WorldWideScience

Sample records for erythroid ankyrin-1 revealed

  1. Ankyrin-1 Gene Exhibits Allelic Heterogeneity in Conferring Protection Against Malaria

    Directory of Open Access Journals (Sweden)

    Hong Ming Huang

    2017-09-01

    Full Text Available Allelic heterogeneity is a common phenomenon where a gene exhibits a different phenotype depending on the nature of its genetic mutations. In the context of genes affecting malaria susceptibility, it allowed us to explore and understand the intricate host–parasite interactions during malaria infections. In this study, we described a gene encoding erythrocytic ankyrin-1 (Ank-1 which exhibits allelic-dependent heterogeneous phenotypes during malaria infections. We conducted an ENU mutagenesis screen on mice and identified two Ank-1 mutations, one resulting in an amino acid substitution (MRI95845, and the other a truncated Ank-1 protein (MRI96570. Both mutations caused hereditary spherocytosis-like phenotypes and confer differing protection against Plasmodium chabaudi infections. Upon further examination, the Ank-1(MRI96570 mutation was found to inhibit intraerythrocytic parasite maturation, whereas Ank-1(MRI95845 caused increased bystander erythrocyte clearance during infection. This is the first description of allelic heterogeneity in ankyrin-1 from the direct comparison between two Ank-1 mutations. Despite the lack of direct evidence from population studies, this data further supported the protective roles of ankyrin-1 mutations in conferring malaria protection. This study also emphasized the importance of such phenomena in achieving a better understanding of host–parasite interactions, which could be the basis of future studies.

  2. The human ankyrin 1 promoter insulator sustains gene expression in a β-globin lentiviral vector in hematopoietic stem cells

    Directory of Open Access Journals (Sweden)

    Zulema Romero

    Full Text Available Lentiviral vectors designed for the treatment of the hemoglobinopathies require the inclusion of regulatory and strong enhancer elements to achieve sufficient expression of the β-globin transgene. Despite the inclusion of these elements, the efficacy of these vectors may be limited by transgene silencing due to the genomic environment surrounding the integration site. Barrier insulators can be used to give more consistent expression and resist silencing even with lower vector copies. Here, the barrier activity of an insulator element from the human ankyrin-1 gene was analyzed in a lentiviral vector carrying an antisickling human β-globin gene. Inclusion of a single copy of the Ankyrin insulator did not affect viral titer, and improved the consistency of expression from the vector in murine erythroleukemia cells. The presence of the Ankyrin insulator element did not change transgene expression in human hematopoietic cells in short-term erythroid culture or in vivo in primary murine transplants. However, analysis in secondary recipients showed that the lentiviral vector with the Ankyrin element preserved transgene expression, whereas expression from the vector lacking the Ankyrin insulator decreased in secondary recipients. These studies demonstrate that the Ankyrin insulator may improve long-term β-globin expression in hematopoietic stem cells for gene therapy of hemoglobinopathies.

  3. Role of methylglyoxal as a transient receptor potential ankyrin 1 agonist in colon motility disturbances associated with diabetes

    Directory of Open Access Journals (Sweden)

    Abdulmohsen Assiri

    2017-01-01

    Full Text Available Introduction: Evidence has been found to suggest that methylglyoxal (MG plays a mediating role in diabetes-related gastrointestinal conditions, and a possible mechanism relating to these conditions could be revealed by determining MG as a transient receptor potential ankyrin 1 (TRPA1 channel agonist. Methods: Muscle strips from the distal colon of male Wistar rats were used, and organ bath was employed to gain insight into the impact of MG + TRPA1 antagonist (HC-030031. Results: Considerable rise of spontaneous contractions for longitudinal muscle strips subjected to pre-treatment with MG were observed. The potentiation of the contractile response of control longitudinal muscle strips to electric field stimulation (EFS took place as a consequence of pre-treatment with 10 mM MG, and maximum response values displayed a rise from 2.16 g ± 0.323 to 3.64 g ± 0.421. 10 μM HC-030031 was observed to block the improvement of EFS responses by MG, and regarding circular muscle strips, a considerable decline in the maximum relaxation response was facilitated by 10 mM MG. Specifically, this was achieved at 20 Hz from 0.26 g ± 0.036 to 0.055 g ± 0.046. Conclusion: MG has been found to directly contract the distal colons of Wistar rats while enhancing the responses initiated as a result of carbachol and EFS. After blockading the impacts using HC-030031, evidence was found to suggest that the mediation of the impacts takes place through the activation of the TRPA1 channel, which occurs from the excretion of excitatory neurotransmitters. The findings also implicate MG in the blocking of inhibitory neurotransmission.

  4. Transient receptor potential channel ankyrin-1 is not a cold sensor for autonomic thermoregulation in rodents.

    Science.gov (United States)

    de Oliveira, Cristiane; Garami, Andras; Lehto, Sonya G; Pakai, Eszter; Tekus, Valeria; Pohoczky, Krisztina; Youngblood, Beth D; Wang, Weiya; Kort, Michael E; Kym, Philip R; Pinter, Erika; Gavva, Narender R; Romanovsky, Andrej A

    2014-03-26

    The rodent transient receptor potential ankyrin-1 (TRPA1) channel has been hypothesized to serve as a temperature sensor for thermoregulation in the cold. We tested this hypothesis by using deletion of the Trpa1 gene in mice and pharmacological blockade of the TRPA1 channel in rats. In both Trpa1(-/-) and Trpa1(+/+) mice, severe cold exposure (8°C) resulted in decreases of skin and deep body temperatures to ∼8°C and 13°C, respectively, both temperatures being below the reported 17°C threshold temperature for TRPA1 activation. Under these conditions, Trpa1(-/-) mice had the same dynamics of body temperature as Trpa1(+/+) mice and showed no weakness in the tail skin vasoconstriction response or thermogenic response to cold. In rats, the effects of pharmacological blockade were studied by using two chemically unrelated TRPA1 antagonists: the highly potent and selective compound A967079, which had been characterized earlier, and the relatively new compound 43 ((4R)-1,2,3,4-tetrahydro-4-[3-(3-methoxypropoxy)phenyl]-2-thioxo-5H-indeno[1,2-d]pyrimidin-5-one), which we further characterized in the present study and found to be highly potent (IC50 against cold of ∼8 nm) and selective. Intragastric administration of either antagonist at 30 mg/kg before severe (3°C) cold exposure did not affect the thermoregulatory responses (deep body and tail skin temperatures) of rats, even though plasma concentrations of both antagonists well exceeded their IC50 value at the end of the experiment. In the same experimental setup, blocking the melastatin-8 (TRPM8) channel with AMG2850 (30 mg/kg) attenuated cold-defense mechanisms and led to hypothermia. We conclude that TRPA1 channels do not drive autonomic thermoregulatory responses to cold in rodents.

  5. Regulatory polymorphisms in the bovine Ankyrin 1 gene promoter are associated with tenderness and intra-muscular fat content

    LENUS (Irish Health Repository)

    Aslan, Ozlem

    2010-12-15

    Abstract Background Recent QTL and gene expression studies have highlighted ankyrins as positional and functional candidate genes for meat quality. Our objective was to characterise the promoter region of the bovine ankyrin 1 gene and to test polymorphisms for association with sensory and technological meat quality measures. Results Seven novel promoter SNPs were identified in a 1.11 kb region of the ankyrin 1 promoter in Angus, Charolais and Limousin bulls (n = 15 per breed) as well as 141 crossbred beef animals for which meat quality data was available. Eighteen haplotypes were inferred with significant breed variation in haplotype frequencies. The five most frequent SNPs and the four most frequent haplotypes were subsequently tested for association with sensory and technological measures of meat quality in the crossbred population. SNP1, SNP3 and SNP4 (which were subsequently designated regulatory SNPs) and SNP5 were associated with traits that contribute to sensorial and technological measurements of tenderness and texture; Haplotype 1 and haplotype 4 were oppositely correlated with traits contributing to tenderness (P < 0.05). While no single SNP was associated with intramuscular fat (IMF), a clear association with increased IMF and juiciness was observed for haplotype 2. Conclusion The conclusion from this study is that alleles defining haplotypes 2 and 4 could usefully contribute to marker SNP panels used to select individuals with improved IMF\\/juiciness or tenderness in a genome-assisted selection framework.

  6. Regulatory polymorphisms in the bovine Ankyrin 1 gene promoter are associated with tenderness and intramuscular fat content

    Directory of Open Access Journals (Sweden)

    Sweeney Torres

    2010-12-01

    Full Text Available Abstract Background Recent QTL and gene expression studies have highlighted ankyrins as positional and functional candidate genes for meat quality. Our objective was to characterise the promoter region of the bovine ankyrin 1 gene and to test polymorphisms for association with sensory and technological meat quality measures. Results Seven novel promoter SNPs were identified in a 1.11 kb region of the ankyrin 1 promoter in Angus, Charolais and Limousin bulls (n = 15 per breed as well as 141 crossbred beef animals for which meat quality data was available. Eighteen haplotypes were inferred with significant breed variation in haplotype frequencies. The five most frequent SNPs and the four most frequent haplotypes were subsequently tested for association with sensory and technological measures of meat quality in the crossbred population. SNP1, SNP3 and SNP4 (which were subsequently designated regulatory SNPs and SNP5 were associated with traits that contribute to sensorial and technological measurements of tenderness and texture; Haplotype 1 and haplotype 4 were oppositely correlated with traits contributing to tenderness (P Conclusion The conclusion from this study is that alleles defining haplotypes 2 and 4 could usefully contribute to marker SNP panels used to select individuals with improved IMF/juiciness or tenderness in a genome-assisted selection framework.

  7. Transient receptor potential ankyrin 1 channel localized to non-neuronal airway cells promotes non-neurogenic inflammation

    DEFF Research Database (Denmark)

    Nassini, Romina; Pedretti, Pamela; Moretto, Nadia

    2012-01-01

    The transient receptor potential ankyrin 1 (TRPA1) channel, localized to airway sensory nerves, has been proposed to mediate airway inflammation evoked by allergen and cigarette smoke (CS) in rodents, via a neurogenic mechanism. However the limited clinical evidence for the role of neurogenic...... inflammation in asthma or chronic obstructive pulmonary disease raises an alternative possibility that airway inflammation is promoted by non-neuronal TRPA1.By using Real-Time PCR and calcium imaging, we found that cultured human airway cells, including fibroblasts, epithelial and smooth muscle cells express...... functional TRPA1 channels. By using immunohistochemistry, TRPA1 staining was observed in airway epithelial and smooth muscle cells in sections taken from human airways and lung, and from airways and lung of wild-type, but not TRPA1-deficient mice. In cultured human airway epithelial and smooth muscle cells...

  8. Chemo-nociceptive signalling from the colon is enhanced by mild colitis and blocked by inhibition of transient receptor potential ankyrin 1 channels

    DEFF Research Database (Denmark)

    Mitrovic, Martina; Shahbazian, Anaid; Bock, Elisabeth

    2010-01-01

    Transient receptor potential ankyrin 1 (TRPA1) channels are expressed by primary afferent neurones and activated by irritant chemicals including allyl isothiocyanate (AITC). Here we investigated whether intracolonic AITC causes afferent input to the spinal cord and whether this response is modifi...

  9. Transient receptor potential ankyrin 1 activation enhances hapten sensitization in a T-helper type 2-driven fluorescein isothiocyanate-induced contact hypersensitivity mouse model

    International Nuclear Information System (INIS)

    Shiba, Takahiro; Tamai, Takuma; Sahara, Yurina; Kurohane, Kohta; Watanabe, Tatsuo; Imai, Yasuyuki

    2012-01-01

    Some chemicals contribute to the development of allergies by increasing the immunogenicity of other allergens. We have demonstrated that several phthalate esters, including dibutyl phthalate (DBP), enhance skin sensitization to fluorescein isothiocyanate (FITC) in a mouse contact hypersensitivity model, in which the T-helper type 2 (Th2) response is essential. On the other hand, some phthalate esters were found to activate transient receptor potential ankyrin 1 (TRPA1) cation channels on sensory neurons. We then found a positive correlation between the enhancing effects of several types of phthalate esters on skin sensitization to FITC and their ability to activate TRPA1. Here we examined the involvement of TRPA1 in sensitization to FITC by using TRPA1 agonists other than phthalate esters. During skin sensitization to FITC, the TRPA1 agonists (menthol, carvacrol, cinnamaldehyde and DBP) augmented the ear-swelling response as well as trafficking of FITC-presenting dendritic cells to draining lymph nodes. We confirmed that these TRPA1 agonists induced calcium influx into TRPA1-expressing Chinese hamster ovary (CHO) cells. We also found that TRPA1 antagonist HC-030031 inhibited DBP-induced calcium influx into TRPA1-expressing CHO cells. After pretreatment with this antagonist upon skin sensitization to FITC, the enhancing effect of DBP on sensitization was suppressed. These results suggest that TRPA1 activation will become a useful marker to find chemicals that facilitate sensitization in combination with other immunogenic haptens. -- Highlights: ► Role of TRPA1 activation was revealed in a mouse model of skin sensitization to FITC. ► TRPA1 agonists enhanced skin sensitization as well as dendritic cell trafficking. ► Dibutyl phthalate (DBP) has been shown to enhance skin sensitization to FITC. ► TRPA1 activation by DBP was inhibited by a selective antagonist, HC-030031. ► HC-030031 inhibited the enhancing effect of DBP on skin sensitization to FITC.

  10. Transient receptor potential ankyrin 1 activation enhances hapten sensitization in a T-helper type 2-driven fluorescein isothiocyanate-induced contact hypersensitivity mouse model

    Energy Technology Data Exchange (ETDEWEB)

    Shiba, Takahiro; Tamai, Takuma; Sahara, Yurina; Kurohane, Kohta [Laboratory of Microbiology and Immunology, School of Pharmaceutical Sciences, University of Shizuoka, 52‐1 Yada, Suruga-ku, Shizuoka City, Shizuoka 422‐8526 (Japan); Watanabe, Tatsuo [Laboratory of Food Chemistry, School of Food and Nutritional Sciences, University of Shizuoka, 52‐1 Yada, Suruga-ku, Shizuoka City, Shizuoka 422‐8526 (Japan); Imai, Yasuyuki, E-mail: imai@u-shizuoka-ken.ac.jp [Laboratory of Microbiology and Immunology, School of Pharmaceutical Sciences, University of Shizuoka, 52‐1 Yada, Suruga-ku, Shizuoka City, Shizuoka 422‐8526 (Japan)

    2012-11-01

    Some chemicals contribute to the development of allergies by increasing the immunogenicity of other allergens. We have demonstrated that several phthalate esters, including dibutyl phthalate (DBP), enhance skin sensitization to fluorescein isothiocyanate (FITC) in a mouse contact hypersensitivity model, in which the T-helper type 2 (Th2) response is essential. On the other hand, some phthalate esters were found to activate transient receptor potential ankyrin 1 (TRPA1) cation channels on sensory neurons. We then found a positive correlation between the enhancing effects of several types of phthalate esters on skin sensitization to FITC and their ability to activate TRPA1. Here we examined the involvement of TRPA1 in sensitization to FITC by using TRPA1 agonists other than phthalate esters. During skin sensitization to FITC, the TRPA1 agonists (menthol, carvacrol, cinnamaldehyde and DBP) augmented the ear-swelling response as well as trafficking of FITC-presenting dendritic cells to draining lymph nodes. We confirmed that these TRPA1 agonists induced calcium influx into TRPA1-expressing Chinese hamster ovary (CHO) cells. We also found that TRPA1 antagonist HC-030031 inhibited DBP-induced calcium influx into TRPA1-expressing CHO cells. After pretreatment with this antagonist upon skin sensitization to FITC, the enhancing effect of DBP on sensitization was suppressed. These results suggest that TRPA1 activation will become a useful marker to find chemicals that facilitate sensitization in combination with other immunogenic haptens. -- Highlights: ► Role of TRPA1 activation was revealed in a mouse model of skin sensitization to FITC. ► TRPA1 agonists enhanced skin sensitization as well as dendritic cell trafficking. ► Dibutyl phthalate (DBP) has been shown to enhance skin sensitization to FITC. ► TRPA1 activation by DBP was inhibited by a selective antagonist, HC-030031. ► HC-030031 inhibited the enhancing effect of DBP on skin sensitization to FITC.

  11. Transient receptor potential ankyrin 1 antagonists block the noxious effects of toxic industrial isocyanates and tear gases.

    Science.gov (United States)

    Bessac, Bret F; Sivula, Michael; von Hehn, Christian A; Caceres, Ana I; Escalera, Jasmine; Jordt, Sven-Eric

    2009-04-01

    The release of methyl isocyanate in Bhopal, India, caused the worst industrial accident in history. Exposures to industrial isocyanates induce lacrimation, pain, airway irritation, and edema. Similar responses are elicited by chemicals used as tear gases. Despite frequent exposures, the biological targets of isocyanates and tear gases in vivo have not been identified, precluding the development of effective countermeasures. We use Ca(2+) imaging and electrophysiology to show that the noxious effects of isocyanates and those of all major tear gas agents are caused by activation of Ca(2+) influx and membrane currents in mustard oil-sensitive sensory neurons. These responses are mediated by transient receptor potential ankyrin 1 (TRPA1), an ion channel serving as a detector for reactive chemicals. In mice, genetic ablation or pharmacological inhibition of TRPA1 dramatically reduces isocyanate- and tear gas-induced nocifensive behavior after both ocular and cutaneous exposures. We conclude that isocyanates and tear gas agents target the same neuronal receptor, TRPA1. Treatment with TRPA1 antagonists may prevent and alleviate chemical irritation of the eyes, skin, and airways and reduce the adverse health effects of exposures to a wide range of toxic noxious chemicals.

  12. Loss of Transient Receptor Potential Ankyrin 1 Channel Deregulates Emotion, Learning and Memory, Cognition, and Social Behavior in Mice.

    Science.gov (United States)

    Lee, Kuan-I; Lin, Hui-Ching; Lee, Hsueh-Te; Tsai, Feng-Chuan; Lee, Tzong-Shyuan

    2017-07-01

    The transient receptor potential ankyrin 1 (TRPA1) channel is a non-selective cation channel that helps regulate inflammatory pain sensation and nociception and the development of inflammatory diseases. However, the potential role of the TRPA1 channel and the underlying mechanism in brain functions are not fully resolved. In this study, we demonstrated that genetic deletion of the TRPA1 channel in mice or pharmacological inhibition of its activity increased neurite outgrowth. In vivo study in mice provided evidence of the TRPA1 channel as a negative regulator in hippocampal functions; functional ablation of the TRPA1 channel in mice enhanced hippocampal functions, as evidenced by less anxiety-like behavior, and enhanced fear-related or spatial learning and memory, and novel location recognition as well as social interactions. However, the TRPA1 channel appears to be a prerequisite for motor function; functional loss of the TRPA1 channel in mice led to axonal bundle fragmentation, downregulation of myelin basic protein, and decreased mature oligodendrocyte population in the brain, for impaired motor function. The TRPA1 channel may play a crucial role in neuronal development and oligodendrocyte maturation and be a potential regulator in emotion, cognition, learning and memory, and social behavior.

  13. A novel ENU-mutation in ankyrin-1 disrupts malaria parasite maturation in red blood cells of mice.

    Directory of Open Access Journals (Sweden)

    Andreas Greth

    Full Text Available The blood stage of the plasmodium parasite life cycle is responsible for the clinical symptoms of malaria. Epidemiological studies have identified coincidental malarial endemicity and multiple red blood cell (RBC disorders. Many RBC disorders result from mutations in genes encoding cytoskeletal proteins and these are associated with increased protection against malarial infections. However the mechanisms underpinning these genetic, host responses remain obscure. We have performed an N-ethyl-N-nitrosourea (ENU mutagenesis screen and have identified a novel dominant (haploinsufficient mutation in the Ank-1 gene (Ank1(MRI23420 of mice displaying hereditary spherocytosis (HS. Female mice, heterozygous for the Ank-1 mutation showed increased survival to infection by Plasmodium chabaudi adami DS with a concomitant 30% decrease in parasitemia compared to wild-type, isogenic mice (wt. A comparative in vivo red cell invasion and parasite growth assay showed a RBC-autonomous effect characterised by decreased proportion of infected heterozygous RBCs. Within approximately 6-8 hours post-invasion, TUNEL staining of intraerythrocytic parasites, showed a significant increase in dead parasites in heterozygotes. This was especially notable at the ring and trophozoite stages in the blood of infected heterozygous mutant mice compared to wt (p<0.05. We conclude that increased malaria resistance due to ankyrin-1 deficiency is caused by the intraerythrocytic death of P. chabaudi parasites.

  14. Expression of transient receptor potential ankyrin 1 (TRPA1 and its role in insulin release from rat pancreatic beta cells.

    Directory of Open Access Journals (Sweden)

    De-Shou Cao

    Full Text Available Several transient receptor potential (TRP channels are expressed in pancreatic beta cells and have been proposed to be involved in insulin secretion. However, the endogenous ligands for these channels are far from clear. Here, we demonstrate the expression of the transient receptor potential ankyrin 1 (TRPA1 ion channel in the pancreatic beta cells and its role in insulin release. TRPA1 is an attractive candidate for inducing insulin release because it is calcium permeable and is activated by molecules that are produced during oxidative glycolysis.Immunohistochemistry, RT-PCR, and Western blot techniques were used to determine the expression of TRPA1 channel. Ca²⁺ fluorescence imaging and electrophysiology (voltage- and current-clamp techniques were used to study the channel properties. TRPA1-mediated insulin release was determined using ELISA.TRPA1 is abundantly expressed in a rat pancreatic beta cell line and freshly isolated rat pancreatic beta cells, but not in pancreatic alpha cells. Activation of TRPA1 by allyl isothiocyanate (AITC, hydrogen peroxide (H₂O₂, 4-hydroxynonenal (4-HNE, and cyclopentenone prostaglandins (PGJ₂ and a novel agonist methylglyoxal (MG induces membrane current, depolarization, and Ca²⁺ influx leading to generation of action potentials in a pancreatic beta cell line and primary cultured pancreatic beta cells. Activation of TRPA1 by agonists stimulates insulin release in pancreatic beta cells that can be inhibited by TRPA1 antagonists such as HC030031 or AP-18 and by RNA interference. TRPA1-mediated insulin release is also observed in conditions of voltage-gated Na⁺ and Ca²⁺ channel blockade as well as ATP sensitive potassium (K(ATP channel activation.We propose that endogenous and exogenous ligands of TRPA1 cause Ca²⁺ influx and induce basal insulin release and that TRPA1-mediated depolarization acts synergistically with K(ATP channel blockade to facilitate insulin release.

  15. Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

    Science.gov (United States)

    Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

    2010-01-01

    Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

  16. Transient receptor potential ankyrin 1 receptor activation in vitro and in vivo by pro-tussive agents: GRC 17536 as a promising anti-tussive therapeutic.

    Directory of Open Access Journals (Sweden)

    Indranil Mukhopadhyay

    Full Text Available Cough is a protective reflex action that helps clear the respiratory tract which is continuously exposed to airborne environmental irritants. However, chronic cough presents itself as a disease in its own right and despite its global occurrence; the molecular mechanisms responsible for cough are not completely understood. Transient receptor potential ankyrin1 (TRPA1 is robustly expressed in the neuronal as well as non-neuronal cells of the respiratory tract and is a sensor of a wide range of environmental irritants. It is fast getting acceptance as a key biological sensor of a variety of pro-tussive agents often implicated in miscellaneous chronic cough conditions. In the present study, we demonstrate in vitro direct functional activation of TRPA1 receptor by citric acid which is routinely used to evoke cough in preclinical and clinical studies. We also show for the first time that a potent and selective TRPA1 antagonist GRC 17536 inhibits citric acid induced cellular Ca(+2 influx in TRPA1 expressing cells and the citric acid induced cough response in guinea pigs. Hence our data provides a mechanistic link between TRPA1 receptor activation in vitro and cough response induced in vivo by citric acid. Furthermore, we also show evidence for TRPA1 activation in vitro by the TLR4, TLR7 and TLR8 ligands which are implicated in bacterial/respiratory virus pathogenesis often resulting in chronic cough. In conclusion, this study highlights the potential utility of TRPA1 antagonist such as GRC 17536 in the treatment of miscellaneous chronic cough conditions arising due to diverse causes but commonly driven via TRPA1.

  17. Role of Transient Receptor Potential Ankyrin 1 Ion Channel and Somatostatin sst4 Receptor in the Antinociceptive and Anti-inflammatory Effects of Sodium Polysulfide and Dimethyl Trisulfide

    Directory of Open Access Journals (Sweden)

    István Z. Bátai

    2018-02-01

    Full Text Available Transient receptor potential ankyrin 1 (TRPA1 non-selective ligand-gated cation channels are mostly expressed in primary sensory neurons. Polysulfides (POLYs are Janus-faced substances interacting with numerous target proteins and associated with both protective and detrimental processes. Activation of TRPA1 in sensory neurons, consequent somatostatin (SOM liberation and action on sst4 receptors have recently emerged as mediators of the antinociceptive effect of organic trisulfide dimethyl trisulfide (DMTS. In the frame of the present study, we set out to compare the participation of this mechanism in antinociceptive and anti-inflammatory effects of inorganic sodium POLY and DMTS in carrageenan-evoked hind-paw inflammation. Inflammation of murine hind paws was induced by intraplantar injection of carrageenan (3% in 30 µL saline. Animals were treated intraperitoneally with POLY (17 µmol/kg or DMTS (250 µmol/kg or their respective vehicles 30 min prior paw challenge and six times afterward every 60 min. Mechanical pain threshold and swelling of the paws were measured by dynamic plantar aesthesiometry and plethysmometry at 2, 4, and 6 h after initiation of inflammation. Myeloperoxidase (MPO activity in the hind paws were detected 6 h after challenge by luminescent imaging. Mice genetically lacking TRPA1 ion channels, sst4 receptors and their wild-type counterparts were used to examine the participation of these proteins in POLY and DMTS effects. POLY counteracted carrageenan-evoked mechanical hyperalgesia in a TRPA1 and sst4 receptor-dependent manner. POLY did not influence paw swelling and MPO activity. DMTS ameliorated all examined inflammatory parameters. Mitigation of mechanical hyperalgesia and paw swelling by DMTS were mediated through sst4 receptors. These effects were present in TRPA1 knockout animals, too. DMTS inhibited MPO activity with no participation of the sensory neuron–SOM axis. While antinociceptive effects of

  18. Pathophysiological Role of Transient Receptor Potential Ankyrin 1 in a Mouse Long-Lasting Cystitis Model Induced by an Intravesical Injection of Hydrogen Peroxide

    Directory of Open Access Journals (Sweden)

    Shohei Oyama

    2017-11-01

    Full Text Available Chronic inflammatory bladder disorders, such as interstitial cystitis/bladder pain syndrome, are associated with poor quality of life. The exact pathological processes remain unclear, but accumulating evidence suggests that reactive oxidative species (ROS are involved in urinary bladder disorders. Transient receptor potential ankyrin 1 (TRPA1, the most sensitive TRP channel to ROS, was shown to be responsible for urinary bladder abnormalities and hyperalgesia in an acute cystitis model. However, the roles of TRPA1 in chronic inflammatory bladder are not fully understood. We previously established a novel mouse cystitis model induced by intravesical injection of hydrogen peroxide (H2O2, resulting in long-lasting frequent urination, bladder inflammation, pain-related behavior, and histopathological changes. In the present study, we investigated the pathophysiological role of TRPA1 in the H2O2-induced long-lasting cystitis mouse model. Under anesthesia, 1.5% H2O2 solution was introduced transurethrally into the bladder of female wild-type (WT and TRPA1-knockout mice and maintained for 30 min. This increased the number of voids in WT mice at 1 and 7 days after injection, but reduced the number in TRPA1-knockout mice at 1 day but not 7 days after injection. Spontaneous locomotor activities (increase in freezing time and decrease in distance moved were reduced at 3 h after injection in WT mice, whereas the spontaneous visceral pain-related behaviors were attenuated in TRPA1-knockout mice. Furthermore, upregulation of c-fos mRNA in the spinal cord at 1 day after injection was observed in WT but not TRPA1-knockout mice. However, there was no difference in histopathological changes in the urinary bladder, such as edematous thickening in the submucosa, between WT and TRPA1-knockout mice at 1 or 7 days after injection. Finally, Trpa1 mRNA levels in the L5-S1 dorsal root ganglion were not altered, but levels in the urinary bladder were drastically increased

  19. Distinct Mechanism of Cysteine Oxidation-Dependent Activation and Cold Sensitization of Human Transient Receptor Potential Ankyrin 1 Channel by High and Low Oxaliplatin

    Directory of Open Access Journals (Sweden)

    Takahito Miyake

    2017-11-01

    Full Text Available Oxaliplatin, a third-generation platinum-based chemotherapeutic agent, displays unique acute peripheral neuropathy triggered or enhanced by cold, and accumulating evidence suggests that transient receptor potential ankyrin 1 (TRPA1 is responsible. TRPA1 is activated by oxaliplatin via a glutathione-sensitive mechanism. However, oxaliplatin interrupts hydroxylation of a proline residue located in the N-terminal region of TRPA1 via inhibition of prolyl hydroxylase (PHD, which causes sensitization of TRPA1 to reactive oxygen species (ROS. Furthermore, PHD inhibition endows cold-insensitive human TRPA1 (hTRPA1 with ROS-dependent cold sensitivity. Since cysteine oxidation and proline hydroxylation regulate its activity, their association with oxaliplatin-induced TRPA1 activation and acquirement of cold sensitivity were investigated in the present study. A high concentration of oxaliplatin (1 mM induced outward-rectifier whole-cell currents and increased the intracellular Ca2+ concentration in hTRPA1-expressing HEK293 cells, but did not increase the probability of hTRPA1 channel opening in the inside-out configuration. Oxaliplatin also induced the rapid generation of hydrogen peroxide, and the resultant Ca2+ influx was prevented in the presence of glutathione and in cysteine-mutated hTRPA1 (Cys641Ser-expressing cells, whereas proline-mutated hTRPA1 (Pro394Ala-expressing cells showed similar whole-cell currents and Ca2+ influx. By contrast, a lower concentration of oxaliplatin (100 μM did not increase the intracellular Ca2+ concentration but did confer cold sensitivity on hTRPA1-expressing cells, and this was inhibited by PHD2 co-overexpression. Cold sensitivity was abolished by the mitochondria-targeting ROS scavenger mitoTEMPO and was minimal in cysteine-mutated hTRPA1 (Cys641Ser or Cys665Ser-expressing cells. Thus, high oxaliplatin evokes ROS-mediated cysteine oxidation-dependent hTRPA1 activation independent of PHD activity, while a lower

  20. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  1. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  2. Reduction of erythroid progenitors in protein-energy malnutrition.

    Science.gov (United States)

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  3. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Science.gov (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  4. Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

    Science.gov (United States)

    Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

    2015-12-01

    Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Characterization of Transient Receptor Potential Vanilloid-1 (TRPV1) Variant Activation by Coal Fly Ash Particles and Associations with Altered Transient Receptor Potential Ankyrin-1 (TRPA1) Expression and Asthma.

    Science.gov (United States)

    Deering-Rice, Cassandra E; Stockmann, Chris; Romero, Erin G; Lu, Zhenyu; Shapiro, Darien; Stone, Bryan L; Fassl, Bernhard; Nkoy, Flory; Uchida, Derek A; Ward, Robert M; Veranth, John M; Reilly, Christopher A

    2016-11-25

    Transient receptor potential (TRP) channels are activated by environmental particulate materials. We hypothesized that polymorphic variants of transient receptor potential vanilloid-1 (TRPV1) would be uniquely responsive to insoluble coal fly ash compared with the prototypical soluble agonist capsaicin. Furthermore, these changes would manifest as differences in lung cell responses to these agonists and perhaps correlate with changes in asthma symptom control. The TRPV1-I315M and -T469I variants were more responsive to capsaicin and coal fly ash. The I585V variant was less responsive to coal fly ash particles due to reduced translation of protein and an apparent role for Ile-585 in activation by particles. In HEK-293 cells, I585V had an inhibitory effect on wild-type TRPV1 expression, activation, and internalization/agonist-induced desensitization. In normal human bronchial epithelial cells, IL-8 secretion in response to coal fly ash treatment was reduced for cells heterozygous for TRPV1-I585V. Finally, both the I315M and I585V variants were associated with worse asthma symptom control with the effects of I315M manifesting in mild asthma and those of the I585V variant manifesting in severe, steroid-insensitive individuals. This effect may be due in part to increased transient receptor potential ankyrin-1 (TRPA1) expression by lung epithelial cells expressing the TRPV1-I585V variant. These findings suggest that specific molecular interactions control TRPV1 activation by particles, differential activation, and desensitization of TRPV1 by particles and/or other agonists, and cellular changes in the expression of TRPA1 as a result of I585V expression could contribute to variations in asthma symptom control. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra

    2009-12-01

    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  7. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  8. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  9. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.

    1979-01-01

    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  10. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  11. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  12. Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

    Science.gov (United States)

    Sherazi, Syed Furqan Haider; Butt, Zeeshan

    2012-09-01

    AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

  13. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  14. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  15. Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

    International Nuclear Information System (INIS)

    Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

  16. Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

  17. Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

    Science.gov (United States)

    Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

    2017-11-01

    The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

    Science.gov (United States)

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-02-03

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

  19. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

    2017-01-01

    are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

  20. Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

    Science.gov (United States)

    Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

    2018-06-15

    In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

  1. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  2. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  3. Expression of assayable residual stem cell damage in erythroid differentiation

    International Nuclear Information System (INIS)

    Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

    1985-01-01

    In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

  4. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.

    Science.gov (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A

    2004-10-01

    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  5. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

    2010-01-01

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  6. Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

    2017-07-15

    Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  8. [Update on the biology of heme synthesis in erythroid cells].

    Science.gov (United States)

    Fujiwara, Tohru; Harigae, Hideo

    2015-02-01

    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  9. Prospective identification of erythroid elements in cultured peripheral blood.

    Science.gov (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P

    1999-04-01

    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  10. Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

    Directory of Open Access Journals (Sweden)

    Josephine Wesely

    2017-01-01

    Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

  11. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  12. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  13. Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

    Science.gov (United States)

    Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

    2002-02-01

    The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

  14. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria

    2017-10-20

    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  15. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

    Directory of Open Access Journals (Sweden)

    Eyayu Belay

    Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

  16. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    2015-06-01

    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  17. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ruth Merkle

    2016-08-01

    Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

  18. A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Pablo Manresa

    2017-12-01

    Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

  19. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

  20. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

    Science.gov (United States)

    Ha, Ae Wha; Kim, Woo Kyoung

    2017-06-01

    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  1. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  2. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  3. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.

    1987-01-01

    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  4. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  5. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

    Science.gov (United States)

    Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

    2017-05-01

    Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

  6. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    Science.gov (United States)

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  7. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  8. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  9. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

    NARCIS (Netherlands)

    Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

  10. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

    1982-01-01

    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  11. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  12. Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

    OpenAIRE

    Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

    2013-01-01

    Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

  13. Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

    OpenAIRE

    Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

    1981-01-01

    Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

  14. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  15. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  16. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  18. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren

    2010-09-01

    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  19. Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

    Science.gov (United States)

    Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

    2018-04-01

    During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

  20. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  1. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

    Science.gov (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

    2017-07-01

    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

    2007-01-01

    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  3. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  4. Erythroid cells in vitro: from developmental biology to blood transfusion products.

    Science.gov (United States)

    Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

    2009-07-01

    Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

  5. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  6. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  8. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  9. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-01-01

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  10. Comparison of different methods for erythroid differentiation in the K562 cell line.

    Science.gov (United States)

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  11. The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

    International Nuclear Information System (INIS)

    Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

    1981-01-01

    The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

  12. Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

    Science.gov (United States)

    Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

    2016-12-01

    In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  14. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

    2012-01-01

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  15. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  16. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  17. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  18. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  19. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

    1999-01-01

    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  20. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  1. Biosynthesis of heme in immature erythroid cells. The regulatory step for heme formation in the human erythron

    International Nuclear Information System (INIS)

    Gardner, L.C.; Cox, T.M.

    1988-01-01

    Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation

  2. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

    Science.gov (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

    2017-03-01

    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  3. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  4. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  5. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K

    2011-01-01

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  6. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.

    Science.gov (United States)

    Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A

    2010-10-28

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.

  7. No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

    Science.gov (United States)

    Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

    2017-07-20

    Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

    Directory of Open Access Journals (Sweden)

    Schmidt Enrico K

    2004-05-01

    Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

  9. Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

    Science.gov (United States)

    Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

    1996-01-01

    Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

  10. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    International Nuclear Information System (INIS)

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-01-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

  11. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  12. Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2.

    Science.gov (United States)

    Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan

    2018-01-01

    Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Zita Garate

    2015-12-01

    Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  14. Generation and Characterization of Erythroid Cells from Human Embryonic Stem Cells and Induced Pluripotent Stem Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Kai-Hsin Chang

    2011-01-01

    Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.

  15. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  16. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.

  17. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  18. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  19. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  20. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    International Nuclear Information System (INIS)

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-01-01

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway

  1. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  2. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  3. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  4. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  6. The negative impact of Wnt signaling on megakaryocyte and primitive erythroid progenitors derived from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Prasuna Paluru

    2014-03-01

    Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.

  7. Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice.

    Science.gov (United States)

    Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D

    2010-04-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

  8. Inhibition of erythroid cell growth by allogeneic murine lymphocytes. Evidence for a synergism between lymph node cells and thymocytes

    International Nuclear Information System (INIS)

    Blomgren, H.; Jacobsson, H.

    1974-01-01

    Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay

  9. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  10. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  11. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

    Directory of Open Access Journals (Sweden)

    Sreoshi Chatterjee

    Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

  12. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    International Nuclear Information System (INIS)

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.

    1991-01-01

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

  13. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    Science.gov (United States)

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

  14. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Science.gov (United States)

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  15. Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage

    DEFF Research Database (Denmark)

    Järås, Marcus; Johnels, Petra; Agerstam, Helena

    2009-01-01

    OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...

  16. Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow

    International Nuclear Information System (INIS)

    Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.

    1976-01-01

    The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors

  17. Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

    Science.gov (United States)

    Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

    2011-06-01

    Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

  18. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  19. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

    NARCIS (Netherlands)

    von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

    2001-01-01

    Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

  20. Hemolytic disease of the fetus and newborn due to anti-Ge3: combined antibody-dependent hemolysis and erythroid precursor cell growth inhibition.

    Science.gov (United States)

    Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A

    2008-10-01

    The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.

  1. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  2. Mathematics revealed

    CERN Document Server

    Berman, Elizabeth

    1979-01-01

    Mathematics Revealed focuses on the principles, processes, operations, and exercises in mathematics.The book first offers information on whole numbers, fractions, and decimals and percents. Discussions focus on measuring length, percent, decimals, numbers as products, addition and subtraction of fractions, mixed numbers and ratios, division of fractions, addition, subtraction, multiplication, and division. The text then examines positive and negative numbers and powers and computation. Topics include division and averages, multiplication, ratios, and measurements, scientific notation and estim

  3. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  4. Phosphorylation of the Transient Receptor Potential Ankyrin 1 by Cyclin-dependent Kinase 5 affects Chemo-nociception

    OpenAIRE

    Hall, Bradford E.; Prochazkova, Michaela; Sapio, Matthew R.; Minetos, Paul; Kurochkina, Natalya; Binukumar, B. K.; Amin, Niranjana D.; Terse, Anita; Joseph, John; Raithel, Stephen J.; Mannes, Andrew J.; Pant, Harish C.; Chung, Man-Kyo; Iadarola, Michael J.; Kulkarni, Ashok B.

    2018-01-01

    Cyclin-dependent kinase 5 (Cdk5) is a key neuronal kinase that is upregulated during inflammation, and can subsequently modulate sensitivity to nociceptive stimuli. We conducted an in silico screen for Cdk5 phosphorylation sites within proteins whose expression was enriched in nociceptors and identified the chemo-responsive ion channel Transient Receptor Potential Ankyrin 1 (TRPA1) as a possible Cdk5 substrate. Immunoprecipitated full length TRPA1 was shown to be phosphorylated by Cdk5 and th...

  5. Revealing Rembrandt

    Directory of Open Access Journals (Sweden)

    Andrew J Parker

    2014-04-01

    Full Text Available The power and significance of artwork in shaping human cognition is self-evident. The starting point for our empirical investigations is the view that the task of neuroscience is to integrate itself with other forms of knowledge, rather than to seek to supplant them. In our recent work, we examined a particular aspect of the appreciation of artwork using present-day functional magnetic resonance imaging (fMRI. Our results emphasised the continuity between viewing artwork and other human cognitive activities. We also showed that appreciation of a particular aspect of artwork, namely authenticity, depends upon the co-ordinated activity between the brain regions involved in multiple decision making and those responsible for processing visual information. The findings about brain function probably have no specific consequences for understanding how people respond to the art of Rembrandt in comparison with their response to other artworks. However, the use of images of Rembrandt’s portraits, his most intimate and personal works, clearly had a significant impact upon our viewers, even though they have been spatially confined to the interior of an MRI scanner at the time of viewing. Neuroscientific studies of humans viewing artwork have the capacity to reveal the diversity of human cognitive responses that may be induced by external advice or context as people view artwork in a variety of frameworks and settings.

  6. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  7. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  8. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  9. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    Science.gov (United States)

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  10. Catalase overexpression prevents nuclear factor erythroid 2-related factor 2 stimulation of renal angiotensinogen gene expression, hypertension, and kidney injury in diabetic mice.

    Science.gov (United States)

    Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D

    2014-10-01

    This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  11. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2–Mediated Protection in Human Primary Alveolar Type II Cells in Smokers

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.

    2016-01-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  12. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

    2004-01-01

    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  13. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  14. The nuclear factor-erythroid 2-related factor/heme oxygenase-1 axis is critical for the inflammatory features of type 2 diabetes-associated osteoarthritis.

    Science.gov (United States)

    Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie

    2017-09-01

    Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Lo, Raymond; Matthews, Jason

    2013-01-01

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  16. Evaluation of effects of various drugs on platelet functions using phorbol 12-myristate 13-acetate-induced megakaryocytic human erythroid leukemia cells

    Directory of Open Access Journals (Sweden)

    Tada T

    2016-09-01

    Full Text Available Tomoki Tada,1 Kensaku Aki,2 Wataru Oboshi,1,3 Kazuyoshi Kawazoe,4 Toshiyuki Yasui,5 Eiji Hosoi2 1Subdivision of Biomedical Laboratory Sciences, Graduate School of Health Sciences, Tokushima University, 2Department of Cells and Immunity Analytics, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, 3Department of Medical Technology, Kagawa Prefectural University of Health Sciences, Kagawa, 4Department of Clinical Pharmacy Practice Pedagogy, Institute of Biomedical Sciences, 5Department of Reproductive and Menopausal Medicine, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, Japan Background: The hyperfunction and activation of platelets have been strongly implicated in the development and recurrence of arterial occlusive disease, and various antiplatelet drugs are used to treat and prevent such diseases. New antiplatelet drugs and many other drugs have been developed, but some drugs may have adverse effects on platelet functions. Objective: The aim of this study was to establish an evaluation method for evaluating the effect and adverse effect of various drugs on platelet functions. Materials and methods: Human erythroid leukemia (HEL cells were used after megakaryocytic differentiation with phorbol 12-myristate 13-acetate as an alternative to platelets. Drugs were evaluated by changes in intracellular Ca2+ concentration ([Ca2+]i mobilization in Fura2-loaded phorbol 12-myristate 13-acetate-induced HEL cells. Aspirin and cilostazol were selected as antiplatelet drugs and ibuprofen and sodium valproate as other drugs. Results: There was a positive correlation between [Ca2+]i and platelet aggregation induced by thrombin. Aspirin (5.6–560 µM and cilostazol (5–10 µM significantly inhibited thrombin-induced increases in [Ca2+]i in a concentration-dependent manner. On the other hand, ibuprofen (8–200 µM and sodium valproate (50–1,000 µg/mL also significantly inhibited

  17. A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

    Science.gov (United States)

    Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

    2015-04-01

    We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

  18. Polylox barcoding reveals haematopoietic stem cell fates realized in vivo.

    Science.gov (United States)

    Pei, Weike; Feyerabend, Thorsten B; Rössler, Jens; Wang, Xi; Postrach, Daniel; Busch, Katrin; Rode, Immanuel; Klapproth, Kay; Dietlein, Nikolaus; Quedenau, Claudia; Chen, Wei; Sauer, Sascha; Wolf, Stephan; Höfer, Thomas; Rodewald, Hans-Reimer

    2017-08-24

    Developmental deconvolution of complex organs and tissues at the level of individual cells remains challenging. Non-invasive genetic fate mapping has been widely used, but the low number of distinct fluorescent marker proteins limits its resolution. Much higher numbers of cell markers have been generated using viral integration sites, viral barcodes, and strategies based on transposons and CRISPR-Cas9 genome editing; however, temporal and tissue-specific induction of barcodes in situ has not been achieved. Here we report the development of an artificial DNA recombination locus (termed Polylox) that enables broadly applicable endogenous barcoding based on the Cre-loxP recombination system. Polylox recombination in situ reaches a practical diversity of several hundred thousand barcodes, allowing tagging of single cells. We have used this experimental system, combined with fate mapping, to assess haematopoietic stem cell (HSC) fates in vivo. Classical models of haematopoietic lineage specification assume a tree with few major branches. More recently, driven in part by the development of more efficient single-cell assays and improved transplantation efficiencies, different models have been proposed, in which unilineage priming may occur in mice and humans at the level of HSCs. We have introduced barcodes into HSC progenitors in embryonic mice, and found that the adult HSC compartment is a mosaic of embryo-derived HSC clones, some of which are unexpectedly large. Most HSC clones gave rise to multilineage or oligolineage fates, arguing against unilineage priming, and suggesting coherent usage of the potential of cells in a clone. The spreading of barcodes, both after induction in embryos and in adult mice, revealed a basic split between common myeloid-erythroid development and common lymphocyte development, supporting the long-held but contested view of a tree-like haematopoietic structure.

  19. Polylox barcoding reveals haematopoietic stem cell fates realized in vivo

    Science.gov (United States)

    Rössler, Jens; Wang, Xi; Postrach, Daniel; Busch, Katrin; Rode, Immanuel; Klapproth, Kay; Dietlein, Nikolaus; Quedenau, Claudia; Chen, Wei; Sauer, Sascha; Wolf, Stephan; Höfer, Thomas; Rodewald, Hans-Reimer

    2017-01-01

    Developmental deconvolution of complex organs and tissues at the level of individual cells remains challenging. Non-invasive genetic fate mapping1 has been widely used, but the low number of distinct fluorescent marker proteins limits its resolution. Much higher numbers of cell markers have been generated using viral integration sites2, viral barcodes3, and strategies based on transposons4 and CRISPR/Cas9 genome editing5; however, temporal and tissue-specific induction of barcodes in situ has not been achieved. Here we report the development of an artificial DNA recombination locus (termed Polylox) that enables broadly applicable endogenous barcoding based on the Cre-loxP recombination system6,7. Polylox recombination in situ reaches a practical diversity of several hundred thousand barcodes, allowing tagging of single cells. We have used this experimental system, combined with fate mapping, to assess haematopoietic stem cell (HSC) fates in vivo. Classical models of haematopoietic lineage specification assume a tree with few major branches. More recently, driven in part by the development of more efficient single-cell assays and improved transplantation efficiencies, different models have been proposed, in which unilineage priming may occur in mice and humans at the level of HSCs8–10. We have introduced barcodes into HSC progenitors in embryonic mice, and found that the adult HSC compartment is a mosaic of embryo-derived HSC clones, some of which are unexpectedly large. Most HSC clones gave rise to multilineage or oligolineage fates, arguing against unilineage priming, and suggesting coherent usage of the potential of cells in a clone. The spreading of barcodes, both after induction in embryos and in adult mice, revealed a basic split between common myeloid-erythroid development and common lymphocyte development, supporting the long-held but contested view of a tree-like haematopoietic structure. PMID:28813413

  20. In vitro studies of the sensitivity of canine bone-marrow erythroid burst-forming units (BFU-E) and fibroblast colony-forming units (CFU-F) to X-irradiation

    International Nuclear Information System (INIS)

    Kreja, Ludwika; Baltschukat, Klaus; Nothdurft, Wilhelm

    1989-01-01

    The radiosensitivity of the early erythroid progenitor cells (BFU-E) and the progenitor cells of the stroma (CFU-F) in canine bone marrow was studied under steady-state conditions by in vitro irradiation with 280 kV X-rays. The dose-effect relationship for colony formation was determined for BFU-E obtained from the iliac crest marrow, and for CFU-F in bone marrow collected from the iliac crest and the humerus of adult beagles. The BFU-E were adequately stimulated with serum from lethally irradiated dogs to obtain a source of BPA (burst-promoting activity). The BFU-E proved to be extremely radiosensitive, (the survival curve was exponential (D o 15.3 ± 1.8 cGY)). Buffy-coat leukocytes separated from bone marrow leukocytes obtained by aspiration were an optimum source of CFU-F. A curve was fitted to data obtained for CFU-F obtained from iliac crest or humerus, resulting in D o = 241 ± 38 cGY and an extrapolation number n = 1.38 ± 0.62 or D o = 261 ± 40 cGY and n = 1.04 ± 0.42, respectively. (author)

  1. Protection by dimethyl fumarate against diabetic cardiomyopathy in type 1 diabetic mice likely via activation of nuclear factor erythroid-2 related factor 2.

    Science.gov (United States)

    Hu, Xinyue; Rajesh, Mohanraj; Zhang, Jian; Zhou, Shanshan; Wang, Shudong; Sun, Jian; Tan, Yi; Zheng, Yang; Cai, Lu

    2018-05-01

    Oxidative stress and inflammation play key roles in the development of diabetic cardiomyopathy (DCM). Dimethyl fumarate (DMF), an FDA approved medicine for relapsing multiple sclerosis, has manifested its antioxidant and anti-inflammatory function mostly in the central nervous system. In this study, we investigated whether DMF could attenuate the development of DCM. Type 1 diabetes mouse model was established using multiple low-dose streptozotocin, and the diabetic mice were treated with DMF (10 mg/kg body weight) for 3 months. Cardiac functions were determined using echocardiography. Oxidative stress, pro-inflammatory cytokines and pro-fibrotic markers were determined with commercially available kits, real-time quantitative PCR or western blot techniques. DCM was characterized by diminished cardiac function, accompanied by oxidative stress and enhanced expression of pro-inflammatory cytokines. Diabetic cardiac tissue exhibited marked fibrosis, revealed by extracellular matrix deposition as determined by Sirius red staining of the myocardial tissues. Furthermore, Nrf2 and its downstream effectors were repressed in diabetic myocardium. On the contrary, diabetic animals treated with DMF exhibited blunted oxidative stress, inflammation, fibrosis and this correlated with Nrf2 activation. Our findings suggest that DMF could potentially thwart diabetes-induced myocardial tissue injury, likely via activation of Nrf2 function, providing firm impetus for future repurposing of DMF in the management of DCM. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Increased Energy Expenditure, Ucp1 Expression, and Resistance to Diet-induced Obesity in Mice Lacking Nuclear Factor-Erythroid-2-related Transcription Factor-2 (Nrf2).

    Science.gov (United States)

    Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y

    2016-04-01

    The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Qing brick tea (QBT) aqueous extract protects monosodium glutamate-induced obese mice against metabolic syndrome and involves up-regulation Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) antioxidant pathway.

    Science.gov (United States)

    Gao, Wenqi; Xiao, Changyi; Hu, Jun; Chen, Biaoxin; Wang, Chunyan; Cui, Bangping; Deng, Pengyi; Yang, Jian; Deng, Zhifang

    2018-04-18

    Qing brick tea (QBT), traditional and popular beverage for Chinese people, is an important post-fermentation dark tea. Our present study was performed to investigate the ameliorative effects of QBT aqueous extract on metabolic syndrome (Mets) in monosodium glutamate-induced obese mice and the potential mechanisms. Monosodium glutamate-induced obese mice were used to evaluate the anti-Mets effects of QBT. Content levels of malonaldehyde (MDA), reactive oxygen species (ROS) and protein carbonylation, antioxidant enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione reductase (GR) in the skeletal muscle were assessed by commercial kits, respectively. Western blot and Q-PCR were used to detect the expressions of Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) signaling pathway and downstream antioxidant factors. In addition, activity of AKT signaling and expression of glucose transporter type 4 (GLUT4) in the skeletal muscle were investigated by western blot. QBT treatment limited gain of body weight, waistline and LEE index, improved insulin resistance and glucose intolerance, reduced lipid level in MSG mice. Content levels of MDA, ROS and protein carbonylation in skeletal muscle of QBT group were significantly improved compared to those of MSG mice. The antioxidant enzyme activities of SOD, GPx, CAT, and GR were increased in skeletal muscle of MSG mice intervened with QBT. After 20-week QBT treatment, Nrf2 signaling pathway and downstream antioxidant factors were both increased in the skeletal muscle. In addition, QBT treatment improved insulin signaling by preferentially augmenting AKT signaling, as well as increased the protein expression of GLUT4 in the skeletal muscle. Our results showed that QBT intake was effective in protecting monosodium glutamate-induced obese mice against metabolic syndrome and involved in the Nrf2 signaling pathway in the skeletal muscle. Copyright © 2018

  4. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    International Nuclear Information System (INIS)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-01-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  5. Dual-energy precursor and nuclear erythroid-related factor 2 activator treatment additively improve redox glutathione levels and neuron survival in aging and Alzheimer mouse neurons upstream of reactive oxygen species.

    Science.gov (United States)

    Ghosh, Debolina; LeVault, Kelsey R; Brewer, Gregory J

    2014-01-01

    To determine whether glutathione (GSH) loss or increased reactive oxygen species (ROS) are more important to neuron loss, aging, and Alzheimer's disease (AD), we stressed or boosted GSH levels in neurons isolated from aging 3xTg-AD neurons compared with those from age-matched nontransgenic (non-Tg) neurons. Here, using titrating with buthionine sulfoximine, an inhibitor of γ-glutamyl cysteine synthetase (GCL), we observed that GSH depletion increased neuronal death of 3xTg-AD cultured neurons at increasing rates across the age span, whereas non-Tg neurons were resistant to GSH depletion until old age. Remarkably, the rate of neuron loss with ROS did not increase in old age and was the same for both genotypes, which indicates that cognitive deficits in the AD model were not caused by ROS. Therefore, we targeted for neuroprotection activation of the redox sensitive transcription factor, nuclear erythroid-related factor 2 (Nrf2) by 18 alpha glycyrrhetinic acid to stimulate GSH synthesis through GCL. This balanced stimulation of a number of redox enzymes restored the lower levels of Nrf2 and GCL seen in 3xTg-AD neurons compared with those of non-Tg neurons and promoted translocation of Nrf2 to the nucleus. By combining the Nrf2 activator together with the NADH precursor, nicotinamide, we increased neuron survival against amyloid beta stress in an additive manner. These stress tests and neuroprotective treatments suggest that the redox environment is more important for neuron survival than ROS. The dual neuroprotective treatment with nicotinamide and an Nrf2 inducer indicates that these age-related and AD-related changes are reversible. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Andrographolide stimulates p38 mitogen-activated protein kinase-nuclear factor erythroid-2-related factor 2-heme oxygenase 1 signaling in primary cerebral endothelial cells for definite protection against ischemic stroke in rats.

    Science.gov (United States)

    Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong

    2016-04-01

    Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could

  7. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    Energy Technology Data Exchange (ETDEWEB)

    Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  8. Revealing the programming process

    DEFF Research Database (Denmark)

    Bennedsen, Jens; Caspersen, Michael Edelgaard

    2005-01-01

    One of the most important goals of an introductory programming course is that the students learn a systematic approach to the development of computer programs. Revealing the programming process is an important part of this; however, textbooks do not address the issue -- probably because...... the textbook medium is static and therefore ill-suited to expose the process of programming. We have found that process recordings in the form of captured narrated programming sessions are a simple, cheap, and efficient way of providing the revelation.We identify seven different elements of the programming...

  9. TypeScript revealed

    CERN Document Server

    Maharry, Dan

    2013-01-01

    TypeScript Revealed is a quick 100-page guide to Anders Hejlsberg's new take on JavaScript. With this brief, fast-paced introduction to TypeScript, .NET, Web and Windows 8 application developers who are already familiar with JavaScript will easily get up to speed with TypeScript and decide whether or not to start incorporating it into their own development. TypeScript is 'JavaScript for Application-scale development'; a superset of JavaScript that brings to it an additional object-oriented-like syntax familiar to .NET programmers that compiles down into simple, clean JavaScript that any browse

  10. Large-scale analysis by SAGE reveals new mechanisms of v-erbA oncogene action

    Directory of Open Access Journals (Sweden)

    Faure Claudine

    2007-10-01

    Full Text Available Abstract Background: The v-erbA oncogene, carried by the Avian Erythroblastosis Virus, derives from the c-erbAα proto-oncogene that encodes the nuclear receptor for triiodothyronine (T3R. v-ErbA transforms erythroid progenitors in vitro by blocking their differentiation, supposedly by interference with T3R and RAR (Retinoic Acid Receptor. However, v-ErbA target genes involved in its transforming activity still remain to be identified. Results: By using Serial Analysis of Gene Expression (SAGE, we identified 110 genes deregulated by v-ErbA and potentially implicated in the transformation process. Bioinformatic analysis of promoter sequence and transcriptional assays point out a potential role of c-Myb in the v-ErbA effect. Furthermore, grouping of newly identified target genes by function revealed both expected (chromatin/transcription and unexpected (protein metabolism functions potentially deregulated by v-ErbA. We then focused our study on 15 of the new v-ErbA target genes and demonstrated by real time PCR that in majority their expression was activated neither by T3, nor RA, nor during differentiation. This was unexpected based upon the previously known role of v-ErbA. Conclusion: This paper suggests the involvement of a wealth of new unanticipated mechanisms of v-ErbA action.

  11. Chemistry of plutonium revealed

    International Nuclear Information System (INIS)

    Connick, R.E.

    1992-01-01

    In 1941 one goal of the Manhattan Project was to unravel the chemistry of the synthetic element plutonium as rapidly as possible. In this paper the work carried out at Berkeley from the spring of 1942 to the summer of 1945 is described briefly. The aqueous chemistry of plutonium is quite remarkable. Important insights were obtained from tracer experiments, but the full complexity was not revealed until macroscopic amounts (milligrams) became available. Because processes for separation from fission products were based on aqueous solutions, such solution chemistry was emphasized, particularly precipitation and oxidation-reduction behavior. The latter turned out to be unusually intricate when it was discovered that two more oxidation states existed in aqueous solution than had previously been suspected. Further, an equilibrium was rapidly established among the four aqueous oxidation states, while at the same time any three were not in equilibrium. These and other observations made while doing a crash study of a previously unknown element are reported

  12. Android Emotions Revealed

    DEFF Research Database (Denmark)

    Vlachos, Evgenios; Schärfe, Henrik

    2012-01-01

    This work presents a method for designing facial interfaces for sociable android robots with respect to the fundamental rules of human affect expression. Extending the work of Paul Ekman towards a robotic direction, we follow the judgment-based approach for evaluating facial expressions to test...... findings are based on the results derived from a number of judgments, and suggest that before programming the facial expressions of a Geminoid, the Original should pass through the proposed procedure. According to our recommendations, the facial expressions of an android should be tested by judges, even...... in which case an android robot like the Geminoid|DK –a duplicate of an Original person- reveals emotions convincingly; when following an empirical perspective, or when following a theoretical one. The methodology includes the processes of acquiring the empirical data, and gathering feedback on them. Our...

  13. Titan Casts Revealing Shadow

    Science.gov (United States)

    2004-05-01

    A rare celestial event was captured by NASA's Chandra X-ray Observatory as Titan -- Saturn's largest moon and the only moon in the Solar System with a thick atmosphere -- crossed in front of the X-ray bright Crab Nebula. The X-ray shadow cast by Titan allowed astronomers to make the first X-ray measurement of the extent of its atmosphere. On January 5, 2003, Titan transited the Crab Nebula, the remnant of a supernova explosion that was observed to occur in the year 1054. Although Saturn and Titan pass within a few degrees of the Crab Nebula every 30 years, they rarely pass directly in front of it. "This may have been the first transit of the Crab Nebula by Titan since the birth of the Crab Nebula," said Koji Mori of Pennsylvania State University in University Park, and lead author on an Astrophysical Journal paper describing these results. "The next similar conjunction will take place in the year 2267, so this was truly a once in a lifetime event." Animation of Titan's Shadow on Crab Nebula Animation of Titan's Shadow on Crab Nebula Chandra's observation revealed that the diameter of the X-ray shadow cast by Titan was larger than the diameter of its solid surface. The difference in diameters gives a measurement of about 550 miles (880 kilometers) for the height of the X-ray absorbing region of Titan's atmosphere. The extent of the upper atmosphere is consistent with, or slightly (10-15%) larger, than that implied by Voyager I observations made at radio, infrared, and ultraviolet wavelengths in 1980. "Saturn was about 5% closer to the Sun in 2003, so increased solar heating of Titan may account for some of this atmospheric expansion," said Hiroshi Tsunemi of Osaka University in Japan, one of the coauthors on the paper. The X-ray brightness and extent of the Crab Nebula made it possible to study the tiny X-ray shadow cast by Titan during its transit. By using Chandra to precisely track Titan's position, astronomers were able to measure a shadow one arcsecond in

  14. Revealed preference with limited consideration

    NARCIS (Netherlands)

    Demuynck, T.; Seel, C.

    2014-01-01

    We derive revealed preference tests for models where individuals use consideration sets to simplify their consumption problem. Our basic test provides necessary and sufficient conditions for consistency of observed choices with the existence of consideration set restrictions. The same conditions can

  15. Decision Making and Revealed Preference

    DEFF Research Database (Denmark)

    de la Rosa, Leonidas Enrique

    If our decision-making processes are to some extent shaped by evolutionary pressures and our environment is different from that to which we adapted, some of our choices will not be in our best interest. But revealed preference is the only tool that we have so far to conduct a normative analysis...

  16. Transparency masters for mathematics revealed

    CERN Document Server

    Berman, Elizabeth

    1980-01-01

    Transparency Masters for Mathematics Revealed focuses on master diagrams that can be used for transparencies for an overhead projector or duplicator masters for worksheets. The book offers information on a compilation of master diagrams prepared by John R. Stafford, Jr., audiovisual supervisor at the University of Missouri at Kansas City. Some of the transparencies are designed to be shown horizontally. The initial three masters are number lines and grids that can be used in a mathematics course, while the others are adaptations of text figures which are slightly altered in some instances. The

  17. Communication Games Reveal Preparation Contextuality

    Science.gov (United States)

    Hameedi, Alley; Tavakoli, Armin; Marques, Breno; Bourennane, Mohamed

    2017-12-01

    A communication game consists of distributed parties attempting to jointly complete a task with restricted communication. Such games are useful tools for studying limitations of physical theories. A theory exhibits preparation contextuality whenever its predictions cannot be explained by a preparation noncontextual model. Here, we show that communication games performed in operational theories reveal the preparation contextuality of that theory. For statistics obtained in a particular family of communication games, we show a direct correspondence with correlations in spacelike separated events obeying the no-signaling principle. Using this, we prove that all mixed quantum states of any finite dimension are preparation contextual. We report on an experimental realization of a communication game involving three-level quantum systems from which we observe a strong violation of the constraints of preparation noncontextuality.

  18. The chemistry of plutonium revealed

    International Nuclear Information System (INIS)

    Connick, R.E.

    1990-01-01

    In 1941 one goal of the Manhattan Project was to unravel the chemistry of the synthetic element plutonium as rapidly as possible. Important insights were obtained from tracer experiments, but the full complexity of plutonium chemistry was not revealed until macroscopic amounts (milligrams) became available. Because processes for separation from fission products were aqueous solution based, such solution chemistry was emphasized, particularly precipitation and oxidation-reduction behavior. The latter turned out to be unusually intricate when it was discovered that two more oxidation states existed in aqueous solution than had previously been suspected. Further, it was found that an equilibrium was rapidly established among the four aqueous oxidation states while at the same time any three were not in equilibrium. These and other observations made while doing a crash study of a previously unknown element will be reported

  19. Plan competitions reveal entrepreneurial talent

    Energy Technology Data Exchange (ETDEWEB)

    Madison, Alison L.

    2011-05-15

    Monthly economic diversity column for Tri-City Herald business section. Excerpt below: There’s something to be said for gaining valuable real-world experience in a structured, nurturing environment. Take for instance learning to scuba dive in the comfort of my resort pool rather than immediately hanging out with sharks while I figure out little things like oxygen tanks and avoiding underwater panic attacks. Likewise, graduate students are getting some excellent, supportive real-world training through university business plan competitions. These competitions are places where smart minds, new technologies, months of preparation and coaching, and some healthy pre-presentation jitters collide to reveal not only solid new business ideas, but also some promising entrepreneurial talent. In fact, professionals from around our region descend upon college campuses every spring to judge these events, which help to bridge the gap between academics and the real technology and business-driven economy.

  20. Sulforaphane Inhibits Lipopolysaccharide-Induced Inflammation, Cytotoxicity, Oxidative Stress, and miR-155 Expression and Switches to Mox Phenotype through Activating Extracellular Signal-Regulated Kinase 1/2-Nuclear Factor Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway in Murine Microglial Cells.

    Science.gov (United States)

    Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin

    2018-01-01

    Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.

  1. Hubble Images Reveal Jupiter's Auroras

    Science.gov (United States)

    1996-01-01

    These images, taken by the Hubble Space Telescope, reveal changes in Jupiter's auroral emissions and how small auroral spots just outside the emission rings are linked to the planet's volcanic moon, Io. The images represent the most sensitive and sharply-detailed views ever taken of Jovian auroras.The top panel pinpoints the effects of emissions from Io, which is about the size of Earth's moon. The black-and-white image on the left, taken in visible light, shows how Io and Jupiter are linked by an invisible electrical current of charged particles called a 'flux tube.' The particles - ejected from Io (the bright spot on Jupiter's right) by volcanic eruptions - flow along Jupiter's magnetic field lines, which thread through Io, to the planet's north and south magnetic poles. This image also shows the belts of clouds surrounding Jupiter as well as the Great Red Spot.The black-and-white image on the right, taken in ultraviolet light about 15 minutes later, shows Jupiter's auroral emissions at the north and south poles. Just outside these emissions are the auroral spots. Called 'footprints,' the spots are created when the particles in Io's 'flux tube' reach Jupiter's upper atmosphere and interact with hydrogen gas, making it fluoresce. In this image, Io is not observable because it is faint in the ultraviolet.The two ultraviolet images at the bottom of the picture show how the auroral emissions change in brightness and structure as Jupiter rotates. These false-color images also reveal how the magnetic field is offset from Jupiter's spin axis by 10 to 15 degrees. In the right image, the north auroral emission is rising over the left limb; the south auroral oval is beginning to set. The image on the left, obtained on a different date, shows a full view of the north aurora, with a strong emission inside the main auroral oval.The images were taken by the telescope's Wide Field and Planetary Camera 2 between May 1994 and September 1995.This image and other images and data

  2. Proteomic analysis reveals heat shock protein 70 has a key role in polycythemia Vera.

    Science.gov (United States)

    Gallardo, Miguel; Barrio, Santiago; Fernandez, Marisol; Paradela, Alberto; Arenas, Alicia; Toldos, Oscar; Ayala, Rosa; Albizua, Enriqueta; Jimenez, Ana; Redondo, Santiago; Garcia-Martin, Rosa Maria; Gilsanz, Florinda; Albar, Juan Pablo; Martinez-Lopez, Joaquin

    2013-11-19

    JAK-STAT signaling through the JAK2V617F mutation is central to the pathogenesis of myeloproliferative neoplasms (MPN). However, other events could precede the JAK2 mutation. The aim of this study is to analyze the phenotypic divergence between polycytemia vera (PV) and essential thrombocytemia (ET) to find novel therapeutics targets by a proteomic and functional approach to identify alternative routes to JAK2 activation. Through 2D-DIGE and mass spectrometry of granulocyte protein from 20 MPN samples, showed differential expression of HSP70 in PV and ET besides other 60 proteins. Immunohistochemistry of 46 MPN bone marrow samples confirmed HSP70 expression. The median of positive granulocytes was 80% in PV (SD 35%) vs. 23% in ET (SD 34.25%). In an ex vivo model KNK437 was used as an inhibition model assay of HSP70, showed dose-dependent inhibition of cell growth and burst formation unit erythroid (BFU-E) in PV and ET, increased apoptosis in the erythroid lineage, and decreased pJAK2 signaling, as well as a specific siRNA for HSP70. These data suggest a key role for HSP70 in proliferation and survival of the erythroid lineage in PV, and may represent a potential therapeutic target in MPN, especially in PV.

  3. Focus groups reveal consumer ambivalence.

    Science.gov (United States)

    1983-01-01

    According to qualitative research, Salvadoreans are ambivalent about the use of contraceptives. Since complete responsibility for management of the CSM project was accepted by the Association Demografica Salvadorena (ADS), the agency which operates the contraceptive social marketing project in El Salvador, in November 1980, the need for decisions in such areas as product price increases, introduction of new condom brands, promotion of the vaginal foaming tablet, and assessment of product sales performance had arisen. The ICSMP funded market research, completed during 1983, was intended to provide the data on which such decisions by ADS could be based. The qualitative research involved 8 focus groups, comprised of men and women, aged 18-45, contraceptive users and nonusers, from the middle and lower socioeconomic strata of the city of San Salvador and other suburban areas. In each group a moderator led discussion of family planning and probed respondents for specific attitudes, knowledge, and behavior regarding the use of contraceptives. To assess attitudes at a more emotional level, moderators asked respondents to "draw" their ideas on certain issues. A marked discrepancy was revealed between respondents' intellectual responses to the issues raised in group discussion, as opposed to their feelings expressed in the drawings. Intellectually, participants responded very positively to family planning practice, but when they were asked to draw their perceptions, ambivalent feelings emerged. Drawings of both the user and the nonuser convey primarily negative aspects for either choice. The user is tense and moody toward her children; the nonuser loses her attractiveness and "dies." Figures also show drawings of some of the attitudes of single and married male participants. 1 drawing shows an incomplete and a complete circle, symbolizing a sterilized man (incomplete) and a nonsterilized man (complete). Another picture depicts a chained man who has lost his freedom

  4. Revealing conceptual understanding of international business

    NARCIS (Netherlands)

    Sue Ashley; Dr. Harmen Schaap; Prof.Dr. Elly de Bruijn

    2017-01-01

    This study aims to identify an adequate approach for revealing conceptual understanding in higher professional education. Revealing students’ conceptual understanding is an important step towards developing effective curricula, assessment and aligned teaching strategies to enhance conceptual

  5. Puerto Rico Revealed Preference Survey Data 2004

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Revealed preference models provide insights into recreational angler behavior and the economic value of recreational fishing trips. Revealed preference data is...

  6. l-2-Oxothiazolidine-4-Carboxylic Acid or α-Lipoic Acid Attenuates Airway Remodeling: Involvement of Nuclear Factor-κB (NF-κB, Nuclear Factor Erythroid 2p45-Related Factor-2 (Nrf2, and Hypoxia-Inducible Factor (HIF

    Directory of Open Access Journals (Sweden)

    Heung Bum Lee

    2012-06-01

    Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.

  7. The 'revealed preferences' theory: Assumptions and conjectures

    International Nuclear Information System (INIS)

    Green, C.H.

    1983-01-01

    Being kind of intuitive psychology the 'Revealed-Preferences'- theory based approaches towards determining the acceptable risks are a useful method for the generation of hypotheses. In view of the fact that reliability engineering develops faster than methods for the determination of reliability aims the Revealed-Preferences approach is a necessary preliminary help. Some of the assumptions on which the 'Revealed-Preferences' theory is based will be identified and analysed and afterwards compared with experimentally obtained results. (orig./DG) [de

  8. Revealing Conceptual Understanding of International Business

    Science.gov (United States)

    Ashley, Sue; Schaap, Harmen; de Bruijn, Elly

    2017-01-01

    This study aims to identify an adequate approach for revealing conceptual understanding in higher professional education. Revealing students' conceptual understanding is an important step towards developing effective curricula, assessment and aligned teaching strategies to enhance conceptual understanding in higher education. Essays and concept…

  9. REVEAL: Software Documentation and Platform Migration

    Science.gov (United States)

    Wilson, Michael A.; Veibell, Victoir T.; Freudinger, Lawrence C.

    2008-01-01

    The Research Environment for Vehicle Embedded Analysis on Linux (REVEAL) is reconfigurable data acquisition software designed for network-distributed test and measurement applications. In development since 2001, it has been successfully demonstrated in support of a number of actual missions within NASA s Suborbital Science Program. Improvements to software configuration control were needed to properly support both an ongoing transition to operational status and continued evolution of REVEAL capabilities. For this reason the project described in this report targets REVEAL software source documentation and deployment of the software on a small set of hardware platforms different from what is currently used in the baseline system implementation. This report specifically describes the actions taken over a ten week period by two undergraduate student interns and serves as a final report for that internship. The topics discussed include: the documentation of REVEAL source code; the migration of REVEAL to other platforms; and an end-to-end field test that successfully validates the efforts.

  10. Studies of the erythroid inductive microenvironment in vitro

    International Nuclear Information System (INIS)

    van Zant, G.; Goldwasser, E.; Pech, N.

    1977-01-01

    Spleen cells from radiated mice (XS), but not from normal mice (NS), when combined with mouse marrow cells in vitro, had two effects on hemoglobin synthesis: (1) increased baseline, and (2) augmented erythropoietin-induced, hemoglobin formation. Spleen cells from normal and radiated rats caused increased hemoglobin synthesis by rat marrow cells in a dose-dependent manner. In addition, lung and thymus cells from radiated rats, but not from normal rats, caused increased hemoglobin synthesis by rat marrow cells. Rat NS augmented hemoglobin formation by mouse marrow, but neither mouse NS nor mouse XS had an effect on rat marrow. Medium from rat NS cultures stimulated hemoglobin synthesis when added to rat marrow cells. The increases in baseline, and in the response to erythropoietin, were dependent on the amount of ''conditioned medium.'' The substance in the medium responsible for these effects was not erythropoietin

  11. REVEAL: Software Documentation and Platform Migration

    Science.gov (United States)

    Wilson, Michael A.; Veibell, Victoir T.

    2011-01-01

    The Research Environment for Vehicle Embedded Analysis on Linux (REVEAL) is reconfigurable data acquisition software designed for network-distributed test and measurement applications. In development since 2001, it has been successfully demonstrated in support of a number of actual missions within NASA's Suborbital Science Program. Improvements to software configuration control were needed to properly support both an ongoing transition to operational status and continued evolution of REVEAL capabilities. For this reason the project described in this report targets REVEAL software source documentation and deployment of the software on a small set of hardware platforms different from what is currently used in the baseline system implementation. This presentation specifically describes the actions taken over a ten week period by two undergraduate student interns and serves as an overview of the content of the final report for that internship.

  12. Omics strategies for revealing Yersinia pestis virulence

    Science.gov (United States)

    Yang, Ruifu; Du, Zongmin; Han, Yanping; Zhou, Lei; Song, Yajun; Zhou, Dongsheng; Cui, Yujun

    2012-01-01

    Omics has remarkably changed the way we investigate and understand life. Omics differs from traditional hypothesis-driven research because it is a discovery-driven approach. Mass datasets produced from omics-based studies require experts from different fields to reveal the salient features behind these data. In this review, we summarize omics-driven studies to reveal the virulence features of Yersinia pestis through genomics, trascriptomics, proteomics, interactomics, etc. These studies serve as foundations for further hypothesis-driven research and help us gain insight into Y. pestis pathogenesis. PMID:23248778

  13. Mechanism governing heme synthesis reveals a GATA factor/heme circuit that controls differentiation.

    Science.gov (United States)

    Tanimura, Nobuyuki; Miller, Eli; Igarashi, Kazuhiko; Yang, David; Burstyn, Judith N; Dewey, Colin N; Bresnick, Emery H

    2016-02-01

    Metal ion-containing macromolecules have fundamental roles in essentially all biological processes throughout the evolutionary tree. For example, iron-containing heme is a cofactor in enzyme catalysis and electron transfer and an essential hemoglobin constituent. To meet the intense demand for hemoglobin assembly in red blood cells, the cell type-specific factor GATA-1 activates transcription of Alas2, encoding the rate-limiting enzyme in heme biosynthesis, 5-aminolevulinic acid synthase-2 (ALAS-2). Using genetic editing to unravel mechanisms governing heme biosynthesis, we discovered a GATA factor- and heme-dependent circuit that establishes the erythroid cell transcriptome. CRISPR/Cas9-mediated ablation of two Alas2 intronic cis elements strongly reduces GATA-1-induced Alas2 transcription, heme biosynthesis, and surprisingly, GATA-1 regulation of other vital constituents of the erythroid cell transcriptome. Bypassing ALAS-2 function in Alas2 cis element-mutant cells by providing its catalytic product 5-aminolevulinic acid rescues heme biosynthesis and the GATA-1-dependent genetic network. Heme amplifies GATA-1 function by downregulating the heme-sensing transcriptional repressor Bach1 and via a Bach1-insensitive mechanism. Through this dual mechanism, heme and a master regulator collaborate to orchestrate a cell type-specific transcriptional program that promotes cellular differentiation. © 2015 The Authors.

  14. Revealed Preference Theory, Rationality, and Neoclassical ...

    African Journals Online (AJOL)

    Revealed Preference Theory (Samuelson 1938) is an attempt to establish economic theory as a genuine empirical science by ridding it of nonempirical psychological concepts. Samuelson's goal was to rid economic theory of the last vestiges of utility analysis. Samuelson structured his theory on a set of preference axioms ...

  15. [Mastitis revealing Churg-Strauss syndrome].

    Science.gov (United States)

    Dannepond, C; Le Fourn, E; de Muret, A; Ouldamer, L; Carmier, D; Machet, L

    2014-01-01

    Churg-Strauss syndrome often involves the skin, and this may sometimes reveal the disease. A 25-year-old woman was referred to a gynaecologist for inflammation of the right breast with breast discharge. Cytological analysis of the liquid showed numerous inflammatory cells, particularly polymorphonuclear eosinophils and neutrophils. Ultrasound examination of the breast was consistent with galactophoritis. CRP was normal, and hypereosinophilia was seen. The patient was subsequently referred to a dermatology unit. Skin examination revealed inflammation of the entire breast, which was painful, warm and erythematous; the border was oedematous with blisters. Necrotic lesions were also present on the thumbs and knees. Skin biopsy of the breast showed a dermal infiltrate with abundant infiltrate of polymorphonuclear eosinophils, including patchy necrosis and intraepidermal vesicles. Histological examination of a biopsy sample from a thumb revealed eosinophilic granuloma and leukocytoclastic vasculitis. The patient was also presenting asthma, pulmonary infiltrates and mononeuropathy at L3, consistent with Churg-Strauss syndrome. Breast involvement in Churg-Strauss syndrome is very rare (only one other case has been reported). This is the first case in which the breast condition revealed the disease. Cutaneous involvement of the breast is, however, also compatible with Wells' cellulitis. The lesions quickly disappeared with 1mg/kg/d oral prednisolone. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. Revealed preference tests for collective household behavior

    NARCIS (Netherlands)

    Cherchye, L.J.H.; de Rock, B.; Vermeulen, F.M.P.; Verriest, E.; Molina, J.A.

    2011-01-01

    This chapter contains a state of the art of revealed preference tests for consistency of observed household behavior with Pareto efficiency. These tests are entirely nonparametric, since they do not require any assumptions regarding the parametric form of individual preferences or the intrahousehold

  17. Reveal quantum correlation in complementary bases

    OpenAIRE

    Shengjun Wu; Zhihao Ma; Zhihua Chen; Sixia Yu

    2014-01-01

    An essential feature of genuine quantum correlation is the simultaneous existence of correlation in complementary bases. We reveal this feature of quantum correlation by defining measures based on invariance under a basis change. For a bipartite quantum state, the classical correlation is the maximal correlation present in a certain optimum basis, while the quantum correlation is characterized as a series of residual correlations in the mutually unbiased bases. Compared with other approaches ...

  18. Mediastinal Mature Teratoma Revealed by Empyema

    Directory of Open Access Journals (Sweden)

    Mohammed Raoufi

    2016-01-01

    Full Text Available Teratomas are germ cell tumors, manifested with a great variety of clinical features; the most common extragonadal site is the anterior mediastinum. In this case, we report the patient with a large mature mediastinal teratoma with several components of ectodermal and endothermal epithelium. A 24-year-old female patient presented with history of persistent chest pain and progressively aggravating dyspnea for the previous 3 months. A chest X-ray showed a large opacity of the entire left hemithorax. Transcutaneous needle aspiration revealed a purulent fluid. The tube thoracostomy was introduced and the effusion was evacuated. Some weeks later, patient was seen in emergency for persistent cough and lateral chest pain. CT scan revealed a mass of the left hemithorax. The mass showed heterogeneous density, without compressing mediastinum great vessels and left hilar structures. Lipase value was elevated in needle aspiration. The patient underwent a total resection of the mediastinum mass via a left posterolateral thoracotomy. Microscopy revealed a mature teratoma with cystic structures. The patient subsequently made a full recovery. This case provide benign mediastinal teratoma with total atelectasis of left lung and elevated lipase value in needle transcutaneous aspiration; this event is explained by pancreatic component in the cystic tumor. Total removal of the tumor is adequate treatment for this type of teratoma and the prognosis is excellent.

  19. Midface swelling reveals nasofrontal dermal sinus

    International Nuclear Information System (INIS)

    Houneida, Zaghouani Ben Alaya; Manel, Limeme; Latifa, Harzallah; Habib, Amara; Dejla, Bakir; Chekib, Kraiem

    2012-01-01

    Nasofrontal dermal sinuses are very rare and generally occur in children. This congenital malformation can be revealed by midface swelling, which can be complicated by local infection or neuromeningitis. Such complications make the dermal sinus a life-threatening disease. Two cases of nasofrontal dermal sinuses are reported in this work. The first case is an 11-month-old girl who presented with left orbitonasal soft tissue swelling accompanied by inflammation. Physical examination found fever, left orbitonasal thickening, and a puncture hole letting out pus. Computed tomography revealed microabscesses located at the left orbitonasal soft tissues, a frontal bone defect, and an intracranial cyst. Magnetic resonance imaging showed the transosseous tract between the glabella and the brain and affirmed the epidermoid nature of the intracranial cyst. The second case is a 7-year-old girl who presented with a nasofrontal non-progressive mass that intermittently secreted a yellow liquid through an external orifice located at the glabella. MRI revealed a cystic mass located in the deep layer of the glabellar skin related to an epidermoid cyst with a nasofrontal dermal sinus tract. In both cases, surgical excision was performed, and pathological confirmation was made for the diagnoses of dermal sinuses. The postoperative course was favorable. Through these cases, the authors stress the role of imaging methods in confirming the diagnosis and looking for associated cysts (dermoid and epidermoid) to improve recognition of this rare disease. Knowledge of the typical clinical presentations, imaging manifestations, and most common sites of occurrence of this malformation are needed to formulate a differential diagnosis.

  20. Structures of Astromaterials Revealed by EBSD

    Science.gov (United States)

    Zolensky, M.

    2018-01-01

    Groups at the Johnson Space Center and the University of Tokyo have been using electron back-scattered diffraction (EBSD) to reveal the crystal structures of extraterrestrial minerals for many years. Even though we also routinely use transmission electron microscopy, synchrotron X-ray diffraction (SXRD), and conventional electron diffraction, we find that EBSD is the most powerful technique for crystal structure elucidation in many instances. In this talk I describe a few of the cases where we have found EBSD to provide crucial, unique information. See attachment.

  1. [Encopresis revealing myotonic dystrophy in 2 children].

    Science.gov (United States)

    Avez-Couturier, J; Michaud, L; Cuisset, J-M; Lamblin, M-D; Dolhem, P; Turck, D; Vallée, L; Gottrand, F

    2009-05-01

    Gastrointestinal symptoms are very frequent in myotonic dystrophy but largely unrecognized. They can be the revealing factors of the disease. We report 2 cases of 10 and 17-year-old children with persistent encopresis starting at the age of 3 and 5 years in spite of laxative treatment. Neurological examination and anorectal manometry provided the diagnosis of myotonic dystrophy. Procainamide treatment was introduced and the digestive symptoms improved. Any child with encopresis should have complete evaluation to rule out the diagnosis of myotonic dystrophy and physicians should look for upper and/or lower gastrointestinal symptoms in every patient with myotonic dystrophy.

  2. Transcriptome classification reveals molecular subtypes in psoriasis

    Directory of Open Access Journals (Sweden)

    Ainali Chrysanthi

    2012-09-01

    Full Text Available Abstract Background Psoriasis is an immune-mediated disease characterised by chronically elevated pro-inflammatory cytokine levels, leading to aberrant keratinocyte proliferation and differentiation. Although certain clinical phenotypes, such as plaque psoriasis, are well defined, it is currently unclear whether there are molecular subtypes that might impact on prognosis or treatment outcomes. Results We present a pipeline for patient stratification through a comprehensive analysis of gene expression in paired lesional and non-lesional psoriatic tissue samples, compared with controls, to establish differences in RNA expression patterns across all tissue types. Ensembles of decision tree predictors were employed to cluster psoriatic samples on the basis of gene expression patterns and reveal gene expression signatures that best discriminate molecular disease subtypes. This multi-stage procedure was applied to several published psoriasis studies and a comparison of gene expression patterns across datasets was performed. Conclusion Overall, classification of psoriasis gene expression patterns revealed distinct molecular sub-groups within the clinical phenotype of plaque psoriasis. Enrichment for TGFb and ErbB signaling pathways, noted in one of the two psoriasis subgroups, suggested that this group may be more amenable to therapies targeting these pathways. Our study highlights the potential biological relevance of using ensemble decision tree predictors to determine molecular disease subtypes, in what may initially appear to be a homogenous clinical group. The R code used in this paper is available upon request.

  3. [Severe pulmonary embolism revealed by status epilepticus].

    Science.gov (United States)

    Allou, N; Coolen-Allou, N; Delmas, B; Cordier, C; Allyn, J

    2016-12-01

    High-risk pulmonary embolism (PE) is associated with high mortality rate (>50%). In some cases, diagnosis of PE remains a challenge with atypical presentations like in this case report with a PE revealed by status epilepticus. We report the case of a 40-year-old man without prior disease, hospitalized in ICU for status epilepticus. All paraclinical examinations at admission did not show any significant abnormalities (laboratory tests, cardiologic and neurological investigations). On day 1, he presented a sudden circulatory collapse and echocardiography showed right intra-auricular thrombus. He was treated by thrombolysis and arteriovenous extracorporeal membrane oxygenation. After stabilization, computed tomography showed severe bilateral PE. He developed multi-organ failure and died 4days after admission. Pulmonary embolism revealed by status epilepticus has rarely been reported and is associated with poor prognosis. Physicians should be aware and think of the possibility of PE in patients with status epilepticus without any history or risk factors of seizure and normal neurological investigations. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  4. [Localized purpura revealing vascular prosthetic graft infection].

    Science.gov (United States)

    Boureau, A S; Lescalie, F; Cassagnau, E; Clairand, R; Connault, J

    2013-07-01

    Prosthetic graft infection after vascular reconstruction is a rare but serious complication. We report a case of infection occurring late after implantation of an iliofemoral prosthetic vascular graft. The Staphylococcus aureus infection was revealed by vascular purpura localized on the right leg 7 years after implantation of a vascular prosthesis. This case illustrates an uncommonly late clinical manifestation presenting as an acute infection 7 years after the primary operation. In this situation, the presentation differs from early infection, which generally occurs within the first four postoperative months. Diagnosis and treatment remain a difficult challenge because prosthetic graft infection is a potentially life-threatening complication. Morbidity and mortality rates are high. Here we detail specific aspects of the clinical and radiological presentation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  5. Chain networking revealed by molecular dynamics simulation

    Science.gov (United States)

    Zheng, Yexin; Tsige, Mesfin; Wang, Shi-Qing

    Based on Kremer-Grest model for entangled polymer melts, we demonstrate how the response of a polymer glass depends critically on the chain length. After quenching two melts of very different chain lengths (350 beads per chain and 30 beads per chain) into deeply glassy states, we subject them to uniaxial extension. Our MD simulations show that the glass of long chains undergoes stable necking after yielding whereas the system of short chains is unable to neck and breaks up after strain localization. During ductile extension of the polymer glass made of long chain significant chain tension builds up in the load-bearing strands (LBSs). Further analysis is expected to reveal evidence of activation of the primary structure during post-yield extension. These results lend support to the recent molecular model 1 and are the simulations to demonstrate the role of chain networking. This work is supported, in part, by a NSF Grant (DMR-EAGER-1444859)

  6. Social patterns revealed through random matrix theory

    Science.gov (United States)

    Sarkar, Camellia; Jalan, Sarika

    2014-11-01

    Despite the tremendous advancements in the field of network theory, very few studies have taken weights in the interactions into consideration that emerge naturally in all real-world systems. Using random matrix analysis of a weighted social network, we demonstrate the profound impact of weights in interactions on emerging structural properties. The analysis reveals that randomness existing in particular time frame affects the decisions of individuals rendering them more freedom of choice in situations of financial security. While the structural organization of networks remains the same throughout all datasets, random matrix theory provides insight into the interaction pattern of individuals of the society in situations of crisis. It has also been contemplated that individual accountability in terms of weighted interactions remains as a key to success unless segregation of tasks comes into play.

  7. Neutron Imaging Reveals Internal Plant Hydraulic Dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Warren, Jeffrey [ORNL; Bilheux, Hassina Z [ORNL; Kang, Misun [ORNL; Voisin, Sophie [ORNL; Cheng, Chu-Lin [ORNL; Horita, Jusuke [ORNL; Perfect, Edmund [ORNL

    2013-01-01

    Many terrestrial ecosystem processes are constrained by water availability and transport within the soil. Knowledge of plant water fluxes is thus critical for assessing mechanistic processes linked to biogeochemical cycles, yet resolution of root structure and xylem water transport dynamics has been a particularly daunting task for the ecologist. Through neutron imaging, we demonstrate the ability to non-invasively monitor individual root functionality and water fluxes within Zea mays L. (maize) and Panicum virgatum L. (switchgrass) seedlings growing in a sandy medium. Root structure and growth were readily imaged by neutron radiography and neutron computed tomography. Seedlings were irrigated with water or deuterium oxide and imaged through time as a growth lamp was cycled on to alter leaf demand for water. Sub-millimeter scale resolution reveals timing and magnitudes of root water uptake, redistribution within the roots, and root-shoot hydraulic linkages, relationships not well characterized by other techniques.

  8. Revealing effective classifiers through network comparison

    Science.gov (United States)

    Gallos, Lazaros K.; Fefferman, Nina H.

    2014-11-01

    The ability to compare complex systems can provide new insight into the fundamental nature of the processes captured, in ways that are otherwise inaccessible to observation. Here, we introduce the n-tangle method to directly compare two networks for structural similarity, based on the distribution of edge density in network subgraphs. We demonstrate that this method can efficiently introduce comparative analysis into network science and opens the road for many new applications. For example, we show how the construction of a “phylogenetic tree” across animal taxa according to their social structure can reveal commonalities in the behavioral ecology of the populations, or how students create similar networks according to the University size. Our method can be expanded to study many additional properties, such as network classification, changes during time evolution, convergence of growth models, and detection of structural changes during damage.

  9. Hidden acoustic information revealed by intentional nonlinearity

    Science.gov (United States)

    Dowling, David R.

    2017-11-01

    Acoustic waves are omnipresent in modern life and are well described by the linearized equations of fluid dynamics. Once generated, acoustic waves carry and collect information about their source and the environment through which they propagate, respectively, and this information may be retrieved by analyzing recordings of these waves. Because of this, acoustics is the primary means for observation, surveillance, reconnaissance, and remote sensing in otherwise opaque environments, such as the Earth's oceans and crust, and the interior of the human body. For such information-retrieval tasks, acoustic fields are nearly always interrogated within their recorded frequency range or bandwidth. However, this frequency-range restriction is not general; acoustic fields may also carry (hidden) information at frequencies outside their bandwidth. Although such a claim may seem counter intuitive, hidden acoustic-field information can be revealed by re-introducing a marquee trait of fluid dynamics: nonlinearity. In particular, an intentional quadratic nonlinearity - a form of intra-signal heterodyning - can be used to obtain acoustic field information at frequencies outside a recorded acoustic field's bandwidth. This quadratic nonlinearity enables a variety of acoustic remote sensing applications that were long thought to be impossible. In particular, it allows the detrimental effects of sparse recordings and random scattering to be suppressed when the original acoustic field has sufficient bandwidth. In this presentation, the topic is developed heuristically, with a just brief exposition of the relevant mathematics. Hidden acoustic field information is then revealed from simulated and measured acoustic fields in simple and complicated acoustic environments involving frequencies from a few Hertz to more than 100 kHz, and propagation distances from tens of centimeters to hundreds of kilometers. Sponsored by ONR, NAVSEA, and NSF.

  10. Ceres Revealed in a Grain of Salt

    Science.gov (United States)

    Zolensky, M. E.; Bodnar, R. J.; Fries, M.; Chan, Q. H.-S.; Kebukawa, Y.; Mikouchi, T.; Hagiya, K.; Komatsu, M.; Ohsumi, K.; Steele, A.

    2016-01-01

    Introduction: Zag and Monahans (1998) are H chondrite regolith breccias containing 4.5 giga-year-old halite crystals which contain abundant inclusions of aqueous fluids, solids and organics. These all originated on a cryo-volcanically-active C class asteroid, probably 1 Ceres; the halite was transported to the regolith of the H chondrite parent asteroid, potentially 6 Hebe. Detailed analysis of these solids will thus potentially reveal the mineralogy of Ceres. Mineralogy of solids in the Monahans Halite Solid grains are present in the halites, which were entrained within the mother brines during eruption, including material from the interior and surface of the erupting body. The solids include abundant, widely variable organics that could not have been significantly heated (which would have resulted in the loss of fluids from the halite). Our analyses by Raman microprobe, SEM/EDX, synchrotron X-ray diffraction, UPLC-FD/QToF-MS, C-XANES and TEM reveal that these trapped grains include macromolecular carbon (MMC) similar in structure to CV3 chondrite matrix carbon, aliphatic carbon compounds, olivine (Fo99-59), high- and low-Ca pyroxene, feldspars, phyllosilicates, magnetite, sulfides, metal, lepidocrocite, carbonates, diamond, apatite and zeolites. Conclusions: The halite in Monahans and Zag derive from a water and carbon-rich object that was cryo-volcanically active in the early solar system, probably Ceres. The Dawn spacecraft found that Ceres includes C chondrite materials. Our samples include both protolith and aqueously-altered samples of the body, permitting understanding of alteration conditions. Whatever the halite parent body, it was rich in a wide variety of organics and warm, liquid water at the solar system's dawn.

  11. ERYTHEMA NODOSUM REVEALING ACUTE MYELOID LEUKEMIA

    Directory of Open Access Journals (Sweden)

    Chebbi Wafa

    2013-07-01

    Full Text Available Introduction: Erythema nodosum (EN is the most common type of panniculitis. It may be idiopathic or secondary to various etiologies. However, the occurrence of erythema nodosum in malignant hemopathy had rarely been reported. Case report: A 42 year-old woman presented with a four week history of recurrent multiple painful erythematous nodules developed on the lower limbs associated with arthralgia of the ankles and fever. The clinical features of skin lesions with contusiform color evolution allowed establishing the diagnosis of EN. No underlying cause was found. The skin lesions were improved with non-steroidal anti-inflammatory drugs and colchicine. Three months later, the patient consulted for recurrence of EN associated with fever, inflammatory polyarthralgia and hepatosplenomegaly. The peripheral blood count revealed pancytopenia. A bone marrow examination confirmed the diagnosis of acute myeloid leukemia type 2. Initiation of chemotherapy was followed by the complete disappearance of skin lesions of EN. Conclusion: Paraneoplastic erythema nodosum is a rare entity. In the literature, a few cases of association with leukemia have been reported. Exploration for solid neoplasms or hemopathy in case of recurrent EN or resistance to conventional treatment should be systematic

  12. Revealing the values behind convenience food consumption.

    Science.gov (United States)

    Botonaki, Anna; Mattas, Konstadinos

    2010-12-01

    The increasing importance of convenience in consumer food choices has attracted researchers' interest. In the effort to understand how convenience affects consumers' food preferences, values are believed to play an important role. The present study attempts to examine the way personal values suggested by Schwartz (1992) are associated with behaviour and attitudes regarding convenience food. A number of constructs describing food related attitudes and behaviours were developed and their relationship with personal values was analyzed following the methodology proposed by Brunsø, Scholderer, and Grunert (2004). Data were collected through a questionnaire survey from a random sample of consumers in Thessaloniki city, Greece. The results reveal that convenience food consumption and convenience orientation in the food domain are mainly connected with values that motivate people to seek new experiences, act independently and enhance their own personal interests, while are in conflict with values of conservation and self-transcendence. The opposite holds for other food related attitudes and behaviours like involvement with cooking and variety in diet. The findings seem to be of particular interest not only for marketers of food products, but also for food policy makers. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. Revealing source signatures in ambient BTEX concentrations

    International Nuclear Information System (INIS)

    Zalel, Amir; Yuval; Broday, David M.

    2008-01-01

    Management of ambient concentrations of Volatile Organic Compounds (VOCs) is essential for maintaining low ozone levels in urban areas where its formation is under a VOC-limited regime. The significant decrease in traffic-induced VOC emissions in many developed countries resulted in relatively comparable shares of traffic and non-traffic VOC emissions in urban airsheds. A key step for urban air quality management is allocating ambient VOC concentrations to their pertinent sources. This study presents an approach that can aid in identifying sources that contribute to observed BTEX concentrations in areas characterized by low BTEX concentrations, where traditional source apportionment techniques are not useful. Analysis of seasonal and diurnal variations of ambient BTEX concentrations from two monitoring stations located in distinct areas reveal the possibility to identify source categories. Specifically, the varying oxidation rates of airborne BTEX compounds are used to allocate contributions of traffic emissions and evaporative sources to observed BTEX concentrations. - BTEX sources are identified from temporal variations of ambient concentration

  14. VISTA Reveals the Secret of the Unicorn

    Science.gov (United States)

    2010-10-01

    A new infrared image from ESO's VISTA survey telescope reveals an extraordinary landscape of glowing tendrils of gas, dark clouds and young stars within the constellation of Monoceros (the Unicorn). This star-forming region, known as Monoceros R2, is embedded within a huge dark cloud. The region is almost completely obscured by interstellar dust when viewed in visible light, but is spectacular in the infrared. An active stellar nursery lies hidden inside a massive dark cloud rich in molecules and dust in the constellation of Monoceros. Although it appears close in the sky to the more familiar Orion Nebula it is actually almost twice as far from Earth, at a distance of about 2700 light-years. In visible light a grouping of massive hot stars creates a beautiful collection of reflection nebulae where the bluish starlight is scattered from parts of the dark, foggy outer layers of the molecular cloud. However, most of the new-born massive stars remain hidden as the thick interstellar dust strongly absorbs their ultraviolet and visible light. In this gorgeous infrared image taken from ESO's Paranal Observatory in northern Chile, the Visible and Infrared Survey Telescope for Astronomy (VISTA [1], eso0949) penetrates the dark curtain of cosmic dust and reveals in astonishing detail the folds, loops and filaments sculpted from the dusty interstellar matter by intense particle winds and the radiation emitted by hot young stars. "When I first saw this image I just said 'Wow!' I was amazed to see all the dust streamers so clearly around the Monoceros R2 cluster, as well as the jets from highly embedded young stellar objects. There is such a great wealth of exciting detail revealed in these VISTA images," says Jim Emerson, of Queen Mary, University of London and leader of the VISTA consortium. With its huge field of view, large mirror and sensitive camera, VISTA is ideal for obtaining deep, high quality infrared images of large areas of the sky, such as the Monoceros R2 region

  15. On revealing graph cycles via boundary measurements

    International Nuclear Information System (INIS)

    Belishev, M I; Wada, N

    2009-01-01

    This paper deals with boundary value inverse problems on a metric graph, the structure of the graph being assumed unknown. The question under consideration is how to detect from the dynamical and/or spectral inverse data whether the graph contains cycles (is not a tree). For any graph Ω, the dynamical as well as spectral boundary inverse data determine the so-called wave diameter d w : H -1 (Ω) → R defined on functionals supported in the graph. The known fact is that if Ω is a tree then d w ≥ 0 holds and, in this case, the inverse data determine Ω up to isometry. A graph Ω is said to be coordinate if the functions {dist Ω (., γ)} γin∂Ω constitute a coordinate system on Ω. For such graphs, we propose a procedure, which reveals the presence/absence of cycles. The hypothesis is that Ω contains cycles if and only if d w takes negative values. We do not justify this hypothesis in the general case but reduce it to a certain special class of graphs (suns)

  16. Sequence tagging reveals unexpected modifications in toxicoproteomics

    Science.gov (United States)

    Dasari, Surendra; Chambers, Matthew C.; Codreanu, Simona G.; Liebler, Daniel C.; Collins, Ben C.; Pennington, Stephen R.; Gallagher, William M.; Tabb, David L.

    2010-01-01

    Toxicoproteomic samples are rich in posttranslational modifications (PTMs) of proteins. Identifying these modifications via standard database searching can incur significant performance penalties. Here we describe the latest developments in TagRecon, an algorithm that leverages inferred sequence tags to identify modified peptides in toxicoproteomic data sets. TagRecon identifies known modifications more effectively than the MyriMatch database search engine. TagRecon outperformed state of the art software in recognizing unanticipated modifications from LTQ, Orbitrap, and QTOF data sets. We developed user-friendly software for detecting persistent mass shifts from samples. We follow a three-step strategy for detecting unanticipated PTMs in samples. First, we identify the proteins present in the sample with a standard database search. Next, identified proteins are interrogated for unexpected PTMs with a sequence tag-based search. Finally, additional evidence is gathered for the detected mass shifts with a refinement search. Application of this technology on toxicoproteomic data sets revealed unintended cross-reactions between proteins and sample processing reagents. Twenty five proteins in rat liver showed signs of oxidative stress when exposed to potentially toxic drugs. These results demonstrate the value of mining toxicoproteomic data sets for modifications. PMID:21214251

  17. Featured Image: Revealing Hidden Objects with Color

    Science.gov (United States)

    Kohler, Susanna

    2018-02-01

    Stunning color astronomical images can often be the motivation for astronomers to continue slogging through countless data files, calculations, and simulations as we seek to understand the mysteries of the universe. But sometimes the stunning images can, themselves, be the source of scientific discovery. This is the case with the below image of Lynds Dark Nebula 673, located in the Aquila constellation, that was captured with the Mayall 4-meter telescope at Kitt Peak National Observatory by a team of scientists led by Travis Rector (University of Alaska Anchorage). After creating the image with a novel color-composite imaging method that reveals faint H emission (visible in red in both images here), Rector and collaborators identified the presence of a dozen new Herbig-Haro objects small cloud patches that are caused when material is energetically flung out from newly born stars. The image adapted above shows three of the new objects, HH 118789, aligned with two previously known objects, HH 32 and 332 suggesting they are driven by the same source. For more beautiful images and insight into the authors discoveries, check out the article linked below!Full view of Lynds Dark Nebula 673. Click for the larger view this beautiful composite image deserves! [T.A. Rector (University of Alaska Anchorage) and H. Schweiker (WIYN and NOAO/AURA/NSF)]CitationT. A. Rector et al 2018 ApJ 852 13. doi:10.3847/1538-4357/aa9ce1

  18. Feather corticosterone reveals developmental stress in seabirds.

    Science.gov (United States)

    Will, Alexis P; Suzuki, Yuya; Elliott, Kyle H; Hatch, Scott A; Watanuki, Yutaka; Kitaysky, Alexander S

    2014-07-01

    In nest-bound avian offspring, food shortages typically trigger a release of the stress hormone corticosterone (CORT). Recent studies indicate that CORT is passively deposited in the tissue of growing feathers and thus may provide an integrated measure of stress incurred during development in the nest. The current hypothesis predicts that, assuming a constant rate of feather growth, elevated CORT circulating in the blood corresponds to higher levels of CORT in feather tissue, but experimental evidence for nutritionally stressed chicks is lacking. Here, we examined how food limitation affects feather CORT content in the rhinoceros auklet (Cerorhinca moncerata). We (i) used captive chicks reared on control versus restricted diets, and (ii) applied this technique to free-living chicks with unknown nutritional histories that fledged at three separate colonies. We found that (i) feather growth was not affected by experimentally induced nutritional stress; (ii) captive chicks raised on a restricted diet had higher levels of CORT in their primary feathers; (iii) feather CORT deposition is a sensitive method of detecting nutritional stress; and (iv) free-living fledglings from the colony with poor reproductive performance had higher CORT in their primary feathers. We conclude that feather CORT is a sensitive integrated measure revealing the temporal dynamics of food limitations experienced by rhinoceros auklet nestlings. The use of feather CORT may be a powerful endocrine tool in ecological and evolutionary studies of bird species with similar preferential allocation of limited resources to feather development. © 2014. Published by The Company of Biologists Ltd.

  19. [Polymyalgia rheumatica revealing a lung cancer].

    Science.gov (United States)

    Cocquempot, K; Defuentes, G; Duron-Martineau, S; Berets, O; Vaylet, F; Margery, J

    2013-01-01

    Polymyalgia rheumatica is an inflammatory condition belonging to the connective tissue diseases, which occurs quite frequently in the elderly. Previously, cases have been reported in association with malignant tumours, in a synchronous fashion or prior to the appearance of the cancer. In these cases, the polymyalgia rheumatica is considered to be a paraneoplastic syndrome. We report the cases of a 63-year-old woman and a 58-year-old man with severe proximal girdle pain associated to a high-level of systemic inflammatory markers and a diagnosis of polymyalgia rheumatica was made. In the face of a lack of ineffectiveness of analgesic and anti-inflammatory treatments, an intensive investigation was undertaken which in both cases revealed an adenocarcinoma of the lung. The rheumatic manifestations responded well to chemotherapy targeting the lung tumour. We present here a review of the literature to give prominence to the diagnostic pitfalls that can occur around paraneoplastic polymyalgia rheumatica. The presence of therapeutic resistance at the onset of treatment and other atypical features may suggest the presence of an occult malignancy. Copyright © 2012 SPLF. Published by Elsevier Masson SAS. All rights reserved.

  20. Radio Telescopes Reveal Unseen Galactic Cannibalism

    Science.gov (United States)

    2008-06-01

    Radio-telescope images have revealed previously-unseen galactic cannibalism -- a triggering event that leads to feeding frenzies by gigantic black holes at the cores of galaxies. Astronomers have long suspected that the extra-bright cores of spiral galaxies called Seyfert galaxies are powered by supermassive black holes consuming material. However, they could not see how the material is started on its journey toward the black hole. Optical/Radio Comparison Visible-light (left) and radio (right) image of galaxy pair: Radio image shows gas streaming between galaxies. CREDIT: Kuo et al., NRAO/AUI/NSF Click on image for more graphics. One leading theory said that Seyfert galaxies have been disturbed by close encounters with neighboring galaxies, thus stirring up their gas and bringing more of it within the gravitational reach of the black hole. However, when astronomers looked at Seyferts with visible-light telescopes, only a small fraction showed any evidence of such an encounter. Now, new images of hydrogen gas in Seyferts made using the National Science Foundation's Very Large Array (VLA) radio telescope show the majority of them are, in fact, disturbed by ongoing encounters with neighbor galaxies. "The VLA lifted the veil on what's really happening with these galaxies," said Cheng-Yu Kuo, a graduate student at the University of Virginia. "Looking at the gas in these galaxies clearly showed that they are snacking on their neighbors. This is a dramatic contrast with their appearance in visible starlight," he added. The effect of the galactic encounters is to send gas and dust toward the black hole and produce energy as the material ultimately is consumed. Black holes, concentrations of matter so dense that not even light can escape their gravitational pull, reside at the cores of many galaxies. Depending on how rapidly the black hole is eating, the galaxy can show a wide range of energetic activity. Seyfert galaxies have the mildest version of this activity, while

  1. Revealing household characteristics from smart meter data

    International Nuclear Information System (INIS)

    Beckel, Christian; Sadamori, Leyna; Staake, Thorsten; Santini, Silvia

    2014-01-01

    Utilities are currently deploying smart electricity meters in millions of households worldwide to collect fine-grained electricity consumption data. We present an approach to automatically analyzing this data to enable personalized and scalable energy efficiency programs for private households. In particular, we develop and evaluate a system that uses supervised machine learning techniques to automatically estimate specific “characteristics” of a household from its electricity consumption. The characteristics are related to a household's socio-economic status, its dwelling, or its appliance stock. We evaluate our approach by analyzing smart meter data collected from 4232 households in Ireland at a 30-min granularity over a period of 1.5 years. Our analysis shows that revealing characteristics from smart meter data is feasible, as our method achieves an accuracy of more than 70% over all households for many of the characteristics and even exceeds 80% for some of the characteristics. The findings are applicable to all smart metering systems without making changes to the measurement infrastructure. The inferred knowledge paves the way for targeted energy efficiency programs and other services that benefit from improved customer insights. On the basis of these promising results, the paper discusses the potential for utilities as well as policy and privacy implications. - Highlights: • Many household characteristics can be automatically inferred from smart meter data. • We develop a system to infer employment status and number of occupants, for instance. • We evaluate our system analyzing data collected from 4232 households in Ireland. • The insights enable personalized and scalable efficiency campaigns for utilities. • Energy efficiency measures must be complemented by privacy protection

  2. Microradiometers Reveal Ocean Health, Climate Change

    Science.gov (United States)

    2013-01-01

    When NASA researcher Stanford Hooker is in the field, he pays close attention to color. For Hooker, being in the field means being at sea. On one such research trip to the frigid waters of the Arctic, with a Coast Guard icebreaker looming nearby and the snow-crusted ice shelf a few feet away, Hooker leaned over the edge of his small boat and lowered a tethered device into the bright turquoise water, a new product devised by a NASA partner and enabled by a promising technology for oceanographers and atmospheric scientists alike. Color is a function of light. Pure water is clear, but the variation in color observed during a visit to the beach or a flight along a coastline depends on the water s depth and the constituents in it, how far down the light penetrates and how it is absorbed and scattered by dissolved and suspended material. Hooker cares about ocean color because of what it can reveal about the health of the ocean, and in turn, the health of our planet. "The main thing we are interested in is the productivity of the water," Hooker says. The seawater contains phytoplankton, microscopic plants, which are the food base for the ocean s ecosystems. Changes in the water s properties, whether due to natural seasonal effects or human influence, can lead to problems for delicate ecosystems such as coral reefs. Ocean color can inform researchers about the quantities and distribution of phytoplankton and other materials, providing clues as to how the world ocean is changing. NASA s Coastal Zone Color Scanner, launched in 1978, was the first ocean color instrument flown on a spacecraft. Since then, the Agency s ocean color research capabilities have become increasingly sophisticated with the launch of the SeaWiFS instrument in 1997 and the twin MODIS instruments carried into orbit on NASA s Terra (1999) and Aqua (2002) satellites. The technology provides sweeping, global information on ocean color on a scale unattainable by any other means. One issue that arises from

  3. Abrasive supply for ancient Egypt revealed

    International Nuclear Information System (INIS)

    Peltz, C.; Bichler, M.

    2008-01-01

    In the framework of the major research scheme 'Synchronization of Civilizations in the Eastern Mediterranean Region in the 2nd Millennium B.C' instrumental neutron activation analysis (INAA) was used to determine 30 elements in pumice from archaeological excavations to reveal their specific volcanic origin. In ancient time, the widespread pumiceous products of several eruptions in the Aegean region have been used as abrasive tools and were therefore popular trade objects. The correlation of such archaeological findings to a specific eruption of known age would therefore allow to certify a maximum age of the respective stratum ('dating by first appearance'). Pumices from the Aegean region can easily be distinguished by their trace element distribution patterns. This has been shown by previous studies of the group. The elements Al, Ba, Ca, Ce, Co, Cr, Cs, Dy, Eu, Fe, Hf, K, La, Lu, Mn, Na, Nd, Rb, Sb, Sc, Sm, Ta, Tb, Th, Ti, U, V, Yb, Zr and Zn were determined in 16 samples of pumice lumps from excavations in Tell-el-Dab'a and Tell-el-Herr (Egypt). Two irradiation cycles and five measurement runs were applied. To show the accuracy of the results obtained, typical samples of the most important pumice sources in the Aegean region, particularly from Milos, Nisyros, Kos and Thera were analyzed together with the Egyptian samples of unknown origin. A reliable identification of the samples is achieved by comparing these results to the database compiled in previous studies. The geographical positions of these islands are shown. Within the error range, most of the elements determined in typical representatives of Milos, Nisyros, Kos and Santorini were in perfect agreement with values from the literature. On the basis of the Cluster graphics presented, it is possible to relate unknown pumice to its primary source, just by comparing the relation of a few elements, like Ta-Eu and Th-Hf. One concludes that all samples except one can be related to the Minoan eruption of Thera

  4. Dramatic Outburst Reveals Nearest Black Hole

    Science.gov (United States)

    2000-01-01

    Sgr. The radio observations revealed the presence of a jet escaping from the system at mind-boggling speeds. Only three other galactic X-ray stellar systems have been found to eject material at such speeds. They have been dubbed "microquasars" because, on a smaller scale, they resemble quasars, which lie at the hearts of distant galaxies and also spew out high-velocity jets of particles. In galaxy-core quasars, the black holes are millions of times more massive than the Sun; in the more nearby microquasars the black holes are roughly three to twenty times more massive than the Sun. The extremely high velocity of the jets suggests that their origin lies close to the event horizon of a black hole. Microquasar activity is thought to arise when the black hole in the binary system draws material away from its companion star. The material surrounding the black hole forms a rapidly spinning disk called an accretion disk. This disk is heated by friction to millions of degrees, causing it to emit X-rays. As spiralling gas moves into the gravity well of the black hole, it moves faster and faster. Magnetic fields in the disk are believed to expel the charged subatomic particles at speeds close to that of light. As the charged particles interact with the magnetic fields, they emit radio waves. If some of the material escapes by being magnetically expelled into space, the matter may continue moving at the tremendous speed it had attained near the black hole. After their ejection, the jets of particles expand and cool, fading from astronomers' view. V4641 Sgr excites astronomers because it is close and because it acted so differently from other microquasars. In other microquasars, outbursts have dimmed more slowly over weeks or months rather than hours. "There's something fundamentally different about this one; it's more extreme than any other example," Hjellming said. "And because this system happens to be so close to us, `it is very likely that there are more objects like V4641

  5. Chandra Data Reveal Rapidly Whirling Black Holes

    Science.gov (United States)

    2008-01-01

    A new study using results from NASA's Chandra X-ray Observatory provides one of the best pieces of evidence yet that many supermassive black holes are spinning extremely rapidly. The whirling of these giant black holes drives powerful jets that pump huge amounts of energy into their environment and affects galaxy growth. A team of scientists compared leading theories of jets produced by rotating supermassive black holes with Chandra data. A sampling of nine giant galaxies that exhibit large disturbances in their gaseous atmospheres showed that the central black holes in these galaxies must be spinning at near their maximum rates. People Who Read This Also Read... NASA’s Swift Satellite Catches First Supernova in The Act of Exploding Black Holes Have Simple Feeding Habits Jet Power and Black Hole Assortment Revealed in New Chandra Image Erratic Black Hole Regulates Itself "We think these monster black holes are spinning close to the limit set by Einstein's theory of relativity, which means that they can drag material around them at close to the speed of light," said Rodrigo Nemmen, a visiting graduate student at Penn State University, and lead author of a paper on the new results presented at American Astronomical Society in Austin, Texas. The research reinforces other, less direct methods previously used which have indicated that some stellar and supermassive black holes are spinning rapidly. According to Einstein's theory, a rapidly spinning black hole makes space itself rotate. This effect, coupled with gas spiraling toward the black hole, can produce a rotating, tightly wound vertical tower of magnetic field that flings a large fraction of the inflowing gas away from the vicinity of the black hole in an energetic, high-speed jet. Computer simulations by other authors have suggested that black holes may acquire their rapid spins when galaxies merge, and through the accretion of gas from their surroundings. "Extremely fast spin might be very common for large

  6. Analysis of human reticulocyte genes reveals altered erythropoiesis: potential use to detect recombinant human erythropoietin doping.

    Science.gov (United States)

    Varlet-Marie, Emmanuelle; Audran, Michel; Lejeune, Mireille; Bonafoux, Béatrice; Sicart, Marie-Therese; Marti, Jacques; Piquemal, David; Commes, Thérèse

    2004-08-01

    Enhancement of oxygen delivery to tissues is associated with improved sporting performance. One way of enhancing oxygen delivery is to take recombinant human erythropoietin (rHuEpo), which is an unethical and potentially dangerous practice. However, detection of the use of rHuEpo remains difficult in situations such as: i) several days after the end of treatment ii) when a treatment with low doses is conducted iii) if the rHuEpo effect is increased by other substances. In an attempt to detect rHuEpo abuse, we selected erythroid gene markers from a SAGE library and analyzed the effects of rHuEpo administration on expression of the HBB, FTL and OAZ genes. Ten athletes were assigned to the rHuEpo or placebo group. The rHuEpo group received subcutaneous injections of rHuEpo (50 UI/kg three times a week, 4 weeks; 20 UI/kg three times a week, 2 weeks). HBB, FTL and OAZ gene profiles were monitored by real time-polymerase chain reaction (PCR) quantification during and for 3 weeks after drug administration. The global analysis of these targeted genes detected in whole blood samples showed a characteristic profile of subjects misusing rHuEpo with a increase above the threshold levels. The individual analysis of OAZ mRNA seemed indicative of rHuEpo treatment. The performance-enhancing effect of rHuEpo treatment is greater than the duration of hematologic changes associated with rHuEpo misuse. Although direct electrophoretic methods to detect rHuEpo have been developed, recombinant isoforms of rHuEpo are not detectable some days after the last subcutaneous injection. To overcome these limitations indirect OFF models have been developed. Our data suggest that, in the near future, it will be possible to consolidate results achievable with the OFF models by analyzing selected erythroid gene markers as a supplement to indirect methods.

  7. Facial cellulitis revealing choreo-acanthocytosis: A case report ...

    African Journals Online (AJOL)

    We report a 62 year-old-man with facial cellulitis revealing choreo-acanthocytosis (ChAc). He showed chorea that started 20 years ago. The orofacial dyskinisia with tongue and cheek biting resulted in facial cellulitis. The peripheral blood smear revealed acanthocytosis of 25%. The overall of chorea, orofacial dyskinetic ...

  8. Comparative mapping reveals similar linkage of functional genes to ...

    Indian Academy of Sciences (India)

    genes between O. sativa and B. napus may have consistent function and control similar traits, which may be ..... acea chromosomes reveals islands of conserved organization. ... 1998 Conserved structure and function of the Arabidopsis flow-.

  9. Paraneoplastic syndromes revealing ovarian teratoma in young and ...

    African Journals Online (AJOL)

    Paraneoplastic syndromes revealing ovarian teratoma in young and menopausal women: report of two cases. Majdouline Boujoual, Ihsan Hakimi, Farid Kassidi, Youssef Akhoudad, Nawal Sahel, Adil Rkiouak, Mohamed Allaoui, Hafsa Chahdi, Mohamed Oukabli, Jaouad Kouach, Driss Rahali Moussaoui, Mohamed ...

  10. DNA markers reveal genetic structure and localized diversity of ...

    African Journals Online (AJOL)

    uqhdesma

    2016-10-12

    Oct 12, 2016 ... STRUCTURE analysis revealed 4 clusters of genetically ..... 10000 cycles and 50000 Markov Chain Monte Carlo (MCMC) iterations and 10 replicate runs performed for each K value to ..... WL, Lee M, Porter K (2000). Genetic ...

  11. Demand effects of consumers’ stated and revealed preferences

    OpenAIRE

    Engström, Per; Forsell, Eskil

    2013-01-01

    Knowledge of how consumers react to different quality signals is fundamental for understanding how markets work. We study the online market- place for Android apps where we compare the causal effects on demand from two quality related signals; other consumers' stated and revealed preferences toward an app. Our main result is that consumers are much more responsive to other consumers' revealed preferences, compared to others' stated preferences. A 10 percentile increase in displayed average ra...

  12. Characteristics of the tomato chromoplast revealed by proteomic analysis

    OpenAIRE

    Barsan, Cristina; Sanchez-Bel, Paloma; Rombaldi, César Valmor; Egea, Isabel; Rossignol, Michel; Kuntz, Marcel; Zouine, Mohamed; Latché, Alain; Bouzayen, Mondher; Pech, Jean-Claude

    2010-01-01

    Chromoplasts are non-photosynthetic specialized plastids that are important in ripening tomato fruit (Solanum lycopersicum) since, among other functions, they are the site of accumulation of coloured compounds. Analysis of the proteome of red fruit chromoplasts revealed the presence of 988 proteins corresponding to 802 Arabidopsis unigenes, among which 209 had not been listed so far in plastidial databanks. These data revealed several features of the chromoplast. Proteins of lipid metabolism ...

  13. UTV Expansion Pack: Special-Purpose Rank-Revealing Algorithms

    DEFF Research Database (Denmark)

    Fierro, Ricardo D.; Hansen, Per Christian

    2005-01-01

    This collection of Matlab 7.0 software supplements and complements the package UTV Tools from 1999, and includes implementations of special-purpose rank-revealing algorithms developed since the publication of the original package. We provide algorithms for computing and modifying symmetric rank-r...... values of a sparse or structured matrix. These new algorithms have applications in signal processing, optimization and LSI information retrieval.......This collection of Matlab 7.0 software supplements and complements the package UTV Tools from 1999, and includes implementations of special-purpose rank-revealing algorithms developed since the publication of the original package. We provide algorithms for computing and modifying symmetric rank......-revealing VSV decompositions, we expand the algorithms for the ULLV decomposition of a matrix pair to handle interference-type problems with a rank-deficient covariance matrix, and we provide a robust and reliable Lanczos algorithm which - despite its simplicity - is able to capture all the dominant singular...

  14. Camelid genomes reveal evolution and adaptation to desert environments.

    Science.gov (United States)

    Wu, Huiguang; Guang, Xuanmin; Al-Fageeh, Mohamed B; Cao, Junwei; Pan, Shengkai; Zhou, Huanmin; Zhang, Li; Abutarboush, Mohammed H; Xing, Yanping; Xie, Zhiyuan; Alshanqeeti, Ali S; Zhang, Yanru; Yao, Qiulin; Al-Shomrani, Badr M; Zhang, Dong; Li, Jiang; Manee, Manee M; Yang, Zili; Yang, Linfeng; Liu, Yiyi; Zhang, Jilin; Altammami, Musaad A; Wang, Shenyuan; Yu, Lili; Zhang, Wenbin; Liu, Sanyang; Ba, La; Liu, Chunxia; Yang, Xukui; Meng, Fanhua; Wang, Shaowei; Li, Lu; Li, Erli; Li, Xueqiong; Wu, Kaifeng; Zhang, Shu; Wang, Junyi; Yin, Ye; Yang, Huanming; Al-Swailem, Abdulaziz M; Wang, Jun

    2014-10-21

    Bactrian camel (Camelus bactrianus), dromedary (Camelus dromedarius) and alpaca (Vicugna pacos) are economically important livestock. Although the Bactrian camel and dromedary are large, typically arid-desert-adapted mammals, alpacas are adapted to plateaus. Here we present high-quality genome sequences of these three species. Our analysis reveals the demographic history of these species since the Tortonian Stage of the Miocene and uncovers a striking correlation between large fluctuations in population size and geological time boundaries. Comparative genomic analysis reveals complex features related to desert adaptations, including fat and water metabolism, stress responses to heat, aridity, intense ultraviolet radiation and choking dust. Transcriptomic analysis of Bactrian camels further reveals unique osmoregulation, osmoprotection and compensatory mechanisms for water reservation underpinned by high blood glucose levels. We hypothesize that these physiological mechanisms represent kidney evolutionary adaptations to the desert environment. This study advances our understanding of camelid evolution and the adaptation of camels to arid-desert environments.

  15. Burned-out seminoma revealed by solitary rib bone metastasis

    Energy Technology Data Exchange (ETDEWEB)

    Nishisho, Toshihiko; Miyagi, Ryo; Sairyo, Koichi [Tokushima University Graduate School, Department of Orthopedics, Institute of Biomedical Sciences, Tokushima-city, Tokushima (Japan); Sakaki, Mika [Saitama Medical University International Medical Center, Department of Pathology, Hidaka-city, Saitama (Japan); Takao, Shoichiro [Tokushima University Graduate School, Department of Radiology, Institute of Biomedical Sciences, Tokushima-city, Tokushima (Japan)

    2017-10-15

    Burned-out tumor is a rare phenomenon in which a testicular tumor regresses in the primary lesion and progresses in a metastatic lesion. We report the case of a 30-year-old male with burned-out seminoma revealed by open biopsy of solitary 10th rib bone metastasis. He underwent inguinal orchiectomy, which revealed hyalinization, indicating a spontaneously regressed testicular tumor. Chemotherapy for seminoma was administered in three cycles of bleomycin + etoposide + cisplatin therapy. The chemotherapy was effective, and wide resection of the rib was subsequently performed. No postoperative chemotherapy was performed, and there has been no evidence of recurrence for 3 years postoperatively. (orig.)

  16. [Postnatal diagnosis of gastric volvulus revealing congenital diaphragmatic hernia].

    Science.gov (United States)

    Aprahamian, A; Nouyrigat, V; Grévent, D; Hervieux, E; Chéron, G

    2017-05-01

    Postnatally diagnosed congenital diaphragmatic hernias (CDH) are rare and have a better prognosis than those diagnosed prenatally. Postnatal symptoms can be respiratory, digestive, or mixed. Gastric volvulus can reveal CDH. Symptoms are pain, abdominal distension, and/or vomiting. Upper gastrointestinal barium X-ray radiography provides the diagnosis. Prognosis is related to early surgical management in complicated forms with intestinal occlusion or sub-occlusion. We report on an infant who presented with vomiting, which revealed gastric volvulus associated with a CDH. Progression was favorable after surgical treatment. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  17. ID-check: Online concealed information test reveals true identity

    NARCIS (Netherlands)

    Verschuere, B.; Kleinberg, B.

    2016-01-01

    The Internet has already changed people's lives considerably and is likely to drastically change forensic research. We developed a web-based test to reveal concealed autobiographical information. Initial studies identified a number of conditions that affect diagnostic efficiency. By combining these

  18. Intratumor Heterogeneity and Branched Evolution Revealed by Multiregion Sequencing

    DEFF Research Database (Denmark)

    Gerlinger, Marco; Rowan, Andrew J.; Horswell, Stuart

    2012-01-01

    .RESULTS: Phylogenetic reconstruction revealed branched evolutionary tumor growth, with 63 to 69% of all somatic mutations not detectable across every tumor region. Intratumor heterogeneity was observed for a mutation within an autoinhibitory domain of the mammalian target of rapamycin (mTOR) kinase, correlating with S6...

  19. Revealing gene action for production characteristics by inbreeding ...

    African Journals Online (AJOL)

    Revealing gene action for production characteristics by inbreeding, based on a long-term selection ... The gene action involved in the expression of production characters was investigated, using the effect of the theoretical inbreeding ..... and predicted selection responses for growth, fat and lean traits in mice. J. Anim. Sci.

  20. An acute adrenal insufficiency revealing pituitary metastases of lung ...

    African Journals Online (AJOL)

    A 69-year-old men presented with vomiting, low blood pressure and hypoglycemia. Hormonal exploration confirmed a hypopituitarism. Appropriate therapy was initiated urgently. The hypothalamic-pituitary MRI showed a pituitary hypertrophy, a nodular thickening of the pituitary stalk. The chest X Rays revealed pulmonary ...

  1. The microbiome of Brazilian mangrove sediments as revealed by metagenomics

    NARCIS (Netherlands)

    Andreote, Fernando Dini; Jiménez Avella, Diego; Chaves, Diego; Dias, Armando Cavalcante Franco; Luvizotto, Danice Mazzer; Dini-Andreote, Francisco; Fasanella, Cristiane Cipola; Lopez, Maryeimy Varon; Baena, Sandra; Taketani, Rodrigo Gouvêa; de Melo, Itamar Soares

    2012-01-01

    Here we embark in a deep metagenomic survey that revealed the taxonomic and potential metabolic pathways aspects of mangrove sediment microbiology. The extraction of DNA from sediment samples and the direct application of pyrosequencing resulted in approximately 215 Mb of data from four distinct

  2. Species Richness and Diversity Reveal that Human-Modified ...

    African Journals Online (AJOL)

    Family diversity and richness showed no significant differences across the sites. The spider species consisted of primarily three functional groups: ground wanderers, web builders and plant wanderers, and showed no within-group differences in abundance between sites. Similarity index between the study sites revealed a ...

  3. Landmark Study Reveals Antarctic Glacier's Long History of Retreat

    OpenAIRE

    Kuska, Dale M.

    2016-01-01

    Faculty Showcase Archive Article Approved for public release; distribution is unlimited. A major study, released in late November in the journal “Nature,” reveals the history of retreat of the massive Pine Island Glacier (PIG) in western Antarctica, widely considered one of the largest contributors to global sea-level rise.

  4. Extensive translational regulation during seed germination revealed by polysomal profiling

    NARCIS (Netherlands)

    Bai, Bing; Peviani, Alessia; Horst, van der Sjors; Gamm, Magdalena; Snel, Berend; Bentsink, Leónie; Hanson, Johannes

    2017-01-01

    This work investigates the extent of translational regulation during seed germination. The polysome occupancy of each gene is determined by genome-wide profiling of total mRNA and polysome-associated mRNA. This reveals extensive translational regulation during Arabidopsis thaliana seed

  5. Quantitative phosphoproteomics reveals widespread full phosphorylation site occupancy during mitosis

    DEFF Research Database (Denmark)

    Miller, Martin Lee; Brunak, Søren; Olsen, JV

    2010-01-01

    and phosphorylation sites were grouped according to their cell cycle kinetics and compared to publicly available messenger RNA microarray data. Most detected phosphorylation sites and more than 20% of all quantified proteins showed substantial regulation, mainly in mitotic cells. Kinase-motif analysis revealed global...

  6. Chemical milling solution reveals stress corrosion cracks in titanium alloy

    Science.gov (United States)

    Braski, D. N.

    1967-01-01

    Solution of hydrogen flouride, hydrogen peroxide, and water reveals hot salt stress corrosion cracks in various titanium alloys. After the surface is rinsed in water, dried, and swabbed with the solution, it can be observed by the naked eye or at low magnification.

  7. Structure defects in malachite revealed by positron annihilation

    International Nuclear Information System (INIS)

    Geffroy, B.; Diallo, I.; Paulin, R.

    1984-01-01

    Positron lifetime is measured between 77 and 400 K in two malachite samples with different mineralogical structures. The complex spectrum found in zoned malachite reveals a microporosity which remains stable in this range of temperature. Besides, above 200 K, equilibrium defects appear. Their formation energy is estimated to be Esub(f) = 0.27 +- 0.02 eV [fr

  8. Structure defects in malachite revealed by positron annihilation

    Energy Technology Data Exchange (ETDEWEB)

    Geffroy, B; Diallo, I; Paulin, R [Institut National des Sciences et Techniques Nucleaires, CEN/Saclay, 91 - Gif-sur-Yvette (France)

    1984-01-01

    Positron lifetime is measured between 77 and 400 K in two malachite samples with different mineralogical structures. The complex spectrum found in zoned malachite reveals a microporosity which remains stable in this range of temperature. Besides, above 200 K, equilibrium defects appear. Their formation energy is estimated to be Esub(f) = 0.27 +- 0.02 eV.

  9. Seasonal succession in zooplankton feeding traits reveals trophic trait coupling

    DEFF Research Database (Denmark)

    Kenitz, Kasia; Visser, Andre; Mariani, Patrizio

    2017-01-01

    non-motile cells flourishing in spring and motile community dominating during summer. The zooplankton community is dominated by active feeding-current feeders with peak biomass in the late spring declining during summer. The model reveals how zooplankton grazing reinforces protist plankton seasonal...

  10. Integrated genomics of Mucorales reveals novel therapeutic targets

    Science.gov (United States)

    Mucormycosis is a life-threatening infection caused by Mucorales fungi. We sequenced 30 fungal genomes and performed transcriptomics with three representative Rhizopus and Mucor strains with human airway epithelial cells during fungal invasion to reveal key host and fungal determinants contributing ...

  11. Adaptation to High Ethanol Reveals Complex Evolutionary Pathways.

    Directory of Open Access Journals (Sweden)

    Karin Voordeckers

    2015-11-01

    Full Text Available Tolerance to high levels of ethanol is an ecologically and industrially relevant phenotype of microbes, but the molecular mechanisms underlying this complex trait remain largely unknown. Here, we use long-term experimental evolution of isogenic yeast populations of different initial ploidy to study adaptation to increasing levels of ethanol. Whole-genome sequencing of more than 30 evolved populations and over 100 adapted clones isolated throughout this two-year evolution experiment revealed how a complex interplay of de novo single nucleotide mutations, copy number variation, ploidy changes, mutator phenotypes, and clonal interference led to a significant increase in ethanol tolerance. Although the specific mutations differ between different evolved lineages, application of a novel computational pipeline, PheNetic, revealed that many mutations target functional modules involved in stress response, cell cycle regulation, DNA repair and respiration. Measuring the fitness effects of selected mutations introduced in non-evolved ethanol-sensitive cells revealed several adaptive mutations that had previously not been implicated in ethanol tolerance, including mutations in PRT1, VPS70 and MEX67. Interestingly, variation in VPS70 was recently identified as a QTL for ethanol tolerance in an industrial bio-ethanol strain. Taken together, our results show how, in contrast to adaptation to some other stresses, adaptation to a continuous complex and severe stress involves interplay of different evolutionary mechanisms. In addition, our study reveals functional modules involved in ethanol resistance and identifies several mutations that could help to improve the ethanol tolerance of industrial yeasts.

  12. Genetic and biochemical evidences reveal novel insights into the ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 41; Issue 4. Genetic and biochemical evidences reveal novel insights into the mechanism underlying Saccharomyces cerevisiae Sae2-mediated abrogation of DNA replication stress. INDRAJEET GHODKE K MUNIYAPPA. ARTICLE Volume 41 Issue 4 December 2016 pp ...

  13. Mitochondrial and nuclear DNA reveals a complete lineage sorti ng ...

    African Journals Online (AJOL)

    Glossogobius callidus exhibits broad salinity tolerance and is distributed in both estuarine and freshwater environments in southern Africa. Previous studies revealed substantial morphological and molecular variation among populations, suggesting they constitute a species complex. The present study utilised phylogenetic ...

  14. Intracranial Hemorrhage Revealing Pseudohypoparathyroidism as a Cause of Fahr Syndrome

    Directory of Open Access Journals (Sweden)

    Abhijit Swami

    2011-01-01

    Full Text Available Pseudohypoparathyroidism is an infrequently encountered disease. It is one of the causes of Fahr syndrome which also is a rare clinical entity caused by multiple diseases. A 4-year-old man hospitalized for sudden onset left hemiparesis and hypertension was diagnosed to have right thalamic and midbrain hemorrhage on plain CT scan of the head which also revealed co-existent extensive intracranial calcifications involving the basal ganglia and cerebellum bilaterally. General physical examination revealed features of Albright hereditary osteodystrophy, goitre, hypertension, left hemiparesis, and signs of cerebellar dysfunction. Laboratory findings suggested hypocalcemia, hyperphosphatemia along with high TSH, low FT4, low FT3, and high anti-TPO antibody. Though bilateral intracranial calcifications are usually encountered as an incidental radiological finding in the CT scan of brain, in this case, the patient admitted for thalamic and midbrain hemorrhage was on investigation for associated intracranial calcification, and goitre was also found to have coexisting pseudohypoparathyroidism and autoimmune hypothyroidism.

  15. Tax Policy Trends: Republicans Reveal Proposed Tax Overhaul

    Directory of Open Access Journals (Sweden)

    Philip Bazel

    2017-10-01

    Full Text Available REPUBLICANS REVEAL PROPOSED TAX OVERHAUL The White House and Congressional Republicans have revealed their much-anticipated proposal for reform of the U.S. personal and corporate tax systems. The proposal titled, “UNIFIED FRAMEWORK FOR FIXING OUR BROKEN TAX CODE” outlines a number of central policy changes, which will significantly alter the U.S. corporate tax system. The proposal includes a top federal marginal rate reduction for the sole proprietorships, partnerships and S corporation—small business equivalents— from 39.6% to 25% (state income tax rates would no longer be deductible. Large corporations would also see a meaningful federal rate reduction given the proposed drop in the federal corporate income tax rate from 35% to 20%. Additionally, the proposal includes a generous temporary measure intended to stimulate investment, full capital expensing for machinery with a partial limitation of interest deductions.

  16. Obscure pulmonary masses: bronchial impaction revealed by CT

    International Nuclear Information System (INIS)

    Pugatch, R.D.; Gale, M.E.

    1983-01-01

    Dilated bronchi impacted with mucus or tumor are recognized on standard chest radiographs because they are surrounded by aerated pulmonary parenchyma. When imaged in different projections, these lesions produce a variety of appearances that are generally familiar. This report characterizes less familiar computed tomographic (CT) findings in eight patients with pathologic bronchial distension of congenital, neoplastic, or infectious etiologies and correlates them with chest films. In seven patients, CT readily revealed dilated bronchi and/or regional lung hypodensity. In four of these cases, CT led to the initial suspicion of dilated bronchi. CT should be used early in the evaluation of atypical pulmonary mass lesions or to confirm suspected bronchial impaction because of the high probability it will reveal diagnostic features

  17. What proverb understanding reveals about how people think.

    Science.gov (United States)

    Gibbs, R W; Beitel, D

    1995-07-01

    The ability to understand proverbial sayings, such as a rolling stone gathers no moss, has been of great interest to researchers in many areas of psychology. Most psychologists assume that understanding the figurative meanings of proverbs requires various kinds of higher order cognitive abilities. The authors review the findings on proverb interpretation to examine the question of what proverb use and understanding reveals about the ways normal and dysfunctional individuals think. The widely held idea that failure to provide a figurative interpretation of a proverb necessarily reflects a deficit in specialized abstract thinking is rejected. Moreover, the ability to correctly explain what a proverb means does not necessarily imply that an individual can think abstractly. Various empirical evidence, nonetheless, suggests that the ability to understand many proverbs reveals the presence of metaphorical schemes that are ubiquitous in everyday thought.

  18. Acting without seeing: eye movements reveal visual processing without awareness.

    Science.gov (United States)

    Spering, Miriam; Carrasco, Marisa

    2015-04-01

    Visual perception and eye movements are considered to be tightly linked. Diverse fields, ranging from developmental psychology to computer science, utilize eye tracking to measure visual perception. However, this prevailing view has been challenged by recent behavioral studies. Here, we review converging evidence revealing dissociations between the contents of perceptual awareness and different types of eye movement. Such dissociations reveal situations in which eye movements are sensitive to particular visual features that fail to modulate perceptual reports. We also discuss neurophysiological, neuroimaging, and clinical studies supporting the role of subcortical pathways for visual processing without awareness. Our review links awareness to perceptual-eye movement dissociations and furthers our understanding of the brain pathways underlying vision and movement with and without awareness. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Digital tissue and what it may reveal about the brain.

    Science.gov (United States)

    Morgan, Josh L; Lichtman, Jeff W

    2017-10-30

    Imaging as a means of scientific data storage has evolved rapidly over the past century from hand drawings, to photography, to digital images. Only recently can sufficiently large datasets be acquired, stored, and processed such that tissue digitization can actually reveal more than direct observation of tissue. One field where this transformation is occurring is connectomics: the mapping of neural connections in large volumes of digitized brain tissue.

  20. Focus Groups to Reveal Parents' Needs for Prenatal Education

    OpenAIRE

    Dumas, Louise

    2002-01-01

    Focus group interviews are a useful qualitative research technique to obtain data from small groups about their opinions, attitudes, and/or feelings on a given subject. This particular technique has been used in Western Quebec in order to reveal the opinions, needs, and feelings of health professionals and future parents concerning prenatal education. As part of the region's priorities for 2002, all future parents in this part of the province were to be offered prenatal, government-paid, comm...

  1. Parascapular mass revealing primary tuberculosis of the posterior arch

    Science.gov (United States)

    Arbault, Anais; Ornetti, Paul; Chevallier, Olivier; Avril, Julien; Pottecher, Pierre

    2016-01-01

    We report the case of a parascapular abscess revealing primary tuberculosis of the posterior arch in a 31-year-old man. Sectional imaging is essential in order to detect the different lesions of this atypical spinal tuberculosis as osteolysis of the posterior arch extendible to vertebral body, osteocondensation, epidural extension which is common in this location, and high specificity of a zygapophysial, costo-vertebral or transverse arthritis. PMID:27709081

  2. [Colonic duplication revealed by intestinal obstruction due to fecal impaction].

    Science.gov (United States)

    Azahouani, A; Hida, M; Benhaddou, H

    2015-12-01

    Colonic duplications are very rare in children. With rectal duplications, they are the rarest locations of alimentary tract duplications, most often diagnosed in the first years of life. We report an unusual case of colic duplication with fecal impaction in a 9-month-old boy revealed by intestinal obstruction. We discuss the main diagnostic and therapeutic aspects of this malformation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  3. 'Big bang' of B-cell development revealed.

    Science.gov (United States)

    Murre, Cornelis

    2018-01-15

    Earlier studies have identified transcription factors that specify B-cell fate, but the underlying mechanisms remain to be revealed. Two new studies by Miyai and colleagues (pp. 112-126) and Li and colleagues (pp. 96-111) in this issue of Genes & Development provide new and unprecedented insights into the genetic and epigenetic mechanisms that establish B-cell identity. © 2018 Murre; Published by Cold Spring Harbor Laboratory Press.

  4. Transient light-induced intracellular oxidation revealed by redox biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Kolossov, Vladimir L., E-mail: viadimer@illinois.edu [Institute for Genomic Biology, University of Illinois at Urbana-Champaign, 1206 W. Gregory Drive, Urbana, IL 61801 (United States); Beaudoin, Jessica N. [Institute for Genomic Biology, University of Illinois at Urbana-Champaign, 1206 W. Gregory Drive, Urbana, IL 61801 (United States); Department of Animal Sciences, University of Illinois at Urbana-Champaign, 1207 W. Gregory Drive, Urbana, IL 61801 (United States); Hanafin, William P. [Institute for Genomic Biology, University of Illinois at Urbana-Champaign, 1206 W. Gregory Drive, Urbana, IL 61801 (United States); DiLiberto, Stephen J. [Institute for Genomic Biology, University of Illinois at Urbana-Champaign, 1206 W. Gregory Drive, Urbana, IL 61801 (United States); Department of Animal Sciences, University of Illinois at Urbana-Champaign, 1207 W. Gregory Drive, Urbana, IL 61801 (United States); Kenis, Paul J.A. [Institute for Genomic Biology, University of Illinois at Urbana-Champaign, 1206 W. Gregory Drive, Urbana, IL 61801 (United States); Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign, 600 S. Mathews Avenue, Urbana, IL 61801 (United States); Rex Gaskins, H. [Institute for Genomic Biology, University of Illinois at Urbana-Champaign, 1206 W. Gregory Drive, Urbana, IL 61801 (United States); Department of Animal Sciences, University of Illinois at Urbana-Champaign, 1207 W. Gregory Drive, Urbana, IL 61801 (United States); Department of Pathobiology, University of Illinois at Urbana-Champaign, 2001 S. Lincoln Avenue, Urbana, IL 61801 (United States); Division of Nutritional Sciences, University of Illinois at Urbana-Champaign, 905 S. Goodwin Avenue, Urbana, IL 61801 (United States)

    2013-10-04

    Highlights: •Time-resolved live cell imaging revealed light-induced oxidation. •Only the roGFP probe fused with glutaredoxin reveals photooxidation. •The transient oxidation is rapidly reduced by the cytosolic antioxidant system. •Intracellular photooxidation is media-dependent. •Oxidation is triggered exclusively by exposure to short wavelength excitation. -- Abstract: We have implemented a ratiometric, genetically encoded redox-sensitive green fluorescent protein fused to human glutaredoxin (Grx1-roGFP2) to monitor real time intracellular glutathione redox potentials of mammalian cells. This probe enabled detection of media-dependent oxidation of the cytosol triggered by short wavelength excitation. The transient nature of light-induced oxidation was revealed by time-lapse live cell imaging when time intervals of less than 30 s were implemented. In contrast, transient ROS generation was not observed with the parental roGFP2 probe without Grx1, which exhibits slower thiol-disulfide exchange. These data demonstrate that the enhanced sensitivity of the Grx1-roGFP2 fusion protein enables the detection of short-lived ROS in living cells. The superior sensitivity of Grx1-roGFP2, however, also enhances responsiveness to environmental cues introducing a greater likelihood of false positive results during image acquisition.

  5. Transient light-induced intracellular oxidation revealed by redox biosensor

    International Nuclear Information System (INIS)

    Kolossov, Vladimir L.; Beaudoin, Jessica N.; Hanafin, William P.; DiLiberto, Stephen J.; Kenis, Paul J.A.; Rex Gaskins, H.

    2013-01-01

    Highlights: •Time-resolved live cell imaging revealed light-induced oxidation. •Only the roGFP probe fused with glutaredoxin reveals photooxidation. •The transient oxidation is rapidly reduced by the cytosolic antioxidant system. •Intracellular photooxidation is media-dependent. •Oxidation is triggered exclusively by exposure to short wavelength excitation. -- Abstract: We have implemented a ratiometric, genetically encoded redox-sensitive green fluorescent protein fused to human glutaredoxin (Grx1-roGFP2) to monitor real time intracellular glutathione redox potentials of mammalian cells. This probe enabled detection of media-dependent oxidation of the cytosol triggered by short wavelength excitation. The transient nature of light-induced oxidation was revealed by time-lapse live cell imaging when time intervals of less than 30 s were implemented. In contrast, transient ROS generation was not observed with the parental roGFP2 probe without Grx1, which exhibits slower thiol-disulfide exchange. These data demonstrate that the enhanced sensitivity of the Grx1-roGFP2 fusion protein enables the detection of short-lived ROS in living cells. The superior sensitivity of Grx1-roGFP2, however, also enhances responsiveness to environmental cues introducing a greater likelihood of false positive results during image acquisition

  6. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells

    OpenAIRE

    Van Handel, Ben; Prashad, Sacha L.; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I.; Mikkola, Hanna K. A.

    2010-01-01

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in fir...

  7. Epigenetic and molecular profiles of erythroid cells after hydroxyurea treatment in sickle cell anemia

    Science.gov (United States)

    Steward, Shirley; Howard, Thad A.; Mortier, Nicole; Smeltzer, Matthew; Wang, Yong-Dong; Ware, Russell E.

    2011-01-01

    Hydroxyurea has been shown to be efficacious for the treatment of sickle cell anemia (SCA), primarily through the induction of fetal hemoglobin (HbF). However, the exact mechanisms by which hydroxyurea can induce HbF remain incompletely defined, although direct transcriptional effects and altered cell cycle kinetics have been proposed. In this study, we investigated potential epigenetic and alternative molecular mechanisms of hydroxyurea-mediated HbF induction by examining methylation patterns within the Gγ-globin promoter and miRNA expression within primary CD71+ erythrocytes of patients with SCA, both at baseline before beginning hydroxyurea therapy and after reaching maximum tolerated dose (MTD). Using both cross-sectional analysis and paired-sample analysis, we found that the highly methylated Gγ-globin promoter was inversely correlated to baseline HbF levels, but only slightly altered by hydroxyurea treatment. Conversely, expression of several specific miRNAs was significantly increased after hydroxyurea treatment, and expression of miR-26b and miR-151-3p were both associated with HbF levels at MTD. The significant associations identified in these studies suggest that methylation may be important for regulation of baseline HbF, but not after hydroxyurea treatment, whereas changes in miRNA expression may be associated with hydroxyurea-mediated HbF induction. This study was registered at ClinicalTrials.gov (NCT00305175). PMID:21921042

  8. Erythroid-specific transcriptional changes in PBMCs from pulmonary hypertension patients.

    Directory of Open Access Journals (Sweden)

    Chris Cheadle

    Full Text Available Gene expression profiling of peripheral blood mononuclear cells (PBMCs is a powerful tool for the identification of surrogate markers involved in disease processes. The hypothesis tested in this study was that chronic exposure of PBMCs to a hypertensive environment in remodeled pulmonary vessels would be reflected by specific transcriptional changes in these cells.The transcript profiles of PBMCs from 30 idiopathic pulmonary arterial hypertension patients (IPAH, 19 patients with systemic sclerosis without pulmonary hypertension (SSc, 42 scleroderma-associated pulmonary arterial hypertensio patients (SSc-PAH, and 8 patients with SSc complicated by interstitial lung disease and pulmonary hypertension (SSc-PH-ILD were compared to the gene expression profiles of PBMCs from 41 healthy individuals. Multiple gene expression signatures were identified which could distinguish various disease groups from controls. One of these signatures, specific for erythrocyte maturation, is enriched specifically in patients with PH. This association was validated in multiple published datasets. The erythropoiesis signature was strongly correlated with hemodynamic measures of increasing disease severity in IPAH patients. No significant correlation of the same type was noted for SSc-PAH patients, this despite a clear signature enrichment within this group overall. These findings suggest an association of the erythropoiesis signature in PBMCs from patients with PH with a variable presentation among different subtypes of disease.In PH, the expansion of immature red blood cell precursors may constitute a response to the increasingly hypoxic conditions prevalent in this syndrome. A correlation of this erythrocyte signature with more severe hypertension cases may provide an important biomarker of disease progression.

  9. Tyrosine kinase receptor RON functions downstream of the erythropoietin receptor to induce expansion of erythroid progenitors

    NARCIS (Netherlands)

    van den Akker, Emile; van Dijk, Thamar; Parren-van Amelsvoort, Martine; Grossmann, Katja S.; Schaeper, Ute; Toney-Earley, Kenya; Waltz, Susan E.; Löwenberg, Bob; von Lindern, Marieke

    2004-01-01

    Erythropoietin (EPO) is required for cell survival during differentiation and for progenitor expansion during stress erythropoiesis. Although signaling pathways may couple directly to docking sites on the EPO receptor (EpoR), additional docking molecules expand the signaling platform of the

  10. Revealed Comparative Advantage of Services in Cariforum Countries

    Directory of Open Access Journals (Sweden)

    Marie Freckleton

    2014-09-01

    Full Text Available A pesar de la importancia de las exportaciones de servicios a los países del CARIFORUM no hay muchos estudios sobre de la competitividad de las exportaciones. Este artículo examina la ventaja comparativa revelada de las exportaciones de servicios de los países del CARIFORUM. El análisis muestra que la mayoría de los países del CARIFORUM han puesto de manifiesto las ventajas comparativas en el turismo, pero también hay casos de ventaja comparativa revelada en otros servicios como transporte, seguros y servicios empresariales, servicios personales, culturales y recreativos. Los resultados sugieren que existe un potencial de CARIFORUM para diversificar las exportaciones de servicios con el fin de pro-mover el crecimiento económico y reducir la vulnerabilidad. Sin embargo, en la medida en que los países del CARIFORUM pueden tomar ventaja de las oportunidades existentes de acceso al Mercado de los servicios depende de su capacidad de mejorar la capacidad de oferta de servicios y promover la competitividad de los servicios. English: Despite the importance of services ex-ports to CARIFORUM countries there is limited research on the competitiveness of such exports. This article examines the revealed comparative advantage of services exports in CARIFORUM countries. The analysis shows that most CARIFORUM countries have revealed comparative advantage in tourism but there are also cases of revealed comparative advantage in other services including transport, insurance, business services and personal, cultural and recreational services. The results suggest that there is potential for CARIFORUM to diversify exports of services in order to promote economic growth and reduce vulnerability. However, the extent to which CARIFORUM countries can take advantage of existing market access opportunities for services depends on their ability to improve the capacity to supply services and to promote the competitiveness of services.

  11. Dislocation Interactions in Olivine Revealed by HR-EBSD

    Science.gov (United States)

    Wallis, David; Hansen, Lars N.; Britton, T. Ben; Wilkinson, Angus J.

    2017-10-01

    Interactions between dislocations potentially provide a control on strain rates produced by dislocation motion during creep of rocks at high temperatures. However, it has been difficult to establish the dominant types of interactions and their influence on the rheological properties of creeping rocks due to a lack of suitable observational techniques. We apply high-angular resolution electron backscatter diffraction to map geometrically necessary dislocation (GND) density, elastic strain, and residual stress in experimentally deformed single crystals of olivine. Short-range interactions are revealed by cross correlation of GND density maps. Spatial correlations between dislocation types indicate that noncollinear interactions may impede motion of proximal dislocations at temperatures of 1000°C and 1200°C. Long-range interactions are revealed by autocorrelation of GND density maps. These analyses reveal periodic variations in GND density and sign, with characteristic length scales on the order of 1-10 μm. These structures are spatially associated with variations in elastic strain and residual stress on the order of 10-3 and 100 MPa, respectively. Therefore, short-range interactions generate local accumulations of dislocations, leading to heterogeneous internal stress fields that influence dislocation motion over longer length scales. The impacts of these short- and/or long-range interactions on dislocation velocities may therefore influence the strain rate of the bulk material and are an important consideration for future models of dislocation-mediated deformation mechanisms in olivine. Establishing the types and impacts of dislocation interactions that occur across a range of laboratory and natural deformation conditions will help to establish the reliability of extrapolating laboratory-derived flow laws to real Earth conditions.

  12. Genes but not genomes reveal bacterial domestication of Lactococcus lactis.

    Directory of Open Access Journals (Sweden)

    Delphine Passerini

    Full Text Available BACKGROUND: The population structure and diversity of Lactococcus lactis subsp. lactis, a major industrial bacterium involved in milk fermentation, was determined at both gene and genome level. Seventy-six lactococcal isolates of various origins were studied by different genotyping methods and thirty-six strains displaying unique macrorestriction fingerprints were analyzed by a new multilocus sequence typing (MLST scheme. This gene-based analysis was compared to genomic characteristics determined by pulsed-field gel electrophoresis (PFGE. METHODOLOGY/PRINCIPAL FINDINGS: The MLST analysis revealed that L. lactis subsp. lactis is essentially clonal with infrequent intra- and intergenic recombination; also, despite its taxonomical classification as a subspecies, it displays a genetic diversity as substantial as that within several other bacterial species. Genome-based analysis revealed a genome size variability of 20%, a value typical of bacteria inhabiting different ecological niches, and that suggests a large pan-genome for this subspecies. However, the genomic characteristics (macrorestriction pattern, genome or chromosome size, plasmid content did not correlate to the MLST-based phylogeny, with strains from the same sequence type (ST differing by up to 230 kb in genome size. CONCLUSION/SIGNIFICANCE: The gene-based phylogeny was not fully consistent with the traditional classification into dairy and non-dairy strains but supported a new classification based on ecological separation between "environmental" strains, the main contributors to the genetic diversity within the subspecies, and "domesticated" strains, subject to recent genetic bottlenecks. Comparison between gene- and genome-based analyses revealed little relationship between core and dispensable genome phylogenies, indicating that clonal diversification and phenotypic variability of the "domesticated" strains essentially arose through substantial genomic flux within the dispensable

  13. Malar Bone Metastasis Revealing a Papillary Thyroid Carcinoma

    Directory of Open Access Journals (Sweden)

    Ihsen Slim

    2012-01-01

    Full Text Available Papillary thyroid carcinoma is the most common form of differentiated thyroid carcinoma. It is generally confined to the neck with or without spread to regional lymph nodes. Metastatic thyroid carcinomas are uncommon and mainly include lung and bone. Metastases involving oral and maxillofacial region are extremely rare. We described a case of malar metastasis revealing a follicular variant of papillary thyroid carcinoma, presenting with pain and swelling of the left cheek in a 67-years-old female patient with an unspecified histological left lobo-isthmectomy medical history. To our knowledge, this is the first recorded instance of a malar metastasis from a follicular variant of papillary thyroid carcinoma.

  14. [Neonatal adrenal hemorrhage revealed by jaundice: a case report].

    Science.gov (United States)

    Oulmaati, A; Hays, S; Mory-Thomas, N; Bretones, P; Bensaid, M; Jordan, I; Bonfils, M; Godbert, I; Picaud, J-C

    2012-04-01

    The clinical presentation of adrenal hemorrhage varies, depending on the extent of hemorrhage as well as the amount of adrenal cortex involved by the hemorrhage. We report here a case of neonatal adrenal hemorrhage revealed by late onset of neonatal jaundice. This adrenal hemorrhage most probably resulted from shoulder dystocia. The aim of this work was to focus on the fact that jaundice can be caused by adrenal hemorrhage and to emphasize the crucial importance of abdominal ultrasound in cases of persistent jaundice. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  15. A Solitary Fibrous Tumor of the Pleura Revealed by Hiccups

    Directory of Open Access Journals (Sweden)

    A. Chafik

    2011-01-01

    Full Text Available Solitary fibrous tumors of the pleura are rare and benign primary localized tumors; they possess a malignant potential and thus should be excised. We report a case of a 43-year-old woman, who had suffered for 5 years from right basithoracic pain associated with progressive dyspnea and persistent hiccups during the last 6 months. We have not found any similar case in the literature. Further testing after excision by thoracotomy revealed a solitary fibrous pleural tumor. A brief discussion of the clinical presentation and incidence of these tumors is included.

  16. [Suicide -- an essay trying to reveal the theme].

    Science.gov (United States)

    Sampaio, M A; Boemer, M R

    2000-12-01

    This essay proposes to reveal facets of the suicide through the discourse of different authors treating this theme as well as through contacts that I was able to have in my nursing training, through my academic trajectory. This trajectory includes an incursion by phenomenological ideas, mainly by the ideas of Heidegger and his existential analysis of the man as being-there. In this way, the understanding of a person who decides to finalize his/her existence, can be, by the existential analysis perspective, a way to reconstruct and redimension his/her existential perspectives.

  17. Windows PowerShell desired state configuration revealed

    CERN Document Server

    Chaganti, Ravikanth

    2014-01-01

    Desired State Configuration (DSC) is a powerful new configuration management platform that makes it easier than ever to perform cross-platform configuration management of your infrastructure, whether on-premise or in the cloud. DSC provides the management platform and Application Programming Interface (API) that can be used with any programming language. Windows PowerShell Desired State Configuration Revealed will take you through this new technology from start to finish and demonstrates the DSC interfaces through Windows PowerShell. DSC allows you to manage target devices by simply declarin

  18. Megacity precipitationsheds reveal tele-connected water security challenges

    Science.gov (United States)

    Wang-Erlandsson, Lan; Gordon, Line J.

    2018-01-01

    Urbanization is a global process that has taken billions of people from the rural countryside to concentrated urban centers, adding pressure to existing water resources. Many cities are specifically reliant on renewable freshwater regularly refilled by precipitation, rather than fossil groundwater or desalination. A precipitationshed can be considered the “watershed of the sky” and identifies the origin of precipitation falling in a given region. In this paper, we use this concept to determine the sources of precipitation that supply renewable water in the watersheds of the largest cities of the world. We quantify the sources of precipitation for 29 megacities and analyze their differences between dry and wet years. Our results reveal that 19 of 29 megacities depend for more than a third of their water supply on evaporation from land. We also show that for many of the megacities, the terrestrial dependence is higher in dry years. This high dependence on terrestrial evaporation for their precipitation exposes these cities to potential land-use change that could reduce the evaporation that generates precipitation. Combining indicators of water stress, moisture recycling exposure, economic capacity, vegetation-regulated evaporation, land-use change, and dry-season moisture recycling sensitivity reveals four highly vulnerable megacities (Karachi, Shanghai, Wuhan, and Chongqing). A further six megacities were found to have medium vulnerability with regard to their water supply. We conclude that understanding how upwind landscapes affect downwind municipal water resources could be a key component for understanding the complexity of urban water security. PMID:29534109

  19. The new galaxy evolution paradigm revealed by the Herschel surveys

    Science.gov (United States)

    Eales, Stephen; Smith, Dan; Bourne, Nathan; Loveday, Jon; Rowlands, Kate; van der Werf, Paul; Driver, Simon; Dunne, Loretta; Dye, Simon; Furlanetto, Cristina; Ivison, R. J.; Maddox, Steve; Robotham, Aaron; Smith, Matthew W. L.; Taylor, Edward N.; Valiante, Elisabetta; Wright, Angus; Cigan, Philip; De Zotti, Gianfranco; Jarvis, Matt J.; Marchetti, Lucia; Michałowski, Michał J.; Phillipps, Steven; Viaene, Sebastien; Vlahakis, Catherine

    2018-01-01

    The Herschel Space Observatory has revealed a very different galaxyscape from that shown by optical surveys which presents a challenge for galaxy-evolution models. The Herschel surveys reveal (1) that there was rapid galaxy evolution in the very recent past and (2) that galaxies lie on a single Galaxy Sequence (GS) rather than a star-forming 'main sequence' and a separate region of 'passive' or 'red-and-dead' galaxies. The form of the GS is now clearer because far-infrared surveys such as the Herschel ATLAS pick up a population of optically red star-forming galaxies that would have been classified as passive using most optical criteria. The space-density of this population is at least as high as the traditional star-forming population. By stacking spectra of H-ATLAS galaxies over the redshift range 0.001 high stellar masses, high star-formation rates but, even several billion years in the past, old stellar populations - they are thus likely to be relatively recent ancestors of early-type galaxies in the Universe today. The form of the GS is inconsistent with rapid quenching models and neither the analytic bathtub model nor the hydrodynamical EAGLE simulation can reproduce the rapid cosmic evolution. We propose a new gentler model of galaxy evolution that can explain the new Herschel results and other key properties of the galaxy population.

  20. The microbiome of Brazilian mangrove sediments as revealed by metagenomics.

    Directory of Open Access Journals (Sweden)

    Fernando Dini Andreote

    Full Text Available Here we embark in a deep metagenomic survey that revealed the taxonomic and potential metabolic pathways aspects of mangrove sediment microbiology. The extraction of DNA from sediment samples and the direct application of pyrosequencing resulted in approximately 215 Mb of data from four distinct mangrove areas (BrMgv01 to 04 in Brazil. The taxonomic approaches applied revealed the dominance of Deltaproteobacteria and Gammaproteobacteria in the samples. Paired statistical analysis showed higher proportions of specific taxonomic groups in each dataset. The metabolic reconstruction indicated the possible occurrence of processes modulated by the prevailing conditions found in mangrove sediments. In terms of carbon cycling, the sequences indicated the prevalence of genes involved in the metabolism of methane, formaldehyde, and carbon dioxide. With respect to the nitrogen cycle, evidence for sequences associated with dissimilatory reduction of nitrate, nitrogen immobilization, and denitrification was detected. Sequences related to the production of adenylsulfate, sulfite, and H(2S were relevant to the sulphur cycle. These data indicate that the microbial core involved in methane, nitrogen, and sulphur metabolism consists mainly of Burkholderiaceae, Planctomycetaceae, Rhodobacteraceae, and Desulfobacteraceae. Comparison of our data to datasets from soil and sea samples resulted in the allotment of the mangrove sediments between those samples. The results of this study add valuable data about the composition of microbial communities in mangroves and also shed light on possible transformations promoted by microbial organisms in mangrove sediments.

  1. The microbiome of Brazilian mangrove sediments as revealed by metagenomics.

    Science.gov (United States)

    Andreote, Fernando Dini; Jiménez, Diego Javier; Chaves, Diego; Dias, Armando Cavalcante Franco; Luvizotto, Danice Mazzer; Dini-Andreote, Francisco; Fasanella, Cristiane Cipola; Lopez, Maryeimy Varon; Baena, Sandra; Taketani, Rodrigo Gouvêa; de Melo, Itamar Soares

    2012-01-01

    Here we embark in a deep metagenomic survey that revealed the taxonomic and potential metabolic pathways aspects of mangrove sediment microbiology. The extraction of DNA from sediment samples and the direct application of pyrosequencing resulted in approximately 215 Mb of data from four distinct mangrove areas (BrMgv01 to 04) in Brazil. The taxonomic approaches applied revealed the dominance of Deltaproteobacteria and Gammaproteobacteria in the samples. Paired statistical analysis showed higher proportions of specific taxonomic groups in each dataset. The metabolic reconstruction indicated the possible occurrence of processes modulated by the prevailing conditions found in mangrove sediments. In terms of carbon cycling, the sequences indicated the prevalence of genes involved in the metabolism of methane, formaldehyde, and carbon dioxide. With respect to the nitrogen cycle, evidence for sequences associated with dissimilatory reduction of nitrate, nitrogen immobilization, and denitrification was detected. Sequences related to the production of adenylsulfate, sulfite, and H(2)S were relevant to the sulphur cycle. These data indicate that the microbial core involved in methane, nitrogen, and sulphur metabolism consists mainly of Burkholderiaceae, Planctomycetaceae, Rhodobacteraceae, and Desulfobacteraceae. Comparison of our data to datasets from soil and sea samples resulted in the allotment of the mangrove sediments between those samples. The results of this study add valuable data about the composition of microbial communities in mangroves and also shed light on possible transformations promoted by microbial organisms in mangrove sediments.

  2. [Research reveals a market for a veterinary behaviour clinic].

    Science.gov (United States)

    Jonckheer-Sheehy, Valerie; Endenburg, Nienke

    2009-11-01

    An enquiry into the requirement of a university veterinary behaviour clinic in The Netherlands revealed that there is a clear call for such a service. The specific demands and wishes of first line practicing veterinarians and companion animal owners were investigated. The research revealed that veterinarians are regular confronted with behaviour problems in companion animals and that they are willing to refer these cases to the University. They also expressed their need for access to continuing professional development opportunities in the field of veterinary behavioural medicine (which is something that most veterinary behaviour clinics associated with veterinary faculties provide). The demand from companion animal owners was also examined. It can be concluded that a large number of them had animals with behaviour problems and that they were willing to seek veterinary advice on these matters. In response to the above mentioned demands the University of Utrecht will open a veterinary behaviour clinic, providing high quality service for animals, their owners and the referring veterinarians. This service will be based on sound scientific practice and delivered by both veterinarians specialised in this field and recognised animal behaviour therapists.

  3. King Lear Reveals the Tragic Pattern of Shakespeare

    Directory of Open Access Journals (Sweden)

    Salim Eflih Al-Ibia

    2017-04-01

    Full Text Available Rather than focusing on the obvious traditions of evaluating Shakespearean tragic heroes, this paper presents a groundbreaking approach to unfold the pattern William Shakespeare follows as he designed his unique characters. This pattern applies to most, if not all, Shakespearean tragic heroes. I argue that Shakespeare himself reveals a great portion of this pattern on the tongue of Lear as the latter disowns Goneril and Regan promising to have “such revenges on [them] both” in King Lear. Lear’s threats bestow four unique aspects that apply not only to his character but they also apply to Shakespearean tragic heroes. Lear’s speech tells us that he is determined to have an awful type of revenge on his daughters. However, the very same speech tells us that he seems uncertain about the method through which he should carry out this revenge. Lear does not express any type of remorse as he pursues his vengeful plans nor should he aim at amnesty. He also admits his own madness as he closes his revealing speech. This research develops these facts about Lear to unfold the unique pattern Shakespeare follows as he portrayed his major tragic figures. This pattern is examined, described and analyzed in King Lear, Othello, and Hamlet. We will find out that the pattern suggested in this study helps us better understand Shakespeare’s tragedies and enables us to provide better explanations for some controversial scenes in the tragedies discussed.

  4. Unilateral proptosis revealing a fronto-ethmoidal mucocele.

    Science.gov (United States)

    Lajmi, Houda; Hmaied, Wassim; Ben Jalel, Wady; Ben Romdhane, Khaoula; Chelly, Zied; El Fekih, Lamia

    2017-06-01

    Backgroud: The fronto-ethmoidal mucocele is a benign condition leading commonly to limited eye movement or ocular pain but it could also induce visual acuity impairment by compressing the optic nerve Aim: To discuss, through a case report, different ophthalmologic manifestations of the fronto-ethmoidalmucocele. Reported case: A 46-years-old man with no general history consulted for a bilateral ocular redness and itching. He reported, however, a mild protrusion of his left globe evolving for oneyear. The clinical examination revealed a unilateral proptosis in the left eye with a discrete limitation of theadduction. A brain and orbital computer tomography (CT)and a magnetic resonance imaging(MRI)revealed a grade I exophthalmos caused by an oval formation of fluid density in the left anterior and posterior ethmoidal cells in addition to the frontal sinus,driving theeyeball and internal oculomotor muscles back and out.The patient was referred to otorhinolaryngology department for a precocious surgical management. The ophtalmologic manifestations of the disease depend on the location, the size of the formation and involvement of adjacent structures. The loss of vision and the apex syndrome due to the compressionof the ocular globe are the most serious complications.

  5. Gaussian graphical modeling reveals specific lipid correlations in glioblastoma cells

    Science.gov (United States)

    Mueller, Nikola S.; Krumsiek, Jan; Theis, Fabian J.; Böhm, Christian; Meyer-Bäse, Anke

    2011-06-01

    Advances in high-throughput measurements of biological specimens necessitate the development of biologically driven computational techniques. To understand the molecular level of many human diseases, such as cancer, lipid quantifications have been shown to offer an excellent opportunity to reveal disease-specific regulations. The data analysis of the cell lipidome, however, remains a challenging task and cannot be accomplished solely based on intuitive reasoning. We have developed a method to identify a lipid correlation network which is entirely disease-specific. A powerful method to correlate experimentally measured lipid levels across the various samples is a Gaussian Graphical Model (GGM), which is based on partial correlation coefficients. In contrast to regular Pearson correlations, partial correlations aim to identify only direct correlations while eliminating indirect associations. Conventional GGM calculations on the entire dataset can, however, not provide information on whether a correlation is truly disease-specific with respect to the disease samples and not a correlation of control samples. Thus, we implemented a novel differential GGM approach unraveling only the disease-specific correlations, and applied it to the lipidome of immortal Glioblastoma tumor cells. A large set of lipid species were measured by mass spectrometry in order to evaluate lipid remodeling as a result to a combination of perturbation of cells inducing programmed cell death, while the other perturbations served solely as biological controls. With the differential GGM, we were able to reveal Glioblastoma-specific lipid correlations to advance biomedical research on novel gene therapies.

  6. Membrane Protein Properties Revealed through Data-Rich Electrostatics Calculations.

    Science.gov (United States)

    Marcoline, Frank V; Bethel, Neville; Guerriero, Christopher J; Brodsky, Jeffrey L; Grabe, Michael

    2015-08-04

    The electrostatic properties of membrane proteins often reveal many of their key biophysical characteristics, such as ion channel selectivity and the stability of charged membrane-spanning segments. The Poisson-Boltzmann (PB) equation is the gold standard for calculating protein electrostatics, and the software APBSmem enables the solution of the PB equation in the presence of a membrane. Here, we describe significant advances to APBSmem, including full automation of system setup, per-residue energy decomposition, incorporation of PDB2PQR, calculation of membrane-induced pKa shifts, calculation of non-polar energies, and command-line scripting for large-scale calculations. We highlight these new features with calculations carried out on a number of membrane proteins, including the recently solved structure of the ion channel TRPV1 and a large survey of 1,614 membrane proteins of known structure. This survey provides a comprehensive list of residues with large electrostatic penalties for being embedded in the membrane, potentially revealing interesting functional information. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Economic choices reveal probability distortion in macaque monkeys.

    Science.gov (United States)

    Stauffer, William R; Lak, Armin; Bossaerts, Peter; Schultz, Wolfram

    2015-02-18

    Economic choices are largely determined by two principal elements, reward value (utility) and probability. Although nonlinear utility functions have been acknowledged for centuries, nonlinear probability weighting (probability distortion) was only recently recognized as a ubiquitous aspect of real-world choice behavior. Even when outcome probabilities are known and acknowledged, human decision makers often overweight low probability outcomes and underweight high probability outcomes. Whereas recent studies measured utility functions and their corresponding neural correlates in monkeys, it is not known whether monkeys distort probability in a manner similar to humans. Therefore, we investigated economic choices in macaque monkeys for evidence of probability distortion. We trained two monkeys to predict reward from probabilistic gambles with constant outcome values (0.5 ml or nothing). The probability of winning was conveyed using explicit visual cues (sector stimuli). Choices between the gambles revealed that the monkeys used the explicit probability information to make meaningful decisions. Using these cues, we measured probability distortion from choices between the gambles and safe rewards. Parametric modeling of the choices revealed classic probability weighting functions with inverted-S shape. Therefore, the animals overweighted low probability rewards and underweighted high probability rewards. Empirical investigation of the behavior verified that the choices were best explained by a combination of nonlinear value and nonlinear probability distortion. Together, these results suggest that probability distortion may reflect evolutionarily preserved neuronal processing. Copyright © 2015 Stauffer et al.

  8. Enhanced limonene production in cyanobacteria reveals photosynthesis limitations.

    Science.gov (United States)

    Wang, Xin; Liu, Wei; Xin, Changpeng; Zheng, Yi; Cheng, Yanbing; Sun, Su; Li, Runze; Zhu, Xin-Guang; Dai, Susie Y; Rentzepis, Peter M; Yuan, Joshua S

    2016-12-13

    Terpenes are the major secondary metabolites produced by plants, and have diverse industrial applications as pharmaceuticals, fragrance, solvents, and biofuels. Cyanobacteria are equipped with efficient carbon fixation mechanism, and are ideal cell factories to produce various fuel and chemical products. Past efforts to produce terpenes in photosynthetic organisms have gained only limited success. Here we engineered the cyanobacterium Synechococcus elongatus PCC 7942 to efficiently produce limonene through modeling guided study. Computational modeling of limonene flux in response to photosynthetic output has revealed the downstream terpene synthase as a key metabolic flux-controlling node in the MEP (2-C-methyl-d-erythritol 4-phosphate) pathway-derived terpene biosynthesis. By enhancing the downstream limonene carbon sink, we achieved over 100-fold increase in limonene productivity, in contrast to the marginal increase achieved through stepwise metabolic engineering. The establishment of a strong limonene flux revealed potential synergy between photosynthate output and terpene biosynthesis, leading to enhanced carbon flux into the MEP pathway. Moreover, we show that enhanced limonene flux would lead to NADPH accumulation, and slow down photosynthesis electron flow. Fine-tuning ATP/NADPH toward terpene biosynthesis could be a key parameter to adapt photosynthesis to support biofuel/bioproduct production in cyanobacteria.

  9. Ananke: temporal clustering reveals ecological dynamics of microbial communities

    Directory of Open Access Journals (Sweden)

    Michael W. Hall

    2017-09-01

    Full Text Available Taxonomic markers such as the 16S ribosomal RNA gene are widely used in microbial community analysis. A common first step in marker-gene analysis is grouping genes into clusters to reduce data sets to a more manageable size and potentially mitigate the effects of sequencing error. Instead of clustering based on sequence identity, marker-gene data sets collected over time can be clustered based on temporal correlation to reveal ecologically meaningful associations. We present Ananke, a free and open-source algorithm and software package that complements existing sequence-identity-based clustering approaches by clustering marker-gene data based on time-series profiles and provides interactive visualization of clusters, including highlighting of internal OTU inconsistencies. Ananke is able to cluster distinct temporal patterns from simulations of multiple ecological patterns, such as periodic seasonal dynamics and organism appearances/disappearances. We apply our algorithm to two longitudinal marker gene data sets: faecal communities from the human gut of an individual sampled over one year, and communities from a freshwater lake sampled over eleven years. Within the gut, the segregation of the bacterial community around a food-poisoning event was immediately clear. In the freshwater lake, we found that high sequence identity between marker genes does not guarantee similar temporal dynamics, and Ananke time-series clusters revealed patterns obscured by clustering based on sequence identity or taxonomy. Ananke is free and open-source software available at https://github.com/beiko-lab/ananke.

  10. [Mutism and acute behavioral disorders revealing MELAS syndrome].

    Science.gov (United States)

    Coomans, H; Barroso, B; Bertandeau, E; Bonnan, M; Dakar, A; Demasles, S; Garraud, S; Krim, E; Martin-Négrier, M-L

    2011-11-01

    MELAS syndrome (mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes) is a rare genetic mitochondrial disease which can cause cerebral (cerebrovascular accident, migraine, mental deterioration..), sensorial (bilateral symmetrical deafness) and peripheral (muscular involvement, neuropathy) disorders potentially associated with diabetes, renal or cardiac disorders, or growth retardation. Eighty percent of the patients have the 3243 A>G mutation in the leucine RNA transfer gene. Clinical manifestations leading to discovery of the mutation can be extremely varied, affecting patients of different age groups. We report the case of a 49-year-old man who presented acute fits of confusion followed by mutism and praxic disorders. History taking revealed recently diagnosed type 2 diabetes, axonal neuropathy, and bilateral symmetrical deafness requiring hearing aids. The initial MRI showed FLAIR sequences with bi-parietal abnormalities, no signs of recent stroke on the DW/B10000 sequences, and basal ganglia calcifications. Blood tests and morphological findings ruled out a vascular origin. Search for lactic acidosis remained constantly negative in blood samples despite positive cerebrospinal fluid samples (N×3). The 3243 A>G mitochondrial DNA mutation was identified. The neuropsychological evaluation revealed a serious dysexecutive syndrome with a major impact on the patient's self sufficiency. Neurocognitive disorders are not common in MELAS syndrome. Brain MRI results and the presence of extra-neurological signs can be helpful for diagnosis. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  11. Differential metabolism of Mycoplasma species as revealed by their genomes

    Directory of Open Access Journals (Sweden)

    Fabricio B.M. Arraes

    2007-01-01

    Full Text Available The annotation and comparative analyses of the genomes of Mycoplasma synoviae and Mycoplasma hyopneumonie, as well as of other Mollicutes (a group of bacteria devoid of a rigid cell wall, has set the grounds for a global understanding of their metabolism and infection mechanisms. According to the annotation data, M. synoviae and M. hyopneumoniae are able to perform glycolytic metabolism, but do not possess the enzymatic machinery for citrate and glyoxylate cycles, gluconeogenesis and the pentose phosphate pathway. Both can synthesize ATP by lactic fermentation, but only M. synoviae can convert acetaldehyde to acetate. Also, our genome analysis revealed that M. synoviae and M. hyopneumoniae are not expected to synthesize polysaccharides, but they can take up a variety of carbohydrates via the phosphoenolpyruvate-dependent phosphotransferase system (PEP-PTS. Our data showed that these two organisms are unable to synthesize purine and pyrimidine de novo, since they only possess the sequences which encode salvage pathway enzymes. Comparative analyses of M. synoviae and M. hyopneumoniae with other Mollicutes have revealed differential genes in the former two genomes coding for enzymes that participate in carbohydrate, amino acid and nucleotide metabolism and host-pathogen interaction. The identification of these metabolic pathways will provide a better understanding of the biology and pathogenicity of these organisms.

  12. NeuCode Proteomics Reveals Bap1 Regulation of Metabolism

    Directory of Open Access Journals (Sweden)

    Joshua M. Baughman

    2016-07-01

    Full Text Available We introduce neutron-encoded (NeuCode amino acid labeling of mice as a strategy for multiplexed proteomic analysis in vivo. Using NeuCode, we characterize an inducible knockout mouse model of Bap1, a tumor suppressor and deubiquitinase whose in vivo roles outside of cancer are not well established. NeuCode proteomics revealed altered metabolic pathways following Bap1 deletion, including profound elevation of cholesterol biosynthetic machinery coincident with reduced expression of gluconeogenic and lipid homeostasis proteins in liver. Bap1 loss increased pancreatitis biomarkers and reduced expression of mitochondrial proteins. These alterations accompany a metabolic remodeling with hypoglycemia, hypercholesterolemia, hepatic lipid loss, and acinar cell degeneration. Liver-specific Bap1 null mice present with fully penetrant perinatal lethality, severe hypoglycemia, and hepatic lipid deficiency. This work reveals Bap1 as a metabolic regulator in liver and pancreas, and it establishes NeuCode as a reliable proteomic method for deciphering in vivo biology.

  13. A Survey of Electronic Serials Managers Reveals Diversity in Practice

    Directory of Open Access Journals (Sweden)

    Laura Costello

    2014-09-01

    Full Text Available A Review of: Branscome, B. A. (2013. Management of electronic serials in academic libraries: The results of an online survey. Serials Review, 39(4, 216-226. http://dx.doi.org/10.1016/j.serrev.2013.10.004 Abstract Objective – To examine industry standards for the management of electronic serials and measure the adoption of electronic serials over print. Design – Survey questionnaire. Setting – Email lists aimed at academic librarians working in serials management. Subjects – 195 self-selected subscribers to serials email lists. Methods – The author created a 20 question survey that consisted primarily of closed-ended questions pertaining to the collection demographics, staff, budget, and tools of serials management groups in academic libraries. The survey was conducted via Survey Monkey and examined using the analytical features of the tool. Participants remained anonymous and the survey questions did not ask them to reveal identifiable information about their libraries. Main Results – Collection demographics questions revealed that 78% of surveyed librarians estimated that print-only collections represented 40% or fewer of their serials holdings. The author observed diversity in the factors that influence print to digital transitions in academic libraries. However 71.5% of participants indicated that publisher technology support like IP authentication was required before adopting digital subscriptions. A lack of standardization also marked serials workflows, department responsibilities, and department titles. The author did not find a correlation between serials budget and the enrollment size of the institution. Participants reported that they used tools from popular serials management vendors like Serials Solutions, Innovative Interfaces, EBSCO, and Ex Libris, but most indicated that they used more than one tool for serials management. Participants specified 52 unique serials management products used in their libraries. Conclusion

  14. Diffusion Tensor Tractography Reveals Disrupted Structural Connectivity during Brain Aging

    Science.gov (United States)

    Lin, Lan; Tian, Miao; Wang, Qi; Wu, Shuicai

    2017-10-01

    Brain aging is one of the most crucial biological processes that entail many physical, biological, chemical, and psychological changes, and also a major risk factor for most common neurodegenerative diseases. To improve the quality of life for the elderly, it is important to understand how the brain is changed during the normal aging process. We compared diffusion tensor imaging (DTI)-based brain networks in a cohort of 75 healthy old subjects by using graph theory metrics to describe the anatomical networks and connectivity patterns, and network-based statistic (NBS) analysis was used to identify pairs of regions with altered structural connectivity. The NBS analysis revealed a significant network comprising nine distinct fiber bundles linking 10 different brain regions showed altered white matter structures in young-old group compare with middle-aged group (p < .05, family-wise error-corrected). Our results might guide future studies and help to gain a better understanding of brain aging.

  15. Principles of Chromosome Architecture Revealed by Hi-C.

    Science.gov (United States)

    Eagen, Kyle P

    2018-06-01

    Chromosomes are folded and compacted in interphase nuclei, but the molecular basis of this folding is poorly understood. Chromosome conformation capture methods, such as Hi-C, combine chemical crosslinking of chromatin with fragmentation, DNA ligation, and high-throughput DNA sequencing to detect neighboring loci genome-wide. Hi-C has revealed the segregation of chromatin into active and inactive compartments and the folding of DNA into self-associating domains and loops. Depletion of CTCF, cohesin, or cohesin-associated proteins was recently shown to affect the majority of domains and loops in a manner that is consistent with a model of DNA folding through extrusion of chromatin loops. Compartmentation was not dependent on CTCF or cohesin. Hi-C contact maps represent the superimposition of CTCF/cohesin-dependent and -independent folding states. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. The hand of birds revealed by early ostrich embryos

    Science.gov (United States)

    Feduccia, Alan; Nowicki, Julie

    2002-08-01

    The problem of resolving the homology of the digits of the avian hand has been framed as a conflict between paleontological and embryological evidence, the former thought to support a hand composed of digits I, II, III, because of similarity of the phalangeal formulae of the earliest known bird Archaeopteryx to that of Mesozoic pentadactyl archosaurs, while embryological evidence has traditionally favored a II, III, IV avian hand. We have identified the critical developmental period for the major features of the avian skeleton in a primitive bird, the ostrich. Analysis of digit anlagen in the avian hand has revealed those for digits/metacarpals I and V, thus confirming previous embryological studies that indirectly suggested that the avian hand comprises digits II, III, IV, and was primitively pentadactyl.

  17. Dinosaurs reveal the geographical signature of an evolutionary radiation.

    Science.gov (United States)

    O'Donovan, Ciara; Meade, Andrew; Venditti, Chris

    2018-03-01

    Dinosaurs dominated terrestrial ecosystems across the globe for over 100 million years and provide a classic example of an evolutionary radiation. However, little is known about how these animals radiated geographically to become globally distributed. Here, we use a biogeographical model to reconstruct the dinosaurs' ancestral locations, revealing the spatial mechanisms that underpinned this 170-million-year-long radiation. We find that dinosaurs spread rapidly initially, followed by a significant continuous and gradual reduction in their speed of movement towards the Cretaceous/Tertiary boundary (66 million years ago). This suggests that the predominant mode of dinosaur speciation changed through time with speciation originally largely driven by geographical isolation-when dinosaurs speciated more, they moved further. This was gradually replaced by increasing levels of sympatric speciation (species taking advantage of ecological opportunities within their existing environment) as terrestrial space became a limiting factor. Our results uncover the geographical signature of an evolutionary radiation.

  18. Bibliometric Analyses Reveal Patterns of Collaboration between ASMS Members

    Science.gov (United States)

    Palmblad, Magnus; van Eck, Nees Jan

    2018-03-01

    We have explored the collaborative network of the current American Society for Mass Spectrometry (ASMS) membership using bibliometric methods. The analysis shows that 4249 members are connected in a single, large, co-authorship graph, including the majority of the most published authors in the field of mass spectrometry. The map reveals topographical differences between university groups and national laboratories, and that the co-authors with the strongest links have long worked together at the same location. We have collected and summarized information on the geographical distribution of members, showing a high coverage of active researchers in North America and Western Europe. Looking at research fields, we could also identify a number of new or `hot' topics among ASMS members. Interactive versions of the maps are available on-line at https://goo.gl/UBNFMQ (collaborative network) and https://goo.gl/WV25vm (research topics). [Figure not available: see fulltext.

  19. [Clinical case of acute renal failure revealing an autoimmune hypothyroidism].

    Science.gov (United States)

    Montasser, Dina Ibrahim; Hassani, Mohamed; Zajjari, Yassir; Bahadi, Abdelali; Alayoud, Ahmed; Hamzi, Amine; Hassani, Kawtar; Moujoud, Omar; Asseraji, Mohamed; Kadiri, Moncif; Aatif, Taoufik; El Kabbaj, Driss; Benyahia, Mohamed; Allam, Mustapha; Akhmouch, Ismail; Oualim, Zouhir

    2010-04-01

    Although the clinic picture is often indicative of muscle manifestations in patients with hypothyroidism, signs and symptoms of this condition are variable from simple elevation of serum muscle enzymes with myalgia, muscle weakness, cramps to rhabdomyolysis with acute renal failure which remains a rare event. Thyroid hormones affect the function of almost every body organ, and thyroid dysfunction produces a wide range of metabolic disturbances. Hypothyroidism is associated with significant effects on the kidney which the pathophysiology seems to be multifactorial, but the exact mechanisms remain poorly understood. Hypothyroidism as a cause of renal impairment is usually overlooked, leading to unnecessary diagnostic procedures. The main objective of our observation is to report a case of acute renal failure revealing an autoimmune hypothyroidism in which thyroid hormone substitution led to a significant improvement in muscular, thyroid and renal disorders. Copyright 2010 Association Société de néphrologie. Published by Elsevier SAS. All rights reserved.

  20. Deciphering CAPTCHAs: what a Turing test reveals about human cognition.

    Directory of Open Access Journals (Sweden)

    Thomas Hannagan

    Full Text Available Turning Turing's logic on its head, we used widespread letter-based Turing Tests found on the internet (CAPTCHAs to shed light on human cognition. We examined the basis of the human ability to solve CAPTCHAs, where machines fail. We asked whether this is due to our use of slow-acting inferential processes that would not be available to machines, or whether fast-acting automatic orthographic processing in humans has superior robustness to shape variations. A masked priming lexical decision experiment revealed efficient processing of CAPTCHA words in conditions that rule out the use of slow inferential processing. This shows that the human superiority in solving CAPTCHAs builds on a high degree of invariance to location and continuous transforms, which is achieved during the very early stages of visual word recognition in skilled readers.

  1. Adipsic diabetes insipidus revealing a bifocal intracranial germinoma.

    Science.gov (United States)

    Kreutz, Julie; Potorac, Iulia; Lutteri, Laurence; Gennigens, Christine; Martin, Didier; Daly, Adrian F; Bonneville, Jean-Francois; Tshibanda, Luaba; Beckers, Albert

    2017-07-01

    Adipsic diabetes insipidus is a rare complication of intracranial tumors in which impaired antidiuretic hormone secretion is associated with the loss of thirst sensation. Here, we present the case of a patient with bifocal intracranial germinoma, diagnosed due to symptoms mainly caused by adipsic diabetes insipidus. This is, to our knowledge, the first case of adipsic diabetes insipidus revealing an intracranial germinoma reported in the literature. We describe the diagnostic procedures and the three-year follow-up of this patient. Management of intracranial germ-cell tumors is made complex by the wide range of histological features. Although germinomas have a generally better prognosis than most nongerminomatous tumors, they can have severe or even life-threatening presentations. Adipsic diabetes insipidus is one such severe presentation and its rarity can make it difficult to recognize and manage. Awareness of this potential entity is therefore important for clinical practice. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. Comparative genomics reveals insights into avian genome evolution and adaptation

    Science.gov (United States)

    Zhang, Guojie; Li, Cai; Li, Qiye; Li, Bo; Larkin, Denis M.; Lee, Chul; Storz, Jay F.; Antunes, Agostinho; Greenwold, Matthew J.; Meredith, Robert W.; Ödeen, Anders; Cui, Jie; Zhou, Qi; Xu, Luohao; Pan, Hailin; Wang, Zongji; Jin, Lijun; Zhang, Pei; Hu, Haofu; Yang, Wei; Hu, Jiang; Xiao, Jin; Yang, Zhikai; Liu, Yang; Xie, Qiaolin; Yu, Hao; Lian, Jinmin; Wen, Ping; Zhang, Fang; Li, Hui; Zeng, Yongli; Xiong, Zijun; Liu, Shiping; Zhou, Long; Huang, Zhiyong; An, Na; Wang, Jie; Zheng, Qiumei; Xiong, Yingqi; Wang, Guangbiao; Wang, Bo; Wang, Jingjing; Fan, Yu; da Fonseca, Rute R.; Alfaro-Núñez, Alonzo; Schubert, Mikkel; Orlando, Ludovic; Mourier, Tobias; Howard, Jason T.; Ganapathy, Ganeshkumar; Pfenning, Andreas; Whitney, Osceola; Rivas, Miriam V.; Hara, Erina; Smith, Julia; Farré, Marta; Narayan, Jitendra; Slavov, Gancho; Romanov, Michael N; Borges, Rui; Machado, João Paulo; Khan, Imran; Springer, Mark S.; Gatesy, John; Hoffmann, Federico G.; Opazo, Juan C.; Håstad, Olle; Sawyer, Roger H.; Kim, Heebal; Kim, Kyu-Won; Kim, Hyeon Jeong; Cho, Seoae; Li, Ning; Huang, Yinhua; Bruford, Michael W.; Zhan, Xiangjiang; Dixon, Andrew; Bertelsen, Mads F.; Derryberry, Elizabeth; Warren, Wesley; Wilson, Richard K; Li, Shengbin; Ray, David A.; Green, Richard E.; O’Brien, Stephen J.; Griffin, Darren; Johnson, Warren E.; Haussler, David; Ryder, Oliver A.; Willerslev, Eske; Graves, Gary R.; Alström, Per; Fjeldså, Jon; Mindell, David P.; Edwards, Scott V.; Braun, Edward L.; Rahbek, Carsten; Burt, David W.; Houde, Peter; Zhang, Yong; Yang, Huanming; Wang, Jian; Jarvis, Erich D.; Gilbert, M. Thomas P.; Wang, Jun

    2015-01-01

    Birds are the most species-rich class of tetrapod vertebrates and have wide relevance across many research fields. We explored bird macroevolution using full genomes from 48 avian species representing all major extant clades. The avian genome is principally characterized by its constrained size, which predominantly arose because of lineage-specific erosion of repetitive elements, large segmental deletions, and gene loss. Avian genomes furthermore show a remarkably high degree of evolutionary stasis at the levels of nucleotide sequence, gene synteny, and chromosomal structure. Despite this pattern of conservation, we detected many non-neutral evolutionary changes in protein-coding genes and noncoding regions. These analyses reveal that pan-avian genomic diversity covaries with adaptations to different lifestyles and convergent evolution of traits. PMID:25504712

  3. Heat islands over Mumbai as revealed by autorecorded thermograph data

    Science.gov (United States)

    Srivastava, A. K.; Voogt, James; Kshirsagar, S. R.; Srivastava, Kavita

    2016-02-01

    This study examined hourly temperature data of two locations of Mumbai metropolitan city. One data point (Coloba, Mumbai) is in centre of the city and the other one (Santacruz, Mumbai) is at the airport. The study finds that there were many occasions when night-time hourly temperatures over the city centre were considerably higher than that of the airport, even though temperature at the time of sunset at both the places was nearly same. In this study, the occasions, when hourly night-time temperature over city was more than that of the airport by objectively defined threshold value (3.0 ∘C in this study) for most of the hours in the night, were termed as heat island events. Analysis of the study reveals that these events are mostly confined to November-February months. The study also found that frequency of such events has doubled in recent two decades in comparison to the earlier two decades.

  4. High-frequency microrheology reveals cytoskeleton dynamics in living cells

    Science.gov (United States)

    Rigato, Annafrancesca; Miyagi, Atsushi; Scheuring, Simon; Rico, Felix

    2017-08-01

    Living cells are viscoelastic materials, dominated by an elastic response on timescales longer than a millisecond. On shorter timescales, the dynamics of individual cytoskeleton filaments are expected to emerge, but active microrheology measurements on cells accessing this regime are scarce. Here, we develop high-frequency microrheology experiments to probe the viscoelastic response of living cells from 1 Hz to 100 kHz. We report the viscoelasticity of different cell types under cytoskeletal drug treatments. On previously inaccessible short timescales, cells exhibit rich viscoelastic responses that depend on the state of the cytoskeleton. Benign and malignant cancer cells revealed remarkably different scaling laws at high frequencies, providing a unique mechanical fingerprint. Microrheology over a wide dynamic range--up to the frequency characterizing the molecular components--provides a mechanistic understanding of cell mechanics.

  5. Biosensor reveals multiple sources for mitochondrial NAD⁺.

    Science.gov (United States)

    Cambronne, Xiaolu A; Stewart, Melissa L; Kim, DongHo; Jones-Brunette, Amber M; Morgan, Rory K; Farrens, David L; Cohen, Michael S; Goodman, Richard H

    2016-06-17

    Nicotinamide adenine dinucleotide (NAD(+)) is an essential substrate for sirtuins and poly(adenosine diphosphate-ribose) polymerases (PARPs), which are NAD(+)-consuming enzymes localized in the nucleus, cytosol, and mitochondria. Fluctuations in NAD(+) concentrations within these subcellular compartments are thought to regulate the activity of NAD(+)-consuming enzymes; however, the challenge in measuring compartmentalized NAD(+) in cells has precluded direct evidence for this type of regulation. We describe the development of a genetically encoded fluorescent biosensor for directly monitoring free NAD(+) concentrations in subcellular compartments. We found that the concentrations of free NAD(+) in the nucleus, cytoplasm, and mitochondria approximate the Michaelis constants for sirtuins and PARPs in their respective compartments. Systematic depletion of enzymes that catalyze the final step of NAD(+) biosynthesis revealed cell-specific mechanisms for maintaining mitochondrial NAD(+) concentrations. Copyright © 2016, American Association for the Advancement of Science.

  6. [Thoracic aortic dissection revealed by systemic cholesterol embolism].

    Science.gov (United States)

    Braem, L; Paule, P; Héno, P; Morand, J J; Mafart, B; La Folie, T; Varlet, P; Mioulet, D; Fourcade, L

    2006-10-01

    Systemic cholesterol embolism is a rare complication of atherosclerosis, and has various presentations. Arterial catheterisms are a common cause. However, the association with an aortic dissection has been exceptionally reported. We report the observation of a 70 year-old man, with coronary artery disease, hypertension, diabetes and dyslipidemia. Six months before hospitalization, a coronary angioplasty was performed due to recurrent angina. The association of purpuric lesions on the feet, with acute renal failure confirmed cholesterol embolism syndrome. Transoesophageal echocardiography showed a dissection of the descending thoracic aorta associated with complex atheroma. The evolution was marked by the pulpar necrosis of a toe and by a worsening of the renal failure, requiring definitive hemodialysis. Further echographic control highlighted the rupture of the intimal veil of the dissection. Cholesterol embolism syndrome may reveal an aortic dissection in patients without thoracic symptoms. In such cases, transoesophageal echocardiography is a useful and non-invasive examination.

  7. Between Concealing and Revealing Intersexed Bodies: Parental Strategies.

    Science.gov (United States)

    Danon, Limor Meoded; Krämer, Anike

    2017-08-01

    Parents of intersex children are perceived in many studies as hopeless, highly dependent on the medical system, and as gate keepers of normative gendered bodies. In this article, we challenge these perceptions and argue that parents of intersex children are problematically positioned between their children's needs for care and well-being and the socialmedical forces that aim to "normalize" them. Their in-between position leads them to establish different parental strategies within and outside of traditional sex/gender norms. We focus on three intertwined parental strategy frameworks: bodily dialogue, sex/gender framing, and concealing/revealing practices, and describe how, in each of these strategic frameworks, the parents maneuver, act in accordance with or against, react to, and challenge the medical system, social interactions, and the sex/gender paradigm. This is a comparative study based on narrative interviews with 22 parents of intersex children in Germany and Israel.

  8. Metabolomics reveals metabolic biomarkers of Crohn's disease

    Energy Technology Data Exchange (ETDEWEB)

    Jansson, J.K.; Willing, B.; Lucio, M.; Fekete, A.; Dicksved, J.; Halfvarson, J.; Tysk, C.; Schmitt-Kopplin, P.

    2009-06-01

    The causes and etiology of Crohn's disease (CD) are currently unknown although both host genetics and environmental factors play a role. Here we used non-targeted metabolic profiling to determine the contribution of metabolites produced by the gut microbiota towards disease status of the host. Ion Cyclotron Resonance Fourier Transform Mass Spectrometry (ICR-FT/MS) was used to discern the masses of thousands of metabolites in fecal samples collected from 17 identical twin pairs, including healthy individuals and those with CD. Pathways with differentiating metabolites included those involved in the metabolism and or synthesis of amino acids, fatty acids, bile acids and arachidonic acid. Several metabolites were positively or negatively correlated to the disease phenotype and to specific microbes previously characterized in the same samples. Our data reveal novel differentiating metabolites for CD that may provide diagnostic biomarkers and/or monitoring tools as well as insight into potential targets for disease therapy and prevention.

  9. Revealing low-energy part of the beta spectra

    International Nuclear Information System (INIS)

    Selvi, S.; Celiktas, C.

    2002-01-01

    An effective method is proposed to separate electronic noise from the beta-particle spectra revealing lower energy part of the spectra. The available methods for reducing the noise problem cut the noise along with the low-energy part of the beta spectra by using a discriminator. Our setup eliminates this undesirable effect by shifting the noise toward the lowest energy scale leaving the low-energy part of spectra undisturbed. We achieved this noise-pulse-separation by treating the noise as a pulse so that we can exploit the application of the pulse-shape analyzer equipment used for pulse shape identification of particles and rejection of defective pulses. To the best of our knowledge this method of the noise separation is a novel approach

  10. Tyrannosauroid integument reveals conflicting patterns of gigantism and feather evolution.

    Science.gov (United States)

    Bell, Phil R; Campione, Nicolás E; Persons, W Scott; Currie, Philip J; Larson, Peter L; Tanke, Darren H; Bakker, Robert T

    2017-06-01

    Recent evidence for feathers in theropods has led to speculations that the largest tyrannosaurids, including Tyrannosaurus rex , were extensively feathered. We describe fossil integument from Tyrannosaurus and other tyrannosaurids ( Albertosaurus, Daspletosaurus, Gorgosaurus and Tarbosaurus ), confirming that these large-bodied forms possessed scaly, reptilian-like skin. Body size evolution in tyrannosauroids reveals two independent occurrences of gigantism; specifically, the large sizes in Yutyrannus and tyrannosaurids were independently derived. These new findings demonstrate that extensive feather coverings observed in some early tyrannosauroids were lost by the Albian, basal to Tyrannosauridae. This loss is unrelated to palaeoclimate but possibly tied to the evolution of gigantism, although other mechanisms exist. © 2017 The Author(s).

  11. Upper Palaeolithic Siberian genome reveals dual ancestry of Native Americans

    DEFF Research Database (Denmark)

    Raghavan, Maanasa; Skoglund, Pontus; Graf, Kelly E.

    2014-01-01

    ,000-year-old individual (MA-1), from Mal'ta in south-central Siberia, to an average depth of 1×. To our knowledge this is the oldest anatomically modern human genome reported to date. The MA-1 mitochondrial genome belongs to haplogroup U, which has also been found at high frequency among Upper Palaeolithic......The origins of the First Americans remain contentious. Although Native Americans seem to be genetically most closely related to east Asians, there is no consensus with regard to which specific Old World populations they are closest to. Here we sequence the draft genome of an approximately 24...... that the region was continuously occupied by humans throughout the Last Glacial Maximum. Our findings reveal that western Eurasian genetic signatures in modern-day Native Americans derive not only from post-Columbian admixture, as commonly thought, but also from a mixed ancestry of the First Americans....

  12. Core-level photoemission revealing the Mott transition

    International Nuclear Information System (INIS)

    Kim, Hyeong-Do; Noh, Han-Jin; Kim, K.H.; Oh, S.-J.

    2005-01-01

    Ru 3d core-level X-ray photoemission spectra of various ruthenates are examined. They show in general two-peak structures, which can be assigned as the screened and unscreened peaks. The screened peak is absent in a Mott insulator, but develops into a main peak as the correlation strength becomes weak. This spectral behavior is well explained by the dynamical mean-field theory calculation for the single-band Hubbard model with the on-site core-hole potential using the exact diagonalization method. The new mechanism of the core-level photoemission satellite can be utilized to reveal the Mott transition phenomenon in various strongly correlated electron systems

  13. Revealing Tripartite Quantum Discord with Tripartite Information Diagram

    Directory of Open Access Journals (Sweden)

    Wei-Ting Lee

    2017-11-01

    Full Text Available A new measure based on the tripartite information diagram is proposed for identifying quantum discord in tripartite systems. The proposed measure generalizes the mutual information underlying discord from bipartite to tripartite systems, and utilizes both one-particle and two-particle projective measurements to reveal the characteristics of the tripartite quantum discord. The feasibility of the proposed measure is demonstrated by evaluating the tripartite quantum discord for systems with states close to Greenberger–Horne–Zeilinger, W, and biseparable states. In addition, the connections between tripartite quantum discord and two other quantum correlations—namely genuine tripartite entanglement and genuine tripartite Einstein–Podolsky–Rosen steering—are briefly discussed. The present study considers the case of quantum discord in tripartite systems. However, the proposed framework can be readily extended to general N-partite systems.

  14. Single Turnover at Molecular Polymerization Catalysts Reveals Spatiotemporally Resolved Reactions.

    Science.gov (United States)

    Easter, Quinn T; Blum, Suzanne A

    2017-10-23

    Multiple active individual molecular ruthenium catalysts have been pinpointed within growing polynorbornene, thereby revealing information on the reaction dynamics and location that is unavailable through traditional ensemble experiments. This is the first single-turnover imaging of a molecular catalyst by fluorescence microscopy and allows detection of individual monomer reactions at an industrially important molecular ruthenium ring-opening metathesis polymerization (ROMP) catalyst under synthetically relevant conditions (e.g. unmodified industrial catalyst, ambient pressure, condensed phase, ca. 0.03 m monomer). These results further establish the key fundamentals of this imaging technique for characterizing the reactivity and location of active molecular catalysts even when they are the minor components. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. ID-Check: Online Concealed Information Test Reveals True Identity.

    Science.gov (United States)

    Verschuere, Bruno; Kleinberg, Bennett

    2016-01-01

    The Internet has already changed people's lives considerably and is likely to drastically change forensic research. We developed a web-based test to reveal concealed autobiographical information. Initial studies identified a number of conditions that affect diagnostic efficiency. By combining these moderators, this study investigated the full potential of the online ID-check. Participants (n = 101) tried to hide their identity and claimed a false identity in a reaction time-based Concealed Information Test. Half of the participants were presented with personal details (e.g., first name, last name, birthday), whereas the others only saw irrelevant details. Results showed that participants' true identity could be detected with high accuracy (AUC = 0.98; overall accuracy: 86-94%). Online memory detection can reliably and validly detect whether someone is hiding their true identity. This suggests that online memory detection might become a valuable tool for forensic applications. © 2015 American Academy of Forensic Sciences.

  16. The ecological origins of snakes as revealed by skull evolution.

    Science.gov (United States)

    Da Silva, Filipe O; Fabre, Anne-Claire; Savriama, Yoland; Ollonen, Joni; Mahlow, Kristin; Herrel, Anthony; Müller, Johannes; Di-Poï, Nicolas

    2018-01-25

    The ecological origin of snakes remains amongst the most controversial topics in evolution, with three competing hypotheses: fossorial; marine; or terrestrial. Here we use a geometric morphometric approach integrating ecological, phylogenetic, paleontological, and developmental data for building models of skull shape and size evolution and developmental rate changes in squamates. Our large-scale data reveal that whereas the most recent common ancestor of crown snakes had a small skull with a shape undeniably adapted for fossoriality, all snakes plus their sister group derive from a surface-terrestrial form with non-fossorial behavior, thus redirecting the debate toward an underexplored evolutionary scenario. Our comprehensive heterochrony analyses further indicate that snakes later evolved novel craniofacial specializations through global acceleration of skull development. These results highlight the importance of the interplay between natural selection and developmental processes in snake origin and diversification, leading first to invasion of a new habitat and then to subsequent ecological radiations.

  17. Inheritance Patterns in Citation Networks Reveal Scientific Memes

    Directory of Open Access Journals (Sweden)

    Tobias Kuhn

    2014-11-01

    Full Text Available Memes are the cultural equivalent of genes that spread across human culture by means of imitation. What makes a meme and what distinguishes it from other forms of information, however, is still poorly understood. Our analysis of memes in the scientific literature reveals that they are governed by a surprisingly simple relationship between frequency of occurrence and the degree to which they propagate along the citation graph. We propose a simple formalization of this pattern and validate it with data from close to 50 million publication records from the Web of Science, PubMed Central, and the American Physical Society. Evaluations relying on human annotators, citation network randomizations, and comparisons with several alternative approaches confirm that our formula is accurate and effective, without a dependence on linguistic or ontological knowledge and without the application of arbitrary thresholds or filters.

  18. Inheritance Patterns in Citation Networks Reveal Scientific Memes

    Science.gov (United States)

    Kuhn, Tobias; Perc, Matjaž; Helbing, Dirk

    2014-10-01

    Memes are the cultural equivalent of genes that spread across human culture by means of imitation. What makes a meme and what distinguishes it from other forms of information, however, is still poorly understood. Our analysis of memes in the scientific literature reveals that they are governed by a surprisingly simple relationship between frequency of occurrence and the degree to which they propagate along the citation graph. We propose a simple formalization of this pattern and validate it with data from close to 50 million publication records from the Web of Science, PubMed Central, and the American Physical Society. Evaluations relying on human annotators, citation network randomizations, and comparisons with several alternative approaches confirm that our formula is accurate and effective, without a dependence on linguistic or ontological knowledge and without the application of arbitrary thresholds or filters.

  19. Conformational changes in DNA gyrase revealed by limited proteolysis

    DEFF Research Database (Denmark)

    Kampranis, S C; Maxwell, A

    1998-01-01

    We have used limited proteolysis to identify conformational changes in DNA gyrase. Gyrase exhibits a proteolytic fingerprint dominated by two fragments, one of approximately 62 kDa, deriving from the A protein, and another of approximately 25 kDa from the B protein. Quinolone binding to the enzyme......-DNA intermediate by calcium ions does not reveal any protection, suggesting that the quinolone-induced conformational change is different from an "open-gate" state of the enzyme. A quinolone-resistant mutant of gyrase fails to give the characteristic quinolone-associated proteolytic signature. The ATP...... does not prevent dimerization since incubation of the enzyme-DNA complex with both ADPNP and quinolones gives rise to a complex whose proteolytic pattern retains the characteristic signature of dimerization but has lost the quinolone-induced protection. As a result, the quinolone-gyrase complex can...

  20. Transcriptomic variation in a coral reveals pathways of clonal organisation

    DEFF Research Database (Denmark)

    K Bay, Line; Nielsen, Henrik Bjørn; Jarmer, Hanne Østergaard

    2009-01-01

    A microarray study was undertaken to examine the potential for clonal gene expression variation in a branching reef building coral, Acropora millepora. The role of small-scale gradients in light and water flow was examined by comparing gene expression levels between branch elevation (tip and base......) and position (centre and edge) of replicate coral colonies (n=3). Analyses of variance revealed that almost 60% of variation in gene expression was present between colonies and 34 genes were considered differentially expressed between colonies (minimum P=6.5 x 10(-4)). These genes are associated with energy...... of corymbose-like branching coral colonies such as A. millepora. Four genes were differentially expressed between the tip and base of branches (P=3.239 x 10(-4)) and were associated with lysosome lipase activity and fluorescence, suggesting that branch tips may encounter higher pathogen loads or levels...

  1. CW EPR parameters reveal cytochrome P450 ligand binding modes.

    Science.gov (United States)

    Lockart, Molly M; Rodriguez, Carlo A; Atkins, William M; Bowman, Michael K

    2018-06-01

    Cytochrome P450 (CYP) monoxygenses utilize heme cofactors to catalyze oxidation reactions. They play a critical role in metabolism of many classes of drugs, are an attractive target for drug development, and mediate several prominent drug interactions. Many substrates and inhibitors alter the spin state of the ferric heme by displacing the heme's axial water ligand in the resting enzyme to yield a five-coordinate iron complex, or they replace the axial water to yield a nitrogen-ligated six-coordinate iron complex, which are traditionally assigned by UV-vis spectroscopy. However, crystal structures and recent pulsed electron paramagnetic resonance (EPR) studies find a few cases where molecules hydrogen bond to the axial water. The water-bridged drug-H 2 O-heme has UV-vis spectra similar to nitrogen-ligated, six-coordinate complexes, but are closer to "reverse type I" complexes described in older liteature. Here, pulsed and continuous wave (CW) EPR demonstrate that water-bridged complexes are remarkably common among a range of nitrogenous drugs or drug fragments that bind to CYP3A4 or CYP2C9. Principal component analysis reveals a distinct clustering of CW EPR spectral parameters for water-bridged complexes. CW EPR reveals heterogeneous mixtures of ligated states, including multiple directly-coordinated complexes and water-bridged complexes. These results suggest that water-bridged complexes are under-represented in CYP structural databases and can have energies similar to other ligation modes. The data indicates that water-bridged binding modes can be identified and distinguished from directly-coordinated binding by CW EPR. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Cyp1a reporter zebrafish reveals target tissues for dioxin

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kun-Hee [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Park, Hye-Jeong [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); Kim, Jin Hee [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Kim, Suhyun [Graduate School of Medicine, Korea University, Ansan (Korea, Republic of); Williams, Darren R. [New Drug Targets Laboratory, School of Life Sciences, Gwangju Institute of Science and Technology, Gwangju (Korea, Republic of); Kim, Myeong-Kyu [Department of Neurology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Jung, Young Do [Department of Biochemistry, Chonnam National University Medical School, Gwangju (Korea, Republic of); Teraoka, Hiroki [School of Veterinary Medicine, Rakuno Gakuen University, Ebetsu (Japan); Park, Hae-Chul [Graduate School of Medicine, Korea University, Ansan (Korea, Republic of); Choy, Hyon E., E-mail: hyonchoy@chonnam.ac.kr [Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Shin, Boo Ahn, E-mail: bashin@chonnam.ac.kr [Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Choi, Seok-Yong, E-mail: zebrafish@chonnam.ac.kr [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); School of Biological Sciences and Technology, Chonnam National University, Gwangju (Korea, Republic of)

    2013-06-15

    Highlights: •2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is the most toxic anthropogenic substance ever identified. •Transgenic cyp1a reporter zebrafish reveals target tissues for TCDD. •The retinal bipolar cells, otic vesicle, lateral line, pancreas, cloaca and pectoral fin bud are novel targets in zebrafish for TCDD. •Our findings will further understanding of human health risks by TCDD. -- Abstract: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is the unintentional byproduct of various industrial processes, is classified as human carcinogen and could disrupt reproductive, developmental and endocrine systems. Induction of cyp1a1 is used as an indicator of TCDD exposure. We sought to determine tissues that are vulnerable to TCDD toxicity using a transgenic zebrafish (Danio rerio) model. We inserted a nuclear enhanced green fluorescent protein gene (EGFP) into the start codon of a zebrafish cyp1a gene in a fosmid clone using DNA recombineering. The resulting recombineered fosmid was then used to generate cyp1a reporter zebrafish, embryos of which were exposed to TCDD. Expression pattern of EGFP in the reporter zebrafish mirrored that of endogenous cyp1a mRNA. In addition, exposure of the embryos to TCDD at as low as 10 pM for 72 h, which does not elicit morphological abnormalities of embryos, markedly increased GFP expression. Furthermore, the reporter embryos responded to other AhR ligands as well. Exposure of the embryos to TCDD revealed previously reported (the cardiovascular system, liver, pancreas, kidney, swim bladder and skin) and unreported target tissues (retinal bipolar cells, otic vesicle, lateral line, cloaca and pectoral fin bud) for TCDD. Transgenic cyp1a reporter zebrafish we have developed can further understanding of ecotoxicological relevance and human health risks by TCDD. In addition, they could be used to identify agonists of AhR and antidotes to TCDD toxicity.

  3. Eye movement monitoring reveals differential influences of emotion on memory

    Directory of Open Access Journals (Sweden)

    Lily Riggs

    2010-11-01

    Full Text Available Research shows that memory for emotional aspects of an event may be enhanced at the cost of impaired memory for surrounding peripheral details. However, this has only been assessed directly via verbal reports which reveal the outcome of a long stream of processing but cannot shed light on how/when emotion may affect the retrieval process. In the present experiment, eye movement monitoring was used as an indirect measure of memory as it can reveal aspects of online memory processing. For example, do emotions modulate the nature of memory representations or the speed with which such memories can be accessed? Participants viewed central negative and neutral scenes surrounded by three neutral objects and after a brief delay, memory was assessed indirectly via eye movement monitoring and then directly via verbal reports. Consistent with the previous literature, emotion enhanced central and impaired peripheral memory as indexed by eye movement scanning and verbal reports. This suggests that eye movement scanning may contribute and/or is related to conscious access of memory. However, the central/peripheral tradeoff effect was not observed in an early measure of eye movement behavior, i.e. participants were faster to orient to a critical region of change in the periphery irrespective of whether it was previously studied in a negative or neutral context. These findings demonstrate emotion’s differential influences on different aspects of retrieval. In particular, emotion appears to affect the detail within, and/or the evaluation of, stored memory representations, but it may not affect the initial access to those representations.

  4. Comparative genomics of neuroglobin reveals its early origins.

    Directory of Open Access Journals (Sweden)

    Jasmin Dröge

    Full Text Available Neuroglobin (Ngb is a hexacoordinated globin expressed mainly in the central and peripheral nervous system of vertebrates. Although several hypotheses have been put forward regarding the role of neuroglobin, its definite function remains uncertain. Ngb appears to have a neuro-protective role enhancing cell viability under hypoxia and other types of oxidative stress. Ngb is phylogenetically ancient and has a substitution rate nearly four times lower than that of other vertebrate globins, e.g. hemoglobin. Despite its high sequence conservation among vertebrates Ngb seems to be elusive in invertebrates.We determined candidate orthologs in invertebrates and identified a globin of the placozoan Trichoplax adhaerens that is most likely orthologous to vertebrate Ngb and confirmed the orthologous relationship of the polymeric globin of the sea urchin Strongylocentrotus purpuratus to Ngb. The putative orthologous globin genes are located next to genes orthologous to vertebrate POMT2 similarly to localization of vertebrate Ngb. The shared syntenic position of the globins from Trichoplax, the sea urchin and of vertebrate Ngb strongly suggests that they are orthologous. A search for conserved transcription factor binding sites (TFBSs in the promoter regions of the Ngb genes of different vertebrates via phylogenetic footprinting revealed several TFBSs, which may contribute to the specific expression of Ngb, whereas a comparative analysis with myoglobin revealed several common TFBSs, suggestive of regulatory mechanisms common to globin genes.Identification of the placozoan and echinoderm genes orthologous to vertebrate neuroglobin strongly supports the hypothesis of the early evolutionary origin of this globin, as it shows that neuroglobin was already present in the placozoan-bilaterian last common ancestor. Computational determination of the transcription factor binding sites repertoire provides on the one hand a set of transcriptional factors that are

  5. A Network Based Methodology to Reveal Patterns in Knowledge Transfer

    Directory of Open Access Journals (Sweden)

    Orlando López-Cruz

    2015-12-01

    Full Text Available This paper motivates, presents and demonstrates in use a methodology based in complex network analysis to support research aimed at identification of sources in the process of knowledge transfer at the interorganizational level. The importance of this methodology is that it states a unified model to reveal knowledge sharing patterns and to compare results from multiple researches on data from different periods of time and different sectors of the economy. This methodology does not address the underlying statistical processes. To do this, national statistics departments (NSD provide documents and tools at their websites. But this proposal provides a guide to model information inferences gathered from data processing revealing links between sources and recipients of knowledge being transferred and that the recipient detects as main source to new knowledge creation. Some national statistics departments set as objective for these surveys the characterization of innovation dynamics in firms and to analyze the use of public support instruments. From this characterization scholars conduct different researches. Measures of dimensions of the network composed by manufacturing firms and other organizations conform the base to inquiry the structure that emerges from taking ideas from other organizations to incept innovations. These two sets of data are actors of a two- mode-network. The link between two actors (network nodes, one acting as the source of the idea. The second one acting as the destination comes from organizations or events organized by organizations that “provide” ideas to other group of firms. The resulting demonstrated design satisfies the objective of being a methodological model to identify sources in knowledge transfer of knowledge effectively used in innovation.

  6. Vibrio cholerae classical biotype strains reveal distinct signatures in Mexico.

    Science.gov (United States)

    Alam, Munirul; Islam, M Tarequl; Rashed, Shah Manzur; Johura, Fatema-tuz; Bhuiyan, Nurul A; Delgado, Gabriela; Morales, Rosario; Mendez, Jose Luis; Navarro, Armando; Watanabe, Haruo; Hasan, Nur-A; Colwell, Rita R; Cravioto, Alejandro

    2012-07-01

    Vibrio cholerae O1 classical (CL) biotype caused the fifth and sixth pandemics, and probably the earlier cholera pandemics, before the El Tor (ET) biotype initiated the seventh pandemic in Asia in the 1970s by completely displacing the CL biotype. Although the CL biotype was thought to be extinct in Asia and although it had never been reported from Latin America, V. cholerae CL and ET biotypes, including a hybrid ET, were found associated with areas of cholera endemicity in Mexico between 1991 and 1997. In this study, CL biotype strains isolated from areas of cholera endemicity in Mexico between 1983 and 1997 were characterized in terms of major phenotypic and genetic traits and compared with CL biotype strains isolated in Bangladesh between 1962 and 1989. According to sero- and biotyping data, all V. cholerae strains tested had the major phenotypic and genotypic characteristics specific for the CL biotype. Antibiograms revealed the majority of the Bangladeshi strains to be resistant to trimethoprim-sulfamethoxazole, furazolidone, ampicillin, and gentamicin, while the Mexican strains were sensitive to all of these drugs, as well as to ciprofloxacin, erythromycin, and tetracycline. Pulsed-field gel electrophoresis (PFGE) of NotI-digested genomic DNA revealed characteristic banding patterns for all of the CL biotype strains although the Mexican strains differed from the Bangladeshi strains in 1 to 2 DNA bands. The difference was subtle but consistent, as confirmed by the subclustering patterns in the PFGE-based dendrogram, and can serve as a regional signature, suggesting the pre-1991 existence and evolution of the CL biotype strains in the Americas, independent from Asia.

  7. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium.

    Science.gov (United States)

    Machado, Henrique; Gram, Lone

    2017-01-01

    Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur , amino-acid usage, ANI), which allowed us to identify two misidentified strains. Genome analyses also revealed occurrence of higher and lower GC content clades, correlating with phylogenetic clusters. Pan- and core-genome analysis revealed the conservation of 25% of the genome throughout the genus, with a large and open pan-genome. The major source of genomic diversity could be traced to the smaller chromosome and plasmids. Several of the physiological traits studied in the genus did not correlate with phylogenetic data. Since horizontal gene transfer (HGT) is often suggested as a source of genetic diversity and a potential driver of genomic evolution in bacterial species, we looked into evidence of such in Photobacterium genomes. Genomic islands were the source of genomic differences between strains of the same species. Also, we found transposase genes and CRISPR arrays that suggest multiple encounters with foreign DNA. Presence of genomic exchange traits was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms.

  8. Four not six: Revealing culturally common facial expressions of emotion.

    Science.gov (United States)

    Jack, Rachael E; Sun, Wei; Delis, Ioannis; Garrod, Oliver G B; Schyns, Philippe G

    2016-06-01

    As a highly social species, humans generate complex facial expressions to communicate a diverse range of emotions. Since Darwin's work, identifying among these complex patterns which are common across cultures and which are culture-specific has remained a central question in psychology, anthropology, philosophy, and more recently machine vision and social robotics. Classic approaches to addressing this question typically tested the cross-cultural recognition of theoretically motivated facial expressions representing 6 emotions, and reported universality. Yet, variable recognition accuracy across cultures suggests a narrower cross-cultural communication supported by sets of simpler expressive patterns embedded in more complex facial expressions. We explore this hypothesis by modeling the facial expressions of over 60 emotions across 2 cultures, and segregating out the latent expressive patterns. Using a multidisciplinary approach, we first map the conceptual organization of a broad spectrum of emotion words by building semantic networks in 2 cultures. For each emotion word in each culture, we then model and validate its corresponding dynamic facial expression, producing over 60 culturally valid facial expression models. We then apply to the pooled models a multivariate data reduction technique, revealing 4 latent and culturally common facial expression patterns that each communicates specific combinations of valence, arousal, and dominance. We then reveal the face movements that accentuate each latent expressive pattern to create complex facial expressions. Our data questions the widely held view that 6 facial expression patterns are universal, instead suggesting 4 latent expressive patterns with direct implications for emotion communication, social psychology, cognitive neuroscience, and social robotics. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  9. Next generation sequencing reveals the hidden diversity of zooplankton assemblages.

    Directory of Open Access Journals (Sweden)

    Penelope K Lindeque

    Full Text Available BACKGROUND: Zooplankton play an important role in our oceans, in biogeochemical cycling and providing a food source for commercially important fish larvae. However, difficulties in correctly identifying zooplankton hinder our understanding of their roles in marine ecosystem functioning, and can prevent detection of long term changes in their community structure. The advent of massively parallel next generation sequencing technology allows DNA sequence data to be recovered directly from whole community samples. Here we assess the ability of such sequencing to quantify richness and diversity of a mixed zooplankton assemblage from a productive time series site in the Western English Channel. METHODOLOGY/PRINCIPLE FINDINGS: Plankton net hauls (200 µm were taken at the Western Channel Observatory station L4 in September 2010 and January 2011. These samples were analysed by microscopy and metagenetic analysis of the 18S nuclear small subunit ribosomal RNA gene using the 454 pyrosequencing platform. Following quality control a total of 419,041 sequences were obtained for all samples. The sequences clustered into 205 operational taxonomic units using a 97% similarity cut-off. Allocation of taxonomy by comparison with the National Centre for Biotechnology Information database identified 135 OTUs to species level, 11 to genus level and 1 to order, <2.5% of sequences were classified as unknowns. By comparison a skilled microscopic analyst was able to routinely enumerate only 58 taxonomic groups. CONCLUSIONS: Metagenetics reveals a previously hidden taxonomic richness, especially for Copepoda and hard-to-identify meroplankton such as Bivalvia, Gastropoda and Polychaeta. It also reveals rare species and parasites. We conclude that Next Generation Sequencing of 18S amplicons is a powerful tool for elucidating the true diversity and species richness of zooplankton communities. While this approach allows for broad diversity assessments of plankton it may

  10. Compartmentation of glycogen metabolism revealed from 13C isotopologue distributions

    Directory of Open Access Journals (Sweden)

    Marin de Mas Igor

    2011-10-01

    Full Text Available Abstract Background Stable isotope tracers are used to assess metabolic flux profiles in living cells. The existing methods of measurement average out the isotopic isomer distribution in metabolites throughout the cell, whereas the knowledge of compartmental organization of analyzed pathways is crucial for the evaluation of true fluxes. That is why we accepted a challenge to create a software tool that allows deciphering the compartmentation of metabolites based on the analysis of average isotopic isomer distribution. Results The software Isodyn, which simulates the dynamics of isotopic isomer distribution in central metabolic pathways, was supplemented by algorithms facilitating the transition between various analyzed metabolic schemes, and by the tools for model discrimination. It simulated 13C isotope distributions in glucose, lactate, glutamate and glycogen, measured by mass spectrometry after incubation of hepatocytes in the presence of only labeled glucose or glucose and lactate together (with label either in glucose or lactate. The simulations assumed either a single intracellular hexose phosphate pool, or also channeling of hexose phosphates resulting in a different isotopic composition of glycogen. Model discrimination test was applied to check the consistency of both models with experimental data. Metabolic flux profiles, evaluated with the accepted model that assumes channeling, revealed the range of changes in metabolic fluxes in liver cells. Conclusions The analysis of compartmentation of metabolic networks based on the measured 13C distribution was included in Isodyn as a routine procedure. The advantage of this implementation is that, being a part of evaluation of metabolic fluxes, it does not require additional experiments to study metabolic compartmentation. The analysis of experimental data revealed that the distribution of measured 13C-labeled glucose metabolites is inconsistent with the idea of perfect mixing of hexose

  11. Architecture of cognitive flexibility revealed by lesion mapping

    Science.gov (United States)

    Barbey, Aron K.; Colom, Roberto; Grafman, Jordan

    2013-01-01

    Neuroscience has made remarkable progress in understanding the architecture of human intelligence, identifying a distributed network of brain structures that support goal-directed, intelligent behavior. However, the neural foundations of cognitive flexibility and adaptive aspects of intellectual function remain to be well characterized. Here, we report a human lesion study (n = 149) that investigates the neural bases of key competencies of cognitive flexibility (i.e., mental flexibility and the fluent generation of new ideas) and systematically examine their contributions to a broad spectrum of cognitive and social processes, including psychometric intelligence (Wechsler Adult Intelligence Scale), emotional intelligence (Mayer, Salovey, Caruso Emotional Intelligence Test), and personality (Neuroticism–Extraversion–Openness Personality Inventory). Latent variable modeling was applied to obtain error-free indices of each factor, followed by voxel-based lesion-symptom mapping to elucidate their neural substrates. Regression analyses revealed that latent scores for psychometric intelligence reliably predict latent scores for cognitive flexibility (adjusted R2 = 0.94). Lesion mapping results further indicated that these convergent processes depend on a shared network of frontal, temporal, and parietal regions, including white matter association tracts, which bind these areas into an integrated system. A targeted analysis of the unique variance explained by cognitive flexibility further revealed selective damage within the right superior temporal gyrus, a region known to support insight and the recognition of novel semantic relations. The observed findings motivate an integrative framework for understanding the neural foundations of adaptive behavior, suggesting that core elements of cognitive flexibility emerge from a distributed network of brain regions that support specific competencies for human intelligence. PMID:23721727

  12. Memory functions reveal structural properties of gene regulatory networks

    Science.gov (United States)

    Perez-Carrasco, Ruben

    2018-01-01

    Gene regulatory networks (GRNs) control cellular function and decision making during tissue development and homeostasis. Mathematical tools based on dynamical systems theory are often used to model these networks, but the size and complexity of these models mean that their behaviour is not always intuitive and the underlying mechanisms can be difficult to decipher. For this reason, methods that simplify and aid exploration of complex networks are necessary. To this end we develop a broadly applicable form of the Zwanzig-Mori projection. By first converting a thermodynamic state ensemble model of gene regulation into mass action reactions we derive a general method that produces a set of time evolution equations for a subset of components of a network. The influence of the rest of the network, the bulk, is captured by memory functions that describe how the subnetwork reacts to its own past state via components in the bulk. These memory functions provide probes of near-steady state dynamics, revealing information not easily accessible otherwise. We illustrate the method on a simple cross-repressive transcriptional motif to show that memory functions not only simplify the analysis of the subnetwork but also have a natural interpretation. We then apply the approach to a GRN from the vertebrate neural tube, a well characterised developmental transcriptional network composed of four interacting transcription factors. The memory functions reveal the function of specific links within the neural tube network and identify features of the regulatory structure that specifically increase the robustness of the network to initial conditions. Taken together, the study provides evidence that Zwanzig-Mori projections offer powerful and effective tools for simplifying and exploring the behaviour of GRNs. PMID:29470492

  13. Impaired Phosphate Tolerance Revealed With an Acute Oral Challenge.

    Science.gov (United States)

    Turner, Mandy E; White, Christine A; Hopman, Wilma M; Ward, Emilie C; Jeronimo, Paul S; Adams, Michael A; Holden, Rachel M

    2018-01-01

    Elevated serum phosphate is consistently linked with cardiovascular disease (CVD) events and mortality in the setting of normal and impaired kidney function. However, serum phosphate does not often exceed the upper limit of normal until glomerular filtration rate (GFR) falls below 30 mL/min/m 2 . It was hypothesized that the response to an oral, bioavailable phosphate load will unmask impaired phosphate tolerance, a maladaptation not revealed by baseline serum phosphate concentrations. In this study, rats with varying kidney function as well as normo-phosphatemic human subjects, with inulin-measured GFR (13.2 to 128.3mL/min), received an oral phosphate load. Hormonal and urinary responses were evaluated over 2 hours. Results revealed that the more rapid elevation of serum phosphate was associated with subjects and rats with higher levels of kidney function, greater responsiveness to acute changes in parathyroid hormone (PTH), and significantly more urinary phosphate at 2 hours. In humans, increases in urinary phosphate to creatinine ratio did not correlate with baseline serum phosphate concentrations but did correlate strongly to early increase of serum phosphate. The blunted rise in serum phosphate in rats with CKD was not the result of altered absorption. This result suggests acute tissue deposition may be altered in the setting of kidney function impairment. Early recognition of impaired phosphate tolerance could translate to important interventions, such as dietary phosphate restriction or phosphate binders, being initiated at much higher levels of kidney function than is current practice. © 2017 American Society for Bone and Mineral Research. © 2017 American Society for Bone and Mineral Research.

  14. Astronomers Reveal Extinct Extra-Terrestrial Fusion Reactor

    Science.gov (United States)

    2004-06-01

    An international team of astronomers, studying the left-over remnants of stars like our own Sun, have found a remarkable object where the nuclear reactor that once powered it has only just shut down. This star, the hottest known white dwarf, H1504+65, seems to have been stripped of its entire outer regions during its death throes leaving behind the core that formed its power plant. Scientists from the United Kingdom, Germany and the USA focused two of NASA's space telescopes, the Chandra X-ray Observatory and the Far Ultraviolet Spectroscopic Explorer (FUSE), onto H1504+65 to probe its composition and measure its temperature. The data revealed that the stellar surface is extremely hot, 200,000 degrees, and is virtually free of hydrogen and helium, something never before observed in any star. Instead, the surface is composed mainly of carbon and oxygen, the 'ashes' of the fusion of helium in a nuclear reactor. An important question we must answer is why has this unique star lost the hydrogen and helium, which usually hide the stellar interior from our view? Professor Martin Barstow (University of Leicester) said. 'Studying the nature of the ashes of dead stars give us important clues as to how stars like the Sun live their lives and eventually die. The nuclear waste of carbon and oxygen produced in the process are essential elements for life and are eventually recycled into interstellar space to form new stars, planets and, possibly, living beings.' Professor Klaus Werner (University of Tübingen) said. 'We realized that this star has, on astronomical time scales, only very recently shut down nuclear fusion (about a hundred years ago). We clearly see the bare, now extinct reactor that once powered a bright giant star.' Dr Jeffrey Kruk (Johns Hopkins University) said: 'Astronomers have long predicted that many stars would have carbon-oxygen cores near the end of their lives, but I never expected we would actually be able to see one. This is a wonderful opportunity to

  15. The rumen microbial metaproteome as revealed by SDS-PAGE.

    Science.gov (United States)

    Snelling, Timothy J; Wallace, R John

    2017-01-07

    Ruminal digestion is carried out by large numbers of bacteria, archaea, protozoa and fungi. Understanding the microbiota is important because ruminal fermentation dictates the efficiency of feed utilisation by the animal and is also responsible for major emissions of the greenhouse gas, methane. Recent metagenomic and metatranscriptomic studies have helped to elucidate many features of the composition and activity of the microbiota. The metaproteome provides complementary information to these other -omics technologies. The aim of this study was to explore the metaproteome of bovine and ovine ruminal digesta using 2D SDS-PAGE. Digesta samples were taken via ruminal fistulae and by gastric intubation, or at slaughter, and stored in glycerol at -80 °C. A protein extraction protocol was developed to maximise yield and representativeness of the protein content. The proteome of ruminal digesta taken from dairy cows fed a high concentrate diet was dominated by a few very highly expressed proteins, which were identified by LC-MS/MS to be structural proteins, such as actin and α- and β-tubulins, derived from ciliate protozoa. Removal of protozoa from digesta before extraction of proteins revealed the prokaryotic metaproteome, which was dominated by enzymes involved in glycolysis, such as glyceraldehyde-3-phosphate dehydrogenase, phosphoenolpyruvate carboxykinase, phosphoglycerate kinase and triosephosphate isomerase. The enzymes were predominantly from the Firmicutes and Bacteroidetes phyla. Enzymes from methanogenic archaea were also abundant, consistent with the importance of methane formation in the rumen. Gels from samples from dairy cows fed a high proportion of grass silage were consistently obscured by co-staining of humic compounds. Samples from beef cattle and fattening lambs receiving a predominantly concentrate diet produced clearer gels, but the pattern of spots was inconsistent between samples, making comparisons difficult. This work demonstrated for the

  16. Episodic sexual transmission of HIV revealed by molecular phylodynamics.

    Directory of Open Access Journals (Sweden)

    Fraser Lewis

    2008-03-01

    Full Text Available The structure of sexual contact networks plays a key role in the epidemiology of sexually transmitted infections, and their reconstruction from interview data has provided valuable insights into the spread of infection. For HIV, the long period of infectivity has made the interpretation of contact networks more difficult, and major discrepancies have been observed between the contact network and the transmission network revealed by viral phylogenetics. The high rate of HIV evolution in principle allows for detailed reconstruction of links between virus from different individuals, but often sampling has been too sparse to describe the structure of the transmission network. The aim of this study was to analyze a high-density sample of an HIV-infected population using recently developed techniques in phylogenetics to infer the short-term dynamics of the epidemic among men who have sex with men (MSM.Sequences of the protease and reverse transcriptase coding regions from 2,126 patients, predominantly MSM, from London were compared: 402 of these showed a close match to at least one other subtype B sequence. Nine large clusters were identified on the basis of genetic distance; all were confirmed by Bayesian Monte Carlo Markov chain (MCMC phylogenetic analysis. Overall, 25% of individuals with a close match with one sequence are linked to 10 or more others. Dated phylogenies of the clusters using a relaxed clock indicated that 65% of the transmissions within clusters took place between 1995 and 2000, and 25% occurred within 6 mo after infection. The likelihood that not all members of the clusters have been identified renders the latter observation conservative.Reconstruction of the HIV transmission network using a dated phylogeny approach has revealed the HIV epidemic among MSM in London to have been episodic, with evidence of multiple clusters of transmissions dating to the late 1990s, a period when HIV prevalence is known to have doubled in this

  17. Comprehensive Genomic Profiling of Esthesioneuroblastoma Reveals Additional Treatment Options.

    Science.gov (United States)

    Gay, Laurie M; Kim, Sungeun; Fedorchak, Kyle; Kundranda, Madappa; Odia, Yazmin; Nangia, Chaitali; Battiste, James; Colon-Otero, Gerardo; Powell, Steven; Russell, Jeffery; Elvin, Julia A; Vergilio, Jo-Anne; Suh, James; Ali, Siraj M; Stephens, Philip J; Miller, Vincent A; Ross, Jeffrey S

    2017-07-01

    Esthesioneuroblastoma (ENB), also known as olfactory neuroblastoma, is a rare malignant neoplasm of the olfactory mucosa. Despite surgical resection combined with radiotherapy and adjuvant chemotherapy, ENB often relapses with rapid progression. Current multimodality, nontargeted therapy for relapsed ENB is of limited clinical benefit. We queried whether comprehensive genomic profiling (CGP) of relapsed or refractory ENB can uncover genomic alterations (GA) that could identify potential targeted therapies for these patients. CGP was performed on formalin-fixed, paraffin-embedded sections from 41 consecutive clinical cases of ENBs using a hybrid-capture, adaptor ligation based next-generation sequencing assay to a mean coverage depth of 593X. The results were analyzed for base substitutions, insertions and deletions, select rearrangements, and copy number changes (amplifications and homozygous deletions). Clinically relevant GA (CRGA) were defined as GA linked to drugs on the market or under evaluation in clinical trials. A total of 28 ENBs harbored GA, with a mean of 1.5 GA per sample. Approximately half of the ENBs (21, 51%) featured at least one CRGA, with an average of 1 CRGA per sample. The most commonly altered gene was TP53 (17%), with GA in PIK3CA , NF1 , CDKN2A , and CDKN2C occurring in 7% of samples. We report comprehensive genomic profiles for 41 ENB tumors. CGP revealed potential new therapeutic targets, including targetable GA in the mTOR, CDK and growth factor signaling pathways, highlighting the clinical value of genomic profiling in ENB. Comprehensive genomic profiling of 41 relapsed or refractory ENBs reveals recurrent alterations or classes of mutation, including amplification of tyrosine kinases encoded on chromosome 5q and mutations affecting genes in the mTOR/PI3K pathway. Approximately half of the ENBs (21, 51%) featured at least one clinically relevant genomic alteration (CRGA), with an average of 1 CRGA per sample. The most commonly altered

  18. Distributed neural system for emotional intelligence revealed by lesion mapping.

    Science.gov (United States)

    Barbey, Aron K; Colom, Roberto; Grafman, Jordan

    2014-03-01

    Cognitive neuroscience has made considerable progress in understanding the neural architecture of human intelligence, identifying a broadly distributed network of frontal and parietal regions that support goal-directed, intelligent behavior. However, the contributions of this network to social and emotional aspects of intellectual function remain to be well characterized. Here we investigated the neural basis of emotional intelligence in 152 patients with focal brain injuries using voxel-based lesion-symptom mapping. Latent variable modeling was applied to obtain measures of emotional intelligence, general intelligence and personality from the Mayer, Salovey, Caruso Emotional Intelligence Test (MSCEIT), the Wechsler Adult Intelligence Scale and the Neuroticism-Extroversion-Openness Inventory, respectively. Regression analyses revealed that latent scores for measures of general intelligence and personality reliably predicted latent scores for emotional intelligence. Lesion mapping results further indicated that these convergent processes depend on a shared network of frontal, temporal and parietal brain regions. The results support an integrative framework for understanding the architecture of executive, social and emotional processes and make specific recommendations for the interpretation and application of the MSCEIT to the study of emotional intelligence in health and disease.

  19. Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Li Jun; van der Does, H. C.; Borkovich, Katherine A.; Coleman, Jeffrey J.; Daboussi, Marie-Jose; Di Pietro, Antonio; Dufresne, Marie; Freitag, Michael; Grabherr, Manfred; Henrissat, Bernard; Houterman, Petra M.; Kang, Seogchan; Shim, Won-Bo; Wolochuk, Charles; Xie, Xiaohui; Xu, Jin Rong; Antoniw, John; Baker, Scott E.; Bluhm, Burton H.; Breakspear, Andrew; Brown, Daren W.; Butchko, Robert A.; Chapman, Sinead; Coulson, Richard; Coutinho, Pedro M.; Danchin, Etienne G.; Diener, Andrew; Gale, Liane R.; Gardiner, Donald; Goff, Steven; Hammond-Kossack, Kim; Hilburn, Karen; Hua-Van, Aurelie; Jonkers, Wilfried; Kazan, Kemal; Kodira, Chinnappa D.; Koehrsen, Michael; Kumar, Lokesh; Lee, Yong Hwan; Li, Liande; Manners, John M.; Miranda-Saavedra, Diego; Mukherjee, Mala; Park, Gyungsoon; Park, Jongsun; Park, Sook Young; Proctor, Robert H.; Regev, Aviv; Ruiz-Roldan, M. C.; Sain, Divya; Sakthikumar, Sharadha; Sykes, Sean; Schwartz, David C.; Turgeon, Barbara G.; Wapinski, Ilan; Yoder, Olen; Young, Sarah; Zeng, Qiandong; Zhou, Shiguo; Galagan, James; Cuomo, Christina A.; Kistler, H. Corby; Rep, Martijn

    2010-03-18

    Fusarium species are among the most important phytopathogenic and toxigenic fungi, having significant impact on crop production and animal health. Distinctively, members of the F. oxysporum species complex exhibit wide host range but discontinuously distributed host specificity, reflecting remarkable genetic adaptability. To understand the molecular underpinnings of diverse phenotypic traits and their evolution in Fusarium, we compared the genomes of three economically important and phylogenetically related, yet phenotypically diverse plant-pathogenic species, F. graminearum, F. verticillioides and F. oxysporum f. sp. lycopersici. Our analysis revealed greatly expanded lineage-specific (LS) genomic regions in F. oxysporum that include four entire chromosomes, accounting for more than one-quarter of the genome. LS regions are rich in transposons and genes with distinct evolutionary profiles but related to pathogenicity. Experimentally, we demonstrate for the first time the transfer of two LS chromosomes between strains of F. oxysporum, resulting in the conversion of a non-pathogenic strain into a pathogen. Transfer of LS chromosomes between otherwise genetically isolated strains explains the polyphyletic origin of host specificity and the emergence of new pathogenic lineages in the F. oxysporum species complex, putting the evolution of fungal pathogenicity into a new perspective.

  20. Opto-acoustic microscopy reveals adhesion mechanics of single cells

    Science.gov (United States)

    Abi Ghanem, Maroun; Dehoux, Thomas; Liu, Liwang; Le Saux, Guillaume; Plawinski, Laurent; Durrieu, Marie-Christine; Audoin, Bertrand

    2018-01-01

    Laser-generated GHz-ultrasonic-based technologies have shown the ability to image single cell adhesion and stiffness simultaneously. Using this new modality, we here demonstrate quantitative indicators to investigate contact mechanics and adhesion processes of the cell. We cultured human cells on a rigid substrate, and we used an inverted pulsed opto-acoustic microscope to generate acoustic pulses containing frequencies up to 100 GHz in the substrate. We map the reflection of the acoustic pulses at the cell-substrate interface to obtain images of the acoustic impedance of the cell, Zc, as well as of the stiffness of the interface, K, with 1 μm lateral resolution. Our results show that the standard deviation ΔZc reveals differences between different cell types arising from the multiplicity of local conformations within the nucleus. From the distribution of K-values within the nuclear region, we extract a mean interfacial stiffness, Km, that quantifies the average contact force in areas of the cell displaying weak bonding. By analogy with classical contact mechanics, we also define the ratio of the real to nominal contact areas, Sr/St. We show that Km can be interpreted as a quantitative indicator of passive contact at metal-cell interfaces, while Sr/St is sensitive to active adhesive processes in the nuclear region. The ability to separate the contributions of passive and active adhesion processes should allow gaining insight into cell-substrate interactions, with important applications in tissue engineering.

  1. Subfield profitability analysis reveals an economic case for cropland diversification

    Science.gov (United States)

    Brandes, E.; McNunn, G. S.; Schulte, L. A.; Bonner, I. J.; Muth, D. J.; Babcock, B. A.; Sharma, B.; Heaton, E. A.

    2016-01-01

    Public agencies and private enterprises increasingly desire to achieve ecosystem service outcomes in agricultural systems, but are limited by perceived conflicts between economic and ecosystem service goals and a lack of tools enabling effective operational management. Here we use Iowa—an agriculturally homogeneous state representative of the Maize Belt—to demonstrate an economic rationale for cropland diversification at the subfield scale. We used a novel computational framework that integrates disparate but publicly available data to map ˜3.3 million unique potential management polygons (9.3 Mha) and reveal subfield opportunities to increase overall field profitability. We analyzed subfield profitability for maize/soybean fields during 2010-2013—four of the most profitable years in recent history—and projected results for 2015. While cropland operating at a loss of US 250 ha-1 or more was negligible between 2010 and 2013 at 18 000-190 000 ha (profitable areas, incorporating conservation management that breaks even (e.g., planting low-input perennials), into low-yielding portions of fields could increase overall cropland profitability by 80%. This approach is applicable to the broader region and differs substantially from the status quo of ‘top-down’ land management for conservation by harnessing private interest to align profitability with the production of ecosystem services.

  2. Functional metabolomics reveals novel active products in the DHA metabolome

    Directory of Open Access Journals (Sweden)

    Masakazu eShinohara

    2012-04-01

    Full Text Available Endogenous mechanisms for successful resolution of an acute inflammatory response and the local return to homeostasis are of interest because excessive inflammation underlies many human diseases. In this review, we provide an update and overview of functional metabolomics that identified a new bioactive metabolome of docosahexaenoic acid (DHA. Systematic studies revealed that DHA was converted to DHEA-derived novel bioactive products as well as aspirin-triggered (AT forms of protectins. The new oxygenated DHEA derived products blocked PMN chemotaxis, reduced P-selectin expression and platelet-leukocyte adhesion, and showed organ protection in ischemia/reperfusion injury. These products activated cannabinoid receptor (CB2 receptor and not CB1 receptors. The AT-PD1 reduced neutrophil (PMN recruitment in murine peritonitis. With human cells, AT-PD1 decreased transendothelial PMN migration as well as enhanced efferocytosis of apoptotic human PMN by macrophages. The recent findings reviewed here indicate that DHEA oxidative metabolism and aspirin-triggered conversion of DHA produce potent novel molecules with anti-inflammatory and organ-protective properties, opening the DHA metabolome functional roles.

  3. [Necrotic leg ulcer revealing vasculitis induced by vitamin K antagonists].

    Science.gov (United States)

    Chabli, H; Hocar, O; Akhdari, N; Amal, S; Hakkou, M; Hamdaoui, A

    2015-12-01

    Vitamin K antagonists are widely used in thromboembolic diseases. Hemorrhagic complications related to drug overdose represent their main side effect. We report a rare side effect, a severe and unexpected type of skin vasculitis - necrotic leg ulcer - induced by vitamin K antagonist. A 63-year-old female with a history of diabetes developed hyperalgesic necrotic ulcerations on the lower limbs one month after starting an acenocoumarol-based treatment for ischemic heart disease. Histological examination revealed lymphocytic vasculitis with fibrinoid necrosis. Etiological explorations searching for vasculitis were negative. In the absence of a precise etiology, drug-induced ulcer was suspected. Low molecular weight heparin was prescribed to replace acenocoumarol. The lesions slowly resolved with topical treatment. The chronological criteria and the negativity of etiological explorations allowed the diagnosis of vitamin K antagonist-induced necrotic skin ulcer. Clinicians should be aware of this rare complication induced by oral anticoagulants because of its practical therapeutic implications. This is the first case of necrotic leg ulcer induced by acenocoumarol corresponding histologically to necrotising lymphocytic vasculitis. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  4. Proteomics Analysis Reveals Previously Uncharacterized Virulence Factors in Vibrio proteolyticus

    Directory of Open Access Journals (Sweden)

    Ann Ray

    2016-07-01

    Full Text Available Members of the genus Vibrio include many pathogens of humans and marine animals that share genetic information via horizontal gene transfer. Hence, the Vibrio pan-genome carries the potential to establish new pathogenic strains by sharing virulence determinants, many of which have yet to be characterized. Here, we investigated the virulence properties of Vibrio proteolyticus, a Gram-negative marine bacterium previously identified as part of the Vibrio consortium isolated from diseased corals. We found that V. proteolyticus causes actin cytoskeleton rearrangements followed by cell lysis in HeLa cells in a contact-independent manner. In search of the responsible virulence factor involved, we determined the V. proteolyticus secretome. This proteomics approach revealed various putative virulence factors, including active type VI secretion systems and effectors with virulence toxin domains; however, these type VI secretion systems were not responsible for the observed cytotoxic effects. Further examination of the V. proteolyticus secretome led us to hypothesize and subsequently demonstrate that a secreted hemolysin, belonging to a previously uncharacterized clan of the leukocidin superfamily, was the toxin responsible for the V. proteolyticus-mediated cytotoxicity in both HeLa cells and macrophages. Clearly, there remains an armory of yet-to-be-discovered virulence factors in the Vibrio pan-genome that will undoubtedly provide a wealth of knowledge on how a pathogen can manipulate host cells.

  5. [Prostatic granulomas revealing a peripheral T-cell lymphoma].

    Science.gov (United States)

    Foguem, C; Curlier, E; Rouamba, M-M; Regent, A; Philippe, P

    2009-02-01

    The presence of granulomas on tissue biopsie has been reported in a wide range of disorders. The clinical presentation and the diagnostic work-up of granulomatosis can be difficult as it is illustrated in the following report. A 59-year-old patient was referred in 2002 for a granulomatous prostatitis. Physical examination was normal. Except for the increase of prostate-specific antigen (which motivated a biopsy), the laboratory results were normal. Thoracic CT-scan disclosed mediastinal lymph nodes. A minor salivary gland biopsy was consistent with the diagnosis of sarcoidosis. In 2004, the patient presented an epidermal necrolysis, and in 2005 the deterioration of general status raised suspicion of a lymphoproliferative disorder. Liver and bone marrow biopsies revealed a granulomatous process. Despite steroid therapy, the patient died. Autopsy discloses a anaplasic T cell lymphoma. This report illustrates the relationship between sarcoidosis and lymphoma as a mode of presentation, a complication, or an accidental but misleading association? The association between anaplastic lymphoma and sarcoidosis is exceptional.

  6. CRISPR loci reveal networks of gene exchange in archaea

    Directory of Open Access Journals (Sweden)

    Brodt Avital

    2011-12-01

    Full Text Available Abstract Background CRISPR (Clustered, Regularly, Interspaced, Short, Palindromic Repeats loci provide prokaryotes with an adaptive immunity against viruses and other mobile genetic elements. CRISPR arrays can be transcribed and processed into small crRNA molecules, which are then used by the cell to target the foreign nucleic acid. Since spacers are accumulated by active CRISPR/Cas systems, the sequences of these spacers provide a record of the past "infection history" of the organism. Results Here we analyzed all currently known spacers present in archaeal genomes and identified their source by DNA similarity. While nearly 50% of archaeal spacers matched mobile genetic elements, such as plasmids or viruses, several others matched chromosomal genes of other organisms, primarily other archaea. Thus, networks of gene exchange between archaeal species were revealed by the spacer analysis, including many cases of inter-genus and inter-species gene transfer events. Spacers that recognize viral sequences tend to be located further away from the leader sequence, implying that there exists a selective pressure for their retention. Conclusions CRISPR spacers provide direct evidence for extensive gene exchange in archaea, especially within genera, and support the current dogma where the primary role of the CRISPR/Cas system is anti-viral and anti-plasmid defense. Open peer review This article was reviewed by: Profs. W. Ford Doolittle, John van der Oost, Christa Schleper (nominated by board member Prof. J Peter Gogarten

  7. Effective connectivity reveals strategy differences in an expert calculator.

    Directory of Open Access Journals (Sweden)

    Ludovico Minati

    Full Text Available Mathematical reasoning is a core component of cognition and the study of experts defines the upper limits of human cognitive abilities, which is why we are fascinated by peak performers, such as chess masters and mental calculators. Here, we investigated the neural bases of calendrical skills, i.e. the ability to rapidly identify the weekday of a particular date, in a gifted mental calculator who does not fall in the autistic spectrum, using functional MRI. Graph-based mapping of effective connectivity, but not univariate analysis, revealed distinct anatomical location of "cortical hubs" supporting the processing of well-practiced close dates and less-practiced remote dates: the former engaged predominantly occipital and medial temporal areas, whereas the latter were associated mainly with prefrontal, orbitofrontal and anterior cingulate connectivity. These results point to the effect of extensive practice on the development of expertise and long term working memory, and demonstrate the role of frontal networks in supporting performance on less practiced calculations, which incur additional processing demands. Through the example of calendrical skills, our results demonstrate that the ability to perform complex calculations is initially supported by extensive attentional and strategic resources, which, as expertise develops, are gradually replaced by access to long term working memory for familiar material.

  8. Shared memories reveal shared structure in neural activity across individuals

    Science.gov (United States)

    Chen, J.; Leong, Y.C.; Honey, C.J.; Yong, C.H.; Norman, K.A.; Hasson, U.

    2016-01-01

    Our lives revolve around sharing experiences and memories with others. When different people recount the same events, how similar are their underlying neural representations? Participants viewed a fifty-minute movie, then verbally described the events during functional MRI, producing unguided detailed descriptions lasting up to forty minutes. As each person spoke, event-specific spatial patterns were reinstated in default-network, medial-temporal, and high-level visual areas. Individual event patterns were both highly discriminable from one another and similar between people, suggesting consistent spatial organization. In many high-order areas, patterns were more similar between people recalling the same event than between recall and perception, indicating systematic reshaping of percept into memory. These results reveal the existence of a common spatial organization for memories in high-level cortical areas, where encoded information is largely abstracted beyond sensory constraints; and that neural patterns during perception are altered systematically across people into shared memory representations for real-life events. PMID:27918531

  9. Ecoinformatics reveals effects of crop rotational histories on cotton yield.

    Science.gov (United States)

    Meisner, Matthew H; Rosenheim, Jay A

    2014-01-01

    Crop rotation has been practiced for centuries in an effort to improve agricultural yield. However, the directions, magnitudes, and mechanisms of the yield effects of various crop rotations remain poorly understood in many systems. In order to better understand how crop rotation influences cotton yield, we used hierarchical Bayesian models to analyze a large ecoinformatics database consisting of records of commercial cotton crops grown in California's San Joaquin Valley. We identified several crops that, when grown in a field the year before a cotton crop, were associated with increased or decreased cotton yield. Furthermore, there was a negative association between the effect of the prior year's crop on June densities of the pest Lygus hesperus and the effect of the prior year's crop on cotton yield. This suggested that some crops may enhance L. hesperus densities in the surrounding agricultural landscape, because residual L. hesperus populations from the previous year cannot continuously inhabit a focal field and attack a subsequent cotton crop. In addition, we found that cotton yield declined approximately 2.4% for each additional year in which cotton was grown consecutively in a field prior to the focal cotton crop. Because L. hesperus is quite mobile, the effects of crop rotation on L. hesperus would likely not be revealed by small plot experimentation. These results provide an example of how ecoinformatics datasets, which capture the true spatial scale of commercial agriculture, can be used to enhance agricultural productivity.

  10. Ecoinformatics reveals effects of crop rotational histories on cotton yield.

    Directory of Open Access Journals (Sweden)

    Matthew H Meisner

    Full Text Available Crop rotation has been practiced for centuries in an effort to improve agricultural yield. However, the directions, magnitudes, and mechanisms of the yield effects of various crop rotations remain poorly understood in many systems. In order to better understand how crop rotation influences cotton yield, we used hierarchical Bayesian models to analyze a large ecoinformatics database consisting of records of commercial cotton crops grown in California's San Joaquin Valley. We identified several crops that, when grown in a field the year before a cotton crop, were associated with increased or decreased cotton yield. Furthermore, there was a negative association between the effect of the prior year's crop on June densities of the pest Lygus hesperus and the effect of the prior year's crop on cotton yield. This suggested that some crops may enhance L. hesperus densities in the surrounding agricultural landscape, because residual L. hesperus populations from the previous year cannot continuously inhabit a focal field and attack a subsequent cotton crop. In addition, we found that cotton yield declined approximately 2.4% for each additional year in which cotton was grown consecutively in a field prior to the focal cotton crop. Because L. hesperus is quite mobile, the effects of crop rotation on L. hesperus would likely not be revealed by small plot experimentation. These results provide an example of how ecoinformatics datasets, which capture the true spatial scale of commercial agriculture, can be used to enhance agricultural productivity.

  11. With neutrino masses revealed, proton decay is the missing link

    International Nuclear Information System (INIS)

    Pati, J.C.

    1999-01-01

    By way of paying tribute to Abdus Salam, I recall the ideas of higher unification that he and I initiated. I discuss the current status of those ideas in the light of recent developments, including those of: (a) gauge coupling unification, (b) discovery of neutrino-oscillation at SuperKamiokande, and (c) ongoing searches for proton decay. It is noted that the mass of ν τ (∼ 1/20 eV), suggested by the SuperK result, provides clear support for the route to higher unification based on the ideas of (i) SU(4)-color, (ii) left-right symmetry and (iii) supersymmetry. The change in perspective, pertaining to both gauge coupling unification and proton decay, brought forth by supersymmetry and superstrings, is noted. And, the beneficial roles of string-symmetries in addressing certain naturalness problems of supersymmetry, including that of rapid proton decay, are emphasized. Further, it is noted that with neutrino masses and coupling unification revealed, proton decay is the missing link. Following recent joint work with K. Babu and F. Wilczek, based on supersymmetric unification, it is remarked that the SuperKamiokande result on neutrino oscillation in fact enhances the expected rate of proton decay compared to prior estimates. Thus, assuming supersymmetric unification, one expects that the discovery of proton decay should not be far behind. (author)

  12. Acoustic telemetry reveals cryptic residency of whale sharks

    KAUST Repository

    Cagua, Edgar F.

    2015-04-01

    Althoughwhale sharks (Rhincodon typus) have beendocumentedtomove thousands of kilometres, they are most frequently observed at a few predictable seasonal aggregation sites. The absence of sharks at the surface during visual surveys has led to the assumption that sharks disperse to places unknown during the long \\'off-seasons\\' at most of these locations. Here we compare 2 years of R. typus visual sighting records from Mafia Island in Tanzania to concurrent acoustic telemetry of tagged individuals. Sightings revealed a clear seasonal pattern with a peak between October and February and no sharks observed at other times. By contrast, acoustic telemetry demonstrated yearround residency of R. typus. The sharks use a different habitat in the offseason, swimming deeper and further away from shore, presumably in response to prey distributions. This behavioural change reduces the sharks\\' visibility, giving the false impression that they have left the area.We demonstrate, for the first timeto our knowledge, year-roundresidencyofunprovisioned, individual R. typus at an aggregation site, and highlight the importance of using multiple techniques to study the movement ecology of marine megafauna. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  13. A novel assay reveals hygrotactic behavior in Drosophila.

    Directory of Open Access Journals (Sweden)

    Feiteng Ji

    Full Text Available Humidity is one of the most important factors that determines the geographical distribution and survival of terrestrial animals. The ability to detect variation in humidity is conserved across many species. Here, we established a novel behavioral assay that revealed the thirsty Drosophila exhibits strong hygrotactic behavior, and it can locate water by detecting humidity gradient. In addition, exposure to high levels of moisture was sufficient to elicit proboscis extension reflex behavior in thirsty flies. Furthermore, we found that the third antennal segment was necessary for hygrotactic behavior in thirsty flies, while arista was required for the avoidance of moist air in hydrated flies. These results indicated that two types of hygroreceptor cells exist in Drosophila: one located in the third antennal segment that mediates hygrotactic behavior in thirst status, and the other located in arista which is responsible for the aversive behavior toward moist air in hydration status. Using a neural silencing screen, we demonstrated that synaptic output from the mushroom body α/β surface and posterior neurons was required for both hygrotactic behavior and moisture-aversive behavior.

  14. Kinematics of Mass Transport Deposits revealed by magnetic fabrics

    Science.gov (United States)

    Weinberger, R.; Levi, T.; Alsop, G. I.; Marco, S.

    2017-08-01

    The internal deformation and movement directions of Mass Transport Deposits (MTDs) are key factors in understanding the kinematics and dynamics of their emplacement. Although these are relatively easy to recover from well-bedded sediments, they are more difficult to deduce from massive beds without visible strain markers. In order to test the applicability of using anisotropy of magnetic susceptibility (AMS) to determine MTD movement, we compare AMS fabrics, with structural measurements of visible kinematic indicators. Our case study involves the structural analysis of slumped lake sediments extensively exposed in MTDs within the Dead Sea Basin. Structural analyses of MTDs outcropping for >100 km reveal radial transport directions toward the basin depocenter. We show that the AMS fabrics display the same transport directions as inferred from structural analyses. Based on this similarity, we outline a robust procedure to obtain the transport direction of slumped MTDs from AMS fabrics. Variations in the magnetic fabrics and anisotropies in fold-thrust systems within the slumps match the various structural domains. We therefore suggest that magnetic fabrics and anisotropy variations in drill cores may reflect internal deformation within the slumps rather than different slumps. Obtaining magnetic fabrics from MTDs provides a viable way to infer the transport directions and internal deformation of MTDs and reconstruct the basin depocenter in ancient settings. The present results also have implications beyond the kinematics of MTDs, as their geometry resembles fold-thrust systems in other geological settings, scales, and tectonic environments.

  15. Statistical universals reveal the structures and functions of human music.

    Science.gov (United States)

    Savage, Patrick E; Brown, Steven; Sakai, Emi; Currie, Thomas E

    2015-07-21

    Music has been called "the universal language of mankind." Although contemporary theories of music evolution often invoke various musical universals, the existence of such universals has been disputed for decades and has never been empirically demonstrated. Here we combine a music-classification scheme with statistical analyses, including phylogenetic comparative methods, to examine a well-sampled global set of 304 music recordings. Our analyses reveal no absolute universals but strong support for many statistical universals that are consistent across all nine geographic regions sampled. These universals include 18 musical features that are common individually as well as a network of 10 features that are commonly associated with one another. They span not only features related to pitch and rhythm that are often cited as putative universals but also rarely cited domains including performance style and social context. These cross-cultural structural regularities of human music may relate to roles in facilitating group coordination and cohesion, as exemplified by the universal tendency to sing, play percussion instruments, and dance to simple, repetitive music in groups. Our findings highlight the need for scientists studying music evolution to expand the range of musical cultures and musical features under consideration. The statistical universals we identified represent important candidates for future investigation.

  16. Geometric Mechanics Reveals Optimal Complex Terrestrial Undulation Patterns

    Science.gov (United States)

    Gong, Chaohui; Astley, Henry; Schiebel, Perrin; Dai, Jin; Travers, Matthew; Goldman, Daniel; Choset, Howie; CMU Team; GT Team

    Geometric mechanics offers useful tools for intuitively analyzing biological and robotic locomotion. However, utility of these tools were previously restricted to systems that have only two internal degrees of freedom and in uniform media. We show kinematics of complex locomotors that make intermittent contacts with substrates can be approximated as a linear combination of two shape bases, and can be represented using two variables. Therefore, the tools of geometric mechanics can be used to analyze motions of locomotors with many degrees of freedom. To demonstrate the proposed technique, we present studies on two different types of snake gaits which utilize combinations of waves in the horizontal and vertical planes: sidewinding (in the sidewinder rattlesnake C. cerastes) and lateral undulation (in the desert specialist snake C. occipitalis). C. cerastes moves by generating posteriorly traveling body waves in the horizontal and vertical directions, with a relative phase offset equal to +/-π/2 while C. occipitalismaintains a π/2 offset of a frequency doubled vertical wave. Geometric analysis reveals these coordination patterns enable optimal movement in the two different styles of undulatory terrestrial locomotion. More broadly, these examples demonstrate the utility of geometric mechanics in analyzing realistic biological and robotic locomotion.

  17. Artemin Crystal Structure Reveals Insights into Heparan Sulfate Binding

    Energy Technology Data Exchange (ETDEWEB)

    Silvian,L.; Jin, P.; Carmillo, P.; Boriack-Sjodin, P.; Pelletier, C.; Rushe, M.; Gong, B.; Sah, D.; Pepinsky, B.; Rossomando, A.

    2006-01-01

    Artemin (ART) promotes the growth of developing peripheral neurons by signaling through a multicomponent receptor complex comprised of a transmembrane tyrosine kinase receptor (cRET) and a specific glycosylphosphatidylinositol-linked co-receptor (GFR{alpha}3). Glial cell line-derived neurotrophic factor (GDNF) signals through a similar ternary complex but requires heparan sulfate proteoglycans (HSPGs) for full activity. HSPG has not been demonstrated as a requirement for ART signaling. We crystallized ART in the presence of sulfate and solved its structure by isomorphous replacement. The structure reveals ordered sulfate anions bound to arginine residues in the pre-helix and amino-terminal regions that were organized in a triad arrangement characteristic of heparan sulfate. Three residues in the pre-helix were singly or triply substituted with glutamic acid, and the resulting proteins were shown to have reduced heparin-binding affinity that is partly reflected in their ability to activate cRET. This study suggests that ART binds HSPGs and identifies residues that may be involved in HSPG binding.

  18. Artificial spatiotemporal touch inputs reveal complementary decoding in neocortical neurons.

    Science.gov (United States)

    Oddo, Calogero M; Mazzoni, Alberto; Spanne, Anton; Enander, Jonas M D; Mogensen, Hannes; Bengtsson, Fredrik; Camboni, Domenico; Micera, Silvestro; Jörntell, Henrik

    2017-04-04

    Investigations of the mechanisms of touch perception and decoding has been hampered by difficulties in achieving invariant patterns of skin sensor activation. To obtain reproducible spatiotemporal patterns of activation of sensory afferents, we used an artificial fingertip equipped with an array of neuromorphic sensors. The artificial fingertip was used to transduce real-world haptic stimuli into spatiotemporal patterns of spikes. These spike patterns were delivered to the skin afferents of the second digit of rats via an array of stimulation electrodes. Combined with low-noise intra- and extracellular recordings from neocortical neurons in vivo, this approach provided a previously inaccessible high resolution analysis of the representation of tactile information in the neocortical neuronal circuitry. The results indicate high information content in individual neurons and reveal multiple novel neuronal tactile coding features such as heterogeneous and complementary spatiotemporal input selectivity also between neighboring neurons. Such neuronal heterogeneity and complementariness can potentially support a very high decoding capacity in a limited population of neurons. Our results also indicate a potential neuroprosthetic approach to communicate with the brain at a very high resolution and provide a potential novel solution for evaluating the degree or state of neurological disease in animal models.

  19. Comparative metatranscriptomics reveals decline of a neustonic planktonic population

    KAUST Repository

    Mojib, Nazia; Thimma, Manjula; Kumaran, M.; Sougrat, Rachid; Irigoien, Xabier

    2016-01-01

    The neuston layer in tropical seas provides a good model to study the effects of increased levels of different stressors (e.g., temperature, ultraviolet radiation and Trichodesmium blooms). Here, we use a comparative in situ metatranscriptomics approach to reveal the functional genomic composition of metabolically active neustonic mesozooplankton community in response to the summer conditions in the Red Sea. The neustonic population exhibited changes in composition and abundance with a significant decline in copepods and appendicularia in July, when Trichodesmium cells were more abundant along with high temperatures and UV-B radiation. Nearly 23,000 genes were differentially expressed at the community level when the metatranscriptomes of the neustonic zooplankton were compared in April, July, and October. On a wider Phylum level, the genes related to oxidative phosphorylation, carbon, nucleotides, amino acids, and lipids were significantly overrepresented in both arthropods and chordates in April and October. On organism level for copepods, expression of genes responsive to oxidative stress, defense against bacteria, immune response, and virus reproduction were increased along with the observed increased appearance of copepod carcasses in the samples collected during July. The differences in expression correspond either to secondary effects of the Trichodesmium bloom or more likely to the increased UV-B radiation in July. Given the dearth of information on the zooplankton gene expression in response to environmental stimuli, our study provides the first transcriptome landscape of the mesozooplankton community during a period of increased mortality of the copepod and appendicularia population.

  20. Metabonomics reveals metabolite changes in biliary atresia infants.

    Science.gov (United States)

    Zhou, Kejun; Xie, Guoxiang; Wang, Jun; Zhao, Aihua; Liu, Jiajian; Su, Mingming; Ni, Yan; Zhou, Ying; Pan, Weihua; Che, Yanran; Zhang, Ting; Xiao, Yongtao; Wang, Yang; Wen, Jie; Jia, Wei; Cai, Wei

    2015-06-05

    Biliary atresia (BA) is a rare neonatal cholestatic disorder caused by obstruction of extra- and intra-hepatic bile ducts. If untreated, progressive liver cirrhosis will lead to death within 2 years. Early diagnosis and operation improve the outcome significantly. Infants with neonatal hepatitis syndrome (NHS) present similar symptoms, confounding the early diagnosis of BA. The lack of noninvasive diagnostic methods to differentiate BA from NHS greatly delays the surgery of BA infants, thus deteriorating the outcome. Here we performed a metabolomics study in plasma of BA, NHS, and healthy infants using gas chromatography-time-of-flight mass spectrometry. Scores plots of orthogonal partial least-squares discriminant analysis clearly separated BA from NHS and healthy infants. Eighteen metabolites were found to be differentially expressed between BA and NHS, among which seven (l-glutamic acid, l-ornithine, l-isoleucine, l-lysine, l-valine, l-tryptophan, and l-serine) were amino acids. The altered amino acids were quantitatively verified using ultraperformance liquid chromatography-tandem mass spectrometry. Ingenuity pathway analysis revealed the network of "Cellular Function and Maintenance, Hepatic System Development and Function, Neurological Disease" was altered most significantly. This study suggests that plasma metabolic profiling has great potential in differentiating BA from NHS, and amino acid metabolism is significantly different between the two diseases.

  1. Urine Metabonomics Reveals Early Biomarkers in Diabetic Cognitive Dysfunction.

    Science.gov (United States)

    Song, Lili; Zhuang, Pengwei; Lin, Mengya; Kang, Mingqin; Liu, Hongyue; Zhang, Yuping; Yang, Zhen; Chen, Yunlong; Zhang, Yanjun

    2017-09-01

    Recently, increasing attention has been paid to diabetic encephalopathy, which is a frequent diabetic complication and affects nearly 30% of diabetics. Because cognitive dysfunction from diabetic encephalopathy might develop into irreversible dementia, early diagnosis and detection of this disease is of great significance for its prevention and treatment. This study is to investigate the early specific metabolites biomarkers in urine prior to the onset of diabetic cognitive dysfunction (DCD) by using metabolomics technology. An ultra-high performance liquid-chromatography-quadrupole time-of-flight-mass spectrometry (UPLC-Q/TOF-MS) platform was used to analyze the urine samples from diabetic mice that were associated with mild cognitive impairment (MCI) and nonassociated with MCI in the stage of diabetes (prior to the onset of DCD). We then screened and validated the early biomarkers using OPLS-DA model and support vector machine (SVM) method. Following multivariate statistical and integration analysis, we found that seven metabolites could be accepted as early biomarkers of DCD, and the SVM results showed that the prediction accuracy is as high as 91.66%. The identities of four biomarkers were determined by mass spectrometry. The identified biomarkers were largely involved in nicotinate and nicotinamide metabolism, glutathione metabolism, tryptophan metabolism, and sphingolipid metabolism. The present study first revealed reliable biomarkers for early diagnosis of DCD. It provides new insight and strategy for the early diagnosis and treatment of DCD.

  2. Revealing the hidden structural phases of FeRh

    Science.gov (United States)

    Kim, Jinwoong; Ramesh, R.; Kioussis, Nicholas

    2016-11-01

    Ab initio electronic structure calculations reveal that tetragonal distortion has a dramatic effect on the relative stability of the various magnetic structures (C-, A-, G-, A'-AFM, and FM) of FeRh giving rise to a wide range of novel stable/metastable structures and magnetic phase transitions between these states. We predict that the cubic G-AFM structure, which was believed thus far to be the ground state, is metastable and that the tetragonally expanded G-AFM is the stable structure. The low energy barrier separating these states suggests phase coexistence at room temperature. We propose an A'-AFM phase to be the global ground state among all magnetic phases which arises from the strain-induced tuning of the exchange interactions. The results elucidate the underlying mechanism for the recent experimental findings of electric-field control of magnetic phase transition driven via tetragonal strain. The magnetic phase transitions open interesting prospects for exploiting strain engineering for the next-generation memory devices.

  3. A Global Synthesis Reveals Gaps in Coastal Habitat Restoration Research

    Directory of Open Access Journals (Sweden)

    Y. Stacy Zhang

    2018-04-01

    Full Text Available Coastal ecosystems have drastically declined in coverage and condition across the globe. To combat these losses, marine conservation has recently employed habitat restoration as a strategy to enhance depleted coastal ecosystems. For restoration to be a successful enterprise, however, it is necessary to identify and address potential knowledge gaps and review whether the field has tracked scientific advances regarding best practices. This enables managers, researchers, and practitioners alike to more readily establish restoration priorities and goals. We synthesized the peer-reviewed, published literature on habitat restoration research in salt marshes, oyster reefs, and seagrasses to address three questions related to restoration efforts: (i How frequent is cross-sector authorship in coastal restoration research? (ii What is the geographic distribution of coastal restoration research? and (iii Are abiotic and biotic factors equally emphasized in the literature, and how does this vary with time? Our vote-count survey indicated that one-third of the journal-published studies listed authors from at least two sectors, and 6% listed authors from all three sectors. Across all habitat types, there was a dearth of studies from Africa, Asia, and South America. Finally, despite many experimental studies demonstrating that species interactions can greatly affect the recovery and persistence of coastal foundation species, only one-fourth of the studies we examined discussed their effects on restoration. Combined, our results reveal gaps and discrepancies in restoration research that should be addressed in order to further propel coastal restoration science.

  4. Comparative Genomic Analysis Reveals Ecological Differentiation in the Genus Carnobacterium.

    Science.gov (United States)

    Iskandar, Christelle F; Borges, Frédéric; Taminiau, Bernard; Daube, Georges; Zagorec, Monique; Remenant, Benoît; Leisner, Jørgen J; Hansen, Martin A; Sørensen, Søren J; Mangavel, Cécile; Cailliez-Grimal, Catherine; Revol-Junelles, Anne-Marie

    2017-01-01

    Lactic acid bacteria (LAB) differ in their ability to colonize food and animal-associated habitats: while some species are specialized and colonize a limited number of habitats, other are generalist and are able to colonize multiple animal-linked habitats. In the current study, Carnobacterium was used as a model genus to elucidate the genetic basis of these colonization differences. Analyses of 16S rRNA gene meta-barcoding data showed that C. maltaromaticum followed by C. divergens are the most prevalent species in foods derived from animals (meat, fish, dairy products), and in the gut. According to phylogenetic analyses, these two animal-adapted species belong to one of two deeply branched lineages. The second lineage contains species isolated from habitats where contact with animal is rare. Genome analyses revealed that members of the animal-adapted lineage harbor a larger secretome than members of the other lineage. The predicted cell-surface proteome is highly diversified in C. maltaromaticum and C. divergens with genes involved in adaptation to the animal milieu such as those encoding biopolymer hydrolytic enzymes, a heme uptake system, and biopolymer-binding adhesins. These species also exhibit genes for gut adaptation and respiration. In contrast, Carnobacterium species belonging to the second lineage encode a poorly diversified cell-surface proteome, lack genes for gut adaptation and are unable to respire. These results shed light on the important genomics traits required for adaptation to animal-linked habitats in generalist Carnobacterium .

  5. Nicotinamide riboside kinase structures reveal new pathways to NAD+.

    Directory of Open Access Journals (Sweden)

    Wolfram Tempel

    2007-10-01

    Full Text Available The eukaryotic nicotinamide riboside kinase (Nrk pathway, which is induced in response to nerve damage and promotes replicative life span in yeast, converts nicotinamide riboside to nicotinamide adenine dinucleotide (NAD+ by phosphorylation and adenylylation. Crystal structures of human Nrk1 bound to nucleoside and nucleotide substrates and products revealed an enzyme structurally similar to Rossmann fold metabolite kinases and allowed the identification of active site residues, which were shown to be essential for human Nrk1 and Nrk2 activity in vivo. Although the structures account for the 500-fold discrimination between nicotinamide riboside and pyrimidine nucleosides, no enzyme feature was identified to recognize the distinctive carboxamide group of nicotinamide riboside. Indeed, nicotinic acid riboside is a specific substrate of human Nrk enzymes and is utilized in yeast in a novel biosynthetic pathway that depends on Nrk and NAD+ synthetase. Additionally, nicotinic acid riboside is utilized in vivo by Urh1, Pnp1, and Preiss-Handler salvage. Thus, crystal structures of Nrk1 led to the identification of new pathways to NAD+.

  6. Comparative metatranscriptomics reveals decline of a neustonic planktonic population

    KAUST Repository

    Mojib, Nazia

    2016-10-20

    The neuston layer in tropical seas provides a good model to study the effects of increased levels of different stressors (e.g., temperature, ultraviolet radiation and Trichodesmium blooms). Here, we use a comparative in situ metatranscriptomics approach to reveal the functional genomic composition of metabolically active neustonic mesozooplankton community in response to the summer conditions in the Red Sea. The neustonic population exhibited changes in composition and abundance with a significant decline in copepods and appendicularia in July, when Trichodesmium cells were more abundant along with high temperatures and UV-B radiation. Nearly 23,000 genes were differentially expressed at the community level when the metatranscriptomes of the neustonic zooplankton were compared in April, July, and October. On a wider Phylum level, the genes related to oxidative phosphorylation, carbon, nucleotides, amino acids, and lipids were significantly overrepresented in both arthropods and chordates in April and October. On organism level for copepods, expression of genes responsive to oxidative stress, defense against bacteria, immune response, and virus reproduction were increased along with the observed increased appearance of copepod carcasses in the samples collected during July. The differences in expression correspond either to secondary effects of the Trichodesmium bloom or more likely to the increased UV-B radiation in July. Given the dearth of information on the zooplankton gene expression in response to environmental stimuli, our study provides the first transcriptome landscape of the mesozooplankton community during a period of increased mortality of the copepod and appendicularia population.

  7. Revealing Amphiphilic Nanodornains of Anti-Biofouling Polymer Coatings

    Energy Technology Data Exchange (ETDEWEB)

    Amadei, CA; Yang, R; Chiesa, M; Gleason, KK; Santos, S

    2014-04-09

    Undesired bacterial adhesion and biofilm formation on wetted surfaces leads to significant economic and environmental costs in various industries. Amphiphilic coatings with molecular hydrophilic and hydrophobic patches can mitigate such biofouling effectively in an environmentally friendly manner. The coatings are synthesized by copolymerizing (Hydroxyethyl)methacrylate and perfluorodecylacrylate via initiated chemical vapor deposition (iCVD). In previous studies, the size of the patches was estimated to be similar to 1.4-1.75 nm by fitting protein adsorption data to a theoretical model. However, no direct observations of the molecular heterogeneity exist and therefore the origin of the fouling resistance of amphiphilic coatings remains unclear. Here, the amphiphilic nature is investigated by amplitude modulation atomic force microscopy (AM-AFM). High-resolution images obtained by penetrating and oscillating the AFM tip under the naturally present water layer with sub-nanometer amplitudes reveal, for the first time, the existence of amphiphilic nanodomains (1-2 nm(2)). Compositional heterogeneity at the nanoscale is further corroborated by a statistical analysis on the data obtained with dynamic AM-AFM force spectroscopy. Variations in the long range attractive forces, responsible for water affinity, are also identified. These nanoscopic results on the polymers wettability are also confirmed by contact angle measurements (i.e., static and dynamic). The unprecedented ability to visualize the amphiphilic nanodomains as well as sub-nanometer crystalline structures provides strong evidence for the existence of previously postulated nanostructures, and sheds light on the underlying antifouling mechanism of amphiphilic chemistry.

  8. Polymyalgia Rheumatica Revealing a Lymphoma: A Two-Case Report

    Directory of Open Access Journals (Sweden)

    Frank Verhoeven

    2016-01-01

    Full Text Available Introduction. Polymyalgia rheumatica (PMR is one of the most common inflammatory rheumatism types in elderly population. The link between cancer and PMR is a matter of debate. Methods. We report two cases of PMR leading to the diagnosis of lymphoma and the growing interest of PET-TDM in this indication. Results. A 84-year-old man known for idiopathic neutropenia presented an inflammatory arthromyalgia of the limb girdle since one month. Blood exams highlighted the presence of a monoclonal B cell clone. Bone marrow concluded to a B cell lymphoma of the marginal zone. He was successfully treated with 0.3 mg/kg/d of prednisone, and response was sustained after 6 months. A 73-year-old man known for prostatic neoplasia in remission for 5 years presented arthromyalgia of the limb girdle since one month. PET-CT revealed bursitis of the hips and the shoulders, no prostatic cancer recurrence, and a metabolically active iliac lymphadenopathy whose pathologic exam concluded to a low grade follicular lymphoma. He was successfully treated with 0.3 mg/kg/d of prednisone. Conclusion. These observations may imply that lymphoma is sometimes already present when PMR is diagnosed and PET-CT is a useful tool in the initial assessment of PMR to avoid missing neoplasia.

  9. Beyond Contagion: Reality Mining Reveals Complex Patterns of Social Influence.

    Science.gov (United States)

    Alshamsi, Aamena; Pianesi, Fabio; Lepri, Bruno; Pentland, Alex; Rahwan, Iyad

    2015-01-01

    Contagion, a concept from epidemiology, has long been used to characterize social influence on people's behavior and affective (emotional) states. While it has revealed many useful insights, it is not clear whether the contagion metaphor is sufficient to fully characterize the complex dynamics of psychological states in a social context. Using wearable sensors that capture daily face-to-face interaction, combined with three daily experience sampling surveys, we collected the most comprehensive data set of personality and emotion dynamics of an entire community of work. From this high-resolution data about actual (rather than self-reported) face-to-face interaction, a complex picture emerges where contagion (that can be seen as adaptation of behavioral responses to the behavior of other people) cannot fully capture the dynamics of transitory states. We found that social influence has two opposing effects on states: adaptation effects that go beyond mere contagion, and complementarity effects whereby individuals' behaviors tend to complement the behaviors of others. Surprisingly, these effects can exhibit completely different directions depending on the stable personality or emotional dispositions (stable traits) of target individuals. Our findings provide a foundation for richer models of social dynamics, and have implications on organizational engineering and workplace well-being.

  10. Analysis reveals potential rangeland impacts if Williamson Act eliminated

    Directory of Open Access Journals (Sweden)

    William C. Wetzel

    2012-10-01

    Full Text Available California budget cuts have resulted in dramatic reductions in state funding for the Williamson Act, a land protection program that reduces property taxes for the owners of 15 million acres of California farms and rangeland. With state reimbursements to counties eliminated, the decision to continue Williamson Act contracts lies with individual counties. We investigated the consequences of eliminating the Williamson Act, using a geospatial analysis and a mail questionnaire asking ranchers for plans under a hypothetical elimination scenario. The geospatial analysis revealed that 72% of rangeland parcels enrolled in Williamson Act contracts contained habitat important for statewide conservation goals. Presented with the elimination scenario, survey respondents reported an intention to sell 20% of their total 496,889 acres. The tendency of survey participants to respond that they would sell land was highest among full-time ranchers with low household incomes and without off-ranch employment. A majority (76% of the ranchers who reported that they would sell land predicted that the buyers would develop it for nonagricultural uses, suggesting substantial changes to California's landscape in a future without the Williamson Act.

  11. THE SUICIDE IN ITS TO REVEAL IT PROFESSIONAL OF HEALTH

    Directory of Open Access Journals (Sweden)

    Viviane Picinato da Silva

    2006-12-01

    Full Text Available ABSTRACT: The number of suicide case and attempting are increasing at last decades and became a great concern in many countries. In front to my observations and literature consulting, an important question emerged from: Do the professional who care people with attempting suicide history are prepared to deal with this situation? This study was conduced on a Phenomenological Inquiry method with medicine doctors, nurses and nursing staff professionals Psychiatric Clinic at the Emergency Unity of the Sao Paulo – Ribeirão Preto Clinical Hospital, from July to August 2003. The following guiding question was proposed: How suicide shows for you? From interviewing answers analysis, thematic categories was constructed revealing, thus, that the suicide is shown to these professionals as something that occurs at a desperation moment, which people appeals to call attention and something that awakes to them a diversity of feelings. From speeches analysis was possible to understand that the study evidences the necessity of introducing, in mental health area, specialized professionals. The specialization makes possible to the professionals to better deal with the preconceptions and difficulties, thus opening, perspectives for a better care to the people whom do not perceive sense in their own lives. KEYWORDS: Suicide, Suicide, Attempted; Mental Health.

  12. THE SUICIDE IN ITS TO REVEAL IT PROFESSIONAL OF HEALTH

    Directory of Open Access Journals (Sweden)

    Magali Roseira Boemer

    2004-08-01

    Full Text Available The number of suicide case and attempting are increasing at last decades and became a great concernin many countries. In front to my observations and literature consulting, an important question emerged from: Do theprofessional who care people with attempting suicide history are prepared to deal with this situation? This study wasconduced on a Phenomenological Inquiry method with medicine doctors, nurses and nursing staff professionalsPsychiatric Clinic at the Emergency Unity of the Sao Paulo – Ribeirão Preto Clinical Hospital, from July to August2003. The following guiding question was proposed: How suicide shows for you? From interviewing answers analysis,thematic categories was constructed revealing, thus, that the suicide is shown to these professionals as something thatoccurs at a desperation moment, which people appeals to call attention and something that awakes to them a diversityof feelings. From speeches analysis was possible to understand that the study evidences the necessity of introducing,in mental health area, specialized professionals. The specialization makes possible to the professionals to better dealwith the preconceptions and difficulties, thus opening, perspectives for a better care to the people whom do notperceive sense in their own lives.

  13. Genomic analysis of primordial dwarfism reveals novel disease genes.

    Science.gov (United States)

    Shaheen, Ranad; Faqeih, Eissa; Ansari, Shinu; Abdel-Salam, Ghada; Al-Hassnan, Zuhair N; Al-Shidi, Tarfa; Alomar, Rana; Sogaty, Sameera; Alkuraya, Fowzan S

    2014-02-01

    Primordial dwarfism (PD) is a disease in which severely impaired fetal growth persists throughout postnatal development and results in stunted adult size. The condition is highly heterogeneous clinically, but the use of certain phenotypic aspects such as head circumference and facial appearance has proven helpful in defining clinical subgroups. In this study, we present the results of clinical and genomic characterization of 16 new patients in whom a broad definition of PD was used (e.g., 3M syndrome was included). We report a novel PD syndrome with distinct facies in two unrelated patients, each with a different homozygous truncating mutation in CRIPT. Our analysis also reveals, in addition to mutations in known PD disease genes, the first instance of biallelic truncating BRCA2 mutation causing PD with normal bone marrow analysis. In addition, we have identified a novel locus for Seckel syndrome based on a consanguineous multiplex family and identified a homozygous truncating mutation in DNA2 as the likely cause. An additional novel PD disease candidate gene XRCC4 was identified by autozygome/exome analysis, and the knockout mouse phenotype is highly compatible with PD. Thus, we add a number of novel genes to the growing list of PD-linked genes, including one which we show to be linked to a novel PD syndrome with a distinct facial appearance. PD is extremely heterogeneous genetically and clinically, and genomic tools are often required to reach a molecular diagnosis.

  14. Can strong correlations be experimentally revealed for Ҡ -mesons?

    Directory of Open Access Journals (Sweden)

    Hiesmayr Beatrix C.

    2014-01-01

    Full Text Available In 1964 the physicists John St. Bell working at CERN took the 1935-idea of Einstein-Podolsky-Rosen seriously and found that all theories based on local realism have to satisfy a certain inequality, nowadays dubbed Bell’s inequality. Experiments with ordinary matter systems or light show violations of Bell’s inequality favouring the quantum theory though a loophole free experiment has not yet been performed. This contribution presents an experimentally feasible Bell inequality for systems at higher energy scales, i.e. entangled neutral Ҡ -meson pairs that are typically produced in Φ -mesons decays or proton-antiproton annihilation processes. Strong requirements have to be overcome in order to achieve a conclusive tests, such a proposal was recently published. Surprisingly, this new Bell inequality reveals new features for weakly decaying particles, in particular, a strong sensitivity to the combined charge-conjugation-parity (CP symmetry. Here-with, a puzzling relation between a symmetry breaking for mesons and Bell’s inequality—which is a necessary and sufficient condition for the security of quantum cryptography protocols— is established. This becomes the more important since CP symmetry is related to the cosmological question why the antimatter disappeared after the Big Bang.

  15. CRISPR loci reveal networks of gene exchange in archaea.

    Science.gov (United States)

    Brodt, Avital; Lurie-Weinberger, Mor N; Gophna, Uri

    2011-12-21

    CRISPR (Clustered, Regularly, Interspaced, Short, Palindromic Repeats) loci provide prokaryotes with an adaptive immunity against viruses and other mobile genetic elements. CRISPR arrays can be transcribed and processed into small crRNA molecules, which are then used by the cell to target the foreign nucleic acid. Since spacers are accumulated by active CRISPR/Cas systems, the sequences of these spacers provide a record of the past "infection history" of the organism. Here we analyzed all currently known spacers present in archaeal genomes and identified their source by DNA similarity. While nearly 50% of archaeal spacers matched mobile genetic elements, such as plasmids or viruses, several others matched chromosomal genes of other organisms, primarily other archaea. Thus, networks of gene exchange between archaeal species were revealed by the spacer analysis, including many cases of inter-genus and inter-species gene transfer events. Spacers that recognize viral sequences tend to be located further away from the leader sequence, implying that there exists a selective pressure for their retention. CRISPR spacers provide direct evidence for extensive gene exchange in archaea, especially within genera, and support the current dogma where the primary role of the CRISPR/Cas system is anti-viral and anti-plasmid defense. This article was reviewed by: Profs. W. Ford Doolittle, John van der Oost, Christa Schleper (nominated by board member Prof. J Peter Gogarten).

  16. Symbolic joint entropy reveals the coupling of various brain regions

    Science.gov (United States)

    Ma, Xiaofei; Huang, Xiaolin; Du, Sidan; Liu, Hongxing; Ning, Xinbao

    2018-01-01

    The convergence and divergence of oscillatory behavior of different brain regions are very important for the procedure of information processing. Measurements of coupling or correlation are very useful to study the difference of brain activities. In this study, EEG signals were collected from ten subjects under two conditions, i.e. eyes closed state and idle with eyes open. We propose a nonlinear algorithm, symbolic joint entropy, to compare the coupling strength among the frontal, temporal, parietal and occipital lobes and between two different states. Instead of decomposing the EEG into different frequency bands (theta, alpha, beta, gamma etc.), the novel algorithm is to investigate the coupling from the entire spectrum of brain wave activities above 4Hz. The coupling coefficients in two states with different time delay steps are compared and the group statistics are presented as well. We find that the coupling coefficient of eyes open state with delay consistently lower than that of eyes close state across the group except for one subject, whereas the results without delay are not consistent. The differences between two brain states with non-zero delay can reveal the intrinsic inter-region coupling better. We also use the well-known Hénon map data to validate the algorithm proposed in this paper. The result shows that the method is robust and has a great potential for other physiologic time series.

  17. Multiple skeletal muscle metastases revealing a cardiac intimal sarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Crombe, Amandine [Institut Bergonie, Department of Radiology, Bordeaux (France); Lintingre, Pierre-Francois; Dallaudiere, Benjamin [Clinique du Sport de Bordeaux-Merignac, Department of Musculoskeletal Radiology, Merignac (France); Le Loarer, Francois [Institut Bergonie, Department of Pathology, Bordeaux (France); Lachatre, Denis [Dupuytren University Hospital, Department of Radiology, Limoges (France)

    2018-01-15

    We report the case of a 59-year-old female with progressive bilateral painful swelling of the thighs. MRI revealed multiple intramuscular necrotic masses with similar morphologic patterns. Whole-body CT and 18-FDG PET-CT scans demonstrated additional hypermetabolic muscular masses and a lobulated lesion within the left atrial cavity. As biopsy of a muscular mass was compatible with a poorly differentiated sarcoma with MDM2 oncogene amplification, two diagnoses were discussed: a dedifferentiated liposarcoma with muscle and heart metastases or a primary cardiac sarcoma, mainly a cardiac intimal sarcoma, with muscular metastases, which was finally confirmed by array-comparative genomic hybridization (aCGH) in a sarcoma reference center. This case emphasizes the potential for intimal sarcoma to disseminate in skeletal muscle prior to any other organ and the need for a genomic approach in addition to classical radiopathologic analyses to distinguish primary from secondary locations facing simultaneous tumors of the heart and skeletal muscles with MDM2 amplification. (orig.)

  18. Molecular analysis of sourdough reveals Lactobacillus mindensis sp. nov.

    Science.gov (United States)

    Ehrmann, Matthias A; Müller, Martin R A; Vogel, Rudi F

    2003-01-01

    Genotypic fingerprinting to analyse the bacterial flora of an industrial sourdough revealed a coherent group of strains which could not be associated with a valid species. Comparative 16S rDNA sequence analysis showed that these strains formed a homogeneous cluster distinct from their closest relatives, Lactobacillus farciminis, Lactobacillus alimentarius and Lactobacillus kimchii. To characterize them further, physiological (sugar fermentation, formation of DL-lactate, hydrolysis of arginine, growth temperature, CO2 production) and chemotaxonomic properties have been determined. The DNA G +C content was 37.5 0.2 mol%. The peptidoglycan was of the lysine-D-iso-asparagine (L-Lys-D-Asp) type. The strains were homofermentative, Gram-positive, catalase-negative, non-spore-forming, non-motile rods. They were found as a major stable component of a rye flour sourdough fermentation. Physiological, biochemical as well as genotypic data suggested them to be a new species of the genus Lactobacillus. This was confirmed by DNA-DNA hybridization of genomic DNA, and the name Lactobacillus mindensis is proposed. The type strain of this species is DSM 14500T (=LMG 21508T).

  19. Strategy revealing phenotypic differences among synthetic oscillator designs.

    Science.gov (United States)

    Lomnitz, Jason G; Savageau, Michael A

    2014-09-19

    Considerable progress has been made in identifying and characterizing the component parts of genetic oscillators, which play central roles in all organisms. Nonlinear interaction among components is sufficiently complex that mathematical models are required to elucidate their elusive integrated behavior. Although natural and synthetic oscillators exhibit common architectures, there are numerous differences that are poorly understood. Utilizing synthetic biology to uncover basic principles of simpler circuits is a way to advance understanding of natural circadian clocks and rhythms. Following this strategy, we address the following questions: What are the implications of different architectures and molecular modes of transcriptional control for the phenotypic repertoire of genetic oscillators? Are there designs that are more realizable or robust? We compare synthetic oscillators involving one of three architectures and various combinations of the two modes of transcriptional control using a methodology that provides three innovations: a rigorous definition of phenotype, a procedure for deconstructing complex systems into qualitatively distinct phenotypes, and a graphical representation for illuminating the relationship between genotype, environment, and the qualitatively distinct phenotypes of a system. These methods provide a global perspective on the behavioral repertoire, facilitate comparisons of alternatives, and assist the rational design of synthetic gene circuitry. In particular, the results of their application here reveal distinctive phenotypes for several designs that have been studied experimentally as well as a best design among the alternatives that has yet to be constructed and tested.

  20. Substrate channel in nitrogenase revealed by a molecular dynamics approach.

    Science.gov (United States)

    Smith, Dayle; Danyal, Karamatullah; Raugei, Simone; Seefeldt, Lance C

    2014-04-15

    Mo-dependent nitrogenase catalyzes the biological reduction of N2 to two NH3 molecules at FeMo-cofactor buried deep inside the MoFe protein. Access of substrates, such as N2, to the active site is likely restricted by the surrounding protein, requiring substrate channels that lead from the surface to the active site. Earlier studies on crystallographic structures of the MoFe protein have suggested three putative substrate channels. Here, we have utilized submicrosecond atomistic molecular dynamics simulations to allow the nitrogenase MoFe protein to explore its conformational space in an aqueous solution at physiological ionic strength, revealing a putative substrate channel. The viability of this observed channel was tested by examining the free energy of passage of N2 from the surface through the channel to FeMo-cofactor, resulting in the discovery of a very low energy barrier. These studies point to a viable substrate channel in nitrogenase that appears during thermal motions of the protein in an aqueous environment and that approaches a face of FeMo-cofactor earlier implicated in substrate binding.

  1. Initiation process of a thrust fault revealed by analog experiments

    Science.gov (United States)

    Yamada, Yasuhiro; Dotare, Tatsuya; Adam, Juergen; Hori, Takane; Sakaguchi, Hide

    2016-04-01

    We conducted 2D (cross-sectional) analog experiments with dry sand using a high resolution digital image correlation (DIC) technique to reveal initiation process of a thrust fault in detail, and identified a number of "weak shear bands" and minor uplift prior to the thrust initiation. The observations suggest that the process can be divided into three stages. Stage 1: characterized by a series of abrupt and short-lived weak shear bands at the location where the thrust will be generated later. Before initiation of the fault, the area to be the hanging wall starts to uplift. Stage 2: defined by the generation of the new thrust and its active displacement. The location of the new thrust seems to be constrained by its associated back-thrust, produced at the foot of the surface slope (by the previous thrust). The activity of the previous thrust turns to zero once the new thrust is generated, but the timing of these two events is not the same. Stage 3: characterized by a constant displacement along the (new) thrust. Similar minor shear bands can be seen in the toe area of the Nankai accretionary prism, SW Japan and we can correlate the along-strike variations in seismic profiles to the model results that show the characteristic features in each thrust development stage.

  2. Beyond Contagion: Reality Mining Reveals Complex Patterns of Social Influence.

    Directory of Open Access Journals (Sweden)

    Aamena Alshamsi

    Full Text Available Contagion, a concept from epidemiology, has long been used to characterize social influence on people's behavior and affective (emotional states. While it has revealed many useful insights, it is not clear whether the contagion metaphor is sufficient to fully characterize the complex dynamics of psychological states in a social context. Using wearable sensors that capture daily face-to-face interaction, combined with three daily experience sampling surveys, we collected the most comprehensive data set of personality and emotion dynamics of an entire community of work. From this high-resolution data about actual (rather than self-reported face-to-face interaction, a complex picture emerges where contagion (that can be seen as adaptation of behavioral responses to the behavior of other people cannot fully capture the dynamics of transitory states. We found that social influence has two opposing effects on states: adaptation effects that go beyond mere contagion, and complementarity effects whereby individuals' behaviors tend to complement the behaviors of others. Surprisingly, these effects can exhibit completely different directions depending on the stable personality or emotional dispositions (stable traits of target individuals. Our findings provide a foundation for richer models of social dynamics, and have implications on organizational engineering and workplace well-being.

  3. Multilocus analysis reveals three candidate genes for Chinese migraine susceptibility.

    Science.gov (United States)

    An, X-K; Fang, J; Yu, Z-Z; Lin, Q; Lu, C-X; Qu, H-L; Ma, Q-L

    2017-08-01

    Several genome-wide association studies (GWASs) in Caucasian populations have identified 12 loci that are significantly associated with migraine. More evidence suggests that serotonin receptors are also involved in migraine pathophysiology. In the present study, a case-control study was conducted in a cohort of 581 migraine cases and 533 ethnically matched controls among a Chinese population. Eighteen polymorphisms from serotonin receptors and GWASs were selected, and genotyping was performed using a Sequenom MALDI-TOF mass spectrometry iPLEX platform. The genotypic and allelic distributions of MEF2D rs2274316 and ASTN2 rs6478241 were significantly different between migraine patients and controls. Univariate and multivariate analysis revealed significant associations of polymorphisms in the MEF2D and ASTN2 genes with migraine susceptibility. MEF2D, PRDM16 and ASTN2 were also found to be associated with migraine without aura (MO) and migraine with family history. And, MEF2D and ASTN2 also served as genetic risk factors for the migraine without family history. The generalized multifactor dimensionality reduction analysis identified that MEF2D and HTR2E constituted the two-factor interaction model. Our study suggests that the MEF2D, PRDM16 and ASTN2 genes from GWAS are associated with migraine susceptibility, especially MO, among Chinese patients. It appears that there is no association with serotonin receptor related genes. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Revealing the Determinants of Widespread Alternative Splicing Perturbation in Cancer

    Directory of Open Access Journals (Sweden)

    Yongsheng Li

    2017-10-01

    Full Text Available It is increasingly appreciated that alternative splicing plays a key role in generating functional specificity and diversity in cancer. However, the mechanisms by which cancer mutations perturb splicing remain unknown. Here, we developed a network-based strategy, DrAS-Net, to investigate more than 2.5 million variants across cancer types and link somatic mutations with cancer-specific splicing events. We identified more than 40,000 driver variant candidates and their 80,000 putative splicing targets deregulated in 33 cancer types and inferred their functional impact. Strikingly, tumors with splicing perturbations show reduced expression of immune system-related genes and increased expression of cell proliferation markers. Tumors harboring different mutations in the same gene often exhibit distinct splicing perturbations. Further stratification of 10,000 patients based on their mutation-splicing relationships identifies subtypes with distinct clinical features, including survival rates. Our work reveals how single-nucleotide changes can alter the repertoires of splicing isoforms, providing insights into oncogenic mechanisms for precision medicine.

  5. Pyrosequencing Reveals Fungal Communities in the Rhizosphere of Xinjiang Jujube

    Directory of Open Access Journals (Sweden)

    Peng Liu

    2015-01-01

    Full Text Available Fungi are important soil components as both decomposers and plant symbionts and play a major role in ecological and biogeochemical processes. However, little is known about the richness and structure of fungal communities. DNA sequencing technologies allow for the direct estimation of microbial community diversity, avoiding culture-based biases. We therefore used 454 pyrosequencing to investigate the fungal communities in the rhizosphere of Xinjiang jujube. We obtained no less than 40,488 internal transcribed spacer (ITS rDNA reads, the number of each sample was 6943, 6647, 6584, 6550, 6860, and 6904, and we used bioinformatics and multivariate statistics to analyze the results. The index of diversity showed greater richness in the rhizosphere fungal community of a 3-year-old jujube than in that of an 8-year-old jujube. Most operational taxonomic units belonged to Ascomycota, and taxonomic analyses identified Hypocreales as the dominant fungal order. Our results demonstrated that the fungal orders are present in different proportions in different sampling areas. Redundancy analysis (RDA revealed a significant correlation between soil properties and the abundance of fungal phyla. Our results indicated lower fungal diversity in the rhizosphere of Xinjiang jujube than that reported in other studies, and we hope our findings provide a reference for future research.

  6. Fine-scaled human genetic structure revealed by SNP microarrays.

    Science.gov (United States)

    Xing, Jinchuan; Watkins, W Scott; Witherspoon, David J; Zhang, Yuhua; Guthery, Stephen L; Thara, Rangaswamy; Mowry, Bryan J; Bulayeva, Kazima; Weiss, Robert B; Jorde, Lynn B

    2009-05-01

    We report an analysis of more than 240,000 loci genotyped using the Affymetrix SNP microarray in 554 individuals from 27 worldwide populations in Africa, Asia, and Europe. To provide a more extensive and complete sampling of human genetic variation, we have included caste and tribal samples from two states in South India, Daghestanis from eastern Europe, and the Iban from Malaysia. Consistent with observations made by Charles Darwin, our results highlight shared variation among human populations and demonstrate that much genetic variation is geographically continuous. At the same time, principal components analyses reveal discernible genetic differentiation among almost all identified populations in our sample, and in most cases, individuals can be clearly assigned to defined populations on the basis of SNP genotypes. All individuals are accurately classified into continental groups using a model-based clustering algorithm, but between closely related populations, genetic and self-classifications conflict for some individuals. The 250K data permitted high-level resolution of genetic variation among Indian caste and tribal populations and between highland and lowland Daghestani populations. In particular, upper-caste individuals from Tamil Nadu and Andhra Pradesh form one defined group, lower-caste individuals from these two states form another, and the tribal Irula samples form a third. Our results emphasize the correlation of genetic and geographic distances and highlight other elements, including social factors that have contributed to population structure.

  7. Comparative analysis reveals the underlying mechanism of vertebrate seasonal reproduction.

    Science.gov (United States)

    Ikegami, Keisuke; Yoshimura, Takashi

    2016-02-01

    Animals utilize photoperiodic changes as a calendar to regulate seasonal reproduction. Birds have highly sophisticated photoperiodic mechanisms and functional genomics analysis in quail uncovered the signal transduction pathway regulating avian seasonal reproduction. Birds detect light with deep brain photoreceptors. Long day (LD) stimulus induces secretion of thyroid-stimulating hormone (TSH) from the pars tuberalis (PT) of the pituitary gland. PT-derived TSH locally activates thyroid hormone (TH) in the hypothalamus, which induces gonadotropin-releasing hormone (GnRH) and hence gonadotropin secretion. However, during winter, low temperatures increase serum TH for adaptive thermogenesis, which accelerates germ cell apoptosis by activating the genes involved in metamorphosis. Therefore, TH has a dual role in the regulation of seasonal reproduction. Studies using TSH receptor knockout mice confirmed the involvement of PT-derived TSH in mammalian seasonal reproduction. In addition, studies in mice revealed that the tissue-specific glycosylation of TSH diversifies its function in the circulation to avoid crosstalk. In contrast to birds and mammals, one of the molecular machineries necessary for the seasonal reproduction of fish are localized in the saccus vasculosus from the photoreceptor to the neuroendocrine output. Thus, comparative analysis is a powerful tool to uncover the universality and diversity of fundamental properties in various organisms. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Frustration-guided motion planning reveals conformational transitions in proteins.

    Science.gov (United States)

    Budday, Dominik; Fonseca, Rasmus; Leyendecker, Sigrid; van den Bedem, Henry

    2017-10-01

    Proteins exist as conformational ensembles, exchanging between substates to perform their function. Advances in experimental techniques yield unprecedented access to structural snapshots of their conformational landscape. However, computationally modeling how proteins use collective motions to transition between substates is challenging owing to a rugged landscape and large energy barriers. Here, we present a new, robotics-inspired motion planning procedure called dCC-RRT that navigates the rugged landscape between substates by introducing dynamic, interatomic constraints to modulate frustration. The constraints balance non-native contacts and flexibility, and instantaneously redirect the motion towards sterically favorable conformations. On a test set of eight proteins determined in two conformations separated by, on average, 7.5 Å root mean square deviation (RMSD), our pathways reduced the Cα atom RMSD to the goal conformation by 78%, outperforming peer methods. We then applied dCC-RRT to examine how collective, small-scale motions of four side-chains in the active site of cyclophilin A propagate through the protein. dCC-RRT uncovered a spatially contiguous network of residues linked by steric interactions and collective motion connecting the active site to a recently proposed, non-canonical capsid binding site 25 Å away, rationalizing NMR and multi-temperature crystallography experiments. In all, dCC-RRT can reveal detailed, all-atom molecular mechanisms for small and large amplitude motions. Source code and binaries are freely available at https://github.com/ExcitedStates/KGS/. © 2017 Wiley Periodicals, Inc.

  9. Towards revealing the structure of bacterial inclusion bodies.

    Science.gov (United States)

    Wang, Lei

    2009-01-01

    Protein aggregation is a widely observed phenomenon in human diseases, biopharmaceutical production, and biological research. Protein aggregates are generally classified as highly ordered, such as amyloid fibrils, or amorphous, such as bacterial inclusion bodies. Amyloid fibrils are elongated filaments with diameters of 6-12 nm, they are comprised of residue-specific cross-beta structure, and display characteristic properties, such as binding with amyloid-specific dyes. Amyloid fibrils are associated with dozens of human pathological conditions, including Alzheimer disease and prion diseases. Distinguished from amyloid fibrils, bacterial inclusion bodies display apparent amorphous morphology. Inclusion bodies are formed during high-level recombinant protein production, and formation of inclusion bodies is a major concern in biotechnology. Despite of the distinctive morphological difference, bacterial inclusion bodies have been found to have some amyloid-like properties, suggesting that they might contain structures similar to amyloid-like fibrils. Recent structural data further support this hypothesis, and this review summarizes the latest progress towards revealing the structural details of bacterial inclusion bodies.

  10. Widespread alternative and aberrant splicing revealed by lariat sequencing

    Science.gov (United States)

    Stepankiw, Nicholas; Raghavan, Madhura; Fogarty, Elizabeth A.; Grimson, Andrew; Pleiss, Jeffrey A.

    2015-01-01

    Alternative splicing is an important and ancient feature of eukaryotic gene structure, the existence of which has likely facilitated eukaryotic proteome expansions. Here, we have used intron lariat sequencing to generate a comprehensive profile of splicing events in Schizosaccharomyces pombe, amongst the simplest organisms that possess mammalian-like splice site degeneracy. We reveal an unprecedented level of alternative splicing, including alternative splice site selection for over half of all annotated introns, hundreds of novel exon-skipping events, and thousands of novel introns. Moreover, the frequency of these events is far higher than previous estimates, with alternative splice sites on average activated at ∼3% the rate of canonical sites. Although a subset of alternative sites are conserved in related species, implying functional potential, the majority are not detectably conserved. Interestingly, the rate of aberrant splicing is inversely related to expression level, with lowly expressed genes more prone to erroneous splicing. Although we validate many events with RNAseq, the proportion of alternative splicing discovered with lariat sequencing is far greater, a difference we attribute to preferential decay of aberrantly spliced transcripts. Together, these data suggest the spliceosome possesses far lower fidelity than previously appreciated, highlighting the potential contributions of alternative splicing in generating novel gene structures. PMID:26261211

  11. Musculoskeletal networks reveal topological disparity in mammalian neck evolution.

    Science.gov (United States)

    Arnold, Patrick; Esteve-Altava, Borja; Fischer, Martin S

    2017-12-13

    The increase in locomotor and metabolic performance during mammalian evolution was accompanied by the limitation of the number of cervical vertebrae to only seven. In turn, nuchal muscles underwent a reorganization while forelimb muscles expanded into the neck region. As variation in the cervical spine is low, the variation in the arrangement of the neck muscles and their attachment sites (i.e., the variability of the neck's musculoskeletal organization) is thus proposed to be an important source of neck disparity across mammals. Anatomical network analysis provides a novel framework to study the organization of the anatomical arrangement, or connectivity pattern, of the bones and muscles that constitute the mammalian neck in an evolutionary context. Neck organization in mammals is characterized by a combination of conserved and highly variable network properties. We uncovered a conserved regionalization of the musculoskeletal organization of the neck into upper, mid and lower cervical modules. In contrast, there is a varying degree of complexity or specialization and of the integration of the pectoral elements. The musculoskeletal organization of the monotreme neck is distinctively different from that of therian mammals. Our findings reveal that the limited number of vertebrae in the mammalian neck does not result in a low musculoskeletal disparity when examined in an evolutionary context. However, this disparity evolved late in mammalian history in parallel with the radiation of certain lineages (e.g., cetartiodactyls, xenarthrans). Disparity is further facilitated by the enhanced incorporation of forelimb muscles into the neck and their variability in attachment sites.

  12. Early Neolithic water wells reveal the world's oldest wood architecture.

    Science.gov (United States)

    Tegel, Willy; Elburg, Rengert; Hakelberg, Dietrich; Stäuble, Harald; Büntgen, Ulf

    2012-01-01

    The European Neolithization ~6000-4000 BC represents a pivotal change in human history when farming spread and the mobile style of life of the hunter-foragers was superseded by the agrarian culture. Permanent settlement structures and agricultural production systems required fundamental innovations in technology, subsistence, and resource utilization. Motivation, course, and timing of this transformation, however, remain debatable. Here we present annually resolved and absolutely dated dendroarchaeological information from four wooden water wells of the early Neolithic period that were excavated in Eastern Germany. A total of 151 oak timbers preserved in a waterlogged environment were dated between 5469 and 5098 BC and reveal unexpectedly refined carpentry skills. The recently discovered water wells enable for the first time a detailed insight into the earliest wood architecture and display the technological capabilities of humans ~7000 years ago. The timbered well constructions made of old oak trees feature an unopened tree-ring archive from which annually resolved and absolutely dated environmental data can be culled. Our results question the principle of continuous evolutionary development in prehistoric technology, and contradict the common belief that metal was necessary for complex timber constructions. Early Neolithic craftsmanship now suggests that the first farmers were also the first carpenters.

  13. Early Neolithic water wells reveal the world's oldest wood architecture.

    Directory of Open Access Journals (Sweden)

    Willy Tegel

    Full Text Available The European Neolithization ~6000-4000 BC represents a pivotal change in human history when farming spread and the mobile style of life of the hunter-foragers was superseded by the agrarian culture. Permanent settlement structures and agricultural production systems required fundamental innovations in technology, subsistence, and resource utilization. Motivation, course, and timing of this transformation, however, remain debatable. Here we present annually resolved and absolutely dated dendroarchaeological information from four wooden water wells of the early Neolithic period that were excavated in Eastern Germany. A total of 151 oak timbers preserved in a waterlogged environment were dated between 5469 and 5098 BC and reveal unexpectedly refined carpentry skills. The recently discovered water wells enable for the first time a detailed insight into the earliest wood architecture and display the technological capabilities of humans ~7000 years ago. The timbered well constructions made of old oak trees feature an unopened tree-ring archive from which annually resolved and absolutely dated environmental data can be culled. Our results question the principle of continuous evolutionary development in prehistoric technology, and contradict the common belief that metal was necessary for complex timber constructions. Early Neolithic craftsmanship now suggests that the first farmers were also the first carpenters.

  14. Satellite-detected fluorescence reveals global physiology of ocean phytoplankton

    Directory of Open Access Journals (Sweden)

    M. J. Behrenfeld

    2009-05-01

    Full Text Available Phytoplankton photosynthesis links global ocean biology and climate-driven fluctuations in the physical environment. These interactions are largely expressed through changes in phytoplankton physiology, but physiological status has proven extremely challenging to characterize globally. Phytoplankton fluorescence does provide a rich source of physiological information long exploited in laboratory and field studies, and is now observed from space. Here we evaluate the physiological underpinnings of global variations in satellite-based phytoplankton chlorophyll fluorescence. The three dominant factors influencing fluorescence distributions are chlorophyll concentration, pigment packaging effects on light absorption, and light-dependent energy-quenching processes. After accounting for these three factors, resultant global distributions of quenching-corrected fluorescence quantum yields reveal a striking consistency with anticipated patterns of iron availability. High fluorescence quantum yields are typically found in low iron waters, while low quantum yields dominate regions where other environmental factors are most limiting to phytoplankton growth. Specific properties of photosynthetic membranes are discussed that provide a mechanistic view linking iron stress to satellite-detected fluorescence. Our results present satellite-based fluorescence as a valuable tool for evaluating nutrient stress predictions in ocean ecosystem models and give the first synoptic observational evidence that iron plays an important role in seasonal phytoplankton dynamics of the Indian Ocean. Satellite fluorescence may also provide a path for monitoring climate-phytoplankton physiology interactions and improving descriptions of phytoplankton light use efficiencies in ocean productivity models.

  15. Wetland Microtopographic Structure is Revealed with Terrestrial Laser Scanning

    Science.gov (United States)

    Diamond, J.; Stovall, A. E.; Mclaughlin, D. L.; Slesak, R.

    2017-12-01

    Wetland microtopographic structure and its function has been the subject of research for decades, and several investigations suggest that microtopography is generated by autogenic ecohydrologic processes. But due to the difficulty of capturing the true spatial variability of wetland microtopography, many of the hypotheses for self-organization have remained elusive to test. We employ a novel method of Terrestrial Laser Scanning (TLS) that reveals an unprecedented high-resolution (structure of wetland microtopography in 10 black ash (Fraxinus nigra) stands of northern Minnesota, USA. Here we present the first efforts to synthesize this information and show that TLS provides a good representation of real microtopographic structure, where TLS accurately measured hummock height, but occlusion of low points led to a slight negative bias. We further show that TLS can accurately locate microtopographic high points (hummocks), as well as estimate their height and area. Using these new data, we estimate distributions in both microtopographic elevation and hummock area in each wetland and relate these to monitored hydrologic regime; in doing so, we test hypotheses linking emergent microtopographic patterns to putative hydrologic controls. Finally, we discuss future efforts to enumerate consequent influences of microtopography on wetland systems (soil properties and vegetation composition).

  16. Network motif frequency vectors reveal evolving metabolic network organisation.

    Science.gov (United States)

    Pearcy, Nicole; Crofts, Jonathan J; Chuzhanova, Nadia

    2015-01-01

    At the systems level many organisms of interest may be described by their patterns of interaction, and as such, are perhaps best characterised via network or graph models. Metabolic networks, in particular, are fundamental to the proper functioning of many important biological processes, and thus, have been widely studied over the past decade or so. Such investigations have revealed a number of shared topological features, such as a short characteristic path-length, large clustering coefficient and hierarchical modular structure. However, the extent to which evolutionary and functional properties of metabolism manifest via this underlying network architecture remains unclear. In this paper, we employ a novel graph embedding technique, based upon low-order network motifs, to compare metabolic network structure for 383 bacterial species categorised according to a number of biological features. In particular, we introduce a new global significance score which enables us to quantify important evolutionary relationships that exist between organisms and their physical environments. Using this new approach, we demonstrate a number of significant correlations between environmental factors, such as growth conditions and habitat variability, and network motif structure, providing evidence that organism adaptability leads to increased complexities in the resultant metabolic networks.

  17. Spatial Congruity Effects Reveal Metaphorical Thinking, not Polarity Correspondence.

    Science.gov (United States)

    Dolscheid, Sarah; Casasanto, Daniel

    2015-01-01

    Spatial congruity effects have often been interpreted as evidence for metaphorical thinking, but an alternative account based on polarity correspondence (a.k.a. markedness) has challenged this view. Here we compared metaphor- and polarity-correspondence-based explanations for spatial congruity effects, using musical pitch as a testbed. In one experiment, English speakers classified high- and low-frequency pitches as "high" and "low," or as "front" and "back," to determine whether space-pitch congruity effects could be elicited by any marked spatial continuum. Although both pairs of terms describe bipolar spatial continuums, we found congruity effects only for high/low judgments, indicating that markedness is not sufficient to produce space-pitch congruity effects. A second experiment confirmed that there were no space-pitch congruity effects for another pair of terms that have clear markedness (big/small), but which do not denote spatial height. By contrast, this experiment showed congruity effects for words that cued an appropriate vertical spatial schema (tall/short), even though these words are not used conventionally in English to describe pitches, ruling out explanations for the observed pattern of results based on verbal polysemy. Together, results suggest that space-pitch congruity effects reveal metaphorical uses of spatial schemas, not polarity correspondence effects.

  18. Spatial congruity effects reveal metaphorical thinking, not polarity correspondence

    Directory of Open Access Journals (Sweden)

    Sarah eDolscheid

    2015-11-01

    Full Text Available Spatial congruity effects have often been interpreted as evidence for metaphorical thinking, but an alternative account based on polarity correspondence (a.k.a. markedness has challenged this view. Here we compared metaphor- and polarity-correspondence-based explanations for spatial congruity effects, using musical pitch as a testbed. In one experiment, English speakers classified high- and low-frequency pitches as high and low, or as front and back, to determine whether space-pitch congruity effects could be elicited by any marked spatial continuum. Although both pairs of terms describe bipolar spatial continuums, we found congruity effects only for high/low judgments, indicating that markedness is not sufficient to produce space-pitch congruity effects. A second experiment confirmed that there were no space-pitch congruity effects for another pair of terms that have clear markedness (big/small, but which do not denote spatial height. By contrast, this experiment showed congruity effects for words that cued an appropriate vertical spatial schema (tall/short, even though these words are not used conventionally in English to describe pitches, ruling out explanations for the observed pattern of results based on verbal polysemy. Together, results suggest that space-pitch congruity effects reveal metaphorical uses of spatial schemas, not polarity correspondence effects.

  19. Revealing physical education students’ misconception in sport biomechanics

    Science.gov (United States)

    Kartiko, D. C.

    2018-04-01

    The aim of this research is reveal Physical Education students’ misconception in several concepts of Sport Biomechanics. The Data of misconception collected by standard question of Diagnostic Test that given to 30 students of Physical Education, Faculty of Sport, State University of Surabaya in academic year 2017/2018. Diagnostic Test completed with CRI (Certainty of Response Index) in order to collect data of students’ certain in answered test. The data result of diagnostic test analysed through compilation graph of CRI right, CRI wrong and right fraction in every single question. Furthermore, students’ answer result of diagnostic test categorized in to 4 quadrants, these: correct concepts, lucky guess, misconceptions, and lack of knowledge. Its categorizing data to know percentage of misconceptions that arise in every concept tested. These sport biomechanics concepts tested are limited on frictional force, deference of distance and displacement, deference of velocity and acceleration, and free fall motion. The result obtained arise misconception in frictional force 52,78%; deference of distance and displacement 36,67%; deference of velocity and acceleration 56,67%; and free fall motion 53,33%. Result of t-test in diagnostic test misconception percentage showed that percentage of misconception arises in every student above 50%.

  20. Algal genomes reveal evolutionary mosaicism and the fate of nucleomorphs

    Energy Technology Data Exchange (ETDEWEB)

    Curtis, Bruce A.; Tanifuji, Goro; Burki, Fabien; Gruber, Ansgar; Irimia, Manuuel; Maruyama, Shinichiro; Arias, Maria C.; Ball, Steven G.; Gile, Gillian H.; Hirakawa, Yoshihisa; Hopkins, Julia F.; Kuo, Alan; Rensing, Stefan A.; Schmutz, Jeremy; Symeonidi, Aikaterini; Elias, Marek; Eveleigh, Robert J. M.; Herman, Emily K.; Klute, Mary J.; Nakayama, Takuro; Obornik, Miroslav; Reyes-Prieto, Adrian; Armbrust, E. Virginia; Aves, Stephen J.; Beiko, Robert G.; Coutinho, Pedro; Dacks, Joel B.; Durnford, Dion G.; Fast, Naomi M.; Green, Beverley R.; Grisdale, Cameron J.; Hempel, Franziska; Henrissat, Bernard; Hoppner, Marc P.; Ishida, Ken-Ichiro; Kim, Eunsoo; Koreny, Ludek; Kroth, Peter G.; Liu, Yuan; Malik, Shehre-Banoo; Maier, Uwe G.; McRose, Darcy; Mock, Thomas; Neilson, Jonathan A. D.; Onodera, Naoko T.; Poole, Anthony M.; Pritham, Ellen J.; Richards, Thomas A.; Rocap, Gabrielle; Roy, Scott W.; Sarai, Chihiro; Schaack, Sarah; Shirato, Shu; Slamovits, Claudio H.; Spencer, Davie F.; Suzuki, Shigekatsu; Worden, Alexandra Z.; Zauner, Stefan; Barry, Kerrie; Bell, Callum; Bharti, Arvind K.; Crow, John A.; Grimwood, Jane; Kramer, Robin; Lindquist, Erika; Lucas, Susan; Salamov, Asaf; McFadden, Geoffrey I.; Lane, Christopher E.; Keeling, Patrick J.; Gray, Michael W.; Grigoriev, Igor V.; Archibald, John M.

    2012-08-10

    Cryptophyte and chlorarachniophyte algae are transitional forms in the widespread secondary endosymbiotic acquisition of photosynthesis by engulfment of eukaryotic algae. Unlike most secondary plastid-bearing algae, miniaturized versions of the endosymbiont nuclei (nucleomorphs) persist in cryptophytes and chlorarachniophytes. To determine why, and to address other fundamental questions about eukaryote eukaryote endosymbiosis, we sequenced the nuclear genomes of the cryptophyte Guillardia theta and the chlorarachniophyte Bigelowiella natans. Both genomes have 21,000 protein genes and are intron rich, and B. natans exhibits unprecedented alternative splicing for a single-celled organism. Phylogenomic analyses and subcellular targeting predictions reveal extensive genetic and biochemical mosaicism, with both host- and endosymbiont-derived genes servicing the mitochondrion, the host cell cytosol, the plastid and the remnant endosymbiont cytosol of both algae. Mitochondrion-to-nucleus gene transfer still occurs in both organisms but plastid-to-nucleus and nucleomorph-to-nucleus transfers do not, which explains why a small residue of essential genes remains locked in each nucleomorph.

  1. Symbiotic polydnavirus and venom reveal parasitoid to its hyperparasitoids.

    Science.gov (United States)

    Zhu, Feng; Cusumano, Antonino; Bloem, Janneke; Weldegergis, Berhane T; Villela, Alexandre; Fatouros, Nina E; van Loon, Joop J A; Dicke, Marcel; Harvey, Jeffrey A; Vogel, Heiko; Poelman, Erik H

    2018-05-15

    Symbiotic relationships may provide organisms with key innovations that aid in the establishment of new niches. For example, during oviposition, some species of parasitoid wasps, whose larvae develop inside the bodies of other insects, inject polydnaviruses into their hosts. These symbiotic viruses disrupt host immune responses, allowing the parasitoid's progeny to survive. Here we show that symbiotic polydnaviruses also have a downside to the parasitoid's progeny by initiating a multitrophic chain of interactions that reveals the parasitoid larvae to their enemies. These enemies are hyperparasitoids that use the parasitoid progeny as host for their own offspring. We found that the virus and venom injected by the parasitoid during oviposition, but not the parasitoid progeny itself, affected hyperparasitoid attraction toward plant volatiles induced by feeding of parasitized caterpillars. We identified activity of virus-related genes in the caterpillar salivary gland. Moreover, the virus affected the activity of elicitors of salivary origin that induce plant responses to caterpillar feeding. The changes in caterpillar saliva were critical in inducing plant volatiles that are used by hyperparasitoids to locate parasitized caterpillars. Our results show that symbiotic organisms may be key drivers of multitrophic ecological interactions. We anticipate that this phenomenon is widespread in nature, because of the abundance of symbiotic microorganisms across trophic levels in ecological communities. Their role should be more prominently integrated in community ecology to understand organization of natural and managed ecosystems, as well as adaptations of individual organisms that are part of these communities.

  2. Proteomic Analysis of Hylocereus polyrhizus Reveals Metabolic Pathway Changes

    Directory of Open Access Journals (Sweden)

    Qingzhu Hua

    2016-09-01

    Full Text Available Red dragon fruit or red pitaya (Hylocereus polyrhizus is the only edible fruit that contains betalains. The color of betalains ranges from red and violet to yellow in plants. Betalains may also serve as an important component of health-promoting and disease-preventing functional food. Currently, the biosynthetic and regulatory pathways for betalain production remain to be fully deciphered. In this study, isobaric tags for relative and absolute quantitation (iTRAQ-based proteomic analyses were used to reveal the molecular mechanism of betalain biosynthesis in H. polyrhizus fruits at white and red pulp stages, respectively. A total of 1946 proteins were identified as the differentially expressed between the two samples, and 936 of them were significantly highly expressed at the red pulp stage of H. polyrhizus. RNA-seq and iTRAQ analyses showed that some transcripts and proteins were positively correlated; they belonged to “phenylpropanoid biosynthesis”, “tyrosine metabolism”, “flavonoid biosynthesis”, “ascorbate and aldarate metabolism”, “betalains biosynthesis” and “anthocyanin biosynthesis”. In betalains biosynthesis pathway, several proteins/enzymes such as polyphenol oxidase, CYP76AD3 and 4,5-dihydroxy-phenylalanine (DOPA dioxygenase extradiol-like protein were identified. The present study provides a new insight into the molecular mechanism of the betalain biosynthesis at the posttranscriptional level.

  3. Modelling reveals kinetic advantages of co-transcriptional splicing.

    Directory of Open Access Journals (Sweden)

    Stuart Aitken

    2011-10-01

    Full Text Available Messenger RNA splicing is an essential and complex process for the removal of intron sequences. Whereas the composition of the splicing machinery is mostly known, the kinetics of splicing, the catalytic activity of splicing factors and the interdependency of transcription, splicing and mRNA 3' end formation are less well understood. We propose a stochastic model of splicing kinetics that explains data obtained from high-resolution kinetic analyses of transcription, splicing and 3' end formation during induction of an intron-containing reporter gene in budding yeast. Modelling reveals co-transcriptional splicing to be the most probable and most efficient splicing pathway for the reporter transcripts, due in part to a positive feedback mechanism for co-transcriptional second step splicing. Model comparison is used to assess the alternative representations of reactions. Modelling also indicates the functional coupling of transcription and splicing, because both the rate of initiation of transcription and the probability that step one of splicing occurs co-transcriptionally are reduced, when the second step of splicing is abolished in a mutant reporter.

  4. Modelling reveals kinetic advantages of co-transcriptional splicing.

    Science.gov (United States)

    Aitken, Stuart; Alexander, Ross D; Beggs, Jean D

    2011-10-01

    Messenger RNA splicing is an essential and complex process for the removal of intron sequences. Whereas the composition of the splicing machinery is mostly known, the kinetics of splicing, the catalytic activity of splicing factors and the interdependency of transcription, splicing and mRNA 3' end formation are less well understood. We propose a stochastic model of splicing kinetics that explains data obtained from high-resolution kinetic analyses of transcription, splicing and 3' end formation during induction of an intron-containing reporter gene in budding yeast. Modelling reveals co-transcriptional splicing to be the most probable and most efficient splicing pathway for the reporter transcripts, due in part to a positive feedback mechanism for co-transcriptional second step splicing. Model comparison is used to assess the alternative representations of reactions. Modelling also indicates the functional coupling of transcription and splicing, because both the rate of initiation of transcription and the probability that step one of splicing occurs co-transcriptionally are reduced, when the second step of splicing is abolished in a mutant reporter.

  5. Acoustic telemetry reveals cryptic residency of whale sharks.

    Science.gov (United States)

    Cagua, E Fernando; Cochran, Jesse E M; Rohner, Christoph A; Prebble, Clare E M; Sinclair-Taylor, Tane H; Pierce, Simon J; Berumen, Michael L

    2015-04-01

    Although whale sharks (Rhincodon typus) have been documented to move thousands of kilometres, they are most frequently observed at a few predictable seasonal aggregation sites. The absence of sharks at the surface during visual surveys has led to the assumption that sharks disperse to places unknown during the long 'off-seasons' at most of these locations. Here we compare 2 years of R. typus visual sighting records from Mafia Island in Tanzania to concurrent acoustic telemetry of tagged individuals. Sightings revealed a clear seasonal pattern with a peak between October and February and no sharks observed at other times. By contrast, acoustic telemetry demonstrated year-round residency of R. typus. The sharks use a different habitat in the off-season, swimming deeper and further away from shore, presumably in response to prey distributions. This behavioural change reduces the sharks' visibility, giving the false impression that they have left the area. We demonstrate, for the first time to our knowledge, year-round residency of unprovisioned, individual R. typus at an aggregation site, and highlight the importance of using multiple techniques to study the movement ecology of marine megafauna. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  6. Integrative modelling reveals mechanisms linking productivity and plant species richness.

    Science.gov (United States)

    Grace, James B; Anderson, T Michael; Seabloom, Eric W; Borer, Elizabeth T; Adler, Peter B; Harpole, W Stanley; Hautier, Yann; Hillebrand, Helmut; Lind, Eric M; Pärtel, Meelis; Bakker, Jonathan D; Buckley, Yvonne M; Crawley, Michael J; Damschen, Ellen I; Davies, Kendi F; Fay, Philip A; Firn, Jennifer; Gruner, Daniel S; Hector, Andy; Knops, Johannes M H; MacDougall, Andrew S; Melbourne, Brett A; Morgan, John W; Orrock, John L; Prober, Suzanne M; Smith, Melinda D

    2016-01-21

    How ecosystem productivity and species richness are interrelated is one of the most debated subjects in the history of ecology. Decades of intensive study have yet to discern the actual mechanisms behind observed global patterns. Here, by integrating the predictions from multiple theories into a single model and using data from 1,126 grassland plots spanning five continents, we detect the clear signals of numerous underlying mechanisms linking productivity and richness. We find that an integrative model has substantially higher explanatory power than traditional bivariate analyses. In addition, the specific results unveil several surprising findings that conflict with classical models. These include the isolation of a strong and consistent enhancement of productivity by richness, an effect in striking contrast with superficial data patterns. Also revealed is a consistent importance of competition across the full range of productivity values, in direct conflict with some (but not all) proposed models. The promotion of local richness by macroecological gradients in climatic favourability, generally seen as a competing hypothesis, is also found to be important in our analysis. The results demonstrate that an integrative modelling approach leads to a major advance in our ability to discern the underlying processes operating in ecological systems.

  7. Two independent modes of chromatin organization revealed by cohesin removal.

    Science.gov (United States)

    Schwarzer, Wibke; Abdennur, Nezar; Goloborodko, Anton; Pekowska, Aleksandra; Fudenberg, Geoffrey; Loe-Mie, Yann; Fonseca, Nuno A; Huber, Wolfgang; H Haering, Christian; Mirny, Leonid; Spitz, Francois

    2017-11-02

    Imaging and chromosome conformation capture studies have revealed several layers of chromosome organization, including segregation into megabase-sized active and inactive compartments, and partitioning into sub-megabase domains (TADs). It remains unclear, however, how these layers of organization form, interact with one another and influence genome function. Here we show that deletion of the cohesin-loading factor Nipbl in mouse liver leads to a marked reorganization of chromosomal folding. TADs and associated Hi-C peaks vanish globally, even in the absence of transcriptional changes. By contrast, compartmental segregation is preserved and even reinforced. Strikingly, the disappearance of TADs unmasks a finer compartment structure that accurately reflects the underlying epigenetic landscape. These observations demonstrate that the three-dimensional organization of the genome results from the interplay of two independent mechanisms: cohesin-independent segregation of the genome into fine-scale compartments, defined by chromatin state; and cohesin-dependent formation of TADs, possibly by loop extrusion, which helps to guide distant enhancers to their target genes.

  8. Submillisecond elastic recoil reveals molecular origins of fibrin fiber mechanics.

    Science.gov (United States)

    Hudson, Nathan E; Ding, Feng; Bucay, Igal; O'Brien, E Timothy; Gorkun, Oleg V; Superfine, Richard; Lord, Susan T; Dokholyan, Nikolay V; Falvo, Michael R

    2013-06-18

    Fibrin fibers form the structural scaffold of blood clots. Thus, their mechanical properties are of central importance to understanding hemostasis and thrombotic disease. Recent studies have revealed that fibrin fibers are elastomeric despite their high degree of molecular ordering. These results have inspired a variety of molecular models for fibrin's elasticity, ranging from reversible protein unfolding to rubber-like elasticity. An important property that has not been explored is the timescale of elastic recoil, a parameter that is critical for fibrin's mechanical function and places a temporal constraint on molecular models of fiber elasticity. Using high-frame-rate imaging and atomic force microscopy-based nanomanipulation, we measured the recoil dynamics of individual fibrin fibers and found that the recoil was orders of magnitude faster than anticipated from models involving protein refolding. We also performed steered discrete molecular-dynamics simulations to investigate the molecular origins of the observed recoil. Our results point to the unstructured αC regions of the otherwise structured fibrin molecule as being responsible for the elastic recoil of the fibers. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  9. Submillisecond Elastic Recoil Reveals Molecular Origins of Fibrin Fiber Mechanics

    Science.gov (United States)

    Hudson, Nathan E.; Ding, Feng; Bucay, Igal; O’Brien, E. Timothy; Gorkun, Oleg V.; Superfine, Richard; Lord, Susan T.; Dokholyan, Nikolay V.; Falvo, Michael R.

    2013-01-01

    Fibrin fibers form the structural scaffold of blood clots. Thus, their mechanical properties are of central importance to understanding hemostasis and thrombotic disease. Recent studies have revealed that fibrin fibers are elastomeric despite their high degree of molecular ordering. These results have inspired a variety of molecular models for fibrin’s elasticity, ranging from reversible protein unfolding to rubber-like elasticity. An important property that has not been explored is the timescale of elastic recoil, a parameter that is critical for fibrin’s mechanical function and places a temporal constraint on molecular models of fiber elasticity. Using high-frame-rate imaging and atomic force microscopy-based nanomanipulation, we measured the recoil dynamics of individual fibrin fibers and found that the recoil was orders of magnitude faster than anticipated from models involving protein refolding. We also performed steered discrete molecular-dynamics simulations to investigate the molecular origins of the observed recoil. Our results point to the unstructured αC regions of the otherwise structured fibrin molecule as being responsible for the elastic recoil of the fibers. PMID:23790375

  10. Distributed neural system for emotional intelligence revealed by lesion mapping

    Science.gov (United States)

    Colom, Roberto; Grafman, Jordan

    2014-01-01

    Cognitive neuroscience has made considerable progress in understanding the neural architecture of human intelligence, identifying a broadly distributed network of frontal and parietal regions that support goal-directed, intelligent behavior. However, the contributions of this network to social and emotional aspects of intellectual function remain to be well characterized. Here we investigated the neural basis of emotional intelligence in 152 patients with focal brain injuries using voxel-based lesion-symptom mapping. Latent variable modeling was applied to obtain measures of emotional intelligence, general intelligence and personality from the Mayer, Salovey, Caruso Emotional Intelligence Test (MSCEIT), the Wechsler Adult Intelligence Scale and the Neuroticism-Extroversion-Openness Inventory, respectively. Regression analyses revealed that latent scores for measures of general intelligence and personality reliably predicted latent scores for emotional intelligence. Lesion mapping results further indicated that these convergent processes depend on a shared network of frontal, temporal and parietal brain regions. The results support an integrative framework for understanding the architecture of executive, social and emotional processes and make specific recommendations for the interpretation and application of the MSCEIT to the study of emotional intelligence in health and disease. PMID:23171618

  11. Revealing the structure of the world airline network

    Science.gov (United States)

    Verma, T.; Araújo, N. A. M.; Herrmann, H. J.

    2014-07-01

    Resilience of most critical infrastructures against failure of elements that appear insignificant is usually taken for granted. The World Airline Network (WAN) is an infrastructure that reduces the geographical gap between societies, both small and large, and brings forth economic gains. With the extensive use of a publicly maintained data set that contains information about airports and alternative connections between these airports, we empirically reveal that the WAN is a redundant and resilient network for long distance air travel, but otherwise breaks down completely due to removal of short and apparently insignificant connections. These short range connections with moderate number of passengers and alternate flights are the connections that keep remote parts of the world accessible. It is surprising, insofar as there exists a highly resilient and strongly connected core consisting of a small fraction of airports (around 2.3%) together with an extremely fragile star-like periphery. Yet, in spite of their relevance, more than 90% of the world airports are still interconnected upon removal of this core. With standard and unconventional removal measures we compare both empirical and topological perceptions for the fragmentation of the world. We identify how the WAN is organized into different classes of clusters based on the physical proximity of airports and analyze the consequence of this fragmentation.

  12. Identifying and annotating human bifunctional RNAs reveals their versatile functions.

    Science.gov (United States)

    Chen, Geng; Yang, Juan; Chen, Jiwei; Song, Yunjie; Cao, Ruifang; Shi, Tieliu; Shi, Leming

    2016-10-01

    Bifunctional RNAs that possess both protein-coding and noncoding functional properties were less explored and poorly understood. Here we systematically explored the characteristics and functions of such human bifunctional RNAs by integrating tandem mass spectrometry and RNA-seq data. We first constructed a pipeline to identify and annotate bifunctional RNAs, leading to the characterization of 132 high-confidence bifunctional RNAs. Our analyses indicate that bifunctional RNAs may be involved in human embryonic development and can be functional in diverse tissues. Moreover, bifunctional RNAs could interact with multiple miRNAs and RNA-binding proteins to exert their corresponding roles. Bifunctional RNAs may also function as competing endogenous RNAs to regulate the expression of many genes by competing for common targeting miRNAs. Finally, somatic mutations of diverse carcinomas may generate harmful effect on corresponding bifunctional RNAs. Collectively, our study not only provides the pipeline for identifying and annotating bifunctional RNAs but also reveals their important gene-regulatory functions.

  13. Revealing Bell's nonlocality for unstable systems in high energy physics

    International Nuclear Information System (INIS)

    Hiesmayr, Beatrix C.; Gabriel, Andreas; Huber, Marcus; Di Domenico, Antonio; Curceanu, Catalina; Larsson, Jan-Aake; Moskal, Pawel

    2012-01-01

    Entanglement and its consequences - in particular the violation of Bell inequalities, which defies our concepts of realism and locality - have been proven to play key roles in Nature by many experiments for various quantum systems. Entanglement can also be found in systems not consisting of ordinary matter and light, i.e. in massive meson-antimeson systems. Bell inequalities have been discussed for these systems, but up to date no direct experimental test to conclusively exclude local realism was found. This mainly stems from the fact that one only has access to a restricted class of observables and that these systems are also decaying. In this Letter we put forward a Bell inequality for unstable systems which can be tested at accelerator facilities with current technology. Herewith, the long awaited proof that such systems at different energy scales can reveal the sophisticated ''dynamical'' nonlocal feature of Nature in a direct experiment gets feasible. Moreover, the role of entanglement and CP violation, an asymmetry between matter and antimatter, is explored, a special feature offered only by these meson-antimeson systems. (orig.)

  14. New View of Distant Galaxy Reveals Furious Star Formation

    Science.gov (United States)

    2007-12-01

    A furious rate of star formation discovered in a distant galaxy shows that galaxies in the early Universe developed either much faster or in a different way from what astronomers have thought. "This galaxy is forming stars at an incredible rate," said Wei-Hao Wang, an astronomer at the National Radio Astronomy Observatory (NRAO) in Socorro, New Mexico. The galaxy, Wang said, is forming the equivalent of 4,000 Suns a year. This is a thousand times more violent than our own Milky Way Galaxy. Location of Distant Galaxy Visible-light, left (from HST) and Infrared, right, (from Spitzer) Images: Circles indicate location of GOODS 850-5. CREDIT: Wang et al., STScI, Spitzer, NASA, NRAO/AUI/NSF Click on image for high-resolution file (1 MB) The galaxy, called GOODS 850-5, is 12 billion light-years from Earth, and thus is seen as it was only about 1.5 billion years after the Big Bang. Wang and his colleagues observed it using the Smithsonian Astrophysical Observatory's Submillimeter Array (SMA) on Mauna Kea in Hawaii. Young stars in the galaxy were enshrouded in dust that was heated by the stars and radiated infrared light strongly. Because of the galaxy's great distance from Earth, the infrared light waves have been stretched out to submillimeter-length radio waves, which are seen by the SMA. The waves were stretched or "redshifted," as astronomers say, by the ongoing expansion of the Universe. "This evidence for prolific star formation is hidden by the dust from visible-light telescopes," Wang explained. The dust, in turn, was formed from heavy elements that had to be built up in the cores of earlier stars. This indicates, Wang said, that significant numbers of stars already had formed, then spewed those heavy elements into interstellar space through supernova explosions and stellar winds. "Seeing the radiation from this heated dust revealed star formation we could have found in no other way," Wang said. Similar dusty galaxies in the early Universe may contain most of the

  15. Fish mucus metabolome reveals fish life-history traits

    Science.gov (United States)

    Reverter, M.; Sasal, P.; Banaigs, B.; Lecchini, D.; Lecellier, G.; Tapissier-Bontemps, N.

    2017-06-01

    Fish mucus has important biological and ecological roles such as defense against fish pathogens and chemical mediation among several species. A non-targeted liquid chromatography-mass spectrometry metabolomic approach was developed to study gill mucus of eight butterflyfish species in Moorea (French Polynesia), and the influence of several fish traits (geographic site and reef habitat, species taxonomy, phylogeny, diet and parasitism levels) on the metabolic variability was investigated. A biphasic extraction yielding two fractions (polar and apolar) was used. Fish diet (obligate corallivorous, facultative corallivorous or omnivorous) arose as the main driver of the metabolic differences in the gill mucus in both fractions, accounting for 23% of the observed metabolic variability in the apolar fraction and 13% in the polar fraction. A partial least squares discriminant analysis allowed us to identify the metabolites (variable important in projection, VIP) driving the differences between fish with different diets (obligate corallivores, facultative corallivores and omnivorous). Using accurate mass data and fragmentation data, we identified some of these VIP as glycerophosphocholines, ceramides and fatty acids. Level of monogenean gill parasites was the second most important factor shaping the gill mucus metabolome, and it explained 10% of the metabolic variability in the polar fraction and 5% in the apolar fraction. A multiple regression tree revealed that the metabolic variability due to parasitism in the polar fraction was mainly due to differences between non-parasitized and parasitized fish. Phylogeny and butterflyfish species were factors contributing significantly to the metabolic variability of the apolar fraction (10 and 3%, respectively) but had a less pronounced effect in the polar fraction. Finally, geographic site and reef habitat of butterflyfish species did not influence the gill mucus metabolome of butterflyfishes.

  16. Reveal genes functionally associated with ACADS by a network study.

    Science.gov (United States)

    Chen, Yulong; Su, Zhiguang

    2015-09-15

    Establishing a systematic network is aimed at finding essential human gene-gene/gene-disease pathway by means of network inter-connecting patterns and functional annotation analysis. In the present study, we have analyzed functional gene interactions of short-chain acyl-coenzyme A dehydrogenase gene (ACADS). ACADS plays a vital role in free fatty acid β-oxidation and regulates energy homeostasis. Modules of highly inter-connected genes in disease-specific ACADS network are derived by integrating gene function and protein interaction data. Among the 8 genes in ACADS web retrieved from both STRING and GeneMANIA, ACADS is effectively conjoined with 4 genes including HAHDA, HADHB, ECHS1 and ACAT1. The functional analysis is done via ontological briefing and candidate disease identification. We observed that the highly efficient-interlinked genes connected with ACADS are HAHDA, HADHB, ECHS1 and ACAT1. Interestingly, the ontological aspect of genes in the ACADS network reveals that ACADS, HAHDA and HADHB play equally vital roles in fatty acid metabolism. The gene ACAT1 together with ACADS indulges in ketone metabolism. Our computational gene web analysis also predicts potential candidate disease recognition, thus indicating the involvement of ACADS, HAHDA, HADHB, ECHS1 and ACAT1 not only with lipid metabolism but also with infant death syndrome, skeletal myopathy, acute hepatic encephalopathy, Reye-like syndrome, episodic ketosis, and metabolic acidosis. The current study presents a comprehensible layout of ACADS network, its functional strategies and candidate disease approach associated with ACADS network. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Ancient Chinese literature reveals pathways of eggplant domestication.

    Science.gov (United States)

    Wang, Jin-Xiu; Gao, Tian-Gang; Knapp, Sandra

    2008-12-01

    Changes in key traits occurring during the processes of plant domestication have long been subjects of debate. Only in the case of genetic analysis or with extensive plant remains can specific sets of changes be documented. Historical details of the plant domestication processes are rare and other evidence of morphological change can be difficult to obtain, especially for those vegetables that lack a substantial body of archaeological data. Botanical records chronicled in the ancient literature of established ancient civilizations, such as that of China, are invaluable resources for the study and understanding of the process of plant domestication. Here, the considerable body of ancient Chinese literature is used to explore the domestication process that has occurred with the eggplant (Solanum melongena), an important vegetable in Old World. Information about eggplant domestication in the ancient Chinese literature was retrieved using a variety of methods. The information obtained was then sorted by taxon, examined and taxonomic identifications verified. It was found that the earliest record of the eggplant documented in ancient Chinese literature was in a work from 59 bc. As far as is known, this is the earliest reliable and accurately dated record of eggplant in cultivation. The analysis reveals that the process of domestication of the eggplant in China involved three principal aspects of fruit quality: size, shape and taste. These traits were actively and gradually selected; fruit size changed from small to large, taste changed from not palatable to what was termed at the time sweetish, and that over time, a wider variety of fruit shapes was cultivated. The results indicate that, in addition to data gleaned from archaeology and genetics, evidence as to changes in key traits occurring during the process of plant domestication and selective forces responsible for these changes can be traced through the ancient literature in some civilizations.

  18. A fifth major genetic group among honeybees revealed in Syria.

    Science.gov (United States)

    Alburaki, Mohamed; Bertrand, Bénédicte; Legout, Hélène; Moulin, Sibyle; Alburaki, Ali; Sheppard, Walter Steven; Garnery, Lionel

    2013-12-06

    Apiculture has been practiced in North Africa and the Middle-East from antiquity. Several thousand years of selective breeding have left a mosaic of Apis mellifera subspecies in the Middle-East, many uniquely adapted and survived to local environmental conditions. In this study we explore the genetic diversity of A. mellifera from Syria (n = 1258), Lebanon (n = 169) and Iraq (n = 35) based on 14 short tandem repeat (STR) loci in the context of reference populations from throughout the Old World (n = 732). Our data suggest that the Syrian honeybee Apis mellifera syriaca occurs in both Syrian and Lebanese territories, with no significant genetic variability between respective populations from Syria and Lebanon. All studied populations clustered within a new fifth independent nuclear cluster, congruent with an mtDNA Z haplotype identified in a previous study. Syrian honeybee populations are not associated with Oriental lineage O, except for sporadic introgression into some populations close to the Turkish and Iraqi borders. Southern Syrian and Lebanese populations demonstrated high levels of genetic diversity compared to the northern populations. This study revealed the effects of foreign queen importations on Syrian bee populations, especially for the region of Tartus, where extensive introgression of A. m. anatolica and/or A. m. caucasica alleles were identified. The policy of creating genetic conservation centers for the Syrian subspecies should take into consideration the influence of the oriental lineage O from the northern Syrian border and the large population of genetically divergent indigenous honeybees located in southern Syria.

  19. Neural correlates of the LSD experience revealed by multimodal neuroimaging.

    Science.gov (United States)

    Carhart-Harris, Robin L; Muthukumaraswamy, Suresh; Roseman, Leor; Kaelen, Mendel; Droog, Wouter; Murphy, Kevin; Tagliazucchi, Enzo; Schenberg, Eduardo E; Nest, Timothy; Orban, Csaba; Leech, Robert; Williams, Luke T; Williams, Tim M; Bolstridge, Mark; Sessa, Ben; McGonigle, John; Sereno, Martin I; Nichols, David; Hellyer, Peter J; Hobden, Peter; Evans, John; Singh, Krish D; Wise, Richard G; Curran, H Valerie; Feilding, Amanda; Nutt, David J

    2016-04-26

    Lysergic acid diethylamide (LSD) is the prototypical psychedelic drug, but its effects on the human brain have never been studied before with modern neuroimaging. Here, three complementary neuroimaging techniques: arterial spin labeling (ASL), blood oxygen level-dependent (BOLD) measures, and magnetoencephalography (MEG), implemented during resting state conditions, revealed marked changes in brain activity after LSD that correlated strongly with its characteristic psychological effects. Increased visual cortex cerebral blood flow (CBF), decreased visual cortex alpha power, and a greatly expanded primary visual cortex (V1) functional connectivity profile correlated strongly with ratings of visual hallucinations, implying that intrinsic brain activity exerts greater influence on visual processing in the psychedelic state, thereby defining its hallucinatory quality. LSD's marked effects on the visual cortex did not significantly correlate with the drug's other characteristic effects on consciousness, however. Rather, decreased connectivity between the parahippocampus and retrosplenial cortex (RSC) correlated strongly with ratings of "ego-dissolution" and "altered meaning," implying the importance of this particular circuit for the maintenance of "self" or "ego" and its processing of "meaning." Strong relationships were also found between the different imaging metrics, enabling firmer inferences to be made about their functional significance. This uniquely comprehensive examination of the LSD state represents an important advance in scientific research with psychedelic drugs at a time of growing interest in their scientific and therapeutic value. The present results contribute important new insights into the characteristic hallucinatory and consciousness-altering properties of psychedelics that inform on how they can model certain pathological states and potentially treat others.

  20. Saturn's Internal Magnetic Field Revealed by Cassini Grand Finale

    Science.gov (United States)

    Cao, H.; Dougherty, M. K.; Khurana, K. K.; Hunt, G. J.; Provan, G.; Kellock, S.; Burton, M. E.; Burk, T. A.

    2017-12-01

    Saturn's internal magnetic field has been puzzling since the first in-situ measurements during the Pioneer 11 Saturn flyby. Cassini magnetometer measurements prior to the Grand Finale phase established 1) the highly axisymmetric nature of Saturn's internal magnetic field with a dipole tilt smaller than 0.06 degrees, 2) at least an order of magnitude slower secular variation rate compared to that of the current geomagnetic field, and 3) expulsion of magnetic fluxes from the equatorial region towards high latitude. The highly axisymmetric nature of Saturn's intrinsic magnetic field not only challenges dynamo theory but also makes an accurate determination of the interior rotation rate of Saturn extremely difficult. The Cassini spacecraft entered the Grand Finale phase in April 2017, during which time the spacecraft dived through the gap between Saturn's atmosphere and the inner edge of the D-ring 22 times before descending into the deep atmosphere of Saturn. The unprecedented proximity to Saturn (reaching 2500 km above the cloud deck) and the highly inclined nature of the Grand Finale orbits provided an ideal opportunity to decode Saturn's internal magnetic field. The fluxgate magnetometer onboard Cassini made precise vector measurements during the Grand Finale phase. Magnetic signals from the interior of the planet, the magnetospheric ring current, the high-latitude field-aligned current (FAC) modulated by the 10.7 hour planetary period oscillation, and low-latitude FACs were observed during the Grand Finale phase. Here we report the magnetometer measurements during the Cassini Grand Finale phase, new features of Saturn's internal magnetic field revealed by these measurements (e.g., the high degree magnetic moments of Saturn, the level of axisymmetry beyond dipole), and implications for the deep interior of Saturn.

  1. Opto-acoustic microscopy reveals adhesion mechanics of single cells.

    Science.gov (United States)

    Abi Ghanem, Maroun; Dehoux, Thomas; Liu, Liwang; Le Saux, Guillaume; Plawinski, Laurent; Durrieu, Marie-Christine; Audoin, Bertrand

    2018-01-01

    Laser-generated GHz-ultrasonic-based technologies have shown the ability to image single cell adhesion and stiffness simultaneously. Using this new modality, we here demonstrate quantitative indicators to investigate contact mechanics and adhesion processes of the cell. We cultured human cells on a rigid substrate, and we used an inverted pulsed opto-acoustic microscope to generate acoustic pulses containing frequencies up to 100 GHz in the substrate. We map the reflection of the acoustic pulses at the cell-substrate interface to obtain images of the acoustic impedance of the cell, Z c , as well as of the stiffness of the interface, K, with 1 μm lateral resolution. Our results show that the standard deviation ΔZ c reveals differences between different cell types arising from the multiplicity of local conformations within the nucleus. From the distribution of K-values within the nuclear region, we extract a mean interfacial stiffness, K m , that quantifies the average contact force in areas of the cell displaying weak bonding. By analogy with classical contact mechanics, we also define the ratio of the real to nominal contact areas, S r /S t . We show that K m can be interpreted as a quantitative indicator of passive contact at metal-cell interfaces, while S r /S t is sensitive to active adhesive processes in the nuclear region. The ability to separate the contributions of passive and active adhesion processes should allow gaining insight into cell-substrate interactions, with important applications in tissue engineering.

  2. Revealing driving factors of China's PM2.5 pollution

    Science.gov (United States)

    Zheng, Y.; Zhao, H.; Zhang, Q.; Geng, G.; Tong, D.; Peng, L.; He, K.

    2017-12-01

    China's rapid economic development and intensive energy consumption are deteriorating the air quality significantly. Understanding the key driving factors behind China's growing emissions of air pollutants and the accompanying PM2.5 pollution is critical for the development of China's clean air policies and also provides insight into how other emerging economies may develop a clear sky future. Here we reveal the socioeconomic drivers of the variations of China's PM2.5 concentrations during 2002-2012 by using an interdisciplinary framework that integrates an emission inventory model, an index decomposition analysis model, and a regional air quality model. The decomposition results demostrate that the improvements in emission efficiency and energy efficiency failed to offset the increased emissions of both primary PM2.5 and gaseous PM2.5 precursors (including SO2 NOx, and volatile organic compounds) triggered by the surging economic growth during 2002-2012. During the same time, the effects of energy structure, production structure and population growth were relatively less significant to all pollutants, which indicates the potential of large emission abatements through energy structure and production structure adjustment. Sensitivity simulations by the air quality model based on the provincial decomposition results also show that the economic growth have outpaced efficiency improvements in the increments of PM2.5 concentrations during the study years. As China continues to develop rapidly, future policies should promote further improvements in efficiency and accelerate the adjustments toward clean energy and production structures, which are critical for reducing China's emissions and alleviating the severe PM2.5 pollution.

  3. Drought sensitivity of Amazonian carbon balance revealed by atmospheric measurements

    Science.gov (United States)

    Gatti, L. V.; Gloor, M.; Miller, J. B.; Doughty, C. E.; Malhi, Y.; Domingues, L. G.; Basso, L. S.; Martinewski, A.; Correia, C. S. C.; Borges, V. F.; Freitas, S.; Braz, R.; Anderson, L. O.; Rocha, H.; Grace, J.; Phillips, O. L.; Lloyd, J.

    2014-02-01

    Feedbacks between land carbon pools and climate provide one of the largest sources of uncertainty in our predictions of global climate. Estimates of the sensitivity of the terrestrial carbon budget to climate anomalies in the tropics and the identification of the mechanisms responsible for feedback effects remain uncertain. The Amazon basin stores a vast amount of carbon, and has experienced increasingly higher temperatures and more frequent floods and droughts over the past two decades. Here we report seasonal and annual carbon balances across the Amazon basin, based on carbon dioxide and carbon monoxide measurements for the anomalously dry and wet years 2010 and 2011, respectively. We find that the Amazon basin lost 0.48+/-0.18 petagrams of carbon per year (PgCyr-1) during the dry year but was carbon neutral (0.06+/-0.1PgCyr-1) during the wet year. Taking into account carbon losses from fire by using carbon monoxide measurements, we derived the basin net biome exchange (that is, the carbon flux between the non-burned forest and the atmosphere) revealing that during the dry year, vegetation was carbon neutral. During the wet year, vegetation was a net carbon sink of 0.25+/-0.14PgCyr-1, which is roughly consistent with the mean long-term intact-forest biomass sink of 0.39+/-0.10PgCyr-1 previously estimated from forest censuses. Observations from Amazonian forest plots suggest the suppression of photosynthesis during drought as the primary cause for the 2010 sink neutralization. Overall, our results suggest that moisture has an important role in determining the Amazonian carbon balance. If the recent trend of increasing precipitation extremes persists, the Amazon may become an increasing carbon source as a result of both emissions from fires and the suppression of net biome exchange by drought.

  4. Antarctic krill 454 pyrosequencing reveals chaperone and stress transcriptome.

    Directory of Open Access Journals (Sweden)

    Melody S Clark

    Full Text Available BACKGROUND: The Antarctic krill Euphausia superba is a keystone species in the Antarctic food chain. Not only is it a significant grazer of phytoplankton, but it is also a major food item for charismatic megafauna such as whales and seals and an important Southern Ocean fisheries crop. Ecological data suggest that this species is being affected by climate change and this will have considerable consequences for the balance of the Southern Ocean ecosystem. Hence, understanding how this organism functions is a priority area and will provide fundamental data for life history studies, energy budget calculations and food web models. METHODOLOGY/PRINCIPAL FINDINGS: The assembly of the 454 transcriptome of E. superba resulted in 22,177 contigs with an average size of 492bp (ranging between 137 and 8515bp. In depth analysis of the data revealed an extensive catalogue of the cellular chaperone systems and the major antioxidant proteins. Full length sequences were characterised for the chaperones HSP70, HSP90 and the super-oxide dismutase antioxidants, with the discovery of potentially novel duplications of these genes. The sequence data contained 41,470 microsatellites and 17,776 Single Nucleotide Polymorphisms (SNPs/INDELS, providing a resource for population and also gene function studies. CONCLUSIONS: This paper details the first 454 generated data for a pelagic Antarctic species or any pelagic crustacean globally. The classical "stress proteins", such as HSP70, HSP90, ferritin and GST were all highly expressed. These genes were shown to be over expressed in the transcriptomes of Antarctic notothenioid fish and hypothesized as adaptations to living in the cold, with the associated problems of decreased protein folding efficiency and increased vulnerability to damage by reactive oxygen species. Hence, these data will provide a major resource for future physiological work on krill, but in particular a suite of "stress" genes for studies understanding

  5. A parts list for fungal cellulosomes revealed by comparative genomics

    Energy Technology Data Exchange (ETDEWEB)

    Haitjema, Charles H.; Gilmore, Sean P.; Henske, John K.; Solomon, Kevin V.; de Groot, Randall; Kuo, Alan; Mondo, Stephen J.; Salamov, Asaf A.; LaButti, Kurt; Zhao, Zhiying; Chiniquy, Jennifer; Barry, Kerrie; Brewer, Heather M.; Purvine, Samuel O.; Wright, Aaron T.; Hainaut, Matthieu; Boxma, Brigitte; van Alen, Theo; Hackstein, Johannes H. P.; Henrissat, Bernard; Baker, Scott E.; Grigoriev, Igor V.; O' Malley, Michelle A.

    2017-05-26

    Cellulosomes are large, multi-protein complexes that tether plant biomass degrading enzymes together for improved hydrolysis1. These complexes were first described in anaerobic bacteria where species specific dockerin domains mediate assembly of enzymes onto complementary cohesin motifs interspersed within non-catalytic protein scaffolds1. The versatile protein assembly mechanism conferred by the bacterial cohesin-dockerin interaction is now a standard design principle for synthetic protein-scale pathways2,3. For decades, analogous structures have been reported in the early branching anaerobic fungi, which are known to assemble by sequence divergent non-catalytic dockerin domains (NCDD)4. However, the enzyme components, modular assembly mechanism, and functional role of fungal cellulosomes remain unknown5,6. Here, we describe the comprehensive set of proteins critical to fungal cellulosome assembly, including novel, conserved scaffolding proteins unique to the Neocallimastigomycota. High quality genomes of the anaerobic fungi Anaeromyces robustus, Neocallimastix californiae and Piromyces finnis were assembled with long-read, single molecule technology to overcome their repeat-richness and extremely low GC content. Genomic analysis coupled with proteomic validation revealed an average 320 NCDD-containing proteins per fungal strain that were overwhelmingly carbohydrate active enzymes (CAZymes), with 95 large fungal scaffoldins identified across 4 genera that contain a conserved amino acid sequence repeat that binds to NCDDs. Fungal dockerin and scaffoldin domains have no similarity to their bacterial counterparts, yet several catalytic domains originated via horizontal gene transfer with gut bacteria. Though many catalytic domains are shared with bacteria, the biocatalytic activity of anaerobic fungi is expanded by the inclusion of GH3, GH6, and GH45 enzymes in the enzyme complexes. Collectively, these findings suggest that the fungal cellulosome is an evolutionarily

  6. Genome size analyses of Pucciniales reveal the largest fungal genomes.

    Science.gov (United States)

    Tavares, Sílvia; Ramos, Ana Paula; Pires, Ana Sofia; Azinheira, Helena G; Caldeirinha, Patrícia; Link, Tobias; Abranches, Rita; Silva, Maria do Céu; Voegele, Ralf T; Loureiro, João; Talhinhas, Pedro

    2014-01-01

    Rust fungi (Basidiomycota, Pucciniales) are biotrophic plant pathogens which exhibit diverse complexities in their life cycles and host ranges. The completion of genome sequencing of a few rust fungi has revealed the occurrence of large genomes. Sequencing efforts for other rust fungi have been hampered by uncertainty concerning their genome sizes. Flow cytometry was recently applied to estimate the genome size of a few rust fungi, and confirmed the occurrence of large genomes in this order (averaging 225.3 Mbp, while the average for Basidiomycota was 49.9 Mbp and was 37.7 Mbp for all fungi). In this work, we have used an innovative and simple approach to simultaneously isolate nuclei from the rust and its host plant in order to estimate the genome size of 30 rust species by flow cytometry. Genome sizes varied over 10-fold, from 70 to 893 Mbp, with an average genome size value of 380.2 Mbp. Compared to the genome sizes of over 1800 fungi, Gymnosporangium confusum possesses the largest fungal genome ever reported (893.2 Mbp). Moreover, even the smallest rust genome determined in this study is larger than the vast majority of fungal genomes (94%). The average genome size of the Pucciniales is now of 305.5 Mbp, while the average Basidiomycota genome size has shifted to 70.4 Mbp and the average for all fungi reached 44.2 Mbp. Despite the fact that no correlation could be drawn between the genome sizes, the phylogenomics or the life cycle of rust fungi, it is interesting to note that rusts with Fabaceae hosts present genomes clearly larger than those with Poaceae hosts. Although this study comprises only a small fraction of the more than 7000 rust species described, it seems already evident that the Pucciniales represent a group where genome size expansion could be a common characteristic. This is in sharp contrast to sister taxa, placing this order in a relevant position in fungal genomics research.

  7. Mesoscopic organization reveals the constraints governing Caenorhabditis elegans nervous system.

    Directory of Open Access Journals (Sweden)

    Raj Kumar Pan

    Full Text Available One of the biggest challenges in biology is to understand how activity at the cellular level of neurons, as a result of their mutual interactions, leads to the observed behavior of an organism responding to a variety of environmental stimuli. Investigating the intermediate or mesoscopic level of organization in the nervous system is a vital step towards understanding how the integration of micro-level dynamics results in macro-level functioning. The coordination of many different co-occurring processes at this level underlies the command and control of overall network activity. In this paper, we have considered the somatic nervous system of the nematode Caenorhabditis elegans, for which the entire neuronal connectivity diagram is known. We focus on the organization of the system into modules, i.e., neuronal groups having relatively higher connection density compared to that of the overall network. We show that this mesoscopic feature cannot be explained exclusively in terms of considerations such as, optimizing for resource constraints (viz., total wiring cost and communication efficiency (i.e., network path length. Even including information about the genetic relatedness of the cells cannot account for the observed modular structure. Comparison with other complex networks designed for efficient transport (of signals or resources implies that neuronal networks form a distinct class. This suggests that the principal function of the network, viz., processing of sensory information resulting in appropriate motor response, may be playing a vital role in determining the connection topology. Using modular spectral analysis we make explicit the intimate relation between function and structure in the nervous system. This is further brought out by identifying functionally critical neurons purely on the basis of patterns of intra- and inter-modular connections. Our study reveals how the design of the nervous system reflects several constraints, including

  8. Isotope analysis reveals foraging area dichotomy for atlantic leatherback turtles.

    Directory of Open Access Journals (Sweden)

    Stéphane Caut

    Full Text Available BACKGROUND: The leatherback turtle (Dermochelys coriacea has undergone a dramatic decline over the last 25 years, and this is believed to be primarily the result of mortality associated with fisheries bycatch followed by egg and nesting female harvest. Atlantic leatherback turtles undertake long migrations across ocean basins from subtropical and tropical nesting beaches to productive frontal areas. Migration between two nesting seasons can last 2 or 3 years, a time period termed the remigration interval (RI. Recent satellite transmitter data revealed that Atlantic leatherbacks follow two major dispersion patterns after nesting season, through the North Gulf Stream area or more eastward across the North Equatorial Current. However, information on the whole RI is lacking, precluding the accurate identification of feeding areas where conservation measures may need to be applied. METHODOLOGY/PRINCIPAL FINDINGS: Using stable isotopes as dietary tracers we determined the characteristics of feeding grounds of leatherback females nesting in French Guiana. During migration, 3-year RI females differed from 2-year RI females in their isotope values, implying differences in their choice of feeding habitats (offshore vs. more coastal and foraging latitude (North Atlantic vs. West African coasts, respectively. Egg-yolk and blood isotope values are correlated in nesting females, indicating that egg analysis is a useful tool for assessing isotope values in these turtles, including adults when not available. CONCLUSIONS/SIGNIFICANCE: Our results complement previous data on turtle movements during the first year following the nesting season, integrating the diet consumed during the year before nesting. We suggest that the French Guiana leatherback population segregates into two distinct isotopic groupings, and highlight the urgent need to determine the feeding habitats of the turtle in the Atlantic in order to protect this species from incidental take by

  9. Evolutionary pets: offspring numbers reveal speciation process in domesticated chickens.

    Directory of Open Access Journals (Sweden)

    Inga Tiemann

    Full Text Available Since Darwin, the nature of the relationship between evolution and domestication has been debated. Evolution offers different mechanisms of selection that lead to adaptation and may end in the origin of new species as defined by the biological species concept. Domestication has given rise to numerous breeds in almost every domesticated species, including chickens. At the same time, so-called artificial selection seems to exclude mechanisms of sexual selection by the animals themselves. We want to forward the question to the animal itself: With whom do you reproduce successfully? This study focused on the sexual behavior of the domestic chicken Gallus gallus f.dom., particularly the White Crested Polish breed. Experiments on mate choice and the observation of fertilization and hatching rates of mixed-breeding groups revealed breed-specific preferences. In breeding groups containing White Crested Polish and a comparative breed, more purebred chicks hatched than hybrids (number of eggs collected: 1059. Mating was possible in equal shares, but in relation to the number of eggs collected, purebred offspring (62.75% ± 7.10%, M ± SE hatched to a greater extend compared to hybrid offspring (28.75% ± 15.32%, M ± SE. These data demonstrate that the mechanism of sexual selection is still present in domestic chicken breeds, which includes the alteration of gene frequencies typical for domestication and evolutionary speciation. Due to selection and mate choice we state that breeding in principle can generate new species. Therefore, we see domestication as an evolutionary process that integrates human interests of animal breeding with innate mate choice by the animal.

  10. Can technology improve intershift report? What the research reveals.

    Science.gov (United States)

    Strople, Bernadette; Ottani, Patricia

    2006-01-01

    Shift report is a multifaceted process that serves to provide nurses with vital patient information to facilitate clinical decisions and patient care planning. A shift report also provides nurses with a forum for functions, such as patient problem solving and collaboration. The authors conducted a literature review, which indicates that current methodologies used to collect and convey patient information are ineffective and may contribute to negative patient outcomes. Data incongruence, legal implications, time constraints augmented by the nursing shortage, and the financial impact of shift report are also addressed. The literature reveals significant rationale for pioneering new and innovative methods of shift-to-shift communication. In the report To Err is Human: Building a Safe Health System, the Institute of Medicine attributes the deaths of up to 98,000 hospitalized Americans to medical errors, including communication failures [Institute of Medicine. (1999). To err is human: Building a safe health system. Report by the Committee on Quality of Health Care in America. Washington, DC: National Academy Press]. As a result, government policy makers and health care agencies have focused their attention on determining the root cause of errors to identify preventative measures, including the use of information technology [Institute of Medicine. (2004). Keeping patients safe: Transforming the work environment of nurses. Report by the Committee on Quality of Health Care in America. Washington, DC: National Academy Press]. Under these premises, the authors examined the process of nursing shift report and how it impacts patient outcomes. The use of computer technology and wireless modes of communication is explored as a means of improving the shift report process and, subsequently, health care outcomes and patient safety.

  11. Metabolomic Profiling of the Malaria Box Reveals Antimalarial Target Pathways

    Science.gov (United States)

    Allman, Erik L.; Painter, Heather J.; Samra, Jasmeet; Carrasquilla, Manuela

    2016-01-01

    The threat of widespread drug resistance to frontline antimalarials has renewed the urgency for identifying inexpensive chemotherapeutic compounds that are effective against Plasmodium falciparum, the parasite species responsible for the greatest number of malaria-related deaths worldwide. To aid in the fight against malaria, a recent extensive screening campaign has generated thousands of lead compounds with low micromolar activity against blood stage parasites. A subset of these leads has been compiled by the Medicines for Malaria Venture (MMV) into a collection of structurally diverse compounds known as the MMV Malaria Box. Currently, little is known regarding the activity of these Malaria Box compounds on parasite metabolism during intraerythrocytic development, and a majority of the targets for these drugs have yet to be defined. Here we interrogated the in vitro metabolic effects of 189 drugs (including 169 of the drug-like compounds from the Malaria Box) using ultra-high-performance liquid chromatography–mass spectrometry (UHPLC-MS). The resulting metabolic fingerprints provide information on the parasite biochemical pathways affected by pharmacologic intervention and offer a critical blueprint for selecting and advancing lead compounds as next-generation antimalarial drugs. Our results reveal several major classes of metabolic disruption, which allow us to predict the mode of action (MoA) for many of the Malaria Box compounds. We anticipate that future combination therapies will be greatly informed by these results, allowing for the selection of appropriate drug combinations that simultaneously target multiple metabolic pathways, with the aim of eliminating malaria and forestalling the expansion of drug-resistant parasites in the field. PMID:27572391

  12. Intersubject information mapping: revealing canonical representations of complex natural stimuli

    Directory of Open Access Journals (Sweden)

    Nikolaus Kriegeskorte

    2015-03-01

    Full Text Available Real-world time-continuous stimuli such as video promise greater naturalism for studies of brain function. However, modeling the stimulus variation is challenging and introduces a bias in favor of particular descriptive dimensions. Alternatively, we can look for brain regions whose signal is correlated between subjects, essentially using one subject to model another. Intersubject correlation mapping (ICM allows us to find brain regions driven in a canonical manner across subjects by a complex natural stimulus. However, it requires a direct voxel-to-voxel match between the spatiotemporal activity patterns and is thus only sensitive to common activations sufficiently extended to match up in Talairach space (or in an alternative, e.g. cortical-surface-based, common brain space. Here we introduce the more general approach of intersubject information mapping (IIM. For each brain region, IIM determines how much information is shared between the subjects' local spatiotemporal activity patterns. We estimate the intersubject mutual information using canonical correlation analysis applied to voxels within a spherical searchlight centered on each voxel in turn. The intersubject information estimate is invariant to linear transforms including spatial rearrangement of the voxels within the searchlight. This invariance to local encoding will be crucial in exploring fine-grained brain representations, which cannot be matched up in a common space and, more fundamentally, might be unique to each individual – like fingerprints. IIM yields a continuous brain map, which reflects intersubject information in fine-grained patterns. Performed on data from functional magnetic resonance imaging (fMRI of subjects viewing the same television show, IIM and ICM both highlighted sensory representations, including primary visual and auditory cortices. However, IIM revealed additional regions in higher association cortices, namely temporal pole and orbitofrontal cortex. These

  13. Raman spectroscopy reveals biophysical markers in skin cancer surgical margins

    Science.gov (United States)

    Feng, Xu; Moy, Austin J.; Nguyen, Hieu T. M.; Zhang, Yao; Fox, Matthew C.; Sebastian, Katherine R.; Reichenberg, Jason S.; Markey, Mia K.; Tunnell, James W.

    2018-02-01

    The recurrence rate of nonmelanoma skin cancer is highly related to the residual tumor after surgery. Although tissueconserving surgery, such as Mohs surgery, is a standard method for the treatment of nonmelanoma skin cancer, they are limited by lengthy and costly frozen-section histopathology. Raman spectroscopy (RS) is proving to be an objective, sensitive, and non-destructive tool for detecting skin cancer. Previous studies demonstrated the high sensitivity of RS in detecting tumor margins of basal cell carcinoma (BCC). However, those studies rely on statistical classification models and do not elucidate the skin biophysical composition. As a result, we aim to discover the biophysical differences between BCC and primary normal skin structures (including epidermis, dermis, hair follicle, sebaceous gland and fat). We obtained freshly resected ex vivo skin samples from fresh resection specimens from 14 patients undergoing Mohs surgery. Raman images were acquired from regions containing one or more structures using a custom built 830nm confocal Raman microscope. The spectra were grouped using K-means clustering analysis and annotated as either BCC or each of the five normal structures by comparing with the histopathology image of the serial section. The spectral data were then fit by a previously established biophysical model with eight primary skin constituents. Our results show that BCC has significant differences in the fit coefficients of nucleus, collagen, triolein, keratin and elastin compared with normal structures. Our study reveals RS has the potential to detect biophysical changes in resection margins, and supports the development of diagnostic algorithms for future intraoperative implementation of RS during Mohs surgery.

  14. Calreticulin reveals a critical Ca2+ checkpoint in cardiac myofibrillogenesis

    Science.gov (United States)

    Li, Jian; Pucéat, Michel; Perez-Terzic, Carmen; Mery, Annabelle; Nakamura, Kimitoshi; Michalak, Marek; Krause, Karl-Heinz; Jaconi, Marisa E.

    2002-01-01

    Calreticulin (crt) is an ubiquitously expressed and multifunctional Ca2+-binding protein that regulates diverse vital cell functions, including Ca2+ storage in the ER and protein folding. Calreticulin deficiency in mice is lethal in utero due to defects in heart development and function. Herein, we used crt − / − embryonic stem (ES) cells differentiated in vitro into cardiac cells to investigate the molecular mechanisms underlying heart failure of knockout embryos. After 8 d of differentiation, beating areas were prominent in ES-derived wild-type (wt) embryoid bodies (EBs), but not in ES-derived crt − / − EBs, despite normal expression levels of cardiac transcription factors. Crt − / − EBs exhibited a severe decrease in expression and a lack of phosphorylation of ventricular myosin light chain 2 (MLC2v), resulting in an impaired organization of myofibrils. Crt − / − phenotype could be recreated in wt cells by chelating extracellular or cytoplasmic Ca2+ with EGTA or BAPTA, or by inhibiting Ca2+/calmodulin-dependent kinases (CaMKs). An imposed ionomycin-triggered cystolic-free Ca2+ concentration ([Ca2+]c) elevation restored the expression, phosphorylation, and insertion of MLC2v into sarcomeric structures and in turn the myofibrillogenesis. The transcription factor myocyte enhancer factor C2 failed to accumulate into nuclei of crt − / − cardiac cells in the absence of ionomycin-triggered [Ca2+]c increase. We conclude that the absence of calreticulin interferes with myofibril formation. Most importantly, calreticulin deficiency revealed the importance of a Ca2+-dependent checkpoint critical for early events during cardiac myofibrillogenesis. PMID:12105184

  15. Environmental barcoding reveals massive dinoflagellate diversity in marine environments.

    Directory of Open Access Journals (Sweden)

    Rowena F Stern

    2010-11-01

    Full Text Available Dinoflagellates are an ecologically important group of protists with important functions as primary producers, coral symbionts and in toxic red tides. Although widely studied, the natural diversity of dinoflagellates is not well known. DNA barcoding has been utilized successfully for many protist groups. We used this approach to systematically sample known "species", as a reference to measure the natural diversity in three marine environments.In this study, we assembled a large cytochrome c oxidase 1 (COI barcode database from 8 public algal culture collections plus 3 private collections worldwide resulting in 336 individual barcodes linked to specific cultures. We demonstrate that COI can identify to the species level in 15 dinoflagellate genera, generally in agreement with existing species names. Exceptions were found in species belonging to genera that were generally already known to be taxonomically challenging, such as Alexandrium or Symbiodinium. Using this barcode database as a baseline for cultured dinoflagellate diversity, we investigated the natural diversity in three diverse marine environments (Northeast Pacific, Northwest Atlantic, and Caribbean, including an evaluation of single-cell barcoding to identify uncultivated groups. From all three environments, the great majority of barcodes were not represented by any known cultured dinoflagellate, and we also observed an explosion in the diversity of genera that previously contained a modest number of known species, belonging to Kareniaceae. In total, 91.5% of non-identical environmental barcodes represent distinct species, but only 51 out of 603 unique environmental barcodes could be linked to cultured species using a conservative cut-off based on distances between cultured species.COI barcoding was successful in identifying species from 70% of cultured genera. When applied to environmental samples, it revealed a massive amount of natural diversity in dinoflagellates. This highlights

  16. Rheology of transgenic switchgrass reveals practical aspects of biomass processing.

    Science.gov (United States)

    Wan, Guigui; Frazier, Taylor; Jorgensen, Julianne; Zhao, Bingyu; Frazier, Charles E

    2018-01-01

    Mechanical properties of transgenic switchgrass have practical implications for biorefinery technologies. Presented are fundamentals for simple (thermo)mechanical measurements of genetically transformed switchgrass. Experimental basics are provided for the novice, where the intention is to promote collaboration between plant biologists and materials scientists. Stem sections were subjected to two stress modes: (1) torsional oscillation in the linear response region, and (2) unidirectional torsion to failure. Specimens were analyzed while submerged/saturated in ethylene glycol, simulating natural hydration and allowing experimental temperatures above 100 °C for an improved view of the lignin glass transition. Down-regulation of the 4-Coumarate:coenzyme A ligase gene (reduced lignin content and altered monomer composition) generally resulted in less stiff and weaker stems. These observations were associated with a reduction in the temperature and activation energy of the lignin glass transition, but surprisingly with no difference in the breadth and intensity of the tan  δ signal. The results showed promise in further investigations of how rheological methods relate to stem lignin content, composition, and functional properties in the field and in bioprocessing. Measurements such as these are complicated by small specimen size; however, torsional rheometers (relatively common in polymer laboratories) are well suited for this task. As opposed to the expense and complication of relative humidity control, solvent-submersion rheological methods effectively reveal fundamental structure/property relationships in plant tissues. Demonstrated are low-strain linear methods, and also nonlinear yield and failure analysis; the latter is very uncommon for typical rheological equipment.

  17. Genetic Diversity of Aromatic Rice Germplasm Revealed By SSR Markers

    Directory of Open Access Journals (Sweden)

    Saba Jasim Aljumaili

    2018-01-01

    Full Text Available Aromatic rice cultivars constitute a small but special group of rice and are considered the best in terms of quality and aroma. Aroma is one of the most significant quality traits of rice, and variety with aroma has a higher price in the market. This research was carried out to study the genetic diversity among the 50 aromatic rice accessions from three regions (Peninsular Malaysia, Sabah, and Sarawak with 3 released varieties as a control using the 32 simple sequence repeat (SSR markers. The objectives of this research were to quantify the genetic divergence of aromatic rice accessions using SSR markers and to identify the potential accessions for introgression into the existing rice breeding program. Genetic diversity index among the three populations such as Shannon information index (I ranged from 0.25 in control to 0.98 in Sabah population. The mean numbers of effective alleles and Shannon’s information index were 0.36 and 64.90%, respectively. Similarly, the allelic diversity was very high with mean expected heterozygosity (He of 0.60 and mean Nei’s gene diversity index of 0.36. The dendrogram based on UPGMA and Nei’s genetic distance classified the 53 rice accessions into 10 clusters. Analysis of molecular variance (AMOVA revealed that 89% of the total variation observed in this germplasm came from within the populations, while 11% of the variation emanated among the populations. These results reflect the high genetic differentiation existing in this aromatic rice germplasm. Using all these criteria and indices, seven accessions (Acc9993, Acc6288, Acc6893, Acc7580, Acc6009, Acc9956, and Acc11816 from three populations have been identified and selected for further evaluation before introgression into the existing breeding program and for future aromatic rice varietal development.

  18. Genetic Diversity of Aromatic Rice Germplasm Revealed By SSR Markers.

    Science.gov (United States)

    Jasim Aljumaili, Saba; Rafii, M Y; Latif, M A; Sakimin, Siti Zaharah; Arolu, Ibrahim Wasiu; Miah, Gous

    2018-01-01

    Aromatic rice cultivars constitute a small but special group of rice and are considered the best in terms of quality and aroma. Aroma is one of the most significant quality traits of rice, and variety with aroma has a higher price in the market. This research was carried out to study the genetic diversity among the 50 aromatic rice accessions from three regions (Peninsular Malaysia, Sabah, and Sarawak) with 3 released varieties as a control using the 32 simple sequence repeat (SSR) markers. The objectives of this research were to quantify the genetic divergence of aromatic rice accessions using SSR markers and to identify the potential accessions for introgression into the existing rice breeding program. Genetic diversity index among the three populations such as Shannon information index ( I ) ranged from 0.25 in control to 0.98 in Sabah population. The mean numbers of effective alleles and Shannon's information index were 0.36 and 64.90%, respectively. Similarly, the allelic diversity was very high with mean expected heterozygosity ( H e ) of 0.60 and mean Nei's gene diversity index of 0.36. The dendrogram based on UPGMA and Nei's genetic distance classified the 53 rice accessions into 10 clusters. Analysis of molecular variance (AMOVA) revealed that 89% of the total variation observed in this germplasm came from within the populations, while 11% of the variation emanated among the populations. These results reflect the high genetic differentiation existing in this aromatic rice germplasm. Using all these criteria and indices, seven accessions (Acc9993, Acc6288, Acc6893, Acc7580, Acc6009, Acc9956, and Acc11816) from three populations have been identified and selected for further evaluation before introgression into the existing breeding program and for future aromatic rice varietal development.

  19. Heterogeneity in Neutrophil Microparticles Reveals Distinct Proteome and Functional Properties*

    Science.gov (United States)

    Dalli, Jesmond; Montero-Melendez, Trinidad; Norling, Lucy V; Yin, Xiaoke; Hinds, Charles; Haskard, Dorian; Mayr, Manuel; Perretti, Mauro

    2013-01-01

    Altered plasma neutrophil microparticle levels have recently been implicated in a number of vascular and inflammatory diseases, yet our understanding of their actions is very limited. Herein, we investigate the proteome of neutrophil microparticles in order to shed light on their biological actions. Stimulation of human neutrophils, either in suspension or adherent to an endothelial monolayer, led to the production of microparticles containing >400 distinct proteins with only 223 being shared by the two subsets. For instance, postadherent microparticles were enriched in alpha-2 macroglobulin and ceruloplasmin, whereas microparticles produced by neutrophils in suspension were abundant in heat shock 70 kDa protein 1. Annexin A1 and lactotransferrin were expressed in both microparticle subsets. We next determined relative abundance of these proteins in three types of human microparticle samples: healthy volunteer plasma, plasma of septic patients and skin blister exudates finding that these proteins were differentially expressed on neutrophil microparticles from these samples reflecting in part the expression profiles we found in vitro. Functional assessment of the neutrophil microparticles subsets demonstrated that in response to direct stimulation neutrophil microparticles produced reactive oxygen species and leukotriene B4 as well as locomoted toward a chemotactic gradient. Finally, we investigated the actions of the two neutrophil microparticles subsets described herein on target cell responses. Microarray analysis with human primary endothelial cells incubated with either microparticle subset revealed a discrete modulation of endothelial cell gene expression profile. These findings demonstrate that neutrophil microparticles are heterogenous and can deliver packaged information propagating the activation status of the parent cell, potentially exerting novel and fundamental roles both under homeostatic and disease conditions. PMID:23660474

  20. HERSCHEL OBSERVATIONS REVEAL ANOMALOUS MOLECULAR ABUNDANCES TOWARD THE GALACTIC CENTER

    Energy Technology Data Exchange (ETDEWEB)

    Sonnentrucker, P. [Space Telescope Science Institute, Baltimore, MD 21218 (United States); Neufeld, D. A.; Indriolo, N. [Physics and Astronomy Department, Johns Hopkins University, Baltimore, MD 21218 (United States); Gerin, M.; De Luca, M. [LERMA-LRA, UMR 8112 du CNRS, Observatoire de Paris, Ecole Normale Superieure, UPMC and UCP, 24 rue Lhomond, F-75231, Paris Cedex 05 (France); Lis, D. C. [Astronomy Department, California Institute of Technology, Pasadena, CA 91125 (United States); Goicoechea, J. R., E-mail: sonnentr@stsci.edu [Centro de Astrobiologia, CSIC/INTA, E-28850, Madrid (Spain)

    2013-01-20

    We report the Herschel detections of hydrogen fluoride (HF) and para-water (p-H{sub 2}O) in gas intercepting the sight lines to two well-studied molecular clouds in the vicinity of the Sgr A complex: G-0.02-0.07 (the {sup +}50 km s{sup -1} cloud{sup )} and G-0.13-0.08 (the {sup +}20 km s{sup -1} cloud{sup )}. Toward both sight lines, HF and water absorption components are detected over a wide range of velocities covering {approx}250 km s{sup -1}. For all velocity components with V{sub LSR} > -85 km s{sup -1}, we find that the HF and water abundances are consistent with those measured toward other sight lines probing the Galactic disk gas. The velocity components with V{sub LSR} {<=} -85 km s{sup -1}, which are known to trace gas residing within {approx}200 pc of the Galactic center, however, exhibit water vapor abundances with respect to HF at least a factor three higher than those found in the Galactic disk gas. Comparison with CH data indicates that our observations are consistent with a picture where HF and a fraction of the H{sub 2}O absorption arise in diffuse molecular clouds showing Galactic disk-like abundances while the bulk of the water absorption arises in warmer (T {>=} 400 K) diffuse molecular gas for V{sub LSR} {<=} -85 km s{sup -1}. This diffuse Interstellar Medium (ISM) phase has also been recently revealed through observations of CO, HF, H{sup +}{sub 3}, and H{sub 3}O{sup +} absorption toward other sight lines probing the Galactic center inner region.

  1. Genetic Diversity of Aromatic Rice Germplasm Revealed By SSR Markers

    Science.gov (United States)

    Jasim Aljumaili, Saba; Sakimin, Siti Zaharah; Arolu, Ibrahim Wasiu; Miah, Gous

    2018-01-01

    Aromatic rice cultivars constitute a small but special group of rice and are considered the best in terms of quality and aroma. Aroma is one of the most significant quality traits of rice, and variety with aroma has a higher price in the market. This research was carried out to study the genetic diversity among the 50 aromatic rice accessions from three regions (Peninsular Malaysia, Sabah, and Sarawak) with 3 released varieties as a control using the 32 simple sequence repeat (SSR) markers. The objectives of this research were to quantify the genetic divergence of aromatic rice accessions using SSR markers and to identify the potential accessions for introgression into the existing rice breeding program. Genetic diversity index among the three populations such as Shannon information index (I) ranged from 0.25 in control to 0.98 in Sabah population. The mean numbers of effective alleles and Shannon's information index were 0.36 and 64.90%, respectively. Similarly, the allelic diversity was very high with mean expected heterozygosity (He) of 0.60 and mean Nei's gene diversity index of 0.36. The dendrogram based on UPGMA and Nei's genetic distance classified the 53 rice accessions into 10 clusters. Analysis of molecular variance (AMOVA) revealed that 89% of the total variation observed in this germplasm came from within the populations, while 11% of the variation emanated among the populations. These results reflect the high genetic differentiation existing in this aromatic rice germplasm. Using all these criteria and indices, seven accessions (Acc9993, Acc6288, Acc6893, Acc7580, Acc6009, Acc9956, and Acc11816) from three populations have been identified and selected for further evaluation before introgression into the existing breeding program and for future aromatic rice varietal development. PMID:29736396

  2. Quantitative flux analysis reveals folate-dependent NADPH production

    Science.gov (United States)

    Fan, Jing; Ye, Jiangbin; Kamphorst, Jurre J.; Shlomi, Tomer; Thompson, Craig B.; Rabinowitz, Joshua D.

    2014-06-01

    ATP is the dominant energy source in animals for mechanical and electrical work (for example, muscle contraction or neuronal firing). For chemical work, there is an equally important role for NADPH, which powers redox defence and reductive biosynthesis. The most direct route to produce NADPH from glucose is the oxidative pentose phosphate pathway, with malic enzyme sometimes also important. Although the relative contribution of glycolysis and oxidative phosphorylation to ATP production has been extensively analysed, similar analysis of NADPH metabolism has been lacking. Here we demonstrate the ability to directly track, by liquid chromatography-mass spectrometry, the passage of deuterium from labelled substrates into NADPH, and combine this approach with carbon labelling and mathematical modelling to measure NADPH fluxes. In proliferating cells, the largest contributor to cytosolic NADPH is the oxidative pentose phosphate pathway. Surprisingly, a nearly comparable contribution comes from serine-driven one-carbon metabolism, in which oxidation of methylene tetrahydrofolate to 10-formyl-tetrahydrofolate is coupled to reduction of NADP+ to NADPH. Moreover, tracing of mitochondrial one-carbon metabolism revealed complete oxidation of 10-formyl-tetrahydrofolate to make NADPH. As folate metabolism has not previously been considered an NADPH producer, confirmation of its functional significance was undertaken through knockdown of methylenetetrahydrofolate dehydrogenase (MTHFD) genes. Depletion of either the cytosolic or mitochondrial MTHFD isozyme resulted in decreased cellular NADPH/NADP+ and reduced/oxidized glutathione ratios (GSH/GSSG) and increased cell sensitivity to oxidative stress. Thus, although the importance of folate metabolism for proliferating cells has been long recognized and attributed to its function of producing one-carbon units for nucleic acid synthesis, another crucial function of this pathway is generating reducing power.

  3. The Physical Mechanism of Frictional Aging Revealed by Nanoindentation Creep

    Science.gov (United States)

    Thom, C.; Carpick, R. W.; Goldsby, D. L.

    2017-12-01

    A classical observation from rock friction experiments is that friction increases linearly with the logarithm of the time of stationary contact, a phenomenon sometimes referred to as aging. Aging is most often attributed to an increase in the real area of contact due to asperity creep. However, recent atomic force microscopy (AFM) experiments and molecular dynamics simulations suggest that time-dependent siloxane (Si—O—Si) bonding gives rise to aging in silica-silica contacts in the absence of plastic deformation. Determining whether an increase in contact `quantity' (due to creep), contact `quality' (due to chemical bonding), or another unknown mechanism causes aging is a challenging experimental task, despite its importance for developing a physical basis for rate and state friction laws. An intriguing observation is that aging is absent in friction experiments on quartz rocks and gouge at humidities water on asperity creep (via hydrolytic weakening) or on the adhesive strength of contacts. To discern between these possibilities, we have conducted nanoindentation experiments on single crystals of quartz to measure their indentation hardness and creep behavior at humidities of 2% to 50%, and in vacuum. Samples were loaded at 1000 mN/s to a peak load of 15, 40, or 400 mN, which was then held constant for 10 s. After the peak load is reached, the tip sinks into the material with time due to creep of the indentation contact. Our experiments reveal that there is no effect of varying humidity on either indentation hardness or indentation creep behavior over the full range of humidities investigated. If asperity creep were the dominant mechanism of frictional aging for quartz in the experiments cited above, then significant increases in hardness and decreases in the growth rate of indentation contacts at low humidities is expected, in stark contrast with our nanoindentation data. Our experiments indicate that asperity creep cannot be the cause of aging in quartz

  4. PRIVATE INFORMATION REVEALED BY ROMANIAN FACEBOOK USERS - AN EXPLORATORY ASSESSMENT

    Directory of Open Access Journals (Sweden)

    VEGHES Calin

    2013-07-01

    Full Text Available The use of online social networks has become part of our lives. More and more people join networks, create their online profile, add pictures with themselves, add personal information about them, find people they know and connect with them, share and like posts, comments, pictures or movies and many more. The social networks allow more and more features and people are open and willing to try them. In this context, it is important for those who own such a profile to be aware of how their personal information is handled, who can view the data they publish in the social network and how they can protect the information they post, by granting access to it only to those persons they want to. The objective of this research was to study what type of information Romanian Facebook users are revealing on their profiles. We have conducted an empirical research, based on an online questionnaire which was available to be accessed in March 2013. 42,5% of the respondents, aged between 21 and 40, formed mostly my employees, managers and students, have not shared on their profiles neither their phone number, their home address, nor their messenger ID. Even though we have considered that the email address was also considered personal and very private information, our assumption did not confirmed, about 30% of the respondents have their email address shown on their profile. At the opposite side, it was confirmed that the gender, real name, personal pictures, birthday and current town are information published by more than 80% the respondents. The respondents do know and do make a difference between having their profile shown when searched on Facebook and allowing their profile to be visualised by whomever they want. Even though most of the respondents have their profile public when searched for it, the great majority have set that only their friends to be able to see the information they post online. Only about 10% of the respondents have added or have accepted

  5. Comparative genomics reveals diversity among xanthomonads infecting tomato and pepper

    LENUS (Irish Health Repository)

    Potnis, Neha

    2011-03-11

    Abstract Background Bacterial spot of tomato and pepper is caused by four Xanthomonas species and is a major plant disease in warm humid climates. The four species are distinct from each other based on physiological and molecular characteristics. The genome sequence of strain 85-10, a member of one of the species, Xanthomonas euvesicatoria (Xcv) has been previously reported. To determine the relationship of the four species at the genome level and to investigate the molecular basis of their virulence and differing host ranges, draft genomic sequences of members of the other three species were determined and compared to strain 85-10. Results We sequenced the genomes of X. vesicatoria (Xv) strain 1111 (ATCC 35937), X. perforans (Xp) strain 91-118 and X. gardneri (Xg) strain 101 (ATCC 19865). The genomes were compared with each other and with the previously sequenced Xcv strain 85-10. In addition, the molecular features were predicted that may be required for pathogenicity including the type III secretion apparatus, type III effectors, other secretion systems, quorum sensing systems, adhesins, extracellular polysaccharide, and lipopolysaccharide determinants. Several novel type III effectors from Xg strain 101 and Xv strain 1111 genomes were computationally identified and their translocation was validated using a reporter gene assay. A homolog to Ax21, the elicitor of XA21-mediated resistance in rice, and a functional Ax21 sulfation system were identified in Xcv. Genes encoding proteins with functions mediated by type II and type IV secretion systems have also been compared, including enzymes involved in cell wall deconstruction, as contributors to pathogenicity. Conclusions Comparative genomic analyses revealed considerable diversity among bacterial spot pathogens, providing new insights into differences and similarities that may explain the diverse nature of these strains. Genes specific to pepper pathogens, such as the O-antigen of the lipopolysaccharide cluster

  6. Revealing Invisible Water: Moisture Recycling as an Ecosystem Service.

    Science.gov (United States)

    Keys, Patrick W; Wang-Erlandsson, Lan; Gordon, Line J

    2016-01-01

    An ecosystem service is a benefit derived by humanity that can be traced back to an ecological process. Although ecosystem services related to surface water have been thoroughly described, the relationship between atmospheric water and ecosystem services has been mostly neglected, and perhaps misunderstood. Recent advances in land-atmosphere modeling have revealed the importance of terrestrial ecosystems for moisture recycling. In this paper, we analyze the extent to which vegetation sustains the supply of atmospheric moisture and precipitation for downwind beneficiaries, globally. We simulate land-surface evaporation with a global hydrology model and track changes to moisture recycling using an atmospheric moisture budget model, and we define vegetation-regulated moisture recycling as the difference in moisture recycling between current vegetation and a hypothetical desert world. Our results show that nearly a fifth of annual average precipitation falling on land is from vegetation-regulated moisture recycling, but the global variability is large, with many places receiving nearly half their precipitation from this ecosystem service. The largest potential impacts for changes to this ecosystem service are land-use changes across temperate regions in North America and Russia. Likewise, in semi-arid regions reliant on rainfed agricultural production, land-use change that even modestly reduces evaporation and subsequent precipitation, could significantly affect human well-being. We also present a regional case study in the Mato Grosso region of Brazil, where we identify the specific moisture recycling ecosystem services associated with the vegetation in Mato Grosso. We find that Mato Grosso vegetation regulates some internal precipitation, with a diffuse region of benefit downwind, primarily to the south and east, including the La Plata River basin and the megacities of Sao Paulo and Rio de Janeiro. We synthesize our global and regional results into a generalized

  7. Cardiac c-Kit Biology Revealed by Inducible Transgenesis.

    Science.gov (United States)

    Gude, Natalie A; Firouzi, Fareheh; Broughton, Kathleen M; Ilves, Kelli; Nguyen, Kristine P; Payne, Christina R; Sacchi, Veronica; Monsanto, Megan M; Casillas, Alexandria R; Khalafalla, Farid G; Wang, Bingyan J; Ebeid, David E; Alvarez, Roberto; Dembitsky, Walter P; Bailey, Barbara A; van Berlo, Jop; Sussman, Mark A

    2018-06-22

    Biological significance of c-Kit as a cardiac stem cell marker and role(s) of c-Kit+ cells in myocardial development or response to pathological injury remain unresolved because of varied and discrepant findings. Alternative experimental models are required to contextualize and reconcile discordant published observations of cardiac c-Kit myocardial biology and provide meaningful insights regarding clinical relevance of c-Kit signaling for translational cell therapy. The main objectives of this study are as follows: demonstrating c-Kit myocardial biology through combined studies of both human and murine cardiac cells; advancing understanding of c-Kit myocardial biology through creation and characterization of a novel, inducible transgenic c-Kit reporter mouse model that overcomes limitations inherent to knock-in reporter models; and providing perspective to reconcile disparate viewpoints on c-Kit biology in the myocardium. In vitro studies confirm a critical role for c-Kit signaling in both cardiomyocytes and cardiac stem cells. Activation of c-Kit receptor promotes cell survival and proliferation in stem cells and cardiomyocytes of either human or murine origin. For creation of the mouse model, the cloned mouse c-Kit promoter drives Histone2B-EGFP (enhanced green fluorescent protein; H2BEGFP) expression in a doxycycline-inducible transgenic reporter line. The combination of c-Kit transgenesis coupled to H2BEGFP readout provides sensitive, specific, inducible, and persistent tracking of c-Kit promoter activation. Tagging efficiency for EGFP+/c-Kit+ cells is similar between our transgenic versus a c-Kit knock-in mouse line, but frequency of c-Kit+ cells in cardiac tissue from the knock-in model is 55% lower than that from our transgenic line. The c-Kit transgenic reporter model reveals intimate association of c-Kit expression with adult myocardial biology. Both cardiac stem cells and a subpopulation of cardiomyocytes express c-Kit in uninjured adult heart

  8. Using qubits to reveal quantum signatures of an oscillator

    Science.gov (United States)

    Agarwal, Shantanu

    In this thesis, we seek to study the qubit-oscillator system with the aim to identify and quantify inherent quantum features of the oscillator. We show that the quantum signatures of the oscillator get imprinted on the dynamics of the joint system. The two key features which we explore are the quantized energy spectrum of the oscillator and the non-classicality of the oscillator's wave function. To investigate the consequences of the oscillator's discrete energy spectrum, we consider the qubit to be coupled to the oscillator through the Rabi Hamiltonian. Recent developments in fabrication technology have opened up the possibility to explore parameter regimes which were conventionally inaccessible. Motivated by these advancements, we investigate in this thesis a parameter space where the qubit frequency is much smaller than the oscillator frequency and the Rabi frequency is allowed to be an appreciable fraction of the bare frequency of the oscillator. We use the adiabatic approximation to understand the dynamics in this quasi-degenerate qubit regime. By deriving a dressed master equation, we systematically investigate the effects of the environment on the system dynamics. We develop a spectroscopic technique, using which one can probe the steady state response of the driven and damped system. The spectroscopic signal clearly reveals the quantized nature of the oscillator's energy spectrum. We extend the adiabatic approximation, earlier developed only for the single qubit case, to a scenario where multiple qubits interact with the oscillator. Using the extended adiabatic approximation, we study the collapse and revival of multi-qubit observables. We develop analytic expressions for the revival signals which are in good agreement with the numerically evaluated results. Within the quantum restriction imposed by Heisenberg's uncertainty principle, the uncertainty in the position and momentum of an oscillator is minimum and shared equally when the oscillator is prepared

  9. Gas Velocities Reveal Newly Born Planets in a Disk

    Science.gov (United States)

    Kohler, Susanna

    2018-06-01

    Occasionally, science comes together beautifully for a discovery and sometimes this happens for more than one team at once! Today we explore how two independent collaborations of scientists simultaneously found the very first kinematic evidence for young planets forming in a protoplanetary disk. Though they explored the same disk, the two teams in fact discovered different planets.Evidence for PlanetsALMAs view of the dust in the protoplanetary disk surrounding the young star HD 163296. Todays studies explore not the dust, but the gas of this disk. [ALMA (ESO/NAOJ/NRAO); A. Isella; B. Saxton (NRAO/AUI/NSF)]Over the past three decades, weve detected around 4,000 fully formed exoplanets. Much more elusive, however, are the young planets still in the early stages of formation; only a handful of these have been discovered. More observations of early-stage exoplanets are needed in order to understand how these worlds are born in dusty protoplanetary-disk environments, how they grow their atmospheres, and how they evolve.Recent observations by the Atacama Large Millimeter/submillimeter Array (ALMA) have produced stunning images of protoplanetary disks. The unprecedented resolution of these images reveals substructure in the form of gaps and rings, hinting at the presence of planets that orbit within the disk and clear out their paths as they move. But there are also non-planet mechanisms that could produce such substructure, like grain growth around ice lines, or hydrodynamic instabilities in the disk.How can we definitively determine whether there are nascent planets embedded in these disks? Direct direction of a point source in a dust gap would be a strong confirmation, but now we have the next best thing: kinematic evidence for planets, from the motion of a disks gas.Observations of carbon monoxide line emission at +1km/s from the systemic velocity (left) vs. the outcome of a computer simulation (right) in the Pinte et al. study. A visible kink occurs in the flow

  10. Space Movie Reveals Shocking Secrets Of The Crab Pulsa

    Science.gov (United States)

    2002-09-01

    Just when it seemed like the summer movie season had ended, two of NASA's Great Observatories have produced their own action movie. Multiple observations made over several months with NASA's Chandra X-ray Observatory and the Hubble Space Telescope captured the spectacle of matter and antimatter propelled to near the speed of light by the Crab pulsar, a rapidly rotating neutron star the size of Manhattan. "Through this movie, the Crab Nebula has come to life," said Jeff Hester of Arizona State University in Tempe, lead author of a paper in the September 20th issue of The Astrophysical Journal Letters. "We can see how this awesome cosmic generator actually works." The Crab was first observed by Chinese astronomers in 1054 A.D. and has since become one of the most studied objects in the sky. By combining the power of both Chandra and Hubble, the movie reveals features never seen in still images. By understanding the Crab, astronomers hope to unlock the secrets of how similar objects across the universe are powered. Crab Nebula Composite Image Crab Nebula Composite Image Bright wisps can be seen moving outward at half the speed of light to form an expanding ring that is visible in both X-ray and optical images. These wisps appear to originate from a shock wave that shows up as an inner X-ray ring. This ring consists of about two dozen knots that form, brighten and fade, jitter around, and occasionally undergo outbursts that give rise to expanding clouds of particles, but remain in roughly the same location. "These data leave little doubt that the inner X-ray ring is the location of the shock wave that turns the high-speed wind from the pulsar into extremely energetic particles," said Koji Mori of Penn State University in University Park, a coauthor of the paper. Another dramatic feature of the movie is a turbulent jet that lies perpendicular to the inner and outer rings. Violent internal motions are obvious, as is a slow motion outward into the surrounding nebula of

  11. Cosmic "Dig" Reveals Vestiges of the Milky Way's Building Blocks

    Science.gov (United States)

    2009-11-01

    Peering through the thick dust clouds of our galaxy's "bulge" (the myriads of stars surrounding its centre), and revealing an amazing amount of detail, a team of astronomers has unveiled an unusual mix of stars in the stellar grouping known as Terzan 5. Never observed anywhere in the bulge before, this peculiar "cocktail" of stars suggests that Terzan 5 is in fact one of the bulge's primordial building blocks, most likely the relic of a proto-galaxy that merged with the Milky Way during its very early days. "The history of the Milky Way is encoded in its oldest fragments, globular clusters and other systems of stars that have witnessed the entire evolution of our galaxy," says Francesco Ferraro from the University of Bologna, lead author of a paper appearing in this week's issue of the journal Nature. "Our study opens a new window on yet another piece of our galactic past." Like archaeologists, who dig through the dust piling up on top of the remains of past civilisations and unearth crucial pieces of the history of mankind, astronomers have been gazing through the thick layers of interstellar dust obscuring the bulge of the Milky Way and have unveiled an extraordinary cosmic relic. The target of the study is the star cluster Terzan 5. The new observations show that this object, unlike all but a few exceptional globular clusters, does not harbour stars which are all born at the same time - what astronomers call a "single population" of stars. Instead, the multitude of glowing stars in Terzan 5 formed in at least two different epochs, the earliest probably some 12 billion years ago and then again 6 billion years ago. "Only one globular cluster with such a complex history of star formation has been observed in the halo of the Milky Way: Omega Centauri," says team member Emanuele Dalessandro. "This is the first time we see this in the bulge." The galactic bulge is the most inaccessible region of our galaxy for astronomical observations: only infrared light can

  12. SOHO reveals violent action on the quiet Sun

    Science.gov (United States)

    1996-05-01

    One instrument in SOHO avoids looking at the Sun, because it would be dazzled. Instead, SWAN surveys the sky all around and sees an ultraviolet glow from hydrogen atoms lit by the Sun. These atoms come on a breeze from the stars that blows through the Solar System. But the competing wind of charged particles from the Sun breaks the incoming atoms, so that they no longer emit their characteristic wavelength. The result is a hole in the pattern of emissions downstream from the Sun. The surviving emissions are brightest upstream, and far above the plane of the Sun's equator. The scientists conclude that the solar wind blowing from high-latitude regions of Sun is less strong, at least during the present quiet phase of the eleven-year cycle of activity. The Earth is also visible in the maps, because a cloud of hydrogen gas called the geocorona envelops it and glows in the ultraviolet. The geocorona would hamper observations of the interstellar glow by satellites close to the Earth. SOHO sees the geocorona from the outside, and will be able to monitor effects of solar activity on the Earth's outer atmosphere. "At the present time of a quiet Sun, our sky maps clearly indicate a situation of increased solar wind around the Sun's equator," says Jean-Loup Bertaux of the Service d'Aéronomie near Paris, who has prime responsibility for SWAN. "We are anxious to see what will happen when the Sun becomes stormier. Then we shall see important changes in the solar wind's impact on the interstellar gas, revealed by the changes in the sky maps. Meanwhile we use alternate days for special investigations, and at present we are tracking Comet Hyakutake as it approaches the Sun. When colleagues ask me why a solar spacecraft should look at comets, I remind them that the solar wind was discovered by studying comet tails." Sub-surface currents mapped SOHO is successfully probing the Sun's interior. It does so with several instruments that observe oscillations of the Sun's surface. They detect

  13. Motions in Nearby Galaxy Cluster Reveal Presence of Hidden Superstructure

    Science.gov (United States)

    2004-09-01

    A nearby galaxy cluster is facing an intergalactic headwind as it is pulled by an underlying superstructure of dark matter, according to new evidence from NASA's Chandra X-ray Observatory. Astronomers think that most of the matter in the universe is concentrated in long large filaments of dark matter and that galaxy clusters are formed where these filaments intersect. A Chandra survey of the Fornax galaxy cluster revealed a vast, swept-back cloud of hot gas near the center of the cluster. This geometry indicates that the hot gas cloud, which is several hundred thousand light years in length, is moving rapidly through a larger, less dense cloud of gas. The motion of the core gas cloud, together with optical observations of a group of galaxies racing inward on a collision course with it, suggests that an unseen, large structure is collapsing and drawing everything toward a common center of gravity. X-ray Image of Fornax with labels X-ray Image of Fornax with labels "At a relatively nearby distance of about 60 million light years, the Fornax cluster represents a crucial laboratory for studying the interplay of galaxies, hot gas and dark matter as the cluster evolves." said Caleb Scharf of Columbia University in New York, NY, lead author of a paper describing the Chandra survey that was presented at an American Astronomical Society meeting in New Orleans, LA. "What we are seeing could be associated directly with the intergalactic gas surrounding a very large scale structure that stretches over millions of light years." The infalling galaxy group, whose motion was detected by Michael Drinkwater of the University of Melbourne in Australia, and colleagues, is about 3 million light years from the cluster core, so a collision with the core will not occur for a few billion years. Insight as to how this collision will look is provided by the elliptical galaxy NGC 1404 that is plunging into the core of the cluster for the first time. As discussed by Scharf and another group

  14. VLBA Reveals Closest Pair of Supermassive Black Holes

    Science.gov (United States)

    2006-05-01

    Astronomers using the National Science Foundation's Very Long Baseline Array (VLBA) radio telescope have found the closest pair of supermassive black holes ever discovered in the Universe -- a duo of monsters that together are more than 150 million times more massive than the Sun and closer together than the Earth and the bright star Vega. The VLBA The VLBA CREDIT: NRAO/AUI/NSF "These two giant black holes are only about 24 light-years apart, and that's more than 100 times closer than any pair found before," said Cristina Rodriguez, of the University of New Mexico (UNM) and Simon Bolivar University in Venezuela. Black holes are concentrations of mass with gravity so strong that not even light can escape them. The black hole pair is in the center of a galaxy called 0402+379, some 750 million light-years from Earth. Astronomers presume that each of the supermassive black holes was once at the core of a separate galaxy, then the two galaxies collided, leaving the black holes orbiting each other. The black holes orbit each other about once every 150,000 years, the scientists say. "If two black holes like these were to collide, that event would create the type of strong gravitational waves that physicists hope to detect with instruments now under construction," said Gregory Taylor, of UNM. The physicists will need to wait, though: the astronomers calculate that the black holes in 0402+379 won't collide for about a billion billion years. "There are some things that might speed that up a little bit," Taylor remarked. An earlier VLBA study of 0402+379, an elliptical galaxy, showed the pair of radio-wave-emitting objects near its core. Further studies using the VLBA and the Hobby-Eberly Telescope in Texas, revealed that the pair of objects is indeed a pair of supermassive black holes. "We needed the ultra-sharp radio 'vision' of the VLBA, particularly at the high radio frequencies of 22 and 43 GigaHertz, to get the detail needed to show that those objects are a pair of

  15. Tremendous Mass Concentration in Strange Galaxy Revealed by VLBA

    Science.gov (United States)

    1995-01-01

    A dense whirling mass orbiting what almost certainly is a black hole of truly Brobdingnagian proportions has been discovered at the heart of an active galaxy some 21 million light years from Earth. The astronomical observations were made by an international team of Japanese and American astronomers using a continent-wide radio telescope funded by the National Science Foundation. The work is reported in the January 12th issue of Nature. The tremendous concentration of mass, equivalent to 40 million suns, in the center of the galaxy NGC4258 in the constellation Canes Venatici, was revealed by the apparent rotation of a molecular disk that surrounds it. The observations showed that the disk of dense material is orbiting within the galaxy's nucleus at velocities -- up to 650 miles per second -- that require the gravitational pull of such a massive object. The high angular resolution and sensitivity of the Very Long Baseline Array of the National Radio Astronomy Observatory allowed precise measurements of the differential rotation of the material in the disk, which provides the most direct and definitive evidence to date for the presence of a supermassive black hole in the center of another galaxy. Black holes, so dense that nothing -- not even light -- can escape their gravitational fields, have long been thought to be present in the centers of active galaxies, where they would act as central engines driving a variety of exotic and energetic phenomena that are seen on much larger scales, such as jets and powerful X ray emission. NGC 4258, a spiral some 90,000 light-years across, is known to have jets of gas that are twisted into the shape of a helix emerging from the nucleus at speeds of 400 miles per second. Makoto Miyoshi of Japan's Mizusawa Astrogeodymanics Observatory; James Moran, James Herrnstein and Lincoln Greenhill of the Harvard-Smithsonian Center for Astrophysics in Cambridge, MA; Naomasa Nakai of Japan's Nobeyama Radio Observatory; Philip Diamond of the

  16. Revealing Hearts

    DEFF Research Database (Denmark)

    Saghaug, Kristin Falck; Pattison, George; Lindgren, Peter

    2014-01-01

    with reference to Tillich’s account of the meaning of revelation through culture and art, summed up in the statement that “(...) revelation is the manifestation of the ground of being for human knowledge” (Tillich, 1951, p.94), which, we argue, can be extended to everyday experiences, for example, in business......Some small business owners want to balance personal values as well as economic values. “I have to follow my heart” or “it must be meaningful” some of them say. But how might they be able to know what gives meaning to the heart? The philosophical theologian Paul Tillich finds that the problem...... life. In Tillich’s own terms, even preliminary concerns may point at an ultimate concern (Tillich, 1964), which can also be understood as ‘knowledge of the heart’. Our account is also connected to wider discussions concerning the nature of intuition....

  17. Revealing roads

    DEFF Research Database (Denmark)

    Pinder, David

    2018-01-01

    against the motorway’s grain. Based on moving with selected walkers who conduct ‘deliberately slow travelling’, and tracing the narratives of time-based civic art projects, the chapter explores the spectral dimensions of motorways in the UK. The chapter ends by positioning their streams of traffic as much...

  18. Geometry Revealed

    CERN Document Server

    Berger, Marcel

    2010-01-01

    Both classical geometry and modern differential geometry have been active subjects of research throughout the 20th century and lie at the heart of many recent advances in mathematics and physics. The underlying motivating concept for the present book is that it offers readers the elements of a modern geometric culture by means of a whole series of visually appealing unsolved (or recently solved) problems that require the creation of concepts and tools of varying abstraction. Starting with such natural, classical objects as lines, planes, circles, spheres, polygons, polyhedra, curves, surfaces,

  19. CREST Revealed

    DEFF Research Database (Denmark)

    Rapp, Hermann; Parisi, Cristiana; Bridgeman, Alfia

    This report covers the period from 1993 when the CREST project was initiated, to its launch in 1996, and considers the environment that prompted its instigation. The report looks at the massive cooperation of Government, industry and a range of different service providers that all came together......, under the central control of the CREST project team. It proposes five reasons why the CREST project was successful and examines why the CREST system continues to be at the heart of UK settlement, 20 years on....

  20. Acute erythremic myelosis (true erythroleukaemia): a variant of AML FAB-M6.

    Science.gov (United States)

    Hasserjian, R P; Howard, J; Wood, A; Henry, K; Bain, B

    2001-03-01

    Classic erythroleukaemia (acute myeloid leukaemia M6, or M6 AML) is defined as an excess of myeloblasts in an erythroid predominant background. Leukaemia variants in which the primitive blast cells are demonstrably erythroid are extremely rare and poorly characterised. Variably referred to as "true erythroleukaemia" or "acute erythremic myelosis", they are often included within the M6 AML category even though they do not meet strict criteria for this type of AML. Two cases of acute erythroid neoplasia are presented with clinical, morphological, immunophenotypic, and cytogenetic analysis. Both patients presented with profound anaemia, one in a setting of long standing myelodysplasia. Bone marrow examination revealed a predominant population of highly dysplastic erythroid cells in both cases. In one case, the liver was infiltrated by neoplastic erythroid cells. Both patients died within four months of diagnosis. This report illustrates that cases of acute leukaemia occur in which the dominant neoplastic cell is a primitive erythroid cell without an accompanying increase in myeloblasts. This does not preclude the neoplastic clone originating in a multipotent haemopoietic stem cell, as suggested by cases arising in patients with myelodysplasia. Acute erythremic myelosis should be recognised as a distinct variant of M6 AML.

  1. On combining revealed and stated preferences to forecast customer behaviour: three case studies

    NARCIS (Netherlands)

    Ph.H.B.F. Franses (Philip Hans); P.C. Verhoef (Peter)

    2002-01-01

    textabstractMany companies collect stated preference data (SP) like intentions and satisfaction as well as revealed preference data (RP) like actual purchasing behavior. It seems relevant to examine the predictive usefulness of this information for future revealed preferences, that is, customer

  2. Metatranscriptomics reveals the molecular mechanism of large granule formation in granular anammox reactor

    KAUST Repository

    Bagchi, Samik; Lamendella, Regina; Strutt, Steven; Van Loosdrecht, Mark C. M.; Saikaly, Pascal

    2016-01-01

    to formation of large granules. Size distribution analysis revealed the spatial distribution of granules in which large granules having higher abundance of anammox bacteria (genus Brocadia) dominated the bottom biomass. Metatranscriptomics analysis detected all

  3. Diffuse correlation tomography reveals spatial and temporal difference in blood flow changes among murine femoral grafts

    Science.gov (United States)

    Han, Songfeng; Proctor, Ashley R.; Benoit, Danielle S. W.; Choe, Regine

    2017-07-01

    Diffuse correlation tomography was utilized to noninvasively monitor 3D blood flow changes in three types of healing mouse femoral grafts. Results reveal the spatial and temporal difference among the groups.

  4. New Genetic Susceptibility Factors for Sjögren's Syndrome Revealed

    Science.gov (United States)

    ... Spotlight on Research Spotlight on Research New Genetic Susceptibility Factors for Sjögren’s Syndrome Revealed By Kirstie Saltsman, ... swallowing and speaking. “The identification of these genetic susceptibility factors opens up new avenues for understanding how ...

  5. What a Decade of Experiments Reveals about Factors that Influence the Sense of Presence

    National Research Council Canada - National Science Library

    Youngblut, Christine

    2006-01-01

    ...? Will behavior learned in a virtual-world transfer to a corresponding real scenario? This document reviews what experimental results reveal about technical factors and task characteristics that may influence the sense of presence...

  6. Incorporation of Ortho- and Meta-Tyrosine Into Cellular Proteins Leads to Erythropoietin-Resistance in an Erythroid Cell Line

    Directory of Open Access Journals (Sweden)

    Esztella Mikolás

    2014-04-01

    Full Text Available Background/Aims: Erythropoietin-resistance is an unsolved concern in the treatment of renal anaemia. We aimed to investigate the possible role of ortho- and meta-tyrosine - the hydroxyl free radical products of L-phenylalanine - in the development of erythropoietin-resistance. Methods: TF-1 erythroblast cell line was used. Cell concentration was determined on day 1; 2 and 3 by two independent observers simultaneously in Bürker cell counting chambers. Protein concentration was determined with colorimetric method. Para-, ortho- and meta-tyrosine levels were measured using reverse phase-HPLC with fluorescence detection. Using Western blot method activating phosphorylation of STAT5 and ERK1/2 were investigated. Results: We found a time- and concentration-dependent decrease of erythropoietin-induced proliferative activity in case of ortho- and meta-tyrosine treated TF-1 erythroblasts, compared to the para-tyrosine cultured cells. Decreased erythropoietin-response could be regained with a competitive dose of para-tyrosine. Proteins of erythroblasts treated by ortho- or meta-tyrosine had lower para-tyrosine and higher ortho- or meta-tyrosine content. Activating phosphorylation of ERK and STAT5 due to erythropoietin was practically prevented by ortho- or meta-tyrosine treatment. Conclusion: According to this study elevated ortho- and meta-tyrosine content of erythroblasts may lead to the dysfunction of intracellular signaling, resulting in erythropoietin-hyporesponsiveness.

  7. Kinetics of granulocytic and erythroid progenitor cells are affected differently by short-term, low-level benzene exposure

    Energy Technology Data Exchange (ETDEWEB)

    Dempster, A.M.; Snyder, C.A. (New York Univ. Medical Center, NY (United States). Inst. of Environmental Medicine)

    1991-09-01

    Mice were exposed to either air or 10 ppm benzene for 6 h/d X 5 d. Immediately after the last exposure, mice were injected, i.v., with either saline or hydroxyurea (HU). The dose of HU was sufficient to kill hematopoietic cells in or near S-phase of the cell cycle and sufficient to synchronize the surviving populations of hematopoietic cells. Three days after benzene exposure, CFU-E numbers had declined to 50% of control values while CFU-GM numbers were equal to control values at this time. The benzene exposures were sufficient to double the percentage of CFU-E in S-phase but produced no such increase among CFU-Gm. During 3 days of recovery from benzene exposure and HU treatment, the CFU-E population expanded 30-fold while the CFU-GM population expanded less than 3-fold. Following benzene exposure and HU treatment, both progenitor cells produced elevated numbers of their respective progeny. When CFU-E from benzene-exposed mice were cultured with varying concentrations of erythropoietin (EPO), the response at maximal EPO concentration was 66% of the response by control CFU-E. This strongly suggests that the CFU-E populations from benzene-exposed mice had been depleted of cells in or near S-phase. The results indicate that CFU-GM respond to low-level benzene exposure by increasing their rate of differentiation but not their rate of proliferation, while CFU-E respond by increasing both their rates of differentiation and proliferation. We speculate that it is the increase in CFU-E proliferation that renders these cells more susceptible to benzene than their granulocytic counterparts, especially those CFU-E at or near the S-phase of the cell cycle. (orig.).

  8. Retroviral-mediated transfer and expression of human β-globin genes in cultured murine and human erythroid cells

    International Nuclear Information System (INIS)

    Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.

    1988-01-01

    The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells

  9. LCR/MEL: A versatile system for high-level expression of heterologous proteins in erythroid cells.

    NARCIS (Netherlands)

    M. Needham; C. Gooding; K. Hudson; M. Antoniou (Michael); F.G. Grosveld (Frank); M. Hollis

    1992-01-01

    textabstractWe have used the human globin locus control region (LCR) to assemble an expression system capable of high-level, integration position-independent expression of heterologous genes and cDNAs in murine erythroleukaemia (MEL) cells. The cDNAs are inserted between the human beta-globin

  10. DMPD: A role for caspases in the differentiation of erythroid cells and macrophages. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available ges. Droin N, Cathelin S, Jacquel A, Guery L, Garrido C, Fontenay M, Hermine O,Solary E. Biochimie. 2008 Feb... Garrido C, Fontenay M, Hermine O,Solary E. Publication Biochimie. 2008 Feb;90(2):416-22. Epub 2007 Sep 2. P

  11. Meloxicam elevates serum concentration of Erythropoietin and numbers of bone marrow erythroid progenitor cells in sublethally gamma-irradiated mice

    Czech Academy of Sciences Publication Activity Database

    Hofer, Michal; Pospíšil, Milan; Vacek, Antonín; Znojil, V.; Holá, Jiřina; Štreitová, Denisa

    2009-01-01

    Roč. 78, č. 1 (2009), s. 19-22 ISSN 0001-7213 R&D Projects: GA ČR(CZ) GA305/08/0158; GA AV ČR(CZ) 1QS500040507 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cyclooxygenase-2 inhibition * erythropoiesis * radiation-induced myelosuppression Subject RIV: BO - Biophysics Impact factor: 0.403, year: 2009

  12. Ischaemic colitis and lung infiltrates caused by extramedullary haematopoiesis in a patient with an acute erythroid leukaemia following polycythaemia vera

    NARCIS (Netherlands)

    Brada, SJL; de Wolf, JTM; Poppema, S; Vellenga, E

    A patient with 'spent' polycythaemia vera showed extensive extramedullary haematopoiesis (EMH) in non-haematopoietic tissue clinically resulting in an ischaemic colitis and respiratory symptoms due to lung infiltrates. On laboratory investigation, the EMH also included immature erythroblasts due to

  13. GAR22: A novel target gene of thyroid hormone receptor causes growth inhibition in human erythroid cells

    Czech Academy of Sciences Publication Activity Database

    Gamper, I.; Koh, K.-R.; Ruau, D.; Ullrich, K.; Bartůňková, Jana; Piroth, D.; Hacker, C.; Bartůněk, Petr; Zenke, M.

    2009-01-01

    Roč. 37, č. 5 (2009), s. 539-548 ISSN 0301-472X R&D Projects: GA MŠk(CZ) LC06077 Institutional research plan: CEZ:AV0Z50520514 Keywords : Thyroid hormone receptor * GAR22 * erythropoiesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.106, year: 2009

  14. A novel way to induce erythroid progenitor self renewal: cooperation of c-Kit with the erythropoietin receptor

    NARCIS (Netherlands)

    Wessely, O.; Bauer, A.; Quang, C. T.; Deiner, E. M.; von Lindern, M.; Mellitzer, G.; Steinlein, P.; Ghysdael, J.; Beug, H.

    1999-01-01

    Red blood cells are of vital importance for oxygen transport in vertebrates. Thus, their formation during development and homeostasis requires tight control of both progenitor proliferation and terminal red cell differentiation. Self renewal (i.e. long-term proliferation without differentiation) of

  15. A dominant mutation in the gene encoding the erythroid transcription factor KLF1 causes a congenital dyserythropoietic anemia

    DEFF Research Database (Denmark)

    Arnaud, Lionel; Saison, Carole; Helias, Virginie

    2010-01-01

    The congenital dyserythropoietic anemias (CDAs) are inherited red blood cell disorders whose hallmarks are ineffective erythropoiesis, hemolysis, and morphological abnormalities of erythroblasts in bone marrow. We have identified a missense mutation in KLF1 of patients with a hitherto unclassified...

  16. PAS positivity of erythroid precursor cells is associated with a poor prognosis in newly diagnosed myelodysplastic syndrome patients.

    Science.gov (United States)

    Masuda, Kenta; Shiga, Shuichi; Kawabata, Hiroshi; Takaori-Kondo, Akifumi; Ichiyama, Satoshi; Kamikubo, Yasuhiko

    2018-07-01

    Myelodysplastic syndrome (MDS) is a group of clonal stem cell disorders characterized by hematopoietic insufficiency. The accurate risk stratification of patients with MDS is essential for selection of appropriate therapies. We herein conducted a retrospective cohort study to examine the prognostic value of periodic acid-Schiff (PAS) reaction-positive erythroblasts in MDS patients. We examined the PAS positivity of the bone marrow erythroblasts of 144 patients newly diagnosed with MDS; 26 (18.1%) of them had PAS-positive erythroblasts, whereas 118 (81.9%) did not. The PAS-positive group showed significantly poorer karyotypes as defined in the revised International Prognostic Scoring System (IPSS-R) and higher scores in age-adjusted IPSS-R (IPSS-RA) than the PAS-negative group. Overall survival (OS) and leukemia-free survival (LFS) were also significantly shorter in the PAS-positive group than in the PAS-negative group. Similar results were obtained when only high- and very high risk groups were analyzed using IPSS-RA. This retrospective study suggested that the PAS positivity of erythroblasts is an additional prognostic factor combined with other risk scores for OS and LFS in MDS, and our results may contribute to improved clinical decision-making and rapid risk stratification.

  17. HS5 of the human β-globin Locus Control Region: a developmental stage-specific border in erythroid cells.

    NARCIS (Netherlands)

    A. Wai (Albert); N. Gillemans (Nynke); S. Raguz-Bolognesi (Selina); S. Pruzina (Sara); G. Zafarana (Gaetano); D.N. Meijer (Dies); F.G. Grosveld (Frank); J.N.J. Philipsen (Sjaak)

    2003-01-01

    textabstractElements with insulator/border activity have been characterized most extensively in Drosophila melanogaster. In vertebrates, the first example of such an element was provided by a hypersensitive site of the chicken beta-globin locus, cHS4. It has been proposed that the homologous site in

  18. A systems level approach reveals new gene regulatory modules in the developing ear

    OpenAIRE

    Chen, Jingchen; Tambalo, Monica; Barembaum, Meyer; Ranganathan, Ramya; Simões-Costa, Marcos; Bronner, Marianne E.; Streit, Andrea

    2017-01-01

    The inner ear is a complex vertebrate sense organ, yet it arises from a simple epithelium, the otic placode. Specification towards otic fate requires diverse signals and transcriptional inputs that act sequentially and/or in parallel. Using the chick embryo, we uncover novel genes in the gene regulatory network underlying otic commitment and reveal dynamic changes in gene expression. Functional analysis of selected transcription factors reveals the genetic hierarchy underlying the transition ...

  19. A Filtering Method to Reveal Crystalline Patterns from Atom Probe Microscopy Desorption Maps

    Science.gov (United States)

    2016-03-26

    reveal crystalline patterns from atom probe microscopy desorption maps Lan Yao Department of Materials Science and Engineering, University of Michigan, Ann...reveal the crystallographic information present in Atom Probe Microscopy (APM) data is presented. Themethod filters atoms based on the time difference...between their evaporation and the evaporation of the previous atom . Since this time difference correlates with the location and the local structure of

  20. High rates of hybridisation reveal fragile reproductive barriers between endangered Australian sea snakes

    DEFF Research Database (Denmark)

    Sanders, Kate L; Redsted Rasmussen, Arne; Guinea, Michael L.

    2014-01-01

    designations, but revealed high frequencies of hybrids on all four reefs and individuals of pure A. fuscus ancestry only at Scott and (historically) Ashmore. Most unexpectedly, 95% of snakes sampled at Hibernia were hybrids that resembled A. laevis in phenotype, revealing a collapse of reproductive barriers...... (‘reverse speciation’) at this reef. These results have dire implications for the conservation status of A. fuscus, and highlight the fragility of reproductive barriers in a recent marine radiation....

  1. Unitary Root Music and Unitary Music with Real-Valued Rank Revealing Triangular Factorization

    Science.gov (United States)

    2010-06-01

    AFRL-RY-WP-TP-2010-1213 UNITARY ROOT MUSIC AND UNITARY MUSIC WITH REAL-VALUED RANK REVEALING TRIANGULAR FACTORIZATION (Postprint) Nizar...DATES COVERED (From - To) June 2010 Journal Article Postprint 08 September 2006 – 31 August 2009 4. TITLE AND SUBTITLE UNITARY ROOT MUSIC AND...UNITARY MUSIC WITH REAL-VALUED RANK REVEALING TRIANGULAR FACTORIZATION (Postprint) 5a. CONTRACT NUMBER 5b. GRANT NUMBER FA8650-05-D-1912-0007 5c

  2. Acting without seeing: Eye movements reveal visual processing without awareness Miriam Spering & Marisa Carrasco

    OpenAIRE

    Spering, Miriam; Carrasco, Marisa

    2015-01-01

    Visual perception and eye movements are considered to be tightly linked. Diverse fields, ranging from developmental psychology to computer science, utilize eye tracking to measure visual perception. However, this prevailing view has been challenged by recent behavioral studies. We review converging evidence revealing dissociations between the contents of perceptual awareness and different types of eye movements. Such dissociations reveal situations in which eye movements are sensitive to part...

  3. Virtually naked: virtual environment reveals sex-dependent nature of skin disclosure.

    Directory of Open Access Journals (Sweden)

    Anna M Lomanowska

    Full Text Available The human tendency to reveal or cover naked skin reflects a competition between the individual propensity for social interactions related to sexual appeal and interpersonal touch versus climatic, environmental, physical, and cultural constraints. However, due to the ubiquitous nature of these constraints, isolating on a large scale the spontaneous human tendency to reveal naked skin has remained impossible. Using the online 3-dimensional virtual world of Second Life, we examined spontaneous human skin-covering behavior unhindered by real-world climatic, environmental, and physical variables. Analysis of hundreds of avatars revealed that virtual females disclose substantially more naked skin than virtual males. This phenomenon was not related to avatar hypersexualization as eva