5-dinitro-1,3,5-triazine (MNX) in rats

    Energy Technology Data Exchange (ETDEWEB)

    Jaligama, Sridhar; Kale, Vijay M.; Wilbanks, Mitchell S. [Department of Toxicology, College of Pharmacy, University of Louisiana at Monroe, Monroe, LA 71209 (United States); Perkins, Edward J. [US Army Engineer Research and Development Center, Vicksburg, MS 39180 (United States); Meyer, Sharon A., E-mail: meyer@ulm.edu [Department of Toxicology, College of Pharmacy, University of Louisiana at Monroe, Monroe, LA 71209 (United States)

    2013-02-01

    Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), a widely used munitions compound, and hexahydro-1-nitroso-3,5-dinitro-1,3,5-triazine (MNX), its N-nitroso product of anaerobic microbial nitroreduction, are contaminants of military sites. Previous studies have shown MNX to be the most acutely toxic among the nitroreduced degradation products of RDX and to cause mild anemia at high dose. The present study compares hematotoxicity with acute oral exposure to MNX with parent RDX. Both RDX and MNX caused a modest decrease in blood hemoglobin and ∼ 50% loss of granulocytes (NOAELs = 47 mg/kg) in female Sprague–Dawley rats observed 14 days post-exposure. We explored the possibility that blood cell loss observed after 14 days was delayed in onset because of toxicity to bone marrow (BM) progenitors. RDX and MNX decreased granulocyte/macrophage-colony forming cells (GM-CFCs) at 14, but not 7, days (NOAELs = 24 mg/kg). The earliest observed time at which MNX decreased GM-CFCs was 10 days post-exposure. RDX and MNX likewise decreased BM burst-forming units-erythroid (BFU-Es) at 14, but not 7, days. Granulocyte–erythrocyte–monocyte–megakaryocyte (GEMM)-CFCs were unaffected by RDX and MNX at 7 days suggesting precursor depletion did not account for GM-CFC and BFU-E loss. MNX added to the culture media was without effect on GM-CFC formation indicating no direct inhibition. Flow cytometry showed no differential loss of BM multilineage progenitors (Thy1.1{sup +}) or erythroid (CD71{sup +}) precursors with MNX suggesting myeloid and erythroid lineages were comparably affected. Collectively, these data indicate that acute exposure to both RDX and MNX caused delayed suppression of myelo- and erythropoiesis with subsequent decrease of peripheral granulocytes and erythrocytes. Highlights: ► Acute oral exposure to munitions RDX causes myelosuppression. ► Environmental degradation product MNX is comparable in effect. ► RDX and MNX are cytotoxic to both myeloid and erythroid

  7. Sulforaphane Inhibits Lipopolysaccharide-Induced Inflammation, Cytotoxicity, Oxidative Stress, and miR-155 Expression and Switches to Mox Phenotype through Activating Extracellular Signal-Regulated Kinase 1/2-Nuclear Factor Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway in Murine Microglial Cells.

    Science.gov (United States)

    Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin

    2018-01-01

    Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.

  8. Peripheral blood cells from children with RASopathies show enhanced spontaneous colonies growth in vitro and hyperactive RAS signaling

    International Nuclear Information System (INIS)

    Gaipa, G; Bugarin, C; Cianci, P; Sarno, J; Bonaccorso, P; Biondi, A; Selicorni, A

    2015-01-01

    Germline mutations in genes coding for molecules involved in the RAS/RAF/MEK/ERK pathway are the hallmarks of a newly classified family of autosomal dominant syndromes termed RASopathies. Myeloproliferative disorders (MPDs), in particular, juvenile myelomonocytic leukemia, can lead to potentially severe complications in children with Noonan syndrome (NS). We studied 27 children with NS or other RASopathies and 35 age-matched children as control subjects. Peripheral blood (PB) cells from these patients were studied for in vitro colony-forming units (CFUs) activity, as well as for intracellular phosphosignaling. Higher spontaneous growth of both burst-forming units-erythroid (BFU-E) and CFU-granulocyte/macrophage (CFU-GM) colonies from RAS-mutated patients were observed as compared with control subjects. We also observed a significantly higher amount of GM-colony-stimulating factor-induced p-ERK in children with RASopathies. Our findings demonstrate for the first time that PB cells isolated from children suffering from NS or other RASopathies without MPD display enhanced BFU-E and CFU-GM colony formation in vitro. The biological significance of these findings clearly awaits further studies. Collectively, our data provide a basis for further investigating of only partially characterized hematological alterations present in children suffering from RASopathies, and may provide new markers for progression toward malignant MPD in these patients

  9. A multiplicity logic unit

    International Nuclear Information System (INIS)

    Bialkowski, J.; Moszynski, M.; Zagorski, A.

    1981-01-01

    The logic diagram principle of operation and some details of the design of the multiplicity logic unit are presented. This unit was specially designed to fulfil the requirements of a multidetector arrangement for gamma-ray multiplicity measurements. The unit is equipped with 16 inputs controlled by a common coincidence gate. It delivers a linear output pulse with the height proportional to the multiplicity of coincidences and logic pulses corresponding to 0, 1, ... up to >= 5-fold coincidences. These last outputs are used to steer the routing unit working with the multichannel analyser. (orig.)

  10. ENERGY STAR Unit Reports

    Data.gov (United States)

    Department of Housing and Urban Development — These quarterly Federal Fiscal Year performance reports track the ENERGY STAR qualified HOME units that Participating Jurisdictions record in HUD's Integrated...

  11. 31 CFR 515.321 - United States; continental United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States; continental United... General Definitions § 515.321 United States; continental United States. The term United States means the United States and all areas under the jurisdiction or authority thereof, including the Trust Territory of...

  12. 31 CFR 500.321 - United States; continental United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States; continental United... General Definitions § 500.321 United States; continental United States. The term United States means the United States and all areas under the jurisdiction or authority thereof, including U.S. trust territories...

  13. 31 CFR 535.321 - United States; continental United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States; continental United... General Definitions § 535.321 United States; continental United States. The term United States means the United States and all areas under the jurisdiction or authority thereof including the Trust Territory of...

  14. Neighbors United for Health

    Science.gov (United States)

    Westhoff, Wayne W.; Corvin, Jaime; Virella, Irmarie

    2009-01-01

    Modeled upon the ecclesiastic community group concept of Latin America to unite and strengthen the bond between the Church and neighborhoods, a community-based organization created Vecinos Unidos por la Salud (Neighbors United for Health) to bring health messages into urban Latino neighborhoods. The model is based on five tenants, and incorporates…

  15. Smart Rocking Armour Units

    NARCIS (Netherlands)

    Hofland, B.; Arefin, Syed Shamsil; van der Lem, Cock; van gent, Marcel

    2018-01-01

    This paper describes a method to measure the rocking motion of lab-scale armour units. Sensors as found in mobile phones are used. These sensors, data-storage and battery are all embedded in the model units, such that they can be applied without wires attached to them. The technique is applied to

  16. METRIC context unit architecture

    Energy Technology Data Exchange (ETDEWEB)

    Simpson, R.O.

    1988-01-01

    METRIC is an architecture for a simple but powerful Reduced Instruction Set Computer (RISC). Its speed comes from the simultaneous processing of several instruction streams, with instructions from the various streams being dispatched into METRIC's execution pipeline as they become available for execution. The pipeline is thus kept full, with a mix of instructions for several contexts in execution at the same time. True parallel programming is supported within a single execution unit, the METRIC Context Unit. METRIC's architecture provides for expansion through the addition of multiple Context Units and of specialized Functional Units. The architecture thus spans a range of size and performance from a single-chip microcomputer up through large and powerful multiprocessors. This research concentrates on the specification of the METRIC Context Unit at the architectural level. Performance tradeoffs made during METRIC's design are discussed, and projections of METRIC's performance are made based on simulation studies.

  17. l-2-Oxothiazolidine-4-Carboxylic Acid or α-Lipoic Acid Attenuates Airway Remodeling: Involvement of Nuclear Factor-κB (NF-κB, Nuclear Factor Erythroid 2p45-Related Factor-2 (Nrf2, and Hypoxia-Inducible Factor (HIF

    Directory of Open Access Journals (Sweden)

    Heung Bum Lee

    2012-06-01

    Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.

  18. Decision unit program

    International Nuclear Information System (INIS)

    Madjar, N.; Pastor, C.; Chambon, B.; Drain, D.; Giorni, A.; Dauchy, A.

    1981-01-01

    A decision unit has been built to simplify the electronic logic set-up in multi-detectors experiments. This unit, designed with fast memories used as decision making tables, replaces conventional logic modules. Nine inputs are provided for receiving the fast detector signals (charged particles, gammas, neutrons, ...). Fifteen independent outputs allow the identification of the choosen events among the 2 9 possible events. A CAMAC interface between the unit and the computer, or a manual control auxiliary module, is used to load, in the memory, the pattern of the choosen events [fr

  19. Smart Rocking Armour Units

    OpenAIRE

    Hofland, B.; Arefin, Syed Shamsil; van der Lem, Cock; van gent, Marcel

    2018-01-01

    This paper describes a method to measure the rocking motion of lab-scale armour units. Sensors as found in mobile phones are used. These sensors, data-storage and battery are all embedded in the model units, such that they can be applied without wires attached to them. The technique is applied to double-layer units in order to compare the results to the existing knowledge for this type of armour layers. In contrast to previous research, the gyroscope reading is used to determine the (rocking)...

  20. Allocating multiple units

    DEFF Research Database (Denmark)

    Tranæs, Torben; Krishna, Kala

    2002-01-01

    This paper studies the allocation and rent distribution in multi-unit, combinatorial-bid auctions under complete information. We focus on the natural multi-unit analogue of the first-price auction, where buyers bid total payments, pay their bids, and where the seller allocates goods to maximize his...... auction, which is the multi unit analogue of a second-price auction. Furthermore, we characterize these equilibria when valuations take a number of different forms: diminishing marginal valuations, increasing average valuations, and marginal valuations with single turning points...

  1. The capacity of peripheral blood stem cells mobilised with chemotherapy plus G-CSF to repopulate irradiated marrow stroma in vitro is similar to that of bone marrow

    International Nuclear Information System (INIS)

    Demuynck, H.; Dexter, T.M.; Testa, N.G.; Pettengell, R.; Campos, E. de

    1992-01-01

    After treatment of patients with intermediate or high grade non-Hodgkin lymphoma with chemotherapy plus G-CSF the numbers of haemopoietic progenitor cells in the circulation increased to a mean of 226-fold for mixed CFC (Mix-CFC), 278-fold for GM-CFC and 29-fold for erythroid burst forming unit (BFU-E). The mean increase was modest (7-12-fold) for patients treated with chemotherapy alone. Peripheral blood mononuclear cells harvested at the time of the peak in the numbers of progenitors, or 2-4 days before the peak, seeded onto irradiated marrow stroma in vitro, repopulated the stroma and generated active haemopoiesis at least as effectively as bone marrow cells on a cell per cell basis. This is in contrast to the poor repopulating capacity of pretreatment blood. The results indicate that not only the progenitor cells, but also the repopulating stem cells migrated into the blood after chemotherapy plus G-CSF in sufficient numbers to allow harvesting and successful grafting without the possible complication of late haemopoietic failure. (author)

  2. Presence of calreticulin mutations in JAK2-negative polycythemia vera.

    Science.gov (United States)

    Broséus, Julien; Park, Ji-Hye; Carillo, Serge; Hermouet, Sylvie; Girodon, François

    2014-12-18

    Calreticulin (CALR) mutations have been reported in Janus kinase 2 (JAK2)- and myeloproliferative leukemia (MPL)-negative essential thrombocythemia and primary myelofibrosis. In contrast, no CALR mutations have ever been reported in the context of polycythemia vera (PV). Here, we describe 2 JAK2(V617F)-JAK2(exon12)-negative PV patients who presented with a CALR mutation in peripheral granulocytes at the time of diagnosis. In both cases, the CALR mutation was a 52-bp deletion. Single burst-forming units-erythroid (BFU-E) from 1 patient were grown in vitro and genotyped: the same CALR del 52-bp mutation was noted in 31 of the 37 colonies examined; 30 of 31 BFU-E were heterozygous for CALR del 52 bp, and 1 of 31 BFU-E was homozygous for CALR del 52 bp. In summary, although unknown mutations leading to PV cannot be ruled out, our results suggest that CALR mutations can be associated with JAK2-negative PV. © 2014 by The American Society of Hematology.

  3. Farnesyltransferase inhibitor tipifarnib (R115777) preferentially inhibits in vitro autonomous erythropoiesis of polycythemia vera patient cells.

    Science.gov (United States)

    Larghero, Jérôme; Gervais, Nathalie; Cassinat, Bruno; Rain, Jean-Didier; Schlageter, Marie-Hélène; Padua, Rose Ann; Chomienne, Christine; Rousselot, Philippe

    2005-05-01

    Polycythemia vera (PV) is an acquired myeloproliferative disorder with primary expansion of the red cell mass leading to an increased risk of thrombosis and less frequently to myelofibrosis and secondary acute leukemia. Standard therapies include cytoreduction with either phlebotomy or chemotherapeutic agents and antithrombotic drugs. Because long-term exposure to cytotoxic chemotherapy may increase the risk of acute transformation, new therapeutic options are needed. Tipifarnib is a nonpeptidomimetic inhibitor of farnesyl transferase that was developed as a potential inhibitor of RAS signaling. In the present study we report that tipifarnib used at pharmacologically achievable concentrations strongly inhibits the erythroid burst-forming unit (BFU-E) autonomous growth that characterizes patients with PV. Moreover, at low tipifarnib concentrations (0.15 muM), the inhibitory effect was preferentially observed in PV BFU-E progenitors and not in normal BFU-E progenitors and was not rescued by erythropoietin (EPO). Thus tipifarnib may specifically target PV stem cells and may be of clinical interest in the treatment of patients with PV.

  4. Preventive effect of ganoderma lucidum (Reishi) on the suppression of hematopoietic system by X-ray irradiation

    International Nuclear Information System (INIS)

    Itoh, Hiroko; Nakata, Fukuyoshi; Sasaki, Hiroyuki; Ito, Hitoshi

    2013-01-01

    Reishi has been used for a roborant or the elixir of life from ancient times. In the present study, the preventive effects of Reishi on hematopoietic suppression from X-ray irradiation in mice were investigated. 5.0 Gy-irradiated mice induced the decrease of red blood cell, platelet, white blood cell, granulocytes, the index of spleen and thymus, and the number of spleen cells. Oral administration of Reishi tended to decrease these damage on hematopoiesis, and reticuloendothelial system. Reishi enhanced the degree of spleen cells-mediated sheep red blood cells (SRBC) hemolysis (quantitative hemolysis of SRBC). Reishi augmented the level of erythroid burst-forming cell (BFU-E), and accelerated the recovery of the number of BFU-E in X-irradiated mice, although Reishi did not influence red blood cell counts and colony-forming unit-erythropoetin dependent (CFU-E) number. A significant elevation in the CFU-GM (granulocytes-macrophages) level was observed. Histological examinations revealed that Reishi accerelated the hematopoietic recovery and decrease on damage of spleen and thymus. (author)

  5. Tax Unit Boundaries

    Data.gov (United States)

    Kansas Data Access and Support Center — The Statewide GIS Tax Unit boundary file was created through a collaborative partnership between the State of Kansas Department of Revenue Property Valuation...

  6. Insects: An Interdisciplinary Unit

    Science.gov (United States)

    Leger, Heather

    2007-01-01

    The author talks about an interdisciplinary unit on insects, and presents activities that can help students practice communication skills (interpersonal, interpretive, and presentational) and learn about insects with hands-on activities.

  7. UnitedHealth Group

    Science.gov (United States)

    UnitedHealth Group provides accessible and affordable services, improved quality of care, coordinated health care efforts, and a supportive environment for shared decision making between patients and their physicians.

  8. Operable Unit Boundaries

    Data.gov (United States)

    U.S. Environmental Protection Agency — This dataset consists of operable unit data from multiple Superfund sites in U.S. EPA Region 8. These data were acquired from multiple sources at different times and...

  9. Flywheel and power unit

    Energy Technology Data Exchange (ETDEWEB)

    Seeley, R.W.

    1992-10-28

    A power unit, e.g. for an electrically driven vehicle, incorporates a flywheel for storing kinetic energy and a battery for storing electrical energy. The battery is incorporated as a substantial part of the rotating mass of the flywheel. Preferably the unit further includes an electrical machine being a motor or generator or machine operable either as a motor or a generator for transferring energy between the battery and the flywheel and/or for the input or output of rotary energy therefrom or thereto. The motor may be used for powering the flywheel and may also operate in a regenerative mode for recharging the unit on de-acceleration of the vehicle. The unit of the invention may also be utilized as an electrical stored power source, e.g. wind or water driven. (author)

  10. Does size matter? Animal units and animal unit months

    Science.gov (United States)

    Lamar Smith; Joe Hicks; Scott Lusk; Mike Hemmovich; Shane Green; Sarah McCord; Mike Pellant; John Mitchell; Judith Dyess; Jim Sprinkle; Amanda Gearhart; Sherm Karl; Mike Hannemann; Ken Spaeth; Jason Karl; Matt Reeves; Dave Pyke; Jordan Spaak; Andrew Brischke; Del Despain; Matt Phillippi; Dave Weixelmann; Alan Bass; Jessie Page; Lori Metz; David Toledo; Emily Kachergis

    2017-01-01

    The concepts of animal units, animal unit months, and animal unit equivalents have long been used as standards for range management planning, estimating stocking rates, reporting actual use, assessing grazing fees, ranch appraisal, and other purposes. Increasing size of cattle on rangelands has led some to suggest that the definition of animal units and animal unit...

  11. UniTed

    OpenAIRE

    Harma, Eero

    2010-01-01

    UniTed on Teddy boy- tyylistä inspiroitunut kevät/kesä mallisto naisille.Mallistossa yhdistyy perinteinen teddy boy- vaatetus ja klassinen feminiinisyys, sekä menneisyys ja nykyisyys. Suunnittelun lähtökohtia olivat naisellisuus, tyylikkyys ja pyrkimys luoda nykyaikaista suunnittelua menneisyydestä lainaillen. United is a teddy boy- style inspired spring/summer collection for women. The collection combines traditional Teddy boy style with classical feminity and past with the present. The b...

  12. Freestanding midwifery unit versus obstetric unit

    DEFF Research Database (Denmark)

    Overgaard, Charlotte; Møller, Anna Margrethe; Fenger-Grøn, Morten

    2011-01-01

    low-risk women intending FMU birth and a matched control group of 839 low-risk women intending OU birth were included at the start of care in labour. OU women were individually chosen to match selected obstetric/socio-economic characteristics of FMU women. Analysis was by intention to treat. Main......Objective To compare perinatal and maternal morbidity and birth interventions in low-risk women giving birth in two freestanding midwifery units (FMUs) and two obstetric units (OUs). Design A cohort study with a matched control group. Setting The region of North Jutland, Denmark. Participants 839...... women were significantly less likely to experience an abnormal fetal heart rate (RR: 0.3, 95% CI 0.2 to 0.5), fetal–pelvic complications (0.2, 0.05 to 0.6), shoulder dystocia (0.3, 0.1 to 0.9), occipital–posterior presentation (0.5, 0.3 to 0.9) and postpartum haemorrhage >500 ml (0.4, 0.3 to 0...

  13. Rapanos v. United States & Carabell v. United States

    Science.gov (United States)

    Documents associated with guidance for implementing the definition of waters of the United States under the Clean Water Act following the Rapanos v. United States, and Carabell v. United States Supreme Court decision.

  14. Gas-centrifuge unit

    International Nuclear Information System (INIS)

    Stark, T.M.

    1977-01-01

    An isotope-enrichment unit is described for separating a gaseous mixture feedstock including a compound of a light nuclear isotope at a predetermined concentration and a compound of a heavy nuclear isotope at a predetermined concentration into at least two unit-output fractions including a waste fraction depleted in the light isotope to a predetermined concentration and a product fraction enriched in the light isotope to a predetermined concentration. The unit comprises a first group of cascades of gas centrifuges, each cascade having an enriching stage, a stripping stage, an input, a light-fraction output, and a heavy-fraction output for separating the gaseous-mixture feed stock into light and heavy gaseous-mixture fractions; and an auxillary cascade

  15. Mechanical strainer unit

    International Nuclear Information System (INIS)

    Kraeling, J.B.; Netkowicz, R.J.; Schnall, I.H.

    1983-01-01

    The mechanical strainer unit is connected to a flanged conduit which originates in and extends out of a suppression chamber in a nuclear reactor. The strainer includes a plurality of centrally apertured plates positioned along a common central axis and in parallel and spaced relationship. The plates have a plurality of bores radially spaced about the central axis. Spacer means such as washers are positioned between adjacent plates to maintain the plates is spaced relationship and form communicating passages of a predetermined size to the central apertures. Connecting means such as bolts or studs extend through the aligned bores to maintain the unit in assembled relationship and secure the unit to the pipe. By employing perforated plates and blocking off certain of the communicating passages, a dual straining effect can be achieved

  16. Mobile emergency response unit

    International Nuclear Information System (INIS)

    Kadi, W.J.; Trolan, R.T.; Becker, J.F.

    1979-01-01

    The Hotspot quick-response unit was the solution to a requirement to find, identify, and control areas of radioactive contamination at the scene of a nuclear weapons accident. The unit consists of two trucks and two trailers, and is designed to be transported by one U.S. Air Force C-141. One truck (generator truck) carries a 40 kW generator-heater-air conditioner combination, spare tires, and accessories. The other (water truck) carries supplies and a 250-gal water tank. One trailer (counting trailer) contains detecting, counting, and recording equipment. The other (decontaminating trailer) contains a shower, sink, 30-gal hot water tank, and supplies

  17. Transfer of manufacturing units

    DEFF Research Database (Denmark)

    Madsen, Erik Skov; Riis, Jens Ove; Sørensen, Brian Vejrum

    2008-01-01

    The ongoing and unfolding relocation of activities is one of the major trends, that calls for attention in the domain of operations management. In particular, prescriptive models outlining: stages of the process, where to locate, and how to establish the new facilities have been studied, while...... and dilemmas to be addressed when transferring manufacturing units....

  18. United States Attorney Prosecutions

    Science.gov (United States)

    1993-10-01

    property of CocaCola Bottling Company, Fayetteville, North Carolina, of a value in excess of $100.00, in violation of Title 18 United States Code, Section...another, to-wit: a Cocacola soft drink machine, the amount of damage to said personal property being more than $200.00, in violation of North Carolina

  19. Planter unit test stand

    Science.gov (United States)

    A planter test stand was developed to evaluate individual row-crop metering units in early 2013. This test stand provided the ability to quantify actual seed metering in terms of population, seed spacing, skips, and multiples over a range of meter RPMs and vacuum pressures. Preliminary data has been...

  20. United Kingdom's experience

    International Nuclear Information System (INIS)

    Drummond, S.M.

    1994-01-01

    This is a presentation of the United Kingdom's experience with power transmission open access. The topics of the presentation include the objectives of changing, commercial arrangements and economic drivers, long term effects, the effects of moving to a more competitive environment, and factors affecting open access such as political climate and market regulation

  1. Whale Teaching Unit.

    Science.gov (United States)

    Peninsula Humane Society, San Mateo, CA.

    Materials in this teaching unit are designed to foster an interest in whale preservation among intermediate grade and junior high school students. Several readings provide background information on various types of whales and the economic value of whales. Student activities include a true and false game, a crossword, and a mobile. A resource list…

  2. Multifunctional centrifugal grinding unit

    Science.gov (United States)

    Sevostyanov, V. S.; Uralskij, V. I.; Uralskij, A. V.; Sinitsa, E. V.

    2018-03-01

    The article presents scientific and engineering developments of multifunctional centrifugal grinding unit in which the selective effect of grinding bodies on the crushing material is realized, depending on its physical and mechanical characteristics and various schemes for organizing the technological process

  3. United in change

    NARCIS (Netherlands)

    Hanneke Posthumus; Josje den Ridder; Joep de Hart

    2014-01-01

    Original title: Verenigd in verandering The importance of citizens who unite in civil society organisations is broadly recognised. Organisations bind people to each other, to the community and to the political system. How are civil-society organisations in the Netherlands faring? Is there

  4. Unit III: International Conflict.

    Science.gov (United States)

    Maxey, Phyllis

    1983-01-01

    This lesson helps students understand the global network involved in international events. Students have an opportunity to examine the impact of international law and the role of international organizations, national governments, and private individuals in the effort to secure the release of United States hostages in Iran. (AM)

  5. Unit 16 - Output

    OpenAIRE

    Unit 16, CC in GIS; Star, Jeffrey L.

    1990-01-01

    This unit discusses issues related to GIS output, including the different types of output possible and the hardware for producing each. It describes text, graphic and digital data that can be generated by a GIS as well as line printers, dot matrix printers/plotters, pen plotters, optical scanners and cathode ray tubes (CRTs) as technologies for generating the output.

  6. Defining line replaceable units

    NARCIS (Netherlands)

    Parada Puig, J. E.; Basten, R. J I

    2015-01-01

    Defective capital assets may be quickly restored to their operational condition by replacing the item that has failed. The item that is replaced is called the Line Replaceable Unit (LRU), and the so-called LRU definition problem is the problem of deciding on which item to replace upon each type of

  7. Studies of the erythroid inductive microenvironment in vitro

    International Nuclear Information System (INIS)

    van Zant, G.; Goldwasser, E.; Pech, N.

    1977-01-01

    Spleen cells from radiated mice (XS), but not from normal mice (NS), when combined with mouse marrow cells in vitro, had two effects on hemoglobin synthesis: (1) increased baseline, and (2) augmented erythropoietin-induced, hemoglobin formation. Spleen cells from normal and radiated rats caused increased hemoglobin synthesis by rat marrow cells in a dose-dependent manner. In addition, lung and thymus cells from radiated rats, but not from normal rats, caused increased hemoglobin synthesis by rat marrow cells. Rat NS augmented hemoglobin formation by mouse marrow, but neither mouse NS nor mouse XS had an effect on rat marrow. Medium from rat NS cultures stimulated hemoglobin synthesis when added to rat marrow cells. The increases in baseline, and in the response to erythropoietin, were dependent on the amount of ''conditioned medium.'' The substance in the medium responsible for these effects was not erythropoietin

  8. Contamination analysis unit

    International Nuclear Information System (INIS)

    Gregg, H.R.; Meltzer, M.P.

    1996-01-01

    The portable Contamination Analysis Unit (CAU) measures trace quantities of surface contamination in real time. The detector head of the portable contamination analysis unit has an opening with an O-ring seal, one or more vacuum valves and a small mass spectrometer. With the valve closed, the mass spectrometer is evacuated with one or more pumps. The O-ring seal is placed against a surface to be tested and the vacuum valve is opened. Data is collected from the mass spectrometer and a portable computer provides contamination analysis. The CAU can be used to decontaminate and decommission hazardous and radioactive surfaces by measuring residual hazardous surface contamination, such as tritium and trace organics. It provides surface contamination data for research and development applications as well as real-time process control feedback for industrial cleaning operations and can be used to determine the readiness of a surface to accept bonding or coatings. 1 fig

  9. Combustion strategy : United Kingdom

    Energy Technology Data Exchange (ETDEWEB)

    Greenhalgh, D. [Heriot-Watt Univ., Edingburgh, Scotland (United Kingdom). School of Engineering and Physical Sciences

    2009-07-01

    The United Kingdom's combustion strategy was briefly presented. Government funding sources for universities were listed. The United Kingdom Research Councils that were listed included the Arts and Humanities Research Council (AHRC) and the Biotechnology and Biological Sciences Research Council (BBSRC); the Engineering and Physical Sciences Research Council (EPSRC); the Economic and Social Research Council; the Medical Research Council; the Natural Environment Research Council; and the Science and Technology Facilities Council. The EPSRC supported 65 grants worth 30.5 million pounds. The combustion industry was noted to be dominated by three main players of which one was by far the largest. The 3 key players were Rolls-Royce; Jaguar Land Rover; and Doosan Babcock. Industry and government involvement was also discussed for the BIS Technology Strategy Board, strategy technology areas, and strategy application areas.

  10. Uranium chemistry research unit

    International Nuclear Information System (INIS)

    Anon.

    1978-01-01

    The initial field of research of this Unit, established in 1973, was the basic co-ordination chemistry of uranium, thorium, copper, cobalt and nickel. Subsequently the interest of the Unit extended to extractive metallurgy relating to these metals. Under the term 'co-ordination chemistry' is understood the interaction of the central transition metal ion with surrounding atoms in its immediate vicinity (within bonding distance) and the influence they have on each other - for example, structural studies for determining the number and arrangement of co-ordinated atoms and spectrophotometric studies to establish how the f electron energy levels of uranium are influenced by the environment. New types of uranium compounds have been synthesized and studied, and the behaviour of uranium ions in non-aqueous systems has also received attention. This work can be applied to the development and study of extractants and new extractive processes for uranium

  11. Laser color recording unit

    Science.gov (United States)

    Jung, E.

    1984-05-01

    A color recording unit was designed for output and control of digitized picture data within computer controlled reproduction and picture processing systems. In order to get a color proof picture of high quality similar to a color print, together with reduced time and material consumption, a photographic color film material was exposed pixelwise by modulated laser beams of three wavelengths for red, green and blue light. Components of different manufacturers for lasers, acousto-optic modulators and polygon mirrors were tested, also different recording methods as (continuous tone mode or screened mode and with a drum or flatbed recording principle). Besides the application for the graphic arts - the proof recorder CPR 403 with continuous tone color recording with a drum scanner - such a color hardcopy peripheral unit with large picture formats and high resolution can be used in medicine, communication, and satellite picture processing.

  12. Optimally Locating MARFORRES Units

    OpenAIRE

    Salmeron, Javier; Dell, Rob

    2015-01-01

    Javier Salmeron and Rob Dell The U.S. Marine Forces Reserve (USMCR, MARFORRES) is conducting realignment studies where discretionary changes may benefit from formal mathematical analysis. This study has developed an optimization tool to guide and/or support Commander, MARFORRES (CMFR) decisions. A prototype of the optimization tool has been tested with data from the units and Reserve Training Centers (RTCs) in the San Francisco, CA and Sacramento, CA areas. Prepared for: MARFORRES, POC:...

  13. LIDAR COMBINED SCANNING UNIT

    Directory of Open Access Journals (Sweden)

    V. V. Elizarov

    2016-11-01

    Full Text Available Subject of Research. The results of lidar combined scanning unit development for locating leaks of hydrocarbons are presented The unit enables to perform high-speed scanning of the investigated space in wide and narrow angle fields. Method. Scanning in a wide angular field is produced by one-line scanning path by means of the movable aluminum mirror with a frequency of 20Hz and amplitude of 20 degrees of swing. Narrowband scanning is performed along a spiral path by the deflector. The deflection of the beam is done by rotation of the optical wedges forming part of the deflector at an angle of ±50. The control function of the scanning node is performed by a specialized software product written in C# programming language. Main Results. This scanning unit allows scanning the investigated area at a distance of 50-100 m with spatial resolution at the level of 3 cm. The positioning accuracy of the laser beam in space is 15'. The developed scanning unit gives the possibility to browse the entire investigated area for the time not more than 1 ms at a rotation frequency of each wedge from 50 to 200 Hz. The problem of unambiguous definition of the beam geographical coordinates in space is solved at the software level according to the rotation angles of the mirrors and optical wedges. Lidar system coordinates are determined by means of GPS. Practical Relevance. Development results open the possibility for increasing the spatial resolution of scanning systems of a wide range of lidars and can provide high positioning accuracy of the laser beam in space.

  14. Radiation quantities and units

    International Nuclear Information System (INIS)

    1980-01-01

    This report supersedes ICRU Report 19. Since ICRU Report 19 was published, a number of discussions have taken place between members of the Report Committee on Fundamental Quantities and Units and other workers in the field. Some of these discussions have resulted in the acceptance of certain modifications in the material set out in Report 19 and these modifications are incorporated in the current report. In addition, there has been some expansion and rearrangement of the material in the earlier report. In line, with providing more didactic material and useful source material for other ICRU reports, the general considerations in subsection 1.A of Report 19 have been expanded and placed in a separate subsection. The additional material includes discussions of four terms that are used in this document - quantity, unit, stochastic, and non-stochastic - along with a brief discussion of the mathematical formalism used in ICRU reports. As in ICRU Report 19, the definitions of quantities and units specifically designed for radiation protection (Part B) are separated from those of the general quantities (Part A). The inclusion of the index concept outlined in ICRU Report 25[4] required an extension of Part B

  15. United States rejoin ITER

    International Nuclear Information System (INIS)

    Roberts, M.

    2003-01-01

    Upon pressure from the United States Congress, the US Department of Energy had to withdraw from further American participation in the ITER Engineering Design Activities after the end of its commitment to the EDA in July 1998. In the years since that time, changes have taken place in both the ITER activity and the US fusion community's position on burning plasma physics. Reflecting the interest in the United States in pursuing burning plasma physics, the DOE's Office of Science commissioned three studies as part of its examination of the option of entering the Negotiations on the Agreement on the Establishment of the International Fusion Energy Organization for the Joint Implementation of the ITER Project. These were a National Academy Review Panel Report supporting the burning plasma mission; a Fusion Energy Sciences Advisory Committee (FESAC) report confirming the role of ITER in achieving fusion power production, and The Lehman Review of the ITER project costing and project management processes (for the latter one, see ITER CTA Newsletter, no. 15, December 2002). All three studies have endorsed the US return to the ITER activities. This historical decision was announced by DOE Secretary Abraham during his remarks to employees of the Department's Princeton Plasma Physics Laboratory. The United States will be working with the other Participants in the ITER Negotiations on the Agreement and is preparing to participate in the ITA

  16. United States advanced technologies

    International Nuclear Information System (INIS)

    Longenecker, J.R.

    1985-01-01

    In the United States, the advanced technologies have been applied to uranium enrichment as a means by which it can be assured that nuclear fuel cost will remain competitive in the future. The United States is strongly committed to the development of advanced enrichment technology, and has brought both advanced gas centrifuge (AGC) and atomic vapor laser isotope separation (AVLIS) programs to a point of significant technical refinement. The ability to deploy advanced technologies is the basis for the confidence in competitive future price. Unfortunately, the development of advanced technologies is capital intensive. The year 1985 is the key year for advanced technology development in the United States, since the decision on the primary enrichment technology for the future, AGC or AVLIS, will be made shortly. The background on the technology selection process, the highlights of AGC and AVLIS programs and the way to proceed after the process selection are described. The key objective is to maximize the sales volume and minimize the operating cost. This will help the utilities in other countries supply low cost energy on a reliable, long term basis. (Kako, I.)

  17. The Military Emergency Unit

    International Nuclear Information System (INIS)

    Gonzalez Requena, J. M.

    2007-01-01

    One of the most justified and pressing demands that society makes of the State, requiring a fast, forceful and effective response, is that it guarantees the safety of people and their assets when a disaster seriously endangers them. At the proposal of the President of the Government, the Cabinet of Ministers, in its meeting held on October 7, 2005, agreed to create the Military Emergency Unit, known since the as the UME. Its mission is to intervene anywhere in the national territory when the President of the Government, or the Minister to whom he delegates, so decides in order to assure the safety and welfare of citizens in cases of serious risk, disaster, catastrophe or any other public need. The UME is organically incorporated into the Ministry of Defense and its actions may be supported with all the available human and material needs of the Armed Forces. Availability and effectiveness, with calmness and humility, have characterized the early actions of the Military Emergency Unit and are the guidelines for future action. The first steps of this military unit have focused on a clear goal: collaboration and participation in situations whose seriousness requires the coordination of different forces in order to immediately respond to them. The UME is the States tool to join forces and, with other administration and institutions, help to rapidly and effectively deal with emergencies. It has taken its first step and achieved the capacity specified in the UME Operations Order for 2007. The 150 men and women per battalion, plus the 80 in the Gando detachment, are on active duty and have sufficient material means to deploy, if necessary and when requested by the regions, town councils an other administrative bodies, to help in the extinction of forest fires. (Author)

  18. Decommissioning Unit Cost Data

    International Nuclear Information System (INIS)

    Sanford, P. C.; Stevens, J. L.; Brandt, R.

    2002-01-01

    The Rocky Flats Closure Site (Site) is in the process of stabilizing residual nuclear materials, decommissioning nuclear facilities, and remediating environmental media. A number of contaminated facilities have been decommissioned, including one building, Building 779, that contained gloveboxes used for plutonium process development but did little actual plutonium processing. The actual costs incurred to decommission this facility formed much of the basis or standards used to estimate the decommissioning of the remaining plutonium-processing buildings. Recent decommissioning activities in the first actual production facility, Building 771, implemented a number of process and procedural improvements. These include methods for handling plutonium contaminated equipment, including size reduction, decontamination, and waste packaging, as well as management improvements to streamline planning and work control. These improvements resulted in a safer working environment and reduced project cost, as demonstrated in the overall project efficiency. The topic of this paper is the analysis of how this improved efficiency is reflected in recent unit costs for activities specific to the decommissioning of plutonium facilities. This analysis will allow the Site to quantify the impacts on future Rocky Flats decommissioning activities, and to develop data for planning and cost estimating the decommissioning of future facilities. The paper discusses the methods used to collect and arrange the project data from the individual work areas within Building 771. Regression and data correlation techniques were used to quantify values for different types of decommissioning activities. The discussion includes the approach to identify and allocate overall project support, waste management, and Site support costs based on the overall Site and project costs to provide a ''burdened'' unit cost. The paper ultimately provides a unit cost basis that can be used to support cost estimates for

  19. Unit for air decontamination

    International Nuclear Information System (INIS)

    Mariano H, E.

    1991-02-01

    To fulfill the applicable requirements of safety to the ventilation systems in nuclear facilities, it is necessary to make a cleaning of the air that hurtles to the atmosphere. For that which was designed and it manufactured an unit for decontamination of the air for the Pilot plant of production of Nuclear Fuel that this built one with national parts, uses Hepa national filters and the design can adapt for different dimensions of filters, also can be added a lodging for a prefilter or to adopt two Hepa filters. (Author)

  20. Waste Water Treatment Unit

    International Nuclear Information System (INIS)

    Ramadan, A.E.K.

    2004-01-01

    A wastewater treatment plant to treat both the sanitary and industrial effluent originated from process, utilities and off site units of the refinery is described. The purpose is to obtain at the end of the treatment plant, a water quality that is in compliance with contractual requirements and relevant environmental regulations. first treatment (pretreatment). Primary de-oiling, Equalization, Neutralization, Secondary de-oiling. Second treatment (Biological), The mechanism of BOD removal, Biological flocculation, Nutrient requirements, Nitrification, De-nitrification, Effect of temperature, Effect of ph, Toxicity

  1. Applied Meteorology Unit (AMU)

    Science.gov (United States)

    Bauman, William; Crawford, Winifred; Barrett, Joe; Watson, Leela; Wheeler, Mark

    2010-01-01

    This report summarizes the Applied Meteorology Unit (AMU) activities for the first quarter of Fiscal Year 2010 (October - December 2009). A detailed project schedule is included in the Appendix. Included tasks are: (1) Peak Wind Tool for User Launch Commit Criteria (LCC), (2) Objective Lightning Probability Tool, Phase III, (3) Peak Wind Tool for General Forecasting, Phase II, (4) Upgrade Summer Severe Weather Tool in Meteorological Interactive Data Display System (MIDDS), (5) Advanced Regional Prediction System (ARPS) Data Analysis System (ADAS) Update and Maintainability, (5) Verify 12-km resolution North American Model (MesoNAM) Performance, and (5) Hybrid Single-Particle Lagrangian Integrated Trajectory (HYSPLIT) Graphical User Interface.

  2. An ISOLDE target unit

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    A good dozen different targets are available for ISOLDE, made of different materials and equipped with different kinds of ion-sources, according to the needs of the experiments. Each separator (GPS: general purpose; HRS: high resolution) has its own target. Because of the high radiation levels, robots effect the target changes, about 80 times per year. In the standard unit shown in picture _01, the target is the cylindrical object in the front. It contains uranium-carbide kept at a temperature of 2200 deg C, necessary for the isotopes to be able to escape. At either end, one sees the heater current leads, carrying 700 A. The Booster beam, some 3E13 protons per pulse, enters the target from left. The evaporated isotope atoms enter a hot-plasma ion source (the black object behind the target). The whole unit sits at 60 kV potential (pulsed in synchronism with the arrival of the Booster beam) which accelerates the ions (away from the viewer) towards one of the 2 separators.

  3. The United Kingdom

    International Nuclear Information System (INIS)

    Jones, P.M.S.

    1987-01-01

    The history of nuclear development in the United Kingdom is traced, together with the factors (eg electricity demand, fossil fuel prices, political policy) that have influenced policy choices. Many of the research establishments and the fissile material production plants were established in the late 1940s. In these early years the civil and military development programmes were not separate. The initial growth period was in the 1950s when the plan was to build twelve reactors in three groups of four over ten years. The first were to be Magnox type reactors. This was trebled in 1957 and the advanced gas cooled reactor was developed. The Windscale fire in 1957 affected confidence in the nuclear programme. However, five AGR twin-reactor stations were ordered in 1964. These ran into construction problems and delay and it was not until 1980 that more new units were contemplated. The plan then was to build a pressurized water reactor at Sizewell-B. A delay to allow for the public inquiry put back the start of this until 1987 with commissioning planned for 1994. A list of the UK nuclear power stations is given and their operating performance discussed. The present situation and future prospects for nuclear power are reviewed. (U.K.)

  4. Functional unit for a processor

    NARCIS (Netherlands)

    Rohani, A.; Kerkhoff, Hans G.

    2013-01-01

    The invention relates to a functional unit for a processor, such as a Very Large Instruction Word Processor. The invention further relates to a processor comprising at least one such functional unit. The invention further relates to a functional unit and processor capable of mitigating the effect of

  5. Design of hydraulic recuperation unit

    Directory of Open Access Journals (Sweden)

    Jandourek Pavel

    2016-01-01

    Full Text Available This article deals with design and measurement of hydraulic recuperation unit. Recuperation unit consist of radial turbine and axial pump, which are coupled on the same shaft. Speed of shaft with impellers are 6000 1/min. For economic reasons, is design of recuperation unit performed using commercially manufactured propellers.

  6. Snakes: An Integrated Unit Plan.

    Science.gov (United States)

    Lawrence, Lisa

    This document presents an integrated unit plan on snakes targeting second grade students. Objectives of the unit include developing concepts of living things, understanding the contribution and importance of snakes to the environment, and making connections between different disciplines. The unit integrates the topic of snakes into the areas of…

  7. Inlet Geomorphology Evolution Work Unit

    Science.gov (United States)

    2015-10-30

    Coastal Inlets Research Program Inlet Geomorphology Evolution Work Unit The Inlet Geomorphology Evolution work unit of the CIRP develops methods...morphologic response. Presently, the primary tool of the Inlet Geomorphology Evolution work unit is the Sediment Mobility Tool (SMT), which allows the user

  8. United Arab Emirates.

    Science.gov (United States)

    1985-02-01

    This discussion of the United Arab Emirates focuses on the following: the people; geography; history; government; political conditions; defense; the economy; foreign relations; and relations between the US and the United Arab Emirates. In 1983 the population was estimated at 1,194,000. In 1984 the annual growth rate was negative. Life expectancy is about 60 years. Fewer than 20% of the population are UAE citizens. Indigenous Emiris are Arab; the rest of the population includes significant numbers of other Arabs -- Palestinians, Egyptians, Jordanians, Yemenis, Omanis, as well as many Iranians, Pakistanis, Indians, and West Europeans, especially in Dubai. The UAE is in the eastern Arabian Peninsula, bounded on the north by the Persian Gulf. European and Arab pirates roamed the Trucial Coast area from the 17th century into the 19th century. Early British expeditions against the pirates led to further campaigns against their headquarters. Piracy continued intermittently until 1835, when the shaikhs agreed not to engage in hostilities at sea. Primarily in reaction to the ambitions of other European countries, the UK and the Trucial States established closer bonds in an 1892 treaty. In 1968 the British government announced its decision, reaffirmed in March 1971, to end the treaty relationship with the gulf shaikhdoms. When the British protective treaty with the Trucial Shaikhdoms ended on December 1, they became fully independent. On December 2, 1971, 6 of them entered into a union called the United Arab Emirates. The 7th, Ras al-Khaimah, joined in early 1972. Administratively, the UAE is a loose federation of 7 emirates, each with its own ruler. The pace at which local government in each emirate is evolving, from traditional to modern, is set primarily by the ruler. Under the provisional constitution of 1971, each emirate reserves considerable powers, including control over mineral rights, taxation, and police powers. In this milieu, the growth of federal powers has

  9. UNITED KINGDOM: under pressure

    International Nuclear Information System (INIS)

    Anon.

    1994-01-01

    While attempting bravely to sustain the legacy left by J.J. Thomson, Rutherford, Chadwick, Cockcroft, Blackett, Dirac and others earlier this century, the United Kingdom, one of the major contributors to CERN, has suffered in recent years from an erosion of the international purchasing power of the pound sterling. At the same time, the national scientific community has squabbled over the apportionment of the research cake. In recent years, the CERN budget has remained constant in real terms, but the pound has drifted steadily down. In 1984 one pound bought 3.15 Swiss francs, now it gets just over 2. The hypersensitivity which left calculations at the mercy of exchange rate hiccups was cushioned in 1988 by a new method of calculating national CERN contributions, introduced by Chris Llewellyn Smith, now the Laboratory's Director General, using less sensitive input data

  10. United Kingdom national report

    International Nuclear Information System (INIS)

    Tomkins, B.

    1998-01-01

    Report of the United Kingdom deals with life extension granted to Calder Hall and Chapelcross reactors for further 10 years operation. The two well recognised life-limiting features of Magnox type reactors are graphite core ageing and materials properties of the reactor pressure circuit components. These features have been scrutinised particularly closely and the conclusion has been reached that there are no safety factors which will necessarily limit the plant life to less than 50 years. Two other life-limiting factors are hear exchanger tubes and the heat exchanger tube failures internal to boiler shells and the integrity of the main engineering structures of the plant. It was concluded that appropriate routine ageing monitoring programs are in place in respect to these features to support continuing operation beyond 40 years

  11. Mobile power plant units

    Energy Technology Data Exchange (ETDEWEB)

    Radtke, R

    1979-10-05

    Diesel engines of the MaK line 282 AK/332 with a cylinder power up to 160 kW are used, either as 6-cylinder or 8-cylinder in-line engine or as 12-cylinder V engine. Fuel consumption is between 207 and 212 g/kW. The engine is mounted on a frame, together with a generator. The fuel reserve in the tank will last for 8 hours. The lubricating system, the cooling water and starting air system, the switchboard system, and the frame are described. The switchboard plant is mounted either on a skid undercarriage or on the undercarriage. The plant can be operated independently or parallel to the network. The unit can be remote-controlled via push buttons or control knobs. A picture is presented of a mobile diesel aggregate which is in service in Libya.

  12. The United States

    International Nuclear Information System (INIS)

    Art, R.J.

    1991-01-01

    This paper reports that at least in the national security arena, the outcomes of bureaucratic infighting and domestic political struggles are not determined wholly by what goes on with the state. Rather struggles among contending groups are greatly affected by what is perceived to be happening outside the nation. Because external conditions give greater potency to some domestic forces over other, the external environment is never neutral in its domestic impact. The decisions of the period 1950-53 discussed above illustrate the point. But so too do the decisions of 1947, 1960-61 and 1969-72. In the 1947 case, Soviet intransigence provoked US nuclear rearmament. In the 1960-61 case, extended deterrent considerations pushed the United States to preserve its again newly discovered nuclear superiority. In the 1969-72 case, a Soviet determination to remain equal forced US acceptance of nuclear equality. And perhaps the best evidence of all, the perpetuation of parity ended the US inclination to resort to nuclear brinkmanship. In each instance, concerns about relative position heavily affected nuclear choice. Finally, the events of the past three years testify to the effects of international events on domestic choice. Under the terms of the 1987 INF Treaty, the two superpowers decided to dismantle and destroy an entire class of missiles of intermediate range (500-3000 kilometers) that both had deployed in Europe in the 1970s and 1980s, and in their June 1990 joint statement on strategic nuclear weapons, President Gorbachev and Brush agreed to cut the number of Soviet and US long range nuclear forces by 30 per cent. This agreement marks a watershed in US-Soviet strategic arm negotiations because for the first time the United States and the Soviet Union agreed in principals to reduce the number of weapons aimed at one another. Between 1985 and 1990 the cold war was brought to a close

  13. SI units in radiation protection

    International Nuclear Information System (INIS)

    Herrmann, D.

    1976-10-01

    In the field of radiation protection all hitherto used units for activity, activity concentrations, exposure, absorbed dose, and dose rates have to be replaced by SI units during the next years. For this purpose graphs and conversion tables are given as well as recommendations on unit combinations preferentially to be used. As to the dose equivalent, it is suggested to introduce a new special unit being 100 times greater than the rem, instead of maintaining the rem or using the gray for both absorbed dose and dose equivalent. Measures and time schedule relating to the gradual transition to SI units in measuring techniques, training, and publishing et cetera are explained. (author)

  14. SI units in radiation protection

    International Nuclear Information System (INIS)

    Jain, V.K.; Soman, S.D.

    1978-01-01

    International System of Units abbreviated as SI units has been adopted by most of the countries of the world. Following this development, the implementation of SI units has become mandatory with a transition period of about ten years. Some of the journals have already adopted the SI units and any material sent for publication to them must use only these. International Commission on Radiation Units and Measurement (ICRU) published letters in several journals including Physics in Medicine and Biology, Health Physics, British Journal of Radiology, etc. outlining the latest recommendations on SI units to elicit the reactions of scientists in the general field of radiological sciences. Reactions to the letters were numerous as can be seen in the correspondence columns of these journals for the last few years and ranged from great misgivings and apprehension to support and appreciation. SI units have also been the subject of editorial comments in several journals. On the basis of a survey of this literature, it may be said that there was general agreement on the long term advantage of SI units inspite of some practical difficulties in their use particularly in the initial stages. This report presents a review of SI units in radiological sciences with a view to familiarize the users with the new units in terms of the old. A time table for the gradual changeover to the SI units is also outlined. (auth.)

  15. SI units in biomedical dosimetry

    International Nuclear Information System (INIS)

    Liden, K.

    1975-01-01

    The International commission on radiation units and measurements (ICRU), during the period from 1953 to 1962 presented its definitions of the quantities absorbed dose, exposure, activity, and dose equivalent and the corresponding special units the rad, the roentgen, the curie, and the rem. At the same time an international practical system of units was developed, Le Systeme International d'Unites (SI). It was adopted by the 11th Conference Generale des Poids et Mesures (CGPM) in 1960 and is now officially introduced in almost all countries. The general implementation of the SI means difficulties for the future use of the special radiation units, because the numerical factors involved prevent their adoption as SI units. In view of this, and after having sampled the opinion in the radiological field, the ICRU prepared a Statement on Units in July, 1974 which was forwarded to the Comite International des Poids et Mesures (CIPM) and its Comite Consultatif des Unites (CCU) for consideration. As a result of this statement the CIPM has now proposed, that the 15rh CGPM adopt special names for two SI units, namely the becquerel, symbol Bq, for the unit of activity of radionuclides equal to the reciprocal second, s 1- , and the gray, symbol Gy, for the unit of absorbed dose equal to the joule per kilogram, J/kg. The 15th CGPM will consider this matter in May, 1975. (author)

  16. Defibrotide in combination with granulocyte colony-stimulating factor significantly enhances the mobilization of primitive and committed peripheral blood progenitor cells in mice.

    Science.gov (United States)

    Carlo-Stella, Carmelo; Di Nicola, Massimo; Magni, Michele; Longoni, Paolo; Milanesi, Marco; Stucchi, Claudio; Cleris, Loredana; Formelli, Franca; Gianni, Massimo A

    2002-11-01

    Defibrotide is a polydeoxyribonucleotide, which significantly reduces the expression of adhesion molecules on endothelial cells. We investigated the activity of Defibrotide alone or in combination with recombinant human granulocyte colony-stimulating factor (rhG-CSF) to mobilize peripheral blood progenitor cells (PBPCs) in BALB/c mice. A 5-day treatment with Defibrotide alone (1-15 mg/mouse/day) had no effect on WBC counts, frequencies and absolute numbers of total circulating colony-forming cells (CFCs), i.e., granulocyte-macrophage colony-forming units, erythroid burst-forming units, and multilineage colony-forming units. As compared with mock-injected mice, administration of rhG-CSF alone (5 micro g/mouse/day) for 5 days significantly (P Defibrotide (15 mg/mouse/day) and rhG-CSF significantly (P Defibrotide plus rhG-CSF resulted in a significant increase (P Defibrotide/rhG-CSF-mobilized mononuclear cells rescued 43% and 71% of recipient mice, respectively. Experiments of CFC homing performed in lethally irradiated or nonirradiated recipients showed that marrow homing of transplanted PBPCs was reduced by 3-fold in Defibrotide-treated animals as compared with mock-injected mice (P Defibrotide might be because of an effect on PBPC trafficking. In conclusion, our data demonstrate that Defibrotide synergizes with rhG-CSF and significantly increases the mobilization of a broad spectrum of PBPCs, including primitive and committed progenitor cells. These data might have relevant implications for autologous and allogeneic anticancer therapy in humans.

  17. [United theory of aging].

    Science.gov (United States)

    Trubitsyn, A G

    2012-01-01

    In attempts to develop a means of life prolongation the humankind has created more than three hundred theories of the aging; each of them offers the original cause of aging. However, none of them has given practical result by now. The majority of the theories have now only historical interest. There are several different theories that are mainly under consideration currently. They are based on reliable, proven evidence: the free radical theory, the protein error theory, the replicative senescence theory, the theory of reparation weakening, the immunological theory, several versions of neuroendocrinal theories, and programmed aging theory. The theory presented here is based on conception that the life as the phenomenon represents many of the interconnected physical and chemical processes propelled by energy of the mitochondrial bioenergetical machine. Gradual degradation of all vital processes is caused by the programmed decrease in level of bioenergetics. This theory unites all existing theories of aging constructed on authentic facts: it is shown, that such fundamental phenomena accompanying aging process as the increase in level of reactive oxygen species (ROS), the decrease in the general level of protein synthesis, the limitation of cellular dividing (Haiflick limit), decrease in efficiency of reparation mechanisms are caused by bioenergetics attenuation. Each of these phenomena in turn generates a number of harmful secondary processes. Any of the theories bases on one of these destructive phenomena or their combination. Hence, each of them describes one of sides of process of the aging initially caused by programmed decrease of level of bioenergetics. This united theory gives the chance to understand the nature of aging clock and explains a phenomenon of increase in longevity at the condition of food restriction. Failures of attempts to develop means from aging are explained by that the manipulations with the separate secondary phenomena of attenuation of

  18. United Kingdom position paper

    International Nuclear Information System (INIS)

    1983-01-01

    In any system employing liquid sodium as a coolant, large heat transfer coefficients exist between the metal structure containing the coolant, and the coolant itself. Any rapidly varying temperatures, either space wise or time wise, in the sodium are readily transmitted to the surrounding metal structure, resulting in the generation of appreciable thermal stresses within these structures. In particular, the phenomenon of thermal stratification in the sodium coolant has the potential to induce unacceptable thermal stresses throughout the system. With respect to the present U.K. fast reactor design, a large programme of work in connection with the thermal hydraulic aspects of the plant is in hand. This programme is being undertaken as a joint effort by the National Nuclear Corporation, the United Kingdom Atomic Energy Authority, and the Central Electricity Generating Board. Work is in progress both to identify the areas of the system that will be susceptible to, and to ensure that the design is capable of successfully withstanding any thermal stratification effects. The production of stratification phenomena depends both upon the design and the operation of the reactor system. These are briefly described below. Areas where thermal stratification effects exist are then identified and the programme of work associated with each area is outlined

  19. Intensive Care Unit Delirium

    Directory of Open Access Journals (Sweden)

    Yongsuk Kim

    2015-05-01

    Full Text Available Delirium is described as a manifestation of acute brain injury and recognized as one of the most common complications in intensive care unit (ICU patients. Although the causes of delirium vary widely among patients, delirium increases the risk of longer ICU and hospital length of stay, death, cost of care, and post-ICU cognitive impairment. Prevention and early detection are therefore crucial. However, the clinical approach toward delirium is not sufficiently aggressive, despite the condition’s high incidence and prevalence in the ICU setting. While the underlying pathophysiology of delirium is not fully understood, many risk factors have been suggested. As a way to improve delirium-related clinical outcome, high-risk patients can be identified. A valid and reliable bedside screening tool is also needed to detect the symptoms of delirium early. Delirium is commonly treated with medications, and haloperidol and atypical antipsychotics are commonly used as standard treatment options for ICU patients although their efficacy and safety have not been established. The approaches for the treatment of delirium should focus on identifying the underlying causes and reducing modifiable risk factors to promote early mobilization.

  20. Mobile contingency unit

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Sergio O. da; Magalhaes, Milton P. de [Petroleo Brasileiro S.A. (PETROBRAS), Rio de Janeiro, RJ (Brazil); Junqueira, Rodrigo A.; Torres, Carlos A.R. [PETROBRAS Transporte S/A (TRANSPETRO), Rio de Janeiro, RJ (Brazil)

    2009-07-01

    This paper is aimed at presenting what is already a reality in TRANSPETRO in the area covered by OSBRA, a pipeline that carries by-products to the Mid-West region of Brazil. In order to meet the needs of covering occasional accidents, TRANSPETRO counts on a standardized system of emergency management. It is a great challenge to secure an efficient communication along the 964 km of extension, considering that there are shadow zones where it is not possible to use conventional means of communication such as mobile telephony and internet. It was in this context that the Mobile Contingency Unit Via Satellite - MCU was developed, to extend the communication facilities existing in fixed installations to remote places, mainly the pipeline right of ways. In case of emergency, simulation and work in the pipeline right of way, MCU is fully able to provide the same data, voice, closed-circuit TV and satellite video conference facilities that are available in any internal area of the PETROBRAS system. (author)

  1. Biobank Report: United Kingdom.

    Science.gov (United States)

    Kaye, Jane; Bell, Jessica; Briceno, Linda; Mitchell, Colin

    2016-03-01

    The United Kingdom is a leader in genomics research, and the presence of numerous types of biobanks and the linking of health data and research within the UK evidences the importance of biobank-based research in the UK. There is no biobank-specific law in the UK and research on biobank materials is governed by a confusing set of statutory law, common law, regulations, and guidance documents. Several layers of applicable law, from European to local, further complicate an understanding of privacy protections. Finally, biobanks frequently contain data in addition to the samples; the legal framework in the UK generally differentiates between data and samples and the form of the data affects the applicability of legal provisions. Biobanks must be licensed by the Human Tissue Authority; certain projects must be reviewed by Research Ethics Committees, and all projects are encouraged to be reviewed by them. Data Access Committees in biobanks are also common in the UK. While this confusing array of legal provisions leaves privacy protections in biobanking somewhat unclear, changes at the EU level may contribute to harmonization of approaches to privacy. © 2016 American Society of Law, Medicine & Ethics.

  2. The United Kingdom

    International Nuclear Information System (INIS)

    Croft, S.; Williams, P.

    1991-01-01

    The possession of nuclear weapons by the United Kingdom has long been a controversial issue in British politics, and among historians and strategists. Part of the controversy has revolved around questions of motivation. Why did the British Government under Prime Minister Clement Attlee develop nuclear weapons? Why have successive British governments maintained and, in fact, modernized the national nuclear force? This paper reports that a frequent response to these questions is to place the issue of the acquisition of nuclear weapons by the UK into a post-colonial context. In the nineteenth and early twentieth centuries, Britain was a great power with global assets and commitments. After the Empire was reduced in size and importance, however, and eventually swept away, Britain could not longer claim to be a superpower in any modern sense. Nevertheless, it is suggested, British policy makers had developed a foreign policy based upon certain assumptions about Britain's position and power and they were reluctant to relinquish these assumptions. Furthermore, it is contended, the decision to develop nuclear weapons was taken to reinforce what were the pretensions of a medium power, and the continued obsession of successive British governments with nuclear weapons provides evidence that Britain has still not come to terms with its reduced role and limited influence. In short, the British infatuation with nuclear weapons over the past 40 years is best explained in terms of concerns about status

  3. Units of rotational information

    Science.gov (United States)

    Yang, Yuxiang; Chiribella, Giulio; Hu, Qinheping

    2017-12-01

    Entanglement in angular momentum degrees of freedom is a precious resource for quantum metrology and control. Here we study the conversions of this resource, focusing on Bell pairs of spin-J particles, where one particle is used to probe unknown rotations and the other particle is used as reference. When a large number of pairs are given, we show that every rotated spin-J Bell state can be reversibly converted into an equivalent number of rotated spin one-half Bell states, at a rate determined by the quantum Fisher information. This result provides the foundation for the definition of an elementary unit of information about rotations in space, which we call the Cartesian refbit. In the finite copy scenario, we design machines that approximately break down Bell states of higher spins into Cartesian refbits, as well as machines that approximately implement the inverse process. In addition, we establish a quantitative link between the conversion of Bell states and the simulation of unitary gates, showing that the fidelity of probabilistic state conversion provides upper and lower bounds on the fidelity of deterministic gate simulation. The result holds not only for rotation gates, but also to all sets of gates that form finite-dimensional representations of compact groups. For rotation gates, we show how rotations on a system of given spin can simulate rotations on a system of different spin.

  4. Hanford Site Waste management units report

    International Nuclear Information System (INIS)

    1992-01-01

    This report summarizes the operable units in several areas of the Hanford Site Waste Facility. Each operable unit has several waste units (crib, ditch, pond, etc.). The operable units are summarized by describing each was unit. Some of the descriptions are unit name, unit type, waste category start data, site description, etc. The descriptions will vary for each waste unit in each operable unit and area of the Hanford Site

  5. Elimination of clonogenic tumor cells from HL-60, Daudi, and U-937 cell lines by laser photoradiation therapy: implications for autologous bone marrow purging

    International Nuclear Information System (INIS)

    Gulliya, K.S.; Pervaiz, S.

    1989-01-01

    Laser photoradiation therapy was tested in an in vitro model for its efficacy in the elimination of non-Hodgkin's lymphoma cells. Results show that at 31.2 J/cm2 of laser light in the presence of 20 micrograms/mL of merocyanine 540 (MC540) there was greater than 5 log reduction in Burkitt's lymphoma (Daudi) cells. Similar tumor cell kill was obtained for leukemia (HL-60) cells at a laser light dose of 93.6 J/cm2. However, to obtain the same efficiency of killing for histiocytic lymphoma (U-937) cells, a higher dose of MC540 (25 micrograms/mL) was required. Clonogenic tumor stem cell colony formation was reduced by greater than 5 logs after laser photoradiation therapy. Under identical conditions for each cell line the percent survival for granulocyte-macrophage colony-forming units (CFU-GM, 45.9%, 40%, 17.5%), granulocyte/erythroid/macrophage/megakaryocyte (GEMM, 40.1%, 20.1%, 11.5%), colony-forming units (CFU-C, 16.2%, 9.1%, 1.8%), and erythroid burst-forming units (BFU-E, 33.4%, 17.8%, 3.9%) was significantly higher than the tumor cells. Mixing of gamma ray-irradiated normal marrow cells with tumor cells (1:1 and 10:1 ratio) did not interfere with the elimination of tumor cells. The effect of highly purified recombinant interferon alpha (rIFN) on laser photoradiation therapy of tumor cells was also investigated. In the presence of rIFN (30 to 3,000 U/mL), the viability of leukemic cells was observed to increase from 0% to 1.5% with a concurrent decrease in membrane polarization, suggesting an increase in fluidity of cell membrane in response to rIFN. However, at higher doses of rIFN (6,000 to 12,000 U/mL) this phenomenon was not observed. The viability of lymphoma cells remained unaffected at all doses of rIFN tested

  6. Judicial Process, Grade Eight. Resource Unit (Unit V).

    Science.gov (United States)

    Minnesota Univ., Minneapolis. Project Social Studies Curriculum Center.

    This resource unit, developed by the University of Minnesota's Project Social Studies, introduces eighth graders to the judicial process. The unit was designed with two major purposes in mind. First, it helps pupils understand judicial decision-making, and second, it provides for the study of the rights guaranteed by the federal Constitution. Both…

  7. The Executive Process, Grade Eight. Resource Unit (Unit III).

    Science.gov (United States)

    Minnesota Univ., Minneapolis. Project Social Studies Curriculum Center.

    This resource unit, developed by the University of Minnesota's Project Social Studies, introduces eighth graders to the executive process. The unit uses case studies of presidential decision making such as the decision to drop the atomic bomb on Hiroshima, the Cuba Bay of Pigs and quarantine decisions, and the Little Rock decision. A case study of…

  8. United States mineral resources

    Science.gov (United States)

    Brobst, Donald A.; Pratt, Walden P.

    1973-01-01

    650 of the U.S. Bureau of Mines) ; indeed, we regard that book and the present volume as being complementary. In the examination of the geologic possibilities for finding new deposits-in many respects the principal innovative contributions of this volume-we asked the authors to frankly apply the limits of their ingenuity and not only to summarize current theories but also to express their own intuitive ideas, however speculative and unconventional they may seem, that have come from years of study devoted to the origin of mineral deposits. Readers will see that some authors have speculated more courageously than others. In any case, we believe readers will find all the chapters interesting, and many stimulating; and a few we believe can be frankly characterized as intellectually exciting. Most chapters include a section on prospecting techniques, and a summary of geologic or related problems on which the authors believe research might be most fruitful in the continuing efforts to find new resources. An integral part of the book is the bibliographic material cited at the conclusion of each chapter, in lieu of repetition of detailed descriptions already in print. Index and "spot" maps are not included in most chapters because they are available elsewhere, and in many cases with more detail than could possibly be included here. Maps showing the distribution of known deposits of many commodities in the United States are available in the Mineral Resource (MR) map series of the U.S. Geological Survey and in the National Atlas of the United States. The first three chapters deal not with resources of specific commodities but with general information that is pertinent to the study of mineral resources. In the introductory chapter we discuss the purposes of the book, the distinctions between reserves and various categories of resources, and some general conclusions drawn from our view of the book in its entirety. In the second chapter V. E. McKelvey discusses the problems of

  9. Fatigue of Concrete Armour Units

    DEFF Research Database (Denmark)

    Sørensen, N. B.; Burcharth, H. F.; Liu, Z.

    1995-01-01

    In the present article fatigue as a possible reason for failure of Dolosse armour units made of plain concrete is discussed.......In the present article fatigue as a possible reason for failure of Dolosse armour units made of plain concrete is discussed....

  10. NZG 201 portable spectrometric unit

    International Nuclear Information System (INIS)

    Jursa, P.; Novakova, O.; Slezak, V.

    The NZG 201 spectrometric unit is a portable single-channel processing unit supplied from the mains or a battery which allows the qualitative and quantitative measurement of different types of ionizing radiation when connected to a suitable detection unit. The circuit layout and the choice of control elements makes the spectrometric unit suitable for use with scintillation detector units. The spectrometric unit consists of a pulse amplifier, an amplitude pulse analyzer, a pulse counter, a pulse rate counter with an output for a recorder, a high voltage source and a low voltage source. The block diagram is given. All circuits are modular and are mounted on PCB's. The apparatus is built in a steel cabinet with a raised edge which protects the control elements. The linear pulse amplifier has a maximum gain of 1024, the pulse counter has a maximum capacity of 10 6 -1 imp and time resolution better than 0.5 μs. The temperature interval at which the apparatus is operational is 0 to 45 degC, its weight is 12.5 kg and dimensions 36x280x310 mm, energy range O.025 to 2.5 MeV, for 137 Cs the energy resolution is 8 to 10%. The spectrometric unit NZG 2O1 may, with regard to its parameters, number and range of control elements, be used as a universal measuring unit. (J.P.)

  11. Imagine There's No Carnegie Unit

    Science.gov (United States)

    Klevgaard, Janine

    2013-01-01

    This article describes how the Alberta Education High School Flexibility Enhancement Pilot Project allowed 16 high schools in Alberta, Canada, to remove the restrictions of the Carnegie unit, the seat time per credit requirement that has been widely used since 1906. The two purposes of the project were to determine whether the Carnegie unit should…

  12. Definitions of Quantities and Units.

    Science.gov (United States)

    Spurgin, C. B.

    1983-01-01

    Compares various methods of defining derived quantities, arguing for a definitional formula using base or fundamental units in a word equation, or symbol-equations with the symbols explained. Suggests that fundamental units be defined operationally or left regarded as intuitive as in the case of length and time. (JM)

  13. Science Unit Plans. PACE '94.

    Science.gov (United States)

    Schoon, Kenneth J., Ed.; Wiles, Clyde A., Ed.

    This booklet contains mathematics unit plans for Biology, Chemistry, and Physical Science developed by PACE (Promoting Academic Excellence In Mathematics, Science & Technology for Workers of the 21st Century). Each unit plan contains suggested timing, objectives, skills to be acquired, workplace relationships, learning activities with suggested…

  14. Edison Home Community Study Unit.

    Science.gov (United States)

    Lee County School District, Ft. Myers, FL. Dept. of Environmental Education and Instructional Development Services.

    History is not merely events that occurred in the past. The past has influenced the present, as the present will influence the future. The purpose of this community study unit is to provide fourth grade students with an opportunity to investigate some of the history of Lee County, Florida. The unit's focus is on Thomas Edison, who built a home in…

  15. Effect of interleukin-9 on clonogenic maturation and cell-cycle status of fetal and adult hematopoietic progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Holbrook, S.T.; Ohls, R.K.; Schibler, K.R.; Yang, Y.C.; Christensen, R.D. (Univ. of Utah School of Medicine, Salt Lake City (USA))

    1991-05-15

    We assessed the effect of interleukin-9 (IL-9) on clonogenic maturation and cell-cycle status of hematopoietic progenitors of fetal (umbilical cord blood) and adult (bone marrow) origin. As a single agent IL-9 supported, in a concentration-dependent fashion, maturation of burst-forming units-erythroid (BFU-E) of adult and fetal origin. However, only 1/3 the number of adult BFU-E colonies developed, as did in response to granulocyte-macrophage colony-stimulating factor (GM-CSF), and only 1/6 the number developed as did in response to IL-3. In contrast, the effect of IL-9 on fetal BFU-E colonies was equal to that of GM-CSF and IL-3. Synergistic effects of IL-9 with low concentrations (0.1 ng/mL) of GM-CSF and IL-3 were seen on adult BFU-E colony formation, but no effect was apparent at higher concentrations (1.0 ng/mL). In contrast, using fetal cells, synergistic effects of IL-9 with low and high concentrations of GM-CSF and IL-3 were apparent. Addition of IL-9 to plates containing fetal cells plus GM-CSF and IL-3 not only resulted in more BFU-E colonies, but also in more multicentered (greater than or equal to 10 individual centers) colonies, and more cells per colony. IL-9 had a wider spectrum of action on progenitors of fetal origin than on progenitors of adult origin, supporting the generation of fetal multipotent colony-forming unit (CFU)-Mix and CFU-GM colonies. Incubation with IL-9 did not accelerate cycling of adult or fetal BFU-E, CFU-Mix, or CFU-GM to the extent observed after incubation with IL-6.

  16. Hemopoietic stem-cell compartment of the SCID mouse: Double-exponential survival curve after γ irradiation

    International Nuclear Information System (INIS)

    Taniguchi, Satoshi; Hirabayashi, Yoko; Inoue, Tohru; Kanisawa, Masayoshi; Sasaki, Hideki; Komatsu, Kenshi; Mori, K.J.

    1993-01-01

    It has been reported that SCID (severe combined immunodeficiency, scid/scid) mice are more radiosensitive than normal mice. In the present studies, graded doses of radiation were given to bone marrow cells from SCID mice, and double-exponential survival curves were observed for day-9 and day-12 colony-forming units in the spleen (CFU-S). Single-exponential curves were found for SCID CFU in in vitro assays for granulocyte/macrophage-CFUs and erythroid burst-forming units, as reported elsewhere. Since the size of this more resistant fraction seems to decrease with stem-cell maturation, the finding implies that this fraction is a primitive subpopulation of the stem-cell compartment. The mean lethal dose (D 0 ), however, of this less sensitive SCID CFU-S is much less than the D 0 of regular CFU-S in normal littermates. Spleen colonies produced by SCID bone marrow were relatively small and abortive. The size of these colonies decreased nearly exponentially with increasing doses of radiation. These colonies produced by the sensitive fraction have disappeared, being killed by a relatively low dose of radiation. This observation might account for the high lymphomagenesis arising from primitive hemopoietic stem cells in SCID mice, because the smallness of the colonies suggests that there is unrepaired or misrepaired damage. Furthermore, this less sensitive fraction might be a source of the open-quotes leakyclose quotes change of T and B cells, possibly due to the induction of an equivocal repair system which appears in the later stages of life in the SCID mice. 34 refs., 5 figs., 3 tabs

  17. Effect of interleukin-9 on clonogenic maturation and cell-cycle status of fetal and adult hematopoietic progenitors

    International Nuclear Information System (INIS)

    Holbrook, S.T.; Ohls, R.K.; Schibler, K.R.; Yang, Y.C.; Christensen, R.D.

    1991-01-01

    We assessed the effect of interleukin-9 (IL-9) on clonogenic maturation and cell-cycle status of hematopoietic progenitors of fetal (umbilical cord blood) and adult (bone marrow) origin. As a single agent IL-9 supported, in a concentration-dependent fashion, maturation of burst-forming units-erythroid (BFU-E) of adult and fetal origin. However, only 1/3 the number of adult BFU-E colonies developed, as did in response to granulocyte-macrophage colony-stimulating factor (GM-CSF), and only 1/6 the number developed as did in response to IL-3. In contrast, the effect of IL-9 on fetal BFU-E colonies was equal to that of GM-CSF and IL-3. Synergistic effects of IL-9 with low concentrations (0.1 ng/mL) of GM-CSF and IL-3 were seen on adult BFU-E colony formation, but no effect was apparent at higher concentrations (1.0 ng/mL). In contrast, using fetal cells, synergistic effects of IL-9 with low and high concentrations of GM-CSF and IL-3 were apparent. Addition of IL-9 to plates containing fetal cells plus GM-CSF and IL-3 not only resulted in more BFU-E colonies, but also in more multicentered (greater than or equal to 10 individual centers) colonies, and more cells per colony. IL-9 had a wider spectrum of action on progenitors of fetal origin than on progenitors of adult origin, supporting the generation of fetal multipotent colony-forming unit (CFU)-Mix and CFU-GM colonies. Incubation with IL-9 did not accelerate cycling of adult or fetal BFU-E, CFU-Mix, or CFU-GM to the extent observed after incubation with IL-6

  18. Evaluation of drug-induced hematotoxicity using novel in vitro monkey CFU-GM and BFU-E colony assays.

    Science.gov (United States)

    Goto, Koichi; Goto, Mayumi; Ando-Imaoka, Masako; Kai, Kiyonori; Mori, Kazuhiko

    2017-01-01

    In order to evaluate drug-induced hematotoxicity in monkey cells in vitro, colony-forming unit-granulocyte, macrophage (CFU-GM), and burst-forming unit-erythroid (BFU-E) colony assays were established using mononuclear cells in the bone marrow collected from male cynomolgus monkeys. Furthermore, the effects of doxorubicin, chloramphenicol, and linezolid on CFU-GM and BFU-E colony formation were investigated using established monkey CFU-GM and BFU-E colony assays in comparison with those on human CFU-GM and BFU-E colonies acquired from human umbilical cord blood cells. Bone marrow mononuclear cells were collected from the ischial or iliac bone of male cynomolgus monkeys. The cells were subsequently processed by density gradient separation at 1.067, 1.070, or 1.077 g/mL for CFU-GM or 1.077 g/mL for BFU-E, and then cultured in methylcellulose medium for 9 or 13 days, respectively. A sufficient number of CFU-GM colonies were formed from mononuclear cells processed at a density of 1.070 g/mL. Moreover, the number of BFU-E colonies from the cells processed at a density of 1.077 g/mL was sufficient for the colony assay. The number of CFU-GM or BFU-E colonies decreased after treatment with the drugs of interest in a concentration-dependent manner. Compared with human CFU-GM, monkey CFU-GM were more sensitive to chloramphenicol and resistant to doxorubicin, whereas monkey BFU-E were more sensitive to all compounds in comparison to the sensitivity of human BFU-E. In conclusion, monkey CFU-GM and BFU-E colony assays were established and considered useful tools to evaluate the differences in drug-induced hematotoxicity between species.

  19. 7 CFR 1160.104 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true United States. 1160.104 Section 1160.104 Agriculture... Definitions § 1160.104 United States. United States means the 48 contiguous states in the continental United States and the District of Columbia, except that United States means the 50 states of the United States...

  20. United States panel presentations

    International Nuclear Information System (INIS)

    Beyea, J.

    1990-01-01

    Before I begin I have to make a disclaimer. That is that I am going to be talking about public perception because I think that is very important. But I do not want to give the impression that I think the public is wrong. I happen to agree with the public's perception of nuclear power, and I want to make that clear. I do not like the current generation of nuclear plants as I have made clear in many statements that I have made. On the other hand, in the long term, I feel that we have only two choices on the supply side, and that is nuclear power and solar electricity. And although I think solar electricity has the best chance, I am realistic enough to know that technologies do not always work the way I want. And so I think it is necessary to have at least some kind of nuclear option available. On the other hand, I do not think just any kind of nuclear technology will do. I want to talk to you about the conditions that I think you have to take into account when you try to design reactors that are publicly acceptable. I look at this as an insurance policy. Again, I do not want to be misquoted: I think nuclear power should be considered as an insurance policy, not as our first line of defense. Having made those disclaimers, what we need to do is set out a problem statement. The problem statement I set out is, 'How could one design and demonstrate a nuclear reactor that would regain public confidence in the United States, if one chose to do that?' By regaining confidence, I mean regaining sufficient confidence to site reactors at a number of locations. It is a pretty heavy task because the public cannot judge the technical issues. They have to judge the players by their characters and their histories, just as the way we calibrate anyone that knows things that we do not. I have three theses that I think are crucial. The first is that people do not believe in the claims of advocates, of any point of view, not just nuclear power, once the advocates have been proved wrong on

  1. The United Kingdom: Issues for the United States

    National Research Council Canada - National Science Library

    Archick, Kristin

    2007-01-01

    ...; and more recently, from the UK's strong support in countering terrorism and confronting Iraq. The United States and Britain also share a mutually beneficial trade and economic relationship, and are each other's biggest foreign direct investors...

  2. A functional intranet for the United States Coast Guard Unit

    OpenAIRE

    Hannah, Robert Todd.

    1998-01-01

    Approved for public release; distribution in unlimited. This thesis describes the complete development process of a friendly functional Intranet for an operational United States Coast Guard (USCG) electronic Support Unit (ESU) in Alameda, California. The final product is suitable for immediate use. It may also be used as a prototype for future Intranet development efforts. The methodology used to develop a finished, working product provides the core subject matter for this thesis. The disc...

  3. Development of diagnostic mammography unit

    Energy Technology Data Exchange (ETDEWEB)

    Matsubara, M.; Muraki, T.; Kitade, K. (Toshiba Corp., Kawasaki, Kanagawa (Japan))

    1981-07-01

    The mortality from breast cancer is gradually increasing year after year. Accordingly, it is eagerly desired that X-ray diagnosis information be obtainable with higher accuracy and ease for early detection of the disease. Meeting this demand, development has been made of a 2 x magnification mammography unit (Model MGU-01) capabel of minutely depicting microcalcifications with a size of 150 ..mu..m or thereabout and the peripheral condition of a mammary abscess. The background of the development, the substance of the unit and the examination made of the unit are described here.

  4. Development of diagnostic mammography unit

    International Nuclear Information System (INIS)

    Matsubara, Mitsuyoshi; Muraki, Takeshi; Kitade, Kooichi

    1981-01-01

    The mortality from breast cancer is gradually increasing year after year. Accordingly, it is eagerly desired that X-ray diagnosis information be obtainable with higher accuracy and ease for early detection of the disease. Meeting this demand, development has been made of a 2 x magnification mammography unit (Model MGU-01) capabel of minutely depicting microcalcifications with a size of 150 μm or thereabout and the peripheral condition of a mammary abscess. The background of the development, the substance of the unit and the examination made of the unit are described here. (author)

  5. Ad valorem versus unit taxes

    DEFF Research Database (Denmark)

    Schröder, Philipp J.H.; Sørensen, Allan

    2010-01-01

    a general equilibrium monopolistic competition model with heterogeneous firms and intra-industry reallocations. We show that the welfare superiority of ad valorem over unit taxes under imperfect competition is not only preserved but amplified. The additional difference between the tools arises because unit...... taxes distort relative prices, which in turn reduces average industry productivity through reallocations (the survival and increased market share of lower productivity firms). Importantly, numerical solutions of the model reveal that the relative welfare loss from using the unit tax increases...

  6. Design of Dolos Armour Units

    DEFF Research Database (Denmark)

    Burcharth, H. F.; Liu, Zhou

    1993-01-01

    The slender, complex types of armour units, such as Tetrapods and Dolosse are widely used. Many of the recent failures are such rubble mound breakwaters revealed that there is an imbalance between strength (structural integrity) of the units and the hydraulic stability (resistance to displacements......) of the armour layers. The paper deals only with dolos armour and presents the first design diagrammes and formulae where stresses from static, quasistatic and impact loads are implemented as well as the hydraulic stability. The dolos is treated as a multi shape unit where the thickness can be adjusted...

  7. Tax_Units_2011_Final

    Data.gov (United States)

    Kansas Data Access and Support Center — The Statewide GIS Tax Unit boundary file was created through a collaborative partnership between the State of Kansas Department of Revenue Property Valuation...

  8. Integrated Ground Operations Demonstration Units

    Data.gov (United States)

    National Aeronautics and Space Administration — The overall goal of the AES Integrated Ground Operations Demonstration Units (IGODU) project is to demonstrate cost efficient cryogenic operations on a relevant...

  9. Renewable energies in United Kingdom

    International Nuclear Information System (INIS)

    Baize, T.

    1993-01-01

    An evaluation of research and development policy in United Kingdom on renewable energy sources is presented with economical studies (short or long term profitability), engaged programs and electric production. (A.B.). refs. tabs

  10. NCHS - Injury Mortality: United States

    Data.gov (United States)

    U.S. Department of Health & Human Services — This dataset describes injury mortality in the United States beginning in 1999. Two concepts are included in the circumstances of an injury death: intent of injury...

  11. Unit 06 - Sampling the World

    OpenAIRE

    Unit 06, CC in GIS; Parson, Charles; Nyerges, Timothy

    1990-01-01

    This unit begins the section on data acquisition by looking at how the infinite complexity of the real world can be discretized and sampled. It considers sampling techniques and associated issues of accuracy and standards.

  12. Environmental Control Unit Harness Project

    Science.gov (United States)

    Oliva-Buisson, Yvette J.

    2014-01-01

    Testing four new Environmental Control Unit Harnesses for improved user comfort during SCAPE operations. Phase I, testing in a lab environment, Phase II will continue testing the best candidates in a field environment.

  13. 77 FR 48542 - United States

    Science.gov (United States)

    2012-08-14

    ... litigation.'' United States v. Armour and Co., 402 U.S. 673, 681 (1971). Section 5 of the Clayton Act... relief in consent judgment that contained recitals in which defendants asserted their innocence); Armour...

  14. Dedicated education unit: student perspectives.

    Science.gov (United States)

    Nishioka, Vicki M; Coe, Michael T; Hanita, Makoto; Moscato, Susan R

    2014-01-01

    The study compared students' perceptions of their clinical learning experiences in a dedicated education unit (DEU) with their experiences in traditional clinical education. Unlike traditional academic-instructor models, expert nurses in the DEU provide clinical education to students with faculty support. This repeated measures design used student surveys, supplemented by focus group data. Students were more likely to agree that their clinical learning experience was high quality and they had a consistent mentoring relationship during DEU rotations. Students also reported the quality of the unit's learning environment, the leadership style of the nurse manager, and the nursing care on the unit was more favorable in DEUs than traditional units. Consistent with their changed role in DEUs, faculty members were less active in helping students integrate theory and practice. These findings provide additional evidence of the value that the DEU model contributes to high-quality clinical education.

  15. United States Strategy for Mexico

    National Research Council Canada - National Science Library

    Centner, Robert C

    2005-01-01

    The security and stability of Mexico is of national interest to the United States, and a strong, effective alliance between the two countries is pivotal to our national defense strategy and economic prosperity...

  16. Architecture of nuclear power units

    International Nuclear Information System (INIS)

    Malaniuk, B.

    1981-01-01

    Nuclear units with circulation cooling using cooling towers are dominating points of the landscape. The individual cooling towers or pairs of cooling towers should be situated in the axes of double units and should also linearly be arranged, rhythmically in the respective zone. Examples are shown of the architectural designs of several nuclear power plants in the USA, the UK, the USSR, France, the FRG and Italy. (H.S.)

  17. Management of planned unit outages

    International Nuclear Information System (INIS)

    Brune, W.

    1984-01-01

    Management of planned unit outages at the Bruno Leuschner Nuclear Power Plant is based on the experience gained with Soviet PWR units of the WWER type over a period of more than 50 reactor-years. For PWR units, planned outages concentrate almost exclusively on annual refuellings and major maintenance of the power plant facilities involved. Planning of such major maintenance work is based on a standardized basic network plan and a catalogue of standardized maintenance and inspection measures. From these, an overall maintenance schedule of the unit and partial process plans of the individual main components are derived (manually or by computer) and, in the temporal integration of major maintenance at every unit, fixed starting times and durations are determined. More than 75% of the maintenance work at the Bruno Leuschner Nuclear Power Plant is carried out by the plant's own maintenance personnel. Large-scale maintenance of every unit is controlled by a special project head. He is assisted by commissioners, each of whom is responsible for his own respective item. A daily control report is made. The organizational centre is a central office which works in shifts around the clock. All maintenance orders and reports of completion pass through this office; thus, the overall maintenance schedule can be corrected daily. To enforce the proposed operational strategy, suitable accompanying technical measures are required with respect to effective facility monitoring and technical diagnosis, purposeful improvement of particularly sensitive components and an increase in the effectiveness of maintenance work by special technologies and devices. (author)

  18. SI units in engineering and technology

    CERN Document Server

    Qasim, S H

    2016-01-01

    SI Units in Engineering and Technology focuses on the use of the International System of Units-Systeme International d'Unités (SI). The publication first elaborates on the SI, derivation of important engineering units, and derived SI units in science and engineering. Discussions focus on applied mechanics in mechanical engineering, electrical and magnetic units, stress and pressure, work and energy, power and force, and magnitude of SI units. The text then examines SI units conversion tables and engineering data in SI units. Tables include details on the sectional properties of metals in SI units, physical properties of important molded plastics, important physical constants expressed in SI units, and temperature, area, volume, and mass conversion. Tables that show the mathematical constants, standard values expressed in SI units, and Tex count conversion are also presented. The publication is a dependable source of data for researchers interested in the use of the International System of Units-Systeme Inter...

  19. 31 CFR 800.225 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 800.225 Section 800... TAKEOVERS BY FOREIGN PERSONS Definitions § 800.225 United States. The term United States or U.S. means the United States of America, the States of the United States, the District of Columbia, and any commonwealth...

  20. Nations United: The United Nations, the United States, and the Global Campaign Against Terrorism. A Curriculum Unit & Video for Secondary Schools.

    Science.gov (United States)

    Houlihan, Christina; McLeod, Shannon

    This curriculum unit and 1-hour videotape are designed to help students understand the purpose and functions of the United Nations (UN) and explore the relationship between the United Nations and the United States. The UN's role in the global counterterrorism campaign serves as a case study for the unit. The students are asked to develop a basic…

  1. Ecological units: definitions and application.

    Science.gov (United States)

    Jax, Kurt

    2006-09-01

    Concepts of ecological units, such as population, community, and ecosystem, are at the basis of ecological theory and research and have increasingly become the focus of conservation strategies. Concepts of these units still suffer from inconsistencies and confusions over terminology. The different concepts are treated here together as a common "conceptual cluster," with similar ecological functions (roles) and similar problems in their definition and use. An analysis of the multitude of existing terms and concepts that have been developed for these units reveals that they differ with respect to at least four basic criteria: (i) the questions as to whether they are defined statistically or via a network of interactions; (ii) if their boundaries are drawn by topographical or process-related criteria; (iii) how high the required internal relationships are; and (iv) if they are perceived as "real" entities or abstractions by an observer The various definitions cannot be easily sorted into just a few types, but they can be characterized by several independent criteria. I argue that serious problems arise if the different possibilities of defining ecological units are not recognized and if the concepts are perceived as self-evident. The different concepts of ecological units should be defined and used in a philosophically informed manner I propose a dual approach to the use of ecological units. Generic meanings of the main concepts (especially population, community, and ecosystem) should be retained only as heuristically useful perspectives, while specific and "operational" definitions of the concepts as units should be developed, depending on specific purposes of their use. Some thoughts on the basic requirements for such definitions and the domains of their uses are briefly explained.

  2. Effect of low-dose irradiation on pregnant mouse haemopoiesis

    International Nuclear Information System (INIS)

    Weinberg, S.R.; McCarthy, E.G.; MacVittie, T.J.; Baum, S.J.

    1981-01-01

    The effects of low-dose gamma radiation to haemopoietic progenitor cell compartments of the marrow and spleen of virgin female mice and pregnant mice were studied. Microplasma clot cultures were used to assess burst-forming uniterythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) activity, and double-layer agar cultures were established to evaluate granulocyte-macrophage colony-forming cell (GM-CFC) and macrophage colony-forming cell (M-CFC). The apparent shift in maternal erythropoiesis from the bone marrow to the enlarged spleen was reflected by an increase in CFU-E and BFU-E per spleen and a concomitant decrease in CFU-E and BFU-E per femur. Whereas maternal GM-CFC values per femur increased 36%, maternal GM-CFC per spleen increased by 172% compared to virgin values. Total-body irradiation to the day-10.5 pregnant mouse caused a further suppression of day-14.5 medullary erythropoiesis (i.e. decreased CFU-E values) compared to the virgin female mouse. An ability of the maternal spleen to support further compensatory erythropoiesis following increasing doses of radiation was demonstrated. Four days after 1.0 Gy exposure, maternal values for GM-CFC per femur or spleen decreased to nonirradiated virgin mice values. M-CFC per maternal femur decreased to nonirradiated virgin mice values. M-CFC per maternal femur decreased following 1.5 Gy, but M-CFC per spleen appeared to be unaffected with doses from 0.5 to 2.0 Gy. (author)

  3. United Nations Peacekeeping: Issues for Congress

    National Research Council Canada - National Science Library

    Browne, Marjorie A

    2008-01-01

    A major issue facing the United Nations, the United States, and the 110th Congress is the extent to which the United Nations has the capacity to restore or keep the peace in the changing world environment...

  4. United Nations Peacekeeping: Issues for Congress

    National Research Council Canada - National Science Library

    Browne, Marjorie A

    2007-01-01

    A major issue facing the United Nations, the United States, and the 110th Congress is the extent to which the United Nations has the capacity to restore or keep the peace in the changing world environment...

  5. Mobile units to hydro geochemistry characterization

    International Nuclear Information System (INIS)

    Gomez, P.; Martinez, B.; Turrero, M.J.

    1994-01-01

    This report shows the mobile units for hydro geochemical studies. The authors analyze the work of mobile unit and the cars that conform the unit: Sampling car and analysis car: The sampling and equipment are took into account as well

  6. United Nations and Multilateralism: Appraising USA's Unilateralism ...

    African Journals Online (AJOL)

    DrNneka

    global peace and security, as well as the survival of the United Nations. This is because ... Key Words: United Nations, multilateralism, United States, unilateralism, national interest, UN Charter ..... Lebanon, Iraq, Turkey, Egypt, Jordan, etc.

  7. UNIT COMMITMENT: A NEW TRUNCATED METHOD OF UNIT ...

    African Journals Online (AJOL)

    NIJOTECH

    Data obtained from the National Electric Power Authority (NEPA) has been used to test the efficacy of this approach. ... every unit in the system must be respected. Some of these ..... Analysis of Power System Reliability. 2.Edwin K. W, Machat, ...

  8. Photovoltaic mounting/demounting unit

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a photovoltaic arrangement comprising a photovoltaic assembly comprising a support structure defining a mounting surface onto which a photovoltaic module is detachably mounted; and a mounting/demounting unit comprising at least one mounting/demounting apparatus...... which when the mounting/demounting unit is moved along the mounting surface, causes the photovoltaic module to be mounted or demounted to the support structure; wherein the photovoltaic module comprises a carrier foil and wherein a total thickness of the photo voltaic module is below 500 muiotaeta....... The present invention further relates to an associated method for mounting/demounting photovoltaic modules....

  9. Organization of the POCT Unit.

    Science.gov (United States)

    Warade, Jayesh

    2015-03-01

    Point-of-care testing (POCT) has evolved as an important part of laboratory medicine by virtue of its compactness, portability, and the feasibility of operation by nonlaboratory personnel, where fast and accurate testing methods are a primary concern and, as a result, improving the patient care. To successfully achieve POCT quality in networks, a multidisciplinary organizational approach is required. A clearly defined organizational structure should be put in place for proper functioning and optimum utilization of each POCT unit. The POCT unit must include designated authority, responsibility, and accountability.

  10. The United Nations at 40

    International Nuclear Information System (INIS)

    1985-01-01

    The United Nations adopted a resolution expressing the hope that 1985 would mark the beginning of an era of durable and global peace and justice, social and economic development and progress and independence of all peoples. 1985 is the organization's 40th anniversary year - the United Nations Charter entered into force on 24 October 1945 - and the Assembly has chosen 'United Nations for a better world' as the anniversary theme. It also has decided to hold a brief commemorative session culminating on 24 October this year. Member States of the UN also have been urged to organize appropriate observance of the anniversary, with the widest possible participation, and to consider the creation of national committees to evaluate the contribution of the UN system over the past four decades, its continuing relevance in the current international situation, and ways in which it could be strengthened and made more effective. Among other things, the Assembly in its resolution appealed to the international mass media, both public and private, to contribute more effectively to dissemination of information on UN activities. During the commemorative session planned this October, a final document is expected to be adopted for which the Assembly has asked the Preparatory Committee for the Fortieth Anniversary of the United Nations to compose a suitable text. The Preparatory Committee had been established by the Assembly in 1983, and by December 1984, 98 countries had joined in its work, which relates to various activities

  11. Kitchen Units for the Classroom.

    Science.gov (United States)

    Illinois Univ., Urbana. Agricultural Experiment Station.

    This study is concerned with functional standards for storage of equipment, use of space, and arrangement of work centers in kitchen units for four students within a high school foods laboratory. Lists of equipment and measurements for storage areas are given for each work center. (FS)

  12. Norovirus in the United States

    Centers for Disease Control (CDC) Podcasts

    2013-09-09

    Dr. Aron Hall, a CDC epidemiologist specializing in norovirus, discusses the impact of norovirus in the United States.  Created: 9/9/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 9/17/2013.

  13. Solar Renewable Energy. Teaching Unit.

    Science.gov (United States)

    Buchanan, Marion; And Others

    This unit develops the concept of solar energy as a renewable resource. It includes: (1) an introductory section (developing understandings of photosynthesis and impact of solar energy); (2) information on solar energy use (including applications and geographic limitations of solar energy use); and (3) future considerations of solar energy…

  14. Spherical Approximation on Unit Sphere

    Directory of Open Access Journals (Sweden)

    Eman Samir Bhaya

    2018-01-01

    Full Text Available In this paper we introduce a Jackson type theorem for functions in LP spaces on sphere And study on best approximation of  functions in  spaces defined on unit sphere. our central problem is to describe the approximation behavior of functions in    spaces for  by modulus of smoothness of functions.

  15. United States Navy DL Perspective

    Science.gov (United States)

    2010-08-10

    United States Navy DL Perspective CAPT Hank Reeves Navy eLearning Project Director 10 August 2010 Report Documentation Page Form ApprovedOMB No...Marine Corps (USMC) Navy eLearning Ongoing Shared with USMC, Coast Guard 9 NeL Help Site https://ile-help.nko.navy.mil/ile/ https://s-ile

  16. Victorian Era: An Interdisciplinary Unit.

    Science.gov (United States)

    Gildart, Donna Mae; And Others

    Seventh grade students studied the Victorian period using a 4-6 week interdisciplinary unit that integrated language arts, mathematics, art, science, social studies, music, home economics, parents, and business into the program. The main goals were to help students understand the importance of all curriculum subjects; comprehend how subjects are…

  17. Tractor Safety. Unit A-9.

    Science.gov (United States)

    Luft, Vernon D.; Backlund, Paul

    This document is a teacher's guide for a unit in tractor and machinery safety for college freshmen. It is intended to be used for 10 hours of instruction for freshmen who are intending to work on or around machinery. Safety hazards directly and indirectly related to many types of machinery are covered in addition to tractors. The objectives of the…

  18. Vapor generating unit blowdown arrangement

    International Nuclear Information System (INIS)

    McDonald, B.N.

    1978-01-01

    A vapor generating unit having a U-shaped tube bundle is provided with an orificed downcomer shroud and a fluid flow distribution plate between the lower hot and cold leg regions to promote fluid entrained sediment deposition in proximity to an apertured blowdown pipe

  19. Cholera in the United States

    Centers for Disease Control (CDC) Podcasts

    2011-11-08

    Anna Newton, Surveillance Epidemiologist at CDC, discusses cholera that was brought to the United States during an outbreak in Haiti and the Dominican Republic (Hispaniola).  Created: 11/8/2011 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 11/8/2011.

  20. The United Nations at 40

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1985-10-01

    The United Nations adopted a resolution expressing the hope that 1985 would mark the beginning of an era of durable and global peace and justice, social and economic development and progress and independence of all peoples. 1985 is the organization's 40th anniversary year - the United Nations Charter entered into force on 24 October 1945 - and the Assembly has chosen 'United Nations for a better world' as the anniversary theme. It also has decided to hold a brief commemorative session culminating on 24 October this year. Member States of the UN also have been urged to organize appropriate observance of the anniversary, with the widest possible participation, and to consider the creation of national committees to evaluate the contribution of the UN system over the past four decades, its continuing relevance in the current international situation, and ways in which it could be strengthened and made more effective. Among other things, the Assembly in its resolution appealed to the international mass media, both public and private, to contribute more effectively to dissemination of information on UN activities. During the commemorative session planned this October, a final document is expected to be adopted for which the Assembly has asked the Preparatory Committee for the Fortieth Anniversary of the United Nations to compose a suitable text. The Preparatory Committee had been established by the Assembly in 1983, and by December 1984, 98 countries had joined in its work, which relates to various activities.

  1. [Developments in medical units. 1915].

    Science.gov (United States)

    Fajardo-Ortiz, Guillermo

    2016-01-01

    In 1915 the political, economic, and social instability initiated the destruction of medical units; they had no administrative bases and they lacked the resources. However, needs encouraged that structures arose to meet the wounded, fractured, and traumatized, called “blood” hospitals and so-called crosses and sanitary trains.

  2. Genetic maps and physical units

    International Nuclear Information System (INIS)

    Karunakaran, V.; Holt, G.

    1976-01-01

    The relationships between physical and genetic units are examined. Genetic mapping involves the detection of linkage of genes and the measurement of recombination frequencies. The genetic distance is measured in map units and is proportional to the recombination frequencies between linked markers. Physical mapping of genophores, particularly the simple genomes of bacteriophages and bacterial plasmids can be achieved through heteroduplex analysis. Genetic distances are dependent on recombination frequencies and, therefore, can only be correlated accurately with physical unit lengths if the recombination frequency is constant throughout the entire genome. Methods are available to calculate the equivalent length of DNA per average map unit in different organisms. Such estimates indicate significant differences from one organism to another. Gene lengths can also be calculated from the number of amino acids in a specified polypeptide and relating this to the number of nucleotides required to code for such a polypeptide. Many attempts have been made to relate microdosimetric measurements to radiobiological data. For irradiation effects involving deletion of genetic material such a detailed correlation may be possible in systems where heteroduplex analysis or amino acid sequencing can be performed. The problems of DNA packaging and other functional associations within the cell in interpreting data is discussed

  3. "Mexico in Transition." Curriculum Units.

    Science.gov (United States)

    Oregon Univ., Eugene. Foreign Language Resource Center.

    These curriculum units were developed in a National Endowment for the Humanities 1994 summer seminar "Mexico in Transition." The 23 lessons are written in Spanish. Lessons are entitled: (1) "La Migracion Mexicana Vista a Traves del Cuento 'Paso del Norte' de Juan Rulfo" (Jose Jorge Armendariz); (2) "Los Grupos Indigenas de…

  4. Pentachlorophenol (PCP) sludge recycling unit

    International Nuclear Information System (INIS)

    1994-08-01

    The Guelph Utility Pole Company treats utility poles by immersion in pentachlorophenol (PCP) or by pressure treatment with chromated copper arsenate (CCA). The PCP treatment process involves a number of steps, each producing a certain amount of sludge and other wastes. In a plant upgrading program to improve processing and treatment of poles and to reduce and recycle waste, a PCP recovery unit was developed, first as an experimental pilot-scale unit and then as a full-scale unit. The PCP recovery unit is modular in design and can be modified to suit different requirements. In a recycling operation, the sludge is pumped through a preheat system (preheated by waste heat) and suspended solids are removed by a strainer. The sludge is then heated in a tank and at a predetermined temperature it begins to separate into its component parts: oil, steam, and solids. The steam condenses to water containing low amounts of light oil, and this water is pumped through an oil/water separator. The recovered oil is reused in the wood treatment process and the water is used in the CCA plant. The oil remaining in the tank is reused in PCP treatment and the solid waste, which includes small stones and wood particles, is removed and stored. By the third quarter of operation, the recovery unit was operating as designed, processing ca 10,000 gal of sludge. This sludge yielded 6,500 gal of water, 3,500 gal of oil, and ca 30 gal of solids. Introduction of the PCP sludge recycling system has eliminated long-term storage of PCP sludge and minimized costs of hazardous waste disposal. 4 figs

  5. United Nations opens gender coordinating unit for Afghanistan.

    Science.gov (United States)

    Morris, K

    1999-02-06

    The UN has created a gender coordinating unit for Afghanistan in an effort to combat some problems encountered by women and girls in the country. Reports continue to come in of women in Afghanistan being denied the right to work, to be educated, and to have access to medical care. The gap in education between men and women continues to widen as a result of edicts issued by Taliban authorities banning girls from attending formal schools and female teachers from working. The situation has grown worse since the UN and nongovernmental organizations (NGOs) withdrew international workers last year due to security concerns. Although a UN mission will travel to the country this week to discuss the return of international staff, the gender coordinating unit will for now have to work out of Islamabad, Pakistan. The unit will create guidelines for gender mainstreaming, a strategy in which mainstream policies and resource allocations are changed to reflect the principle of gender equality. Other goals include setting realistic objectives for gender activities, working with partners on pilot projects, and establishing minimum standards for best practices. MERLIN, a NGO with a primary health care program run by local staff in the Taliban-controlled province of Farah, welcomes the move.

  6. Qualification of package units; Qualifizierung von Package Units

    Energy Technology Data Exchange (ETDEWEB)

    Brombacher, M.; Walter, U. [Bayer AG, Leverkusen (Germany)

    1999-07-01

    The use of package units in pharmaceutical plants is increasing. If they are involved in the manufacture of pharmaceuticals and have an influence on the quality of the end product, the user is required to validate the processes used. Parallel to the growing demands with respect to the automation of these units, the importance of PCS equipment has increased and with this the necessity for its qualification. Experience to date shows that the manufacturer's awareness of these requirements can be heightened still further. This paper describes approaches for improving the present situation and should be interpreted not as criticism but as providing an opportunity to increase the knowledge base and work together to define solutions which satisfy the guidelines. (orig.) [German] Der Einsatz von Package Units in Pharma-Anlagen erfaehrt zunehmende Verbreitung. Wenn sie an der Herstellung von Arzneimitteln beteiligt sind und auf die Qualitaet des Endprodukts Einfluss nehmen, unterliegen sie der Validierungspflicht, die der Anwender zu gewaehrleisten hat. Entsprechend den wachsenden Anforderungen an die Automatisierung dieser Einheiten ist auch der Stellenwert der PLT-Ausruestung angestiegen und mit ihm die Notwendigkeit von deren Qualifizierung. Die bisherige Praxis zeigt, dass die Sensbilitaet der Hersteller diesen Anforderungen gegenueber noch besser entwickelt werden kann. Der Beitrag zeigt Wege auf, um die derzeitige Situation zu verbessern und sollte nicht als Kritik sondern als Chance aufgefasst werden, den Wissensstand auszugleichen und gemeinsam zu richtliniengerechten Loesungen zu kommen. (orig.)

  7. 7 CFR 1250.308 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1250.308 Section 1250.308 Agriculture... Research and Promotion Order Definitions § 1250.308 United States. United States means the 48 contiguous States of the United States of America and the District of Columbia. ...

  8. 31 CFR 598.317 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 598.317 Section 598.317 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 598.317 United States. The term United States means the United States, its territories and...

  9. 31 CFR 596.312 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 596.312 Section 596.312 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... General Definitions § 596.312 United States. The term United States means the United States, including its...

  10. 31 CFR 538.314 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 538.314 Section 538.314 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... § 538.314 United States. The term United States means the United States, its territories and possessions...

  11. 31 CFR 543.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 543.310 Section 543.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 543.310 United States. The term United States means the United States, its territories and...

  12. 31 CFR 542.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 542.310 Section 542.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....310 United States. The term United States means the United States, its territories and possessions...

  13. 31 CFR 548.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 548.310 Section 548.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....310 United States. The term United States means the United States, its territories and possessions...

  14. 7 CFR 65.255 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false United States. 65.255 Section 65.255 Agriculture..., PEANUTS, AND GINSENG General Provisions Definitions § 65.255 United States. United States means the 50... United States. ...

  15. 31 CFR 546.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 546.310 Section 546.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....310 United States. The term United States means the United States, its territories and possessions...

  16. 31 CFR 594.313 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 594.313 Section 594.313 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 594.313 United States. The term United States means the United States, its territories and...

  17. 31 CFR 588.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 588.310 Section 588.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 588.310 United States. The term United States means the United States, its territories and...

  18. 7 CFR 1206.23 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1206.23 Section 1206.23 Agriculture... INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.23 United States. United... Rico, and the territories and possessions of the United States. ...

  19. 31 CFR 536.315 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 536.315 Section 536.315 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 536.315 United States. The term United States means the United States, its territories and...

  20. 31 CFR 544.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 544.310 Section 544.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... REGULATIONS General Definitions § 544.310 United States. The term United States means the United States, its...

  1. 31 CFR 592.311 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 592.311 Section 592... § 592.311 United States. The term United States, when used in the geographic sense, means the several States, the District of Columbia, and any commonwealth, territory, or possession of the United States. ...

  2. 31 CFR 545.313 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 545.313 Section 545.313 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... Definitions § 545.313 United States. The term United States means the United States, its territories and...

  3. 7 CFR 1205.23 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1205.23 Section 1205.23 Agriculture... Procedures for Conduct of Sign-up Period Definitions § 1205.23 United States. The term United States means the 50 states of the United States of America. Procedures ...

  4. 31 CFR 595.314 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 595.314 Section 595.314 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... § 595.314 United States. The term United States means the United States, its territories and possessions...

  5. 31 CFR 586.318 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 586.318 Section 586...) KOSOVO SANCTIONS REGULATIONS General Definitions § 586.318 United States. The term United States means the United States, its territories and possessions, and all areas under the jurisdiction or authority...

  6. 31 CFR 537.318 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 537.318 Section 537.318 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....318 United States. The term United States means the United States, its territories and possessions...

  7. 31 CFR 597.318 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 597.318 Section 597... General Definitions § 597.318 United States. The term United States means the United States, its territories, states, commonwealths, districts, and possessions, and all areas under the jurisdiction or...

  8. 31 CFR 560.307 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 560.307 Section 560.307 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... § 560.307 United States. The term United States means the United States, including its territories and...

  9. 7 CFR 1150.106 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true United States. 1150.106 Section 1150.106 Agriculture... Order Definitions § 1150.106 United States. United States means the 48 contiguous States in the continental United States. ...

  10. 31 CFR 593.311 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 593.311 Section 593.311 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... REGULATIONS General Definitions § 593.311 United States. The term United States means the United States, its...

  11. 31 CFR 585.316 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 585.316 Section 585.316 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... General Definitions § 585.316 United States. The term United States means the United States, its...

  12. 31 CFR 575.319 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 575.319 Section 575.319 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....319 United States. The term United States means the United States, its territories and possessions...

  13. 7 CFR 1212.31 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1212.31 Section 1212.31 Agriculture..., Consumer Education, and Industry Information Order Definitions § 1212.31 United States. “United States... territories and possessions of the United States. ...

  14. 31 CFR 539.312 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 539.312 Section 539.312 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... General Definitions § 539.312 United States. The term United States means the United States, its...

  15. 31 CFR 551.309 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 551.309 Section 551.309 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF....309 United States. The term United States means the United States, its territories and possessions...

  16. 7 CFR 1219.26 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1219.26 Section 1219.26 Agriculture..., AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.26 United States. United States means collectively the several 50 States of the United States, the District of...

  17. 31 CFR 587.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 587.310 Section 587...) MILOSEVIC SANCTIONS REGULATIONS General Definitions § 587.310 United States. The term United States means the United States, its territories and possessions, and all areas under the jurisdiction or authority...

  18. 31 CFR 541.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 541.310 Section 541.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... § 541.310 United States. The term United States means the United States, its territories and possessions...

  19. 22 CFR 120.13 - United States.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false United States. 120.13 Section 120.13 Foreign... United States. United States, when used in the geographical sense, includes the several states, the Commonwealth of Puerto Rico, the insular possessions of the United States, the District of Columbia, the...

  20. 7 CFR 1205.313 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1205.313 Section 1205.313 Agriculture... Research and Promotion Order Definitions § 1205.313 United States. United States means the 50 States of the United States of America. [31 FR 16758, Dec. 31, 1966. Redesignated at 56 FR 64472, Dec. 10, 1991] ...

  1. 31 CFR 540.313 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 540.313 Section 540.313 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... REGULATIONS General Definitions § 540.313 United States. The term United States means the United States, its...

  2. 31 CFR 547.310 - United States.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false United States. 547.310 Section 547.310 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... General Definitions § 547.310 United States. The term United States means the United States, its...

  3. Hanford Site waste management units report

    International Nuclear Information System (INIS)

    1993-04-01

    The Hanford Site Waste Management Units Report was originated to provide information responsive to Section 3004(u) of the Hazardous and Solid Waste Amendments of the 1984. This report provides a comprehensive inventory of all types of waste management units at the Hanford Site, including a description of the units and the waste they contain. Waste management units in the report include: (1) Resource Conservation and Recovery Act of 1976 (RCRA) disposal units, (2) Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) disposal units, (3) unplanned releases, (4) inactive contaminated structures, (5) RCRA treatment, storage, and disposal (TSD) units, and (6) other storage areas. Because of the comprehensive nature of the units report, the list of units is more extensive than required by Section 3004(u) of Hazardous and Solid Waste Amendments of the 1984. In Sections 3.0 through 6.0 of this report, the four aggregate areas are subdivided into their operable units. The operable units are further divided into two parts: (1) those waste management units assigned to the operable unit that will be remediated as part of the Environmental Restoration Remedial Actions (ERRA) Program, and (2) those waste management units located within the operable unit boundaries but not assigned to the ERRA program. Only some operable unit sections contain the second part

  4. Waste management units - Savannah River Site

    International Nuclear Information System (INIS)

    1989-10-01

    This report is a compilation of worksheets from the waste management units of Savannah River Plant. Information is presented on the following: Solid Waste Management Units having received hazardous waste or hazardous constituents with a known release to the environment; Solid Waste Management Units having received hazardous waste or hazardous constituents with no known release to the environment; Solid Waste Management Units having received no hazardous waste or hazardous constituents; Waste Management Units having received source; and special nuclear, or byproduct material only

  5. Organization of Control Units with Operational Addressing

    OpenAIRE

    Alexander A. Barkalov; Roman M. Babakov; Larysa A. Titarenko

    2012-01-01

    The using of operational addressing unit as the block of control unit is proposed. The new structure model of Moore finite-state machine with reduced hardware amount is developed. The generalized structure of operational addressing unit is suggested. An example of synthesis process for Moore finite-state machine with operational addressing unit is given. The analytical researches of proposed structure of control unit are executed.

  6. Masturbation in the United States.

    Science.gov (United States)

    Das, Aniruddha

    2007-01-01

    Using data from the nationally representative National Health and Social Life Survey, this study queried the correlates of masturbation in the United States in 1992. Among those aged 18-60, 38% (CI, 35-41) of women and 61% (CI, 57-65) of men reported any masturbation over the preceding year. The system of factors underlying masturbation was similar for both genders, consistent with a convergence in gender patterns of sexual expression in the United States. Among both women and men, masturbation responded to a stable sexualized personality pattern, catalyzed by early-life factors and manifested in current sexual traits. Strikingly, the masturbation-partnered sex linkage, often conceptualized either as compensating for unsatisfying sex or complementing a satisfactory sex life, appeared to be bimodal for both genders. For some, masturbation complemented an active and pleasurable sex life, while among others, it compensated for a lack of partnered sex or satisfaction in sex.

  7. Units for radiation protection work

    International Nuclear Information System (INIS)

    Lindborg, L.

    1997-06-01

    ICRU has defined special measurable (operational) quantities for radiation protection. A consequence of using the operational quantities is that hand-held and personal dosemeters can give different measuring results in the same radiation situation. The differences vary and are caused by the geometry of the radiation field. The units have well documented relations to e.g. the ICRP effective dose and equivalent dose to an organ or tissue. Therefore, it is possible to estimate these doses from a measured value of e.g. the ambient dose equivalent. ICRU and ICRP have recently reviewed these relations in two important commonly issued reports (Report 57 and Publication 74). This report tries to show the value of understanding these units and their relations and is primarily meant to be used for educational purposes. 11 refs

  8. Optical programmable Boolean logic unit.

    Science.gov (United States)

    Chattopadhyay, Tanay

    2011-11-10

    Logic units are the building blocks of many important computational operations likes arithmetic, multiplexer-demultiplexer, radix conversion, parity checker cum generator, etc. Multifunctional logic operation is very much essential in this respect. Here a programmable Boolean logic unit is proposed that can perform 16 Boolean logical operations from a single optical input according to the programming input without changing the circuit design. This circuit has two outputs. One output is complementary to the other. Hence no loss of data can occur. The circuit is basically designed by a 2×2 polarization independent optical cross bar switch. Performance of the proposed circuit has been achieved by doing numerical simulations. The binary logical states (0,1) are represented by the absence of light (null) and presence of light, respectively.

  9. Phoenix's Wet Chemistry Laboratory Units

    Science.gov (United States)

    2008-01-01

    This image shows four Wet Chemistry Laboratory units, part of the Microscopy, Electrochemistry, and Conductivity Analyzer (MECA) instrument on board NASA's Phoenix Mars Lander. This image was taken before Phoenix's launch on August 4, 2007. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  10. THE UNITED STATES EDUCATIONAL SYSTEM

    OpenAIRE

    David Suriñach Fernández

    2017-01-01

    The United States educational system is very complex. Due to the fact a big number of agents take play of its regulation, the differences between the education from one State compared to the education from another, or even between school districts, might be considerable. The last two largest federal education initiatives, No Child Left Behind and Race to the Top, have had a huge impact on the American education system. The escalation of the standardized test throughout the whole country as a ...

  11. The Uranium Chemistry Research Unit

    International Nuclear Information System (INIS)

    Anon.

    1983-01-01

    The article discusses the research work done at the Uranium Chemistry Research Unit of the University of Port Elizabeth. The initial research programme dealt with fundamental aspects of uranium chemistry. New uranium compounds were synthesized and their chemical properties were studied. Research was also done to assist the mining industry, as well as on nuclear medicine. Special mentioning is made of the use of technetium for medical diagnosis and therapy

  12. Eddy current tube testing unit

    International Nuclear Information System (INIS)

    Dufayet, J.P.; Duret, G.

    1975-01-01

    The unit described can check a wide variety of tubes in quick succession and its modular design gives it a high degree of versability. Suitably defined working conditions and specific fittings enable most of the faults encountered in the manufacture of a tube to be detected. By appropriate means of selection based on signal amplitude, phase and frequency analyses it is possible to adapt selection criteria to the seriousness of the different categories of defect [fr

  13. Environmental performance reviews: United States

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-01-15

    This book presents OECD assessments and recommendations regarding the United States' effort to manage its environment including air, water nature, and biodiversity to do this in a sustainable manner; and to do this in co-operation with its global neighbours. In particular, it assesses progress made since 1996, when OECD's previous review on the US was done. 40 figs., 21 tabs.

  14. Pricing decision-making units

    OpenAIRE

    R F&aauml;re; S Grosskopf; D Margaritis

    2013-01-01

    In this note we extend the standard DEA paradigm to address the question of how one can price DMUs (decision-making units). To do this we use an adjoint transformation to the technology generated by these DMUs which links to traditional linear programming theory of the firm and is similar to pricing portfolios in financial markets. We also provide a numerical example illustrating the practicality of the proposed method.

  15. Dixie Valley Bottoming Binary Unit

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, Dale [Terra-Gen Sierra Holdings, LLC, Reno, NV (United States)

    2014-12-21

    This binary plant is the first air cooled, high-output refrigeration based waste heat recovery cycle in the industry. Its working fluid is environmentally friendly and as such, the permits that would be required with a hydrocarbon based cycle are not necessary. The unit is largely modularized, meaning that the unit’s individual skids were assembled in another location and were shipped via truck to the plant site. The Air Cooled Condensers (ACC), equipment piping, and Balance of Plant (BOP) piping were constructed at site. This project further demonstrates the technical feasibility of using low temperature brine for geothermal power utilization. The development of the unit led to the realization of low temperature, high output, and environmentally friendly heat recovery systems through domestic research and engineering. The project generates additional renewable energy, resulting in cleaner air and reduced carbon dioxide emissions. Royalty and tax payments to governmental agencies will increase, resulting in reduced financial pressure on local entities. The major components of the unit were sourced from American companies, resulting in increased economic activity throughout the country.

  16. United States National Seismographic Network

    International Nuclear Information System (INIS)

    Buland, R.

    1993-09-01

    The concept of a United States National Seismograph Network (USNSN) dates back nearly 30 years. The idea was revived several times over the decades. but never funded. For, example, a national network was proposed and discussed at great length in the so called Bolt Report (U. S. Earthquake Observatories: Recommendations for a New National Network, National Academy Press, Washington, D.C., 1980, 122 pp). From the beginning, a national network was viewed as augmenting and complementing the relatively dense, predominantly short-period vertical coverage of selected areas provided by the Regional Seismograph Networks (RSN's) with a sparse, well-distributed network of three-component, observatory quality, permanent stations. The opportunity finally to begin developing a national network arose in 1986 with discussions between the US Geological Survey (USGS) and the Nuclear Regulatory Commission (NRC). Under the agreement signed in 1987, the NRC has provided $5 M in new funding for capital equipment (over the period 1987-1992) and the USGS has provided personnel and facilities to develop. deploy, and operate the network. Because the NRC funding was earmarked for the eastern United States, new USNSN station deployments are mostly east of 105 degree W longitude while the network in the western United States is mostly made up of cooperating stations (stations meeting USNSN design goals, but deployed and operated by other institutions which provide a logical extension to the USNSN)

  17. Pickering Unit 1 chemical cleaning

    International Nuclear Information System (INIS)

    Smee, J.L.; Fiola, R.J.; Brennenstuhl, K.R.; Zerkee, D.D.; Daniel, C.M.

    1995-01-01

    The secondary sides of all 12 boilers at Pickering Unit 1 were chemically cleaned in 1994 by the team of Ontario Hydro, B and W International (Cambridge, Ontario) and B and W Nuclear Technologies (Lynchburg, Virginia). A multi-step EPRI/SGOG process was employed in a similar manner to previous clearings at Units 5 and 6 in 1992 and 1993, respectively. A major innovation with the Unit 1 cleaning was the incorporation of a crevice cleaning step, the first time this had been done on Ontario Hydro plants. In addition, six boilers were cleaned in parallel compared to three at a time in previous Pickering cleanings. This significantly reduced cleaning time. A total of 6,770 kg of sludge was removed through direct chemical dissolution. It consisted of 66% iron/nickel oxides and 28% copper metal. A total of 1,600,000 L (420,000 US gallons) of liquid waste was produced. It was processed through the spent solvent treatment facility located at the Bruce Nuclear Power Development site. Visual inspection performed after the cleaning indicated that the crevices between the boiler tubes and the tube support structure were completely clear of deposit and the general condition of the tubing and lattice bars appeared to be in 'as new' condition. (author)

  18. Measurement units of physical values

    International Nuclear Information System (INIS)

    Debraine, P.

    1955-01-01

    The aim of this paper is twofold: 1) to give an analysis of the formation conditions of the various systems of units, 2) to show how the practical problems involving changes of units can be solved. This analysis leads to the conception of 'types' of systems, which is very useful to clarity the question of rationalized and non rationalized systems. The second point which consists essentially in: 1) finding the relationship between the measures of a given quantity in different systems, 2) deriving practical formulas, 3) deriving formulas in various 'types' of systems, is made easier by use of sets of: * definition formulas, * transformation formulas, * units of the various practical systems with useful numerical information covering the following fields: ** geometry, ** kinematics, ** mechanics, ** electricity and magnetism, ** thermodynamics, ** radiation, ** photometry, These sets being printed on coloured paper can be easily found. A number of numerical examples (21) show in a detailed way how to solve the various problems likely to occur. A chapter is particularly devoted to the Giorgi MKS system. (author) [fr

  19. Low cost balancing unit design

    Science.gov (United States)

    Golembiovsky, Matej; Dedek, Jan; Slanina, Zdenek

    2017-06-01

    This article deals with the design of a low-cost balancing system which consist of battery balancing units, accumulator pack units and coordinator unit with interface for higher level of battery management system. This solution allows decentralized mode of operation and the aim of this work is implementation of controlling and diagnostic mechanism into an electric scooter project realized at Technical university of Ostrava. In todays world which now fully enjoys the prime of electromobility, off-grid battery systems and other, it is important to seek the optimal balance between functionality and the economy side of BMS that being electronics which deals with secondary cells of batery packs. There were numerous sophisticated, but not too practical BMS models in the past, such as centralized system or standalone balance modules of individual cells. This article aims at development of standalone balance modules which are able to communicate with the coordinator, adjust their parameters and ensure their cells safety in case of a communication failure. With the current worldwide cutting cost trend in mind, the emphasis was put on the lowest price possible for individual component. The article is divided into two major categories, the first one being desing of power electronics with emphasis on quality, safety (cooling) and also cost. The second part describes development of a communication interface with reliability and cost in mind. The article contains numerous graphs from practical measurements. The outcome of the work and its possible future is defined in the conclusion.

  20. Strategic renewal for business units.

    Science.gov (United States)

    Whitney, J O

    1996-01-01

    Over the past decade, business units have increasingly taken the role of strategy formulation away from corporate headquarters. The change makes sense: business units are closer to customers, competitors, and costs. Nevertheless, business units can fail, just as headquarters once did, by losing their focus on the organization's priorities and capabilities. John Whitney--turnaround expert and professor of management at Columbia University--offers a method for refocusing companies that he calls the strategic-renewal process. The principles behind the process are straightforward, but its execution demands extensive data, rigorous analysis, and the judgment of key decision makers. However, when applied with diligence, it can produce a strategy that yields both growth and profit. To carry out the process, managers must analyze, one by one or in logical groupings, the company's customers, the products it sells, and the services it offers in light of three criteria: strategic importance, significance, and profitability. Does a given customer, product, or service mesh with the organization's goals? Is it significant in terms of current and future revenues? And is it truly profitable when all costs are care fully considered? Customers, products, and services that do not measure up, says the author, must be weeded out relentlessly. Although the process is a painstaking one, the article offers clear thinking on why-and how-to go about it. A series of exhibits takes managers through the questions they need to raise, and two matrices offer Whitney's concentrated wisdom on when to cultivate--and when to prune.

  1. High pressure gas reinjection unit

    Energy Technology Data Exchange (ETDEWEB)

    1976-03-01

    Nuovo Pignone has built for gas reinjection at Ekofisk the highest pressure injection unit to date: suction pressure 246 bar, discharge 647 bar, for 5.7 million cu m/day of natural gas, and driven by a GE MS 5001 gas turbine of 24,000 hp. The barrel-type compressor has been used already in Algeria at Hassi Messaoud. Full scale tests have shown that the unit is satisfactory; special attention being paid to the stability of the rotor. Air cooled heat exchangers were used in the test loop to cool the discharge gas; at Ekofisk, heat exchangers with sea water will be used. The valves in the test loop were of a special, low- noise type. Vibrations of the rotor system and changes in gas pressure monitored, showing that a pressure of 680 bars can be achieved without instability. Economic considerations lead to preference for rotary compressors driven by gas turbines for similar applications in the exploitation of oil fields. A graph of the characteristics of the unit is given.

  2. Coin sorting unit; Koka ikkatsu tonyu shori unit

    Energy Technology Data Exchange (ETDEWEB)

    Oyabu, H.; Nishiyama, T.; Iijima, S. [Fuji Electric Co. Ltd., Tokyo (Japan)

    1999-08-10

    There are promising demands for barrier-free vending machines which can easily be used by the aged and the handicapped as well as ordinary people. Fuji Electric had developed an advanced unit for throwing in coins for the new hearty series that can smoothly be used by the aged and the handicapped. Its main advantages are (1) two or more coins can be thrown in together, (2) The port for putting in coins and the port for taking out change are of unified construction and simply adjoin each other, (3) Directional signs in braille are added. (author)

  3. Hanford Site waste management units report

    International Nuclear Information System (INIS)

    1993-04-01

    The Hanford Site Waste Management Units Report was originated to provide information responsive to Section 3004(u) of the Hazardous and Solid Waste Amendments of the 1984. This report provides a comprehensive inventory of all types of waste management units at the Hanford Site, including a description of the units and the waste they contain. Waste management units in the report include: (1) Resource Conservation and Recovery Act of 1976 (RCRA) disposal units, (2) Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) disposal units, (3) unplanned releases, (4) inactive contaminated structures, (5) RCRA treatment, storage, and disposal (TSD) units, and (6) other storage areas. Because of the comprehensive nature of the units report, the list of units is more extensive than required by Section 3004(u) of Hazardous and Solid Waste Amendments of the 1984. In Sections 3.0 through 6.0 of this report, the four aggregate areas are subdivided into their operable units. The operable units are further divided into two parts: (1) those waste management units assigned to the operable unit that will be remediated as part of the Environmental Restoration Remedial Actions (ERRA) Program, and (2) those waste management units located within the operable unit boundaries but not assigned to the ERRA program. Only some operable unit sections contain the second part.Volume two contains Sections 4.0 through 6.0 and the following appendices: Appendix A -- acronyms and definition of terms; Appendix B -- unplanned releases that are not considered to be units; and Appendix C -- operable unit maps

  4. Uniting to prevent unwanted pregnancies.

    Science.gov (United States)

    Lynch, D

    1994-02-18

    In reading the column of Cal Thomas entitled "Speaking Truth to Power" it becomes clear that the forces aligned against each other on the issue of reproductive choice should work together in order to reduce the number of unwanted pregnancies. An estimated 400 million women are unable to limit their family size for economic reasons. More are inhibited by social or religious constraints. When family planning (FP) services are available, and the status and education levels of women are raised, abortion rates decrease. This is demonstrated in the Netherlands, where legal abortions and contraception are available. The abortion rate is less than 5/1000 women there, one of the lowest worldwide. Latin America, where abortion is illegal and FP services are lacking, has abortion rates of 30-60/1000. Furthermore, these illegal abortions usually have a tragic effect on the woman's health. Of an estimated 6 million pregnancies annually in the United States, approximately half are unintended. Of these, about 1.6 million are aborted. Of the women in the United States who become pregnant annually, 82% are unmarried, 25% are under 20 years of age, and 33% make less than $11,000 yearly. If industrialized nations made contraceptives and FP services available to the poor worldwide, the quality of life on earth would increase. Human misery, anarchy, and resource depletion would decrease. State and local governments should increase support of domestic FP activities, while the federal government should raise its funding of international FP services. In order to reach the goals set by the 1989 Amsterdam Declaration, which was signed by the US, the annual contribution of the United States needs to be doubled. 4% of the US foreign aid budget, $720 million, is less than 0.1% of its $1.5 trillion budget. This amounts to less than $3 per US citizen.

  5. Entomology Unit annual report 2003

    International Nuclear Information System (INIS)

    2003-01-01

    As described in the 2002 Annual Report an improved medfly genetic sexing strain (GSS) was developed, VIENNA 8. This strain shows improved production characteristics and will have a major impact on the production efficiency in SIT rearing facilities. During 2003 this strain was transferred to four rearing facilities in Guatemala, Peru, South Africa and Tunisia based on acceptable QC data developed for the strain in the Unit. For the first time the strain was transferred to the different facilities under an agreement that prevents further distribution to third parties without consent of the Unit. In the past, strains originating from the Unit have been freely exchanged within the medfly SIT community, sometimes with not always the best results. During 2003 there has been a substantial increase in the resources devoted to activities in fruit flies other than medfly e.g. Bactrocera oleae and Anastrepha fraterculus. Rearing of the olive fly, B. oleae has traditionally not been straightforward due to the very specific, and expensive, larval diet that is required by this monophagous pest. With the disappearance of an essential larval diet component from the commercial market an urgent search is underway for an alternative. In 2004, experiments will be carried out to identify improved larval diets. For A. fraterculus, a large-scale evaluation of mating compatibility between different geographical races has been carried out by a consultant. Progress has been made in the containerised rearing of tsetse fly colonies. The container required considerable work before the temperature and humidity controls were suitable for tsetse rearing and a closed colony of Glossina fuscipes is now being reared. Discussions are now underway to install a version of TPU 3.2 (an automated tsetse feeding and production unit) in the container. A protocol for the handling, irradiation and eventual release of large numbers of sterile male tsetse has been formulated and it will involve at least two

  6. Optics in the United kingdom.

    Science.gov (United States)

    Ditchburn, R W

    1969-10-01

    Optics is interpreted to include x-ray optics, electronic optics, and short wave radiooptics as well as the more conventional visible, uv, and ir optics. Recent work in Britain on x-ray optics (applied to molecular biology), on scanning electron microscopy, and in radioastronomy (discovery of pulsars) is mentioned. In the optics of the visible and ir there is an increasing interest in over-all systems design. .The formation of large industrial units capable of carrying through major design program, requiring advanced mechanical and electronic design associated with new lens systems, is welcomed.

  7. Graphs with Eulerian unit spheres

    OpenAIRE

    Knill, Oliver

    2015-01-01

    d-spheres in graph theory are inductively defined as graphs for which all unit spheres S(x) are (d-1)-spheres and that the removal of one vertex renders the graph contractible. Eulerian d-spheres are geometric d-spheres which are d+1 colorable. We prove here that G is an Eulerian sphere if and only if the degrees of all the (d-2)-dimensional sub-simplices in G are even. This generalizes a Kempe-Heawood result for d=2 and is work related to the conjecture that all d-spheres have chromatic numb...

  8. Enhanced Master Controller Unit Tester

    Science.gov (United States)

    Benson, Patricia; Johnson, Yvette; Johnson, Brian; Williams, Philip; Burton, Geoffrey; McCoy, Anthony

    2007-01-01

    The Enhanced Master Controller Unit Tester (EMUT) software is a tool for development and testing of software for a master controller (MC) flight computer. The primary function of the EMUT software is to simulate interfaces between the MC computer and external analog and digital circuitry (including other computers) in a rack of equipment to be used in scientific experiments. The simulations span the range of nominal, off-nominal, and erroneous operational conditions, enabling the testing of MC software before all the equipment becomes available.

  9. Loviisa Unit One: Annealing - healing

    Energy Technology Data Exchange (ETDEWEB)

    Kohopaeae, J.; Virsu, R. [ed.; Henriksson, A. [ed.

    1997-11-01

    Unit 1 of the Loviisa nuclear powerplant was annealed in connection with the refuelling outage in the summer of 1996. This type of heat treatment restored the toughness properties of the pressure vessel weld, which had been embrittled be neutron radiation, so that it is almost equivalent to a new weld. The treatment itself was an ordinary metallurgical procedure that took only a few days. But the material studies that preceded it began over fifteen years ago and have put IVO at the forefront of world-wide expertise in the area of radiation embrittlement

  10. Multi-Unit Initiating Event Analysis for a Single-Unit Internal Events Level 1 PSA

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong San; Park, Jin Hee; Lim, Ho Gon [KAERI, Daejeon (Korea, Republic of)

    2016-05-15

    The Fukushima nuclear accident in 2011 highlighted the importance of considering the risks from multi-unit accidents at a site. The ASME/ANS probabilistic risk assessment (PRA) standard also includes some requirements related to multi-unit aspects, one of which (IE-B5) is as follows: 'For multi-unit sites with shared systems, DO NOT SUBSUME multi-unit initiating events if they impact mitigation capability [1].' However, the existing single-unit PSA models do not explicitly consider multi-unit initiating events and hence systems shared by multiple units (e.g., alternate AC diesel generator) are fully credited for the single unit and ignores the need for the shared systems by other units at the same site [2]. This paper describes the results of the multi-unit initiating event (IE) analysis performed as a part of the at-power internal events Level 1 probabilistic safety assessment (PSA) for an OPR1000 single unit ('reference unit'). In this study, a multi-unit initiating event analysis for a single-unit PSA was performed, and using the results, dual-unit LOOP initiating event was added to the existing PSA model for the reference unit (OPR1000 type). Event trees were developed for dual-unit LOOP and dual-unit SBO which can be transferred from dual- unit LOOP. Moreover, CCF basic events for 5 diesel generators were modelled. In case of simultaneous SBO occurrences in both units, this study compared two different assumptions on the availability of the AAC D/G. As a result, when dual-unit LOOP initiating event was added to the existing single-unit PSA model, the total CDF increased by 1∼ 2% depending on the probability that the AAC D/G is available to a specific unit in case of simultaneous SBO in both units.

  11. Chapter 2. The production units

    International Nuclear Information System (INIS)

    1998-01-01

    In the second chapter of this CD ROM the production units of the Slovak Electric, Plc. (Slovenske elektrarne, a.s.), are presented. It consist of next paragraphs: (1) Nuclear power plants (A-1 Nuclear Power Plant (History, Technological scheme, basic data are presented); V-1, V-2 Bohunice Nuclear Power Plant (History 1972-1985, technological scheme; nuclear safety, radiation protection, heat supply, international co-operation and basic data are presented); Mochovce Nuclear Power Plant (History 1980-1998, technological scheme, construction completion, milestones of commissioning, safety and environmental protection as well as basic data are included). (2) Conventional sources of energy (Vojany fossil power plant (History 1959-1992, Technological units of power plant, Impact of operation on the environment, Plant of Vojany FPP Renewal and Reconstruction, Basic data are listed), Novaky fossil power plant (History 1949-1998, Technological scheme, current investment construction, basic data, Handlova heating plant). Kosice Combined Heat Power Plant (History 1960-1995, technological scheme, State metrology centre, acredited chemical laboratory, basic data). (3) Hydroelectric power plants (Trencin HPPs: Cierny Vah pumped storage HPP, Liptovska Mara HPP, Orava HPP, Sucany HPP, Miksova HPP, Nosice HPP, Velke Kozmalovce HPP, Gabcikovo HPP, Dubnica HPP, Nove Mesto n/V HPP, Madunice HPP, Kralova HPP) and Dobsina HPPs: (Dobsina HPP, Ruzin HPP, Domasa HPP, small HPPs) are presented

  12. Are environmental scanning units effective?

    Science.gov (United States)

    Stubbart, C

    1982-06-01

    Many authorities have urged companies to set up environmental scanning to assist corporate planning. Some advocates have recommended a unit at corporate level. This would give breadth of view and penetration into the future. It would arm decision makers with accurate forecasts. The information would be broad in scope and future directed. It could provide also assumptions for long-range planning. The Fahey and King study produced a model of corporate scanning types. The data showed that environmental information was built into the plan. Though the political environment was important, scanning was inadequate. The best location for scanning was not at corporate level and most firms used irregular methods. The Thomas study concluded that effective environmental scanning was permanent and multi level and that 'best practice' was continuous scanning. In 1978 the sample organizations were revisited. Five of the twelve have not changed their practice. The factors which encouraged a continuous model were the attitudes of academics and business media, demonstrated success of the units, the right kind of personnel. Contrary influences were changes in top management, decentralization moves, resource cuts, defining the environment and its significance, the availability of scanning competent personnel, surprise itself, and the availability of alternatives e.g. external forecasts.

  13. East Carnduff Unit: corrosion problems

    Energy Technology Data Exchange (ETDEWEB)

    Banks, C D

    1966-07-01

    Waterflooding of the East Carnduff Unit began in late 1962. The first injection line leak was discovered April 29, 1965. The first 6 leaks in the East Carnduff Unit occurred within a period of less than one month--a very startling and serious warning of pending problems. Analysis of the pipe removed showed a deep pit covered by a severe scale in the piping fitting. Several remedial actions were tried in order to develop the present inhibition program. First, the lines were cleaned as well as possible utilizing rubber pig spheres with normal injection pressure. This proved very effective and 2 passes wiped out most of the scale in the lines. Only one line required acid. After the lines had been cleaned, a water treating rate of an organic amine corrosion inhibitor, 10 ppm of the scale inhibitor, and bactericide at the rate of 40 ppm slugs 2 days per month was initiated. The above treating program is in use at the present time and is maintaining a very low leak frequency. This experience has demonstrated 2 important points in waterflood operations: (1) a bare piping system in warm brine service requires constant attention to insure that it is being kept clean; and (2) reliance cannot be placed on any one method of checking corrosion rates.

  14. Devolution in the United Kingdom

    Directory of Open Access Journals (Sweden)

    Marković Ratko

    2014-01-01

    Full Text Available Devolution is a transfer of the legislative powers of the Westminster Parliament to the parliaments of the historical provinces once united with England into the United Kingdom, which are directly elected by the provincial population. That delegation is asymmetrical and revocable, but it does not affect the basic norms of the British unwritten constitution on parliamentary supremacy. Over the devolution the provinces do not acquire the primary competence, but the one that is given to them by the transfer of the legislative powers of the Westminster Parliament. A special law retaining the Westminster Parliament's primary competence and sovereignty grants this competence. Regarding the scope of the devolved powers of the provinces and the organizational mechanism for their execution, there is a significant asymmetry. In all the provinces, there is a unique junction between devolved powers and their holders. Before the referendum on the independence in Scotland in September 2014, the increase of devolved powers was promised not only for all the historical provinces (Scotland, Wales, Northern Ireland, but for England as well, which represents a step towards the federalization of the UK. Devolution and several other institutions of the British constitution also, have a stamp 'Made in Britain' which does not allow easy imitation and transfer to another countries and their constitutions.

  15. Equivalent unit in telecommunications services

    Directory of Open Access Journals (Sweden)

    Luiza Santangelo Reis

    2016-03-01

    Full Text Available The aim of this study is to analyze the relationship between the “cost” and “production” variables in a telecommunications company, measuring the latter in the unit of measure termed Network Units (NU.  The study shows a Pearson correlation coefficient of 0.55 -evaluated as moderate - over the course of a 24-month period and resulting from 177 trials.  Subsequently, only the work teams composed of the company´s standard structure were taken into consideration, which yielded 32 observations of interest and a derived correlation coefficient of 0.8.  Finally, the data pertaining to each individual work team over a determined length of time was analyzed, showing strong correlation coefficients in seven of the eleven, and in the remainder, a moderate linear relationship between the variables analyzed.  These results suggest the viability of applying the NU production measurement model in the telecommunications company in question

  16. Teen Pregnancy in the United States

    Science.gov (United States)

    ... United States: the contribution of abstinence and improved contraceptive use. Am J Public Health. 2007;97(1):150-6. Lindberg LD, Santelli JS, Desai, S. Understanding the Decline in Adolescent Fertility in the United States, 2007–2012. J ...

  17. 76 FR 66845 - United Nations Day, 2011

    Science.gov (United States)

    2011-10-27

    ... become ever more intertwined, the leadership, staff, and member states of the United Nations continue to... a time of dramatic political transformation, the United Nations can embrace democratic movements and...

  18. 16-channel analog store and multiplexer unit

    Energy Technology Data Exchange (ETDEWEB)

    Brossard, M; Kulka, Z [Clermont-Ferrand-2 Univ., 63 - Aubiere (France). Lab. de Physique Corpusculaire

    1979-03-15

    A 16-channel analog store and multiplexer unit is described. The unit enables storing and selection of analog information which is then digitally encoded by single ADC. This solution becomes economically attractive particularly in multidetector pulse height analysis systems.

  19. Coordinator, Evaluation Unit | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Job Summary The Evaluation Unit Coordinator is expected to: ... with Centre policies and procedures and disseminates information to Unit staff on changes ... Coordinates the planning and organization of technical and administrative meetings ...

  20. Order units in a C-algebra

    Indian Academy of Sciences (India)

    Abstract. Order unit property of a positive element in a *-algebra is defined. It is proved that precisely projections satisfy this order theoretic property. This way, unital hereditary *-subalgebras of a *-algebra are characterized.

  1. Labour of love yields new maternity unit.

    Science.gov (United States)

    2012-01-01

    Birmingham's City Hospital's new maternity unit is an inspiring departure from conventional units. Contemporary design and the latest technology combine to give mothers a safe, yet relaxed, environment in which to give birth. HEJ reports.

  2. Fatigue in Breakwater Concrete Armour Units

    DEFF Research Database (Denmark)

    Burcharth, Hans F.

    The reliability of rubble mound breakwaters depends on the hydraulic stability and the mechanical strength of the armour units. The paper deals with the important aspect of fatigue related to the strength of concrete armour units.......The reliability of rubble mound breakwaters depends on the hydraulic stability and the mechanical strength of the armour units. The paper deals with the important aspect of fatigue related to the strength of concrete armour units....

  3. Vehicle with inclinable caterpillar propulsion units

    International Nuclear Information System (INIS)

    Clar, G.

    1991-01-01

    This vehicle usable in hostile environment such nuclear industry has four propulsion units with a caterpillar track and two integrated motors: one for advancing the caterpillar track and the other for inclining the propulsion unit when overcoming obstacles. Each propulsion unit is easily replaceable because there are no mechanical parts in the body of the vehicle [fr

  4. 24 CFR 970.31 - Replacement units.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Replacement units. 970.31 Section... PUBLIC HOUSING PROGRAM-DEMOLITION OR DISPOSITION OF PUBLIC HOUSING PROJECTS § 970.31 Replacement units. Notwithstanding any other provision of law, replacement public housing units may be built on the original public...

  5. Oil Vulnerabilities and United States Strategy

    Science.gov (United States)

    2007-02-08

    Mazda, Mercedes - Benz , Ford, Mercury, and Nissan offer flexible fuel vehicles in the United States. Ethanol is currently produced in the United States...USAWC STRATEGY RESEARCH PROJECT OIL VULNERABILITIES AND UNITED STATES STRATEGY by Colonel Shawn P. Walsh...Colleges and Schools, 3624 Market Street, Philadelphia, PA 19104, (215) 662-5606. The Commission on Higher Education is an institutional accrediting

  6. 7 CFR 1215.20 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1215.20 Section 1215.20 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... United States. United States means all of the States. Popcorn Board ...

  7. 7 CFR 1260.108 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1260.108 Section 1260.108 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Promotion and Research Order Definitions § 1260.108 United States. United States means the 50 States and the...

  8. 7 CFR 1280.127 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1280.127 Section 1280.127 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Definitions § 1280.127 United States. United States means collectively the 50 States and the District of Columbia. ...

  9. 7 CFR 1210.315 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1210.315 Section 1210.315 Agriculture... PLAN Watermelon Research and Promotion Plan Definitions § 1210.315 United States. United States means each of the several States and the District of Columbia. [60 FR 10797, Feb. 28, 1995] National...

  10. 7 CFR 1221.32 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1221.32 Section 1221.32 Agriculture... INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.32 United States. United States or U.S. means collectively the 50 States, the District of Columbia, the Commonwealth of...

  11. 7 CFR 1216.30 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1216.30 Section 1216.30 Agriculture... INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.30 United States. United States means collectively the 50 states, the District of Columbia, the Commonwealth of Puerto Rico...

  12. 7 CFR 1218.22 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1218.22 Section 1218.22 Agriculture... INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.22 United States. United States means collectively the 50 states, the District of Columbia, the Commonwealth of Puerto Rico...

  13. SPOKEN CUZCO QUECHUA, UNITS 1-6.

    Science.gov (United States)

    SOLA, DONALD F.; AND OTHERS

    THE MATERIALS IN THIS VOLUME COMPRISE SIX UNITS WHICH PRESENT BASIC ASPECTS OF CUZCO QUECHUA PHONOLOGY, MORPHOLOGY, AND SYNTAX FOR THE BEGINNING STUDENT. THE SIX UNITS ARE DESIGNED FOR APPROXIMATELY 120 HOURS OF SUPERVISED CLASS WORK WITH OUTSIDE PREPARATION EXPECTED OF THE STUDENT. EACH UNIT CONSISTS OF A DIALOGUE TO BE MEMORIZED, A DIALOGUE…

  14. United Nations and multilateralism: appraising USA's unilateralism ...

    African Journals Online (AJOL)

    Multilateralism as symbolized by the United Nations Organization, seems to have come under threat today, and nowhere is this more evident than in the United States-United Nations relations particularly in the area of military interventions around the world. The aim of this paper is to appraise the practice of the principle of ...

  15. Ecological units of the Northern Region: Subsections

    Science.gov (United States)

    John A. Nesser; Gary L. Ford; C. Lee Maynard; Debbie Dumroese

    1997-01-01

    Ecological units are described at the subsection level of the Forest Service National Hierarchical Framework of Ecological Units. A total of 91 subsections are delineated on the 1996 map "Ecological Units of the Northern Region: Subsections," based on physical and biological criteria. This document consists of descriptions of the climate, geomorphology,...

  16. Image processing unit with fall-back.

    NARCIS (Netherlands)

    2011-01-01

    An image processing unit ( 100,200,300 ) for computing a sequence of output images on basis of a sequence of input images, comprises: a motion estimation unit ( 102 ) for computing a motion vector field on basis of the input images; a quality measurement unit ( 104 ) for computing a value of a

  17. Unit area control in California forests

    Science.gov (United States)

    William E. Hallin

    1951-01-01

    There is a definite distinction between the basic concept of unit area control and the specific techniques or treatments used for specific units. Unit area control as a term was first used in connection with a cutting trial in the sugar pine-fir type; consequently, many foresters think the term refers merely to the technique used in sugar pine management, This is not...

  18. 12 CFR 541.10 - Dwelling unit.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Dwelling unit. 541.10 Section 541.10 Banks and... FEDERAL SAVINGS ASSOCIATIONS § 541.10 Dwelling unit. The term dwelling unit means the unified combination of rooms designed for residential use by one family, other than a single-family dwelling. ...

  19. Malaria Surveillance - United States, 2015.

    Science.gov (United States)

    Mace, Kimberly E; Arguin, Paul M; Tan, Kathrine R

    2018-05-04

    Malaria in humans is caused by intraerythrocytic protozoa of the genus Plasmodium. These parasites are transmitted by the bite of an infective female Anopheles species mosquito. The majority of malaria infections in the United States occur among persons who have traveled to regions with ongoing malaria transmission. However, malaria is occasionally acquired by persons who have not traveled out of the country through exposure to infected blood products, congenital transmission, laboratory exposure, or local mosquitoborne transmission. Malaria surveillance in the United States is conducted to provide information on its occurrence (e.g., temporal, geographic, and demographic), guide prevention and treatment recommendations for travelers and patients, and facilitate transmission control measures if locally acquired cases are identified. This report summarizes confirmed malaria cases in persons with onset of illness in 2015 and summarizes trends in previous years. Malaria cases diagnosed by blood film microscopy, polymerase chain reaction, or rapid diagnostic tests are reported to local and state health departments by health care providers or laboratory staff members. Case investigations are conducted by local and state health departments, and reports are transmitted to CDC through the National Malaria Surveillance System (NMSS), the National Notifiable Diseases Surveillance System (NNDSS), or direct CDC consultations. CDC reference laboratories provide diagnostic assistance and conduct antimalarial drug resistance marker testing on blood samples submitted by health care providers or local or state health departments. This report summarizes data from the integration of all NMSS and NNDSS cases, CDC reference laboratory reports, and CDC clinical consultations. CDC received reports of 1,517 confirmed malaria cases, including one congenital case, with an onset of symptoms in 2015 among persons who received their diagnoses in the United States. Although the number of

  20. Sleep in intensive care unit

    DEFF Research Database (Denmark)

    Boyko, Yuliya; Jennum, Poul; Nikolic, Miki

    2017-01-01

    PURPOSE: To determine if improving intensive care unit (ICU) environment would enhance sleep quality, assessed by polysomnography (PSG), in critically ill mechanically ventilated patients. MATERIALS AND METHODS: Randomized controlled trial, crossover design. The night intervention "quiet routine...... Medicine) sleep scoring criteria were insufficient for the assessment of polysomnograms. Modified classification for sleep scoring in critically ill patients, suggested by Watson et al. (Crit Care Med 2013;41:1958-1967), was used. RESULTS: Sound level analysis showed insignificant effect...... patients. We were not able to further reduce the already existing low noise levels in the ICU and did not find any association between the environmental intervention and the presence of normal sleep characteristics in the PSG....

  1. Fracking in the United States

    International Nuclear Information System (INIS)

    Cho, Renee

    2015-01-01

    Over the last decade, advances in technology have made it profitable to extract natural gas from shale, leading to a boom in shale gas development in the United States. Hydraulic fracturing, or fracking, the controversial method for extracting natural gas, offers numerous benefits: relatively cheap energy, enhanced energy security, job creation, tax revenues and decreased dependence on dirty coal. Fracking, however, can also increase greenhouse gas emissions, pollute the air and result in health effects, consume huge quantities of water, and cause earthquakes. While some areas welcome fracking for the economic benefits it brings, other communities are attempting to ban fracking altogether. This article examines the benefits and risks of fracking in the U.S

  2. United States uranium enrichment policies

    International Nuclear Information System (INIS)

    Roberts, R.W.

    1977-01-01

    ERDA's uranium enrichment program policies governing the manner in which ERDA's enrichment complex is being operated and expanded to meet customer requirements for separative work, research and development activities directed at providing technology alternatives for future enrichment capacity, and establishing the framework for additional domestic uranium enrichment capacity to meet the domestic and foreign nuclear industry's growing demand for enrichment services are considered. The ERDA enrichment complex consists of three gaseous diffusion plants located in Oak Ridge, Tennessee; Paducah, Kentucky; and Portsmouth, Ohio. Today, these plants provide uranium enrichment services for commercial nuclear power generation. These enrichment services are provided under contracts between the Government and the utility customers. ERDA's program involves a major pilot plant cascade, and pursues an advanced isotope separation technique for the late 1980's. That the United States must develop additional domestic uranium enrichment capacity is discussed

  3. Biblis unit A thirty years

    International Nuclear Information System (INIS)

    Lauer, H.

    2004-01-01

    The first nuclear power plant in the Federal Republic of Germany started operation in 1961. It was followed by a consistent period of development until a new energy source had become available by the late sixties which was both powerful and capable of expansion. With 1200 MW electric power, the pressurized water reactor of Biblis A in 1974 was equipped with the world's most powerful single-shaft turbine generator. In 187,656 hours of operation, Biblis A over the past thirty years generated slightly more than 211 billion kWh of gross electricity (by July 31, 2004). The operating experience accumulated also resulted in improvements and modifications of technical plant systems in the 1970s and 1980s which served to bring the unit up to the then current state of the art. Modifications of technical plant systems serving to increase the safety margins or improve operating systems, always in the light of the state of the art, have been carried out consistently and continuously over the years. In combination with a high level of qualification of the operating personnel, which is ensured by an efficient system of primary and refresher training courses of responsible shift personnel and other groups of power plant personnel, this creates a lasting foundation of safe plant operation. In connection with the preparations for, and the execution of, revision outages, Biblis provided the first experience with a PWR of this size category. Unit A of the Biblis nuclear power station is proof of the fact that technical and safety challenges can be solved, and have been solved, by engineering expertise. The high availability and low susceptibility to failure of the plant demonstrate the widely optimized maintenance strategy and the high qualification and motivation of the staff. (orig.)

  4. Edexcel A2 Physics Student Unit Guide

    CERN Document Server

    Benn, Mike

    2010-01-01

    Student Unit Guides are perfect for revision. Each guide is written by an examiner and explains the unit requirements, summarises the relevant unit content and includes a series of specimen questions and answers. There are three sections to each guide:. Introduction - includes advice on how to use the guide, an explanation of the skills being tested by the assessment objectives, an outline of the unit or module and, depending on the unit, suggestions for how to revise effectively and prepare for the examination questions. Content Guidance - provides an examiner's overview of the module's key t

  5. AQA A2 Chemistry Student Unit Guide

    CERN Document Server

    Cross, Margaret

    2010-01-01

    Student Unit Guides are perfect for revision. Each guide is written by an examiner and explains the unit requirements, summarises the relevant unit content and includes a series of specimen questions and answers. There are three sections to each guide:. Introduction - includes advice on how to use the guide, an explanation of the skills being tested by the assessment objectives, an outline of the unit or module and, depending on the unit, suggestions for how to revise effectively and prepare for the examination questions. Content Guidance - provides an examiner's overview of the module's key t

  6. Hanford Site Waste Managements Units reports

    International Nuclear Information System (INIS)

    1992-01-01

    The Hanford Site Waste Management Units Report (HSWMUR) was originated to provide information responsive to Section 3004(u) of the Hazardous and Solid Waste Amendments (HSWA) of the 1984 United States Code (USC 1984). This report provides a comprehensive inventory of all types of waste management units at the Hanford Site, including a description of the units and the waste they contain. Waste management units in this report include: (1) Resource Conservation and Recovery Act of 1976 (RCRA) disposal units, (2) Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) disposal units, (3) unplanned releases, (4) inactive contaminated structures, (5) RCRA treatment, storage, and disposal (TSD) units, and (6) other storage areas. Because of the comprehensive nature of this report, the listing of sites is more extensive than required by Section 3004(u) of HSWA. The information in this report is extracted from the Waste Information Data System (WIDS). The WIDS provides additional information concerning the waste management units contained in this report and is maintained current with changes to these units. This report is updated annually if determined necessary per the Hanford Federal Facility Agreement and Consent Order Order (commonly referred to as the Tri-Party Agreement, Ecology et al. 1990). This report identifies 1,414 waste management units. Of these, 1,015 units are identified as solid waste management units (SWMU), and 342 are RCRA treatment, storage, and disposal units. The remaining 399 are comprised mainly of one-time spills to the environment, sanitary waste disposal facilities (i.e., septic tanks), and surplus facilities awaiting decontamination and decommissioning

  7. 3 CFR - Waiver of Reimbursement Under the United Nations Participation Act to Support the United Nations...

    Science.gov (United States)

    2010-01-01

    ... Participation Act to Support the United Nations/African Union Mission in Darfur Presidential Documents Other... the United Nations Participation Act to Support the United Nations/African Union Mission in Darfur... the United Nations/African Union Mission in Darfur to support the airlift of equipment for...

  8. Discharge from an emergency department observation unit and a surgical assessment unit

    DEFF Research Database (Denmark)

    Schultz, Helen; Qvist, Niels; Backer Mogensen, Christian

    2014-01-01

    To investigate the experiences of patients with acute abdominal pain at discharge from an emergency department observation unit compared with discharge from a surgical assessment unit.......To investigate the experiences of patients with acute abdominal pain at discharge from an emergency department observation unit compared with discharge from a surgical assessment unit....

  9. Malaria Surveillance - United States, 2014.

    Science.gov (United States)

    Mace, Kimberly E; Arguin, Paul M

    2017-05-26

    Malaria in humans is caused by intraerythrocytic protozoa of the genus Plasmodium. These parasites are transmitted by the bite of an infective female Anopheles mosquito. The majority of malaria infections in the United States occur among persons who have traveled to regions with ongoing malaria transmission. However, malaria is occasionally acquired by persons who have not traveled out of the country through exposure to infected blood products, congenital transmission, laboratory exposure, or local mosquitoborne transmission. Malaria surveillance in the United States is conducted to identify episodes of local transmission and to guide prevention recommendations for travelers. This report summarizes cases in persons with onset of illness in 2014 and trends during previous years. Malaria cases diagnosed by blood film, polymerase chain reaction, or rapid diagnostic tests are reported to local and state health departments by health care providers or laboratory staff. Case investigations are conducted by local and state health departments, and reports are transmitted to CDC through the National Malaria Surveillance System, National Notifiable Diseases Surveillance System, or direct CDC consultations. CDC conducts antimalarial drug resistance marker testing on blood samples submitted by health care providers or local or state health departments. Data from these reporting systems serve as the basis for this report. CDC received reports of 1,724 confirmed malaria cases, including one congenital case and two cryptic cases, with onset of symptoms in 2014 among persons in the United States. The number of confirmed cases in 2014 is consistent with the number of confirmed cases reported in 2013 (n = 1,741; this number has been updated from a previous publication to account for delayed reporting for persons with symptom onset occurring in late 2013). Plasmodium falciparum, P. vivax, P. ovale, and P. malariae were identified in 66.1%, 13.3%, 5.2%, and 2.7% of cases, respectively

  10. Hanford Site Waste Management Units Report

    International Nuclear Information System (INIS)

    1991-01-01

    This Hanford Site Waste Management Units Report (HSWMUR) was originated to provide information responsive to Section 3004(u) of the Hazardous and Solid Waste Amendments (HSWA) of the 1984 United States Code (USC). The report provides a comprehensive inventory of all types of waste management units at the Hanford Site and consists of waste disposal units, including (1) Resource Conservation and Recovery Act of 1976 (RCRA) disposal units, (2) Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) disposal units, (3) unplanned releases, (4) inactive contaminated structure, (5) RCRA treatment and storage units, and (6) other storage areas. Because of the comprehensive nature of this report, the listing of sites is more extensive than required by Section 3004(u) of HSWA. In support of the Hanford RCRA permit, a field was added to designate whether the waste management unit is a solid waste management unit (SWMU). As SWMUs are identified, they will added to the Hanford Waste Information Data System (WIDS), which is the database supporting this report, and added to the report at its next annual update. A quality review of the WIDS was conducted this past year. The review included checking all data against their reference and making appropriate changes, updating the data elements using the most recent references, marking duplicate units for deletion, and addition additional information. 6 refs

  11. Hanford Site Waste Management Units Report

    International Nuclear Information System (INIS)

    1991-01-01

    This Hanford Site Waste Management Units Report (HSWMUR) was originated to provide information responsive to Section 3004(u) of the Hazardous and Solid Waste Amendments (HSWA) of the 1984 United States Code (USC). The report provides a comprehensive inventory of all types of waste management units at the Hanford Site and consists of waste disposal units, including (1) Resource Conservation and Recovery Act of 1976 (RCRA) disposal units, (2) Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) disposal units, (3) unplanned releases, (4) inactive contaminated structures, (5) RCRA treatment and storage units, and (6) other storage areas. Because of the comprehensive nature of this report, the listing of sites is more extensive than required by Section 3004(u) of HSWA. In support of the Hanford RCRA permit, a field was added to designate whether the waste management unit is a solid waste management unit (SWMU). As SWMUs are identified, they will added to the Hanford Waste Information Data System (WIDS), which is the database supporting this report, and added to the report at its next annual update. A quality review of the WIDS was conducted this past year. The review included checking all data against their reference and making appropriate changes, updating the data elements using the most recent references, marking duplicate units for deletion, and adding additional information. 6 refs

  12. Generating units performances: power system requirements

    Energy Technology Data Exchange (ETDEWEB)

    Fourment, C; Girard, N; Lefebvre, H

    1994-08-01

    The part of generating units within the power system is more than providing power and energy. Their performance are not only measured by their energy efficiency and availability. Namely, there is a strong interaction between the generating units and the power system. The units are essential components of the system: for a given load profile the frequency variation follows directly from the behaviour of the units and their ability to adapt their power output. In the same way, the voltage at the units terminals are the key points to which the voltage profile at each node of the network is linked through the active and especially the reactive power flows. Therefore, the customer will experience the frequency and voltage variations induced by the units behaviour. Moreover, in case of adverse conditions, if the units do not operate as well as expected or trip, a portion of the system, may be the whole system, may collapse. The limitation of the performance of a unit has two kinds of consequences. Firstly, it may result in an increased amount of not supplied energy or loss of load probability: for example if the primary reserve is not sufficient, a generator tripping may lead to an abnormal frequency deviation, and load may have to be shed to restore the balance. Secondly, the limitation of a unit performance results in an economic over-cost for the system: for instance, if not enough `cheap` units are able to load-following, other units with higher operating costs have to be started up. We would like to stress the interest for the operators and design teams of the units on the one hand, and the operators and design teams of the system on the other hand, of dialog and information exchange, in operation but also at the conception stage, in order to find a satisfactory compromise between the system requirements and the consequences for the generating units. (authors). 11 refs., 4 figs.

  13. International law and United Nations

    Directory of Open Access Journals (Sweden)

    Savić Matej

    2012-01-01

    Full Text Available Along with centuries-lasting open military pretensions of world superpowers, modern diplomacy has developed, as beginning a war, as well as coming to peace demanded political activity which resulted, first in signing, and then coming into effect of international documents, on the basis of which, a foundation for the modern international order has been cast. Further on, by the formation of international organizations, codification has been allowed, as well as a progressive development of international law. Additionally, in the sense of preserving international peace and security, first the League of Nations was formed, and following the ending of World War II, the UN. Generally, the functioning of the United Nation's organs, has been regulated by legal rules, however political goals, tendencies, and mechanisms which the member states are using determine greatly the activity above all of the Security Council, but furthermore of the General Assembly, as a plenary organ. Nevertheless, the achieved results of the Commission for International Law in the meaning of creation of international conventions, as well as state adhering to the same, present unassailable achievements in the sense of development of international law. On the other hand, tendencies of motion of international relationships are aimed at establishing a multi-polar system in the international community. Today, the political scene is assuming a new appearance, by which the nearly built international system is already awaiting further progressive development.

  14. Decommissioning: a United Kingdom perspective

    International Nuclear Information System (INIS)

    Haworth, A.; Reed, D.L.; Bleeze, A.

    1995-01-01

    The paper considers the United Kingdom legislative framework relevant to decommissioning of facilities on nuclear licensed sites. It describes the various legislative bodies involved in regulating this activity and the inspectorate concerned. The licensing regime is described in some detail highlighting the UK arrangements whereby a license is granted for the site upon which nuclear facilities are planned or exist. The license remains in place throughout the life of the plant on the site: from initial planning through to the end of decommissioning. A site (of part of) is not de-licensed until it can be stated that there has ceased to be any danger from ionising radiations from anything on the site (or appropriate part of the site). The final part of the paper considers the changes arising from the commercialization of the nuclear power industry in UK and the restatement of the Nuclear Installation Inspectorate's policy on decommissioning which has arisen as a result of a review made in response to these changes. (author)

  15. Several hundred megawatt MHD units

    International Nuclear Information System (INIS)

    Pishchikov, S.; Pinkhasik, D.; Sidorov, V.

    1978-01-01

    The features are described of the future MHD unit U-25 tested at the Institute of High Temperatures of the Academy of Sciences of the USSR. The attainable thermal load of the combustion chamber is 290x10 6 kJ/m 3 .h. Three types of channel were tested, i.e., the Faraday channel divided into sections with modular insulating walls, the diagonal channel without metal body, and an improved Faraday channel with an output of 20 MW. The described MHD generator is equipped with an inverter which transforms direct current into alternating current, continuously adjusts the load from no-load operation to short-circuit connection and maintains the desired electrical voltage independently of the changes in loading. A new technique of connecting and disconnecting the oxygen equipment was developed which considerably reduces the time of start-up and shut-down. Natural gas is used for heating the air heaters. All equipment used in the operation of the MHD generator is remote controlled by computer or manually. (J.B.)

  16. Several hundred megawatt MHD units

    Energy Technology Data Exchange (ETDEWEB)

    Pishchikov, S; Pinkhasik, D; Sidorov, V

    1978-07-01

    The features are described of the future MHD unit U-25 tested at the Institute of High Temperatures of the Academy of Sciences of the USSR. The attainable thermal load of the combustion chamber is 290x10/sup 6/ kJ/m/sup 3/.h. Three types of channel were tested, i.e., the Faraday channel divided into sections with modular insulating walls, the diagonal channel without metal body, and an improved Faraday channel with an output of 20 MW. The described MHD generator is equipped with an inverter which transforms direct current into alternating current, continuously adjusts the load from no-load operation to short-circuit connection and maintains the desired electrical voltage independently of the changes in loading. A new technique of connecting and disconnecting the oxygen equipment was developed which considerably reduces the time of start-up and shut-down. Natural gas is used for heating the air heaters. All equipment used in the operation of the MHD generator is remote controlled by computer or manually.

  17. AREVA in the United States

    International Nuclear Information System (INIS)

    2007-01-01

    In 2005, the United States had 297 million inhabitants (the 3. most populous country in the world) and a land area of 9.4 million km 2 (17 times larger than France). With a GDP of 10,996 billion dollars (under the economic conditions of the year 2000), the U.S. is the largest economic power in the world. It is also the largest consumer of energy, with primary energy consumption of 2,329 million metric tons, meaning that 25% of the world's energy is consumed by just 4% of its population. Although it has large domestic energy supplies, the U.S. is very far from achieving energy self-sufficiency. A decline of nearly 50% in oil production over a period of more than 30 years and the simultaneous stagnation of gas production have further weakened the U.S. energy balance. On a more general level, the increasing depletion of hydrocarbon resources (gas and oil), the concentration of the world's main resources in geo-politically unstable areas and the forecasted increase in the consumption and price of hydrocarbons, especially since 2005, mean that energy independence and supply security have become 2 of the top priorities of U.S. commercial and international policy. In 2007, the U.S. accounted for 22% of global CO 2 emissions, equaling those of China. In relation to population, the U.S. emits 8 metric tons/inhabitant compared to a world average of 4.2 metric tons/inhabitant. Although global warming is seen as a reality by the American public, it has only recently become a major argument in favor of a nuclear energy revival in the U.S. The context is, however, changing significantly. This is evidenced by America's adoption, in recent years, of measures to reduce greenhouse gases, particularly through the development of new, more environmentally friendly technologies. Since 2001, nearly 23 billion dollars in public funds have been devoted to climate research and the development of clean energy sources, notably renewable energies such as wind and solar, but also hydrogen and

  18. Patient dose in neonatal units

    International Nuclear Information System (INIS)

    Smans, K.; Struelens, L.; Smet, M.; Bosmans, H.; Vanhavere, F.

    2008-01-01

    Lung disease represents one of the most life-threatening conditions in prematurely born children. In the evaluation of the neonatal chest, the primary and most important diagnostic study is therefore the chest radiograph. Since prematurely born children are very sensitive to radiation, those radiographs may lead to a significant radiation detriment. Hence, knowledge of the patient dose is necessary to justify the exposures. A study to assess the patient doses was started at the neonatal intensive care unit (NICU) of the Univ. Hospital in Leuven. Between September 2004 and September 2005, prematurely born babies underwent on average 10 X-ray examinations in the NICU. In this sample, the maximum was 78 X-ray examinations. For chest radiographs, the median entrance skin dose was 34 μGy and the median dose area product was 7.1 mGy.cm 2 . By means of conversion coefficients, the measured values were converted to organ doses. Organ doses were calculated for three different weight classes: extremely low birth weight infants ( 2500 g). The doses to the lungs for a single chest radiograph for infants with extremely low birth weights, low birth weights and normal birth weights were 24, 25 and 32 μGy, respectively. (authors)

  19. United Kingdom electric system privatization

    Energy Technology Data Exchange (ETDEWEB)

    Lolli, A. (Bologna Univ. (Italy))

    1992-03-01

    This paper reviews the mechanics and first results of deregulation in the electric power industry of the United Kingdom. Several aspects are dealt with, namely: 1983 Energy Act impacts on ownership and subsequent changes brought about by the 1989 Energy Act; the Act's stipulations with regard to share acquisition and distribution; the division of the patrimony of the Area Boards; natural monopolistic characteristics of power distribution; vertical integration in Scotland, target investment limits in Government and public participation; the 'golden share' concept to guarantee public participation; current 40% share ownership by the Government; 15% private ownership limit for individual investors; external control by Government of licensing and rate structure setting; the impacts of organizational changes on the overall cost benefits of deregulation; modified Governmental regulatory powers; measures to ensure competition and consumer protection; provisions regarding misbehaviour; second tier suppliers and reserve fuel supply obligations; deregulation impacts on nuclear power marketing; power pooling regulations; installation of new transmission lines; provisions encouraging the use of diverse energy sources; franchising; interconnection with national grid; regulation of technical operations; standby as it affects rate structure; and spot market pricing.

  20. Neurovascular Unit in Chronic Pain

    Directory of Open Access Journals (Sweden)

    Beatrice Mihaela Radu

    2013-01-01

    Full Text Available Chronic pain is a debilitating condition with major socioeconomic impact, whose neurobiological basis is still not clear. An involvement of the neurovascular unit (NVU has been recently proposed. In particular, the blood-brain barrier (BBB and blood-spinal cord barrier (BSCB, two NVU key players, may be affected during the development of chronic pain; in particular, transient permeabilization of the barrier is suggested by several inflammatory- and nerve-injury-based pain models, and we argue that the clarification of molecular BBB/BSCB permeabilization events will shed new light in understanding chronic pain mechanisms. Possible biases in experiments supporting this theory and its translational potentials are discussed. Moving beyond an exclusive focus on the role of the endothelium, we propose that our understanding of the mechanisms subserving chronic pain will benefit from the extension of research efforts to the NVU as a whole. In this view, the available evidence on the interaction between analgesic drugs and the NVU is here reviewed. Chronic pain comorbidities, such as neuroinflammatory and neurodegenerative diseases, are also discussed in view of NVU changes, together with innovative pharmacological solutions targeting NVU components in chronic pain treatment.

  1. Management information systems. [United Kingdom

    Energy Technology Data Exchange (ETDEWEB)

    Hartley, D.; Spence, A.C.

    1985-02-01

    The successful application in the United Kingdom of the real time monitoring and control systems (MINOS) for underground mining operations, particularly in coal transport and the development of coalface monitoring (FIDO) in 1980 led naturally to the design of an operational data base for management. A User Group of experienced colliery managers produced a Management Information System (MIS) requirements specification and began the evolution of the systems of today. Twenty-four mines operate MIS in different ways from total dependency to a means of checking their manual reporting system. MIS collects useful data from all the major MINOS applications and provides a means of manually inputting other, relevant information. A wide variety of displays and reports are available to management, adjusted to meet individual requirements. The benefits from the use of MIS are difficult to quantify, since they become part of the management process. Further developments are taking place based on operational experience and requirements and taking advantage of the recent advances in computer technology. MIS is the modern management tool in British coal mining, collecting, storing, analysing and presenting accurate information upon which management decision making is based.

  2. AREVA in the United States

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-07-01

    In 2005, the United States had 297 million inhabitants (the 3. most populous country in the world) and a land area of 9.4 million km{sup 2} (17 times larger than France). With a GDP of 10,996 billion dollars (under the economic conditions of the year 2000), the U.S. is the largest economic power in the world. It is also the largest consumer of energy, with primary energy consumption of 2,329 million metric tons, meaning that 25% of the world's energy is consumed by just 4% of its population. Although it has large domestic energy supplies, the U.S. is very far from achieving energy self-sufficiency. A decline of nearly 50% in oil production over a period of more than 30 years and the simultaneous stagnation of gas production have further weakened the U.S. energy balance. On a more general level, the increasing depletion of hydrocarbon resources (gas and oil), the concentration of the world's main resources in geo-politically unstable areas and the forecasted increase in the consumption and price of hydrocarbons, especially since 2005, mean that energy independence and supply security have become 2 of the top priorities of U.S. commercial and international policy. In 2007, the U.S. accounted for 22% of global CO{sub 2} emissions, equaling those of China. In relation to population, the U.S. emits 8 metric tons/inhabitant compared to a world average of 4.2 metric tons/inhabitant. Although global warming is seen as a reality by the American public, it has only recently become a major argument in favor of a nuclear energy revival in the U.S. The context is, however, changing significantly. This is evidenced by America's adoption, in recent years, of measures to reduce greenhouse gases, particularly through the development of new, more environmentally friendly technologies. Since 2001, nearly 23 billion dollars in public funds have been devoted to climate research and the development of clean energy sources, notably renewable energies such as wind and solar

  3. The Kozloduy project management unit

    International Nuclear Information System (INIS)

    Carnes, W.S.; Gros-Gean, P.; Demireva, E.

    2004-01-01

    The Project Management Unit (PMU) has been established in support to the Kozloduy NPP decommissioning department. It is comprised of a Consortium of the British Nuclear Group, EDF and subcontractor ENPRO Consult. It is responsible for the management of seven projects (a facility for dry storage of spent fuel; equipment to treat low activity liquid radioactive waste; provision of physical separation of the plant systems and areas to be decommissioned from the ones in operation; equipment to decontaminate and clean pools and large tanks; a facility to provide high volume reduction of solid radioactive wastes and retrieval and conditioning of ion exchange resins and other sorbents; equipment to provide measurement for the free-release of materials and components; a facility for personnel monitoring, decontamination and clothes changing for work outside of the normal radiological control areas) that will be used in support of the KNPP decommissioning process. The projects will be tendered in compliance with the European Bank for Reconstruction and Development requirements

  4. Data report: western United States

    International Nuclear Information System (INIS)

    Cook, J.R.; Fay, W.M.

    1982-04-01

    This abbreviated summary data report, presents results of ground water and stream surface sediment reconnaissance in the western United States. Surface sediment samples were collected at 67,741 sites, at a target sampling density of one site per 13 square kilometers. Ground water samples were collected at 13,979 sites, and surface water samples were collected at 2,958 sites. Neutron activaton analysis results are given for uranium and 16 other elements in sediments, and for uranium and 9 other elements in waters. Mass spectrometry results are given for helium in ground waters. Supplemental analyses of the sediments for extractable uranium and 22 other elements are given where they are available. Supplemental analyses of water samples for 33 additional elements are also reported where they are available. Analytical data and field measurements are presented in tables on microfiche. Data from ground water sites (on microfiche in pocket) include (1) water chemistry measurements (pH, conductivity, and alkalinity), (2) physical measurements where applicable (water temperature, well description, and scintillometer reading), and (3) elemental analyses (U, Al, Br Cl, Dy, F, Mg, Mn, Na, and V by neutron activation and Ag, Al, As, B, Ba, Be, Ca, Ce, Co, Cr, Cu, Fe, K, Li, Mg, Mn, Mo, Na, Nb, Ni, P, Sc, Se, Si, Sr, Th, Ti, V, Y, Zn, and Zr by spectrophotometry). Helium analyses are given for ground water

  5. Effect of the administration time of HS6101 on hematopoietic recovery in ICR mice injured by cyclophosphamide

    Directory of Open Access Journals (Sweden)

    Shuang XING

    2015-06-01

    Full Text Available Objective To explore the effect of the administration time of HS6101 on hematopoietic recovery in ICR mice injured by cyclophosphamide (CTX. Methods One hundred and three male ICR mice were divided into 4 groups: CTX control, HS6101 prevention, HS6101 treatment, and HS6101 prevention+treatment groups. CTX was intraperitoneally injected into the ICR mice at a dose of 100mg/(kg.d for three consecutive days to establish a chemotherapeutics-injured model. HS6101 at a dose of 27μg/mouse in 0.2ml was subcutaneously injected into the mice 1h before the first administration of CTX in HS6101-prevention group, 1h after the last administration of CTX in HS6101 treatment group, and both at 1h before the first administration and 1h after the last administration of CTX in HS6101 prevention + treatment group. Physiological saline was subcutaneously injected into the mice in CTX control group (0.2ml/mouse. 10μl peripheral blood was collected from the caudal vein for WBC, neutrophil lymphocyte, RBC and platelet counts on day -1, 3, 5, 7, 9, 11, 13, 15, 17 with the MEK-7222K cell analyzer, and the cell count was compared between HS6101 treatment mice and CTX control mice. Another 30 male ICR mice were used for bone marrow colony forming unit (CFU assay and bone marrow histopathological examination, and they were assigned into normal control, CTX control, HS6101 prevention, HS6101treatment and HS6101 prevention + treatment groups (each n=6. On the day 4 and day 9 after CTX injection, mice were sacrificed and bone marrow cells were collected from the left femur for mononuclear cell (MNC isolation. 1×104 MNCs were planted in 1.0ml mouse CFU culture medium M3434 and cultured in incubator with the temperature of 37℃, and 5% CO2 for 7 days. After that, granulocyte macrophage-colony-forming unit (GM-CFU, megakaryocyte colony forming unit (MK-CFU, mixture-colony-forming unit (Mix-CFU, burst-forming unit-erythroid (BFU-E and colony-forming unit-erythroid (CFU

  6. The Unitality of Quantum B-algebras

    Science.gov (United States)

    Han, Shengwei; Xu, Xiaoting; Qin, Feng

    2018-02-01

    Quantum B-algebras as a generalization of quantales were introduced by Rump and Yang, which cover the majority of implicational algebras and provide a unified semantic for a wide class of substructural logics. Unital quantum B-algebras play an important role in the classification of implicational algebras. The main purpose of this paper is to construct unital quantum B-algebras from non-unital quantum B-algebras.

  7. Junior Leader Training Development in Operational Units

    Science.gov (United States)

    2012-04-01

    UNITS Successful operational units do not arise without tough, realistic, and challenging training. Field Manual (FM) 7-0, Training Units and D...operations. The manual provides junior leaders with guidance on how to conduct training and training management. Of particular importance is the definition...1 Relation htp between ADDIE and the Anny Training Management Model. The Army Training Management Model and ADDIE process appear in TRADOC PAM 350

  8. Fatigue in Breakwater Concrete Armour Units

    OpenAIRE

    Burcharth, Hans F.

    1984-01-01

    The reliability of rubble mound breakwaters depends on the hydraulic stability and the mechanical strength of the armour units. The paper deals with the important aspect of fatigue related to the strength of concrete armour units. Results showing significant fatigue from impact tests with Dolosse made of unreinforced and steel fibre reinforced flyash concrete are presented. Moreover universal graphs for fatigue in armour units made of conventional unreinforced concrete exposed to impact load ...

  9. Seasonal unit roots in trade variables

    OpenAIRE

    Carol Alexander; Manuel Cantavella Jordá

    1997-01-01

    In this paper we examine the presence of seasonal unit roots in trade variables for Germany, France, the United Kingdom, and Italy, using the procedure developed by Hylleberg, Engle, Granger, and Yoo (1990) [HEGY]. Both quarterly and monthly data reject the presence of unit roots at most seasonal frequencies, more frequently in quarterly than in monthly data. This has important implications for econometric modeling of trade balance, exchange rates and income in European Union (EU) countries. ...

  10. Contemporary United States Foreign Policy Towards Indonesia

    National Research Council Canada - National Science Library

    McAslan, Hugh

    2004-01-01

    United States national interests in Indonesia have traditionally being based on strategic security requirements given Indonesia's geographic location between the Indian and Pacific Oceans, and strong...

  11. Polymeric Traypack Integrity: Bench-Scale Unit

    National Research Council Canada - National Science Library

    Canavan, Jeffrey

    2002-01-01

    .... Additional experimentation was conducted to determine the applicability of the unit for non-destructive residual gas testing since current destructive tests represent a substantial continuing expense...

  12. Stabilization of gas turbine unit power

    Science.gov (United States)

    Dolotovskii, I.; Larin, E.

    2017-11-01

    We propose a new cycle air preparation unit which helps increasing energy power of gas turbine units (GTU) operating as a part of combined cycle gas turbine (CCGT) units of thermal power stations and energy and water supply systems of industrial enterprises as well as reducing power loss of gas turbine engines of process blowers resulting from variable ambient air temperatures. Installation of GTU power stabilizer at CCGT unit with electric and thermal power of 192 and 163 MW, respectively, has resulted in reduction of produced electrical energy production costs by 2.4% and thermal energy production costs by 1.6% while capital expenditures after installation of this equipment increased insignificantly.

  13. Portable brine evaporator unit, process, and system

    Science.gov (United States)

    Hart, Paul John; Miller, Bruce G.; Wincek, Ronald T.; Decker, Glenn E.; Johnson, David K.

    2009-04-07

    The present invention discloses a comprehensive, efficient, and cost effective portable evaporator unit, method, and system for the treatment of brine. The evaporator unit, method, and system require a pretreatment process that removes heavy metals, crude oil, and other contaminates in preparation for the evaporator unit. The pretreatment and the evaporator unit, method, and system process metals and brine at the site where they are generated (the well site). Thus, saving significant money to producers who can avoid present and future increases in transportation costs.

  14. Logistics Support of Naval Expeditionary Units

    National Research Council Canada - National Science Library

    Nilsen, Jan

    2004-01-01

    .... Based on literature from strategic management, logistics, and supply chain management, the research evaluates the existing theater logistics capabilities and the requirements of the supported expeditionary units...

  15. Clinical Epidemiology Unit - overview of research areas

    Science.gov (United States)

    Clinical Epidemiology Unit (CEU) conducts etiologic research with potential clinical and public health applications, and leads studies evaluating population-based early detection and cancer prevention strategies

  16. GENDER ISSUES: Perceptions of Readiness in Selected Units

    National Research Council Canada - National Science Library

    1999-01-01

    .... More than 13,000 women have joined these units.3 Among the units that have opened to women are Army smoke and chemical companies, forward support battalions, air defense artillery headquarters' units, military police units, and engineer companies...

  17. TRAINING OF THE STATE PRESIDENT'S UNIT

    African Journals Online (AJOL)

    The primary function of the State President's Unit is to protect the head of state - not his person as is generally believed, but his authority over the state. Ironically, the ceremonial performances of the State President's Unit lead people to believe that they are only capable of doing drill exer- cises. However, upon investigating.

  18. 40 CFR 157.27 - Unit packaging.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Unit packaging. 157.27 Section 157.27 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PACKAGING REQUIREMENTS FOR PESTICIDES AND DEVICES Child-Resistant Packaging § 157.27 Unit packaging. Pesticide products...

  19. Organizational evaluation of an interprofessional study unit

    DEFF Research Database (Denmark)

    Jensen, Didde Cramer; Nørgaard, Birgitte; Draborg, Eva

    2012-01-01

    This article presents results from an organizational evaluation of an interprofessional clinical study unit (ICS) in Denmark. The aim of this study was to test whether the ICS was based on a durable organizational concept and to identify the prerequisites for the unit to be successful...

  20. Global Entrepreneurship and the United States

    Science.gov (United States)

    2010-09-01

    Global Entrepreneurship and the United States by Zoltan J. Acs Laszlo Szerb Ruxton, MD 21204 for under contract number SBAHQ-09...SUBTITLE Global Entrepreneurship and the United States 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT...3 2.1. Assessing Entrepreneurship ..................................................................................4 2.2. Stages of Development

  1. Charpak, Garwin, propose unit for radiation dose

    CERN Multimedia

    Feder, Toni

    2002-01-01

    Becquerels, curries, grays, rads, rems, roentgens, sieverts - even for specialists the units of radiation can get confusing. That's why two eminent physicists, Georges Charpak of France, and Richard Garwin, are proposing the DARI as a unit of radiation dose they hope will help the public evaluate the risks associated with low-level radiation exposure (1 page)

  2. Block Gas Sol Unit in Haderslev

    DEFF Research Database (Denmark)

    Vejen, Niels Kristian

    2000-01-01

    Investigation of a SDHW system based on a Block Gas Sol Unit from Baxi A/S installed by a consumer i Haderslev, Denmark.......Investigation of a SDHW system based on a Block Gas Sol Unit from Baxi A/S installed by a consumer i Haderslev, Denmark....

  3. Traditional African Religion: A Resource Unit.

    Science.gov (United States)

    Garland, William E.

    This resource unit is based on research conducted by Lynn Mitchell and Ernest Valenzuela, experienced classroom teachers of African history and culture. The unit consists of an introduction by Mr. Garland and two major parts. Part I is an annotated bibliography of selected sources on various aspects of traditional African Religion useful in…

  4. Portable field water sample filtration unit

    International Nuclear Information System (INIS)

    Hebert, A.J.; Young, G.G.

    1977-01-01

    A lightweight back-packable field-tested filtration unit is described. The unit is easily cleaned without cross contamination at the part-per-billion level and allows rapid filtration of boiling hot and sometimes muddy water. The filtration results in samples that are free of bacteria and particulates and which resist algae growth even after storage for months. 3 figures

  5. Unit labour costs, productivity and international competitiveness

    NARCIS (Netherlands)

    Ark, Bart van; Stuivenwold, Edwin; Ypma, Gerard

    2005-01-01

    This paper provides international comparisons of relative levels of unit labour costs (ULC) for several OECD countries relative to the United States. The estimates are based on the Total Economy Database and the 60-Industry Database of the Groningen Growth and Development Centre (GGDC), and are also

  6. United States housing, first quarter 2013

    Science.gov (United States)

    Delton Alderman

    2014-01-01

    Provides current and historical information on housing market in the United States. Information includes trends for housing permits and starts, housing under construction, and housing completions for single and multifamily units, and sales and construction. This report will be updated regularly.

  7. 78 FR 64385 - United Nations Day, 2013

    Science.gov (United States)

    2013-10-28

    ... A Proclamation In 1945, after two world wars that showed the horrific lethality of modern conflict.... We celebrate the organization's challenging and often unheralded work of forging a world in which... children and grandchildren from the ravages of war, the members of the United Nations committed ``to unite...

  8. An intersection test for panel unit roots

    NARCIS (Netherlands)

    Hanck, C.

    2013-01-01

    This article proposes a new panel unit root test based on Simes' ( 1986) classical intersection test. The test is robust to general patterns of cross-sectional dependence and yet is straightforward to implement, only requiring p-values of time series unit root tests of the series in the panel, and

  9. National Lexicography Units: Past, Present, Future

    African Journals Online (AJOL)

    Mariëtta Alberts, Research Unit for Languages and Literature in SA Context,. Northwest ..... NLUs were also assisted with the marketing of the units and the obtaining .... each dictionary project, and developing an editorial style guide for each dic- .... The DSAE edited the South African Concise Oxford Dictionary that was.

  10. Oversight Institutions Within the United Nations

    DEFF Research Database (Denmark)

    Pontoppidan, Caroline Aggestam

    2015-01-01

    This article will give a description of the role of internal audit and governance functions within the United Nations system. The United Nations has, during the last 10 years, worked to establish effective oversight services. Oversight, governance and hereunder the internal audit function has been...

  11. Performance and burnout in intensive care units

    NARCIS (Netherlands)

    Keijsers, GJ; Schaufeli, WB; LeBlanc, P; Zwerts, C; Miranda, DR

    1995-01-01

    The relationship between three different performance measures and burnout was explored in 20 Dutch Intensive Care Units (ICUs). Burnout (i.e. emotional exhaustion and depersonalization) proved to be significantly related to nurses' perceptions of performance as well as to objectively assessed unit

  12. Physical protection of nuclear operational units

    International Nuclear Information System (INIS)

    1981-07-01

    The general principles of and basic requirements for the physical protection of operational units in the nuclear field are established. They concern the operational units whose activities are related with production, utilization, processing, reprocessing, handling, transport or storage of materials of interest for the Brazilian Nuclear Program. (I.C.R.) [pt

  13. 7 CFR 275.6 - Management units.

    Science.gov (United States)

    2010-01-01

    ... FOOD STAMP AND FOOD DISTRIBUTION PROGRAM PERFORMANCE REPORTING SYSTEM Management Evaluation (ME... management unit; (iii) Food Stamp Program participation, including the number of persons and number of... 7 Agriculture 4 2010-01-01 2010-01-01 false Management units. 275.6 Section 275.6 Agriculture...

  14. How Do We Really Compute with Units?

    Science.gov (United States)

    Fiedler, B. H.

    2010-01-01

    The methods that we teach students for computing with units of measurement are often not consistent with the practice of professionals. For professionals, the vast majority of computations with quantities of measure are performed within programs on electronic computers, for which an accounting for the units occurs only once, in the design of the…

  15. Unit roots, nonlinearities and structural breaks

    DEFF Research Database (Denmark)

    Haldrup, Niels; Kruse, Robinson; Teräsvirta, Timo

    One of the most influential research fields in econometrics over the past decades concerns unit root testing in economic time series. In macro-economics much of the interest in the area originate from the fact that when unit roots are present, then shocks to the time series processes have...

  16. 75 FR 65561 - United Nations Day, 2010

    Science.gov (United States)

    2010-10-26

    ... A Proclamation Sixty-five years ago, 51 nations came together in the aftermath of one of history's... all peoples. The United Nations has made great advances since it first developed out of ruin and... of nations. The United Nations' humanitarian assistance lifts up countless lives, supporting nations...

  17. Understanding "Romeo and Juliet": A Thematic Unit.

    Science.gov (United States)

    Koveleski, Erin

    This curriculum unit for Grade 9 combines the classic Shakespeare play "Romeo and Juliet" with three young adult novels: "The Outsiders" (S.E. Hinton), "Summer of My German Soldier" (Bette Greene), and "The Witch of Blackbird Pond" (Elizabeth George Speare). To complete the unit, all students will be…

  18. The Carnegie Unit: Past, Present, and Future

    Science.gov (United States)

    Silva, Elena; White, Taylor

    2015-01-01

    For more than a century, the Carnegie Unit has been the central organizing feature of American education. Translated into the "credit hour" in higher education (roughly, one hour of class time per week in a 14-16 week semester), this time-based unit is embedded in nearly every aspect of the system, from faculty-workload and…

  19. Improper colouring of (random) unit disk graphs

    NARCIS (Netherlands)

    Kang, R.J.; Müller, T.; Sereni, J.S.

    2008-01-01

    For any graph G, the k-improper chromatic number ¿k(G) is the smallest number of colours used in a colouring of G such that each colour class induces a subgraph of maximum degree k. We investigate ¿k for unit disk graphs and random unit disk graphs to generalise results of McDiarmid and Reed

  20. 28 CFR 0.1 - Organizational units.

    Science.gov (United States)

    2010-07-01

    ... Legal Policy. Office of Public Affairs. Office of the Pardon Attorney. Office of Special Counsel for Immigration Related Unfair Employment Practices. Community Relations Service. Executive Office for Immigration Review. Executive Office for United States Attorneys. Executive Office for United States Trustees...

  1. Chinese Dragons in an American Science Unit

    Science.gov (United States)

    Lew, Lee Yuen; McLure, John W.

    2005-01-01

    Can art and science find a happy home in the same unit? We think the answer is yes, if the central problem interests the students and allows them to try out multiple abilities. The sixth-grade unit described in this article, which we called "The Dragon Project," grew mainly from two roots, a study of ancient China and a later probe into…

  2. "Units of Comparison" across Languages, across Time

    Science.gov (United States)

    Thomas, Margaret

    2009-01-01

    Lardiere's keynote article adverts to a succession of "units of comparison" that have been employed in the study of cross-linguistic differences, including mid-twentieth-century structural patterns, generative grammar's parameters, and (within contemporary Minimalism) features. This commentary expands on the idea of units of cross-linguistic…

  3. The United Nations and Its Critics.

    Science.gov (United States)

    Menon, Bhaskar P.

    1989-01-01

    Provides a brief history of the development of the United Nations. Identifies achievements of the United Nations in the promotion of human rights, the translation of the Universal Declaration of Human Rights into binding international covenants, and the establishment of monitoring mechanisms to ensure the protection of human rights. (KO)

  4. SPOKEN AYACUCHO QUECHUA, UNITS 11-20.

    Science.gov (United States)

    PARKER, GARY J.; SOLA, DONALD F.

    THE ESSENTIALS OF AYACUCHO GRAMMAR WERE PRESENTED IN THE FIRST VOLUME OF THIS SERIES, SPOKEN AYACUCHO QUECHUA, UNITS 1-10. THE 10 UNITS IN THIS VOLUME (11-20) ARE INTENDED FOR USE IN AN INTERMEDIATE OR ADVANCED COURSE, AND PRESENT THE STUDENT WITH LENGTHIER AND MORE COMPLEX DIALOGS, CONVERSATIONS, "LISTENING-INS," AND DICTATIONS AS WELL…

  5. SPOKEN COCHABAMBA QUECHUA, UNITS 1-12.

    Science.gov (United States)

    LASTRA, YOLANDA; SOLA, DONALD F.

    THE FIRST OF TWO VOLUMES PREPARED FOR TEACHING THE COCHABAMBA DIALECT OF QUECHUA TO SPEAKERS OF ENGLISH, THIS DOCUMENT IS MADE UP OF 12 UNITS THAT COMPRISE A 6-WEEK INTENSIVE COURSE OF 20 CLASS HOURS A WEEK. EACH UNIT CONSISTS OF ONE OR MORE DIALOGS TO BE MEMORIZED, A DIALOG REVIEW, A SECTION ON GRAMMAR WITH ACCOMPANYING EXERCISES, CONVERSATION,…

  6. SPOKEN COCHABAMBA QUECHUA, UNITS 13-24.

    Science.gov (United States)

    LASTRA, YOLANDA; SOLA, DONALD F.

    UNITS 13-24 OF THE SPOKEN COCHABAMBA QUECHUA COURSE FOLLOW THE GENERAL FORMAT OF THE FIRST VOLUME (UNITS 1-12). THIS SECOND VOLUME IS INTENDED FOR USE IN AN INTERMEDIATE OR ADVANCED COURSE AND INCLUDES MORE COMPLEX DIALOGS, CONVERSATIONS, "LISTENING-INS," AND DICTATIONS, AS WELL AS GRAMMAR AND EXERCISE SECTIONS COVERING ADDITIONAL…

  7. Unit: Plants, Inspection Pack, National Trial Print.

    Science.gov (United States)

    Australian Science Education Project, Toorak, Victoria.

    This is a National Trial Print of a unit on plants produced as a part of the Australian Science Education Project. The unit consists of an information booklet for students, a booklet for recording student data, and a teacher's guide. The material, designed for use with students in the upper elementary grades, takes from 15 to 20 forty-minute…

  8. Unit 148 - World Wide Web Basics

    OpenAIRE

    148, CC in GIScience; Yeung, Albert K.

    2000-01-01

    This unit explains the characteristics and the working principles of the World Wide Web as the most important protocol of the Internet. Topics covered in this unit include characteristics of the World Wide Web; using the World Wide Web for the dissemination of information on the Internet; and using the World Wide Web for the retrieval of information from the Internet.

  9. Topology optimization of inertia driven dosing units

    DEFF Research Database (Denmark)

    Andreasen, Casper Schousboe

    2017-01-01

    This paper presents a methodology for optimizing inertia driven dosing units, sometimes referred to as eductors, for use in small scale flow applications. The unit is assumed to operate at low to moderate Reynolds numbers and under steady state conditions. By applying topology optimization...

  10. An Environmental Unit for the Social Studies.

    Science.gov (United States)

    Kroll, Claudia J.

    Based on the inquiry method of learning, this instructional unit attempts to encourage students to discover for themselves the facts, problems, values, conflicts, and potential solutions of an environmental issue. Specifically, it deals with surface mining in the United States, with special focus on surface mining in Illinois. Materials and…

  11. Stresses in Dolos Breakwater Armour Units

    DEFF Research Database (Denmark)

    Burcharth, H. F.; Liu, Z.

    1991-01-01

    Breakage of slender unreinforced armour unite is the cause of many breakwater failures. Design diagrams to ensure structural integrity of armour unite such as dolosse and tetrapods have not been available. The article presents results of an analysis of the stresses in dolosse based on model tests...

  12. Portable Power And Digital-Communication Units

    Science.gov (United States)

    Levin, Richard R.; Henry, Paul K.; Rosenberg, Leigh S.

    1992-01-01

    Conceptual network of electronic-equipment modules provides electrical power and digital radio communications at multiple sites not served by cables. System includes central communication unit and portable units powered by solar photovoltaic arrays. Useful to serve equipment that must be set up quickly at remote sites or buildings that cannot be modified to provide cable connections.

  13. Immigration Enforcement Within the United States

    Science.gov (United States)

    2006-04-06

    Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Policy Issues...Remained in the United States, (Washington: Center for Immigration Studies, May 2002). Immigration Enforcement Within the United States Introduction ...interior enforcement lack a border component. For example, fugitive taskforces, investigations of alien slavery and sweatshops , and employer sanctions do

  14. Socioeconomic Development Inequalities among Geographic Units ...

    African Journals Online (AJOL)

    Socio-economic development inequality among geographic units is a phenomenon common in both the developed and developing countries. Regional inequality may result in dissension among geographic units of the same state due to the imbalance in socio-economic development. This study examines the inequality ...

  15. 75 FR 25925 - United States Mint

    Science.gov (United States)

    2010-05-10

    ... Committee May 25, 2010 Public Meeting. SUMMARY: Pursuant to United States Code, Title 31, section 5135(b)(8... scheduled for May 25, 2010. Date: May 25, 2010. Time: 9 a.m. to 12 p.m. Location: 8th Floor Board Room, United States Mint, 801 9th Street, NW., Washington, DC 20220. Subject: Review and discuss obverse and...

  16. Anti-Terrorism Authority Under the Laws of the United Kingdom and the United States

    National Research Council Canada - National Science Library

    Feikert, Clare; Doyle, Charles

    2006-01-01

    This is a comparison of the laws of the United Kingdom and of the United States that govern criminal and intelligence investigations of terrorist activities Both systems rely upon a series of statutory authorizations...

  17. Intelligent multi-unit disk controller

    International Nuclear Information System (INIS)

    Poirot, Lucien

    1982-01-01

    This controller has been designed as a link between a 16 bits minicomputer and two types of disks units interface: the SMD interface and an equivalent to the DRI unit interface. Four units of each type can be handled by the controller. A bit slice microprocessor controls the interface with the disks units. The maximum exchange rate is 8 megabits per second. A CRC feature has been provided for error detection. A 16 bits microprocessor implements the interface to the computer, assuring head positioning, the management of bad tracks, as well as the supervision of each transfer. A internal buffer memory allows an asynchronous dialogue with the computer. The implementation of the controller makes easy the adaptation to disks units of various types, and though it has been initially intended for a minicomputer of the MITRA type, its microprocessor based design makes it fitted to any minicomputer. (author) [fr

  18. A computer controlled tele-cobalt unit

    International Nuclear Information System (INIS)

    Brace, J.A.

    1982-01-01

    A computer controlled cobalt treatment unit was commissioned for treating patients in January 1980. Initially the controlling computer was a minicomputer, but now the control of the therapy unit is by a microcomputer. The treatment files, which specify the movement and configurations necessary to deliver the prescribed dose, are produced on the minicomputer and then transferred to the microcomputer using minitape cartridges. The actual treatment unit is based on a standard cobalt unit with a few additional features e.g. the drive motors can be controlled either by the computer or manually. Since the treatment unit is used for both manual and automatic treatments, the operational procedure under computer control is made to closely follow the manual procedure for a single field treatment. The necessary safety features which protect against human, hardware and software errors as well as the advantages and disadvantages of computer controlled radiotherapy are discussed

  19. Cultural traits as units of analysis.

    Science.gov (United States)

    O'Brien, Michael J; Lyman, R Lee; Mesoudi, Alex; VanPool, Todd L

    2010-12-12

    Cultural traits have long been used in anthropology as units of transmission that ostensibly reflect behavioural characteristics of the individuals or groups exhibiting the traits. After they are transmitted, cultural traits serve as units of replication in that they can be modified as part of an individual's cultural repertoire through processes such as recombination, loss or partial alteration within an individual's mind. Cultural traits are analogous to genes in that organisms replicate them, but they are also replicators in their own right. No one has ever seen a unit of transmission, either behavioural or genetic, although we can observe the effects of transmission. Fortunately, such units are manifest in artefacts, features and other components of the archaeological record, and they serve as proxies for studying the transmission (and modification) of cultural traits, provided there is analytical clarity over how to define and measure the units that underlie this inheritance process.

  20. Stroke Unit: General principles and standards

    Directory of Open Access Journals (Sweden)

    Mehmet Akif Topçuoğlu

    2015-04-01

    Full Text Available Evidence-based medicinal methods have convincingly shown that stroke unit approach reduces mortality and disability rates, improves the quality of life and economic burden resulting from acute ischemic and hemorrhagic stroke. Any contemporary stroke system of care cannot be successful without putting the stroke unit concept in the center of its organization. Stroke units are the main elements of primary and comprehensive stroke centers. As a modernization process, this article focuses on practical issues and suggestions related to integration of the stroke unit approach to a regionally organized stroke system of care for perusal by not only national health authorities and service providers, but also neurologists. Stroke unit quality metrics revisited herein are of critical importance for hospitals establishing or renovating primary and comprehensive stroke centers.

  1. Understanding nursing units with data and theory.

    Science.gov (United States)

    Diers, Donna; Hendrickson, Karrie; Rimar, Joan; Donovan, Donna

    2013-01-01

    Nursing units are social systems whose function depends on many variables. Available nursing data, combined with a theory of organizational diagnosis, can be used to understand nursing unit performance. One troubled unit served as a case study in organizational diagnosis and treatment using modern methods of data mining and performance improvement. Systems theory did not prescribe how to fix an underbounded system. The theory did suggest, however, that addressing the characteristics of overbounded and underbounded systems can provide some order and structure and identify helpful resources. In this instance, the data analysis served to help define the unit's problems in conjunction with information gained from talking with the nurses and touring the unit, but it was the theory that gave hints for direction for change.

  2. Mobile vapor recovery and vapor scavenging unit

    International Nuclear Information System (INIS)

    Stokes, C.A.; Steppe, D.E.

    1991-01-01

    This patent describes a mobile anti- pollution apparatus, for the recovery of hydrocarbon emissions. It comprises a mobile platform upon which is mounted a vapor recovery unit for recovering vapors including light hydrocarbons, the vapor recovery unit having an inlet and an outlet end, the inlet end adapted for coupling to an external source of hydrocarbon vapor emissions to recover a portion of the vapors including light hydrocarbons emitted therefrom, and the outlet end adapted for connection to a means for conveying unrecovered vapors to a vapor scavenging unit, the vapor scavenging unit comprising an internal combustion engine adapted for utilizing light hydrocarbon in the unrecovered vapors exiting from the vapor recovery unit as supplemental fuel

  3. 28 CFR 541.49 - Review of control unit placement.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Review of control unit placement. 541.49... INMATE DISCIPLINE AND SPECIAL HOUSING UNITS Control Unit Programs § 541.49 Review of control unit placement. (a) Unit staff shall evaluate informally and daily an inmate's adjustment within the control unit...

  4. Entomology Unit annual report 2002

    International Nuclear Information System (INIS)

    2002-01-01

    order to support this activity a prototype container rearing system was designed and constructed. The successful development of the TPU3 system for tsetse rearing enables this approach to be evaluated. The container has now been placed at Seibersdorf and it will be used for rearing tsetse in 2003. For areawide tsetse SIT programmes it will be essential that an aerial fly release system is developed and a prototype release mechanism has been designed and built. However, for such a system to be operational tsetse will have to be immobilized for some time at low temperature and a suitable temperature regime is being identified. During 2002, a start was made on the renovation of part of the Unit to provide a rearing facility for mosquitoes. The renovations will be completed in the first half of 2003 following which a colony of Anopheles arabiensis will be established

  5. Violence in the United States

    Science.gov (United States)

    Sumner, Steven A.; Mercy, James A.; Dahlberg, Linda L.; Hillis, Susan D.; Klevens, Joanne; Houry, Debra

    2015-01-01

    IMPORTANCE Interpersonal violence, which includes child abuse and neglect, youth violence, intimate partner violence, sexual violence, and elder abuse, affects millions of US residents each year. However, surveillance systems, programs, and policies to address violence often lack broad, cross-sector collaboration, and there is limited awareness of effective strategies to prevent violence. OBJECTIVES To describe the burden of interpersonal violence in the United States, explore challenges to violence prevention efforts and to identify prevention opportunities. DATA SOURCES We reviewed data from health and law enforcement surveillance systems including the National Vital Statistics System, the Federal Bureau of Investigation’s Uniform Crime Reports, the US Justice Department’s National Crime Victimization Survey, the National Survey of Children’s Exposure to Violence, the National Child Abuse and Neglect Data System, the National Intimate Partner and Sexual Violence Survey, the Youth Risk Behavior Surveillance System, and the National Electronic Injury Surveillance System—All Injury Program. RESULTS Homicide rates have decreased from a peak of 10.7 per 100 000 persons in 1980 to 5.1 per 100 000 in 2013. Aggravated assault rates have decreased from a peak of 442 per 100 000 in 1992 to 242 per 100 000 in 2012. Nevertheless, annually, there are more than 16 000 homicides and 1.6 million nonfatal assault injuries requiring treatment in emergency departments. More than 12 million adults experience intimate partner violence annually and more than 10 million children younger than 18 years experience some form of maltreatment from a caregiver, ranging from neglect to sexual abuse, but only a small percentage of these violent incidents are reported to law enforcement, health care clinicians, or child protective agencies. Moreover, exposure to violence increases vulnerability to a broad range of mental and physical health problems over the life course; for example

  6. Register of basic residential units and spatial units in the Slovak Republic

    International Nuclear Information System (INIS)

    Galdik, S.; Vavrinec, B.

    2005-01-01

    In this contribution authors deal with the register of basic residential units and spatial units in the Slovak Republic. Classification of statistical territorial units is presented. Map data and statistical data contain information about environmental impact of industrial and energetic mills

  7. Units of measurement past, present and future international system of units

    CERN Document Server

    Gupta, S V

    2010-01-01

    It is for the first time that the subject of quantities and their respective units is dealt this much in detail a glimpse of units of measurements of base quantities of length, time, mass and volume is given for ancient India three and four dimensional systems of measurement units are critically examined establishment of the fact that only four base units are needed to describe a system of units the basics to arrive at the unit of a derived quantity are explained basic, derived and dimensionless quantities including quantity calculus are introduced life history of scientists concerned with measurements units are presented to be inspiring to working metrologists and students. The International System of Units including, Metre Convention Treaty and its various organs including International National of Weights and Measure are described. The realisation of base units is given in detail. Classes of derived units within the SI, units permitted for time to come, units outside SI but used in special fields of measur...

  8. Cross Selling Implementation From Outpatient Unit to Radiology Unit in Semen Gresik Hospital

    OpenAIRE

    Rochmah, Thinni Nurul; Faradisa, Mutiara Ayu

    2013-01-01

    Thelow visitingnumberinhospital€™sunitarecloselyrelatedtomarketingactivities,includinginternal marketing which consistsof cross sellingfromother units.Thisstudy aims toanalyze crossselling implementation from Outpatient Unit to Radiology Unit in Semen Gresik Hospital. This study was a cross sectional analytic design. Samplewastakenbysimple random samplingwithsamplesize25respondents.Independentvariableswere marketing policy,employee commitment,perception, motivation,andreadiness ofcross sellin...

  9. Simulation of motor unit recruitment and microvascular unit perfusion: spatial considerations.

    Science.gov (United States)

    Fuglevand, A J; Segal, S S

    1997-10-01

    Muscle fiber activity is the principal stimulus for increasing capillary perfusion during exercise. The control elements of perfusion, i.e., microvascular units (MVUs), supply clusters of muscle fibers, whereas the control elements of contraction, i.e., motor units, are composed of fibers widely scattered throughout muscle. The purpose of this study was to examine how the discordant spatial domains of MVUs and motor units could influence the proportion of open capillaries (designated as perfusion) throughout a muscle cross section. A computer model simulated the locations of perfused MVUs in response to the activation of up to 100 motor units in a muscle with 40,000 fibers and a cross-sectional area of 100 mm2. The simulation increased contraction intensity by progressive recruitment of motor units. For each step of motor unit recruitment, the percentage of active fibers and the number of perfused MVUs were determined for several conditions: 1) motor unit fibers widely dispersed and motor unit territories randomly located (which approximates healthy human muscle), 2) regionalized motor unit territories, 3) reversed recruitment order of motor units, 4) densely clustered motor unit fibers, and 5) increased size but decreased number of motor units. The simulations indicated that the widespread dispersion of motor unit fibers facilitates complete capillary (MVU) perfusion of muscle at low levels of activity. The efficacy by which muscle fiber activity induced perfusion was reduced 7- to 14-fold under conditions that decreased the dispersion of active fibers, increased the size of motor units, or reversed the sequence of motor unit recruitment. Such conditions are similar to those that arise in neuromuscular disorders, with aging, or during electrical stimulation of muscle, respectively.

  10. Assessment of Motor Units in Neuromuscular Disease.

    Science.gov (United States)

    Henderson, Robert D; McCombe, Pamela A

    2017-01-01

    The motor unit comprises the anterior horn cell, its axon, and the muscle fibers that it innervates. Although the true number of motor units is unknown, the number of motor units appears to vary greatly between different muscles and between different individuals. Assessment of the number and function of motor units is needed in diseases of the anterior horn cell and other motor nerve disorders. Amyotrophic lateral sclerosis is the most important disease of anterior horn cells. The need for an effective biomarker for assessing disease progression and for use in clinical trials in amyotrophic lateral sclerosis has stimulated the study of methods to measure the number of motor units. Since 1970 a number of different methods, including the incremental, F-wave, multipoint, and statistical methods, have been developed but none has achieved widespread applicability. Two methods (MUNIX and the multipoint incremental method) are in current use across multiple centres and are discussed in detail in this review, together with other recently published methods. Imaging with magnetic resonance and ultrasound is increasingly being applied to this area. Motor unit number estimates have also been applied to other neuromuscular diseases such as spinal muscular atrophy, compression neuropathies, and prior poliomyelitis. The need for an objective measure for the assessment of motor units remains tantalizingly close but unfulfilled in 2016.

  11. Nuclear development in the United States

    International Nuclear Information System (INIS)

    Brewer, S.

    1983-01-01

    The history of the nuclear development in the United States has been one of international cooperation relations so far. The United States is to offer the technical information on atomic energy utilization to foreign countries in exchange for the guarantee that they never attempt to have or develop nuclear weapons. Actually, the United States has supplied the technologies on nuclear fuel cycle and other related fields to enable other countries to achieve economical and social progress. The Department of Energy clarified the public promise of the United States regarding the idea of international energy community. The ratio of nuclear power generation to total electric power supply in the United States exceeded 12%, and will exceed 20% by 1990. Since 1978, new nuclear power station has not been ordered, and some of the contracted power stations were canceled. The atomic energy industry in the United States prospered at the beginning of 1970s, but lost the spirit now, mainly due to the institutional problems rather than the technical ones. As the policy of the government to eliminate the obstacles, the improvement of the procedure for the permission and approval, the establishment of waste disposal capability, the verification of fast breeder reactor technology and the promotion of commercial fuel reprocessing were proposed. The re-establishment of the United States as the reliable supplier of atomic energy service is the final aim. (Kako, I.)

  12. Practical unit testing with JUnit and Mockito

    CERN Document Server

    Kaczanowski, Tomek

    2013-01-01

    This book explains in detail how to implement unit tests using two very popular open source Java technologies: JUnit and Mockito. It presents a range of techniques necessary to write high quality unit tests - e.g. mocks, parametrized tests and matchers. It also discusses trade-offs related to the choices we have to make when dealing with some real-life code issues. The book stresses the importance of writing readable and maintainable unit tests, and puts a lot of stress on code quality. It shows how to achieve testable code and to eliminate common mistakes by following the Test Driven Development approach. Every topic discussed in the book is illustrated with code examples, and each chapter is accompanied by some exercises. By reading this book you will: Grasp the role and purpose of unit tests Write high-quality, readable and maintainable unit tests Learn how to use JUnit and Mockito (but also other useful tools) Avoid common pitfalls when writing unit tests Recognize bad unit tests, a...

  13. SmartUnit: Empirical Evaluations for Automated Unit Testing of Embedded Software in Industry

    OpenAIRE

    Zhang, Chengyu; Yan, Yichen; Zhou, Hanru; Yao, Yinbo; Wu, Ke; Su, Ting; Miao, Weikai; Pu, Geguang

    2018-01-01

    In this paper, we aim at the automated unit coverage-based testing for embedded software. To achieve the goal, by analyzing the industrial requirements and our previous work on automated unit testing tool CAUT, we rebuild a new tool, SmartUnit, to solve the engineering requirements that take place in our partner companies. SmartUnit is a dynamic symbolic execution implementation, which supports statement, branch, boundary value and MC/DC coverage. SmartUnit has been used to test more than one...

  14. Reform of the United Kingdom judicial system

    Directory of Open Access Journals (Sweden)

    Ovidiu-Horia MAICAN

    2013-12-01

    Full Text Available The separation of powers in a state is an essential characteristic of every democratic country, a principle present in many constitutions, most notably that of the United States. The concept is imperfectly fulfilled in the United Kingdom, given that the executive (Ministers form part of the legislature and that part of the judiciary (Law Lords sit in the legislature. As a result, it was necessary to remove the constitutional anomaly that the highest court of appeal in the United Kingdom was situated within one of the chambers of Parliament.

  15. A Nonparametric Test for Seasonal Unit Roots

    OpenAIRE

    Kunst, Robert M.

    2009-01-01

    Abstract: We consider a nonparametric test for the null of seasonal unit roots in quarterly time series that builds on the RUR (records unit root) test by Aparicio, Escribano, and Sipols. We find that the test concept is more promising than a formalization of visual aids such as plots by quarter. In order to cope with the sensitivity of the original RUR test to autocorrelation under its null of a unit root, we suggest an augmentation step by autoregression. We present some evidence on the siz...

  16. Incident Command System - Environmental Unit responsibilities

    International Nuclear Information System (INIS)

    Hillman, S. O.

    1997-01-01

    The Incident Command System (ICS) for crisis management, used for response to oil spills by the Alyeska Pipeline Service Company throughout its facilities, including the Trans Alaska Pipeline and the Valdez Marine Terminal, was described. Special attention was given to the Environmental Unit within the ICS which functions as a primary support unit for the Incident Operations Section. Details of the Unit's function were provided. These include the collection, evaluation and dissemination of information on all environmental issues concerning the crisis, provision of advice and direction on environmental aspects, and up-front agency interaction. A checklist of tasks is included. 7 refs

  17. Practice development units: a study of teamwork.

    Science.gov (United States)

    Walsh, M; Walsh, A

    In this report of a study using the Team Climate Inventory (TCI) tool, the researchers explain how the tool can be used in preparation for creating a practice development unit (PDU). The TCI provides a picture of the level and quality of teamwork in a unit using a series of Likert scales. The ward in this study was found to lack the necessary level of teamwork for successful PDU development and the researchers show how this information shaped trust plans. They recommend that units contemplating PDU accreditation should assess their level of teamwork prior to proceeding with bids.

  18. Household pesticide usage in the United States.

    Science.gov (United States)

    Savage, E P; Keefe, T J; Wheeler, H W; Mounce, L; Helwic, L; Applehans, F; Goes, E; Goes, T; Mihlan, G; Rench, J; Taylor, D K

    1981-01-01

    A total of 10,000 U.S. households in 25 standard metropolitan statistical areas and 25 counties were included in the United States. More than 8,200 households granted an interview. Nine of every ten households in the United States used some types of pesticide in their house, garden, or yard. Households in the southeastern United States used the most pesticides. Although more than 500 different pesticide formulations were used by the sampled households, 15 pesticides accounted for 65.5% of all pesticides reported in this study. Thirteen of these 15 pesticides were insecticides, one was a herbicide, and one was a rodenticide.

  19. Estimated United States Transportation Energy Use 2005

    Energy Technology Data Exchange (ETDEWEB)

    Smith, C A; Simon, A J; Belles, R D

    2011-11-09

    A flow chart depicting energy flow in the transportation sector of the United States economy in 2005 has been constructed from publicly available data and estimates of national energy use patterns. Approximately 31,000 trillion British Thermal Units (trBTUs) of energy were used throughout the United States in transportation activities. Vehicles used in these activities include automobiles, motorcycles, trucks, buses, airplanes, rail, and ships. The transportation sector is powered primarily by petroleum-derived fuels (gasoline, diesel and jet fuel). Biomass-derived fuels, electricity and natural gas-derived fuels are also used. The flow patterns represent a comprehensive systems view of energy used within the transportation sector.

  20. Fatigue in Breakwater Concrete Armour Units

    DEFF Research Database (Denmark)

    Burcharth, Hans F.

    1985-01-01

    The reliability of rubble mound breakwaters depends on the hydraulic stability and the mechanical strength of the armour units. The paper deals with the important aspect of fatigue related to the strength of concrete armour units. Results showing significant fatigue from impact tests with Dolosse...... made of unreinforced and steel fibre reinforced flyash concrete are presented. Moreover universal graphs for fatigue in armour units made of conventional unreinforced concrete exposed to impact load and pulsating load are presented. The effect of fibre reinforcement and the implementation of fatigue...