Directory of Open Access Journals (Sweden)
Zulema Romero
Full Text Available Lentiviral vectors designed for the treatment of the hemoglobinopathies require the inclusion of regulatory and strong enhancer elements to achieve sufficient expression of the β-globin transgene. Despite the inclusion of these elements, the efficacy of these vectors may be limited by transgene silencing due to the genomic environment surrounding the integration site. Barrier insulators can be used to give more consistent expression and resist silencing even with lower vector copies. Here, the barrier activity of an insulator element from the human ankyrin-1 gene was analyzed in a lentiviral vector carrying an antisickling human β-globin gene. Inclusion of a single copy of the Ankyrin insulator did not affect viral titer, and improved the consistency of expression from the vector in murine erythroleukemia cells. The presence of the Ankyrin insulator element did not change transgene expression in human hematopoietic cells in short-term erythroid culture or in vivo in primary murine transplants. However, analysis in secondary recipients showed that the lentiviral vector with the Ankyrin element preserved transgene expression, whereas expression from the vector lacking the Ankyrin insulator decreased in secondary recipients. These studies demonstrate that the Ankyrin insulator may improve long-term β-globin expression in hematopoietic stem cells for gene therapy of hemoglobinopathies.
Ankyrins: Roles in synaptic biology and pathology.
Smith, Katharine R; Penzes, Peter
2018-05-03
Ankyrins are broadly expressed adaptors that organize diverse membrane proteins into specialized domains and link them to the sub-membranous cytoskeleton. In neurons, ankyrins are known to have essential roles in organizing the axon initial segment and nodes of Ranvier. However, recent studies have revealed novel functions for ankyrins at synapses, where they organize and stabilize neurotransmitter receptors, modulate dendritic spine morphology and control adhesion to the presynaptic site. Ankyrin genes have also been highly associated with a range of neurodevelopmental and psychiatric diseases, including bipolar disorder, schizophrenia and autism, which all demonstrate overlap in their genetics, mechanisms and phenotypes. This review discusses the novel synaptic functions of ankyrin proteins in neurons, and places these exciting findings in the context of ANK genes as key neuropsychiatric disorder risk-factors. Copyright © 2018 Elsevier Inc. All rights reserved.
Bmi-1 Regulates Extensive Erythroid Self-Renewal
Directory of Open Access Journals (Sweden)
Ah Ram Kim
2015-06-01
Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.
Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu
2012-08-01
Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
Ankyrin-1 Gene Exhibits Allelic Heterogeneity in Conferring Protection Against Malaria
Directory of Open Access Journals (Sweden)
Hong Ming Huang
2017-09-01
Full Text Available Allelic heterogeneity is a common phenomenon where a gene exhibits a different phenotype depending on the nature of its genetic mutations. In the context of genes affecting malaria susceptibility, it allowed us to explore and understand the intricate host–parasite interactions during malaria infections. In this study, we described a gene encoding erythrocytic ankyrin-1 (Ank-1 which exhibits allelic-dependent heterogeneous phenotypes during malaria infections. We conducted an ENU mutagenesis screen on mice and identified two Ank-1 mutations, one resulting in an amino acid substitution (MRI95845, and the other a truncated Ank-1 protein (MRI96570. Both mutations caused hereditary spherocytosis-like phenotypes and confer differing protection against Plasmodium chabaudi infections. Upon further examination, the Ank-1(MRI96570 mutation was found to inhibit intraerythrocytic parasite maturation, whereas Ank-1(MRI95845 caused increased bystander erythrocyte clearance during infection. This is the first description of allelic heterogeneity in ankyrin-1 from the direct comparison between two Ank-1 mutations. Despite the lack of direct evidence from population studies, this data further supported the protective roles of ankyrin-1 mutations in conferring malaria protection. This study also emphasized the importance of such phenomena in achieving a better understanding of host–parasite interactions, which could be the basis of future studies.
Energy Technology Data Exchange (ETDEWEB)
Sakamoto, Hikaru [Department of Bioproduction, Faculty of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri-shi, Hokkaido 093-2422 (Japan); Sakata, Keiko; Kusumi, Kensuke [Department of Biology, Faculty of Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Kojima, Mikiko; Sakakibara, Hitoshi [RIKEN Plant Science Center, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama 230-0045 (Japan); Iba, Koh, E-mail: koibascb@kyushu-u.org [Department of Biology, Faculty of Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)
2012-06-29
Highlights: Black-Right-Pointing-Pointer ITN1, a plasma membrane ankyrin protein, interacts with a nuclear DNA-binding protein RTV1. Black-Right-Pointing-Pointer The nuclear transport of RTV1 is partially inhibited by interaction with ITN1. Black-Right-Pointing-Pointer RTV1 can promote the nuclear localization of ITN1. Black-Right-Pointing-Pointer Both overexpression of RTV1 and the lack of ITN1 increase salicylic acids sensitivity in plants. -- Abstract: The increased tolerance to NaCl 1 (ITN1) protein is a plasma membrane (PM)-localized protein involved in responses to NaCl stress in Arabidopsis. The predicted structure of ITN1 is composed of multiple transmembrane regions and an ankyrin-repeat domain that is known to mediate protein-protein interactions. To elucidate the molecular functions of ITN1, we searched for interacting partners using a yeast two-hybrid assay, and a nuclear-localized DNA-binding protein, RTV1, was identified as a candidate. Bimolecular fluorescence complementation analysis revealed that RTV1 interacted with ITN1 at the PM and nuclei in vivo. RTV1 tagged with red fluorescent protein localized to nuclei and ITN1 tagged with green fluorescent protein localized to PM; however, both proteins localized to both nuclei and the PM when co-expressed. These findings suggest that RTV1 and ITN1 regulate the subcellular localization of each other.
Directory of Open Access Journals (Sweden)
Sweeney Torres
2010-12-01
Full Text Available Abstract Background Recent QTL and gene expression studies have highlighted ankyrins as positional and functional candidate genes for meat quality. Our objective was to characterise the promoter region of the bovine ankyrin 1 gene and to test polymorphisms for association with sensory and technological meat quality measures. Results Seven novel promoter SNPs were identified in a 1.11 kb region of the ankyrin 1 promoter in Angus, Charolais and Limousin bulls (n = 15 per breed as well as 141 crossbred beef animals for which meat quality data was available. Eighteen haplotypes were inferred with significant breed variation in haplotype frequencies. The five most frequent SNPs and the four most frequent haplotypes were subsequently tested for association with sensory and technological measures of meat quality in the crossbred population. SNP1, SNP3 and SNP4 (which were subsequently designated regulatory SNPs and SNP5 were associated with traits that contribute to sensorial and technological measurements of tenderness and texture; Haplotype 1 and haplotype 4 were oppositely correlated with traits contributing to tenderness (P Conclusion The conclusion from this study is that alleles defining haplotypes 2 and 4 could usefully contribute to marker SNP panels used to select individuals with improved IMF/juiciness or tenderness in a genome-assisted selection framework.
PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.
Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C
2017-05-01
Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.
Directory of Open Access Journals (Sweden)
2005-12-01
Full Text Available We report identification of an ankyrin-B-based macromolecular complex of Na/K ATPase (alpha 1 and alpha 2 isoforms, Na/Ca exchanger 1, and InsP3 receptor that is localized in cardiomyocyte T-tubules in discrete microdomains distinct from classic dihydropyridine receptor/ryanodine receptor "dyads." E1425G mutation of ankyrin-B, which causes human cardiac arrhythmia, also blocks binding of ankyrin-B to all three components of the complex. The ankyrin-B complex is markedly reduced in adult ankyrin-B(+/- cardiomyocytes, which may explain elevated [Ca2+]i transients in these cells. Thus, loss of the ankyrin-B complex provides a molecular basis for cardiac arrhythmia in humans and mice. T-tubule-associated ankyrin-B, Na/Ca exchanger, and Na/K ATPase are not present in skeletal muscle, where ankyrin-B is expressed at 10-fold lower levels than in heart. Ankyrin-B also is not abundantly expressed in smooth muscle. We propose that the ankyrin-B-based complex is a specialized adaptation of cardiomyocytes with a role for cytosolic Ca2+ modulation.
Directory of Open Access Journals (Sweden)
Deepti Jain
2015-06-01
Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.
Regulation of the transient receptor potential channel TRPA1 by its N-terminal ankyrin repeat domain
Czech Academy of Sciences Publication Activity Database
Zayats, Vasilina; Samad, Abdul; Minofar, Babak; Roelofs, K. E.; Stockner, T.; Ettrich, Rüdiger
2012-01-01
Roč. 19, č. 11 (2012), s. 4689-4700 ISSN 1610-2940 R&D Projects: GA ČR GAP207/10/1934 Institutional research plan: CEZ:AV0Z60870520 Keywords : ankyrin repeat * EF-hand * familial episodic pain syndrom * TRPA1 Subject RIV: CE - Biochemistry Impact factor: 1.984, year: 2012
LENUS (Irish Health Repository)
Aslan, Ozlem
2010-12-15
Abstract Background Recent QTL and gene expression studies have highlighted ankyrins as positional and functional candidate genes for meat quality. Our objective was to characterise the promoter region of the bovine ankyrin 1 gene and to test polymorphisms for association with sensory and technological meat quality measures. Results Seven novel promoter SNPs were identified in a 1.11 kb region of the ankyrin 1 promoter in Angus, Charolais and Limousin bulls (n = 15 per breed) as well as 141 crossbred beef animals for which meat quality data was available. Eighteen haplotypes were inferred with significant breed variation in haplotype frequencies. The five most frequent SNPs and the four most frequent haplotypes were subsequently tested for association with sensory and technological measures of meat quality in the crossbred population. SNP1, SNP3 and SNP4 (which were subsequently designated regulatory SNPs) and SNP5 were associated with traits that contribute to sensorial and technological measurements of tenderness and texture; Haplotype 1 and haplotype 4 were oppositely correlated with traits contributing to tenderness (P < 0.05). While no single SNP was associated with intramuscular fat (IMF), a clear association with increased IMF and juiciness was observed for haplotype 2. Conclusion The conclusion from this study is that alleles defining haplotypes 2 and 4 could usefully contribute to marker SNP panels used to select individuals with improved IMF\\/juiciness or tenderness in a genome-assisted selection framework.
Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.
2010-01-01
Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494
THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA
DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
1994-01-01
Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using
Bennett, Vann; Lorenzo, Damaris N
2016-01-01
Ankyrins are membrane-associated proteins that together with their spectrin partners are responsible for micron-scale organization of vertebrate plasma membranes, including those of erythrocytes, excitable membranes of neurons and heart, lateral membrane domains of columnar epithelial cells, and striated muscle. Ankyrins coordinate functionally related membrane transporters and cell adhesion proteins (15 protein families identified so far) within plasma membrane compartments through independently evolved interactions of intrinsically disordered sequences with a highly conserved peptide-binding groove formed by the ANK repeat solenoid. Ankyrins are coupled to spectrins, which are elongated organelle-sized proteins that form mechanically resilient arrays through cross-linking by specialized actin filaments. In addition to protein interactions, cellular targeting and assembly of spectrin/ankyrin domains also critically depend on palmitoylation of ankyrin-G by aspartate-histidine-histidine-cysteine 5/8 palmitoyltransferases, as well as interaction of beta-2 spectrin with phosphoinositide lipids. These lipid-dependent spectrin/ankyrin domains are not static but are locally dynamic and determine membrane identity through opposing endocytosis of bulk lipids as well as specific proteins. A partnership between spectrin, ankyrin, and cell adhesion molecules first emerged in bilaterians over 500 million years ago. Ankyrin and spectrin may have been recruited to plasma membranes from more ancient roles in organelle transport. The basic bilaterian spectrin-ankyrin toolkit markedly expanded in vertebrates through gene duplications combined with variation in unstructured intramolecular regulatory sequences as well as independent evolution of ankyrin-binding activity by ion transporters involved in action potentials and calcium homeostasis. In addition, giant vertebrate ankyrins with specialized roles in axons acquired new coding sequences by exon shuffling. We speculate that
The diversity and evolution of Wolbachia ankyrin repeat domain genes.
Directory of Open Access Journals (Sweden)
Stefanos Siozios
Full Text Available Ankyrin repeat domain-encoding genes are common in the eukaryotic and viral domains of life, but they are rare in bacteria, the exception being a few obligate or facultative intracellular Proteobacteria species. Despite having a reduced genome, the arthropod strains of the alphaproteobacterium Wolbachia contain an unusually high number of ankyrin repeat domain-encoding genes ranging from 23 in wMel to 60 in wPip strain. This group of genes has attracted considerable attention for their astonishing large number as well as for the fact that ankyrin proteins are known to participate in protein-protein interactions, suggesting that they play a critical role in the molecular mechanism that determines host-Wolbachia symbiotic interactions. We present a comparative evolutionary analysis of the wMel-related ankyrin repeat domain-encoding genes present in different Drosophila-Wolbachia associations. Our results show that the ankyrin repeat domain-encoding genes change in size by expansion and contraction mediated by short directly repeated sequences. We provide examples of intra-genic recombination events and show that these genes are likely to be horizontally transferred between strains with the aid of bacteriophages. These results confirm previous findings that the Wolbachia genomes are evolutionary mosaics and illustrate the potential that these bacteria have to generate diversity in proteins potentially involved in the symbiotic interactions.
Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang
2017-07-01
Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.
Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.
Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong
2017-02-03
Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.
Hall, Bradford E.; Prochazkova, Michaela; Sapio, Matthew R.; Minetos, Paul; Kurochkina, Natalya; Binukumar, B. K.; Amin, Niranjana D.; Terse, Anita; Joseph, John; Raithel, Stephen J.; Mannes, Andrew J.; Pant, Harish C.; Chung, Man-Kyo; Iadarola, Michael J.; Kulkarni, Ashok B.
2018-01-01
Cyclin-dependent kinase 5 (Cdk5) is a key neuronal kinase that is upregulated during inflammation, and can subsequently modulate sensitivity to nociceptive stimuli. We conducted an in silico screen for Cdk5 phosphorylation sites within proteins whose expression was enriched in nociceptors and identified the chemo-responsive ion channel Transient Receptor Potential Ankyrin 1 (TRPA1) as a possible Cdk5 substrate. Immunoprecipitated full length TRPA1 was shown to be phosphorylated by Cdk5 and th...
Directory of Open Access Journals (Sweden)
Pichon Samuel
2012-04-01
Full Text Available Abstract Background The maternally inherited α-Proteobacteria Wolbachia pipientis is an obligate endosymbiont of nematodes and arthropods, in which they induce a variety of reproductive alterations, including Cytoplasmic Incompatibility (CI and feminization. The genome of the feminizing wVulC Wolbachia strain harboured by the isopod Armadillidium vulgare has been sequenced and is now at the final assembly step. It contains an unusually high number of ankyrin motif-containing genes, two of which are homologous to the phage-related pk1 and pk2 genes thought to contribute to the CI phenotype in Culex pipiens. These genes encode putative bacterial effectors mediating Wolbachia-host protein-protein interactions via their ankyrin motifs. Results To test whether these Wolbachia homologs are potentially involved in altering terrestrial isopod reproduction, we determined the distribution and expression of both pk1 and pk2 genes in the 3 Wolbachia strains that induce CI and in 5 inducing feminization of their isopod hosts. Aside from the genes being highly conserved, we found a substantial copy number variation among strains, and that is linked to prophage diversity. Transcriptional analyses revealed expression of one pk2 allele (pk2b2 only in the feminizing Wolbachia strains of isopods. Conclusions These results reveal the need to investigate the functions of Wolbachia ankyrin gene products, in particular those of Pk2, and their host targets with respect to host sex manipulation.
Structural analyses of the Ankyrin Repeat Domain of TRPV6 and related TRPV ion channels†‡
Phelps, Christopher B.; Huang, Robert J.; Lishko, Polina V.; Wang, Ruiqi R.; Gaudet, Rachelle
2008-01-01
Transient Receptor Potential (TRP) proteins are cation channels composed of a transmembrane domain flanked by large N- and C-terminal cytoplasmic domains. All members of the vanilloid family of TRP channels (TRPV) possess an N-terminal ankyrin repeat domain (ARD). The ARD of mammalian TRPV6, an important regulator of calcium uptake and homeostasis, is essential for channel assembly and regulation. The 1.7 Å crystal structure of the TRPV6-ARD reveals conserved structural elements unique to the...
International Nuclear Information System (INIS)
Maiweilidan, Yimingjiang; Klauza, Izabela; Kordeli, Ekaterini
2011-01-01
Ankyrins, the adapters of the spectrin skeleton, are involved in local accumulation and stabilization of integral proteins to the appropriate membrane domains. In striated muscle, tissue-dependent alternative splicing generates unique Ank3 gene products (ankyrins-G); they share the Obscurin/Titin-Binding-related Domain (OTBD), a muscle-specific insert of the C-terminal domain which is highly conserved among ankyrin genes, and binds obscurin and titin to Ank1 gene products. We previously proposed that OTBD sequences constitute a novel domain of protein-protein interactions which confers ankyrins with specific cellular functions in muscle. Here we searched for muscle proteins binding to ankyrin-G OTBD by yeast two hybrid assay, and we found plectin and filamin C, two organizing elements of the cytoskeleton with essential roles in myogenesis, muscle cell cytoarchitecture, and muscle disease. The three proteins coimmunoprecipitate from skeletal muscle extracts and colocalize at costameres in adult muscle fibers. During in vitro myogenesis, muscle ankyrins-G are first expressed in postmitotic myocytes undergoing fusion to myotubes. In western blots of subcellular fractions from C2C12 cells, the majority of muscle ankyrins-G appear associated with membrane compartments. Occasional but not extensive co-localization at nascent costameres suggested that ankyrin-G interactions with plectin and filamin C are not involved in costamere assembly; they would rather reinforce stability and/or modulate molecular interactions in sarcolemma microdomains by establishing novel links between muscle-specific ankyrins-G and the two costameric dystrophin-associated glycoprotein and integrin-based protein complexes. These results report the first protein-protein interactions involving the ankyrin-G OTBD domain and support the hypothesis that OTBD sequences confer ankyrins with a gain of function in vertebrates, bringing further consolidation and resilience of the linkage between sarcomeres
Directory of Open Access Journals (Sweden)
Josephine Wesely
2017-01-01
Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.
DEFF Research Database (Denmark)
Mitrovic, Martina; Shahbazian, Anaid; Bock, Elisabeth
2010-01-01
Transient receptor potential ankyrin 1 (TRPA1) channels are expressed by primary afferent neurones and activated by irritant chemicals including allyl isothiocyanate (AITC). Here we investigated whether intracolonic AITC causes afferent input to the spinal cord and whether this response is modifi...
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
International Nuclear Information System (INIS)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun
2012-01-01
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2012-11-15
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
Directory of Open Access Journals (Sweden)
Laurie A Steiner
Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.
A hanging drop culture method to study terminal erythroid differentiation.
Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak
2005-10-01
To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.
Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.
Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A
2004-10-01
A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.
Behavioural characterization of AnkyrinG deficient mice, a model for ANK3 related disorders
van der Werf, I. M.; van Dam, D.; Missault, S.; Yalcin, B.; De Deyn, P. P.; Vandeweyer, G.; Kooy, R. Frank
2017-01-01
ANK3 encodes AnkyrinG (AnkG), a member of the Ankyrin family that is expressed in several different isoforms in many tissues. A unique serine-rich domain and tail domain in the two largest isoforms of AnkG (270 and 480 kDa), restrict AnkG to the axon initial segment and nodes of Ranvier of
Parvovirus B19 integration into human CD36+ erythroid progenitor cells.
Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik
2017-11-01
The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)
2009-12-11
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
International Nuclear Information System (INIS)
Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.
2009-01-01
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S
2012-01-01
Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited
Energy Technology Data Exchange (ETDEWEB)
Shen, B.W. [Argonne National Lab., IL (United States). Biological and Medical Research Div.
1995-02-01
To understand the role of ankyrin-band 3 complexes in the organization of the spectrin-based membrane skeleton and its contribution to the mechanical properties of human erythrocytes, intact skeletons and single-layered skeleton leaflets were prepared from intact and physically sheared membrane ghosts, expanded in low salt buffer, and examined by transmission electron microscopy. While the structures of intact skeletons and single-layered skeleton leaflets shared many common features, including rigid junctional complexes of spectrin, actin, and band 4.1; short stretches ({approximately}50 {angstrom}) of flexible spectrin filaments; and globular masses of ankyrin-band 3 complexes situated close to the middle of the spectrin filaments, the definition of structural units in the intact skeleton is obscured by the superposition of the two layers. However, the spatial disposition of structural elements can be clearly defined in the images of the single-layered skeleton leaflets. Partially expanded skeletal leaflets contain conglomerates of ankyrin-band 3 complexes arranged in a circular or clove-leaf configuration that straddles multiple strands of thick spectrin cables, presumably reflecting the association of ankyrin-band 3 complexes on neighboring spectrin tetramers as well as the lateral association of the spectrin filaments. Hyperexpansion of the skeleton leaflets led to dissociation of the conglomerates of ankyrin-band 3 complexes, full-extension of the spectrin tetramers, and separation of the individual strands of spectrin tetramers. Clearly defined stands of spectrin tetramers in the hyperexpanded single-layered skeletal leaflets often contained two sets of globular protein masses that divided the spectrin tetramers into three segments of approximately equal length.
Weng, Haibo; Guo, Xinhua; Papoin, Julien; Wang, Jie; Coppel, Ross; Mohandas, Narla; An, Xiuli
2014-01-01
The malaria parasite Plasmodium falciparum exports a large number of proteins into the erythrocyte cytoplasm during the asexual intraerythrocytic stage of its life cycle. A subset of these proteins interacts with erythrocyte membrane skeletal proteins and grossly alters the structure and function of the membrane. Several of the exported proteins, such as PfEMP1, PfEMP3, RESA and KAHRP, interact with the preponderant erythrocyte skeleton protein, spectrin. Here we have searched for possible interaction of these four malaria proteins with another major erythrocyte skeleton protein, ankyrin R. We have shown that KAHRP, but none of the other three, binds to ankyrin R. We have mapped the binding site for ankyrin R to a 79-residue segment of the KAHRP sequence, and the reciprocal binding site for KAHRP in ankyrin R to a subdomain (D3) of the 89kDa ankyrin R membrane-binding domain. Interaction of intact ankyrin R with KAHRP was inhibited by the free D3 subdomain. When, moreover, red cells loaded with the soluble D3 subdomain were infected with P. falciparum, KAHRP secreted by the intraerythrocytic parasite no longer migrated to the host cell membrane, but remained diffusely distributed throughout the cytosol. Our findings suggest a potentially important role for interaction of KAHRP with red cell membrane skeleton in promoting the adhesion of malaria-infected red cells to endothelial surfaces, a central element in the pathophysiology of malaria. © 2013.
DEFF Research Database (Denmark)
Nassini, Romina; Pedretti, Pamela; Moretto, Nadia
2012-01-01
The transient receptor potential ankyrin 1 (TRPA1) channel, localized to airway sensory nerves, has been proposed to mediate airway inflammation evoked by allergen and cigarette smoke (CS) in rodents, via a neurogenic mechanism. However the limited clinical evidence for the role of neurogenic...... inflammation in asthma or chronic obstructive pulmonary disease raises an alternative possibility that airway inflammation is promoted by non-neuronal TRPA1.By using Real-Time PCR and calcium imaging, we found that cultured human airway cells, including fibroblasts, epithelial and smooth muscle cells express...... functional TRPA1 channels. By using immunohistochemistry, TRPA1 staining was observed in airway epithelial and smooth muscle cells in sections taken from human airways and lung, and from airways and lung of wild-type, but not TRPA1-deficient mice. In cultured human airway epithelial and smooth muscle cells...
Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan
2015-12-01
Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.
Studies of globin gene expression in differentiating erythroid cells
International Nuclear Information System (INIS)
Sullivan, T.D.
1985-01-01
The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation
Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.
Directory of Open Access Journals (Sweden)
Abigail A Lamikanra
2009-12-01
Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that
Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.
Sherazi, Syed Furqan Haider; Butt, Zeeshan
2012-09-01
AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.
PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia
DEFF Research Database (Denmark)
Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta
2004-01-01
markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...
Fréal, Amélie; Fassier, Coralie; Le Bras, Barbara; Bullier, Erika; De Gois, Stéphanie; Hazan, Jamilé; Hoogenraad, Casper C; Couraud, François
2016-04-20
The axon initial segment (AIS) is required for generating action potentials and maintaining neuronal polarity. Significant progress has been made in deciphering the basic building blocks composing the AIS, but the underlying mechanisms required for AIS formation remains unclear. The scaffolding protein ankyrin-G is the master-organizer of the AIS. Microtubules and their interactors, particularly end-binding proteins (EBs), have emerged as potential key players in AIS formation. Here, we show that the longest isoform of ankyrin-G (480AnkG) selectively associates with EBs via its specific tail domain and that this interaction is crucial for AIS formation and neuronal polarity in cultured rodent hippocampal neurons. EBs are essential for 480AnkG localization and stabilization at the AIS, whereas 480AnkG is required for the specific accumulation of EBs in the proximal axon. Our findings thus provide a conceptual framework for understanding how the cooperative relationship between 480AnkG and EBs induces the assembly of microtubule-AIS structures in the proximal axon. Neuronal polarity is crucial for the proper function of neurons. The assembly of the axon initial segment (AIS), which is the hallmark of early neuronal polarization, relies on the longest 480 kDa ankyrin-G isoform. The microtubule cytoskeleton and its interacting proteins were suggested to be early key players in the process of AIS formation. In this study, we show that the crosstalk between 480 kDa ankyrin-G and the microtubule plus-end tracking proteins, EBs, at the proximal axon is decisive for AIS assembly and neuronal polarity. Our work thus provides insight into the functional mechanisms used by 480 kDa ankyrin-G to drive the AIS formation and thereby to establish neuronal polarity. Copyright © 2016 the authors 0270-6474/16/364421-13$15.00/0.
Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation
International Nuclear Information System (INIS)
Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella
2010-01-01
Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria
2017-10-20
The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.
Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T
1987-02-01
The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.
Superfamily of ankyrin repeat proteins in tomato.
Yuan, Xiaowei; Zhang, Shizhong; Qing, Xiaohe; Sun, Meihong; Liu, Shiyang; Su, Hongyan; Shu, Huairui; Li, Xinzheng
2013-07-10
The ankyrin repeat (ANK) protein family plays a crucial role in plant growth and development and in response to biotic and abiotic stresses. However, no detailed information concerning this family is available for tomato (Solanum lycopersicum) due to the limited information on whole genome sequences. In this study, we identified a total of 130 ANK genes in tomato genome (SlANK), and these genes were distributed across all 12 chromosomes at various densities. And chromosomal localizations of SlANK genes indicated 25 SlANK genes were involved in tandem duplications. Based on their domain composition, all of the SlANK proteins were grouped into 13 subgroups. A combined phylogenetic tree was constructed with the aligned SlANK protein sequences. This tree revealed that the SlANK proteins comprise five major groups. An analysis of the expression profiles of SlANK genes in tomato in different tissues and in response to stresses showed that the SlANK proteins play roles in plant growth, development and stress responses. To our knowledge, this is the first report of a genome-wide analysis of the tomato ANK gene family. This study provides valuable information regarding the classification and putative functions of SlANK genes in tomato. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.
Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice
Directory of Open Access Journals (Sweden)
Ibrahim Mansur
2016-01-01
Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.
Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F
2018-06-15
In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.
Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming
2017-05-01
Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.
Shyu, Yu-Chiau; Lee, Tung-Liang; Chen, Xin; Hsu, Pang-Hung; Wen, Shau-Ching; Liaw, Yi-Wei; Lu, Chi-Huan; Hsu, Po-Yen; Lu, Mu-Jie; Hwang, JauLang; Tsai, Ming-Daw; Hwang, Ming-Jing; Chen, Jim-Ray; Shen, Che-Kun James
2014-02-24
Erythropoiesis is a highly regulated process during which BFU-E are differentiated into RBCs through CFU-E, Pro-E, PolyCh-E, OrthoCh-E, and reticulocyte stages. Uniquely, most erythroid-specific genes are activated during the Pro-E to Baso-E transition. We show that a wave of nuclear import of the erythroid-specific transcription factor EKLF occurs during the Pro-E to Baso-E transition. We further demonstrate that this wave results from a series of finely tuned events, including timed activation of PKCθ, phosphorylation of EKLF at S68 by P-PKCθ(S676), and sumoylation of EKLF at K74. The latter EKLF modifications modulate its interactions with a cytoplasmic ankyrin-repeat-protein FOE and importinβ1, respectively. The role of FOE in the control of EKLF nuclear import is further supported by analysis of the subcellular distribution patterns of EKLF in FOE-knockout mice. This study reveals the regulatory mechanisms of the nuclear import of EKLF, which may also be utilized in the nuclear import of other factors. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Abdulmohsen Assiri
2017-01-01
Full Text Available Introduction: Evidence has been found to suggest that methylglyoxal (MG plays a mediating role in diabetes-related gastrointestinal conditions, and a possible mechanism relating to these conditions could be revealed by determining MG as a transient receptor potential ankyrin 1 (TRPA1 channel agonist. Methods: Muscle strips from the distal colon of male Wistar rats were used, and organ bath was employed to gain insight into the impact of MG + TRPA1 antagonist (HC-030031. Results: Considerable rise of spontaneous contractions for longitudinal muscle strips subjected to pre-treatment with MG were observed. The potentiation of the contractile response of control longitudinal muscle strips to electric field stimulation (EFS took place as a consequence of pre-treatment with 10 mM MG, and maximum response values displayed a rise from 2.16 g ± 0.323 to 3.64 g ± 0.421. 10 μM HC-030031 was observed to block the improvement of EFS responses by MG, and regarding circular muscle strips, a considerable decline in the maximum relaxation response was facilitated by 10 mM MG. Specifically, this was achieved at 20 Hz from 0.26 g ± 0.036 to 0.055 g ± 0.046. Conclusion: MG has been found to directly contract the distal colons of Wistar rats while enhancing the responses initiated as a result of carbachol and EFS. After blockading the impacts using HC-030031, evidence was found to suggest that the mediation of the impacts takes place through the activation of the TRPA1 channel, which occurs from the excretion of excitatory neurotransmitters. The findings also implicate MG in the blocking of inhibitory neurotransmission.
Acute erythroid neoplastic proliferations. A biological study based on 62 patients.
Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad
2002-02-01
The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was
Walker, Aisha L.; Ofori-Acquah, Solomon
2016-01-01
The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...
Directory of Open Access Journals (Sweden)
Michael H. Herbert
2015-02-01
Full Text Available Multiple repeats of the ankyrin motif (ANK are ubiquitous throughout the kingdoms of life but are absent from most viruses. The main exception to this is the poxvirus family, and specifically the chordopoxviruses, with ANK repeat proteins present in all but three species from separate genera. The poxviral ANK repeat proteins belong to distinct orthologue groups spread over different species, and align well with the phylogeny of their genera. This distribution throughout the chordopoxviruses indicates these proteins were present in an ancestral vertebrate poxvirus, and have since undergone numerous duplication events. Most poxviral ANK repeat proteins contain an unusual topology of multiple ANK motifs starting at the N-terminus with a C-terminal poxviral homologue of the cellular F-box enabling interaction with the cellular SCF ubiquitin ligase complex. The subtle variations between ANK repeat proteins of individual poxviruses suggest an array of different substrates may be bound by these protein-protein interaction domains and, via the F-box, potentially directed to cellular ubiquitination pathways and possible degradation. Known interaction partners of several of these proteins indicate that the NF-κB coordinated anti-viral response is a key target, whilst some poxviral ANK repeat domains also have an F-box independent affect on viral host-range.
TMEM14C is required for erythroid mitochondrial heme metabolism.
Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H
2014-10-01
The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.
VieBrock, Lauren; Evans, Sean M; Beyer, Andrea R; Larson, Charles L; Beare, Paul A; Ge, Hong; Singh, Smita; Rodino, Kyle G; Heinzen, Robert A; Richards, Allen L; Carlyon, Jason A
2014-01-01
Scrub typhus is an understudied, potentially fatal infection that threatens one billion persons in the Asia-Pacific region. How the causative obligate intracellular bacterium, Orientia tsutsugamushi, facilitates its intracellular survival and pathogenesis is poorly understood. Many intracellular bacterial pathogens utilize the Type 1 (T1SS) or Type 4 secretion system (T4SS) to translocate ankyrin repeat-containing proteins (Anks) that traffic to distinct subcellular locations and modulate host cell processes. The O. tsutsugamushi genome encodes one of the largest known bacterial Ank repertoires plus T1SS and T4SS components. Whether these potential virulence factors are expressed during infection, how the Anks are potentially secreted, and to where they localize in the host cell are not known. We determined that O. tsutsugamushi transcriptionally expresses 20 unique ank genes as well as genes for both T1SS and T4SS during infection of mammalian host cells. Examination of the Anks' C-termini revealed that the majority of them resemble T1SS substrates. Escherichia coli expressing a functional T1SS was able to secrete chimeric hemolysin proteins bearing the C-termini of 19 of 20 O. tsutsugamushi Anks in an HlyBD-dependent manner. Thus, O. tsutsugamushi Anks C-termini are T1SS-compatible. Conversely, Coxiella burnetii could not secrete heterologously expressed Anks in a T4SS-dependent manner. Analysis of the subcellular distribution patterns of 20 ectopically expressed Anks revealed that, while 6 remained cytosolic or trafficked to the nucleus, 14 localized to, and in some cases, altered the morphology of the endoplasmic reticulum. This study identifies O. tsutsugamushi Anks as T1SS substrates and indicates that many display a tropism for the host cell secretory pathway.
Bessac, Bret F; Sivula, Michael; von Hehn, Christian A; Caceres, Ana I; Escalera, Jasmine; Jordt, Sven-Eric
2009-04-01
The release of methyl isocyanate in Bhopal, India, caused the worst industrial accident in history. Exposures to industrial isocyanates induce lacrimation, pain, airway irritation, and edema. Similar responses are elicited by chemicals used as tear gases. Despite frequent exposures, the biological targets of isocyanates and tear gases in vivo have not been identified, precluding the development of effective countermeasures. We use Ca(2+) imaging and electrophysiology to show that the noxious effects of isocyanates and those of all major tear gas agents are caused by activation of Ca(2+) influx and membrane currents in mustard oil-sensitive sensory neurons. These responses are mediated by transient receptor potential ankyrin 1 (TRPA1), an ion channel serving as a detector for reactive chemicals. In mice, genetic ablation or pharmacological inhibition of TRPA1 dramatically reduces isocyanate- and tear gas-induced nocifensive behavior after both ocular and cutaneous exposures. We conclude that isocyanates and tear gas agents target the same neuronal receptor, TRPA1. Treatment with TRPA1 antagonists may prevent and alleviate chemical irritation of the eyes, skin, and airways and reduce the adverse health effects of exposures to a wide range of toxic noxious chemicals.
Energy Technology Data Exchange (ETDEWEB)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.
International Nuclear Information System (INIS)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-01-01
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation
Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.
Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit
2015-01-01
We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632
Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique
2017-07-11
Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alessandro Di Tullio
2017-07-01
Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.
Enhancement of erythroid colony growth in culture by hemin
International Nuclear Information System (INIS)
Porter, P.N.; Meints, R.H.; Mesner, K.
1979-01-01
Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)
Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki
2011-06-01
Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.
DEFF Research Database (Denmark)
Järås, Marcus; Johnels, Petra; Agerstam, Helena
2009-01-01
OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...
DEFF Research Database (Denmark)
Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio
2015-01-01
Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...
Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow
International Nuclear Information System (INIS)
Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.
1976-01-01
The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors
Reduction of erythroid progenitors in protein-energy malnutrition.
Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio
2007-02-01
Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.
Directory of Open Access Journals (Sweden)
Shlomi Toobiak
Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.
Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells
International Nuclear Information System (INIS)
Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.
1987-01-01
The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes
Directory of Open Access Journals (Sweden)
Ikuta T
2013-12-01
Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to
Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells
International Nuclear Information System (INIS)
Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)
Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells
Energy Technology Data Exchange (ETDEWEB)
Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna
2017-01-01
are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.
Directory of Open Access Journals (Sweden)
Gloria Bua
Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells
Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio
2016-01-01
The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771
Lee, Kuan-I; Lin, Hui-Ching; Lee, Hsueh-Te; Tsai, Feng-Chuan; Lee, Tzong-Shyuan
2017-07-01
The transient receptor potential ankyrin 1 (TRPA1) channel is a non-selective cation channel that helps regulate inflammatory pain sensation and nociception and the development of inflammatory diseases. However, the potential role of the TRPA1 channel and the underlying mechanism in brain functions are not fully resolved. In this study, we demonstrated that genetic deletion of the TRPA1 channel in mice or pharmacological inhibition of its activity increased neurite outgrowth. In vivo study in mice provided evidence of the TRPA1 channel as a negative regulator in hippocampal functions; functional ablation of the TRPA1 channel in mice enhanced hippocampal functions, as evidenced by less anxiety-like behavior, and enhanced fear-related or spatial learning and memory, and novel location recognition as well as social interactions. However, the TRPA1 channel appears to be a prerequisite for motor function; functional loss of the TRPA1 channel in mice led to axonal bundle fragmentation, downregulation of myelin basic protein, and decreased mature oligodendrocyte population in the brain, for impaired motor function. The TRPA1 channel may play a crucial role in neuronal development and oligodendrocyte maturation and be a potential regulator in emotion, cognition, learning and memory, and social behavior.
A novel ENU-mutation in ankyrin-1 disrupts malaria parasite maturation in red blood cells of mice.
Directory of Open Access Journals (Sweden)
Andreas Greth
Full Text Available The blood stage of the plasmodium parasite life cycle is responsible for the clinical symptoms of malaria. Epidemiological studies have identified coincidental malarial endemicity and multiple red blood cell (RBC disorders. Many RBC disorders result from mutations in genes encoding cytoskeletal proteins and these are associated with increased protection against malarial infections. However the mechanisms underpinning these genetic, host responses remain obscure. We have performed an N-ethyl-N-nitrosourea (ENU mutagenesis screen and have identified a novel dominant (haploinsufficient mutation in the Ank-1 gene (Ank1(MRI23420 of mice displaying hereditary spherocytosis (HS. Female mice, heterozygous for the Ank-1 mutation showed increased survival to infection by Plasmodium chabaudi adami DS with a concomitant 30% decrease in parasitemia compared to wild-type, isogenic mice (wt. A comparative in vivo red cell invasion and parasite growth assay showed a RBC-autonomous effect characterised by decreased proportion of infected heterozygous RBCs. Within approximately 6-8 hours post-invasion, TUNEL staining of intraerythrocytic parasites, showed a significant increase in dead parasites in heterozygotes. This was especially notable at the ring and trophozoite stages in the blood of infected heterozygous mutant mice compared to wt (p<0.05. We conclude that increased malaria resistance due to ankyrin-1 deficiency is caused by the intraerythrocytic death of P. chabaudi parasites.
Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.
Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali
2017-03-01
Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.
Ankyrin domains across the Tree of Life
Directory of Open Access Journals (Sweden)
Kristin K. Jernigan
2014-02-01
Full Text Available Ankyrin (ANK repeats are one of the most common amino acid sequence motifs that mediate interactions between proteins of myriad sizes, shapes and functions. We assess their widespread abundance in Bacteria and Archaea for the first time and demonstrate in Bacteria that lifestyle, rather than phylogenetic history, is a predictor of ANK repeat abundance. Unrelated organisms that forge facultative and obligate symbioses with eukaryotes show enrichment for ANK repeats in comparison to free-living bacteria. The reduced genomes of obligate intracellular bacteria remarkably contain a higher fraction of ANK repeat proteins than other lifestyles, and the number of ANK repeats in each protein is augmented in comparison to other bacteria. Taken together, these results reevaluate the concept that ANK repeats are signature features of eukaryotic proteins and support the hypothesis that intracellular bacteria broadly employ ANK repeats for structure-function relationships with the eukaryotic host cell.
International Nuclear Information System (INIS)
Watanabe, T.; Oishi, M.
1987-01-01
A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed
Cunha, Eva S; Hatem, Christine L; Barrick, Doug
2016-08-01
Biomass deconstruction to small simple sugars is a potential approach to biofuels production; however, the highly recalcitrant nature of biomass limits the economic viability of this approach. Thus, research on efficient biomass degradation is necessary to achieve large-scale production of biofuels. Enhancement of cellulolytic activity by increasing synergism between cellulase enzymes holds promise in achieving high-yield biofuels production. Here we have inserted cellulase pairs from extremophiles into hyperstable α-helical consensus ankyrin repeat domain scaffolds. Such chimeric constructs allowed us to optimize arrays of enzyme pairs against a variety of cellulolytic substrates. We found that endocellulolytic domains CelA (CA) and Cel12A (C12A) act synergistically in the context of ankyrin repeats, with both three and four repeat spacing. The extent of synergy differs for different substrates. Also, having C12A N-terminal to CA provides greater synergy than the reverse construct, especially against filter paper. In contrast, we do not see synergy for these enzymes in tandem with CelK (CK) catalytic domain, a larger exocellulase, demonstrating the importance of enzyme identity in synergistic enhancement. Furthermore, we found endocellulases CelD and CA with three repeat spacing to act synergistically against filter paper. Importantly, connecting CA and C12A with a disordered linker of similar contour length shows no synergistic enhancement, indicating that synergism results from connecting these domains with folded ankyrin repeats. These results show that ankyrin arrays can be used to vary spacing and orientation between enzymes, helping to design and optimize artificial cellulosomes, providing a novel architecture for synergistic enhancement of enzymatic cellulose degradation. Proteins 2016; 84:1043-1054. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A
1998-06-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and
Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun
1998-01-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited
Ribonuclease inhibitor 1 regulates erythropoiesis by controlling GATA1 translation.
Chennupati, Vijaykumar; Veiga, Diogo Ft; Maslowski, Kendle M; Andina, Nicola; Tardivel, Aubry; Yu, Eric Chi-Wang; Stilinovic, Martina; Simillion, Cedric; Duchosal, Michel A; Quadroni, Manfredo; Roberts, Irene; Sankaran, Vijay G; MacDonald, H Robson; Fasel, Nicolas; Angelillo-Scherrer, Anne; Schneider, Pascal; Hoang, Trang; Allam, Ramanjaneyulu
2018-04-02
Ribosomal proteins (RP) regulate specific gene expression by selectively translating subsets of mRNAs. Indeed, in Diamond-Blackfan anemia and 5q- syndrome, mutations in RP genes lead to a specific defect in erythroid gene translation and cause anemia. Little is known about the molecular mechanisms of selective mRNA translation and involvement of ribosomal-associated factors in this process. Ribonuclease inhibitor 1 (RNH1) is a ubiquitously expressed protein that binds to and inhibits pancreatic-type ribonucleases. Here, we report that RNH1 binds to ribosomes and regulates erythropoiesis by controlling translation of the erythroid transcription factor GATA1. Rnh1-deficient mice die between embryonic days E8.5 and E10 due to impaired production of mature erythroid cells from progenitor cells. In Rnh1-deficient embryos, mRNA levels of Gata1 are normal, but GATA1 protein levels are decreased. At the molecular level, we found that RNH1 binds to the 40S subunit of ribosomes and facilitates polysome formation on Gata1 mRNA to confer transcript-specific translation. Further, RNH1 knockdown in human CD34+ progenitor cells decreased erythroid differentiation without affecting myelopoiesis. Our results reveal an unsuspected role for RNH1 in the control of GATA1 mRNA translation and erythropoiesis.
Directory of Open Access Journals (Sweden)
Laura Breda
Full Text Available Preclinical and clinical studies demonstrate the feasibility of treating β-thalassemia and Sickle Cell Disease (SCD by lentiviral-mediated transfer of the human β-globin gene. However, previous studies have not addressed whether the ability of lentiviral vectors to increase hemoglobin synthesis might vary in different patients.We generated lentiviral vectors carrying the human β-globin gene with and without an ankyrin insulator and compared their ability to induce hemoglobin synthesis in vitro and in thalassemic mice. We found that insertion of an ankyrin insulator leads to higher, potentially therapeutic levels of human β-globin through a novel mechanism that links the rate of transcription of the transgenic β-globin mRNA during erythroid differentiation with polysomal binding and efficient translation, as reported here for the first time. We also established a preclinical assay to test the ability of this novel vector to synthesize adult hemoglobin in erythroid precursors and in CD34(+ cells isolated from patients affected by β-thalassemia and SCD. Among the thalassemic patients, we identified a subset of specimens in which hemoglobin production can be achieved using fewer copies of the vector integrated than in others. In SCD specimens the treatment with AnkT9W ameliorates erythropoiesis by increasing adult hemoglobin (Hb A and concurrently reducing the sickling tetramer (Hb S.Our results suggest two major findings. First, we discovered that for the purpose of expressing the β-globin gene the ankyrin element is particularly suitable. Second, our analysis of a large group of specimens from β-thalassemic and SCD patients indicates that clinical trials could benefit from a simple test to predict the relationship between the number of vector copies integrated and the total amount of hemoglobin produced in the erythroid cells of prospective patients. This approach would provide vital information to select the best candidates for these
de Oliveira, Cristiane; Garami, Andras; Lehto, Sonya G; Pakai, Eszter; Tekus, Valeria; Pohoczky, Krisztina; Youngblood, Beth D; Wang, Weiya; Kort, Michael E; Kym, Philip R; Pinter, Erika; Gavva, Narender R; Romanovsky, Andrej A
2014-03-26
The rodent transient receptor potential ankyrin-1 (TRPA1) channel has been hypothesized to serve as a temperature sensor for thermoregulation in the cold. We tested this hypothesis by using deletion of the Trpa1 gene in mice and pharmacological blockade of the TRPA1 channel in rats. In both Trpa1(-/-) and Trpa1(+/+) mice, severe cold exposure (8°C) resulted in decreases of skin and deep body temperatures to ∼8°C and 13°C, respectively, both temperatures being below the reported 17°C threshold temperature for TRPA1 activation. Under these conditions, Trpa1(-/-) mice had the same dynamics of body temperature as Trpa1(+/+) mice and showed no weakness in the tail skin vasoconstriction response or thermogenic response to cold. In rats, the effects of pharmacological blockade were studied by using two chemically unrelated TRPA1 antagonists: the highly potent and selective compound A967079, which had been characterized earlier, and the relatively new compound 43 ((4R)-1,2,3,4-tetrahydro-4-[3-(3-methoxypropoxy)phenyl]-2-thioxo-5H-indeno[1,2-d]pyrimidin-5-one), which we further characterized in the present study and found to be highly potent (IC50 against cold of ∼8 nm) and selective. Intragastric administration of either antagonist at 30 mg/kg before severe (3°C) cold exposure did not affect the thermoregulatory responses (deep body and tail skin temperatures) of rats, even though plasma concentrations of both antagonists well exceeded their IC50 value at the end of the experiment. In the same experimental setup, blocking the melastatin-8 (TRPM8) channel with AMG2850 (30 mg/kg) attenuated cold-defense mechanisms and led to hypothermia. We conclude that TRPA1 channels do not drive autonomic thermoregulatory responses to cold in rodents.
Moparthi, Lavanya; Survery, Sabeen; Kreir, Mohamed; Simonsen, Charlotte; Kjellbom, Per; Högestätt, Edward D; Johanson, Urban; Zygmunt, Peter M
2014-11-25
We have purified and reconstituted human transient receptor potential (TRP) subtype A1 (hTRPA1) into lipid bilayers and recorded single-channel currents to understand its inherent thermo- and chemosensory properties as well as the role of the ankyrin repeat domain (ARD) of the N terminus in channel behavior. We report that hTRPA1 with and without its N-terminal ARD (Δ1-688 hTRPA1) is intrinsically cold-sensitive, and thus, cold-sensing properties of hTRPA1 reside outside the N-terminal ARD. We show activation of hTRPA1 by the thiol oxidant 2-((biotinoyl)amino)ethyl methanethiosulfonate (MTSEA-biotin) and that electrophilic compounds activate hTRPA1 in the presence and absence of the N-terminal ARD. The nonelectrophilic compounds menthol and the cannabinoid Δ(9)-tetrahydrocannabiorcol (C16) directly activate hTRPA1 at different sites independent of the N-terminal ARD. The TRPA1 antagonist HC030031 inhibited cold and chemical activation of hTRPA1 and Δ1-688 hTRPA1, supporting a direct interaction with hTRPA1 outside the N-terminal ARD. These findings show that hTRPA1 is an intrinsically cold- and chemosensitive ion channel. Thus, second messengers, including Ca(2+), or accessory proteins are not needed for hTRPA1 responses to cold or chemical activators. We suggest that conformational changes outside the N-terminal ARD by cold, electrophiles, and nonelectrophiles are important in hTRPA1 channel gating and that targeting chemical interaction sites outside the N-terminal ARD provides possibilities to fine tune TRPA1-based drug therapies (e.g., for treatment of pain associated with cold hypersensitivity and cardiovascular disease).
Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.
Directory of Open Access Journals (Sweden)
Eyayu Belay
Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.
Directory of Open Access Journals (Sweden)
Ryo Kurita
Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.
Directory of Open Access Journals (Sweden)
Ruth Merkle
2016-08-01
Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in
International Nuclear Information System (INIS)
Shiba, Takahiro; Tamai, Takuma; Sahara, Yurina; Kurohane, Kohta; Watanabe, Tatsuo; Imai, Yasuyuki
2012-01-01
Some chemicals contribute to the development of allergies by increasing the immunogenicity of other allergens. We have demonstrated that several phthalate esters, including dibutyl phthalate (DBP), enhance skin sensitization to fluorescein isothiocyanate (FITC) in a mouse contact hypersensitivity model, in which the T-helper type 2 (Th2) response is essential. On the other hand, some phthalate esters were found to activate transient receptor potential ankyrin 1 (TRPA1) cation channels on sensory neurons. We then found a positive correlation between the enhancing effects of several types of phthalate esters on skin sensitization to FITC and their ability to activate TRPA1. Here we examined the involvement of TRPA1 in sensitization to FITC by using TRPA1 agonists other than phthalate esters. During skin sensitization to FITC, the TRPA1 agonists (menthol, carvacrol, cinnamaldehyde and DBP) augmented the ear-swelling response as well as trafficking of FITC-presenting dendritic cells to draining lymph nodes. We confirmed that these TRPA1 agonists induced calcium influx into TRPA1-expressing Chinese hamster ovary (CHO) cells. We also found that TRPA1 antagonist HC-030031 inhibited DBP-induced calcium influx into TRPA1-expressing CHO cells. After pretreatment with this antagonist upon skin sensitization to FITC, the enhancing effect of DBP on sensitization was suppressed. These results suggest that TRPA1 activation will become a useful marker to find chemicals that facilitate sensitization in combination with other immunogenic haptens. -- Highlights: ► Role of TRPA1 activation was revealed in a mouse model of skin sensitization to FITC. ► TRPA1 agonists enhanced skin sensitization as well as dendritic cell trafficking. ► Dibutyl phthalate (DBP) has been shown to enhance skin sensitization to FITC. ► TRPA1 activation by DBP was inhibited by a selective antagonist, HC-030031. ► HC-030031 inhibited the enhancing effect of DBP on skin sensitization to FITC.
Energy Technology Data Exchange (ETDEWEB)
Shiba, Takahiro; Tamai, Takuma; Sahara, Yurina; Kurohane, Kohta [Laboratory of Microbiology and Immunology, School of Pharmaceutical Sciences, University of Shizuoka, 52‐1 Yada, Suruga-ku, Shizuoka City, Shizuoka 422‐8526 (Japan); Watanabe, Tatsuo [Laboratory of Food Chemistry, School of Food and Nutritional Sciences, University of Shizuoka, 52‐1 Yada, Suruga-ku, Shizuoka City, Shizuoka 422‐8526 (Japan); Imai, Yasuyuki, E-mail: imai@u-shizuoka-ken.ac.jp [Laboratory of Microbiology and Immunology, School of Pharmaceutical Sciences, University of Shizuoka, 52‐1 Yada, Suruga-ku, Shizuoka City, Shizuoka 422‐8526 (Japan)
2012-11-01
Some chemicals contribute to the development of allergies by increasing the immunogenicity of other allergens. We have demonstrated that several phthalate esters, including dibutyl phthalate (DBP), enhance skin sensitization to fluorescein isothiocyanate (FITC) in a mouse contact hypersensitivity model, in which the T-helper type 2 (Th2) response is essential. On the other hand, some phthalate esters were found to activate transient receptor potential ankyrin 1 (TRPA1) cation channels on sensory neurons. We then found a positive correlation between the enhancing effects of several types of phthalate esters on skin sensitization to FITC and their ability to activate TRPA1. Here we examined the involvement of TRPA1 in sensitization to FITC by using TRPA1 agonists other than phthalate esters. During skin sensitization to FITC, the TRPA1 agonists (menthol, carvacrol, cinnamaldehyde and DBP) augmented the ear-swelling response as well as trafficking of FITC-presenting dendritic cells to draining lymph nodes. We confirmed that these TRPA1 agonists induced calcium influx into TRPA1-expressing Chinese hamster ovary (CHO) cells. We also found that TRPA1 antagonist HC-030031 inhibited DBP-induced calcium influx into TRPA1-expressing CHO cells. After pretreatment with this antagonist upon skin sensitization to FITC, the enhancing effect of DBP on sensitization was suppressed. These results suggest that TRPA1 activation will become a useful marker to find chemicals that facilitate sensitization in combination with other immunogenic haptens. -- Highlights: ► Role of TRPA1 activation was revealed in a mouse model of skin sensitization to FITC. ► TRPA1 agonists enhanced skin sensitization as well as dendritic cell trafficking. ► Dibutyl phthalate (DBP) has been shown to enhance skin sensitization to FITC. ► TRPA1 activation by DBP was inhibited by a selective antagonist, HC-030031. ► HC-030031 inhibited the enhancing effect of DBP on skin sensitization to FITC.
de Waard, Vivian; van Achterberg, Tanja A. E.; Beauchamp, Nicholas J.; Pannekoek, Hans; de Vries, Carlie J. M.
2003-01-01
Objective-Cardiac ankyrin repeat protein (CARP) is a transcription factor-related protein that has been studied most extensively in the heart. In the present study, we investigated the expression and the potential function of CARP in human and murine atherosclerosis. Methods and Results-CARP
Directory of Open Access Journals (Sweden)
De-Shou Cao
Full Text Available Several transient receptor potential (TRP channels are expressed in pancreatic beta cells and have been proposed to be involved in insulin secretion. However, the endogenous ligands for these channels are far from clear. Here, we demonstrate the expression of the transient receptor potential ankyrin 1 (TRPA1 ion channel in the pancreatic beta cells and its role in insulin release. TRPA1 is an attractive candidate for inducing insulin release because it is calcium permeable and is activated by molecules that are produced during oxidative glycolysis.Immunohistochemistry, RT-PCR, and Western blot techniques were used to determine the expression of TRPA1 channel. Ca²⁺ fluorescence imaging and electrophysiology (voltage- and current-clamp techniques were used to study the channel properties. TRPA1-mediated insulin release was determined using ELISA.TRPA1 is abundantly expressed in a rat pancreatic beta cell line and freshly isolated rat pancreatic beta cells, but not in pancreatic alpha cells. Activation of TRPA1 by allyl isothiocyanate (AITC, hydrogen peroxide (H₂O₂, 4-hydroxynonenal (4-HNE, and cyclopentenone prostaglandins (PGJ₂ and a novel agonist methylglyoxal (MG induces membrane current, depolarization, and Ca²⁺ influx leading to generation of action potentials in a pancreatic beta cell line and primary cultured pancreatic beta cells. Activation of TRPA1 by agonists stimulates insulin release in pancreatic beta cells that can be inhibited by TRPA1 antagonists such as HC030031 or AP-18 and by RNA interference. TRPA1-mediated insulin release is also observed in conditions of voltage-gated Na⁺ and Ca²⁺ channel blockade as well as ATP sensitive potassium (K(ATP channel activation.We propose that endogenous and exogenous ligands of TRPA1 cause Ca²⁺ influx and induce basal insulin release and that TRPA1-mediated depolarization acts synergistically with K(ATP channel blockade to facilitate insulin release.
Dong, Zhaobin; Li, Wei; Unger-Wallace, Erica; Yang, Jinliang; Vollbrecht, Erik; Chuck, George
2017-10-10
Axillary branch suppression is a favorable trait bred into many domesticated crop plants including maize compared with its highly branched wild ancestor teosinte. Branch suppression in maize was achieved through selection of a gain of function allele of the teosinte branched1 (tb1) transcription factor that acts as a repressor of axillary bud growth. Previous work indicated that other loci may function epistatically with tb1 and may be responsible for some of its phenotypic effects. Here, we show that tb1 mediates axillary branch suppression through direct activation of the tassels replace upper ears1 ( tru1 ) gene that encodes an ankyrin repeat domain protein containing a BTB/POZ motif necessary for protein-protein interactions. The expression of TRU1 and TB1 overlap in axillary buds, and TB1 binds to two locations in the tru1 gene as shown by chromatin immunoprecipitation and gel shifts. In addition, nucleotide diversity surveys indicate that tru1 , like tb1 , was a target of selection. In modern maize, TRU1 is highly expressed in the leaf trace vasculature of axillary internodes, while in teosinte, this expression is highly reduced or absent. This increase in TRU1 expression levels in modern maize is supported by comparisons of relative protein levels with teosinte as well as by quantitative measurements of mRNA levels. Hence, a major innovation in creating ideal maize plant architecture originated from ectopic overexpression of tru1 in axillary branches, a critical step in mediating the effects of domestication by tb1.
Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm
2015-01-01
Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.
Directory of Open Access Journals (Sweden)
Yao Song
Full Text Available AIMS: It has been reported that cardiac ankyrin repeat protein is associated with heart development and diseases. This study is aimed to investigate the role of CARP in heart hypertrophy in vivo. METHODS AND RESULTS: We generated a cardiac-specific CARP-overexpressing transgenic mouse. Although such animals did not display any overt physiological abnormality, they developed less cardiac hypertrophy in response to pressure overload than did wildtype mice, as indicated by heart weight/body weight ratios, echocardiographic and histological analyses, and expression of hypertrophic markers. These mice also exhibited less cardiac hypertrophy after infusion of isoproterenol. To gain a molecular insight into how CARP attenuated heart hypertrophy, we examined expression of the mitogen-activated protein kinase cascade and found that the concentrations of phosphorylated ERK1/2 and MEK were markedly reduced in the hearts of transgenic mice subjected to pressure overload. In addition, the expressions of TGF-β and phosphorylated Smad3 were significantly downregulated in the hearts of CARP Tg mice in response to pressure overload. Furthermore, addition of human TGF-β1 could reverse the inhibitory effect of CARP on the hypertrophic response induced by phenylephrine in cardiomyocytes. It was also evidenced that the inhibitory effect of CARP on cardiac hypertrophy was not attributed to apoptosis. CONCLUSION: CARP attenuates cardiac hypertrophy, in which the ERK and TGF-β pathways may be involved. Our findings highlight the significance of CARP as an anti-hypertrophic factor in therapy of cardiac hypertrophy.
The Plasmodium falciparum exported protein PF3D7_0402000 binds to erythrocyte ankyrin and band 4.1
Energy Technology Data Exchange (ETDEWEB)
Shakya, Bikash; Penn, Wesley D.; Nakayasu, Ernesto S.; Lacount, Douglas J.
2017-09-01
Plasmodium falciparum extensively modifies the infected red blood cell (RBC), resulting in changes in deformability, shape and surface properties. These alterations suggest that the RBC cytoskeleton is a major target for modification during infection. However, the molecular mechanisms leading to these changes are largely unknown. To begin to address this question, we screened for exported P. falciparum proteins that bound to the erythrocyte cytoskeleton proteins ankyrin 1 (ANK1) and band 4.1 (4.1R), which form critical interactions with other cytoskeletal proteins that contribute to the deformability and stability of RBCs. Yeast two-hybrid screens with ANK1 and 4.1R identified eight interactions with P. falciparum exported proteins, including an interaction between 4.1R and PF3D7_0402000 (PFD0090c). This interaction was first identified in a large-scale screen (Vignali et al., Malaria J, 7:211, 2008), which also reported an interaction between PF3D7_0402000 and ANK1. We confirmed the interactions of PF3D7_0402000 with 4.1R and ANK1 in pair-wise yeast two-hybrid and co-precipitation assays. In both cases, an intact PHIST domain in PF3D7_0402000 was required for binding. Complex purification followed by mass spectrometry analysis provided additional support for the interaction of PF3D7_0402000 with ANK1 and 4.1R. RBC ghost cells loaded with maltose-binding protein (MBP)-PF3D7_0402000 passed through a metal microsphere column less efficiently than mock- or MBP-loaded controls, consistent with an effect of PF3D7_0402000 on RBC rigidity or membrane stability. This study confirmed the interaction of PF3D7_0402000 with 4.1R in multiple independent assays, provided the first evidence that PF3D7_0402000 also binds to ANK1, and suggested that PF3D7_0402000 affects deformability or membrane stability of uninfected RBC ghosts.
Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage
Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.
2013-01-01
Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...
A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review
Directory of Open Access Journals (Sweden)
Pablo Manresa
2017-12-01
Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.
MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B
Directory of Open Access Journals (Sweden)
Dongsheng Wang
2018-03-01
Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.
Directory of Open Access Journals (Sweden)
Jian-Guo Ren
2010-09-01
Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel
Deering-Rice, Cassandra E; Stockmann, Chris; Romero, Erin G; Lu, Zhenyu; Shapiro, Darien; Stone, Bryan L; Fassl, Bernhard; Nkoy, Flory; Uchida, Derek A; Ward, Robert M; Veranth, John M; Reilly, Christopher A
2016-11-25
Transient receptor potential (TRP) channels are activated by environmental particulate materials. We hypothesized that polymorphic variants of transient receptor potential vanilloid-1 (TRPV1) would be uniquely responsive to insoluble coal fly ash compared with the prototypical soluble agonist capsaicin. Furthermore, these changes would manifest as differences in lung cell responses to these agonists and perhaps correlate with changes in asthma symptom control. The TRPV1-I315M and -T469I variants were more responsive to capsaicin and coal fly ash. The I585V variant was less responsive to coal fly ash particles due to reduced translation of protein and an apparent role for Ile-585 in activation by particles. In HEK-293 cells, I585V had an inhibitory effect on wild-type TRPV1 expression, activation, and internalization/agonist-induced desensitization. In normal human bronchial epithelial cells, IL-8 secretion in response to coal fly ash treatment was reduced for cells heterozygous for TRPV1-I585V. Finally, both the I315M and I585V variants were associated with worse asthma symptom control with the effects of I315M manifesting in mild asthma and those of the I585V variant manifesting in severe, steroid-insensitive individuals. This effect may be due in part to increased transient receptor potential ankyrin-1 (TRPA1) expression by lung epithelial cells expressing the TRPV1-I585V variant. These findings suggest that specific molecular interactions control TRPV1 activation by particles, differential activation, and desensitization of TRPV1 by particles and/or other agonists, and cellular changes in the expression of TRPA1 as a result of I585V expression could contribute to variations in asthma symptom control. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Zita Garate
2015-12-01
Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.
MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral
Fusion of ZMYND8 and RELA genes in acute erythroid leukemia
DEFF Research Database (Denmark)
Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim
2013-01-01
Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...
International Nuclear Information System (INIS)
Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P
2013-01-01
Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository
Band 3 in aging and neurological disease.
Kay, M M
1991-01-01
Senescent cell antigen appears on old cells and marks them for death by initiating the binding of IgG autoantibody and subsequent removal by phagocytes in mammals and other vertebrates. We have created a synthetic aging antigen that blocks binding of IgG to senescent cells in vitro. Synthetic senescent cell antigen might be effective in preventing cellular destruction in vivo in certain diseases, and can be used to manipulate cellular life span in situ. Senescent cell antigen is generated by the modification of an important structural and transport membrane molecule, protein band 3. Band 3 is present in cellular, nuclear, Golgi, and mitochondrial membranes as well as in cell membranes. Band 3 proteins in nucleated cells participate in cell surface patching and capping. Band 3 maintains acid-base balance by mediating the exchange of anions (e.g., chloride, bicarbonate), and is the binding site for glycolytic enzymes. It is responsible for CO2 exchange in all tissues and organs. Thus, it is the most heavily used anion transport system in the body. Band 3 is a major transmembrane structural protein which attaches the plasma membrane to the internal cell cytoskeleton by binding to band 2.1 (ankyrin). Oxidation generates senescent cell antigen in situ. Band 3 is present in the central nervous system, and differences have been described in band 3 between young and aging brain tissue. One autosomal recessive neurological disease, choreoacanthocytosis, is associated with band 3 abnormalities. The 150 residues of the carboxyl terminus segment of band 3 appear to be altered. In brains from Alzheimer's disease patients, antibodies to aged band 3 label the amyloid core of classical plaques and the microglial cells located in the middle of the plaque in tissue sections, and an abnormal band 3 in immunoblots. Band 3 protein(s) in mammalian brain performs the same functions as that of erythroid band 3. These functions is anion transport, ankyrin binding, and generation of
Sadvakassova, Gulzhakhan; Dobocan, Monica C; Difalco, Marcos R; Congote, Luis F
2009-09-01
The matrix protein thrombospondin-4 has an acidic amphipathic C-terminal peptide (C21) which stimulates erythroid cell proliferation. Here we show that C21 stimulates red cell formation in anemic mice in vivo. In vitro experiments indicated that the peptide-mediated increase of erythroid colony formation in cultures of human CD34+ hematopoietic progenitor cells was possible only under continuous presence of erythropoietin. In the absence of this cytokine, C21 stimulated exclusively myeloid colony formation. Therefore, the peptide is not a specific erythroid differentiation factor. In fact, it is mitogenic in non-erythroid cells, such as skin fibroblasts and kidney epithelial cells. In erythroleukemic TF-1 cells, it actually decreased the production of the erythroid differentiation marker glycophorin A. C21-affinity chromatography revealed regulator of differentiation 1 (ROD1) as a major C21-binding protein. ROD1 is the hematopoietic cell paralog of polypyrimidine tract binding proteins (PTBs), RNA splice regulators which regulate differentiation by repressing tissue-specific exons. ROD1 binding to C21 was strongly inhibited by synthetic RNAs in the order poly A > poly U > poly G = poly C and was weakly inhibited by a synthetic phosphorylated peptide mimicking the C-terminal domain of RNA polymerase II. Cellular overexpression or knockdown experiments of ROD1 suggest a role for this protein in the mitogenic activity of C21. Since the nuclear proteins ROD1 and PTBs regulate differentiation at a posttranscriptional level and there is a fast nuclear uptake of C21, we put forward the idea that the peptide is internalized, goes to the nucleus and maintains cells in a proliferative state by supporting ROD1-mediated inhibition of differentiation.
De Petrocellis, Luciano; Vellani, Vittorio; Schiano-Moriello, Aniello; Marini, Pietro; Magherini, Pier Cosimo; Orlando, Pierangelo; Di Marzo, Vincenzo
2008-06-01
The plant cannabinoids (phytocannabinoids), cannabidiol (CBD), and Delta(9)-tetrahydrocannabinol (THC) were previously shown to activate transient receptor potential channels of both vanilloid type 1 (TRPV1) and ankyrin type 1 (TRPA1), respectively. Furthermore, the endocannabinoid anandamide is known to activate TRPV1 and was recently found to antagonize the menthol- and icilin-sensitive transient receptor potential channels of melastatin type 8 (TRPM8). In this study, we investigated the effects of six phytocannabinoids [i.e., CBD, THC, CBD acid, THC acid, cannabichromene (CBC), and cannabigerol (CBG)] on TRPA1- and TRPM8-mediated increase in intracellular Ca2+ in either HEK-293 cells overexpressing the two channels or rat dorsal root ganglia (DRG) sensory neurons. All of the compounds tested induced TRPA1-mediated Ca2+ elevation in HEK-293 cells with efficacy comparable with that of mustard oil isothiocyanates (MO), the most potent being CBC (EC(50) = 60 nM) and the least potent being CBG and CBD acid (EC(50) = 3.4-12.0 microM). CBC also activated MO-sensitive DRG neurons, although with lower potency (EC(50) = 34.3 microM). Furthermore, although none of the compounds tested activated TRPM8-mediated Ca2+ elevation in HEK-293 cells, they all, with the exception of CBC, antagonized this response when it was induced by either menthol or icilin. CBD, CBG, THC, and THC acid were equipotent (IC(50) = 70-160 nM), whereas CBD acid was the least potent compound (IC(50) = 0.9-1.6 microM). CBG inhibited Ca2+ elevation also in icilin-sensitive DRG neurons with potency (IC(50) = 4.5 microM) similar to that of anandamide (IC(50) = 10 microM). Our findings suggest that phytocannabinoids and cannabis extracts exert some of their pharmacological actions also by interacting with TRPA1 and TRPM8 channels, with potential implications for the treatment of pain and cancer.
Annas, Anita; Berg, Anna-Lena; Nyman, Eva; Meijer, Thomas; Lundgren, Viveka; Franzén, Bo; Ståhle, Lars
2015-12-01
During clinical development of analgesics, it is important to have access to pharmacologically specific human pain models. o-Chlorobenzylidene malononitrile (CS) is a selective and potent agonist of the transient receptor potential ankyrin repeat 1 (TRPA1), which is a transducer molecule in nociceptors sensing reactive chemical species. While CS has been subject to extensive toxicological investigations in animals and human beings, its effects on intradermal or subcutaneous injection have not previously been reported. We have investigated the potential of CS to be used as an agonist on TRPA1 in human experimental pain studies. A calcium influx assay was used to confirm the capacity of CS to activate TRPA1 with >100,000 times the selectivity over the transient receptor potential vanilloid receptor 1. CS dose-dependently (EC50 0.9 μM) released calcitonin gene-related peptide in rat dorsal root ganglion cultures, supporting involvement in pain signalling. In a local tolerance study, injection of a single intradermal dose of 20 mM CS to rats resulted in superficial, circular crusts at the injection sites after approximately 4 days. The histopathology evaluation revealed a mild, acute inflammatory reaction in the epidermis and dermis at the intradermal CS injection site 1 day after administration. After 14 days, the epidermal epithelium was fully restored. The symptoms were not considered to be adverse, and it is suggested that doses up to 20 μL of 20 mM CS can be safely administered to human beings. In conclusion, our data support development of a CS human dermal pain model. © 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).
Directory of Open Access Journals (Sweden)
Ali Dehghanifard
2012-07-01
Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.
Wang, Tingting; Abou-Ouf, Hatem; Hegazy, Samar A; Alshalalfa, Mohammed; Stoletov, Konstantin; Lewis, John; Donnelly, Bryan; Bismar, Tarek A
2016-12-01
Ankyrin G (ANK3) is a member of the Ankyrin family, which functions to provide cellular stability by anchoring the cytoskeleton to the plasma membrane. Deregulation of ANK3 expression has been observed in multiple human cancers but its mechanism remains unknown. ANK3 expression in relation to disease progression and patients' outcome was investigated in two cohorts of prostate cancer (PCA). Mechanistic studies were carried out in vitro and in vivo using several PCA cell lines and the avian embryo model. Silencing ANK3 resulted in significant reduction of cell proliferation through an AR-independent mechanism. Decreased ANK3 expression delayed S phase to G2/M cell cycle transition and reduced the expression of cyclins A and B. However, cells with knocked-down ANK3 exhibited significant increase in cell invasion through an AR-dependent mechanism. Furthermore, we found that ANK3 is a regulator of AR protein stability. ANK3 knockdown also promoted cancer cell invasion and extravasations in vivo using the avian embryo model (p cancer tissues was correlated with better cancer-specific survival of PCA patients (p = 0.012). Silencing ANK3 results in significant reduction of cell proliferation through an AR-independent mechanism. ANK3 knockdown results in significant increase in cell invasion through an AR-dependent mechanism. ANK3 is a regulator of AR protein stability. ANK3 knockdown also promotes cancer cell invasion and extravasation in vivo using the avian embryo model.
Erythroid cells in vitro: from developmental biology to blood transfusion products.
Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni
2009-07-01
Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
International Nuclear Information System (INIS)
Gardner, L.C.; Cox, T.M.
1988-01-01
Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation
Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M
1981-01-01
Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...
International Nuclear Information System (INIS)
Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.
1982-01-01
Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)
DEFF Research Database (Denmark)
Andresen, Christina Aaen; Smedegaard, Stine; Sylvestersen, Kathrine Beck
2014-01-01
The Ankyrin and SOCS (Suppressor of Cytokine Signaling) box (ASB) family of proteins function as the substrate recognition subunit in a subset of Elongin-Cullin-SOCS (ECS) E3 ubiquitin ligases. Despite counting with 18 members in humans, the identity of the physiological targets of the Asb protei...
Directory of Open Access Journals (Sweden)
Indranil Mukhopadhyay
Full Text Available Cough is a protective reflex action that helps clear the respiratory tract which is continuously exposed to airborne environmental irritants. However, chronic cough presents itself as a disease in its own right and despite its global occurrence; the molecular mechanisms responsible for cough are not completely understood. Transient receptor potential ankyrin1 (TRPA1 is robustly expressed in the neuronal as well as non-neuronal cells of the respiratory tract and is a sensor of a wide range of environmental irritants. It is fast getting acceptance as a key biological sensor of a variety of pro-tussive agents often implicated in miscellaneous chronic cough conditions. In the present study, we demonstrate in vitro direct functional activation of TRPA1 receptor by citric acid which is routinely used to evoke cough in preclinical and clinical studies. We also show for the first time that a potent and selective TRPA1 antagonist GRC 17536 inhibits citric acid induced cellular Ca(+2 influx in TRPA1 expressing cells and the citric acid induced cough response in guinea pigs. Hence our data provides a mechanistic link between TRPA1 receptor activation in vitro and cough response induced in vivo by citric acid. Furthermore, we also show evidence for TRPA1 activation in vitro by the TLR4, TLR7 and TLR8 ligands which are implicated in bacterial/respiratory virus pathogenesis often resulting in chronic cough. In conclusion, this study highlights the potential utility of TRPA1 antagonist such as GRC 17536 in the treatment of miscellaneous chronic cough conditions arising due to diverse causes but commonly driven via TRPA1.
Comparison of different methods for erythroid differentiation in the K562 cell line.
Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein
2016-08-01
To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.
N-terminal tetrapeptide T/SPLH motifs contribute to multimodal activation of human TRPA1 channel
Czech Academy of Sciences Publication Activity Database
Hynková, Anna; Maršáková, Lenka; Vašková, Jana; Vlachová, Viktorie
2016-01-01
Roč. 6, Jun 27 (2016), s. 28700 ISSN 2045-2322 R&D Projects: GA ČR(CZ) GA15-15839S Institutional support: RVO:67985823 Keywords : ankyrin receptor subtype 1 * transient receptor potential * gating * ankyrin repeat * whole-cell electrophysiology * N-terminus * mutagenesis Subject RIV: FH - Neurology Impact factor: 4.259, year: 2016
Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G
1996-01-01
Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.
Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.
Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired
Prospective identification of erythroid elements in cultured peripheral blood.
Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P
1999-04-01
We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.
Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan
2015-01-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...
The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice
International Nuclear Information System (INIS)
Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.
1981-01-01
The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)
Ha, Ae Wha; Kim, Woo Kyoung
2017-06-01
Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.
Let-7 microRNAs are developmentally regulated in circulating human erythroid cells
Directory of Open Access Journals (Sweden)
Reed Christopher
2009-11-01
Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.
International Nuclear Information System (INIS)
Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.
1991-01-01
These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase
Directory of Open Access Journals (Sweden)
Takahito Miyake
2017-11-01
Full Text Available Oxaliplatin, a third-generation platinum-based chemotherapeutic agent, displays unique acute peripheral neuropathy triggered or enhanced by cold, and accumulating evidence suggests that transient receptor potential ankyrin 1 (TRPA1 is responsible. TRPA1 is activated by oxaliplatin via a glutathione-sensitive mechanism. However, oxaliplatin interrupts hydroxylation of a proline residue located in the N-terminal region of TRPA1 via inhibition of prolyl hydroxylase (PHD, which causes sensitization of TRPA1 to reactive oxygen species (ROS. Furthermore, PHD inhibition endows cold-insensitive human TRPA1 (hTRPA1 with ROS-dependent cold sensitivity. Since cysteine oxidation and proline hydroxylation regulate its activity, their association with oxaliplatin-induced TRPA1 activation and acquirement of cold sensitivity were investigated in the present study. A high concentration of oxaliplatin (1 mM induced outward-rectifier whole-cell currents and increased the intracellular Ca2+ concentration in hTRPA1-expressing HEK293 cells, but did not increase the probability of hTRPA1 channel opening in the inside-out configuration. Oxaliplatin also induced the rapid generation of hydrogen peroxide, and the resultant Ca2+ influx was prevented in the presence of glutathione and in cysteine-mutated hTRPA1 (Cys641Ser-expressing cells, whereas proline-mutated hTRPA1 (Pro394Ala-expressing cells showed similar whole-cell currents and Ca2+ influx. By contrast, a lower concentration of oxaliplatin (100 μM did not increase the intracellular Ca2+ concentration but did confer cold sensitivity on hTRPA1-expressing cells, and this was inhibited by PHD2 co-overexpression. Cold sensitivity was abolished by the mitochondria-targeting ROS scavenger mitoTEMPO and was minimal in cysteine-mutated hTRPA1 (Cys641Ser or Cys665Ser-expressing cells. Thus, high oxaliplatin evokes ROS-mediated cysteine oxidation-dependent hTRPA1 activation independent of PHD activity, while a lower
Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio
2016-07-15
Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Zíma, V.; Witschas, Katja; Hynková, Anna; Zímová, Lucie; Barvík, I.; Vlachová, Viktorie
2015-01-01
Roč. 93, Jun (2015), s. 294-307 ISSN 0028-3908 R&D Projects: GA ČR(CZ) GA305/09/0081; GA ČR(CZ) GBP304/12/G069; GA MŠk(CZ) EE2.3.30.0025; GA ČR(CZ) GA15-15839S Institutional support: RVO:67985823 Keywords : ankyrin receptor subtype 1 * S4-S5-linker * mutagenesis Subject RIV: ED - Physiology Impact factor: 4.936, year: 2015
International Nuclear Information System (INIS)
Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru
2004-01-01
The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells
Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu
2018-04-01
During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.
The BARD1 C-Terminal Domain Structure and Interactions with Polyadenylation Factor CstF-50
Energy Technology Data Exchange (ETDEWEB)
Edwards, Ross A.; Lee, Megan S.; Tsutakawa, Susan E.; Williams, R. Scott; Tainer, John A.; Glover, J. N. Mark
2009-07-13
The BARD1 N-terminal RING domain binds BRCA1 while the BARD1 C-terminal ankyrin and tandem BRCT repeat domains bind CstF-50 to modulate mRNA processing and RNAP II stability in response to DNA damage. Here we characterize the BARD1 structural biochemistry responsible for CstF- 50 binding. The crystal structure of the BARD1 BRCT domain uncovers a degenerate phosphopeptide binding pocket lacking the key arginine required for phosphopeptide interactions in other BRCT proteins.Small angle X-ray scattering together with limited proteolysis results indicates that ankyrin and BRCT domains are linked by a flexible tether and do not adopt a fixed orientation relative to one another. Protein pull-down experiments utilizing a series of purified BARD1 deletion mutants indicate that interactions between the CstF-50 WD-40 domain and BARD1 involve the ankyrin-BRCT linker but do not require ankyrin or BRCT domains. The structural plasticity imparted by the ANK-BRCT linker helps to explain the regulated assembly of different protein BARD1 complexes with distinct functions in DNA damage signaling including BARD1-dependent induction of apoptosis plus p53 stabilization and interactions. BARD1 architecture and plasticity imparted by the ANK-BRCT linker are suitable to allow the BARD1 C-terminus to act as a hub with multiple binding sites to integrate diverse DNA damage signals directly to RNA polymerase.
Expression of assayable residual stem cell damage in erythroid differentiation
International Nuclear Information System (INIS)
Huebner, G.E.; Miller, M.E.; Cronkite, E.P.
1985-01-01
In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)
International Nuclear Information System (INIS)
Porter, P.N.; Ogawa, M.
1982-01-01
Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture
Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S
2015-07-01
Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.
Directory of Open Access Journals (Sweden)
Shohei Oyama
2017-11-01
Full Text Available Chronic inflammatory bladder disorders, such as interstitial cystitis/bladder pain syndrome, are associated with poor quality of life. The exact pathological processes remain unclear, but accumulating evidence suggests that reactive oxidative species (ROS are involved in urinary bladder disorders. Transient receptor potential ankyrin 1 (TRPA1, the most sensitive TRP channel to ROS, was shown to be responsible for urinary bladder abnormalities and hyperalgesia in an acute cystitis model. However, the roles of TRPA1 in chronic inflammatory bladder are not fully understood. We previously established a novel mouse cystitis model induced by intravesical injection of hydrogen peroxide (H2O2, resulting in long-lasting frequent urination, bladder inflammation, pain-related behavior, and histopathological changes. In the present study, we investigated the pathophysiological role of TRPA1 in the H2O2-induced long-lasting cystitis mouse model. Under anesthesia, 1.5% H2O2 solution was introduced transurethrally into the bladder of female wild-type (WT and TRPA1-knockout mice and maintained for 30 min. This increased the number of voids in WT mice at 1 and 7 days after injection, but reduced the number in TRPA1-knockout mice at 1 day but not 7 days after injection. Spontaneous locomotor activities (increase in freezing time and decrease in distance moved were reduced at 3 h after injection in WT mice, whereas the spontaneous visceral pain-related behaviors were attenuated in TRPA1-knockout mice. Furthermore, upregulation of c-fos mRNA in the spinal cord at 1 day after injection was observed in WT but not TRPA1-knockout mice. However, there was no difference in histopathological changes in the urinary bladder, such as edematous thickening in the submucosa, between WT and TRPA1-knockout mice at 1 or 7 days after injection. Finally, Trpa1 mRNA levels in the L5-S1 dorsal root ganglion were not altered, but levels in the urinary bladder were drastically increased
Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y
2016-01-01
Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.
Czech Academy of Sciences Publication Activity Database
Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.
2007-01-01
Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007
Energy Technology Data Exchange (ETDEWEB)
Verardi, Raffaello; Kim, Jin-Sik; Ghirlando, Rodolfo; Banerjee, Anirban
2017-09-01
DHHC enzymes catalyze palmitoylation, a major post-translational modification that regulates a number of key cellular processes. There are up to 24 DHHCs in mammals and hundreds of substrate proteins that get palmitoylated. However, how DHHC enzymes engage with their substrates is still poorly understood. There is currently no structural information about the interaction between any DHHC enzyme and protein substrates. In this study we have investigated the structural and thermodynamic bases of interaction between the ankyrin repeat domain of human DHHC17 (ANK17) and Snap25b. We solved a high-resolution crystal structure of the complex between ANK17 and a peptide fragment of Snap25b. Through structure-guided mutagenesis, we discovered key residues in DHHC17 that are critically important for interaction with Snap25b. We further extended our finding by showing that the same residues are also crucial for the interaction of DHHC17 with Huntingtin, one of its most physiologically relevant substrates.
Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M
2015-04-01
We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.
Survey and evaluation of mutations in the human KLF1 transcription unit.
Gnanapragasam, Merlin Nithya; Crispino, John D; Ali, Abdullah M; Weinberg, Rona; Hoffman, Ronald; Raza, Azra; Bieker, James J
2018-04-26
Erythroid Krüppel-like Factor (EKLF/KLF1) is an erythroid-enriched transcription factor that plays a global role in all aspects of erythropoiesis, including cell cycle control and differentiation. We queried whether its mutation might play a role in red cell malignancies by genomic sequencing of the KLF1 transcription unit in cell lines, erythroid neoplasms, dysplastic disorders, and leukemia. In addition, we queried published databases from a number of varied sources. In all cases we only found changes in commonly notated SNPs. Our results suggest that if there are mutations in KLF1 associated with erythroid malignancies, they are exceedingly rare.
Directory of Open Access Journals (Sweden)
Schmidt Enrico K
2004-05-01
Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.
Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata
2016-09-01
Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.
Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.
Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem
2016-12-01
In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.
Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle
International Nuclear Information System (INIS)
Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella
2012-01-01
Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.
Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.
Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio
2017-07-15
Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.
Jaquemar, D; Schenker, T; Trueb, B
1999-03-12
We have identified a novel transformation-sensitive mRNA, which is present in cultured fibroblasts but is lacking in SV40 transformed cells as well as in many mesenchymal tumor cell lines. The corresponding gene is located on human chromosome 8 in band 8q13. The open reading frame of the mRNA encodes a protein of 1119 amino acids forming two distinct domains. The N-terminal domain consists of 18 repeats that are related to the cytoskeletal protein ankyrin. The C-terminal domain contains six putative transmembrane segments that resemble many ion channels. This overall structure is reminiscent of TRP-like proteins that function as store-operated calcium channels. The novel protein with an Mr of 130 kDa is expressed at a very low level in human fibroblasts and at a moderate level in liposarcoma cells. Overexpression in eukaryotic cells appears to interfere with normal growth, suggesting that it might play a direct or indirect role in signal transduction and growth control.
Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M
2014-05-13
Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.
International Nuclear Information System (INIS)
Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin
2008-01-01
Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy
von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.
1999-01-01
Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors
Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S
2015-11-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.
[Update on the biology of heme synthesis in erythroid cells].
Fujiwara, Tohru; Harigae, Hideo
2015-02-01
Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.
Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.
2016-01-01
Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578
Tian, Renmao; Wang, Yong; Bougouffa, Salim; Gao, Zhaoming; Cai, Lin; Bajic, Vladimir B.; Qian, Peiyuan
2014-01-01
coevolved with the ancient host during establishment of their association. Exclusive distribution in sponge, bacterial detoxification for the host (sulfide oxidation) and the enrichment for symbiotic characteristics (genes-encoding ankyrin) in the SOB genome
Directory of Open Access Journals (Sweden)
István Z. Bátai
2018-02-01
Full Text Available Transient receptor potential ankyrin 1 (TRPA1 non-selective ligand-gated cation channels are mostly expressed in primary sensory neurons. Polysulfides (POLYs are Janus-faced substances interacting with numerous target proteins and associated with both protective and detrimental processes. Activation of TRPA1 in sensory neurons, consequent somatostatin (SOM liberation and action on sst4 receptors have recently emerged as mediators of the antinociceptive effect of organic trisulfide dimethyl trisulfide (DMTS. In the frame of the present study, we set out to compare the participation of this mechanism in antinociceptive and anti-inflammatory effects of inorganic sodium POLY and DMTS in carrageenan-evoked hind-paw inflammation. Inflammation of murine hind paws was induced by intraplantar injection of carrageenan (3% in 30 µL saline. Animals were treated intraperitoneally with POLY (17 µmol/kg or DMTS (250 µmol/kg or their respective vehicles 30 min prior paw challenge and six times afterward every 60 min. Mechanical pain threshold and swelling of the paws were measured by dynamic plantar aesthesiometry and plethysmometry at 2, 4, and 6 h after initiation of inflammation. Myeloperoxidase (MPO activity in the hind paws were detected 6 h after challenge by luminescent imaging. Mice genetically lacking TRPA1 ion channels, sst4 receptors and their wild-type counterparts were used to examine the participation of these proteins in POLY and DMTS effects. POLY counteracted carrageenan-evoked mechanical hyperalgesia in a TRPA1 and sst4 receptor-dependent manner. POLY did not influence paw swelling and MPO activity. DMTS ameliorated all examined inflammatory parameters. Mitigation of mechanical hyperalgesia and paw swelling by DMTS were mediated through sst4 receptors. These effects were present in TRPA1 knockout animals, too. DMTS inhibited MPO activity with no participation of the sensory neuron–SOM axis. While antinociceptive effects of
International Nuclear Information System (INIS)
Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.
1986-01-01
Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells
Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.
2015-01-01
Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726
Directory of Open Access Journals (Sweden)
V Chandana Epa
Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.
Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D
2010-04-01
The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.
Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie
2017-09-01
Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Sreoshi Chatterjee
Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.
NCBI nr-aa BLAST: CBRC-ACAR-01-0651 [SEVENS
Lifescience Database Archive (English)
Full Text Available subfamily A member 1 (Ankyrin-like with transmembrane domains protein 1) (Transformation sensitive protein p120) emb|CAA71610.1| ankyrin-like protein [Homo sapiens] O75762 0.46 27% ...
Designed ankyrin repeat proteins: a new approach to mimic complex antigens for diagnostic purposes?
Directory of Open Access Journals (Sweden)
Stefanie Hausammann
Full Text Available Inhibitory antibodies directed against coagulation factor VIII (FVIII can be found in patients with acquired and congenital hemophilia A. Such FVIII-inhibiting antibodies are routinely detected by the functional Bethesda Assay. However, this assay has a low sensitivity and shows a high inter-laboratory variability. Another method to detect antibodies recognizing FVIII is ELISA, but this test does not allow the distinction between inhibitory and non-inhibitory antibodies. Therefore, we aimed at replacing the intricate antigen FVIII by Designed Ankyrin Repeat Proteins (DARPins mimicking the epitopes of FVIII inhibitors. As a model we used the well-described inhibitory human monoclonal anti-FVIII antibody, Bo2C11, for the selection on DARPin libraries. Two DARPins were selected binding to the antigen-binding site of Bo2C11, which mimic thus a functional epitope on FVIII. These DARPins inhibited the binding of the antibody to its antigen and restored FVIII activity as determined in the Bethesda assay. Furthermore, the specific DARPins were able to recognize the target antibody in human plasma and could therefore be used to test for the presence of Bo2C11-like antibodies in a large set of hemophilia A patients. These data suggest, that our approach might be used to isolate epitopes from different sets of anti-FVIII antibodies in order to develop an ELISA-based screening assay allowing the distinction of inhibitory and non-inhibitory anti-FVIII antibodies according to their antibody signatures.
Directory of Open Access Journals (Sweden)
Andreas Schweizer
2008-07-01
Full Text Available Here, we describe the generation of a novel type of HIV entry inhibitor using the recently developed Designed Ankyrin Repeat Protein (DARPin technology. DARPin proteins specific for human CD4 were selected from a DARPin DNA library using ribosome display. Selected pool members interacted specifically with CD4 and competed with gp120 for binding to CD4. DARPin proteins derived in the initial selection series inhibited HIV in a dose-dependent manner, but showed a relatively high variability in their capacity to block replication of patient isolates on primary CD4 T cells. In consequence, a second series of CD4-specific DARPins with improved affinity for CD4 was generated. These 2nd series DARPins potently inhibit infection of genetically divergent (subtype B and C HIV isolates in the low nanomolar range, independent of coreceptor usage. Importantly, the actions of the CD4 binding DARPins were highly specific: no effect on cell viability or activation, CD4 memory cell function, or interference with CD4-independent virus entry was observed. These novel CD4 targeting molecules described here combine the unique characteristics of DARPins-high physical stability, specificity and low production costs-with the capacity to potently block HIV entry, rendering them promising candidates for microbicide development.
Nuclear RNA sequencing of the mouse erythroid cell transcriptome.
Directory of Open Access Journals (Sweden)
Jennifer A Mitchell
Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.
Comparative biology of the ubiquitous Na+/H+ exchanger, NHE1: lessons from erythrocytes
DEFF Research Database (Denmark)
Pedersen, Stine Falsig; Cala, Peter Michael
2004-01-01
of NHE1 in erythrocytes, in their own right and as model systems, but pertinent findings from non-erythroid cells are also discussed. NHE1 plays a key role in the regulation of cell volume and pH, and consequently in the control of such diverse processes as blood O2/CO2 transport, and cell proliferation......, motility, and survival. Disturbances in NHE1 function are involved in important pathological states such as hypoxic cell damage and cancer development. NHE1 has a predicted topology of 12 transmembrane domains, and a hydrophilic C-terminus thought to be the major site for NHE1 regulation. NHE1 is highly...... conserved throughout the vertebrate phylum, particularly in the transmembrane region and the proximal part of the C-terminus. In non-erythroid, and probably also in erythroid cells, this part of the hydrophilic C-terminus interacts with multiple binding partners important for NHE1 function. Erythrocyte NHE1...
von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.
2001-01-01
Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal
Expression of the transcription factor Evi-1 in human erythroleukemia cell lines and in leukemias.
Fontenay-Roupie, M; Bouscary, D; Melle, J; Viguié, F; Picard, F; Guesnu, M; Dreyfus, F
1997-02-01
The Evi-1 proto-oncogene is a zinc finger DNA binding protein. Although activation of the Evi-1 gene has been associated with chromosomal rearrangements of the 3q25-q28 region, ectopic expression of Evi-1 could also be observed in acute myelogenous leukemias and myelodysplastic syndromes without cytogenetic abnormalities of the 3q26 locus. In this study, human erythroleukemic cell lines were screened for the expression of Evi-1 mRNA by northern blotting. Evi-1 was expressed in all the erythroid cell lines, whether undifferentiated (K 562, HEL, LAMA 84) or exhibiting spontaneous terminal erythroid differentiation (KU 812, JK-1). Evi-1 mRNA levels were constant or elevated in hemoglobin-synthesizing KU 812 or K 562 cells in response to erythropoietin or hemin treatment, respectively. In human acute myeloblastic leukemias (AML), 11/30 expressed Evi-1 by RT-PCR. Among these cases, 4/6 erythroleukemias without abnormalities of the 3q25-q28 region were found positive. The presence of acidophilic erythroblasts (15-47% of bone marrow cells) accounted for the existence of a terminal erythroid differentiation in all Evi-1-positive AML M6, whereas one negative case was poorly differentiated and referred to as AML M6 variant. These results suggest that Evi-1 mRNA expression can coexist with erythroid differentiation.
Energy Technology Data Exchange (ETDEWEB)
Jaligama, Sridhar; Kale, Vijay M.; Wilbanks, Mitchell S. [Department of Toxicology, College of Pharmacy, University of Louisiana at Monroe, Monroe, LA 71209 (United States); Perkins, Edward J. [US Army Engineer Research and Development Center, Vicksburg, MS 39180 (United States); Meyer, Sharon A., E-mail: meyer@ulm.edu [Department of Toxicology, College of Pharmacy, University of Louisiana at Monroe, Monroe, LA 71209 (United States)
2013-02-01
Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), a widely used munitions compound, and hexahydro-1-nitroso-3,5-dinitro-1,3,5-triazine (MNX), its N-nitroso product of anaerobic microbial nitroreduction, are contaminants of military sites. Previous studies have shown MNX to be the most acutely toxic among the nitroreduced degradation products of RDX and to cause mild anemia at high dose. The present study compares hematotoxicity with acute oral exposure to MNX with parent RDX. Both RDX and MNX caused a modest decrease in blood hemoglobin and ∼ 50% loss of granulocytes (NOAELs = 47 mg/kg) in female Sprague–Dawley rats observed 14 days post-exposure. We explored the possibility that blood cell loss observed after 14 days was delayed in onset because of toxicity to bone marrow (BM) progenitors. RDX and MNX decreased granulocyte/macrophage-colony forming cells (GM-CFCs) at 14, but not 7, days (NOAELs = 24 mg/kg). The earliest observed time at which MNX decreased GM-CFCs was 10 days post-exposure. RDX and MNX likewise decreased BM burst-forming units-erythroid (BFU-Es) at 14, but not 7, days. Granulocyte–erythrocyte–monocyte–megakaryocyte (GEMM)-CFCs were unaffected by RDX and MNX at 7 days suggesting precursor depletion did not account for GM-CFC and BFU-E loss. MNX added to the culture media was without effect on GM-CFC formation indicating no direct inhibition. Flow cytometry showed no differential loss of BM multilineage progenitors (Thy1.1{sup +}) or erythroid (CD71{sup +}) precursors with MNX suggesting myeloid and erythroid lineages were comparably affected. Collectively, these data indicate that acute exposure to both RDX and MNX caused delayed suppression of myelo- and erythropoiesis with subsequent decrease of peripheral granulocytes and erythrocytes. Highlights: ► Acute oral exposure to munitions RDX causes myelosuppression. ► Environmental degradation product MNX is comparable in effect. ► RDX and MNX are cytotoxic to both myeloid and erythroid
Mechanism governing heme synthesis reveals a GATA factor/heme circuit that controls differentiation.
Tanimura, Nobuyuki; Miller, Eli; Igarashi, Kazuhiko; Yang, David; Burstyn, Judith N; Dewey, Colin N; Bresnick, Emery H
2016-02-01
Metal ion-containing macromolecules have fundamental roles in essentially all biological processes throughout the evolutionary tree. For example, iron-containing heme is a cofactor in enzyme catalysis and electron transfer and an essential hemoglobin constituent. To meet the intense demand for hemoglobin assembly in red blood cells, the cell type-specific factor GATA-1 activates transcription of Alas2, encoding the rate-limiting enzyme in heme biosynthesis, 5-aminolevulinic acid synthase-2 (ALAS-2). Using genetic editing to unravel mechanisms governing heme biosynthesis, we discovered a GATA factor- and heme-dependent circuit that establishes the erythroid cell transcriptome. CRISPR/Cas9-mediated ablation of two Alas2 intronic cis elements strongly reduces GATA-1-induced Alas2 transcription, heme biosynthesis, and surprisingly, GATA-1 regulation of other vital constituents of the erythroid cell transcriptome. Bypassing ALAS-2 function in Alas2 cis element-mutant cells by providing its catalytic product 5-aminolevulinic acid rescues heme biosynthesis and the GATA-1-dependent genetic network. Heme amplifies GATA-1 function by downregulating the heme-sensing transcriptional repressor Bach1 and via a Bach1-insensitive mechanism. Through this dual mechanism, heme and a master regulator collaborate to orchestrate a cell type-specific transcriptional program that promotes cellular differentiation. © 2015 The Authors.
DEFF Research Database (Denmark)
Liew, Chu Wai; Rand, Kasper Dyrberg; Simpson, Raina J Y
2006-01-01
GATA-1 and PU.1 are transcription factors that control erythroid and myeloid development, respectively. The two proteins have been shown to function in an antagonistic fashion, with GATA-1 repressing PU.1 activity during erythropoiesis and PU.1 repressing GATA-1 function during myelopoiesis. It has...... also become clear that this functional antagonism involves direct interactions between the two proteins. However, the molecular basis for these interactions is not known, and a number of inconsistencies exist in the literature. We have used a range of biophysical methods to define the molecular details...... of the GATA-1-PU.1 interaction. A combination of NMR titration data and extensive mutagenesis revealed that the PU.1-Ets domain and the GATA-1 C-terminal zinc finger (CF) form a low affinity interaction in which specific regions of each protein are implicated. Surprisingly, the interaction cannot be disrupted...
Intracellular cavity of sensor domain controls allosteric gating of TRPA1 channel
Czech Academy of Sciences Publication Activity Database
Zímová, Lucie; Sinica, Viktor; Kádková, Anna; Vyklická, Lenka; Zíma, Vlastimil; Barvík, I.; Vlachová, Viktorie
2018-01-01
Roč. 11, č. 514 (2018), č. článku eaan8621. ISSN 1945-0877 R&D Projects: GA ČR(CZ) GA15-15839S Institutional support: RVO:67985823 Keywords : TRPA1 * gating * sensor domain * open state * transient receptor potential * ankyrin receptor subtype 1 Subject RIV: FH - Neurology OBOR OECD: Neurosciences (including psychophysiology Impact factor: 6.494, year: 2016
Energy Technology Data Exchange (ETDEWEB)
Liu, Xin-Hua [National Center of Excellence for the Medical Consequences of Spinal Cord Injury, James J. Peter VA Medical Center, Bronx, NY 10468 (United States); Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Bauman, William A. [National Center of Excellence for the Medical Consequences of Spinal Cord Injury, James J. Peter VA Medical Center, Bronx, NY 10468 (United States); Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Department of Rehabilitation Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Cardozo, Christopher, E-mail: chris.cardozo@va.gov [National Center of Excellence for the Medical Consequences of Spinal Cord Injury, James J. Peter VA Medical Center, Bronx, NY 10468 (United States); Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Department of Rehabilitation Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Department of Pharmacology and Systems Therapeutics, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States)
2015-08-14
Transcription factors of the nuclear factor-kappa B (NF-κB) family play a pivotal role in inflammation, immunity and cell survival responses. Recent studies revealed that NF-κB also regulates the processes of muscle atrophy. NF-κB activity is regulated by various factors, including ankyrin repeat domain 2 (AnkrD2), which belongs to the muscle ankyrin repeat protein family. Another member of this family, AnkrD1 is also a transcriptional effector. The expression levels of AnkrD1 are highly upregulated in denervated skeletal muscle, suggesting an involvement of AnkrD1 in NF-κB mediated cellular responses to paralysis. However, the molecular mechanism underlying the interactive role of AnkrD1 in NF-κB mediated cellular responses is not well understood. In the current study, we examined the effect of AnkrD1 on NF-κB activity and determined the interactions between AnkrD1 expression and NF-κB signaling induced by TNFα in differentiating C2C12 myoblasts. TNFα upregulated AnkrD1 mRNA and protein levels. AnkrD1-siRNA significantly increased TNFα-induced transcriptional activation of NF-κB, whereas overexpression of AnkrD1 inhibited TNFα-induced NF-κB activity. Co-immunoprecipitation studies demonstrated that AnkrD1 was able to bind p50 subunit of NF-κB and vice versa. Finally, CHIP assays revealed that AnkrD1 bound chromatin at a NF-κB binding site in the AnrkD2 promoter and required NF-κB to do so. These results provide evidence of signaling integration between AnkrD1 and NF-κB pathways, and suggest a novel anti-inflammatory role of AnkrD1 through feedback inhibition of NF-κB transcriptional activity by which AnkrD1 modulates the balance between physiological and pathological inflammatory responses in skeletal muscle. - Highlights: • AnkrD1 is upregulated by TNFα and represses NF-κB-induced transcriptional activity. • AnkrD1 binds to p50 subunit of NF-κB and is recruited to NF-κB bound to chromatin. • AnkrD1 mediates a feed-back inhibitory loop
LDB1-mediated enhancer looping can be established independent of mediator and cohesin.
Krivega, Ivan; Dean, Ann
2017-08-21
Mechanistic studies in erythroid cells indicate that LDB1, as part of a GATA1/TAL1/LMO2 complex, brings erythroid-expressed genes into proximity with enhancers for transcription activation. The role of co-activators in establishing this long-range interaction is poorly understood. Here we tested the contributions of the RNA Pol II pre-initiation complex (PIC), mediator and cohesin to establishment of locus control region (LCR)/β-globin proximity. CRISPR/Cas9 editing of the β-globin promoter to eliminate the RNA Pol II PIC by deleting the TATA-box resulted in loss of transcription, but enhancer-promoter interaction was unaffected. Additional deletion of the promoter GATA1 site eliminated LDB1 complex and mediator occupancy and resulted in loss of LCR/β-globin proximity. To separate the roles of LDB1 and mediator in LCR looping, we expressed a looping-competent but transcription-activation deficient form of LDB1 in LDB1 knock down cells: LCR/β-globin proximity was restored without mediator core occupancy. Further, Cas9-directed tethering of mutant LDB1 to the β-globin promoter forced LCR loop formation in the absence of mediator or cohesin occupancy. Moreover, ENCODE data and our chromatin immunoprecipitation results indicate that cohesin is almost completely absent from validated and predicted LDB1-regulated erythroid enhancer-gene pairs. Thus, lineage specific factors largely mediate enhancer-promoter looping in erythroid cells independent of mediator and cohesin. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Rothé, Benjamin; Leettola, Catherine N; Leal-Esteban, Lucia; Cascio, Duilio; Fortier, Simon; Isenschmid, Manuela; Bowie, James U; Constam, Daniel B
2018-02-06
Head-to-tail polymers of sterile alpha motifs (SAM) can scaffold large macromolecular complexes. Several SAM-domain proteins that bind each other are mutated in patients with cystic kidneys or laterality defects, including the Ankyrin (ANK) and SAM domain-containing proteins ANKS6 and ANKS3, and the RNA-binding protein Bicc1. To address how their interactions are regulated, we first determined a high-resolution crystal structure of a Bicc1-SAM polymer, revealing a canonical SAM polymer with a high degree of flexibility in the subunit interface orientations. We further mapped interactions between full-length and distinct domains of Bicc1, ANKS3, and ANKS6. Neither ANKS3 nor ANKS6 alone formed macroscopic homopolymers in vivo. However, ANKS3 recruited ANKS6 to Bicc1, and the three proteins together cooperatively generated giant macromolecular complexes. Thus, the giant assemblies are shaped by SAM domains, their flanking sequences, and SAM-independent protein-protein and protein-mRNA interactions. Copyright © 2017 Elsevier Ltd. All rights reserved.
Molecular Basis of TRPA1 Regulation in Nociceptive Neurons. A Review
Czech Academy of Sciences Publication Activity Database
Kádková, Anna; Synytsya, Viktor; Krůšek, Jan; Zímová, Lucie; Vlachová, Viktorie
2017-01-01
Roč. 66, č. 3 (2017), s. 425-439 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA15-15839S; GA MZd(CZ) NV16-28784A Institutional support: RVO:67985823 Keywords : transient receptor potential ankyrin 1 * bradykinin * structure- function * nociception * post-translational modifications * signaling pathways Subject RIV: FH - Neurology OBOR OECD: Neurosciences (including psychophysiology Impact factor: 1.461, year: 2016
Biernatowska, Agnieszka; Augoff, Katarzyna; Podkalicka, Joanna; Tabaczar, Sabina; Gajdzik-Nowak, Weronika; Czogalla, Aleksander; Sikorski, Aleksander F
2017-11-01
Flotillins are prominent, oligomeric protein components of erythrocyte (RBC) membrane raft domains and are considered to play an important structural role in lateral organization of the plasma membrane. In our previous work on erythroid membranes and giant plasma membrane vesicles (GPMVs) derived from them we have shown that formation of functional domains (resting state rafts) depends on the presence of membrane palmitoylated protein 1 (MPP1/p55), pointing to its new physiological role. Exploration of the molecular mechanism of MPP1 function in organizing membrane domains described here, through searching for its molecular partners in RBC membrane by using different methods, led to the identification of the raft-marker proteins, flotillin 1 and flotillin 2, as hitherto unreported direct MPP1 binding-partners in the RBC membrane. These proteins are found in high molecular-weight complexes in native RBC membrane and, significantly, their presence was shown to be separate from the well-known protein 4.1-dependent interactions of MPP1 with membrane proteins. Furthermore, FLIM analysis revealed that loss of the endogenous MPP1-flotillins interactions resulted in significant changes in RBC membrane-fluidity, emphasizing the physiological importance of such interactions in vivo. Therefore, our data establish a new perspective on the role of MPP1 in erythroid cells and suggests that direct MPP1-flotillins interactions could be the major driving-force behind the formation of raft domains in RBC. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.
Patel, B; Kang, Y; Cui, K; Litt, M; Riberio, M S J; Deng, C; Salz, T; Casada, S; Fu, X; Qiu, Y; Zhao, K; Huang, S
2014-02-01
Long-range chromatin interactions control metazoan gene transcription. However, the involvement of intra- and interchromosomal interactions in development and oncogenesis remains unclear. TAL1/SCL is a critical transcription factor required for the development of all hematopoietic lineages; yet, aberrant TAL1 transcription often occurs in T-cell acute lymphoblastic leukemia (T-ALL). Here, we report that oncogenic TAL1 expression is regulated by different intra- and interchromosomal loops in normal hematopoietic and leukemic cells, respectively. These intra- and interchromosomal loops alter the cell-type-specific enhancers that interact with the TAL1 promoter. We show that human SET1 (hSET1)-mediated H3K4 methylations promote a long-range chromatin loop, which brings the +51 enhancer in close proximity to TAL1 promoter 1 in erythroid cells. The CCCTC-binding factor (CTCF) facilitates this long-range enhancer/promoter interaction of the TAL1 locus in erythroid cells while blocking the same enhancer/promoter interaction of the TAL1 locus in human T-cell leukemia. In human T-ALL, a T-cell-specific transcription factor c-Maf-mediated interchromosomal interaction brings the TAL1 promoter into close proximity with a T-cell-specific regulatory element located on chromosome 16, activating aberrant TAL1 oncogene expression. Thus, our study reveals a novel molecular mechanism involving changes in three-dimensional chromatin interactions that activate the TAL1 oncogene in human T-cell leukemia.
Proteomic analysis reveals heat shock protein 70 has a key role in polycythemia Vera.
Gallardo, Miguel; Barrio, Santiago; Fernandez, Marisol; Paradela, Alberto; Arenas, Alicia; Toldos, Oscar; Ayala, Rosa; Albizua, Enriqueta; Jimenez, Ana; Redondo, Santiago; Garcia-Martin, Rosa Maria; Gilsanz, Florinda; Albar, Juan Pablo; Martinez-Lopez, Joaquin
2013-11-19
JAK-STAT signaling through the JAK2V617F mutation is central to the pathogenesis of myeloproliferative neoplasms (MPN). However, other events could precede the JAK2 mutation. The aim of this study is to analyze the phenotypic divergence between polycytemia vera (PV) and essential thrombocytemia (ET) to find novel therapeutics targets by a proteomic and functional approach to identify alternative routes to JAK2 activation. Through 2D-DIGE and mass spectrometry of granulocyte protein from 20 MPN samples, showed differential expression of HSP70 in PV and ET besides other 60 proteins. Immunohistochemistry of 46 MPN bone marrow samples confirmed HSP70 expression. The median of positive granulocytes was 80% in PV (SD 35%) vs. 23% in ET (SD 34.25%). In an ex vivo model KNK437 was used as an inhibition model assay of HSP70, showed dose-dependent inhibition of cell growth and burst formation unit erythroid (BFU-E) in PV and ET, increased apoptosis in the erythroid lineage, and decreased pJAK2 signaling, as well as a specific siRNA for HSP70. These data suggest a key role for HSP70 in proliferation and survival of the erythroid lineage in PV, and may represent a potential therapeutic target in MPN, especially in PV.
Central Role of ULK1 in Type I Interferon Signaling
Directory of Open Access Journals (Sweden)
Diana Saleiro
2015-04-01
Full Text Available We provide evidence that the Unc-51-like kinase 1 (ULK1 is activated during engagement of the type I interferon (IFN receptor (IFNR. Our studies demonstrate that the function of ULK1 is required for gene transcription mediated via IFN-stimulated response elements (ISRE and IFNγ activation site (GAS elements and controls expression of key IFN-stimulated genes (ISGs. We identify ULK1 as an upstream regulator of p38α mitogen-activated protein kinase (MAPK and establish that the regulatory effects of ULK1 on ISG expression are mediated possibly by engagement of the p38 MAPK pathway. Importantly, we demonstrate that ULK1 is essential for antiproliferative responses and type I IFN-induced antineoplastic effects against malignant erythroid precursors from patients with myeloproliferative neoplasms. Together, these data reveal a role for ULK1 as a key mediator of type I IFNR-generated signals that control gene transcription and induction of antineoplastic responses.
Directory of Open Access Journals (Sweden)
Pascariello Caterina
2008-05-01
Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of
Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong
2016-04-01
Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could
International Nuclear Information System (INIS)
Fujiwara, Tohru; Okamoto, Koji; Niikuni, Ryoyu; Takahashi, Kiwamu; Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi; Ishizawa, Kenichi; Ichinohasama, Ryo; Nakamura, Yukio; Nakajima, Motowo; Tanaka, Tohru; Harigae, Hideo
2014-01-01
Highlights: • Treatment with ALA induces erythroid differentiation of K562 cells. • Transportation of ALA into erythroid cells occurs predominantly via SLC36A1. • ALA restores defects in ALAS2 in human iPS cell-derived erythroblasts. • ALA may represent a novel therapeutic option for CSA caused by ALAS2 mutations. - Abstract: Congenital sideroblastic anemia (CSA) is a hereditary disorder characterized by microcytic anemia and bone marrow sideroblasts. The most common form of CSA is attributed to mutations in the X-linked gene 5-aminolevulinic acid synthase 2 (ALAS2). ALAS2 is a mitochondrial enzyme, which utilizes glycine and succinyl-CoA to form 5-aminolevulinic acid (ALA), a crucial precursor in heme synthesis. Therefore, ALA supplementation could be an effective therapeutic strategy to restore heme synthesis in CSA caused by ALAS2 defects. In a preclinical study, we examined the effects of ALA in human erythroid cells, including K562 cells and human induced pluripotent stem cell-derived erythroid progenitor (HiDEP) cells. ALA treatment resulted in significant dose-dependent accumulation of heme in the K562 cell line. Concomitantly, the treatment substantially induced erythroid differentiation as assessed using benzidine staining. Quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis confirmed significant upregulation of heme-regulated genes, such as the globin genes [hemoglobin alpha (HBA) and hemoglobin gamma (HBG)] and the heme oxygenase 1 (HMOX1) gene, in K562 cells. Next, to investigate the mechanism by which ALA is transported into erythroid cells, quantitative RT-PCR analysis was performed on previously identified ALA transporters, including solute carrier family 15 (oligopeptide transporter), member (SLC15A) 1, SLC15A2, solute carrier family 36 (proton/amino acid symporter), member (SLC36A1), and solute carrier family 6 (neurotransmitter transporter), member 13 (SLC6A13). Our analysis revealed that SLC36A1 was abundantly
Energy Technology Data Exchange (ETDEWEB)
Fujiwara, Tohru [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Department of Molecular Hematology/Oncology, Tohoku University Graduate School, Sendai (Japan); Okamoto, Koji; Niikuni, Ryoyu [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Takahashi, Kiwamu [SBI Pharmaceuticals Co., Ltd., Tokyo (Japan); Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Ishizawa, Kenichi [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Clinical Research, Innovation and Education Center, Tohoku University Hospital, Sendai (Japan); Ichinohasama, Ryo [Department of Hematopathology, Tohoku University Graduate School, Sendai (Japan); Nakamura, Yukio [Cell Engineering Division, RIKEN BioResource Center, Tsukuba, Ibaraki (Japan); Nakajima, Motowo; Tanaka, Tohru [SBI Pharmaceuticals Co., Ltd., Tokyo (Japan); Harigae, Hideo, E-mail: harigae@med.tohoku.ac.jp [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Department of Molecular Hematology/Oncology, Tohoku University Graduate School, Sendai (Japan)
2014-11-07
Highlights: • Treatment with ALA induces erythroid differentiation of K562 cells. • Transportation of ALA into erythroid cells occurs predominantly via SLC36A1. • ALA restores defects in ALAS2 in human iPS cell-derived erythroblasts. • ALA may represent a novel therapeutic option for CSA caused by ALAS2 mutations. - Abstract: Congenital sideroblastic anemia (CSA) is a hereditary disorder characterized by microcytic anemia and bone marrow sideroblasts. The most common form of CSA is attributed to mutations in the X-linked gene 5-aminolevulinic acid synthase 2 (ALAS2). ALAS2 is a mitochondrial enzyme, which utilizes glycine and succinyl-CoA to form 5-aminolevulinic acid (ALA), a crucial precursor in heme synthesis. Therefore, ALA supplementation could be an effective therapeutic strategy to restore heme synthesis in CSA caused by ALAS2 defects. In a preclinical study, we examined the effects of ALA in human erythroid cells, including K562 cells and human induced pluripotent stem cell-derived erythroid progenitor (HiDEP) cells. ALA treatment resulted in significant dose-dependent accumulation of heme in the K562 cell line. Concomitantly, the treatment substantially induced erythroid differentiation as assessed using benzidine staining. Quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis confirmed significant upregulation of heme-regulated genes, such as the globin genes [hemoglobin alpha (HBA) and hemoglobin gamma (HBG)] and the heme oxygenase 1 (HMOX1) gene, in K562 cells. Next, to investigate the mechanism by which ALA is transported into erythroid cells, quantitative RT-PCR analysis was performed on previously identified ALA transporters, including solute carrier family 15 (oligopeptide transporter), member (SLC15A) 1, SLC15A2, solute carrier family 36 (proton/amino acid symporter), member (SLC36A1), and solute carrier family 6 (neurotransmitter transporter), member 13 (SLC6A13). Our analysis revealed that SLC36A1 was abundantly
FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia
International Nuclear Information System (INIS)
Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K
2011-01-01
The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6
Effect of complete protein 4.1R deficiency on ion transport properties of murine erythrocytes
International Nuclear Information System (INIS)
Rivera, Alicia; De Franceschi, Lucia; Peters, Luanne L.; Gascard, Philippe; Mohandas, Narla; Brugnara, Carlo
2006-01-01
Moderate hemolytic anemia, abnormal erythrocyte morphology (spherocytosis), and decreased membrane stability are observed in mice with complete deficiency of all erythroid protein 4.1 protein isoforms (4.1-/-; Shi TS et al., J. Clin. Invest. 103:331,1999). We have examined the effects of erythroid protein 4.1 (4.1R) deficiency on erythrocyte cation transport and volume regulation. 4.1-/- mice exhibited erythrocyte dehydration that was associated with reduced cellular K and increased Na content. Increased Na permeability was observed in these mice, mostly mediated by Na/H exchange with normal Na-K pump and Na-K-2Cl cotransport activities. The Na/H exchange of 4.1-/- erythrocytes was markedly activated by exposure to hypertonic conditions (18.2+- 3.2 in 4.1 -/- vs.9.8 +- 1.3 mmol/1013 cell x h in control mice), with an abnormal dependence on osmolarity, (K0.5=417 +- 42 in 4.1 -/- vs. 460 +- 35 mOsmin control mice) suggestive of an up-regulated functional state. While the affinity for internal protons was not altered (K0.5= 489.7 +- 0.7 vs.537.0 +- 0.56 nM in control mice), the Vmax of the H-induced Na/H exchange activity was markedly elevated in 4.1-/- erythrocytes Vmax 91.47 Moderate hemolytic anemia, abnormal erythrocyte morphology (spherocytosis), and decreased membrane stability are observed in mice with complete deficiency of all erythroid protein 4.1 protein isoforms (4.1-/-; Shi TSet al., J. Clin. Invest. 103:331,1999). We have examined the effects of erythroid protein 4.1 (4.1R) deficiency on erythrocyte cation transport and volume regulation. 4.1-/- mice exhibited erythrocyte dehydration that was associated with reduced cellular K and increased Na content. Increased Na permeability was observed in these mice, mostly mediated by Na/H exchange with normal Na-K pump and Na-K-2Cl cotransport activities. The Na/H exchange of 4.1-/- erythrocytes was markedly activated by exposure to hypertonic conditions (18.2 +- 3.2 in 4.1 -/- vs. 9.8 +- 1.3mmol/1013 cell x h in
Directory of Open Access Journals (Sweden)
Kai-Hsin Chang
2011-01-01
Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.
International Nuclear Information System (INIS)
Samaras, Susan E.; Chen, Billy; Koch, Stephen R.; Sawyer, Douglas B.; Lim, Chee Chew; Davidson, Jeffrey M.
2012-01-01
Highlights: ► The 26S proteasome regulates Ankrd1 levels in cardiomyocytes and endothelial cells. ► Ankrd1 protein degrades 60-fold faster in endothelial cells than cardiomyocytes. ► Differential degradation appears related to nuclear vs. sarcolemmal localization. ► Endothelial cell density shows uncoupling of Ankrd1 mRNA and protein levels. -- Abstract: Ankyrin repeat domain 1 protein (Ankrd1), also known as cardiac ankyrin repeat protein (CARP), increases dramatically after tissue injury, and its overexpression improves aspects of wound healing. Reports that Ankrd1/CARP protein stability may affect cardiovascular organization, together with our findings that the protein is crucial to stability of the cardiomyocyte sarcomere and increased in wound healing, led us to compare the contribution of Ankrd1/CARP stability to its abundance. We found that the 26S proteasome is the dominant regulator of Ankrd1/CARP degradation, and that Ankrd1/CARP half-life is significantly longer in cardiomyocytes (h) than endothelial cells (min). In addition, higher endothelial cell density decreased the abundance of the protein without affecting steady state mRNA levels. Taken together, our data and that of others indicate that Ankrd1/CARP is highly regulated at multiple levels of its expression. The striking difference in protein half-life between a muscle and a non-muscle cell type suggests that post-translational proteolysis is correlated with the predominantly structural versus regulatory role of the protein in the two cell types.
Acute erythremic myelosis (true erythroleukaemia): a variant of AML FAB-M6.
Hasserjian, R P; Howard, J; Wood, A; Henry, K; Bain, B
2001-03-01
Classic erythroleukaemia (acute myeloid leukaemia M6, or M6 AML) is defined as an excess of myeloblasts in an erythroid predominant background. Leukaemia variants in which the primitive blast cells are demonstrably erythroid are extremely rare and poorly characterised. Variably referred to as "true erythroleukaemia" or "acute erythremic myelosis", they are often included within the M6 AML category even though they do not meet strict criteria for this type of AML. Two cases of acute erythroid neoplasia are presented with clinical, morphological, immunophenotypic, and cytogenetic analysis. Both patients presented with profound anaemia, one in a setting of long standing myelodysplasia. Bone marrow examination revealed a predominant population of highly dysplastic erythroid cells in both cases. In one case, the liver was infiltrated by neoplastic erythroid cells. Both patients died within four months of diagnosis. This report illustrates that cases of acute leukaemia occur in which the dominant neoplastic cell is a primitive erythroid cell without an accompanying increase in myeloblasts. This does not preclude the neoplastic clone originating in a multipotent haemopoietic stem cell, as suggested by cases arising in patients with myelodysplasia. Acute erythremic myelosis should be recognised as a distinct variant of M6 AML.
International Nuclear Information System (INIS)
Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.
1987-01-01
To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)
The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.
Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A
2010-10-28
Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.
International Nuclear Information System (INIS)
Kreja, Ludwika; Baltschukat, Klaus; Nothdurft, Wilhelm
1989-01-01
The radiosensitivity of the early erythroid progenitor cells (BFU-E) and the progenitor cells of the stroma (CFU-F) in canine bone marrow was studied under steady-state conditions by in vitro irradiation with 280 kV X-rays. The dose-effect relationship for colony formation was determined for BFU-E obtained from the iliac crest marrow, and for CFU-F in bone marrow collected from the iliac crest and the humerus of adult beagles. The BFU-E were adequately stimulated with serum from lethally irradiated dogs to obtain a source of BPA (burst-promoting activity). The BFU-E proved to be extremely radiosensitive, (the survival curve was exponential (D o 15.3 ± 1.8 cGY)). Buffy-coat leukocytes separated from bone marrow leukocytes obtained by aspiration were an optimum source of CFU-F. A curve was fitted to data obtained for CFU-F obtained from iliac crest or humerus, resulting in D o = 241 ± 38 cGY and an extrapolation number n = 1.38 ± 0.62 or D o = 261 ± 40 cGY and n = 1.04 ± 0.42, respectively. (author)
Zeng, Canjun; Goodluck, Helen; Qin, Xuezhong; Liu, Bo; Mohan, Subburaman; Xing, Weirong
2016-10-01
Leucine-rich repeat kinase-1 (Lrrk1) consists of ankyrin repeats (ANK), leucine-rich repeats (LRR), a GTPase-like domain of Roc (ROC), a COR domain, a serine/threonine kinase domain (KD), and WD40 repeats (WD40). Previous studies have revealed that knockout (KO) of Lrrk1 in mice causes severe osteopetrosis, and a human mutation of Lrrk1 leads to osteosclerotic metaphysial dysplasia. The molecular mechanism by which Lrrk1 regulates osteoclast function is unknown. In this study, we generated a series of Lrrk1 mutants and evaluated their ability to rescue defective bone resorption in Lrrk1-deficient osteoclasts by use of pit formation assays. Overexpression of Lrrk1 or LRR-truncated Lrrk1, but not ANK-truncated Lrrk1, WD40-truncated Lrrk1, Lrrk1-KD, or K651A mutant Lrrk1, rescued bone resorption function of Lrrk1 KO osteoclasts. We next examined whether RAC1/Cdc42 small GTPases are direct substrates of Lrrk1 in osteoclasts. Western blot and pull-down assays revealed that Lrrk1 deficiency in osteoclasts resulted in reduced phosphorylation and activation of RAC1/Cdc42. In vitro kinase assays confirmed that recombinant Lrrk1 phosphorylated RAC1-GST protein, and immunoprecipitation showed that the interaction of Lrrk1 with RAC1 occurred within 10 min after RANKL treatment. Overexpression of constitutively active Q61L RAC1 partially rescued the resorptive function of Lrrk1-deficient osteoclasts. Furthermore, lack of Lrrk1 in osteoclasts led to reduced autophosphorylation of p21 protein-activated kinase-1 at Ser 144 , catalyzed by RAC1/Cdc42 binding and activation. Our data indicate that Lrrk1 regulates osteoclast function by directly modulating phosphorylation and activation of small GTPase RAC1/Cdc42 and that its function depends on ANK, ROC, WD40, and kinase domains. Copyright © 2016 the American Physiological Society.
Yang, Chunzhang; Zhuang, Zhengping; Fliedner, Stephanie M J; Shankavaram, Uma; Sun, Michael G; Bullova, Petra; Zhu, Roland; Elkahloun, Abdel G; Kourlas, Peter J; Merino, Maria; Kebebew, Electron; Pacak, Karel
2015-01-01
We have investigated genetic/pathogenetic factors associated with a new clinical entity in patients presenting with pheochromocytoma/paraganglioma (PHEO/PGL) and polycythemia. Two patients without hypoxia-inducible factor 2α (HIF2A) mutations, who presented with similar clinical manifestations, were analyzed for other gene mutations, including prolyl hydroxylase (PHD) mutations. We have found for the first time a germ-line mutation in PHD1 in one patient and a novel germ-line PHD2 mutation in a second patient. Both mutants exhibited reduced protein stability with substantial quantitative protein loss and thus compromised catalytic activities. Due to the unique association of patients' polycythemia with borderline or mildly elevated erythropoietin (EPO) levels, we also performed an in vitro sensitivity assay of erythroid progenitors to EPO and for EPO receptor (EPOR) expression. The results show inappropriate hypersensitivity of erythroid progenitors to EPO in these patients, indicating increased EPOR expression/activity. In addition, the present study indicates that HIF dysregulation due to PHD mutations plays an important role in the pathogenesis of these tumors and associated polycythemia. The PHD1 mutation appears to be a new member contributing to the genetic landscape of this novel clinical entity. Our results support the existence of a specific PHD1- and PHD2-associated PHEO/PGL-polycythemia disorder. • A novel germ-l i n e PHD1 mutation causing heochromocytoma/paraganglioma and polycythemia. • Increased EPOR activity and inappropriate hypersensitivity of erythroid progenitors to EPO.
Glen, Katie E; Workman, Victoria L; Ahmed, Forhad; Ratcliffe, Elizabeth; Stacey, Adrian J; Thomas, Robert J
2013-09-01
Economic ex vivo manufacture of erythrocytes at 10(12) cell doses requires an efficiently controlled bio-process capable of extensive proliferation and high terminal density. High-resolution characterization of the process would identify production strategies for increased efficiency, monitoring and control. CD34(+) cord blood cells or equivalent cells that had been pre-expanded for 7 days with Delta1 Notch ligand were placed in erythroid expansion and differentiation conditions in a micro-scale ambr suspension bioreactor. Multiple culture parameters were varied, and phenotype markers and metabolites measured to identify conserved trends and robust monitoring markers. The cells exhibited a bi-modal erythroid differentiation pattern with an erythroid marker peak after 2 weeks and 3 weeks of culture; differentiation was comparatively weighted toward the second peak in Delta1 pre-expanded cells. Both differentiation events were strengthened by omission of stem cell factor and dexamethasone. The cumulative cell proliferation and death, or directly measured CD45 expression, enabled monitoring of proliferative rate of the cells. The metabolic activities of the cultures (glucose, glutamine and ammonia consumption or production) were highly variable but exhibited systematic change synchronized with the change in differentiation state. Erythroid differentiation chronology is partly determined by the heterogeneous CD34(+) progenitor compartment with implications for input control; Delta1 ligand-mediated progenitor culture can alter differentiation profile with control benefits for engineering production strategy. Differentiation correlated changes in cytokine response, markers and metabolic state will enable scientifically designed monitoring and timing of manufacturing process steps. Copyright © 2013 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina
2011-10-15
4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jeffrey R Shearstone
Full Text Available Therapeutic intervention aimed at reactivation of fetal hemoglobin protein (HbF is a promising approach for ameliorating sickle cell disease (SCD and β-thalassemia. Previous studies showed genetic knockdown of histone deacetylase (HDAC 1 or 2 is sufficient to induce HbF. Here we show that ACY-957, a selective chemical inhibitor of HDAC1 and 2 (HDAC1/2, elicits a dose and time dependent induction of γ-globin mRNA (HBG and HbF in cultured primary cells derived from healthy individuals and sickle cell patients. Gene expression profiling of erythroid progenitors treated with ACY-957 identified global changes in gene expression that were significantly enriched in genes previously shown to be affected by HDAC1 or 2 knockdown. These genes included GATA2, which was induced greater than 3-fold. Lentiviral overexpression of GATA2 in primary erythroid progenitors increased HBG, and reduced adult β-globin mRNA (HBB. Furthermore, knockdown of GATA2 attenuated HBG induction by ACY-957. Chromatin immunoprecipitation and sequencing (ChIP-Seq of primary erythroid progenitors demonstrated that HDAC1 and 2 occupancy was highly correlated throughout the GATA2 locus and that HDAC1/2 inhibition led to elevated histone acetylation at well-known GATA2 autoregulatory regions. The GATA2 protein itself also showed increased binding at these regions in response to ACY-957 treatment. These data show that chemical inhibition of HDAC1/2 induces HBG and suggest that this effect is mediated, at least in part, by histone acetylation-induced activation of the GATA2 gene.
Directory of Open Access Journals (Sweden)
Yeunkum Lee
2017-06-01
Full Text Available Mania causes symptoms of hyperactivity, impulsivity, elevated mood, reduced anxiety and decreased need for sleep, which suggests that the dysfunction of the striatum, a critical component of the brain motor and reward system, can be causally associated with mania. However, detailed molecular pathophysiology underlying the striatal dysfunction in mania remains largely unknown. In this study, we aimed to identify the molecular pathways showing alterations in the striatum of SH3 and multiple ankyrin repeat domains 3 (Shank3-overexpressing transgenic (TG mice that display manic-like behaviors. The results of transcriptome analysis suggested that mammalian target of rapamycin complex 1 (mTORC1 signaling may be the primary molecular signature altered in the Shank3 TG striatum. Indeed, we found that striatal mTORC1 activity, as measured by mTOR S2448 phosphorylation, was significantly decreased in the Shank3 TG mice compared to wild-type (WT mice. To elucidate the potential underlying mechanism, we re-analyzed previously reported protein interactomes, and detected a high connectivity between Shank3 and several upstream regulators of mTORC1, such as tuberous sclerosis 1 (TSC1, TSC2 and Ras homolog enriched in striatum (Rhes, via 94 common interactors that we denominated “Shank3-mTORC1 interactome”. We noticed that, among the 94 common interactors, 11 proteins were related to actin filaments, the level of which was increased in the dorsal striatum of Shank3 TG mice. Furthermore, we could co-immunoprecipitate Shank3, Rhes and Wiskott-Aldrich syndrome protein family verprolin-homologous protein 1 (WAVE1 proteins from the striatal lysate of Shank3 TG mice. By comparing with the gene sets of psychiatric disorders, we also observed that the 94 proteins of Shank3-mTORC1 interactome were significantly associated with bipolar disorder (BD. Altogether, our results suggest a protein interaction-mediated connectivity between Shank3 and certain upstream
NRF1 Is an ER Membrane Sensor that Is Central to Cholesterol Homeostasis.
Widenmaier, Scott B; Snyder, Nicole A; Nguyen, Truc B; Arduini, Alessandro; Lee, Grace Y; Arruda, Ana Paula; Saksi, Jani; Bartelt, Alexander; Hotamisligil, Gökhan S
2017-11-16
Cholesterol is a critical nutrient requiring tight constraint in the endoplasmic reticulum (ER) due to its uniquely challenging biophysical properties. While the mechanisms by which the ER defends against cholesterol insufficiency are well described, it remains unclear how the ER senses and effectively defends against cholesterol excess. Here, we identify the ER-bound transcription factor nuclear factor erythroid 2 related factor-1, Nrf1/Nfe2L1, as a critical mediator of this process. We show that Nrf1 directly binds to and specifically senses cholesterol in the ER through a defined domain and that cholesterol regulates Nrf1 turnover, processing, localization, and activity. In Nrf1 deficiency, in vivo cholesterol challenges induce massive hepatic cholesterol accumulation and damage, which is rescued by replacing Nrf1 exogenously. This Nrf1-mediated mechanism involves the suppression of CD36-driven inflammatory signaling and derepression of liver X receptor activity. These findings reveal Nrf1 as a guardian of cholesterol homeostasis and a core component of adaptive responses to excess cellular cholesterol. Copyright © 2017. Published by Elsevier Inc.
A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders
International Nuclear Information System (INIS)
Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon
2010-01-01
Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.
Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan
2018-01-01
Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hemopoietic cell precursor responses to erythropoietin in plasma clot cultures
Energy Technology Data Exchange (ETDEWEB)
Kennedy, W.L.
1979-01-01
The time dependence of the response of mouse bone marrow cells to erythropoietin (Ep) in vitro was studied. Experiments include studies on the Ep response of marrow cells from normal, plethoric, or bled mice. Results with normal marrow reveal: (1) Not all erythroid precursors (CFU-E) are alike in their response to Ep. A significant number of the precursors develop to a mature erythroid colony after very short Ep exposures, but they account for only approx. 13% of the total colonies generated when Ep is active for 48 hrs. If Ep is active more than 6 hrs, a second population of erythroid colonies emerges at a nearly constant rate until the end of the culture. Full erythroid colony production requires prolonged exposure to erythropoietin. (2) The longer erythropoietin is actively present, the larger the number of erythroid colonies that reach 17 cells or more. Two distinct populations of immediate erythroid precursors are also present in marrow from plethoric mice. In these mice, total colony numbers are equal to or below those obtained from normal mice. However, the population of fast-responding CFU-E is consistently decreased to 10 to 20% of that found in normal marrow. The remaining colonies are formed from plethoric marrow at a rate equal to normal marrow. With increasing Ep exposures, the number of large colonies produced increases. From the marrow of bled mice, total erythroid colony production is equal to or above that of normal marrow. Two populations of colony-forming cells are again evident, with the fast-responding CFU-E being below normal levels. The lack of colonies from this group was compensated in bled mice by rapid colony production in the second population. A real increase in numbers of precursors present in this pool increased the rate of colony production in culture to twice that of normal marrow. The number of large colonies obtained from bled mice was again increased as the Ep exposure was lengthened. (ERB)
Directory of Open Access Journals (Sweden)
Anna Hammer
2017-12-01
Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.
Development of the designed ankyrin repeat protein (DARPin) G3 for HER2 molecular imaging
International Nuclear Information System (INIS)
Goldstein, Robert; Livanos, Maria; Bhavsar, Gaurav; Rashid, Mohammed; Miranda, Enrique; Tolner, Berend; Meyer, Tim; Chester, Kerry; Sosabowski, Jane; Leyton, Julius; Mather, Stephen; Vigor, Kim; Nagy-Davidescu, Gabriela; Plueckthun, Andreas; Yeung, Jenny
2015-01-01
Human epidermal growth factor receptor-2 (HER2) overexpression is a predictor of response to anti-HER2 therapy in breast and gastric cancer. Currently, HER2 status is assessed by tumour biopsy, but this may not be representative of the larger tumour mass or other metastatic sites, risking misclassification and selection of suboptimal therapy. The designed ankyrin repeat protein (DARPin) G3 binds HER2 with high affinity at an epitope that does not overlap with trastuzumab and is biologically inert. We hypothesized that radiolabelled DARPin G3 would be capable of selectively imaging HER2-positive tumours, and aimed to identify a suitable format for clinical application. G3 DARPins tagged with hexahistidine (His 6 ) or with histidine glutamate (HE) 3 and untagged G3 DARPins were manufactured using a GMP-compatible Pichia pastoris protocol and radiolabelled with 125 I, or with 111 In via DOTA linked to a C-terminal cysteine. BALB/c mice were injected with radiolabelled G3 and tissue biodistribution was evaluated by gamma counting. The lead construct ((HE) 3 -G3) was assessed in mice bearing HER2-positive human breast tumour (BT474) xenografts. For both isotopes, (HE) 3 -G3 had significantly lower liver uptake than His 6 -G3 and untagged G3 counterparts in non-tumour-bearing mice, and there was no significantly different liver uptake between His 6 -G3 and untagged G3. (HE) 3 -G3 was taken forward for evaluation in mice bearing HER2-positive tumour xenografts. The results demonstrated that radioactivity from 111 In-(HE) 3 -G3 was better maintained in tumours and cleared faster from serum than radioactivity from 125 I-(HE) 3 -G3, achieving superior tumour-to-blood ratios (343.7 ± 161.3 vs. 22.0 ± 11.3 at 24 h, respectively). On microSPECT/CT, 111 In-labelled and 125 I-labelled (HE) 3 -G3 could image HER2-positive tumours at 4 h after administration, but there was less normal tissue uptake of radioactivity with 111 In-(HE) 3 -G3. Preadministration of trastuzumab did not
Directory of Open Access Journals (Sweden)
Ken-Ichi Nonomura
2011-01-01
Full Text Available The molecular mechanism for meiotic entry remains largely elusive in flowering plants. Only Arabidopsis SWI1/DYAD and maize AM1, both of which are the coiled-coil protein, are known to be required for the initiation of plant meiosis. The mechanism underlying the synchrony of male meiosis, characteristic to flowering plants, has also been unclear in the plant kingdom. In other eukaryotes, RNA-recognition-motif (RRM proteins are known to play essential roles in germ-cell development and meiosis progression. Rice MEL2 protein discovered in this study shows partial similarity with human proline-rich RRM protein, deleted in Azoospermia-Associated Protein1 (DAZAP1, though MEL2 also possesses ankyrin repeats and a RING finger motif. Expression analyses of several cell-cycle markers revealed that, in mel2 mutant anthers, most germ cells failed to enter premeiotic S-phase and meiosis, and a part escaped from the defect and underwent meiosis with a significant delay or continued mitotic cycles. Immunofluorescent detection revealed that T7 peptide-tagged MEL2 localized at cytoplasmic perinuclear region of germ cells during premeiotic interphase in transgenic rice plants. This study is the first report of the plant RRM protein, which is required for regulating the premeiotic G1/S-phase transition of male and female germ cells and also establishing synchrony of male meiosis. This study will contribute to elucidation of similarities and diversities in reproduction system between plants and other species.
Directory of Open Access Journals (Sweden)
Prasuna Paluru
2014-03-01
Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.
Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin
2018-01-01
Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.
Single-Cell Network Analysis Identifies DDIT3 as a Nodal Lineage Regulator in Hematopoiesis
Directory of Open Access Journals (Sweden)
Cristina Pina
2015-06-01
Full Text Available We explore cell heterogeneity during spontaneous and transcription-factor-driven commitment for network inference in hematopoiesis. Since individual genes display discrete OFF states or a distribution of ON levels, we compute and combine pairwise gene associations from binary and continuous components of gene expression in single cells. Ddit3 emerges as a regulatory node with positive linkage to erythroid regulators and negative association with myeloid determinants. Ddit3 loss impairs erythroid colony output from multipotent cells, while forcing Ddit3 in granulo-monocytic progenitors (GMPs enhances self-renewal and impedes differentiation. Network analysis of Ddit3-transduced GMPs reveals uncoupling of myeloid networks and strengthening of erythroid linkages. RNA sequencing suggests that Ddit3 acts through development or stabilization of a precursor upstream of GMPs with inherent Meg-E potential. The enrichment of Gata2 target genes in Ddit3-dependent transcriptional responses suggests that Ddit3 functions in an erythroid transcriptional network nucleated by Gata2.
No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.
Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte
2017-07-20
Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.
NeuCode Proteomics Reveals Bap1 Regulation of Metabolism
Directory of Open Access Journals (Sweden)
Joshua M. Baughman
2016-07-01
Full Text Available We introduce neutron-encoded (NeuCode amino acid labeling of mice as a strategy for multiplexed proteomic analysis in vivo. Using NeuCode, we characterize an inducible knockout mouse model of Bap1, a tumor suppressor and deubiquitinase whose in vivo roles outside of cancer are not well established. NeuCode proteomics revealed altered metabolic pathways following Bap1 deletion, including profound elevation of cholesterol biosynthetic machinery coincident with reduced expression of gluconeogenic and lipid homeostasis proteins in liver. Bap1 loss increased pancreatitis biomarkers and reduced expression of mitochondrial proteins. These alterations accompany a metabolic remodeling with hypoglycemia, hypercholesterolemia, hepatic lipid loss, and acinar cell degeneration. Liver-specific Bap1 null mice present with fully penetrant perinatal lethality, severe hypoglycemia, and hepatic lipid deficiency. This work reveals Bap1 as a metabolic regulator in liver and pancreas, and it establishes NeuCode as a reliable proteomic method for deciphering in vivo biology.
Molecular Convergence of Infrared Vision in Snakes
Yokoyama, Shozo; Altun, Ahmet; DeNardo, Dale F.
2011-01-01
It has been discovered that the transient receptor potential ankyrin 1 (TRPA1) proteins of Boidae (boas), Pythonidae (pythons), and Crotalinae (pit vipers) are used to detect infrared radiation, but the molecular mechanism for detecting the infrared radiation is unknown. Here, relating the amino acid substitutions in their TRPA1 proteins and the functional differentiations, we propose that three parallel amino acid changes (L330M, Q391H, and S434T) are responsible for the development of infrared vision in the three groups of snakes. Protein modeling shows that the three amino acid changes alter the structures of the central region of their ankyrin repeats. PMID:20937734
A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders
Energy Technology Data Exchange (ETDEWEB)
Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)
2010-08-07
Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.
Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A
2008-10-01
The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.
Functional variants in the B-cell gene BANK1 are associated with systemic lupus erythematosus
DEFF Research Database (Denmark)
Kozyrev, Sergey V; Abelson, Anna-Karin; Wojcik, Jerome
2008-01-01
Systemic lupus erythematosus (SLE) is a prototypical autoimmune disease characterized by production of autoantibodies and complex genetic inheritance. In a genome-wide scan using 85,042 SNPs, we identified an association between SLE and a nonsynonymous substitution (rs10516487, R61H) in the B...... without a putative IP3R-binding domain. The transcripts were differentially expressed depending on a branch point-site SNP, rs17266594, in strong linkage disequilibrium (LD) with rs10516487. A third associated variant was found in the ankyrin domain (rs3733197, A383T). Our findings implicate BANK1...
Stabilizing IkappaBalpha by "consensus" design.
Ferreiro, Diego U; Cervantes, Carla F; Truhlar, Stephanie M E; Cho, Samuel S; Wolynes, Peter G; Komives, Elizabeth A
2007-01-26
IkappaBalpha is the major regulator of transcription factor NF-kappaB function. The ankyrin repeat region of IkappaBalpha mediates specific interactions with NF-kappaB dimers, but ankyrin repeats 1, 5 and 6 display a highly dynamic character when not in complex with NF-kappaB. Using chemical denaturation, we show here that IkappaBalpha displays two folding transitions: a non-cooperative conversion under weak perturbation, and a major cooperative folding phase upon stronger insult. Taking advantage of a native Trp residue in ankyrin repeat (AR) 6 and engineered Trp residues in AR2, AR4 and AR5, we show that the cooperative transition involves AR2 and AR3, while the non-cooperative transition involves AR5 and AR6. The major structural transition can be affected by single amino acid substitutions converging to the "consensus" ankyrin repeat sequence, increasing the native state stability significantly. We further characterized the structural and dynamic properties of the native state ensemble of IkappaBalpha and the stabilized mutants by H/(2)H exchange mass spectrometry and NMR. The solution experiments were complemented with molecular dynamics simulations to elucidate the microscopic origins of the stabilizing effect of the consensus substitutions, which can be traced to the fast conformational dynamics of the folded ensemble.
Anks3 alters the sub-cellular localization of the Nek7 kinase
Energy Technology Data Exchange (ETDEWEB)
Ramachandran, Haribaskar; Engel, Christina; Müller, Barbara [Renal Division, Department of Medicine, University Freiburg Medical Center, Hugstetter Str. 55, 79106 Freiburg (Germany); Dengjel, Jörn [Department of Dermatology, University Freiburg Medical Center and Center of Biological Systems Analysis, Habsburgerstr. 49, 79104 Freiburg (Germany); Walz, Gerd [Renal Division, Department of Medicine, University Freiburg Medical Center, Hugstetter Str. 55, 79106 Freiburg (Germany); Center for Biological Signaling Studies (BIOSS), Albertstr. 19, 79104 Freiburg (Germany); Yakulov, Toma A., E-mail: toma.antonov.yakulov@uniklinik-freiburg.de [Renal Division, Department of Medicine, University Freiburg Medical Center, Hugstetter Str. 55, 79106 Freiburg (Germany)
2015-08-28
Nephronophthisis (NPH) is an autosomal recessive cystic kidney disease, and a frequent cause of end-stage renal failure in children. To date, 17 NPH-associated gene products (NPHPs) have been identified. Most NPHPs participate in large multi-protein complexes that localize to the cilium and/or basal body; however, the precise composition of these complexes and their biological function remain largely unknown. We recently observed that the ankyrin repeat protein Anks3 interacts with the NPH family member Anks6. Both Anks3 and Anks6 form complexes with multiple other NPHPs, suggesting that both proteins function in similar or overlapping signaling pathways. Here, we show that Anks3, but not Anks6 interacted with the NIMA-related kinase Nek7, and was heavily modified in the presence of Nek7, resulting in an approximately 20 kD increase in molecular weight. Although mass spectrometry revealed increased serine and threonine phosphorylation of Anks3 primarily within the N-terminal ankyrin repeats also required for Nek7 interaction, the molecular weight increase occurred even in the presence of a kinase-dead Nek7 mutant, indicating that this modification was not caused by Nek7-dependent Anks3 phosphorylation. Furthermore, the Anks3 modification was specific for Nek7, and did not occur in the presence of Nek8. Importantly, Anks3 retained Nek7 in the cytoplasm, suggesting that, Nek7 triggers the modification of Anks3, which in turn prevents the nuclear localization of Nek7. - Highlights: • Anks3 interacted with Nek7 kinase, and was heavily modified in the presence of Nek7. • Anks3 N-terminal ankyrin repeats, but not SAM domain required for Nek7 interaction. • Nek7 increased Ser/Thr phosphorylation of Anks3 primarily within ankyrin domain. • Interaction with Anks3 led to cytoplasmic retention and nuclear exclusion of Nek7.
International Nuclear Information System (INIS)
Blomgren, H.; Jacobsson, H.
1974-01-01
Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay
Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D
2014-10-01
This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
Development of the designed ankyrin repeat protein (DARPin) G3 for HER2 molecular imaging
Energy Technology Data Exchange (ETDEWEB)
Goldstein, Robert; Livanos, Maria; Bhavsar, Gaurav; Rashid, Mohammed; Miranda, Enrique; Tolner, Berend; Meyer, Tim; Chester, Kerry [UCL Cancer Institute, London (United Kingdom); Sosabowski, Jane; Leyton, Julius; Mather, Stephen [Queen Mary University of London, Centre for Molecular Oncology, Barts Cancer Institute, London (United Kingdom); Vigor, Kim [Clare Hall Laboratories, Biotherapeutics Development Unit, Cancer Research UK, South Mimms (United Kingdom); Nagy-Davidescu, Gabriela; Plueckthun, Andreas [Universitaet Zuerich, Biochemisches Institut, Zuerich (Switzerland); Yeung, Jenny [UCL Cancer Institute, London (United Kingdom); UCL Institute of Child Health, London (United Kingdom)
2014-11-13
Human epidermal growth factor receptor-2 (HER2) overexpression is a predictor of response to anti-HER2 therapy in breast and gastric cancer. Currently, HER2 status is assessed by tumour biopsy, but this may not be representative of the larger tumour mass or other metastatic sites, risking misclassification and selection of suboptimal therapy. The designed ankyrin repeat protein (DARPin) G3 binds HER2 with high affinity at an epitope that does not overlap with trastuzumab and is biologically inert. We hypothesized that radiolabelled DARPin G3 would be capable of selectively imaging HER2-positive tumours, and aimed to identify a suitable format for clinical application. G3 DARPins tagged with hexahistidine (His{sub 6}) or with histidine glutamate (HE){sub 3} and untagged G3 DARPins were manufactured using a GMP-compatible Pichia pastoris protocol and radiolabelled with {sup 125}I, or with {sup 111}In via DOTA linked to a C-terminal cysteine. BALB/c mice were injected with radiolabelled G3 and tissue biodistribution was evaluated by gamma counting. The lead construct ((HE){sub 3}-G3) was assessed in mice bearing HER2-positive human breast tumour (BT474) xenografts. For both isotopes, (HE){sub 3}-G3 had significantly lower liver uptake than His{sub 6}-G3 and untagged G3 counterparts in non-tumour-bearing mice, and there was no significantly different liver uptake between His{sub 6}-G3 and untagged G3. (HE){sub 3}-G3 was taken forward for evaluation in mice bearing HER2-positive tumour xenografts. The results demonstrated that radioactivity from {sup 111}In-(HE){sub 3}-G3 was better maintained in tumours and cleared faster from serum than radioactivity from {sup 125}I-(HE){sub 3}-G3, achieving superior tumour-to-blood ratios (343.7 ± 161.3 vs. 22.0 ± 11.3 at 24 h, respectively). On microSPECT/CT, {sup 111}In-labelled and {sup 125}I-labelled (HE){sub 3}-G3 could image HER2-positive tumours at 4 h after administration, but there was less normal tissue uptake of
Directory of Open Access Journals (Sweden)
Xingguo Zhu
Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.
Mcph1-deficient mice reveal a role for MCPH1 in otitis media.
Directory of Open Access Journals (Sweden)
Jing Chen
Full Text Available Otitis media is a common reason for hearing loss, especially in children. Otitis media is a multifactorial disease and environmental factors, anatomic dysmorphology and genetic predisposition can all contribute to its pathogenesis. However, the reasons for the variable susceptibility to otitis media are elusive. MCPH1 mutations cause primary microcephaly in humans. So far, no hearing impairment has been reported either in the MCPH1 patients or mouse models with Mcph1 deficiency. In this study, Mcph1-deficient (Mcph1(tm1a (/tm1a mice were produced using embryonic stem cells with a targeted mutation by the Sanger Institute's Mouse Genetics Project. Auditory brainstem response measurements revealed that Mcph1(tm1a (/tm1a mice had mild to moderate hearing impairment with around 70% penetrance. We found otitis media with effusion in the hearing-impaired Mcph1(tm1a (/tm1a mice by anatomic and histological examinations. Expression of Mcph1 in the epithelial cells of middle ear cavities supported its involvement in the development of otitis media. Other defects of Mcph1(tm1a (/tm1a mice included small skull sizes, increased micronuclei in red blood cells, increased B cells and ocular abnormalities. These findings not only recapitulated the defects found in other Mcph1-deficient mice or MCPH1 patients, but also revealed an unexpected phenotype, otitis media with hearing impairment, which suggests Mcph1 is a new gene underlying genetic predisposition to otitis media.
Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway
Directory of Open Access Journals (Sweden)
Michelle R. Campbell
2013-01-01
Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.
International Nuclear Information System (INIS)
Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir
2014-01-01
Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway
Energy Technology Data Exchange (ETDEWEB)
Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)
2014-07-18
Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.
Directory of Open Access Journals (Sweden)
Capretto L
2012-01-01
Full Text Available Lorenzo Capretto1, Stefania Mazzitelli2, Eleonora Brognara2, Ilaria Lampronti2, Dario Carugo1, Martyn Hill1, Xunli Zhang1, Roberto Gambari2, Claudio Nastruzzi31Engineering Sciences, University of Southampton, Southampton, UK; 2Department of Biochemistry and Molecular Biology, 3Department of Pharmaceutical Sciences, University of Ferrara, Ferrara, ItalyAbstract: This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH, based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of ß-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying ß-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol
Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan
2016-01-01
Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.
A variant in ANKK1 modulates acute subjective effects of cocaine: a preliminary study
Spellicy, Catherine J.; Harding, Mark J.; Hamon, Sara C.; Mahoney, James J.; Reyes, Jennifer A.; Kosten, Thomas R.; Newton, Thomas F.; De La Garza, Richard; Nielsen, David A.
2014-01-01
This study aimed to evaluate whether functional variants in the ankyrin repeat and kinase domain-containing 1 gene (ANKK1) and/or the dopamine receptor D2 gene (DRD2) modulate the subjective effects (reward or non-reward response to a stimulus) produced by cocaine administration. Cocaine-dependent participants (N = 47) were administered 40 mg of cocaine or placebo at time 0, and a subjective effects questionnaire (visual analog scale) was administered 15 minutes prior to cocaine administration, and at 5, 10,15, and 20 minutes following administration. The influence of polymorphisms in the ANKK1 and DRD2 genes on subjective experience of cocaine in the laboratory was tested. Participants with a T allele of ANKK1 rs1800497 experienced greater subjective ‘high’ (p = 0.00006), ‘any drug effect’ (p = 0.0003), and ‘like’ (p = 0.0004) relative to the CC genotype group. Although the variant in the DRD2 gene was shown to be associated with subjective effects, LD analysis revealed this association was driven by the ANKK1 rs1800497 variant. A participant’s ANKK1 genotype may identify individuals who are likely to experience greater positive subjective effects following cocaine exposure, including greater ‘high’ and ‘like’, and these individuals may have increased vulnerability to continue using cocaine or they may be at greater risk to relapse during periods of abstinence. However, these results are preliminary and replication is necessary to confirm these findings. PMID:24528631
Energy Technology Data Exchange (ETDEWEB)
Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca
2013-07-15
Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.
International Nuclear Information System (INIS)
Lo, Raymond; Matthews, Jason
2013-01-01
Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.
Zhao, Jingyao; Chen, Xufeng; Song, Guangrong; Zhang, Jiali; Liu, Haifeng; Liu, Xiaolong
2017-01-10
Hematopoietic stem cells (HSCs) are able to both self-renew and differentiate. However, how individual HSC makes the decision between self-renewal and differentiation remains largely unknown. Here we report that ablation of the key epigenetic regulator Uhrf1 in the hematopoietic system depletes the HSC pool, leading to hematopoietic failure and lethality. Uhrf1-deficient HSCs display normal survival and proliferation, yet undergo erythroid-biased differentiation at the expense of self-renewal capacity. Notably, Uhrf1 is required for the establishment of DNA methylation patterns of erythroid-specific genes during HSC division. The expression of these genes is enhanced in the absence of Uhrf1, which disrupts the HSC-division modes by promoting the symmetric differentiation and suppressing the symmetric self-renewal. Moreover, overexpression of one of the up-regulated genes, Gata1, in HSCs is sufficient to phenocopy Uhrf1-deficient HSCs, which show impaired HSC symmetric self-renewal and increased differentiation commitment. Taken together, our findings suggest that Uhrf1 controls the self-renewal versus differentiation of HSC through epigenetically regulating the cell-division modes, thus providing unique insights into the relationship among Uhrf1-mediated DNA methylation, cell-division mode, and HSC fate decision.
Du, C; Xu, Y; Yang, K; Chen, S; Wang, X; Wang, S; Wang, C; Shen, M; Chen, F; Chen, M; Zeng, D; Li, F; Wang, T; Wang, F; Zhao, J; Ai, G; Cheng, T; Su, Y; Wang, J
2017-04-01
Estrogen is reported to be involved in thrombopoiesis and the disruption of its signaling may cause myeloproliferative disease, yet the underlying mechanisms remain largely unknown. GATA-binding factor 1 (GATA1) is a key regulator of megakaryocyte (MK) differentiation and its deficiency will lead to megakaryoblastic leukemia. Here we show that estrogen can dose-dependently promote MK polyploidization and maturation via activation of estrogen receptor beta (ERβ), accompanied by a significant upregulation of GATA1. Chromatin immunoprecipitation and a dual luciferase assay demonstrate that ERβ can directly bind the promoter region of GATA1 and activate its transcription. Steroid receptor coactivator 3 (SRC3) is involved in ERβ-mediated GATA1 transcription. The deficiency of ERβ or SRC3, similar to the inhibition of GATA1, leads to the impediment of estrogen-induced MK polyploidization and platelet production. Further investigations reveal that signal transducer and activator of transcription 1 signaling pathway downstream of GATA1 has a crucial role in estrogen-induced MK polyploidization, and ERβ-mediated GATA1 upregulation subsequently enhances nuclear factor erythroid-derived 2 expression, thereby promoting proplatelet formation and platelet release. Our study provides a deep insight into the molecular mechanisms of estrogen signaling in regulating thrombopoiesis and the pathogenesis of ER deficiency-related leukemia.
Diffusion chamber culture of mouse bone marrow cells, (1)
International Nuclear Information System (INIS)
Sigeta, Chiharu; Tanaka, Kimio; Kawakami, Masahito; Takahashi, Hiroshi; Ohkita, Takeshi
1980-01-01
Mouse bone marrow cells were cultured in diffusion chambers (DC) implanted in the peritoneal cavity of host mice. Host mice were subjected to (1) irradiation ( 60 Co 800 rad) and/or (2) phenylhydrazine induced anemia and then receiving irradiation ( 60 Co 600 rad). After culture periods of 3-7 days, the total number of cells in DC was increased. A marked increase in DC is due to the proliferation of granulocyte series. When host mice were subjected to anemia and irradiation, the start of cell proliferation in DC was delay about two days. On the whole, anemia and irradiation host reduced a little cell growth in DC. The number of immature granulocytes grown in DC in irradiated hosts or anemia and irradiated hosts increased and reached a plateu at day 5. During the plateu period, the proportions between immature and mature granulocytes in DC were kept constantly. The number of macrophages showed a two-phase increasing. Erythroid cells and lymphocytes rapidly disappeared from the chambers during 3 days. The number of erythroid cells was not significantly influenced even in anemia and irradiation hosts. (author)
International Nuclear Information System (INIS)
Giglio, M.J.; Brandan, N.; Leal, T.L.; Bozzini, C.E.
1989-01-01
With the purpose of assessing the effect of uranyl nitrate (UN) on the rate of erythropoiesis, 1 mg/kg of the compound was injected iv to adult female Wistar rats. The dosing vehicle was injected into control animals. A single injection of UN induced a transient depression of the rate of red cell volume 59 Fe uptake, which reached its lowest value (68% depression) by the seventh postinjection day. By 14 days, 59 Fe incorporation had returned to normal. The amount of iron going to erythroid tissue per hour, reticulocyte count, and immunoreactive erythropoietin concentration in both plasma and kidney extracts were also significantly depressed in UN-treated rats in relation to these values in vehicle-injected rats by the seventh postinjection day. Dose-response curves for exogenous erythropoietin (Epo) performed in polycythemic intact and UN-treated rats 7 days after drug injection revealed a significant depression of the response in UN-injected animals. Moreover, bone marrow cells obtained from rats pretreated with UN formed a reduced number of erythroid colonies in vitro in response to Epo. Therefore, possible mechanisms for the observed transient depression in the rate of erythropoiesis associated with acute UN treatment include decreased Epo production and direct or indirect damage of erythroid progenitor cells
Polylox barcoding reveals haematopoietic stem cell fates realized in vivo
Rössler, Jens; Wang, Xi; Postrach, Daniel; Busch, Katrin; Rode, Immanuel; Klapproth, Kay; Dietlein, Nikolaus; Quedenau, Claudia; Chen, Wei; Sauer, Sascha; Wolf, Stephan; Höfer, Thomas; Rodewald, Hans-Reimer
2017-01-01
Developmental deconvolution of complex organs and tissues at the level of individual cells remains challenging. Non-invasive genetic fate mapping1 has been widely used, but the low number of distinct fluorescent marker proteins limits its resolution. Much higher numbers of cell markers have been generated using viral integration sites2, viral barcodes3, and strategies based on transposons4 and CRISPR/Cas9 genome editing5; however, temporal and tissue-specific induction of barcodes in situ has not been achieved. Here we report the development of an artificial DNA recombination locus (termed Polylox) that enables broadly applicable endogenous barcoding based on the Cre-loxP recombination system6,7. Polylox recombination in situ reaches a practical diversity of several hundred thousand barcodes, allowing tagging of single cells. We have used this experimental system, combined with fate mapping, to assess haematopoietic stem cell (HSC) fates in vivo. Classical models of haematopoietic lineage specification assume a tree with few major branches. More recently, driven in part by the development of more efficient single-cell assays and improved transplantation efficiencies, different models have been proposed, in which unilineage priming may occur in mice and humans at the level of HSCs8–10. We have introduced barcodes into HSC progenitors in embryonic mice, and found that the adult HSC compartment is a mosaic of embryo-derived HSC clones, some of which are unexpectedly large. Most HSC clones gave rise to multilineage or oligolineage fates, arguing against unilineage priming, and suggesting coherent usage of the potential of cells in a clone. The spreading of barcodes, both after induction in embryos and in adult mice, revealed a basic split between common myeloid-erythroid development and common lymphocyte development, supporting the long-held but contested view of a tree-like haematopoietic structure. PMID:28813413
Defining the Minimal Factors Required for Erythropoiesis through Direct Lineage Conversion
Directory of Open Access Journals (Sweden)
Sandra Capellera-Garcia
2016-06-01
Full Text Available Erythroid cell commitment and differentiation proceed through activation of a lineage-restricted transcriptional network orchestrated by a group of well characterized genes. However, the minimal set of factors necessary for instructing red blood cell (RBC development remains undefined. We employed a screen for transcription factors allowing direct lineage reprograming from fibroblasts to induced erythroid progenitors/precursors (iEPs. We show that Gata1, Tal1, Lmo2, and c-Myc (GTLM can rapidly convert murine and human fibroblasts directly to iEPs. The transcriptional signature of murine iEPs resembled mainly that of primitive erythroid progenitors in the yolk sac, whereas addition of Klf1 or Myb to the GTLM cocktail resulted in iEPs with a more adult-type globin expression pattern. Our results demonstrate that direct lineage conversion is a suitable platform for defining and studying the core factors inducing the different waves of erythroid development.
Directory of Open Access Journals (Sweden)
Hideyuki Miyatake
Full Text Available In this study, we determined the crystal structure of N-terminal importin-β-binding domain (IBB-truncated human importin-α1 (ΔIBB-h-importin-α1 at 2.63 Å resolution. The crystal structure of ΔIBB-h-importin-α1 reveals a novel closed homodimer. The homodimer exists in an autoinhibited state in which both the major and minor nuclear localization signal (NLS binding sites are completely buried in the homodimerization interface, an arrangement that restricts NLS binding. Analytical ultracentrifugation studies revealed that ΔIBB-h-importin-α1 is in equilibrium between monomers and dimers and that NLS peptides shifted the equilibrium toward the monomer side. This finding suggests that the NLS binding sites are also involved in the dimer interface in solution. These results show that when the IBB domain dissociates from the internal NLS binding sites, e.g., by binding to importin-β, homodimerization possibly occurs as an autoinhibition state.
A designated centre for people with disabilities operated by Praxis Care, Louth
LENUS (Irish Health Repository)
Aslan, Ozlem
2010-12-15
Abstract Background Recent QTL and gene expression studies have highlighted ankyrins as positional and functional candidate genes for meat quality. Our objective was to characterise the promoter region of the bovine ankyrin 1 gene and to test polymorphisms for association with sensory and technological meat quality measures. Results Seven novel promoter SNPs were identified in a 1.11 kb region of the ankyrin 1 promoter in Angus, Charolais and Limousin bulls (n = 15 per breed) as well as 141 crossbred beef animals for which meat quality data was available. Eighteen haplotypes were inferred with significant breed variation in haplotype frequencies. The five most frequent SNPs and the four most frequent haplotypes were subsequently tested for association with sensory and technological measures of meat quality in the crossbred population. SNP1, SNP3 and SNP4 (which were subsequently designated regulatory SNPs) and SNP5 were associated with traits that contribute to sensorial and technological measurements of tenderness and texture; Haplotype 1 and haplotype 4 were oppositely correlated with traits contributing to tenderness (P < 0.05). While no single SNP was associated with intramuscular fat (IMF), a clear association with increased IMF and juiciness was observed for haplotype 2. Conclusion The conclusion from this study is that alleles defining haplotypes 2 and 4 could usefully contribute to marker SNP panels used to select individuals with improved IMF\\/juiciness or tenderness in a genome-assisted selection framework.
Herde, Michel K; Herbison, Allan E
2015-11-01
GnRH neurons are the final output neurons of the hypothalamic network controlling fertility in mammals. In the present study, we used ankyrin G immunohistochemistry and neurobiotin filling of live GnRH neurons in brain slices from GnRH-green fluorescent protein transgenic male mice to examine in detail the location of action potential initiation in GnRH neurons with somata residing at different locations in the basal forebrain. We found that the vast majority of GnRH neurons are bipolar in morphology, elaborating a thick (primary) and thinner (secondary) dendrite from opposite poles of the soma. In addition, an axon-like process arising predominantly from a proximal dendrite was observed in a subpopulation of GnRH neurons. Ankyrin G immunohistochemistry revealed the presence of a single action potential initiation zone ∼27 μm in length primarily in the secondary dendrite of GnRH neurons and located 30 to 140 μm distant from the cell soma, depending on the type of process and location of the cell body. In addition to dendrites, the GnRH neurons with cell bodies located close to hypothalamic circumventricular organs often elaborated ankyrin G-positive axon-like structures. Almost all GnRH neurons (>90%) had their action potential initiation site in a process that initially, or ultimately after a hairpin loop, was coursing in the direction of the median eminence. These studies indicate that action potentials are initiated in different dendritic and axonal compartments of the GnRH neuron in a manner that is dependent partly on the neuroanatomical location of the cell body.
TRPA1 is a polyunsaturated fatty acid sensor in mammals.
Directory of Open Access Journals (Sweden)
Arianne L Motter
Full Text Available Fatty acids can act as important signaling molecules regulating diverse physiological processes. Our understanding, however, of fatty acid signaling mechanisms and receptor targets remains incomplete. Here we show that Transient Receptor Potential Ankyrin 1 (TRPA1, a cation channel expressed in sensory neurons and gut tissues, functions as a sensor of polyunsaturated fatty acids (PUFAs in vitro and in vivo. PUFAs, containing at least 18 carbon atoms and three unsaturated bonds, activate TRPA1 to excite primary sensory neurons and enteroendocrine cells. Moreover, behavioral aversion to PUFAs is absent in TRPA1-null mice. Further, sustained or repeated agonism with PUFAs leads to TRPA1 desensitization. PUFAs activate TRPA1 non-covalently and independently of known ligand binding domains located in the N-terminus and 5(th transmembrane region. PUFA sensitivity is restricted to mammalian (rodent and human TRPA1 channels, as the drosophila and zebrafish TRPA1 orthologs do not respond to DHA. We propose that PUFA-sensing by mammalian TRPA1 may regulate pain and gastrointestinal functions.
Directory of Open Access Journals (Sweden)
Jianguo Wen
2017-06-01
Full Text Available Abstract Background Sickle cell disease (SCD is a disorder of red blood cells (RBCs expressing abnormal hemoglobin-S (HbS due to genetic inheritance of homologous HbS gene. However, people with the sickle cell trait (SCT carry a single allele of HbS and do not usually suffer from SCD symptoms, thus providing a rationale to treat SCD. Methods To validate gene therapy potential, hematopoietic stem cells were isolated from the SCD patient blood and treated with CRISPR/Cas9 approach. To precisely dissect genome-editing effects, erythroid progenitor cells were cloned from single colonies of CRISPR-treated cells and then expanded for simultaneous gene, protein, and cellular function studies. Results Genotyping and sequencing analysis revealed that the genome-edited erythroid progenitor colonies were converted to SCT genotype from SCD genotype. HPLC protein assays confirmed reinstallation of normal hemoglobin at a similar level with HbS in the cloned genome-edited erythroid progenitor cells. For cell function evaluation, in vitro RBC differentiation of the cloned erythroid progenitor cells was induced. As expected, cell sickling assays indicated function reinstitution of the genome-edited offspring SCD RBCs, which became more resistant to sickling under hypoxia condition. Conclusions This study is an exploration of genome editing of SCD HSPCs.
Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2013-01-01
In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011
Large-scale analysis by SAGE reveals new mechanisms of v-erbA oncogene action
Directory of Open Access Journals (Sweden)
Faure Claudine
2007-10-01
Full Text Available Abstract Background: The v-erbA oncogene, carried by the Avian Erythroblastosis Virus, derives from the c-erbAα proto-oncogene that encodes the nuclear receptor for triiodothyronine (T3R. v-ErbA transforms erythroid progenitors in vitro by blocking their differentiation, supposedly by interference with T3R and RAR (Retinoic Acid Receptor. However, v-ErbA target genes involved in its transforming activity still remain to be identified. Results: By using Serial Analysis of Gene Expression (SAGE, we identified 110 genes deregulated by v-ErbA and potentially implicated in the transformation process. Bioinformatic analysis of promoter sequence and transcriptional assays point out a potential role of c-Myb in the v-ErbA effect. Furthermore, grouping of newly identified target genes by function revealed both expected (chromatin/transcription and unexpected (protein metabolism functions potentially deregulated by v-ErbA. We then focused our study on 15 of the new v-ErbA target genes and demonstrated by real time PCR that in majority their expression was activated neither by T3, nor RA, nor during differentiation. This was unexpected based upon the previously known role of v-ErbA. Conclusion: This paper suggests the involvement of a wealth of new unanticipated mechanisms of v-ErbA action.
Engelke, Michael; Friedrich, Olaf; Budde, Petra; Schäfer, Christina; Niemann, Ursula; Zitt, Christof; Jüngling, Eberhard; Rocks, Oliver; Lückhoff, Andreas; Frey, Jürgen
2002-07-17
Transient receptor potential proteins (TRP) are supposed to participate in the formation of store-operated Ca(2+) influx channels by co-assembly. However, little is known which domains facilitate the interaction of subunits. Contribution of the N-terminal coiled-coil domain and ankyrin-like repeats and the putative pore region of the mouse TRP1beta (mTRP1beta) variant to the formation of functional cation channels were analyzed following overexpression in HEK293 (human embryonic kidney) cells. MTRP1beta expressing cells exhibited enhanced Ca(2+) influx and enhanced whole-cell membrane currents compared to mTRP1beta deletion mutants. Using a yeast two-hybrid assay only the coiled-coil domain facilitated homodimerization of the N-terminus. These results suggest that the N-terminus of mTRP1beta is required for structural organization thus forming functional channels.
International Nuclear Information System (INIS)
Goupille, Olivier; Penglong, Tipparat; Lefèvre, Carine; Granger, Marine; Kadri, Zahra; Fucharoen, Suthat; Maouche-Chrétien, Leila; Leboulch, Philippe; Chrétien, Stany
2012-01-01
Highlights: ► UT7 erythroleukemia cells are known to be refractory to differentiate. ► Brief JQ1 treatment initiates the first steps of erythroid differentiation program. ► Engaged UT7 cells then maturate in the presence of erythropoietin. ► Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.
Energy Technology Data Exchange (ETDEWEB)
Goupille, Olivier [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Penglong, Tipparat [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Lefevre, Carine; Granger, Marine; Kadri, Zahra [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Fucharoen, Suthat [Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Maouche-Chretien, Leila [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Leboulch, Philippe [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Genetics Division, Department of Medicine, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA (United States); Chretien, Stany, E-mail: stany.chretien@cea.fr [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France)
2012-12-07
Highlights: Black-Right-Pointing-Pointer UT7 erythroleukemia cells are known to be refractory to differentiate. Black-Right-Pointing-Pointer Brief JQ1 treatment initiates the first steps of erythroid differentiation program. Black-Right-Pointing-Pointer Engaged UT7 cells then maturate in the presence of erythropoietin. Black-Right-Pointing-Pointer Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.
Yang, Jie; Wu, Renyi; Li, Wenji; Gao, Linbo; Yang, Yuqing; Li, Ping; Kong, Ah-Ng
2018-04-01
Corosolic acid (CRA) is found in various plants and has been used as a health food supplement worldwide. Although it has been reported that CRA exhibits significant anticancer activity, the effect of this compound on prostate cancer remains unknown. In this study, we investigated the effect of CRA on cellular transformation and the reactivation of nuclear factor erythroid 2-related factor 2 (Nrf2) through epigenetic regulation in TRAMP-C1 prostate cells. Specifically, we found that CRA inhibited anchorage-independent growth of prostate cancer TRAMP-C1 cells but not Nrf2 knockout prostate cancer TRAMP-C1 cells. Moreover, CRA induced mRNA and protein expression of Nrf2, heme oxygenase-1 (HO-1) and NAD(P)H Quinone Oxidoreductase 1 (NQO1). Bisulfite genomic sequencing and methylated DNA immunoprecipitation results revealed that CRA treatment decreased the level of methylation of the first five CpG sites of the Nrf2 promoter. Histone modification was analyzed using a chromatin immunoprecipitation (ChIP) assay, which revealed that CRA treatment increased the acetylation of histone H3 lysine 27 (H3K27ac) while decreasing the trimethylation of histone H3 lysine 27 (H3K27me3) in the promoter region of Nrf2. Furthermore, CRA treatment attenuated the protein expression of DNA methyltransferases (DNMTs) and histone deacetylases (HDACs). These findings indicate that CRA has a significant anticancer effect in TRAMP-C1 cells, which could be partly attributed to epigenetics including its ability to epigenetically restore the expression of Nrf2. © 2017 Wiley Periodicals, Inc.
Park, Jonghyuck; Zheng, Lingxing; Acosta, Glen; Vega-Alvarez, Sasha; Chen, Zhe; Muratori, Breanne; Cao, Peng; Shi, Riyi
2015-12-01
Acrolein, an endogenous aldehyde, has been shown to be involved in sensory hypersensitivity after rat spinal cord injury (SCI), for which the pathogenesis is unclear. Acrolein can directly activate a pro-algesic transient receptor protein ankyrin 1 (TRPA1) channel that exists in sensory neurons. Both acrolein and TRPA1 mRNA are elevated post SCI, which contributes to the activation of TRPA1 by acrolein and consequently, neuropathic pain. In the current study, we further showed that, post-SCI elevation of TRPA1 mRNA exists not only in dorsal root ganglias but also in both peripheral (paw skin) and central endings of primary afferent nerves (dorsal horn of spinal cord). This is the first indication that pain signaling can be over-amplified in the peripheral skin by elevated expressions of TRPA1 following SCI, in addition over-amplification previously seen in the spinal cord and dorsal root ganglia. Furthermore, we show that acrolein alone, in the absence of physical trauma, could lead to the elevation of TRPA1 mRNA at various locations when injected to the spinal cord. In addition, post-SCI elevation of TRPA1 mRNA could be mitigated using acrolein scavengers. Both of these attributes support the critical role of acrolein in elevating TRPA1 expression through gene regulation. Taken together, these data indicate that acrolein is likely a critical causal factor in heightening pain sensation post-SCI, through both the direct binding of TRPA1 receptor, and also by boosting the expression of TRPA1. Finally, our data also further support the notion that acrolein scavenging may be an effective therapeutic approach to alleviate neuropathic pain after SCI. We propose that the trauma-mediated elevation of acrolein causes neuropathic pain through at least two mechanisms: acrolein stimulates the production of transient receptor protein ankyrin 1 (TRPA1) in both central and peripheral locations, and it activates TRPA1 channels directly. Therefore, acrolein appears to be a critical
Cyp1a reporter zebrafish reveals target tissues for dioxin
Energy Technology Data Exchange (ETDEWEB)
Kim, Kun-Hee [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Park, Hye-Jeong [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); Kim, Jin Hee [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Kim, Suhyun [Graduate School of Medicine, Korea University, Ansan (Korea, Republic of); Williams, Darren R. [New Drug Targets Laboratory, School of Life Sciences, Gwangju Institute of Science and Technology, Gwangju (Korea, Republic of); Kim, Myeong-Kyu [Department of Neurology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Jung, Young Do [Department of Biochemistry, Chonnam National University Medical School, Gwangju (Korea, Republic of); Teraoka, Hiroki [School of Veterinary Medicine, Rakuno Gakuen University, Ebetsu (Japan); Park, Hae-Chul [Graduate School of Medicine, Korea University, Ansan (Korea, Republic of); Choy, Hyon E., E-mail: hyonchoy@chonnam.ac.kr [Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Shin, Boo Ahn, E-mail: bashin@chonnam.ac.kr [Department of Microbiology, Chonnam National University Medical School, Gwangju (Korea, Republic of); Choi, Seok-Yong, E-mail: zebrafish@chonnam.ac.kr [Department of Biomedical Sciences, Chonnam National University Medical School, Gwangju (Korea, Republic of); School of Biological Sciences and Technology, Chonnam National University, Gwangju (Korea, Republic of)
2013-06-15
Highlights: •2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is the most toxic anthropogenic substance ever identified. •Transgenic cyp1a reporter zebrafish reveals target tissues for TCDD. •The retinal bipolar cells, otic vesicle, lateral line, pancreas, cloaca and pectoral fin bud are novel targets in zebrafish for TCDD. •Our findings will further understanding of human health risks by TCDD. -- Abstract: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is the unintentional byproduct of various industrial processes, is classified as human carcinogen and could disrupt reproductive, developmental and endocrine systems. Induction of cyp1a1 is used as an indicator of TCDD exposure. We sought to determine tissues that are vulnerable to TCDD toxicity using a transgenic zebrafish (Danio rerio) model. We inserted a nuclear enhanced green fluorescent protein gene (EGFP) into the start codon of a zebrafish cyp1a gene in a fosmid clone using DNA recombineering. The resulting recombineered fosmid was then used to generate cyp1a reporter zebrafish, embryos of which were exposed to TCDD. Expression pattern of EGFP in the reporter zebrafish mirrored that of endogenous cyp1a mRNA. In addition, exposure of the embryos to TCDD at as low as 10 pM for 72 h, which does not elicit morphological abnormalities of embryos, markedly increased GFP expression. Furthermore, the reporter embryos responded to other AhR ligands as well. Exposure of the embryos to TCDD revealed previously reported (the cardiovascular system, liver, pancreas, kidney, swim bladder and skin) and unreported target tissues (retinal bipolar cells, otic vesicle, lateral line, cloaca and pectoral fin bud) for TCDD. Transgenic cyp1a reporter zebrafish we have developed can further understanding of ecotoxicological relevance and human health risks by TCDD. In addition, they could be used to identify agonists of AhR and antidotes to TCDD toxicity.
International Nuclear Information System (INIS)
Evans, T.; Reitman, M.; Felsenfeld, G.
1988-01-01
The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites
Decreased "ineffective erythropoiesis" preserves polycythemia in mice under long-term hypoxia.
Harada, Tomonori; Tsuboi, Isao; Hirabayashi, Yukio; Kosaku, Kazuhiro; Naito, Michiko; Hara, Hiroyuki; Inoue, Tohru; Aizawa, Shin
2015-05-01
Hypoxia induces innumerable changes in humans and other animals, including an increase in peripheral red blood cells (polycythemia) caused by the activation of erythropoiesis mediated by increased erythropoietin (EPO) production. However, the elevation of EPO is limited and levels return to normal ranges under normoxia within 5-7 days of exposure to hypoxia, whereas polycythemia continues for as long as hypoxia persists. We investigated erythropoiesis in bone marrow and spleens from mouse models of long-term normobaric hypoxia (10 % O2) to clarify the mechanism of prolonged polycythemia in chronic hypoxia. The numbers of erythroid colony-forming units (CFU-E) in the spleen remarkably increased along with elevated serum EPO levels indicating the activation of erythropoiesis during the first 7 days of hypoxia. After 14 days of hypoxia, the numbers of CFU-E returned to normoxic levels, whereas polycythemia persisted for >140 days. Flow cytometry revealed a prolonged increase in the numbers of TER119-positive cells (erythroid cells derived from pro-erythroblasts through mature erythrocyte stages), especially the TER119 (high) CD71 (high) population, in bone marrow. The numbers of annexin-V-positive cells among the TER119-positive cells particularly declined under chronic hypoxia, suggesting that the numbers of apoptotic cells decrease during erythroid cell maturation. Furthermore, RT-PCR analysis showed that the RNA expression of BMP-4 and stem cell factor that reduces apoptotic changes during erythroid cell proliferation and maturation was increased in bone marrow under hypoxia. These findings indicated that decreased apoptosis of erythroid cells during erythropoiesis contributes to polycythemia in mice during chronic exposure to long-term hypoxia.
Primitive and definitive erythropoiesis in mammals
Directory of Open Access Journals (Sweden)
James ePalis
2014-01-01
Full Text Available Red blood cells (RBCs, which constitute the most abundant cell type in the body, come in two distinct flavors- primitive and definitive. Definitive RBCs in mammals circulate as smaller, anucleate cells during fetal and postnatal life, while primitive RBCs circulate transiently in the early embryo as large, nucleated cells before ultimately enucleating. Both cell types are formed from lineage-committed progenitors that generate a series of morphologically identifiable precursors that enucleate to form mature RBCs. While definitive erythroid precursors mature extravascularly in the fetal liver and postnatal marrow in association with macrophage cells, primitive erythroid precursors mature as a semi-synchronous cohort in the embryonic bloodstream. While the cytoskeletal network is critical for the maintenance of cell shape and the deformability of definitive RBCs, little is known about the components and function of the cytoskeleton in primitive erythroblasts. Erythropoietin (EPO is a critical regulator of late-stage definitive, but not primitive, erythroid progenitor survival. However, recent studies indicate that EPO regulates multiple aspects of terminal maturation of primitive murine and human erythroid precursors, including cell survival, proliferation, and the rate of terminal maturation. Primitive and definitive erythropoiesis share central transcriptional regulators, including Gata1 and Klf1, but are also characterized by the differential expression and function of other regulators, including myb, Sox6, and Bcl11A. Flow cytometry-based methodologies, developed to purify murine and human stage-specific erythroid precursors, have enabled comparative global gene expression studies and are providing new insights into the biology of erythroid maturation.
Bone Marrow Scans with Colloidal {sup 198}Au
Energy Technology Data Exchange (ETDEWEB)
Chang, Sung Soo; Whang, Kee Suk [Kyungpook National University College of Medicine, Daegu (Korea, Republic of)
1973-03-15
The bone marrow scans with colloidal {sup 198}Au were performed on 33 cases with hematologically normal patients and patients with various blood dyscrasia. Bone marrow aspirations were done at iliac crest in all cases but one. A correlation between the scan findings and an erythroid cellularity was evaluated. The following results were obtained. 1) Out of 33 cases, 23 (about 70%) showed a correlation between {sup 198}Au marrow uptakes on the scans and the erythroid cellularity. 2) The diseases in which no correlation existed between {sup 198}Au uptake and erythroid cellularity were aplastic anemia, acute leukemia and chronic myelogenous leukemia.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Directory of Open Access Journals (Sweden)
Olivier Gouin
2017-03-01
Full Text Available ABSTRACT Cutaneous neurogenic inflammation (CNI is inflammation that is induced (or enhanced in the skin by the release of neuropeptides from sensory nerve endings. Clinical manifestations are mainly sensory and vascular disorders such as pruritus and erythema. Transient receptor potential vanilloid 1 and ankyrin 1 (TRPV1 and TRPA1, respectively are non-selective cation channels known to specifically participate in pain and CNI. Both TRPV1 and TRPA1 are co-expressed in a large subset of sensory nerves, where they integrate numerous noxious stimuli. It is now clear that the expression of both channels also extends far beyond the sensory nerves in the skin, occuring also in keratinocytes, mast cells, dendritic cells, and endothelial cells. In these non-neuronal cells, TRPV1 and TRPA1 also act as nociceptive sensors and potentiate the inflammatory process. This review discusses the role of TRPV1 and TRPA1 in the modulation of inflammatory genes that leads to or maintains CNI in sensory neurons and non-neuronal skin cells. In addition, this review provides a summary of current research on the intracellular sensitization pathways of both TRP channels by other endogenous inflammatory mediators that promote the self-maintenance of CNI.
Li, Ji-Yao; Chai, Biao-Xin; Zhang, Weizhen; Wang, Hui; Mulholland, Michael W
2010-01-01
Ankyrin repeat and suppressor of cytokine signaling box-containing protein 4 (Asb-4) is specifically expressed in the energy homeostasis-related brain areas and colocalizes with proopiomelanocortin (POMC) neurons of the arcuate nucleus (ARC). Injection of insulin into the third ventricle of the rat brain increased Asb-4 mRNA expression in the paraventricular nucleus but not in the ARC of the hypothalamus, whereas injection of leptin (ip) increased Asb-4 expression in both mouse paraventricular nucleus and ARC. A transgenic mouse in which Myc-tagged Asb-4 is specifically expressed in POMC neurons of the ARC was made and used to study the effects of Asb-4 on ingestive behavior and metabolic rate. Animals with overexpression of Asb-4 in POMC neurons demonstrated an increase in food intake. However, POMC-Asb-4 transgenic animals gained significantly less weight from 6-30 wk of age. The POMC-Asb-4 mice had reduced fat mass and increased lean mass and lower levels of blood leptin. The transgenic animals were resistant to high-fat diet-induced obesity. Transgenic mice had significantly higher rates of oxygen consumption and carbon dioxide production than wild-type mice during both light and dark periods. The locomotive activity of transgenic mice was increased. The overexpression of Asb-4 in POMC neurons increased POMC mRNA expression in the ARC. The transgenic animals had no observed effect on peripheral glucose metabolism and the activity of the autonomic nervous system. These results indicate that Asb-4 is a key regulatory protein in the central nervous system, involved in the control of feeding behavior and metabolic rate.
Directory of Open Access Journals (Sweden)
Xia Zefeng
2011-09-01
Full Text Available Abstract Background The arcuate nucleus of the hypothalamus regulates food intake. Ankyrin repeat and SOCS box containing protein 4 (Asb-4 is expressed in neuropeptide Y and proopiomelanocortin (POMC neurons in the arcuate nucleus, target neurons in the regulation of food intake and metabolism by insulin and leptin. However, the target protein(s of Asb-4 in these neurons remains unknown. Insulin receptor substrate 4 (IRS4 is an adaptor molecule involved in the signal transduction by both insulin and leptin. In the present study we examined the colocalization and interaction of Asb-4 with IRS4 and the involvement of Asb-4 in insulin signaling. Results In situ hybridization showed that the expression pattern of Asb-4 was consistent with that of IRS4 in the rat brain. Double in situ hybridization showed that IRS4 colocalized with Asb-4, and both Asb-4 and IRS4 mRNA were expressed in proopiomelanocortin (POMC and neuropeptide Y (NPY neurons within the arcuate nucleus of the hypothalamus. In HEK293 cells co-transfected with Myc-tagged Asb-4 and Flag-tagged IRS4, Asb-4 co-immunoprecipitated with IRS4; In these cells endogenous IRS4 also co-immunoprecipitated with transfected Myc-Asb-4; Furthermore, Asb-4 co-immunoprecipitated with IRS4 in rat hypothalamic extracts. In HEK293 cells over expression of Asb-4 decreased IRS4 protein levels and deletion of the SOCS box abolished this effect. Asb-4 increased the ubiquitination of IRS4; Deletion of SOCS box abolished this effect. Expression of Asb-4 decreased both basal and insulin-stimulated phosphorylation of AKT at Thr308. Conclusions These data demonstrated that Asb-4 co-localizes and interacts with IRS4 in hypothalamic neurons. The interaction of Asb-4 with IRS4 in cell lines mediates the degradation of IRS4 and decreases insulin signaling.
Ridge, Justin P; Dodd, Peter R
2009-10-01
Real-time RT-PCR normalized to GAPDH was used to assay N-methyl-D-aspartate (NMDA) receptor NR1, NR2A and NR2B subunit mRNA in human autopsy cortex tissue from chronic alcoholics with and without comorbid cirrhosis of the liver and matched controls. Subunit expression was influenced by the subject's genotype. The TaqIA polymorphism selectively modulated NMDA receptor mean transcript expression in cirrhotic-alcoholic superior frontal cortex, in diametrically opposite ways in male and female subjects. Genetic make-up may differentially influence vulnerability to brain damage by altering the excitation: inhibition balance, particularly in alcoholics with comorbid cirrhosis of the liver. The TaqIA polymorphism occurs within the poorly characterised ankyrin-repeat containing kinase 1 (ANKK1) gene. Using PCR, ANKK1 mRNA transcript was detected in inferior temporal, occipital, superior frontal and primary motor cortex of control human brain. ANKK1 expression may mediate the influence of the TaqIA polymorphism on phenotype.
Structure of the TRPV1 ion channel determined by electron cryo-microscopy.
Liao, Maofu; Cao, Erhu; Julius, David; Cheng, Yifan
2013-12-05
Transient receptor potential (TRP) channels are sensors for a wide range of cellular and environmental signals, but elucidating how these channels respond to physical and chemical stimuli has been hampered by a lack of detailed structural information. Here we exploit advances in electron cryo-microscopy to determine the structure of a mammalian TRP channel, TRPV1, at 3.4 Å resolution, breaking the side-chain resolution barrier for membrane proteins without crystallization. Like voltage-gated channels, TRPV1 exhibits four-fold symmetry around a central ion pathway formed by transmembrane segments 5-6 (S5-S6) and the intervening pore loop, which is flanked by S1-S4 voltage-sensor-like domains. TRPV1 has a wide extracellular 'mouth' with a short selectivity filter. The conserved 'TRP domain' interacts with the S4-S5 linker, consistent with its contribution to allosteric modulation. Subunit organization is facilitated by interactions among cytoplasmic domains, including amino-terminal ankyrin repeats. These observations provide a structural blueprint for understanding unique aspects of TRP channel function.
GIT1 enhances neurite outgrowth by stimulating microtubule assembly
Directory of Open Access Journals (Sweden)
Yi-sheng Li
2016-01-01
Full Text Available GIT1, a G-protein-coupled receptor kinase interacting protein, has been reported to be involved in neurite outgrowth. However, the neurobiological functions of the protein remain unclear. In this study, we found that GIT1 was highly expressed in the nervous system, and its expression was maintained throughout all stages of neuritogenesis in the brain. In primary cultured mouse hippocampal neurons from GIT1 knockout mice, there was a significant reduction in total neurite length per neuron, as well as in the average length of axon-like structures, which could not be prevented by nerve growth factor treatment. Overexpression of GIT1 significantly promoted axon growth and fully rescued the axon outgrowth defect in the primary hippocampal neuron cultures from GIT1 knockout mice. The GIT1 N terminal region, including the ADP ribosylation factor-GTPase activating protein domain, the ankyrin domains and the Spa2 homology domain, were sufficient to enhance axonal extension. Importantly, GIT1 bound to many tubulin proteins and microtubule-associated proteins, and it accelerated microtubule assembly in vitro. Collectively, our findings suggest that GIT1 promotes neurite outgrowth, at least partially by stimulating microtubule assembly. This study provides new insight into the cellular and molecular pathogenesis of GIT1-associated neurological diseases.
Ishida, Atsushi; Ohto, Hitoshi; Yasuda, Hiroyasu; Negishi, Yutaka; Tsuiki, Hideki; Arakawa, Takeshi; Yagi, Yoshihito; Uchimura, Daisuke; Miyazaki, Toru; Ohashi, Wataru; Takamoto, Shigeru
2015-08-01
Hemolytic disease of the newborn (HDN) arising from MNSs incompatibility is rare, with few reports of prolonged anemia and reticulocytopenia following HDN. We report the younger of 2 male siblings, both of whom had anti-M-induced HDN and anemia persisting for over a month. Peripheral reticulocytes remained inappropriately low for the degree of anemia, and they needed multiple red cell transfusions. Viral infections were ruled out. Corticosteroids were given for suspected pure red cell aplasia. Anemia and reticulocytopenia subsequently improved. Colony-forming unit erythroid assay revealed erythropoietic suppression of M antigen-positive erythroid precursor cells cultured with maternal or infant sera containing anti-M. In conclusion, maternal anti-M caused HDN and prolonged anemia by erythropoietic suppression in 2 siblings.
Ma, Y F; Wu, Z H; Gao, M; Loor, J J
2018-03-21
The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2
Structure of the human protein kinase MPSK1 reveals an atypical activation loop architecture.
Eswaran, Jeyanthy; Bernad, Antonio; Ligos, Jose M; Guinea, Barbara; Debreczeni, Judit E; Sobott, Frank; Parker, Sirlester A; Najmanovich, Rafael; Turk, Benjamin E; Knapp, Stefan
2008-01-01
The activation segment of protein kinases is structurally highly conserved and central to regulation of kinase activation. Here we report an atypical activation segment architecture in human MPSK1 comprising a beta sheet and a large alpha-helical insertion. Sequence comparisons suggested that similar activation segments exist in all members of the MPSK1 family and in MAST kinases. The consequence of this nonclassical activation segment on substrate recognition was studied using peptide library screens that revealed a preferred substrate sequence of X-X-P/V/I-phi-H/Y-T*-N/G-X-X-X (phi is an aliphatic residue). In addition, we identified the GTPase DRG1 as an MPSK1 interaction partner and specific substrate. The interaction domain in DRG1 was mapped to the N terminus, leading to recruitment and phosphorylation at Thr100 within the GTPase domain. The presented data reveal an atypical kinase structural motif and suggest a role of MPSK1 regulating DRG1, a GTPase involved in regulation of cellular growth.
Identification of Natural Compound Carnosol as a Novel TRPA1 Receptor Agonist
Directory of Open Access Journals (Sweden)
Chenxi Zhai
2014-11-01
Full Text Available The transient receptor potential ankyrin 1 (TRPA1 cation channel is one of the well-known targets for pain therapy. Herbal medicine is a rich source for new drugs and potentially useful therapeutic agents. To discover novel natural TRPA1 agonists, compounds isolated from Chinese herbs were screened using a cell-based calcium mobilization assay. Out of the 158 natural compounds derived from traditional Chinese herbal medicines, carnosol was identified as a novel agonist of TRPA1 with an EC50 value of 12.46 µM. And the agonistic effect of carnosol on TRPA1 could be blocked by A-967079, a selective TRPA1 antagonist. Furthermore, the specificity of carnosol was verified as it showed no significant effects on two other typical targets of TRP family member: TRPM8 and TRPV3. Carnosol exhibited anti-inflammatory and anti-nociceptive properties; the activation of TRPA1 might be responsible for the modulation of inflammatory nociceptive transmission. Collectively, our findings indicate that carnosol is a new anti-nociceptive agent targeting TRPA1 that can be used to explore further biological role in pain therapy.
Thrombopoietin has a differentiative effect on late-stage human erythropoiesis.
Liu, W; Wang, M; Tang, D C; Ding, I; Rodgers, G P
1999-05-01
To further explore the mechanism of the effect of thrombopoietin (TPO) on erythropoiesis, we used a two-phase culture system to investigate the effect of TPO on late-stage human erythroid lineage differentiation. In serum-free suspension and semisolid cultures of human peripheral blood derived erythroid progenitors, TPO alone did not produce benzidine-positive cells. However, in serum-containing culture, TPO alone stimulated erythroid cell proliferation and differentiation, demonstrated by erythroid colony formation, production of benzidine-positive cells and haemoglobin (Hb) synthesis. Monoclonal anti-human erythropoietin antibody and anti-human erythropoietin receptor antibody completely abrogated the erythroid differentiative ability of TPO in the serum-containing systems. This implied that binding of EPO and EPO-R was essential for erythropoiesis and the resultant signal transduction may be augmented by the signals emanating from TPO-c-Mpl interaction. Experiment of withdrawal of TPO further demonstrated the involvement of TPO in late-stage erythropoiesis. RT-PCR results showed that there was EPO-R but not c-Mpl expression on developing erythroblasts induced by TPO in serum-containing system. Our results establish that TPO affects not only the proliferation of erythroid progenitors but also the differentiation of erythroid progenitors to mature erythroid cells.
LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele
2014-01-01
Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.
Zhu, Xiang-Yu; Liu, Ning; Liu, Wei; Song, Shao-Wei; Guo, Ke-Jian
2012-04-01
Integrin-linked kinase (ILK) is an ankyrin repeat-containing serine-threonine protein kinase that is involved in the regulation of integrin-mediated processes such as cancer cell proliferation, migration and invasion. In this study, we examined the effect of a lentivirus-mediated knockdown of ILK on the proliferation, migration and invasion of pancreatic cancer (Panc-1) cells. Immunohistochemical staining showed that ILK expression was enhanced in pancreatic cancer tissue. The silencing of ILK in human Panc-1 cells led to cell cycle arrest in the G0/G1 phase and delayed cell proliferation, in addition to down-regulating cell migration and invasion. The latter effects were mediated by up-regulating the expression of E-cadherin, a key protein in cell adhesion. These findings indicate that ILK may be a new diagnostic marker for pancreatic cancer and that silencing ILK could be a potentially useful therapeutic approach for treating pancreatic cancer.
Levels of 2,3-diphosphoglycerate in Friend leukaemic cells.
Yeoh, G C
1980-05-08
Most cells are thought to contain trace amounts of 2,3-diphosphoglycerate (DPG), as it acts as a cofactor in the interconversion of 2-phosphoglycerate and 3-phosphoglycerate by the glycolytic enzyme phosphoglyceromutase. DPG is synthesized from 1,3-diphosphoglycerate by the action of diphosphoglycerate mutase. Lowry et al. reported levels of 29 mumol DPG per kg wet weight brain tissue which is approximately 3 pmol per 10(8) cells, assuming that 1 g of brain tissue contains 10(9) cells. In contrast, erythroid cells contain 50-100 nmol DPG per 10(8) cells, depending on the species and the stage of development. This is of the order of a 1,000-fold more DPG compared with non-erythroid cells. In red cells DPG concentration modulates the binding of oxygen to haemoglobin. I show here that erythroid precurser cells also contain markedly raised levels of DPG.
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences. Xiuhong Yang. Articles written in Journal of Biosciences. Volume 33 Issue 1 March 2008 pp 103-112 Articles. Molecular cloning and characterization of a gene encoding RING zinc finger ankyrin protein from drought-tolerant Artemisia desertorum · Xiuhong Yang Chao Sun Yuanlei ...
Directory of Open Access Journals (Sweden)
Jiafei Xi
2013-01-01
Full Text Available In vitro models of human erythropoiesis are useful in studying the mechanisms of erythroid differentiation in normal and pathological conditions. Here we describe an erythroid liquid culture system starting from cord blood derived hematopoietic stem cells (HSCs. HSCs were cultured for more than 50 days in erythroid differentiation conditions and resulted in a more than 109-fold expansion within 50 days under optimal conditions. Homogeneous erythroid cells were characterized by cell morphology, flow cytometry, and hematopoietic colony assays. Furthermore, terminal erythroid maturation was improved by cosculturing with human fetal liver stromal cells. Cocultured erythroid cells underwent multiple maturation events, including decrease in size, increase in glycophorin A expression, and nuclear condensation. This process resulted in extrusion of the pycnotic nuclei in up to 80% of the cells. Importantly, they possessed the capacity to express the adult definitive β-globin chain upon further maturation. We also show that the oxygen equilibrium curves of the cord blood-differentiated red blood cells (RBCs are comparable to normal RBCs. The large number and purity of erythroid cells and RBCs produced from cord blood make this method useful for fundamental research in erythroid development, and they also provide a basis for future production of available RBCs for transfusion.
Erythropoiesis in the aged mouse. I. Response to stimulation in vivo
International Nuclear Information System (INIS)
Udupa, K.B.; Lipschitz, D.A.
1984-01-01
Changes in erythropoiesis with age were studied by examining the hematocrit increase in response to hypoxia in aged mice and by assessing the change in erythropoiesis following the injection of erythropoietin in young and old polycythemic mice. The increase in hematocrit after exposure to hypoxia was more variable and generally lower in old mice than in young mice. When erythropoietin was injected into polycythemic animals, the increase in differentiated erythroid cells and 59 Fe incorporation into erythroid marrow and peripheral blood cells was significantly lower in old mice than in young mice. In contrast to differentiated erythroid cells, there was less evidence of a reduced response to simulation of the more primitive erythroid progenitor cells of aged animals. The early undifferentiated erythroid progenitor, burst-forming units, did not decrease when either young or aged mice were made polycythemic, and no change following erythropoietin injection was noted. Polycythemia suppressed the late-differentiated erythroid progenitor, erythroid colony-forming units, to a greater extent in aged animals, but when erythropoietin was injected, the percent increase over the subsequent 24 hours was identical to that in young mice. These observations indicate a reduced erythropoietic capacity with age, the abnormality being most obvious in the more mature erythroid precursors
Heme and erythropoieis: more than a structural role.
Chiabrando, Deborah; Mercurio, Sonia; Tolosano, Emanuela
2014-06-01
Erythropoiesis is the biological process that consumes the highest amount of body iron for heme synthesis. Heme synthesis in erythroid cells is finely coordinated with that of alpha (α) and beta (β)-globin, resulting in the production of hemoglobin, a tetramer of 2α- and 2β-globin chains, and heme as the prosthetic group. Heme is not only the structural component of hemoglobin, but it plays multiple regulatory roles during the differentiation of erythroid precursors since it controls its own synthesis and regulates the expression of several erythroid-specific genes. Heme is synthesized in developing erythroid progenitors by the stage of proerythroblast, through a series of eight enzymatic reactions divided between mitochondria and cytosol. Defects of heme synthesis in the erythroid lineage result in sideroblastic anemias, characterized by microcytic anemia associated to mitochondrial iron overload, or in erythropoietic porphyrias, characterized by porphyrin deposition in erythroid cells. Here, we focus on the heme biosynthetic pathway and on human erythroid disorders due to defective heme synthesis. The regulatory role of heme during erythroid differentiation is discussed as well as the heme-mediated regulatory mechanisms that allow the orchestration of the adaptive cell response to heme deficiency. Copyright© Ferrata Storti Foundation.
Coordinate expression of heme and globin is essential for effective erythropoiesis.
Doty, Raymond T; Phelps, Susan R; Shadle, Christina; Sanchez-Bonilla, Marilyn; Keel, Siobán B; Abkowitz, Janis L
2015-12-01
Erythropoiesis requires rapid and extensive hemoglobin production. Heme activates globin transcription and translation; therefore, heme synthesis must precede globin synthesis. As free heme is a potent inducer of oxidative damage, its levels within cellular compartments require stringent regulation. Mice lacking the heme exporter FLVCR1 have a severe macrocytic anemia; however, the mechanisms that underlie erythropoiesis dysfunction in these animals are unclear. Here, we determined that erythropoiesis failure occurs in these animals at the CFU-E/proerythroblast stage, a point at which the transferrin receptor (CD71) is upregulated, iron is imported, and heme is synthesized--before ample globin is produced. From the CFU-E/proerythroblast (CD71(+) Ter119(-) cells) stage onward, erythroid progenitors exhibited excess heme content, increased cytoplasmic ROS, and increased apoptosis. Reducing heme synthesis in FLVCR1-defient animals via genetic and biochemical approaches improved the anemia, implying that heme excess causes, and is not just associated with, the erythroid marrow failure. Expression of the cell surface FLVCR1 isoform, but not the mitochondrial FLVCR1 isoform, restored normal rbc production, demonstrating that cellular heme export is essential. Together, these studies provide insight into how heme is regulated to allow effective erythropoiesis, show that erythropoiesis fails when heme is excessive, and emphasize the importance of evaluating Ter119(-) erythroid cells when studying erythroid marrow failure in murine models.
Directory of Open Access Journals (Sweden)
Maheswara Reddy Emani
2015-03-01
Full Text Available The RNA-binding protein L1TD1 is one of the most specific and abundant proteins in pluripotent stem cells and is essential for the maintenance of pluripotency in human cells. Here, we identify the protein interaction network of L1TD1 in human embryonic stem cells (hESCs and provide insights into the interactome network constructed in human pluripotent cells. Our data reveal that L1TD1 has an important role in RNA splicing, translation, protein traffic, and degradation. L1TD1 interacts with multiple stem-cell-specific proteins, many of which are still uncharacterized in the context of development. Further, we show that L1TD1 is a part of the pluripotency interactome network of OCT4, SOX2, and NANOG, bridging nuclear and cytoplasmic regulation and highlighting the importance of RNA biology in pluripotency.
Witschas, Katja; Jobin, Marie-Lise; Korkut, Dursun Nizam; Vladan, Maria Magdalena; Salgado, Gilmar; Lecomte, Sophie; Vlachova, Viktorie; Alves, Isabel D
2015-05-01
The transient receptor potential ankyrin 1 channel (TRPA1) belongs to the TRP cation channel superfamily that responds to a panoply of stimuli such as changes in temperature, calcium levels, reactive oxygen and nitrogen species and lipid mediators among others. The TRP superfamily has been implicated in diverse pathological states including neurodegenerative disorders, kidney diseases, inflammation, pain and cancer. The intracellular C-terminus is an important regulator of TRP channel activity. Studies with this and other TRP superfamily members have shown that the C-terminus association with lipid bilayer alters channel sensitivity and activation, especially interactions occurring through basic residues. Nevertheless, it is not yet clear how this process takes place and which regions in the C-terminus would be responsible for such membrane recognition. With that in mind, herein the first putative membrane interacting region of the C-terminus of human TRPA1, (corresponding to a 29 residue peptide, IAEVQKHASLKRIAMQVELHTSLEKKLPL) named H1 due to its potential helical character was chosen for studies of membrane interaction. The affinity of H1 to lipid membranes, H1 structural changes occurring upon this interaction as well as effects of this interaction in lipid organization and integrity were investigated using a biophysical approach. Lipid models systems composed of zwitterionic and anionic lipids, namely those present in the lipid membrane inner leaflet, where H1 is prone to interact, where used. The study reveals a strong interaction and affinity of H1 as well as peptide structuration especially with membranes containing anionic lipids. Moreover, the interactions and peptide structure adoption are headgroup specific. Copyright © 2015 Elsevier B.V. All rights reserved.
Phase 1 Study of a Sulforaphane-Containing Broccoli Sprout Homogenate for Sickle Cell Disease.
Directory of Open Access Journals (Sweden)
Jennifer F Doss
Full Text Available Sickle cell disease (SCD is the most common inherited hemoglobinopathy worldwide. Our previous results indicate that the reduced oxidative stress capacity of sickle erythrocytes may be caused by decreased expression of NRF2 (Nuclear factor (erythroid-derived 2-like 2, an oxidative stress regulator. We found that activation of NRF2 with sulforaphane (SFN in erythroid progenitors significantly increased the expression of NRF2 targets HMOX1, NQO1, and HBG1 (subunit of fetal hemoglobin in a dose-dependent manner. Therefore, we hypothesized that NRF2 activation with SFN may offer therapeutic benefits for SCD patients by restoring oxidative capacity and increasing fetal hemoglobin concentration. To test this hypothesis, we performed a Phase 1, open-label, dose-escalation study of SFN, contained in a broccoli sprout homogenate (BSH that naturally contains SFN, in adults with SCD. The primary and secondary study endpoints were safety and physiological response to NRF2 activation, respectively. We found that BSH was well tolerated, and the few adverse events that occurred during the trial were not likely related to BSH consumption. We observed an increase in the mean relative whole blood mRNA levels for the NRF2 target HMOX1 (p = 0.02 on the last day of BSH treatment, compared to pre-treatment. We also observed a trend toward increased mean relative mRNA levels of the NRF2 target HBG1 (p = 0.10 from baseline to end of treatment, but without significant changes in HbF protein. We conclude that BSH, in the provided doses, is safe in stable SCD patients and may induce changes in gene expression levels. We therefore propose investigation of more potent NRF2 inducers, which may elicit more robust physiological changes and offer clinical benefits to SCD patients. Trial registration: ClinicalTrials.gov NCT01715480.
Polylox barcoding reveals haematopoietic stem cell fates realized in vivo.
Pei, Weike; Feyerabend, Thorsten B; Rössler, Jens; Wang, Xi; Postrach, Daniel; Busch, Katrin; Rode, Immanuel; Klapproth, Kay; Dietlein, Nikolaus; Quedenau, Claudia; Chen, Wei; Sauer, Sascha; Wolf, Stephan; Höfer, Thomas; Rodewald, Hans-Reimer
2017-08-24
Developmental deconvolution of complex organs and tissues at the level of individual cells remains challenging. Non-invasive genetic fate mapping has been widely used, but the low number of distinct fluorescent marker proteins limits its resolution. Much higher numbers of cell markers have been generated using viral integration sites, viral barcodes, and strategies based on transposons and CRISPR-Cas9 genome editing; however, temporal and tissue-specific induction of barcodes in situ has not been achieved. Here we report the development of an artificial DNA recombination locus (termed Polylox) that enables broadly applicable endogenous barcoding based on the Cre-loxP recombination system. Polylox recombination in situ reaches a practical diversity of several hundred thousand barcodes, allowing tagging of single cells. We have used this experimental system, combined with fate mapping, to assess haematopoietic stem cell (HSC) fates in vivo. Classical models of haematopoietic lineage specification assume a tree with few major branches. More recently, driven in part by the development of more efficient single-cell assays and improved transplantation efficiencies, different models have been proposed, in which unilineage priming may occur in mice and humans at the level of HSCs. We have introduced barcodes into HSC progenitors in embryonic mice, and found that the adult HSC compartment is a mosaic of embryo-derived HSC clones, some of which are unexpectedly large. Most HSC clones gave rise to multilineage or oligolineage fates, arguing against unilineage priming, and suggesting coherent usage of the potential of cells in a clone. The spreading of barcodes, both after induction in embryos and in adult mice, revealed a basic split between common myeloid-erythroid development and common lymphocyte development, supporting the long-held but contested view of a tree-like haematopoietic structure.
Liao, Wei-Ju; Tsao, Ku-Chi; Yang, Ruey-Bing
2016-03-01
SCUBE1 (S1), a secreted and membrane-bound glycoprotein, has a modular protein structure composed of an N-terminal signal peptide sequence followed by nine epidermal growth factor (EGF)-like repeats, a spacer region and three cysteine-rich (CR) motifs with multiple potential N-linked glycosylation sites, and one CUB domain at the C-terminus. Soluble S1 is a biomarker of platelet activation but an active participant of thrombosis via its adhesive EGF-like repeats, whereas its membrane-associated form acts as a bone morphogenetic protein (BMP) co-receptor in promoting BMP signal activity. However, the mechanism responsible for the membrane tethering and the biological importance of N-glycosylation of S1 remain largely unknown. In the present study, molecular mapping analysis identified a polycationic segment (amino acids 501-550) in the spacer region required for its membrane tethering via electrostatic interactions possibly with the anionic heparan sulfate proteoglycans. Furthermore, deglycosylation by peptide N-glycosidase F treatment revealed that N-glycans within the CR motif are essential for membrane recruitment through lectin-mediated surface retention. Injection of mRNA encoding zebrafish wild-type but not N-glycan-deficient scube1 restores the expression of haematopoietic and erythroid markers (scl and gata1) in scube1-knockdown embryos. We describe novel mechanisms in targeting S1 to the plasma membrane and demonstrate that N-glycans are required for S1 functions during primitive haematopoiesis in zebrafish. © 2016 Authors; published by Portland Press Limited.
Energy Technology Data Exchange (ETDEWEB)
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D. (Scripps)
2012-03-27
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.
DEFF Research Database (Denmark)
Chondrou, Vasiliki; Kolovos, Petros; Sgourou, Argyro
2017-01-01
from whole transcriptome analysis of erythroid cells, isolated from erythroid tissues at various developmental stages in an effort to identify distinct molecular signatures of each erythroid tissue. Results: From our in-depth data analysis, pathway analysis, and text mining, we opted to focus...
Straub, Rainer H
2014-09-01
Chronic inflammatory diseases are accompanied by a systemic response of the body, necessary to redirect energy-rich fuels to the activated immune system and to induce volume expansion. The systemic response is switched on by two major pathways: (a) circulating cytokines enter the brain, and (b) signals via sensory nerve fibers are transmitted to the brain. Concerning item b, sensory nerve terminals are equipped with a multitude of receptors that sense temperature, inflammation, osmolality, and pain. Thus, they can be important to inform the brain about peripheral inflammation. Central to these sensory modalities are transient receptor potential channels (TRP channels) on sensory nerve endings. For example, TRP vanilloid 1 (TRPV1) can be activated by heat, inflammatory factors (e.g., protons, bradykinin, anandamide), hyperosmolality, pungent irritants, and others. TRP channels are multimodal switches that transmit peripheral signals to the brain, thereby inducing a systemic response. It is demonstrated how and why these TRP channels (TRPV1, TRP ankyrin type 1 (TRPA1), and TRP melastatin type 8 (TRPM8)) are important to start up a systemic response of energy expenditure, energy allocation, and water retention and how this is linked to a continuously activated immune system in chronic inflammatory diseases.
Directory of Open Access Journals (Sweden)
Kei Kohno
Full Text Available Erythroid abnormalities including anemia and polycythemia are often observed in the general clinical setting. Because recent studies reported that adiponectin negatively affects hematopoiesis, we performed a prospective observational study to assess the relationship between anemia and adiponectin, as well as other parameters, in 1029 Japanese subjects (477 men and 552 women 40 years of age and older. Body measurements, blood tests, and nutrition intake studies were performed at baseline, and 5 to 7 years later (follow-up. Hemoglobin (Hb and hematocrit (Hct levels in men with high serum adiponectin levels were lower at follow-up than at baseline. Multiple regression analysis showed that age, body mass index, adiponectin, and glutamic-pyruvic transaminase were significantly associated with erythroid-related variables (red blood cells, Hb, and Hct in both men and women (P <0.05. In a logistic regression analysis, adiponectin, fasting blood glucose, and β-natriuretic peptide were significant risk factors for anemia in men, and blood urea nitrogen and amylase were significant risk factors in women. Physical features and nutrient intake were not risk factors for anemia. Our study demonstrates, both clinically and epidemiologically, that a high serum adiponectin level decreases the amounts of erythroid-related variables and is a risk factor for anemia in Japanese men.
Directory of Open Access Journals (Sweden)
Annalisa LoGerfo
2014-01-01
Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.
Directory of Open Access Journals (Sweden)
Xiang-Yu Zhu
2012-01-01
Full Text Available Integrin-linked kinase (ILK is an ankyrin repeat-containing serine-threonine protein kinase that is involved in the regulation of integrin-mediated processes such as cancer cell proliferation, migration and invasion. In this study, we examined the effect of a lentivirus-mediated knockdown of ILK on the proliferation, migration and invasion of pancreatic cancer (Panc-1 cells. Immunohistochemical staining showed that ILK expression was enhanced in pancreatic cancer tissue. The silencing of ILK in human Panc-1 cells led to cell cycle arrest in the G0/G1 phase and delayed cell proliferation, in addition to down-regulating cell migration and invasion. The latter effects were mediated by up-regulating the expression of E-cadherin, a key protein in cell adhesion. These findings indicate that ILK may be a new diagnostic marker for pancreatic cancer and that silencing ILK could be a potentially useful therapeutic approach for treating pancreatic cancer.
Directory of Open Access Journals (Sweden)
Tada T
2016-09-01
Full Text Available Tomoki Tada,1 Kensaku Aki,2 Wataru Oboshi,1,3 Kazuyoshi Kawazoe,4 Toshiyuki Yasui,5 Eiji Hosoi2 1Subdivision of Biomedical Laboratory Sciences, Graduate School of Health Sciences, Tokushima University, 2Department of Cells and Immunity Analytics, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, 3Department of Medical Technology, Kagawa Prefectural University of Health Sciences, Kagawa, 4Department of Clinical Pharmacy Practice Pedagogy, Institute of Biomedical Sciences, 5Department of Reproductive and Menopausal Medicine, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, Japan Background: The hyperfunction and activation of platelets have been strongly implicated in the development and recurrence of arterial occlusive disease, and various antiplatelet drugs are used to treat and prevent such diseases. New antiplatelet drugs and many other drugs have been developed, but some drugs may have adverse effects on platelet functions. Objective: The aim of this study was to establish an evaluation method for evaluating the effect and adverse effect of various drugs on platelet functions. Materials and methods: Human erythroid leukemia (HEL cells were used after megakaryocytic differentiation with phorbol 12-myristate 13-acetate as an alternative to platelets. Drugs were evaluated by changes in intracellular Ca2+ concentration ([Ca2+]i mobilization in Fura2-loaded phorbol 12-myristate 13-acetate-induced HEL cells. Aspirin and cilostazol were selected as antiplatelet drugs and ibuprofen and sodium valproate as other drugs. Results: There was a positive correlation between [Ca2+]i and platelet aggregation induced by thrombin. Aspirin (5.6–560 µM and cilostazol (5–10 µM significantly inhibited thrombin-induced increases in [Ca2+]i in a concentration-dependent manner. On the other hand, ibuprofen (8–200 µM and sodium valproate (50–1,000 µg/mL also significantly inhibited
Unfolding of core nucleosomes by PARP-1 revealed by spFRET microscopy
Directory of Open Access Journals (Sweden)
Daniel Sultanov
2017-01-01
Full Text Available DNA accessibility to various protein complexes is essential for various processes in the cell and is affected by nucleosome structure and dynamics. Protein factor PARP-1 (poly(ADP-ribose polymerase 1 increases the accessibility of DNA in chromatin to repair proteins and transcriptional machinery, but the mechanism and extent of this chromatin reorganization are unknown. Here we report on the effects of PARP-1 on single nucleosomes revealed by spFRET (single-particle Förster Resonance Energy Transfer microscopy. PARP-1 binding to a double-strand break in the vicinity of a nucleosome results in a significant increase of the distance between the adjacent gyres of nucleosomal DNA. This partial uncoiling of the entire nucleosomal DNA occurs without apparent loss of histones and is reversed after poly(ADP-ribosylation of PARP-1. Thus PARP-1-nucleosome interactions result in reversible, partial uncoiling of the entire nucleosomal DNA.
Directory of Open Access Journals (Sweden)
Katherine J Zappia
Full Text Available Keratinocytes are the first cells that come into direct contact with external tactile stimuli; however, their role in touch transduction in vivo is not clear. The ion channel Transient Receptor Potential Ankyrin 1 (TRPA1 is essential for some mechanically-gated currents in sensory neurons, amplifies mechanical responses after inflammation, and has been reported to be expressed in human and mouse skin. Other reports have not detected Trpa1 mRNA transcripts in human or mouse epidermis. Therefore, we set out to determine whether selective deletion of Trpa1 from keratinocytes would impact mechanosensation. We generated K14Cre-Trpa1fl/fl mice lacking TRPA1 in K14-expressing cells, including keratinocytes. Surprisingly, Trpa1 transcripts were very poorly detected in epidermis of these mice or in controls, and detection was minimal enough to preclude observation of Trpa1 mRNA knockdown in the K14Cre-Trpa1fl/fl mice. Unexpectedly, these K14Cre-Trpa1fl/fl mice nonetheless exhibited a pronounced deficit in mechanosensitivity at the behavioral and primary afferent levels, and decreased mechanically-evoked ATP release from skin. Overall, while these data suggest that the intended targeted deletion of Trpa1 from keratin 14-expressing cells of the epidermis induces functional deficits in mechanotransduction and ATP release, these deficits are in fact likely due to factors other than reduction of Trpa1 expression in adult mouse keratinocytes because they express very little, if any, Trpa1.
Directory of Open Access Journals (Sweden)
Tamotsu Irino
Full Text Available Myeloproliferative neoplasms (MPN are multiple disease entities characterized by clonal expansion of one or more of the myeloid lineages (i.e. granulocytic, erythroid, megakaryocytic and mast cell. JAK2 mutations, such as the common V617F substitution and the less common exon 12 mutations, are frequently detected in such tumor cells and have been incorporated into the diagnostic criteria published by the World Health Organization since 2008. However, the mechanism by which these mutations contribute to MPN development is poorly understood. We examined gene expression profiles of MPN patients focusing on genes in the JAK-STAT signaling pathway using low-density real-time PCR arrays. We identified the following 2 upregulated genes in MPN patients: a known target of the JAK-STAT axis, SOCS3, and a potentially novel target, SPI1, encoding PU.1. Induction of PU.1 expression by JAK2 V617F in JAK2-wildtype K562 cells and its downregulation by JAK2 siRNA transfection in JAK2 V617F-positive HEL cells supported this possibility. We also found that the ABL1 kinase inhibitor imatinib was very effective in suppressing PU.1 expression in BCR-ABL1-positive K562 cells but not in HEL cells. This suggests that PU.1 expression is regulated by both JAK2 and ABL1. The contribution of the two kinases in driving PU.1 expression was dominant for JAK2 and ABL1 in HEL and K562 cells, respectively. Therefore, PU.1 may be a common transcription factor upregulated in MPN. PU.1 is a transcription factor required for myeloid differentiation and is implicated in erythroid leukemia. Therefore, expression of PU.1 downstream of activated JAK2 may explain why JAK2 mutations are frequently observed in MPN patients.
The Receptor-Binding Domain in the VP1u Region of Parvovirus B19.
Leisi, Remo; Di Tommaso, Chiarina; Kempf, Christoph; Ros, Carlos
2016-02-24
Parvovirus B19 (B19V) is known as the human pathogen causing the mild childhood disease erythema infectiosum. B19V shows an extraordinary narrow tissue tropism for erythroid progenitor cells in the bone marrow, which is determined by a highly restricted uptake. We have previously shown that the specific internalization is mediated by the interaction of the viral protein 1 unique region (VP1u) with a yet unknown cellular receptor. To locate the receptor-binding domain (RBD) within the VP1u, we analyzed the effect of truncations and mutations on the internalization capacity of the recombinant protein into UT7/Epo cells. Here we report that the N-terminal amino acids 5-80 of the VP1u are necessary and sufficient for cellular binding and internalization; thus, this N-terminal region represents the RBD required for B19V uptake. Using site-directed mutagenesis, we further identified a cluster of important amino acids playing a critical role in VP1u internalization. In silico predictions and experimental results suggest that the RBD is structured as a rigid fold of three α-helices. Finally, we found that dimerization of the VP1u leads to a considerably enhanced cellular binding and internalization. Taken together, we identified the RBD that mediates B19V uptake and mapped functional and structural motifs within this sequence. The findings reveal insights into the uptake process of B19V, which contribute to understand the pathogenesis of the infection and the neutralization of the virus by the immune system.
The 1-Tosylpentan-3-one Protects against 6-Hydroxydopamine-Induced Neurotoxicity
Directory of Open Access Journals (Sweden)
Chien-Jen Kao
2017-05-01
Full Text Available Previous studies have demonstrated that the marine compound austrasulfone, isolated from the soft coral Cladiella australis, exerts a neuroprotective effect. The intermediate product in the synthesis of austrasulfone, dihydroaustrasulfone alcohol, attenuates several inflammatory responses. The present study uses in vitro and in vivo methods to investigate the neuroprotective effect of dihydroaustrasulfone alcohol-modified 1-tosylpentan-3-one (1T3O. Results from in vitro experiments show that 1T3O effectively inhibits 6-hydroxydopamine-induced (6-OHDA-induced activation of both p38 mitogen-activated protein kinase (MAPK and caspase-3 in SH-SY5Y cells; and enhances nuclear factor erythroid 2–related factor 2 (Nrf2 and heme oxygenase-1 (HO-1 expression via phosphoinositide 3-kinase (PI3K/protein kinase B (Akt signaling. Hoechst staining and Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL staining results reveal that 1T3O significantly inhibits 6-OHDA-induced apoptosis. In addition, the addition of an Akt or HO-1 inhibitor decreases the protective effect of 1T3O. Thus, we hypothesize that the anti-apoptotic activity of 1T3O in neuronal cells is mediated through the regulation of the Akt and HO-1 signaling pathways. In vivo experiments show that 1T3O can reverse 6-OHDA-induced reduction in locomotor behavior ability in zebrafish larvae, and inhibit 6-OHDA-induced tumor necrosis factor-alpha (TNF-α increase at the same time. According to our in vitro and in vivo results, we consider that 1T3O exerts its anti-apoptotic activities at SH-SY5Y cells after 6-OHDA challenges, probably via the regulation of anti-oxidative signaling pathways. Therefore, this compound may be a promising therapeutic agent for neurodegenerations.
Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y
2016-04-01
The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Mondal, Nandan Kumar; Saha, Hirak; Mukherjee, Bidisha; Tyagi, Neetu; Ray, Manas Ranjan
2018-01-24
The study was carried out to examine whether chronic exposure to smoke during daily household cooking with biomass fuel (BMF) elicits changes in airway cytology and expressions of Nrf2 (nuclear factor erythroid 2 [NF-E2]-related factor 2 [Nrf2]), Keap1 (Kelch-like erythroid-cell-derived protein with CNC homology [ECH]-associated protein 1), and NQO1 (NAD(P)H:quinone oxidoreductase 1) proteins in the airways. For this, 282 BMF-using women (median age 34 year) and 236 age-matched women who cooked with liquefied petroleum gas (LPG) were enrolled. Particulate matter with diameters of LPG. Compared with LPG users, BMF users had 32% more leukocytes in circulation and their sputa were 1.4-times more cellular with significant increase in absolute number of neutrophils, lymphocytes, eosinophils, and alveolar macrophages, suggesting airway inflammation. ROS generation was 1.5-times higher in blood neutrophils and 34% higher in sputum cells of BMF users while erythrocyte SOD was 31% lower and plasma catalase was relatively unchanged, suggesting oxidative stress. In BMF users, Keap1 expression was reduced, the percentage of AEC with nuclear expression of Nrf2 was two- to three-times more, and NQO1 level in sputum cell lysate was two-times higher than that of LPG users. In conclusion, cooking with BMF was associated with Nrf2 activation and elevated NQO1 protein level in the airways. The changes may be adaptive cellular response to counteract biomass smoke-elicited oxidative stress and inflammation-related tissue injury in the airways.
Activation of the chemosensing transient receptor potential channel A1 (TRPA1) by alkylating agents.
Stenger, Bernhard; Zehfuss, Franziska; Mückter, Harald; Schmidt, Annette; Balszuweit, Frank; Schäfer, Eva; Büch, Thomas; Gudermann, Thomas; Thiermann, Horst; Steinritz, Dirk
2015-09-01
The transient receptor potential ankyrin 1 (TRPA1) cation channel is expressed in different tissues including skin, lung and neuronal tissue. Recent reports identified TRPA1 as a sensor for noxious substances, implicating a functional role in the molecular toxicology. TRPA1 is activated by various potentially harmful electrophilic substances. The chemical warfare agent sulfur mustard (SM) is a highly reactive alkylating agent that binds to numerous biological targets. Although SM is known for almost 200 years, detailed knowledge about the pathophysiology resulting from exposure is lacking. A specific therapy is not available. In this study, we investigated whether the alkylating agent 2-chloroethyl-ethylsulfide (CEES, a model substance for SM-promoted effects) and SM are able to activate TRPA1 channels. CEES induced a marked increase in the intracellular calcium concentration ([Ca(2+)]i) in TRPA1-expressing but not in TRPA1-negative cells. The TRP-channel blocker AP18 diminished the CEES-induced calcium influx. HEK293 cells permanently expressing TRPA1 were more sensitive toward cytotoxic effects of CEES compared with wild-type cells. At low CEES concentrations, CEES-induced cytotoxicity was prevented by AP18. Proof-of-concept experiments using SM resulted in a pronounced increase in [Ca(2+)]i in HEK293-A1-E cells. Human A549 lung epithelial cells, which express TRPA1 endogenously, reacted with a transient calcium influx in response to CEES exposure. The CEES-dependent calcium response was diminished by AP18. In summary, our results demonstrate that alkylating agents are able to activate TRPA1. Inhibition of TRPA1 counteracted cellular toxicity and could thus represent a feasible approach to mitigate SM-induced cell damage.
OPD4-positive T-cell lymphoma of the liver in systemic lupus erythematosus.
Tsutsumi, Y; Deng, Y L; Uchiyama, M; Kawano, K; Ikeda, Y
1991-11-01
Primary malignant lymphoma of the liver occupying the right lobe, 14 x 9 x 7 cm in size, developed in a 30-year-old man with a 4-year history of autoimmune hemolytic anemia. The diagnosis of systemic lupus erythematosus (SLE) accompanying thrombocytopenia had been made clinically 10 months earlier. The liver biopsy specimen revealed diffuse proliferation of large lymphoma cells expressing the activated helper/inducer T-cell phenotype (LCA+, UCHL1+, OPD4+, LN3+, MT1-, L26-, MB1-, Leu M1-, Ki-1-, KP1-). The lymphoma was successfully treated by chemotherapy and irradiation. Intractable thrombocytopenia provoked fatal esophageal hemorrhage. At autopsy, no lymphomatous lesion was identified, and the hepatic right lobe contained an encapsulated necrotic lesion without any viable tumor cells. The bone marrow revealed marked hyperplasia of erythroid and megakaryocytic series. Extramedullary hematopoiesis was demonstrated in the liver, spleen and lymph nodes. This is the second case of primary hepatic T-cell lymphoma associated with SLE.
Directory of Open Access Journals (Sweden)
Guangda Peng
2016-10-01
Full Text Available The transient receptor potential cation channel, subfamily A, member 1 (TRPA1 is conserved between many arthropods, and in some has been shown to function as a chemosensor for noxious compounds. Activation of arthropod TRPA1 channels by temperature fluctuations has been tested in only a few insect species, and all of them were shown to be activated by heat. The recent identification of chemosensitive TRPA1 channels from two honey bee ectoparasitic mite species (VdTRPA1 and TmTRPA1 have provided an opportunity to study the temperature-dependent activation and the temperature-associated physiological functions of TRPA1 channels in non-insect arthropods. We found that both mite TRPA1 channels are heat sensitive and capable of rescuing the temperature-related behavioral defects of a Drosophila melanogaster trpA1 mutant. These results suggest that heat-sensitivity of TRPA1 could be conserved between many arthropods despite its amino acid sequence diversity. Nevertheless, the ankyrin repeats (ARs 6 and 7 are well-conserved between six heat-sensitive arthropod TRPA1 channels and have critical roles for the heat activation of VdTRPA1.
Macrophages support splenic erythropoiesis in 4T1 tumor-bearing mice.
Directory of Open Access Journals (Sweden)
Min Liu
Full Text Available Anemia is a common complication of cancer; a role of spleen in tumor-stress erythropoiesis has been suggested. However, the molecular mechanisms involved in the splenic erythropoiesis following tumor maintenance remain poorly understood. Here we show that tumor development blocks medullar erythropoiesis by granulocyte colony-stimulating factor (G-CSF and then causes anemia in murine 4T1 breast tumor-bearing mice. Meanwhile, tumor-stress promotes splenic erythropoiesis. Splenectomy worsened tumor-induced anemia, and reduced tumor volume and tumor weight, indicating the essential role of spleen in tumor-stress erythropoiesis and tumor growth. Tumor progression of these mice led to increased amounts of bone morphogenetic protein 4 (BMP4 in spleen. The in vivo role of macrophages in splenic erythropoiesis under tumor-stress conditions was investigated. Macrophage depletion by injecting liposomal clodronate decreased the expression of BMP4, inhibited splenic erythropoiesis, aggravated the tumor-induced anemia and suppressed tumor growth. Our results provide insight that macrophages and BMP4 are positive regulators of splenic erythropoiesis in tumor pathological situations. These findings reveal that during the tumor-stress period, the microenvironment of the spleen is undergoing changes, which contributes to adopt a stress erythropoietic fate and supports the expansion and differentiation of stress erythroid progenitors, thereby replenishing red blood cells and promoting tumor growth.
Blocking TRPA1 in Respiratory Disorders: Does It Hold a Promise?
Directory of Open Access Journals (Sweden)
Indranil Mukhopadhyay
2016-11-01
Full Text Available Transient Receptor Potential Ankyrin 1 (TRPA1 ion channel is expressed abundantly on the C fibers that innervate almost entire respiratory tract starting from oral cavity and oropharynx, conducting airways in the trachea, bronchi, terminal bronchioles, respiratory bronchioles and upto alveolar ducts and alveoli. Functional presence of TRPA1 on non-neuronal cells got recognized recently. TRPA1 plays a well-recognized role of “chemosensor”, detecting presence of exogenous irritants and endogenous pro-inflammatory mediators that are implicated in airway inflammation and sensory symptoms like chronic cough, asthma, chronic obstructive pulmonary disease (COPD, allergic rhinitis and cystic fibrosis. TRPA1 can remain activated chronically due to elevated levels and continued presence of such endogenous ligands and pro-inflammatory mediators. Several selective TRPA1 antagonists have been tested in animal models of respiratory disease and their performance is very promising. Although there is no TRPA1 antagonist in advanced clinical trials or approved on market yet to treat respiratory diseases, however, limited but promising evidences available so far indicate likelihood that targeting TRPA1 may present a new therapy in treatment of respiratory diseases in near future. This review will focus on in vitro, animal and human evidences that strengthen the proposed role of TRPA1 in modulation of specific airway sensory responses and also on preclinical and clinical progress of selected TRPA1 antagonists.
Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V
2017-07-11
In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing
Wang, Lina; Cao, Chenxing; Zheng, Shuangshuang; Zhang, Haiyang; Liu, Panjing; Ge, Qian; Li, Jinrui; Ren, Zhonghai
2017-06-07
Fruit size is an important quality trait in different market classes of Cucumis sativus L., an economically important vegetable cultivated worldwide, but the genetic and molecular mechanisms that control fruit size are largely unknown. In this study, we isolated a natural cucumber mutant, short fruit 1 (sf1), caused by a single recessive Mendelian factor, from the North China-type inbred line CNS2. In addition to significantly decreased fruit length, other fruit-related phenotypic variations were also observed in sf1 compared to the wild-type (WT) phenotype, indicating that sf1 might have pleiotropic effects. Microscopic imaging showed that fruit cell size in sf1 was much larger than that in WT, suggesting that the short fruit phenotype in sf1 is caused by decreased cell number. Fine mapping revealed that sf1 was localized to a 174.3 kb region on chromosome 6. Similarly, SNP association analysis of bulked segregant RNA-Seq data showed increased SNP frequency in the same region of chromosome 6. In addition, transcriptomic analysis revealed that sf1 might control fruit length through the fine-tuning of cytokinin and auxin signalling, gibberellin biosynthesis and signal transduction in cucumber fruits. Overall, our results provide important information for further study of fruit length and other fruit-related features in cucumber.
Human parvovirus B19 VP1u Protein as inflammatory mediators induces liver injury in naïve mice.
Hsu, Tsai-Ching; Chiu, Chun-Ching; Chang, Shun-Chih; Chan, Hsu-Chin; Shi, Ya-Fang; Chen, Tzy-Yen; Tzang, Bor-Show
2016-01-01
Human parvovirus B19 (B19V) is a human pathogen known to be associated with many non-erythroid diseases, including hepatitis. Although B19V VP1-unique region (B19-VP1u) has crucial roles in the pathogenesis of B19V infection, the influence of B19-VP1u proteins on hepatic injury is still obscure. This study investigated the effect and possible inflammatory signaling of B19-VP1u in livers from BALB/c mice that were subcutaneously inoculated with VP1u-expressing COS-7 cells. The in vivo effects of B19-VP1u were analyzed by using live animal imaging system (IVIS), Haematoxylin-Eosin staining, gel zymography, and immunoblotting after inoculation. Markedly hepatocyte disarray and lymphocyte infiltration, enhanced matrix metalloproteinase (MMP)-9 activity and increased phosphorylation of p38, ERK, IKK-α, IκB and NF-κB (p-p65) proteins were observed in livers from BALB/c mice receiving COS-7 cells expressing B19-VP1u as well as the significantly increased CRP, IL-1β and IL-6. Notably, IFN-γ and phosphorylated STAT1, but not STAT3, were also significantly increased in the livers of BALB/c mice that were subcutaneously inoculated with VP1u-expressing COS-7 cells. These findings revealed the effects of B19-VP1u on liver injury and suggested that B19-VP1u may have a role as mediators of inflammation in B19V infection.
Energy Technology Data Exchange (ETDEWEB)
Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu
2013-08-01
Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.
Metabolomics reveals mycoplasma contamination interferes with the metabolism of PANC-1 cells.
Yu, Tao; Wang, Yongtao; Zhang, Huizhen; Johnson, Caroline H; Jiang, Yiming; Li, Xiangjun; Wu, Zeming; Liu, Tian; Krausz, Kristopher W; Yu, Aiming; Gonzalez, Frank J; Huang, Min; Bi, Huichang
2016-06-01
Mycoplasma contamination is a common problem in cell culture and can alter cellular functions. Since cell metabolism is either directly or indirectly involved in every aspect of cell function, it is important to detect changes to the cellular metabolome after mycoplasma infection. In this study, liquid chromatography mass spectrometry (LC/MS)-based metabolomics was used to investigate the effect of mycoplasma contamination on the cellular metabolism of human pancreatic carcinoma cells (PANC-1). Multivariate analysis demonstrated that mycoplasma contamination induced significant metabolic changes in PANC-1 cells. Twenty-three metabolites were identified and found to be involved in arginine and purine metabolism and energy supply. This study demonstrates that mycoplasma contamination significantly alters cellular metabolite levels, confirming the compelling need for routine checking of cell cultures for mycoplasma contamination, particularly when used for metabolomics studies. Graphical abstract Metabolomics reveals mycoplasma contamination changes the metabolome of PANC-1 cells.
TRPA1 receptor is upregulated in human oral lichen planus.
Kun, J; Perkecz, A; Knie, L; Sétáló, G; Tornóczki, T; Pintér, E; Bán, Á
2017-03-01
Oral lichen planus (OLP) is a chronic inflammatory disease of unknown etiology with antigen-specific and non-specific mechanisms. Transient receptor potential ankyrin 1 (TRPA1) is a non-selective cation channel activated by noxious stimuli such as oxidative stress products evoking pain and release of proinflammatory mediators from sensory nerve endings culminating in neurogenic inflammation. Extraneuronal TRPA1s, for example, on immune cells possess yet unknown functions. We studied the buccal mRNA expression (qPCR) and protein localization (immunohistochemistry) of TRPA1 receptors and key OLP mediator transcripts in oral mucosa samples of healthy volunteers (n = 9), OLP patients (n = 43), and OLP-like hyperkeratotic patients (n = 12). We measured 27.7- and 25.5-fold TRPA1 mRNA increase in OLP and OLP-like hyperkeratotic patients compared to healthy controls. TRPA1 transcripts elevated 2.4-fold in hypertensive OLP but not in hyperkeratotic patients compared to counterparts, reduced by 1.6-fold by angiotensin-convertase inhibitor intake. TRPA1 messenger RNA was more coexpressed with transcripts of tumor necrosis factor α than with interferon γ. Keratinocytes, macrophages but not T cells expressed TRPA1. We provided evidence for the extraneuronal presence and upregulation of the proinflammatory TRPA1 receptor in buccal samples of patients with OLP. This may implicate the ion channel in the pathomechanism of OLP. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Pure red cell aplasia following autoimmune hemolytic anemia: An enigma
Directory of Open Access Journals (Sweden)
M Saha
2013-01-01
Full Text Available A 26-year-old previously healthy female presented with a 6-month history of anemia. The laboratory findings revealed hemolytic anemia and direct antiglobulin test was positive. With a diagnosis of autoimmune hemolytic anemia (AIHA, prednisolone was started but was ineffective after 1 month of therapy. A bone marrow trephine biopsy revealed pure red cell aplasia (PRCA showing severe erythroid hypoplasia. The case was considered PRCA following AIHA. This combination without clear underlying disease is rare. Human parvovirus B19 infection was not detected in the marrow aspirate during reticulocytopenia. The patient received azathioprine, and PRCA improved but significant hemolysis was once again documented with a high reticulocyte count. The short time interval between AIHA and PRCA phase suggested an increased possibility of the evolution of a single disease.
Gonzaga-Jauregui, Claudia; Mir, Sabina; Penney, Samantha; Jhangiani, Shalini; Midgen, Craig; Finegold, Milton; Muzny, Donna M; Wang, Min; Bacino, Carlos A; Gibbs, Richard A; Lupski, James R; Kellermayer, Richard; Hanchard, Neil A
2014-07-01
Severe congenital hypertriglyceridemia (HTG) is a rare disorder caused by mutations in genes affecting lipoprotein lipase (LPL) activity. Here we report a 5-week-old Hispanic girl with severe HTG (12,031 mg/dL, normal limit 150 mg/dL) who presented with the unusual combination of lower gastrointestinal bleeding and milky plasma. Initial colonoscopy was consistent with colitis, which resolved with reduction of triglycerides. After negative sequencing of the LPL gene, whole-exome sequencing revealed novel compound heterozygous mutations in GPIHBP1. Our study broadens the phenotype of GPIHBP1-associated HTG, reinforces the effectiveness of whole-exome sequencing in Mendelian diagnoses, and implicates triglycerides in gastrointestinal mucosal injury.
Calvo, Xavier; Arenillas, Leonor; Luño, Elisa; Senent, Leonor; Arnan, Montserrat; Ramos, Fernando; Ardanaz, María Teresa; Pedro, Carme; Tormo, Mar; Montoro, Julia; Díez-Campelo, María; Arrizabalaga, Beatriz; Xicoy, Blanca; Bonanad, Santiago; Jerez, Andrés; Nomdedeu, Benet; Ferrer, Ana; Sanz, Guillermo F; Florensa, Lourdes
2016-12-01
Erythroleukemia was considered an acute myeloid leukemia in the 2008 World Health Organization (WHO) classification and is defined by the presence of ≥50% bone marrow erythroblasts, having <20% bone marrow blasts from total nucleated cells but ≥20% bone marrow myeloblasts from nonerythroid cells. Erythroleukemia shares clinicopathologic features with myelodysplastic syndromes, especially with erythroid-predominant myelodysplastic syndromes (≥50% bone marrow erythroblasts). The upcoming WHO revision proposes to eliminate the nonerythroid blast cell count rule and to move erythroleukemia patients into the appropriate myelodysplastic syndrome category on the basis of the absolute blast cell count. We conducted a retrospective study of patients with de novo erythroleukemia and compared their clinico-biological features and outcome with those of de novo myelodysplastic syndromes, focusing on erythroid-predominant myelodysplastic syndromes. Median overall survival of 405 erythroid-predominant myelodysplastic syndromes without excess blasts was significantly longer than that observed in 57 erythroid-predominant refractory anemias with excess blasts-1 and in 59 erythroleukemias, but no significant difference was observed between erythroid-predominant refractory anemias with excess blasts-1 and erythroleukemias. In this subset of patients with ≥50% bone marrow erythroblasts and excess blasts, the presence of a high-risk karyotype defined by the International Prognostic Scoring System or by the Revised International Prognostic Scoring System was the main prognostic factor. In the same way, the survival of 459 refractory anemias with excess blasts-2, independently of having ≥20% bone marrow blasts from nonerythroid cells or not, was almost identical to the observed in 59 erythroleukemias. Interestingly, 11 low-blast count erythroleukemias with 5 to <10% bone marrow blasts from total nucleated cells showed similar survival than the rest of erythroleukemias. Our data
Protein 4.1 and its interaction with other cytoskeletal proteins in Xenopus laevis oogenesis.
Carotenuto, Rosa; Petrucci, Tamara C; Correas, Isabel; Vaccaro, Maria C; De Marco, Nadia; Dale, Brian; Wilding, Martin
2009-06-01
In human red blood cells, protein 4.1 (4.1R) is an 80-kDa polypeptide that stabilizes the spectrin-actin network and anchors it to the plasma membrane. In non-erythroid cells there is a great variety of 4.1R isoforms, mainly generated by alternative pre-mRNA splicing, which localize at various intracellular sites, including the nucleus. We studied protein 4.1R distribution in relation to beta-spectrin, actin and cytokeratin during Xenopus oogenesis. Immunoprecipitation experiments indicate that at least two isoforms of protein 4.1R are present in Xenopus laevis oocytes: a 56-kDa form in the cytoplasm and a 37-kDa form in the germinal vesicle (GV). Antibodies to beta-spectrin reveal two bands of 239 and 100 kDa in the cytoplasm. Coimmunoprecipitation experiments indicate that both the 37- and 56-kDa isoforms of protein 4.1R associate with the 100-kDa isoform of beta-spectrin. Moreover, the 56-kDa form coimmunoprecipitates with a cytokeratin of the same molecular weight. Confocal immunolocalization shows that protein 4.1R distribution is in the peripheral cytoplasm, in the mitochondrial cloud (MC) and in the GV of previtellogenic oocytes. In the cytoplasm of vitellogenic oocytes, a loose network of fibers stained by the anti-protein 4.1R antibody spreads across the cytoplasm. beta-Spectrin has a similar distribution. Protein 4.1R was found to colocalize with actin in the cortex of oocytes in the form of fluorescent dots. Double immunolocalization of protein 4.1R and cytokeratin depicts two separate networks that overlap throughout the whole cytoplasm. Protein 4.1R filaments partially colocalize with cytokeratin in both the animal and vegetal hemispheres. We hypothesize that protein 4.1R could function as a linker protein between cytokeratin and the actin-based cytoskeleton.
A genomewide screen for suppressors of Alu-mediated rearrangements reveals a role for PIF1.
Directory of Open Access Journals (Sweden)
Karen M Chisholm
Full Text Available Alu-mediated rearrangement of tumor suppressor genes occurs frequently during carcinogenesis. In breast cancer, this mechanism contributes to loss of the wild-type BRCA1 allele in inherited disease and to loss of heterozygosity in sporadic cancer. To identify genes required for suppression of Alu-mediated recombination we performed a genomewide screen of a collection of 4672 yeast gene deletion mutants using a direct repeat recombination assay. The primary screen and subsequent analysis identified 12 candidate genes including TSA, ELG1, and RRM3, which are known to play a significant role in maintaining genomic stability. Genetic analysis of the corresponding human homologs was performed in sporadic breast tumors and in inherited BRCA1-associated carcinomas. Sequencing of these genes in high risk breast cancer families revealed a potential role for the helicase PIF1 in cancer predisposition. PIF1 variant L319P was identified in three breast cancer families; importantly, this variant, which is predicted to be functionally damaging, was not identified in a large series of controls nor has it been reported in either dbSNP or the 1000 Genomes Project. In Schizosaccharomyces pombe, Pfh1 is required to maintain both mitochondrial and nuclear genomic integrity. Functional studies in yeast of human PIF1 L319P revealed that this variant cannot complement the essential functions of Pfh1 in either the nucleus or mitochondria. Our results provide a global view of nonessential genes involved in suppressing Alu-mediated recombination and implicate variation in PIF1 in breast cancer predisposition.
DEFF Research Database (Denmark)
Bultmann-Mellin, Insa; Conradi, Anne; Maul, Alexandra C
2015-01-01
Recent studies have revealed an important role for LTBP-4 in elastogenesis. Its mutational inactivation in humans causes autosomal recessive cutis laxa type 1C (ARCL1C), which is a severe disorder caused by defects of the elastic fiber network. Although the human gene involved in ARCL1C has been ...
SF3B1-initiating mutations in MDS-RSs target lymphomyeloid hematopoietic stem cells.
Mortera-Blanco, Teresa; Dimitriou, Marios; Woll, Petter S; Karimi, Mohsen; Elvarsdottir, Edda; Conte, Simona; Tobiasson, Magnus; Jansson, Monika; Douagi, Iyadh; Moarii, Matahi; Saft, Leonie; Papaemmanuil, Elli; Jacobsen, Sten Eirik W; Hellström-Lindberg, Eva
2017-08-17
Mutations in the RNA splicing gene SF3B1 are found in >80% of patients with myelodysplastic syndrome with ring sideroblasts (MDS-RS). We investigated the origin of SF3B1 mutations within the bone marrow hematopoietic stem and progenitor cell compartments in patients with MDS-RS. Screening for recurrently mutated genes in the mononuclear cell fraction revealed mutations in SF3B1 in 39 of 40 cases (97.5%), combined with TET2 and DNMT3A in 11 (28%) and 6 (15%) patients, respectively. All recurrent mutations identified in mononuclear cells could be tracked back to the phenotypically defined hematopoietic stem cell (HSC) compartment in all investigated patients and were also present in downstream myeloid and erythroid progenitor cells. While in agreement with previous studies, little or no evidence for clonal ( SF3B1 mutation) involvement could be found in mature B cells, consistent involvement at the pro-B-cell progenitor stage was established, providing definitive evidence for SF3B1 mutations targeting lymphomyeloid HSCs and compatible with mutated SF3B1 negatively affecting lymphoid development. Assessment of stem cell function in vitro as well as in vivo established that only HSCs and not investigated progenitor populations could propagate the SF3B1 mutated clone. Upon transplantation into immune-deficient mice, SF3B1 mutated MDS-RS HSCs differentiated into characteristic ring sideroblasts, the hallmark of MDS-RS. Our findings provide evidence of a multipotent lymphomyeloid HSC origin of SF3B1 mutations in MDS-RS patients and provide a novel in vivo platform for mechanistically and therapeutically exploring SF3B1 mutated MDS-RS. © 2017 by The American Society of Hematology.
Micieli, Jonathan A; Wang, Duncheng; Denomme, Gregory A
2010-08-01
Anti-glycophorin C (GPC), blood group antibodies of which cause hemolytic disease of the fetus and newborn (HDFN), is a potent inhibitor of erythroid progenitor cell growth. The cellular mechanism for growth inhibition has not been characterized. K562 cells were incubated in the presence of either anti-GPC, an immunoglobulin G isotype control, an inhibitor of actin polymerization called cytochalasin D with anti-GPC, or cytochalasin D alone. The JC-1 cationic dye was used to detect mitochondrial depolarization and the activity of the mitogen-activated protein kinases was assessed by Western blotting. Anti-GPC inhibits the activity of extracellular regulated kinase (ERK)1/2 within 10 minutes but does not alter the activity of p38 or c-Jun N-terminal kinase. After 24 hours there was a significant loss of mitochondrial membrane potential compared to isotype control–treated cells. Both the ERK1/2 inhibition and the loss of mitochondrial potential were prevented by pretreatment with cytochalasin D. A cell surface antibody can cause anemia by altering the signaling pathways in erythroid cells by promoting depolarization of mitochondria via cytoskeletal rearrangement. The observation that neonates with anti-GPC HDFN are unresponsive to erythropoietin can be explained by the antibody inhibiting a protein kinase through which this hematopoietic growth factor achieves its effects.
Girl with idiopathic childhood hypercalcemia reveals new disease-causing CYP24A1 mutation
DEFF Research Database (Denmark)
Madsen, Jens Otto Broby; Sauer, Sabrina; Beck, Bodo
2018-01-01
of a 21 months old girl initially hospitalized due to excessive consumption of water and behavioral difficulties. Blood tests showed hypercalcemia, borderline high vitamin-D levels, and renal ultrasound revealed medullary nephrocalcinosis. An abnormality within the vitamin-D metabolism was suspected......CONTEXT: Idiopathic Infantile Hypercalcemia (IHH) was associated with vitamin-D supplementation in the 1950's. 50 years later mutations in the CYP241A gene, involved in the degradation of vitamin-D, have been identified as being a part of the etiology. CASE DESCRIPTION: We hereby report a case...... and genetic testing was performed. This revealed the patient to be compound heterozygous for a common (p.E143del) and a novel (likely) disease-causing mutation (p.H83D) in the CYP24A1 gene. The hypercalcemia normalized after calcium depleted diet and discontinuation of vitamin-D supplementation. CONCLUSIONS...
Heuer, Sigrid; Lu, Xiaochun; Chin, Joong Hyoun; Tanaka, Juan Pariasca; Kanamori, Hiroyuki; Matsumoto, Takashi; De Leon, Teresa; Ulat, Victor Jun; Ismail, Abdelbagi M; Yano, Masahiro; Wissuwa, Matthias
2009-06-01
The phosphorus uptake 1 (Pup1) locus was identified as a major quantitative trait locus (QTL) for tolerance of phosphorus deficiency in rice. Near-isogenic lines with the Pup1 region from tolerant donor parent Kasalath typically show threefold higher phosphorus uptake and grain yield in phosphorus-deficient field trials than the intolerant parent Nipponbare. In this study, we report the fine mapping of the Pup1 locus to the long arm of chromosome 12 (15.31-15.47 Mb). Genes in the region were initially identified on the basis of the Nipponbare reference genome, but did not reveal any obvious candidate genes related to phosphorus uptake. Kasalath BAC clones were therefore sequenced and revealed a 278-kbp sequence significantly different from the syntenic regions in Nipponbare (145 kb) and in the indica reference genome of 93-11 (742 kbp). Size differences are caused by large insertions or deletions (INDELs), and an exceptionally large number of retrotransposon and transposon-related elements (TEs) present in all three sequences (45%-54%). About 46 kb of the Kasalath sequence did not align with the entire Nipponbare genome, and only three Nipponbare genes (fatty acid alpha-dioxygenase, dirigent protein and aspartic proteinase) are highly conserved in Kasalath. Two Nipponbare genes (expressed proteins) might have evolved by at least three TE integrations in an ancestor gene that is still present in Kasalath. Several predicted Kasalath genes are novel or unknown genes that are mainly located within INDEL regions. Our results highlight the importance of sequencing QTL regions in the respective donor parent, as important genes might not be present in the current reference genomes.
Feed-Back Regulation of Haemopoiesis
Energy Technology Data Exchange (ETDEWEB)
Feldman, M. [Department of Cell Biology, Weizmann Institute of Science, Rehovoth (Israel)
1968-08-15
Studies ate reported on the feed-back regulation of erythropoiesis by means of the intrasplenic cloning system of haemopoietic cells. Polycythaemia, produced by passive transfusion of synzeneic, allogeneic or xenogeneic red blood cells, inhibited the formation of bone-marrow derived erythroid clones. Polycythaemia also inhibited the formation of erythroid clones of endogenous stem cells. Oxygen overloading was found to be a necessary factor in the suppression of erythroid clone formation: no suppression of erythroid colonies was observed when polycythaemic animals were kept under hypoxic conditions. Erythropoietin, either of exogenous or of endogenous origin, elicited a reformation of erythroid clones in 'suppressed' animals. Studies on the kinetics of reformation of erythroid clones after the administration of erythropoietin suggested that the colony-forming stem cell can replicate a few times in the absence of erythropoietin and the cell progeny thus formed are the target cells for erythropoietin action. If, indeed, the colony-forming cell replicates in the absence of the specific inducer, then the cells thus formed should themselves be stem cells. This was substantiated by demonstrating that the cloning efficiency of spleens of polycythaemic recipients was higher than that of non-polycythaemic animals. Experiments indicating that erythroid clones produced by erythropoietin in polycythaemic animals disappeared after the discontinuance of erythropoietin application demonstrated the distinction between the 'mitogenic' and the 'morphogenetic' effects of erythropoietin. The latter seemed to be operated by an early transcription of RNA for proteins necessary for the complete maturation of the red blood cell, Erythroid clones produced by foetal haemopoietic stem cells seemed to be regulated by a different mechanism from that which controls the formation of bone-marrow derived clones. Clones produced by foetal cells were only partially suppressed in the polycythaemic
The Nrf1 CNC-bZIP protein is regulated by the proteasome and activated by hypoxia.
Chepelev, Nikolai L; Bennitz, Joshua D; Huang, Ting; McBride, Skye; Willmore, William G
2011-01-01
Nrf1 (nuclear factor-erythroid 2 p45 subunit-related factor 1) is a transcription factor mediating cellular responses to xenobiotic and pro-oxidant stress. Nrf1 regulates the transcription of many stress-related genes through the electrophile response elements (EpREs) located in their promoter regions. Despite its potential importance in human health, the mechanisms controlling Nrf1 have not been addressed fully. We found that proteasomal inhibitors MG-132 and clasto-lactacystin-β-lactone stabilized the protein expression of full-length Nrf1 in both COS7 and WFF2002 cells. Concomitantly, proteasomal inhibition decreased the expression of a smaller, N-terminal Nrf1 fragment, with an approximate molecular weight of 23 kDa. The EpRE-luciferase reporter assays revealed that proteasomal inhibition markedly inhibited the Nrf1 transactivational activity. These results support earlier hypotheses that the 26 S proteasome processes Nrf1 into its active form by removing its inhibitory N-terminal domain anchoring Nrf1 to the endoplasmic reticulum. Immunoprecipitation demonstrated that Nrf1 is ubiquitinated and that proteasomal inhibition increased the degree of Nrf1 ubiquitination. Furthermore, Nrf1 protein had a half-life of approximately 5 hours in COS7 cells. In contrast, hypoxia (1% O(2)) significantly increased the luciferase reporter activity of exogenous Nrf1 protein, while decreasing the protein expression of p65, a shorter form of Nrf1, known to act as a repressor of EpRE-controlled gene expression. Finally, the protein phosphatase inhibitor okadaic acid activated Nrf1 reporter activity, while the latter was repressed by the PKC inhibitor staurosporine. Collectively, our data suggests that Nrf1 is controlled by several post-translational mechanisms, including ubiquitination, proteolytic processing and proteasomal-mediated degradation as well as by its phosphorylation status. © 2011 Chepelev et al.
Jin, Hao; Sood, Raman; Xu, Jin; Zhen, Fenghua; English, Milton A; Liu, P Paul; Wen, Zilong
2009-02-01
One unique feature of vertebrate definitive hematopoiesis is the ontogenic switching of hematopoietic stem cells from one anatomical compartment or niche to another. In mice, hematopoietic stem cells are believed to originate in the aorta-gonad-mesonephros (AGM), subsequently migrate to the fetal liver (FL) and finally colonize the bone marrow (BM). Yet, the differentiation potential of hematopoietic stem cells within early niches such as the AGM and FL remains incompletely defined. Here, we present in vivo analysis to delineate the differentiation potential of definitive hematopoietic stem/progenitor cells (HSPCs) in the zebrafish AGM and FL analogies, namely the ventral wall of dorsal aorta (VDA) and the posterior blood island (PBI), respectively. Cell fate mapping and analysis of zebrafish runx1(w84x) and vlad tepes (vlt(m651)) mutants revealed that HSPCs in the PBI gave rise to both erythroid and myeloid lineages. However, we surprisingly found that HSPCs in the VDA were not quiescent but were uniquely adapted to generate myeloid but not erythroid lineage cells. We further showed that such distinct differentiation output of HSPCs was, at least in part, ascribed to the different micro-environments present in these two niches. Our results highlight the importance of niche in shaping the differentiation output of developing HSPCs.
TRPA1 gene polymorphisms and childhood asthma.
Gallo, Valentina; Dijk, F Nicole; Holloway, John W; Ring, Susan M; Koppelman, Gerard H; Postma, Dirkje S; Strachan, David P; Granell, Raquel; de Jongste, Johan C; Jaddoe, Vincent W V; den Dekker, Herman T; Duijts, Liesbeth; Henderson, A John; Shaheen, Seif O
2017-03-01
Animal data have suggested that the transient receptor potential ankyrin-1 (TRPA1) ion channel plays a key role in promoting airway inflammation in asthma and may mediate effects of paracetamol on asthma, yet confirmatory human data are lacking. To study associations of TRPA1 gene variants with childhood asthma and total IgE concentration, and interactions between TRPA1 and prenatal paracetamol exposure on these outcomes. We analysed associations between 31 TRPA1 single nucleotide polymorphisms (SNPs) and current doctor-diagnosed asthma and total IgE concentration at 7.5 years in the Avon Longitudinal Study of Parents and Children (ALSPAC) birth cohort. We sought to confirm the most significant associations with comparable outcomes in the Prevention and Incidence of Asthma and Mite Allergy (PIAMA) and Generation R birth cohorts. In ALSPAC, we explored interactions with prenatal paracetamol exposure. In ALSPAC, there was strong evidence for association between six SNPs and asthma: rs959974 and rs1384001 (per-allele odds ratio for both: 1.30 (95% CI: 1.15-1.47), p = 0.00001), rs7010969 (OR 1.28 (1.13-1.46), p = 0.00004), rs3735945 (OR 1.30 (1.09-1.55), p = 0.003), rs920829 (OR 1.30 (1.09-1.54), p = 0.004) and rs4738202 (OR 1.22 (1.07-1.39), p = 0.004). In a meta-analysis across the three cohorts, the pooled effect estimates confirmed that all six SNPs were significantly associated with asthma. In ALSPAC, TRPA1 associations with asthma were not modified by prenatal paracetamol, although associations with IgE concentration were. This study suggests that TRPA1 may play a role in the development of childhood asthma. (249 words). © 2016 The Authors Pediatric Allergy and Immunology Published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Mattila, Henna; Schindler, Martin; Isotalo, Jarkko; Ikonen, Tarja; Vihinen, Mauno; Oja, Hannu; Tammela, Teuvo LJ; Wahlfors, Tiina; Schleutker, Johanna
2011-01-01
Several predisposition loci for hereditary prostate cancer (HPC) have been suggested, including HPCX1 at Xq27-q28, but due to the complex structure of the region, the susceptibility gene has not yet been identified. In this study, nonsense-mediated mRNA decay (NMD) inhibition was used for the discovery of truncating mutations. Six prostate cancer (PC) patients and their healthy brothers were selected from a group of HPCX1-linked families. Expression analyses were done using Agilent 44 K oligoarrays, and selected genes were screened for mutations by direct sequencing. In addition, microRNA expression levels in the lymphoblastic cells were analyzed to trace variants that might alter miRNA expression and explain partly an inherited genetic predisposion to PC. Seventeen genes were selected for resequencing based on the NMD array, but no truncating mutations were found. The most interesting variant was MAGEC1 p.Met1?. An association was seen between the variant and unselected PC (OR = 2.35, 95% CI = 1.10-5.02) and HPC (OR = 3.38, 95% CI = 1.10-10.40). miRNA analysis revealed altogether 29 miRNAs with altered expression between the PC cases and controls. miRNA target analysis revealed that 12 of them also had possible target sites in the MAGEC1 gene. These miRNAs were selected for validation process including four miRNAs located in the X chromosome. The expressions of 14 miRNAs were validated in families that contributed to the significant signal differences in Agilent arrays. Further functional studies are needed to fully understand the possible contribution of these miRNAs and MAGEC1 start codon variant to PC
Aayadi, Hoda; Mittal, Smriti P K; Deshpande, Anjali; Gore, Makarand; Ghaskadbi, Saroj S
2017-11-01
Geraniin, a hydrolysable tannin, used in traditional medicine in Southeast Asia, is known to exhibit various biological activities. As an antioxidant it is known to up-regulate phase II enzyme Heme oxygenase-1 (HO-1). However its mechanism is not clearly understood. Nuclear factor erythroid-derived 2 related factor 2 (Nrf-2) is transcriptionally up-regulated by Extracellular signal-regulated kinase (ERK) 1/2 and retained in nucleus due to inactivated Glycogen synthase kinase 3 beta (GSK-3β). Geraniin additionally down-regulates expression of microRNA 217 and 377 (miR-217 and miR-377) which target HO-1 mRNA. Expression of BTB and CNC homolog 1 (BACH-1), another regulator of HO-1, is also down-regulated by up-regulating microRNA 98 (miR-98), a negative regulator of BACH-1. Thus, geraniin up-regulates HO-1 expression both through activating its positive regulator Nrf-2 and by down-regulating its negative regulator BACH-1. Up-regulation of HO-1 also confers protection to HepG2 cells from tertiary butyl hydroperoxide (TBH) induced cytotoxicity. [BMB Reports 2017; 50(11): 560-565].
Ankyrinový receptor – iontový kanál v nocicepčních drahách
Czech Academy of Sciences Publication Activity Database
Surá, Lucie; Zima, V.; Touška, Filip; Vlachová, Viktorie
2010-01-01
Roč. 13, č. 3 (2010), s. 109-114 ISSN 1212-0634 R&D Projects: GA MŠk(CZ) 1M0517; GA MŠk(CZ) LC554; GA ČR GA305/09/0081 Grant - others:Univerzita Karlova(CZ) 43-259-052; GA MŠk(CZ) SVV-2010-261304 Institutional research plan: CEZ:AV0Z50110509 Keywords : nociception * ankyrin receptor * pain Subject RIV: FH - Neurology
RNA-Seq profiling reveals novel hepatic gene expression pattern in aflatoxin B1 treated rats.
Merrick, B Alex; Phadke, Dhiral P; Auerbach, Scott S; Mav, Deepak; Stiegelmeyer, Suzy M; Shah, Ruchir R; Tice, Raymond R
2013-01-01
Deep sequencing was used to investigate the subchronic effects of 1 ppm aflatoxin B1 (AFB1), a potent hepatocarcinogen, on the male rat liver transcriptome prior to onset of histopathological lesions or tumors. We hypothesized RNA-Seq would reveal more differentially expressed genes (DEG) than microarray analysis, including low copy and novel transcripts related to AFB1's carcinogenic activity compared to feed controls (CTRL). Paired-end reads were mapped to the rat genome (Rn4) with TopHat and further analyzed by DESeq and Cufflinks-Cuffdiff pipelines to identify differentially expressed transcripts, new exons and unannotated transcripts. PCA and cluster analysis of DEGs showed clear separation between AFB1 and CTRL treatments and concordance among group replicates. qPCR of eight high and medium DEGs and three low DEGs showed good comparability among RNA-Seq and microarray transcripts. DESeq analysis identified 1,026 differentially expressed transcripts at greater than two-fold change (p<0.005) compared to 626 transcripts by microarray due to base pair resolution of transcripts by RNA-Seq, probe placement within transcripts or an absence of probes to detect novel transcripts, splice variants and exons. Pathway analysis among DEGs revealed signaling of Ahr, Nrf2, GSH, xenobiotic, cell cycle, extracellular matrix, and cell differentiation networks consistent with pathways leading to AFB1 carcinogenesis, including almost 200 upregulated transcripts controlled by E2f1-related pathways related to kinetochore structure, mitotic spindle assembly and tissue remodeling. We report 49 novel, differentially-expressed transcripts including confirmation by PCR-cloning of two unique, unannotated, hepatic AFB1-responsive transcripts (HAfT's) on chromosomes 1.q55 and 15.q11, overexpressed by 10 to 25-fold. Several potentially novel exons were found and exon refinements were made including AFB1 exon-specific induction of homologous family members, Ugt1a6 and Ugt1a7c. We find the
Directory of Open Access Journals (Sweden)
Fogarty Keir H
2010-09-01
Full Text Available Abstract Background Human T-lymphotropic virus type 1 (HTLV-1 is an important human retrovirus that is a cause of adult T-cell leukemia/lymphoma. While an important human pathogen, the details regarding virus replication cycle, including the nature of HTLV-1 particles, remain largely unknown due to the difficulties in propagating the virus in tissue culture. In this study, we created a codon-optimized HTLV-1 Gag fused to an EYFP reporter as a model system to quantitatively analyze HTLV-1 particles released from producer cells. Results The codon-optimized Gag led to a dramatic and highly robust level of Gag expression as well as virus-like particle (VLP production. The robust level of particle production overcomes previous technical difficulties with authentic particles and allowed for detailed analysis of particle architecture using two novel methodologies. We quantitatively measured the diameter and morphology of HTLV-1 VLPs in their native, hydrated state using cryo-transmission electron microscopy (cryo-TEM. Furthermore, we were able to determine HTLV-1 Gag stoichiometry as well as particle size with the novel biophysical technique of fluorescence fluctuation spectroscopy (FFS. The average HTLV-1 particle diameter determined by cryo-TEM and FFS was 71 ± 20 nm and 75 ± 4 nm, respectively. These values are significantly smaller than previous estimates made of HTLV-1 particles by negative staining TEM. Furthermore, cryo-TEM reveals that the majority of HTLV-1 VLPs lacks an ordered structure of the Gag lattice, suggesting that the HTLV-1 Gag shell is very likely to be organized differently compared to that observed with HIV-1 Gag in immature particles. This conclusion is supported by our observation that the average copy number of HTLV-1 Gag per particle is estimated to be 510 based on FFS, which is significantly lower than that found for HIV-1 immature virions. Conclusions In summary, our studies represent the first quantitative biophysical
N-acetylcysteine Ameliorates Prostatitis via miR-141 Regulating Keap1/Nrf2 Signaling.
Wang, Liang-Liang; Huang, Yu-Hua; Yan, Chun-Yin; Wei, Xue-Dong; Hou, Jian-Quan; Pu, Jin-Xian; Lv, Jin-Xing
2016-04-01
Chronic prostatitis was the most common type of prostatitis and oxidative stress was reported to be highly elevated in prostatitis patients. In this study, we determined the effect of N-acetylcysteine (NAC) on prostatitis and the molecular mechanism involved in it. Male Sprague-Dawley rats were divided into three groups: control group (group A, n = 20), carrageenan-induced chronic nonbacterial prostatitis (CNP) model group (group B, n = 20), and carrageenan-induced CNP model group with NAC injection (group C, n = 20). Eye score, locomotion score, inflammatory cell count, cyclooxygenase 2 (COX2) expression, and Evans blue were compared in these three groups. The expression of miR-141 was determined by quantitative real-time PCR (qRT-PCR). Moreover, protein expressions of Kelch-like ECH-associated protein-1 (Keap1) and nuclear factor erythroid-2 related factor 2 (Nrf2) and its target genes were examined by Western blot. Luciferase reporter assay was performed in RWPE-1 cells transfected miR-141 mimic or inhibitor and the plasmid carrying 3'-UTR of Keap1. The value of eye score, locomotion score, inflammatory cell count, and Evans blue were significantly decreased in group C, as well as the expression of COX2, when comparing to that of group B. These results indicated that NAC relieved the carrageenan-induced CNP. Further, we found that NAC increased the expression of miR-141 and activated the Keap1/Nrf2 signaling. Luciferase reporter assay revealed that miR-141 mimic could suppress the activity of Keap1 and stimulate the downstream target genes of Nrf2. In addition, miR-141 inhibitor could reduce the effect of NAC on prostatitis. NAC ameliorates the carrageenan-induced prostatitis and prostate inflammation pain through miR-141 regulating Keap1/Nrf2 signaling.
Obana, Edwin A; Lundell, Travis G; Yi, Kevin J; Radomski, Kryslaine L; Zhou, Qiong; Doughty, Martin L
2015-06-01
Neurog1 is a pro-neural basic helix-loop-helix (bHLH) transcription factor expressed in progenitor cells located in the ventricular zone and subsequently the presumptive white matter tracts of the developing mouse cerebellum. We used genetic inducible fate mapping (GIFM) with a transgenic Neurog1-CreER allele to characterize the contributions of Neurog1 lineages to cerebellar circuit formation in mice. GIFM reveals Neurog1-expressing progenitors are fate-mapped to become Purkinje cells and all GABAergic interneuron cell types of the cerebellar cortex but not glia. The spatiotemporal sequence of GIFM is unique to each neuronal cell type. GIFM on embryonic days (E) 10.5 to E12.5 labels Purkinje cells with different medial-lateral settling patterns depending on the day of tamoxifen delivery. GIFM on E11.5 to P7 labels interneurons and the timing of tamoxifen administration correlates with the final inside-to-outside resting position of GABAergic interneurons in the cerebellar cortex. Proliferative status and long-term BrdU retention of GIFM lineages reveals Purkinje cells express Neurog1 around the time they become post-mitotic. In contrast, GIFM labels mitotic and post-mitotic interneurons. Neurog1-CreER GIFM reveals a correlation between the timing of Neurog1 expression and the spatial organization of GABAergic neurons in the cerebellar cortex with possible implications for cerebellar circuit assembly.
Varlet-Marie, Emmanuelle; Audran, Michel; Lejeune, Mireille; Bonafoux, Béatrice; Sicart, Marie-Therese; Marti, Jacques; Piquemal, David; Commes, Thérèse
2004-08-01
Enhancement of oxygen delivery to tissues is associated with improved sporting performance. One way of enhancing oxygen delivery is to take recombinant human erythropoietin (rHuEpo), which is an unethical and potentially dangerous practice. However, detection of the use of rHuEpo remains difficult in situations such as: i) several days after the end of treatment ii) when a treatment with low doses is conducted iii) if the rHuEpo effect is increased by other substances. In an attempt to detect rHuEpo abuse, we selected erythroid gene markers from a SAGE library and analyzed the effects of rHuEpo administration on expression of the HBB, FTL and OAZ genes. Ten athletes were assigned to the rHuEpo or placebo group. The rHuEpo group received subcutaneous injections of rHuEpo (50 UI/kg three times a week, 4 weeks; 20 UI/kg three times a week, 2 weeks). HBB, FTL and OAZ gene profiles were monitored by real time-polymerase chain reaction (PCR) quantification during and for 3 weeks after drug administration. The global analysis of these targeted genes detected in whole blood samples showed a characteristic profile of subjects misusing rHuEpo with a increase above the threshold levels. The individual analysis of OAZ mRNA seemed indicative of rHuEpo treatment. The performance-enhancing effect of rHuEpo treatment is greater than the duration of hematologic changes associated with rHuEpo misuse. Although direct electrophoretic methods to detect rHuEpo have been developed, recombinant isoforms of rHuEpo are not detectable some days after the last subcutaneous injection. To overcome these limitations indirect OFF models have been developed. Our data suggest that, in the near future, it will be possible to consolidate results achievable with the OFF models by analyzing selected erythroid gene markers as a supplement to indirect methods.
Costet, L; Le Cunff, L; Royaert, S; Raboin, L-M; Hervouet, C; Toubi, L; Telismart, H; Garsmeur, O; Rousselle, Y; Pauquet, J; Nibouche, S; Glaszmann, J-C; Hoarau, J-Y; D'Hont, A
2012-09-01
Modern sugarcane cultivars (Saccharum spp., 2n = 100-130) are high polyploid, aneuploid and of interspecific origin. A major gene (Bru1) conferring resistance to brown rust, caused by the fungus Puccinia melanocephala, has been identified in cultivar R570. We analyzed 380 modern cultivars and breeding materials covering the worldwide diversity with 22 molecular markers genetically linked to Bru1 in R570 within a 8.2 cM segment. Our results revealed a strong LD in the Bru1 region and strong associations between most of the markers and rust resistance. Two PCR markers, that flank the Bru1-bearing segment, were found completely associated with one another and only in resistant clones representing efficient molecular diagnostic for Bru1. On this basis, Bru1 was inferred in 86 % of the 194 resistant sugarcane accessions, revealing that it constitutes the main source of brown rust resistance in modern cultivars. Bru1 PCR diagnostic markers should be particularly useful to identify cultivars with potentially alternative sources of resistance to diversify the basis of brown rust resistance in breeding programs.
Directory of Open Access Journals (Sweden)
Heung Bum Lee
2012-06-01
Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.
Yang, Xue; Xiong, Qian; Wu, Ying; Li, Siting; Ge, Feng
2017-10-06
Circular RNAs (circRNAs), a class of widespread endogenous RNAs, play crucial roles in diverse biological processes and are potential biomarkers in diverse human diseases and cancers. Cerebellar-degeneration-related protein 1 antisense RNA (CDR1as), an oncogenic circRNA, is involved in human tumorigenesis and is dysregulated in hepatocellular carcinoma (HCC). However, the molecular mechanisms underlying CDR1as functions in HCC remain unclear. Here we explored the functions of CDR1as and searched for CDR1as-regulated proteins in HCC cells. A quantitative proteomics strategy was employed to globally identify CDR1as-regulated proteins in HCC cells. In total, we identified 330 differentially expressed proteins (DEPs) upon enhanced CDR1as expression in HepG2 cells, indicating that they could be proteins regulated by CDR1as. Bioinformatic analysis revealed that many DEPs were involved in cell proliferation and the cell cycle. Further functional studies of epidermal growth factor receptor (EGFR) found that CDR1as exerts its effects on cell proliferation at least in part through the regulation of EGFR expression. We further confirmed that CDR1as could inhibit the expression of microRNA-7 (miR-7). EGFR is a validated target of miR-7; therefore, CDR1as may exert its function by regulating EGFR expression via targeting miR-7 in HCC cells. Taken together, we revealed novel functions and underlying mechanisms of CDR1as in HCC cells. This study serves as the first proteome-wide analysis of a circRNA-regulated protein in cells and provides a reliable and highly efficient method for globally identifying circRNA-regulated proteins.
In vitro protease cleavage and computer simulations reveal the HIV-1 capsid maturation pathway
Ning, Jiying; Erdemci-Tandogan, Gonca; Yufenyuy, Ernest L.; Wagner, Jef; Himes, Benjamin A.; Zhao, Gongpu; Aiken, Christopher; Zandi, Roya; Zhang, Peijun
2016-12-01
HIV-1 virions assemble as immature particles containing Gag polyproteins that are processed by the viral protease into individual components, resulting in the formation of mature infectious particles. There are two competing models for the process of forming the mature HIV-1 core: the disassembly and de novo reassembly model and the non-diffusional displacive model. To study the maturation pathway, we simulate HIV-1 maturation in vitro by digesting immature particles and assembled virus-like particles with recombinant HIV-1 protease and monitor the process with biochemical assays and cryoEM structural analysis in parallel. Processing of Gag in vitro is accurate and efficient and results in both soluble capsid protein and conical or tubular capsid assemblies, seemingly converted from immature Gag particles. Computer simulations further reveal probable assembly pathways of HIV-1 capsid formation. Combining the experimental data and computer simulations, our results suggest a sequential combination of both displacive and disassembly/reassembly processes for HIV-1 maturation.
Energy Technology Data Exchange (ETDEWEB)
Ponthier, Julie L.; Schluepen, Christina; Chen, Weiguo; Lersch,Robert A.; Gee, Sherry L.; Hou, Victor C.; Lo, Annie J.; Short, Sarah A.; Chasis, Joel A.; Winkelmann, John C.; Conboy, John G.
2006-03-01
Activation of protein 4.1R exon 16 (E16) inclusion during erythropoiesis represents a physiologically important splicing switch that increases 4.1R affinity for spectrin and actin. Previous studies showed that negative regulation of E16 splicing is mediated by the binding of hnRNP A/B proteins to silencer elements in the exon and that downregulation of hnRNP A/B proteins in erythroblasts leads to activation of E16 inclusion. This paper demonstrates that positive regulation of E16 splicing can be mediated by Fox-2 or Fox-1, two closely related splicing factors that possess identical RNA recognition motifs. SELEX experiments with human Fox-1 revealed highly selective binding to the hexamer UGCAUG. Both Fox-1 and Fox-2 were able to bind the conserved UGCAUG elements in the proximal intron downstream of E16, and both could activate E16 splicing in HeLa cell co-transfection assays in a UGCAUG-dependent manner. Conversely, knockdown of Fox-2 expression, achieved with two different siRNA sequences resulted in decreased E16 splicing. Moreover, immunoblot experiments demonstrate mouse erythroblasts express Fox-2, but not Fox-1. These findings suggest that Fox-2 is a physiological activator of E16 splicing in differentiating erythroid cells in vivo. Recent experiments show that UGCAUG is present in the proximal intron sequence of many tissue-specific alternative exons, and we propose that the Fox family of splicing enhancers plays an important role in alternative splicing switches during differentiation in metazoan organisms.
Hu, Xinyue; Rajesh, Mohanraj; Zhang, Jian; Zhou, Shanshan; Wang, Shudong; Sun, Jian; Tan, Yi; Zheng, Yang; Cai, Lu
2018-05-01
Oxidative stress and inflammation play key roles in the development of diabetic cardiomyopathy (DCM). Dimethyl fumarate (DMF), an FDA approved medicine for relapsing multiple sclerosis, has manifested its antioxidant and anti-inflammatory function mostly in the central nervous system. In this study, we investigated whether DMF could attenuate the development of DCM. Type 1 diabetes mouse model was established using multiple low-dose streptozotocin, and the diabetic mice were treated with DMF (10 mg/kg body weight) for 3 months. Cardiac functions were determined using echocardiography. Oxidative stress, pro-inflammatory cytokines and pro-fibrotic markers were determined with commercially available kits, real-time quantitative PCR or western blot techniques. DCM was characterized by diminished cardiac function, accompanied by oxidative stress and enhanced expression of pro-inflammatory cytokines. Diabetic cardiac tissue exhibited marked fibrosis, revealed by extracellular matrix deposition as determined by Sirius red staining of the myocardial tissues. Furthermore, Nrf2 and its downstream effectors were repressed in diabetic myocardium. On the contrary, diabetic animals treated with DMF exhibited blunted oxidative stress, inflammation, fibrosis and this correlated with Nrf2 activation. Our findings suggest that DMF could potentially thwart diabetes-induced myocardial tissue injury, likely via activation of Nrf2 function, providing firm impetus for future repurposing of DMF in the management of DCM. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Jozef Madzo
2014-01-01
Full Text Available Hematopoietic stem cell differentiation involves the silencing of self-renewal genes and induction of a specific transcriptional program. Identification of multiple covalent cytosine modifications raises the question of how these derivatized bases influence stem cell commitment. Using a replicative primary human hematopoietic stem/progenitor cell differentiation system, we demonstrate dynamic changes of 5-hydroxymethylcytosine (5-hmC during stem cell commitment and differentiation to the erythroid lineage. Genomic loci that maintain or gain 5-hmC density throughout erythroid differentiation contain binding sites for erythroid transcription factors and several factors not previously recognized as erythroid-specific factors. The functional importance of 5-hmC was demonstrated by impaired erythroid differentiation, with augmentation of myeloid potential, and disrupted 5-hmC patterning in leukemia patient-derived CD34+ stem/early progenitor cells with TET methylcytosine dioxygenase 2 (TET2 mutations. Thus, chemical conjugation and affinity purification of 5-hmC-enriched sequences followed by sequencing serve as resources for deciphering functional implications for gene expression during stem cell commitment and differentiation along a particular lineage.
Yamamoto, Yuko; Hirai, Takaaki; Yamamoto, Eiji; Kawamura, Mayuko; Sato, Tomomi; Kitano, Hidemi; Matsuoka, Makoto; Ueguchi-Tanaka, Miyako
2010-11-01
To investigate gibberellin (GA) signaling using the rice (Oryza sativa) GA receptor GIBBERELLIN-INSENSITIVE DWARF1 (GID1) mutant gid1-8, we isolated a suppressor mutant, Suppressor of gid1-1 (Sgd-1). Sgd-1 is an intragenic mutant containing the original gid1-8 mutation (L45F) and an additional amino acid substitution (P99S) in the loop region. GID1(P99S) interacts with the rice DELLA protein SLENDER RICE1 (SLR1), even in the absence of GA. Substitution of the 99th Pro with other amino acids revealed that substitution with Ala (P99A) caused the highest level of GA-independent interaction. Physicochemical analysis using surface plasmon resonance revealed that GID1(P99A) has smaller K(a) (association) and K(d) (dissociation) values for GA(4) than does wild-type GID1. This suggests that the GID1(P99A) lid is at least partially closed, resulting in both GA-independent and GA-hypersensitive interactions with SLR1. One of the three Arabidopsis thaliana GID1s, At GID1b, can also interact with DELLA proteins in the absence of GA, so we investigated whether GA-independent interaction of At GID1b depends on a mechanism similar to that of rice GID1(P99A). Substitution of the loop region or a few amino acids of At GID1b with those of At GID1a diminished its GA-independent interaction with GAI while maintaining the GA-dependent interaction. Soybean (Glycine max) and Brassica napus also have GID1s similar to At GID1b, indicating that these unique GID1s occur in various dicots and may have important functions in these plants.
Chatterjee, Anwesha; Ronghe, Amruta; Singh, Bhupendra; Bhat, Nimee K; Chen, Jie; Bhat, Hari K
2014-12-01
The objective of the present study was to characterize the role of resveratrol (Res) and vitamin C (VC) in prevention of estrogen-induced breast cancer through regulation of cap "n"collar (CNC) b-zip transcription factors. Human breast epithelial cell line MCF-10A was treated with 17β-estradiol (E2) and VC or Res with or without E2. mRNA and protein expression levels of CNC b-zip transcription factors nuclear factor erythroid 2-related factor 1 (Nrf1), nuclear factor erythroid 2 related factor 2 (Nrf2), nuclear factor erythroid 2 related factor 3 (Nrf3), and Nrf2-regulated antioxidant enzymes superoxide dismutase 3 (SOD3) and quinone oxidoreductase 1 (NQO1) were quantified. The treatment with E2 suppressed, whereas VC and Res prevented E2-mediated decrease in the expression levels of SOD3, NQO1, Nrf2 mRNA, and protein in MCF-10A cells. The treatment with E2, Res, or VC significantly increased mRNA and protein expression levels of Nrf1. 17β-Estradiol treatment significantly increased but VC or Res decreased Nrf3 mRNA and protein expression levels. Our studies demonstrate that estrogen-induced breast cancer might be prevented through upregulation of antioxidant enzymes via Nrf-dependent pathways. © 2014 Wiley Periodicals, Inc.
Lu, Shiyou
2011-09-23
A novel mutant of Arabidopsis (Arabidopsis thaliana), having highly glossy inflorescence stems, postgenital fusion in floral organs, and reduced fertility, was isolated from an ethyl methanesulfonate-mutagenized population and designated glossyhead1 (gsd1). The gsd1 locus was mapped to chromosome 1, and the causal gene was identified as a new allele of Acetyl-Coenzyme A Carboxylase1 (ACC1), a gene encoding the main enzyme in cytosolic malonyl-coenzyme A synthesis. This, to our knowledge, is the first mutant allele of ACC1 that does not cause lethality at the seed or early germination stage, allowing for the first time a detailed analysis of ACC1 function in mature tissues. Broad lipid profiling of mature gsd1 organs revealed a primary role for ACC1 in the biosynthesis of the very-long-chain fatty acids (C 20:0 or longer) associated with cuticular waxes and triacylglycerols. Unexpectedly, transcriptome analysis revealed that gsd1 has limited impact on any lipid metabolic networks but instead has a large effect on environmental stress-responsive pathways, especially senescence and ethylene synthesis determinants, indicating a possible role for the cytosolic malonyl-coenzyme A-derived lipids in stress response signaling. © 2011 American Society of Plant Biologists. All Rights Reserved.
Interspecific introgression in cetaceans: DNA markers reveal post-F1 status of a pilot whale.
Directory of Open Access Journals (Sweden)
Laura Miralles
Full Text Available Visual species identification of cetacean strandings is difficult, especially when dead specimens are degraded and/or species are morphologically similar. The two recognised pilot whale species (Globicephala melas and Globicephala macrorhynchus are sympatric in the North Atlantic Ocean. These species are very similar in external appearance and their morphometric characteristics partially overlap; thus visual identification is not always reliable. Genetic species identification ensures correct identification of specimens. Here we have employed one mitochondrial (D-Loop region and eight nuclear loci (microsatellites as genetic markers to identify six stranded pilot whales found in Galicia (Northwest Spain, one of them of ambiguous phenotype. DNA analyses yielded positive amplification of all loci and enabled species identification. Nuclear microsatellite DNA genotypes revealed mixed ancestry for one individual, identified as a post-F1 interspecific hybrid employing two different Bayesian methods. From the mitochondrial sequence the maternal species was Globicephala melas. This is the first hybrid documented between Globicephala melas and G. macrorhynchus, and the first post-F1 hybrid genetically identified between cetaceans, revealing interspecific genetic introgression in marine mammals. We propose to add nuclear loci to genetic databases for cetacean species identification in order to detect hybrid individuals.
Energy Technology Data Exchange (ETDEWEB)
Mavromatis, K.; Kuyler Doyle, C.; Lykidis, A.; Ivanova, N.; Francino, P.; Chain, P.; Shin, M.; Malfatti, S.; Larimer, F.; Copeland,A.; Detter, J.C.; Land, M.; Richardson, P.M.; Yu, X.J.; Walker, D.H.; McBride, J.W.; Kyrpides, N.C.
2005-09-01
Ehrlichia canis, a small obligately intracellular, tick-transmitted, gram-negative, a-proteobacterium is the primary etiologic agent of globally distributed canine monocytic ehrlichiosis. Complete genome sequencing revealed that the E. canis genome consists of a single circular chromosome of 1,315,030 bp predicted to encode 925 proteins, 40 stable RNA species, and 17 putative pseudogenes, and a substantial proportion of non-coding sequence (27 percent). Interesting genome features include a large set of proteins with transmembrane helices and/or signal sequences, and a unique serine-threonine bias associated with the potential for O-glycosylation that was prominent in proteins associated with pathogen-host interactions. Furthermore, two paralogous protein families associated with immune evasion were identified, one of which contains poly G:C tracts, suggesting that they may play a role in phase variation and facilitation of persistent infections. Proteins associated with pathogen-host interactions were identified including a small group of proteins (12) with tandem repeats and another with eukaryotic-like ankyrin domains (7).
Energy Technology Data Exchange (ETDEWEB)
Yang, Bin [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Li, Wei [Department of Gerontology, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Zheng, Qichang [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Qin, Tao [Department of Hepatobiliary Pancreatic Surgery, People' s Hospital of Zhengzhou University, School of Medicine, Zhengzhou University, Zhengzhou 450003 (China); Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Liu, Sanguang, E-mail: sanguang1998@sina.com [Department of Hepatobiliary Surgery, The Second Hospital, Hebei Medical University, Shijiazhuang 050000 (China); Song, Zifang, E-mail: zsong@hust.edu.cn [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China)
2015-07-17
Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation.
International Nuclear Information System (INIS)
Yang, Bin; Li, Wei; Zheng, Qichang; Qin, Tao; Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen; Liu, Sanguang; Song, Zifang
2015-01-01
Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation
Eggler, Aimee L; Small, Evan; Hannink, Mark; Mesecar, Andrew D
2009-07-29
Nrf2 (nuclear factor erythroid 2-related factor 2) is a transcription factor that activates transcription of a battery of cytoprotective genes by binding to the ARE (antioxidant response element). Nrf2 is repressed by the cysteine-rich Keap1 (kelch-like ECH-associated protein 1) protein, which targets Nrf2 for ubiquitination and subsequent degradation by a Cul3 (cullin 3)-mediated ubiquitination complex. We find that modification of Cys(151) of human Keap1, by mutation to a tryptophan, relieves the repression by Keap1 and allows activation of the ARE by Nrf2. The Keap1 C151W substitution has a decreased affinity for Cul3, and can no longer serve to target Nrf2 for ubiquitination, though it retains its affinity for Nrf2. A series of 12 mutant Keap1 proteins, each containing a different residue at position 151, was constructed to explore the chemistry required for this effect. The series reveals that the extent to which Keap1 loses the ability to target Nrf2 for degradation, and hence the ability to repress ARE activation, correlates well with the partial molar volume of the residue. Other physico-chemical properties do not appear to contribute significantly to the effect. Based on this finding, a structural model is proposed whereby large residues at position 151 cause steric clashes that lead to alteration of the Keap1-Cul3 interaction. This model has significant implications for how electrophiles which modify Cys(151), disrupt the repressive function of Keap1.
The role of tumor suppressor p15Ink4b in the regulation of hematopoietic progenitor cell fate
International Nuclear Information System (INIS)
Humeniuk, R; Rosu-Myles, M; Fares, J; Koller, R; Bies, J; Wolff, L
2013-01-01
Epigenetic silencing of the tumor suppressor gene p15Ink4b (CDKN2B) is a frequent event in blood disorders like acute myeloid leukemia and myelodysplastic syndromes. The molecular function of p15Ink4b in hematopoietic differentiation still remains to be elucidated. Our previous study demonstrated that loss of p15Ink4b in mice results in skewing of the differentiation pattern of the common myeloid progenitor towards the myeloid lineage. Here, we investigated a function of p15Ink4b tumor suppressor gene in driving erythroid lineage commitment in hematopoietic progenitors. It was found that p15Ink4b is expressed more highly in committed megakaryocyte–erythroid progenitors than granulocyte–macrophage progenitors. More importantly, mice lacking p15Ink4b have lower numbers of primitive red cell progenitors and a severely impaired response to 5-fluorouracil- and phenylhydrazine-induced hematopoietic stress. Introduction of p15Ink4b into multipotential progenitors produced changes at the molecular level, including activation of mitogen-activated protein kinase/extracellular signal-regulated kinase (MEK/ERK) signaling, increase GATA-1, erythropoietin receptor (EpoR) and decrease Pu1, GATA-2 expression. These changes rendered cells more permissive to erythroid commitment and less permissive to myeloid commitment, as demonstrated by an increase in early burst-forming unit-erythroid formation with concomitant decrease in myeloid colonies. Our results indicate that p15Ink4b functions in hematopoiesis, by maintaining proper lineage commitment of progenitors and assisting in rapid red blood cells replenishment following stress
RNA-Seq profiling reveals novel hepatic gene expression pattern in aflatoxin B1 treated rats.
Directory of Open Access Journals (Sweden)
B Alex Merrick
Full Text Available Deep sequencing was used to investigate the subchronic effects of 1 ppm aflatoxin B1 (AFB1, a potent hepatocarcinogen, on the male rat liver transcriptome prior to onset of histopathological lesions or tumors. We hypothesized RNA-Seq would reveal more differentially expressed genes (DEG than microarray analysis, including low copy and novel transcripts related to AFB1's carcinogenic activity compared to feed controls (CTRL. Paired-end reads were mapped to the rat genome (Rn4 with TopHat and further analyzed by DESeq and Cufflinks-Cuffdiff pipelines to identify differentially expressed transcripts, new exons and unannotated transcripts. PCA and cluster analysis of DEGs showed clear separation between AFB1 and CTRL treatments and concordance among group replicates. qPCR of eight high and medium DEGs and three low DEGs showed good comparability among RNA-Seq and microarray transcripts. DESeq analysis identified 1,026 differentially expressed transcripts at greater than two-fold change (p<0.005 compared to 626 transcripts by microarray due to base pair resolution of transcripts by RNA-Seq, probe placement within transcripts or an absence of probes to detect novel transcripts, splice variants and exons. Pathway analysis among DEGs revealed signaling of Ahr, Nrf2, GSH, xenobiotic, cell cycle, extracellular matrix, and cell differentiation networks consistent with pathways leading to AFB1 carcinogenesis, including almost 200 upregulated transcripts controlled by E2f1-related pathways related to kinetochore structure, mitotic spindle assembly and tissue remodeling. We report 49 novel, differentially-expressed transcripts including confirmation by PCR-cloning of two unique, unannotated, hepatic AFB1-responsive transcripts (HAfT's on chromosomes 1.q55 and 15.q11, overexpressed by 10 to 25-fold. Several potentially novel exons were found and exon refinements were made including AFB1 exon-specific induction of homologous family members, Ugt1a6 and Ugt1a7c
Structure of the hDmc1-ssDNA filament reveals the principles of its architecture.
Directory of Open Access Journals (Sweden)
Andrei L Okorokov
Full Text Available In eukaryotes, meiotic recombination is a major source of genetic diversity, but its defects in humans lead to abnormalities such as Down's, Klinefelter's and other syndromes. Human Dmc1 (hDmc1, a RecA/Rad51 homologue, is a recombinase that plays a crucial role in faithful chromosome segregation during meiosis. The initial step of homologous recombination occurs when hDmc1 forms a filament on single-stranded (ss DNA. However the structure of this presynaptic complex filament for hDmc1 remains unknown. To compare hDmc1-ssDNA complexes to those known for the RecA/Rad51 family we have obtained electron microscopy (EM structures of hDmc1-ssDNA nucleoprotein filaments using single particle approach. The EM maps were analysed by docking crystal structures of Dmc1, Rad51, RadA, RecA and DNA. To fully characterise hDmc1-DNA complexes we have analysed their organisation in the presence of Ca2+, Mg2+, ATP, AMP-PNP, ssDNA and dsDNA. The 3D EM structures of the hDmc1-ssDNA filaments allowed us to elucidate the principles of their internal architecture. Similar to the RecA/Rad51 family, hDmc1 forms helical filaments on ssDNA in two states: extended (active and compressed (inactive. However, in contrast to the RecA/Rad51 family, and the recently reported structure of hDmc1-double stranded (ds DNA nucleoprotein filaments, the extended (active state of the hDmc1 filament formed on ssDNA has nine protomers per helical turn, instead of the conventional six, resulting in one protomer covering two nucleotides instead of three. The control reconstruction of the hDmc1-dsDNA filament revealed 6.4 protein subunits per helical turn indicating that the filament organisation varies depending on the DNA templates. Our structural analysis has also revealed that the N-terminal domain of hDmc1 accomplishes its important role in complex formation through domain swapping between adjacent protomers, thus providing a mechanistic basis for coordinated action of hDmc1 protomers
Directory of Open Access Journals (Sweden)
Minghua Nie
2016-07-01
Full Text Available Posttranslational modifications (PTMs provide dynamic regulation of the cellular proteome, which is critical for both normal cell growth and for orchestrating rapid responses to environmental stresses, e.g. genotoxins. Key PTMs include ubiquitin, the Small Ubiquitin-like MOdifier SUMO, and phosphorylation. Recently, SUMO-targeted ubiquitin ligases (STUbLs were found to integrate signaling through the SUMO and ubiquitin pathways. In general, STUbLs are recruited to target proteins decorated with poly-SUMO chains to ubiquitinate them and drive either their extraction from protein complexes, and/or their degradation at the proteasome. In fission yeast, reducing or preventing the formation of SUMO chains can circumvent the essential and DNA damage response functions of STUbL. This result indicates that whilst some STUbL "targets" have been identified, the crucial function of STUbL is to antagonize SUMO chain formation. Herein, by screening for additional STUbL suppressors, we reveal crosstalk between the serine/threonine phosphatase PP2A-Pab1B55 and the SUMO pathway. A hypomorphic Pab1B55 mutant not only suppresses STUbL dysfunction, but also mitigates the phenotypes associated with deletion of the SUMO protease Ulp2, or mutation of the STUbL cofactor Rad60. Together, our results reveal a novel role for PP2A-Pab1B55 in modulating SUMO pathway output, acting in parallel to known critical regulators of SUMOylation homeostasis. Given the broad evolutionary functional conservation of the PP2A and SUMO pathways, our results could be relevant to the ongoing attempts to therapeutically target these factors.
Directory of Open Access Journals (Sweden)
Saliha Ece Acuner Ozbabacan
2014-02-01
Full Text Available Interleukin-1 (IL-1 is a large cytokine family closely related to innate immunity and inflammation. IL-1 proteins are key players in signaling pathways such as apoptosis, TLR, MAPK, NLR and NF-κB. The IL-1 pathway is also associated with cancer, and chronic inflammation increases the risk of tumor development via oncogenic mutations. Here we illustrate that the structures of interfaces between proteins in this pathway bearing the mutations may reveal how. Proteins are frequently regulated via their interactions, which can turn them ON or OFF. We show that oncogenic mutations are significantly at or adjoining interface regions, and can abolish (or enhance the protein-protein interaction, making the protein constitutively active (or inactive, if it is a repressor. We combine known structures of protein-protein complexes and those that we have predicted for the IL-1 pathway, and integrate them with literature information. In the reconstructed pathway there are 104 interactions between proteins whose three dimensional structures are experimentally identified; only 15 have experimentally-determined structures of the interacting complexes. By predicting the protein-protein complexes throughout the pathway via the PRISM algorithm, the structural coverage increases from 15% to 71%. In silico mutagenesis and comparison of the predicted binding energies reveal the mechanisms of how oncogenic and single nucleotide polymorphism (SNP mutations can abrogate the interactions or increase the binding affinity of the mutant to the native partner. Computational mapping of mutations on the interface of the predicted complexes may constitute a powerful strategy to explain the mechanisms of activation/inhibition. It can also help explain how an oncogenic mutation or SNP works.
Perrotta, Silverio; Cucciolla, Valeria; Ferraro, Marcella; Ronzoni, Luisa; Tramontano, Annunziata; Rossi, Francesca; Scudieri, Anna Chiara; Borriello, Adriana; Roberti, Domenico; Nobili, Bruno; Cappellini, Maria Domenica; Oliva, Adriana; Amendola, Giovanni; Migliaccio, Anna Rita; Mancuso, Patrizia; Martin-Padura, Ines; Bertolini, Francesco; Yoon, Donghoon; Prchal, Josef T.; Della Ragione, Fulvio
2010-01-01
Background Gain-of-function of erythropoietin receptor (EPOR) mutations represent the major cause of primary hereditary polycythemia. EPOR is also found in non-erythroid tissues, although its physiological role is still undefined. Methodology/Principal Findings We describe a family with polycythemia due to a heterozygous mutation of the EPOR gene that causes a G→T change at nucleotide 1251 of exon 8. The novel EPOR G1251T mutation results in the replacement of a glutamate residue by a stop codon at amino acid 393. Differently from polycythemia vera, EPOR G1251T CD34+ cells proliferate and differentiate towards the erythroid phenotype in the presence of minimal amounts of EPO. Moreover, the affected individuals show a 20-fold increase of circulating endothelial precursors. The analysis of erythroid precursor membranes demonstrates a heretofore undescribed accumulation of the truncated EPOR, probably due to the absence of residues involved in the EPO-dependent receptor internalization and degradation. Mutated receptor expression in EPOR-negative cells results in EPOR and Stat5 phosphorylation. Moreover, patient erythroid precursors present an increased activation of EPOR and its effectors, including Stat5 and Erk1/2 pathway. Conclusions/Significance Our data provide an unanticipated mechanism for autosomal dominant inherited polycythemia due to a heterozygous EPOR mutation and suggest a regulatory role of EPO/EPOR pathway in human circulating endothelial precursors homeostasis. PMID:20700488
Directory of Open Access Journals (Sweden)
Chad M. Toledo
2015-12-01
Full Text Available To identify therapeutic targets for glioblastoma (GBM, we performed genome-wide CRISPR-Cas9 knockout (KO screens in patient-derived GBM stem-like cells (GSCs and human neural stem/progenitors (NSCs, non-neoplastic stem cell controls, for genes required for their in vitro growth. Surprisingly, the vast majority GSC-lethal hits were found outside of molecular networks commonly altered in GBM and GSCs (e.g., oncogenic drivers. In vitro and in vivo validation of GSC-specific targets revealed several strong hits, including the wee1-like kinase, PKMYT1/Myt1. Mechanistic studies demonstrated that PKMYT1 acts redundantly with WEE1 to inhibit cyclin B-CDK1 activity via CDK1-Y15 phosphorylation and to promote timely completion of mitosis in NSCs. However, in GSCs, this redundancy is lost, most likely as a result of oncogenic signaling, causing GBM-specific lethality.
Nucleoli in human early erythroblasts (K2, K1, K1/2 cells).
Smetana, K; Jirásková, I; Klamová, H
2005-01-01
Human early erythroid precursors classified according to the nuclear size were studied to provide information on nucleoli in these cells using simple cytochemical procedures for demonstration of RNA and proteins of silver-stained nucleolar organizers. K2 cells with nuclear diameter larger than 13 microm and K1 cells with nuclear diameter larger than 9 microm corresponding to proerythroblasts and macroblasts (large basophilic erythroblasts) mostly possessed large irregularly shaped nucleoli with multiple fibrillar centres representing "active nucleoli". K1/2 cells with nuclear diameter smaller than 9 microm corresponding to small basophilic erythroblasts were usually characterized by the presence of micronucleoli representing "inactive nucleolar types". On the other hand, a few K1/2 cells contained large nucleoli with multiple fibrillar centres similar to those present in K2 cells and thus appeared as "microproerythroblasts". The nucleolar asynchrony expressed by the presence of large irregularly shaped nucleoli with multiple nucleoli (active nucleoli) and ring-shaped nucleoli (resting nucleoli) in one and the same nucleus of K2 or K1 cells was not exceptional and might reflect a larger resistance of these cells to negative factors influencing the erythropoiesis. The intranucleolar translocation of silver-stained nucleolus organized regions was noted in K2 cells and might indicate the premature aging of these cells without further differentiation. More studies, however, are required in this direction.
Koh, Won Uk; Choi, Seong-Soo; Kim, Ji Hyun; Yoon, Hye Joo; Ahn, Ho-Soo; Lee, Sun Kyung; Leem, Jeong Gil; Song, Jun Gol; Shin, Jin Woo
2016-06-21
Resiniferatoxin (RTX) is a potent analog of capsaicin and activates transient receptor potential (TRP) vanilloid type (TRPV) 1. In the current study, we investigated the preventive effect of perineural RTX on the development of cold hypersensitivity induced by spinal nerve ligation (SNL) in rats. Furthermore, we examined the association between the expression level of TRPV1, TRP ankyrin type (TRPA) 1 and TRP melastatin type (TRPM) 8 in the dorsal root ganglion (DRG) and cold hypersensitivity after SNL. RTX pretreatment prevented the development of SNL-induced hypersensitivity to mechanical, thermal, and cold stimuli. Western blot analysis 4 weeks after RTX pretreatment showed that RTX pretreatment decreased the protein expression level of SNL-induced TRPM8, but not TRPV1 or TRPA1, in the DRG of SNL rats. Immunofluorescent analysis revealed that up-regulated TRPM8-stained neurons after SNL co-localized with neurofilament 200-positive neurons located in the DRG. Pretreatment with perineural RTX significantly inhibits SNL-induced mechanical, thermal, and cold hypersensitivity. The antinociceptive effect of perineural RTX, especially on cold hypersensitivity, may be related to the suppression of TRPM8 expression in DRG.
Sarangi, Susmita; Lanikova, Lucie; Kapralova, Katarina; Acharya, Suchitra; Swierczek, Sabina; Lipton, Jeffrey M; Wolfe, Lawrence; Prchal, Josef T
2014-11-01
von Hippel-Lindau (VHL) protein is the principal negative regulator of hypoxia sensing mediated by transcription factors. Mutations in exon 3 of the VHL gene lead to Chuvash (VHL(R200W)) and Croatian (VHL(H191D)) polycythemias. Here, we describe an infant of Bangladesh ethnicity with a novel homozygous VHL(D126N) mutation with congenital polycythemia and dramatically elevated erythropoietin (EPO) levels, who developed severe fatal pulmonary hypertension. In contrast to Chuvash polycythemia, erythroid progenitors (BFU-Es) did not reveal a marked EPO hypersensitivity. Further, NF-E2 and RUNX1 transcripts that correlate with BFU-Es EPO hypersensitivity in polycythemic mutations were not elevated. © 2014 Wiley Periodicals, Inc.
The proto-oncogenic protein TAL1 controls TGF-β1 signaling through interaction with SMAD3
Directory of Open Access Journals (Sweden)
Jean-Michel Terme
2016-06-01
Full Text Available TGF-β1 is involved in many aspects of tissue development and homeostasis including hematopoiesis. The TAL1 transcription factor is also an important player of this latter process and is expressed very early in the myeloid and erythroid lineages. We previously established a link between TGF-β1 signaling and TAL1 by showing that the cytokine was able to induce its proteolytic degradation by the ubiquitin proteasome pathway. In this manuscript we show that TAL1 interacts with SMAD3 that acts in the pathway downstream of TGF-β1 association with its receptor. TAL1 expression strengthens the positive or negative effect of SMAD3 on various genes. Both transcription factors activate the inhibitory SMAD7 factor through the E box motif present in its transcriptional promoter. DNA precipitation assays showed that TAL1 present in Jurkat or K562 cells binds to this SMAD binding element in a SMAD3 dependent manner. SMAD3 and TAL1 also inhibit several genes including ID1, hTERT and TGF-β1 itself. In this latter case TAL1 and SMAD3 can impair the positive effect exerted by E47. Our results indicate that TAL1 expression can modulate TGF-β1 signaling by interacting with SMAD3 and by increasing its transcriptional properties. They also suggest the existence of a negative feedback loop between TAL1 expression and TGF-β1 signaling.
Li, Guohui; Hu, Zhaoyang; Guo, Xuli; Li, Guangtian; Tang, Qi; Wang, Peng; Chen, Keping; Yao, Qin
2013-06-01
Bombyx mori bidensovirus (BmBDV) VD1-ORF4 (open reading frame 4, ORF4) consists of 3,318 nucleotides, which codes for a predicted 1,105-amino acid protein containing a conserved DNA polymerase motif. However, its functions in viral propagation remain unknown. In the current study, the transcription of VD1-ORF4 was examined from 6 to 96 h postinfection (p.i.) by RT-PCR, 5'-RACE revealed the transcription initiation site of BmBDV ORF4 to be -16 nucleotides upstream from the start codon, and 3'-RACE revealed the transcription termination site of VD1-ORF4 to be +7 nucleotides downstream from termination codon. Three different proteins were examined in the extracts of BmBDV-infected silkworms midguts by Western blot using raised antibodies against VD1-ORF4 deduced amino acid, and a specific protein band about 53 kDa was further detected in purified virions using the same antibodies. Taken together, BmBDV VD1-ORF4 codes for three or more proteins during the viral life cycle, one of which is a 53 kDa protein and confirmed to be a component of BmBDV virion.
Fasani, Elisa; DalCorso, Giovanni; Varotto, Claudio; Li, Mingai; Visioli, Giovanna; Mattarozzi, Monica; Furini, Antonella
2017-06-01
In the hyperaccumulator Arabidopsis halleri, the zinc (Zn) vacuolar transporter MTP1 is a key component of hypertolerance. Because protein sequences and functions are highly conserved between A. halleri and Arabidopsis thaliana, Zn tolerance in A. halleri may reflect the constitutively higher MTP1 expression compared with A. thaliana, based on copy number expansion and different cis regulation. Three MTP1 promoters were characterized in A. halleri ecotype I16. The comparison with the A. thaliana MTP1 promoter revealed different expression profiles correlated with specific cis-acting regulatory elements. The MTP1 5' untranslated region, highly conserved among A. thaliana, Arabidopsis lyrata and A. halleri, contains a dimer of MYB-binding motifs in the A. halleri promoters absent in the A. thaliana and A. lyrata sequences. Site-directed mutagenesis of these motifs revealed their role for expression in trichomes. A. thaliana mtp1 transgenic lines expressing AtMTP1 controlled by the native A. halleri promoter were more Zn-tolerant than lines carrying mutations on MYB-binding motifs. Differences in Zn tolerance were associated with different distribution of Zn among plant organs and in trichomes. The different cis-acting elements in the MTP1 promoters of A. halleri, particularly the MYB-binding sites, are probably involved in the evolution of Zn tolerance. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Zhang, Yiguo; Qiu, Lu; Li, Shaojun; Xiang, Yuancai; Chen, Jiayu; Ren, Yonggang
2014-01-01
The C-terminal domain (CTD, aa 686-741) of nuclear factor-erythroid 2 p45-related factor 1 (Nrf1) shares 53% amino acid sequence identity with the equivalent Neh3 domain of Nrf2, a homologous transcription factor. The Neh3 positively regulates Nrf2, but whether the Neh3-like (Neh3L) CTD of Nrf1 has a similar role in regulating Nrf1-target gene expression is unknown. Herein, we report that CTD negatively regulates the full-length Nrf1 (i.e. 120-kDa glycoprotein and 95-kDa deglycoprotein) and its shorter isoform LCR-F1/Nrf1β (55-kDa). Attachment of its CTD-adjoining 112-aa to the C-terminus of Nrf2 yields the chimaeric Nrf2-C112Nrf1 factor with a markedly decreased activity. Live-cell imaging of GFP-CTD reveals that the extra-nuclear portion of the fusion protein is allowed to associate with the endoplasmic reticulum (ER) membrane through the amphipathic Neh3L region of Nrf1 and its basic c-tail. Thus removal of either the entire CTD or the essential Neh3L portion within CTD from Nrf1, LCR-F1/Nrf1β and Nrf2-C112Nrf1, results in an increase in their transcriptional ability to regulate antioxidant response element (ARE)-driven reporter genes. Further examinations unravel that two smaller isoforms, 36-kDa Nrf1γ and 25-kDa Nrf1δ, act as dominant-negative inhibitors to compete against Nrf1, LCR-F1/Nrf1β and Nrf2. Relative to Nrf1, LCR-F1/Nrf1β is a weak activator, that is positively regulated by its Asn/Ser/Thr-rich (NST) domain and acidic domain 2 (AD2). Like AD1 of Nrf1, both AD2 and NST domain of LCR-F1/Nrf1β fused within two different chimaeric contexts to yield Gal4D:Nrf1β607 and Nrf1β:C270Nrf2, positively regulate their transactivation activity of cognate Gal4- and Nrf2-target reporter genes. More importantly, differential expression of endogenous ARE-battery genes is attributable to up-regulation by Nrf1 and LCR-F1/Nrf1β and down-regulation by Nrf1γ and Nrf1δ.
Protein Profiling Reveals Novel Proteins in Pollen and Pistil of W22 (ga1; Ga1 in Maize
Directory of Open Access Journals (Sweden)
Jin Yu
2014-05-01
Full Text Available Gametophytic factors mediate pollen-pistil interactions in maize (Zea mays L. and play active roles in limiting gene flow among maize populations and between maize and teosinte. This study was carried out to identify proteins and investigate the mechanism of gametophytic factors using protein analysis. W22 (ga1; which did not carry a gametophytic factor and W22 (Ga1, a near iso-genic line, were used for the proteome investigation. SDS-PAGE was executed to investigate proteins in the pollen and pistil of W22 (ga1 and W22 (Ga1. A total of 44 differentially expressed proteins were identified in the pollen and pistil on SDS-PAGE using LTQ-FTICR MS. Among the 44 proteins, a total of 24 proteins were identified in the pollen of W22 (ga1 and W22 (Ga1 whereas 20 differentially expressed proteins were identified from the pistil of W22 (ga1 and W22 (Ga1. However, in pollen, 2 proteins were identified only in the W22 (ga1 and 12 proteins only in the W22 (Ga1 whereas 10 proteins were confirmed from the both of W22 (ga1 and W22 (Ga1. In contrary, 10 proteins were appeared only in the pistil of W22 (ga1 and 7 proteins from W22 (Ga1 while 3 proteins confirmed in the both of W22 (ga1 and W22 (Ga1. Moreover, the identified proteins were generally involved in hydrolase activity, nucleic acid binding and nucleotide binding. These results help to reveal the mechanism of gametophytic factors and provide a valuable clue for the pollen and pistil research in maize.
Casey, Eoghan; Mahony, Jennifer; Neve, Horst; Noben, Jean-Paul; Dal Bello, Fabio; van Sinderen, Douwe
2015-02-01
Ldl1 is a virulent phage infecting the dairy starter Lactobacillus delbrueckii subsp. lactis LdlS. Electron microscopy analysis revealed that this phage exhibits a large head and a long tail and bears little resemblance to other characterized phages infecting Lactobacillus delbrueckii. In vitro propagation of this phage revealed a latent period of 30 to 40 min and a burst size of 59.9 +/- 1.9 phage particles. Comparative genomic and proteomic analyses showed remarkable similarity between the genome of Ldl1 and that of Lactobacillus plantarum phage ATCC 8014-B2. The genomic and proteomic characteristics of Ldl1 demonstrate that this phage does not belong to any of the four previously recognized L. delbrueckii phage groups, necessitating the creation of a new group, called group e, thus adding to the knowledge on the diversity of phages targeting strains of this industrially important lactic acid bacterial species.
Bradykinin stimulation of nitric oxide production is not sufficient for gamma-globin induction
Directory of Open Access Journals (Sweden)
Čokić Vladan P.
2014-01-01
Full Text Available Introduction. Hydroxycarbamide, used in therapy of hemoglobinopathies, enhances nitric oxide (NO production both in primary human umbilical vein endothelial cells (HUVECs and human bone marrow endothelial cell line (TrHBMEC. Moreover, NO increases γ-globin and fetal hemoglobin levels in human erythroid progenitors. Objective. In order to find out whether simple physiologic stimulation of NO production by components of hematopoietic microenvironment can increase γ-globin gene expression, the effects of NO-inducer bradykinin were examined in endothelial cells. Methods. The study was performed in co-cultures of human erythroid progenitors, TrHBMEC and HUVECs by ozone-based chemiluminescent determination of NO and real-time quantitative RT-PCR. Results. In accordance with previous reports, the endogenous factor bradykinin increased endothelial cell production of NO in a dose- and time-dependent manner (0.1-0.6 μM up to 30 minutes. This induction of NO in HUVECs and TrHBMEC by bradykinin was blocked by competitive inhibitors of NO synthase (NOS, demonstrating NOS-dependence. It has been shown that bradykinin significantly reduced endothelial NOS (eNOS mRNA level and eNOS/Я-actin ratio in HUVEC (by twofold. In addition, bradykinin failed to increase γ-globin mRNA expression in erythroid progenitors only, as well as in co-culture studies of erythroid progenitors with TrHBMEC and HUVEC after 24 hours of treatment. Furthermore, bradykinin did not induce γ/β globin ratio in erythroid progenitors in co-cultures with HUVEC. Conclusion. Bradykinin mediated eNOS activation leads to short time and low NO production in endothelial cells, insufficient to induce γ-globin gene expression. These results emphasized the significance of elevated and extended NO production in augmentation of γ-globin gene expression. [Projekat Ministarstva nauke Republike Srbije, br. 175053
Directory of Open Access Journals (Sweden)
Schwend Tyler
2009-11-01
Full Text Available Abstract Background The vertebrate head skeleton is derived largely from cranial neural crest cells (CNCC. Genetic studies in zebrafish and mice have established that the Hedgehog (Hh-signaling pathway plays a critical role in craniofacial development, partly due to the pathway's role in CNCC development. Disruption of the Hh-signaling pathway in humans can lead to the spectral disorder of Holoprosencephaly (HPE, which is often characterized by a variety of craniofacial defects including midline facial clefting and cyclopia 12. Previous work has uncovered a role for Hh-signaling in zebrafish dorsal neurocranium patterning and chondrogenesis, however Hh-signaling mutants have not been described with respect to the ventral pharyngeal arch (PA skeleton. Lipid-modified Hh-ligands require the transmembrane-spanning receptor Dispatched 1 (Disp1 for proper secretion from Hh-synthesizing cells to the extracellular field where they act on target cells. Here we study chameleon mutants, lacking a functional disp1(con/disp1. Results con/disp1 mutants display reduced and dysmorphic mandibular and hyoid arch cartilages and lack all ceratobranchial cartilage elements. CNCC specification and migration into the PA primorida occurs normally in con/disp1 mutants, however disp1 is necessary for post-migratory CNCC patterning and differentiation. We show that disp1 is required for post-migratory CNCC to become properly patterned within the first arch, while the gene is dispensable for CNCC condensation and patterning in more posterior arches. Upon residing in well-formed pharyngeal epithelium, neural crest condensations in the posterior PA fail to maintain expression of two transcription factors essential for chondrogenesis, sox9a and dlx2a, yet continue to robustly express other neural crest markers. Histology reveals that posterior arch residing-CNCC differentiate into fibrous-connective tissue, rather than becoming chondrocytes. Treatments with Cyclopamine, to
Directory of Open Access Journals (Sweden)
Kai-Chun Chang
2012-01-01
Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.
Wang, Shuai; Hannafon, Bethany N; Wolf, Roman F; Zhou, Jundong; Avery, Jori E; Wu, Jinchang; Lind, Stuart E; Ding, Wei-Qun
2014-05-01
The effect of docosahexaenoic acid (DHA) on heme oxygenase-1 (HO-1) expression in cancer cells has never been characterized. This study examines DHA-induced HO-1 expression in human cancer cell model systems. DHA enhanced HO-1 gene expression in a time- and concentration-dependent manner, with maximal induction at 21 h of treatment. This induction of HO-1 expression was confirmed in vivo using a xenograft nude mouse model fed a fish-oil-enriched diet. The increase in HO-1 gene transcription induced by DHA was significantly attenuated by the antioxidant N-acetyl cysteine, suggesting the involvement of oxidative stress. This was supported by direct measurement of lipid peroxide levels after DHA treatment. Using a human HO-1 gene promoter reporter construct, we identified two antioxidant response elements (AREs) that mediate the DHA-induced increase in HO-1 gene transcription. Knockdown of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) expression compromised the DHA-induced increase in HO-1 gene transcription, indicating the importance of the Nrf2 pathway in this event. However, the nuclear protein levels of Nrf2 remained unchanged upon DHA treatment. Further studies demonstrated that DHA reduces nuclear Bach1 protein expression by promoting its degradation and attenuates Bach1 binding to the AREs in the HO-1 gene promoter. In contrast, DHA enhanced Nrf2 binding to the AREs without affecting nuclear Nrf2 expression levels, indicating a new cellular mechanism that mediates DHA's induction of HO-1 gene transcription. To our knowledge, this is the first characterization of DHA-induced HO-1 expression in human malignant cells. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Po-Len Liu
2014-01-01
Full Text Available Proliferation of vascular smooth muscle cells (VSMCs triggered by inflammatory stimuli and oxidative stress contributes importantly to atherogenesis. The association of green tea consumption with cardiovascular protection has been well documented in epidemiological observations, however, the underlying mechanisms remain unclear. This study aimed to elucidate the effects of the most active green tea catechin derivative, (−-epigallocatechin-3-gallate (EGCG, in human aortic smooth muscle cells (HASMCs, focusing particularly on the role of a potent anti-inflammatory and antioxidative enzyme heme oxygenase-1 (HO-1. We found that pretreatment of EGCG dose- and time-dependently induced HO-1 protein levels in HASMCs. EGCG inhibited interleukin- (IL-1β-induced HASMC proliferation and oxidative stress in a dose-dependent manner. The HO-1 inducer CoPPIX decreased IL-1β-induced cell proliferation, whereas the HO-1 enzyme inhibitor ZnPPIX significantly reversed EGCG-caused growth inhibition in IL-1β-treated HASMCs. At the molecular level, EGCG treatment significantly activated nuclear factor erythroid-2-related factor (Nrf2 transcription activities. These results suggest that EGCG might serve as a complementary and alternative medicine in the treatment of these pathologies by inducing HO-1 expression and subsequently decreasing VSMC proliferation.
International Nuclear Information System (INIS)
Bustos, Rodrigo I.; Jensen, Erik L.; Ruiz, Lina M.; Rivera, Salvador; Ruiz, Sebastián; Simon, Felipe; Riedel, Claudia; Ferrick, David; Elorza, Alvaro A.
2013-01-01
Highlights: •In copper deficiency, cell proliferation is not affected. In turn, cell differentiation is impaired. •Enlarged mitochondria are due to up-regulation of MNF2 and OPA1. •Mitochondria turn off respiratory chain and ROS production. •Energy metabolism switch from mitochondria to glycolysis. -- Abstract: Copper is essential in cell physiology, participating in numerous enzyme reactions. In mitochondria, copper is a cofactor for respiratory complex IV, the cytochrome c oxidase. Low copper content is associated with anemia and the appearance of enlarged mitochondria in erythropoietic cells. These findings suggest a connection between copper metabolism and bioenergetics, mitochondrial dynamics and erythropoiesis, which has not been explored so far. Here, we describe that bathocuproine disulfonate-induced copper deficiency does not alter erythropoietic cell proliferation nor induce apoptosis. However it does impair erythroid differentiation, which is associated with a metabolic switch between the two main energy-generating pathways. That is, from mitochondrial function to glycolysis. Switching off mitochondria implies a reduction in oxygen consumption and ROS generation along with an increase in mitochondrial membrane potential. Mitochondrial fusion proteins MFN2 and OPA1 were up-regulated along with the ability of mitochondria to fuse. Morphometric analysis of mitochondria did not show changes in total mitochondrial biomass but rather bigger mitochondria because of increased fusion. Similar results were also obtained with human CD34+, which were induced to differentiate into red blood cells. In all, we have shown that adequate copper levels are important for maintaining proper mitochondrial function and for erythroid differentiation where the energy metabolic switch plus the up-regulation of fusion proteins define an adaptive response to copper deprivation to keep cells alive
Energy Technology Data Exchange (ETDEWEB)
Bustos, Rodrigo I.; Jensen, Erik L.; Ruiz, Lina M.; Rivera, Salvador; Ruiz, Sebastián [Center for Biomedical Research, Faculty of Biological Sciences and Faculty of Medicine, Universidad Andres Bello, Santiago (Chile); Simon, Felipe; Riedel, Claudia [Center for Biomedical Research, Faculty of Biological Sciences and Faculty of Medicine, Universidad Andres Bello, Santiago (Chile); Millennium Institute of Immunology and Immunotherapy, Santiago (Chile); Ferrick, David [Seahorse Bioscience, Billerica, MA (United States); Elorza, Alvaro A., E-mail: aelorza@unab.cl [Center for Biomedical Research, Faculty of Biological Sciences and Faculty of Medicine, Universidad Andres Bello, Santiago (Chile); Millennium Institute of Immunology and Immunotherapy, Santiago (Chile)
2013-08-02
Highlights: •In copper deficiency, cell proliferation is not affected. In turn, cell differentiation is impaired. •Enlarged mitochondria are due to up-regulation of MNF2 and OPA1. •Mitochondria turn off respiratory chain and ROS production. •Energy metabolism switch from mitochondria to glycolysis. -- Abstract: Copper is essential in cell physiology, participating in numerous enzyme reactions. In mitochondria, copper is a cofactor for respiratory complex IV, the cytochrome c oxidase. Low copper content is associated with anemia and the appearance of enlarged mitochondria in erythropoietic cells. These findings suggest a connection between copper metabolism and bioenergetics, mitochondrial dynamics and erythropoiesis, which has not been explored so far. Here, we describe that bathocuproine disulfonate-induced copper deficiency does not alter erythropoietic cell proliferation nor induce apoptosis. However it does impair erythroid differentiation, which is associated with a metabolic switch between the two main energy-generating pathways. That is, from mitochondrial function to glycolysis. Switching off mitochondria implies a reduction in oxygen consumption and ROS generation along with an increase in mitochondrial membrane potential. Mitochondrial fusion proteins MFN2 and OPA1 were up-regulated along with the ability of mitochondria to fuse. Morphometric analysis of mitochondria did not show changes in total mitochondrial biomass but rather bigger mitochondria because of increased fusion. Similar results were also obtained with human CD34+, which were induced to differentiate into red blood cells. In all, we have shown that adequate copper levels are important for maintaining proper mitochondrial function and for erythroid differentiation where the energy metabolic switch plus the up-regulation of fusion proteins define an adaptive response to copper deprivation to keep cells alive.
Isthmin 1 (ism1) is required for normal hematopoiesis in developing zebrafish.
Berrun, Arturo; Harris, Elena; Stachura, David L
2018-01-01
Hematopoiesis is an essential and highly regulated biological process that begins with hematopoietic stem cells (HSCs). In healthy organisms, HSCs are responsible for generating a multitude of mature blood cells every day, yet the molecular pathways that instruct HSCs to self-renew and differentiate into post-mitotic blood cells are not fully known. To understand these molecular pathways, we investigated novel genes expressed in hematopoietic-supportive cell lines from the zebrafish (Danio rerio), a model system increasingly utilized to uncover molecular pathways important in the development of other vertebrate species. We performed RNA sequencing of the transcriptome of three stromal cell lines derived from different stages of embryonic and adult zebrafish and identified hundreds of highly expressed transcripts. For our studies, we focused on isthmin 1 (ism1) due to its shared synteny with its human gene ortholog and because it is a secreted protein. To characterize ism1, we performed loss-of-function experiments to identify if mature blood cell production was disrupted. Myeloid and erythroid lineages were visualized and scored with transgenic zebrafish expressing lineage-specific markers. ism1 knockdown led to reduced numbers of neutrophils, macrophages, and erythrocytes. Analysis of clonal methylcellulose assays from ism1 morphants also showed a reduction in total hematopoietic stem and progenitor cells (HSPCs). Overall, we demonstrate that ism1 is required for normal generation of HSPCs and their downstream progeny during zebrafish hematopoiesis. Further investigation into ism1 and its importance in hematopoiesis may elucidate evolutionarily conserved processes in blood formation that can be further investigated for potential clinical utility.
Isthmin 1 (ism1) is required for normal hematopoiesis in developing zebrafish
Berrun, Arturo; Harris, Elena
2018-01-01
Hematopoiesis is an essential and highly regulated biological process that begins with hematopoietic stem cells (HSCs). In healthy organisms, HSCs are responsible for generating a multitude of mature blood cells every day, yet the molecular pathways that instruct HSCs to self-renew and differentiate into post-mitotic blood cells are not fully known. To understand these molecular pathways, we investigated novel genes expressed in hematopoietic-supportive cell lines from the zebrafish (Danio rerio), a model system increasingly utilized to uncover molecular pathways important in the development of other vertebrate species. We performed RNA sequencing of the transcriptome of three stromal cell lines derived from different stages of embryonic and adult zebrafish and identified hundreds of highly expressed transcripts. For our studies, we focused on isthmin 1 (ism1) due to its shared synteny with its human gene ortholog and because it is a secreted protein. To characterize ism1, we performed loss-of-function experiments to identify if mature blood cell production was disrupted. Myeloid and erythroid lineages were visualized and scored with transgenic zebrafish expressing lineage-specific markers. ism1 knockdown led to reduced numbers of neutrophils, macrophages, and erythrocytes. Analysis of clonal methylcellulose assays from ism1 morphants also showed a reduction in total hematopoietic stem and progenitor cells (HSPCs). Overall, we demonstrate that ism1 is required for normal generation of HSPCs and their downstream progeny during zebrafish hematopoiesis. Further investigation into ism1 and its importance in hematopoiesis may elucidate evolutionarily conserved processes in blood formation that can be further investigated for potential clinical utility. PMID:29758043
Tian, Renmao
2014-08-29
Sulfur-reducing bacteria (SRB) and sulfur-oxidizing bacteria (SOB) play essential roles in marine sponges. However, the detailed characteristics and physiology of the bacteria are largely unknown. Here, we present and analyse the first genome of sponge-associated SOB using a recently developed metagenomic binning strategy. The loss of transposase and virulence-associated genes and the maintenance of the ancient polyphosphate glucokinase gene suggested a stabilized SOB genome that might have coevolved with the ancient host during establishment of their association. Exclusive distribution in sponge, bacterial detoxification for the host (sulfide oxidation) and the enrichment for symbiotic characteristics (genes-encoding ankyrin) in the SOB genome supported the bacterial role as an intercellular symbiont. Despite possessing complete autotrophic sulfur oxidation pathways, the bacterium developed a much more versatile capacity for carbohydrate uptake and metabolism, in comparison with its closest relatives (Thioalkalivibrio) and to other representative autotrophs from the same order (Chromatiales). The ability to perform both autotrophic and heterotrophic metabolism likely results from the unstable supply of reduced sulfur in the sponge and is considered critical for the sponge-SOB consortium. Our study provides insights into SOB of sponge-specific clade with thioautotrophic and versatile heterotrophic metabolism relevant to its roles in the micro-environment of the sponge body. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
The Structure of Neurexin 1[alpha] Reveals Features Promoting a Role as Synaptic Organizer
Energy Technology Data Exchange (ETDEWEB)
Chen, Fang; Venugopal, Vandavasi; Murray, Beverly; Rudenko, Gabby (Michigan)
2014-10-02
{alpha}-Neurexins are essential synaptic adhesion molecules implicated in autism spectrum disorder and schizophrenia. The {alpha}-neurexin extracellular domain consists of six LNS domains interspersed by three EGF-like repeats and interacts with many different proteins in the synaptic cleft. To understand how {alpha}-neurexins might function as synaptic organizers, we solved the structure of the neurexin 1{alpha} extracellular domain (n1{alpha}) to 2.65 {angstrom}. The L-shaped molecule can be divided into a flexible repeat I (LNS1-EGF-A-LNS2), a rigid horseshoe-shaped repeat II (LNS3-EGF-B-LNS4) with structural similarity to so-called reelin repeats, and an extended repeat III (LNS5-EGF-B-LNS6) with controlled flexibility. A 2.95 {angstrom} structure of n1{alpha} carrying splice insert SS3 in LNS4 reveals that SS3 protrudes as a loop and does not alter the rigid arrangement of repeat II. The global architecture imposed by conserved structural features enables {alpha}-neurexins to recruit and organize proteins in distinct and variable ways, influenced by splicing, thereby promoting synaptic function.
Detection of trans-acting factors for hemoglobin switching by cell fusions
International Nuclear Information System (INIS)
Broyles, R.H.; Palmer, J.C.; Smith, D.J.; Ramseyer, T.H.
1986-01-01
The authors have devised protocols for chemically fusing erythroid cells from amphibians of different developmental stages, so that we may study the short-term effects of trans-acting factors on globin gene expression. The authors are performing both homospecifc (Rana x Rana) and heterospecific (Rana x Xenopus) fusions; and they are detecting the expression of specific globin genes with selective radioactive labeling ( 35 S-methionine is incorporated only into adult globins), polyacrylamide gel electrophoresis, monospecific antisera, and cDNA probes that are species-and developmental stage-specific. Their results indicate that: (1) there are factors in tadpole erythroblasts that can reactivate adult Hb synthesis in mature, synthetically-inactive adult RBCs; (2) there are factors in tadpole erythroblasts that can reactivate tadpole globin genes in adult RBCs; and (3) there are factors in adult erythroid cells that apparently activate adult globin genes in tadpole RBCs. These results suggests that erythroid cells from animals of different developmental stages possess different sets of globin gene-specific trans-acting factors which can be studied with a system that exhibits normal developmental Hb switching
Doulatov, Sergei; Vo, Linda T.; Chou, Stephanie S.; Kim, Peter G.; Arora, Natasha; Li, Hu; Hadland, Brandon K.; Bernstein, Irwin D.; Collins, James J.; Zon, Leonard I.; Daley, George Q.
2013-01-01
Summary Human pluripotent stem cells (hPSCs) represent a promising source of patient-specific cells for disease modeling, drug screens, and cellular therapies. However, the inability to derive engraftable human hematopoietic stem and progenitor (HSPCs) has limited their characterization to in vitro assays. We report a strategy to re-specify lineage-restricted CD34+CD45+ myeloid precursors derived from hPSCs into multilineage progenitors that can be expanded in vitro and engraft in vivo. HOXA9, ERG, and RORA conferred self-renewal and multilineage potential in vitro and maintained primitive CD34+CD38− cells. Screening cells via transplantation revealed that two additional factors, SOX4 and MYB, were required for engraftment. Progenitors specified with all five factors gave rise to reproducible short-term engraftment with myeloid and erythroid lineages. Erythroid precursors underwent hemoglobin switching in vivo, silencing embryonic and activating adult globin expression. Our combinatorial screening approach establishes a strategy for obtaining transcription factor-mediated engraftment of blood progenitors from human pluripotent cells. PMID:24094326
International Nuclear Information System (INIS)
Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia
2016-01-01
Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating
Energy Technology Data Exchange (ETDEWEB)
Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)
2016-08-01
Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating
Functional expression of TRPM8 and TRPA1 channels in rat odontoblasts.
Directory of Open Access Journals (Sweden)
Maki Tsumura
Full Text Available Odontoblasts produce dentin during development, throughout life, and in response to pathological conditions by sensing stimulation of exposed dentin. The functional properties and localization patterns of transient receptor potential (TRP melastatin subfamily member 8 (TRPM8 and ankyrin subfamily member 1 (TRPA1 channels in odontoblasts remain to be clarified. We investigated the localization and the pharmacological, biophysical, and mechano-sensitive properties of TRPM8 and TRPA1 channels in rat odontoblasts. Menthol and icilin increased the intracellular free Ca(2+ concentration ([Ca(2+]i. Icilin-, WS3-, or WS12-induced [Ca(2+]i increases were inhibited by capsazepine or 5-benzyloxytriptamine. The increase in [Ca(2+]i elicited by allyl isothiocyanate (AITC was inhibited by HC030031. WS12 and AITC exerted a desensitizing effect on [Ca(2+]i increase. Low-temperature stimuli elicited [Ca(2+]i increases that are sensitive to both 5-benzyloxytriptamine and HC030031. Hypotonic stimulation-induced membrane stretch increased [Ca(2+]i; HC030031 but not 5-benzyloxytriptamine inhibited the effect. The results suggest that TRPM8 channels in rat odontoblasts play a role in detecting low-temperature stimulation of the dentin surface and that TRPA1 channels are involved in sensing membrane stretching and low-temperature stimulation. The results also indicate that odontoblasts act as mechanical and thermal receptor cells, detecting the stimulation of exposed dentin to drive multiple cellular functions, such as sensory transduction.
Five hTRPA1 Agonists Found in Indigenous Korean Mint, Agastache rugosa.
Directory of Open Access Journals (Sweden)
Hana Moon
Full Text Available Transient receptor potential ankyrin1 (TRPA1 and transient receptor potential vanilloid 1 (TRPV1 are members of the TRP superfamily of structurally related, nonselective cation channels and mediators of several signaling pathways. Previously, we identified methyl syringate as an hTRPA1 agonist with efficacy against gastric emptying. The aim of this study was to find hTRPA1 and/or hTRPV1 activators in Agastache rugosa (Fisch. et Meyer O. Kuntze (A.rugosa, commonly known as Korean mint to improve hTRPA1-related phenomena. An extract of the stem and leaves of A.rugosa (Labiatae selectively activated hTRPA1 and hTRPV1. We next investigated the effects of commercially available compounds found in A.rugosa (acacetin, 4-allylanisole, p-anisaldehyde, apigenin 7-glucoside, L-carveol, β-caryophyllene, trans-p-methoxycinnamaldehyde, methyl eugenol, pachypodol, and rosmarinic acid on cultured hTRPA1- and hTRPV1-expressing cells. Of the ten compounds, L-carveol, trans-p-methoxycinnamaldehyde, methyl eugenol, 4-allylanisole, and p-anisaldehyde selectively activated hTRPA1, with EC50 values of 189.1±26.8, 29.8±14.9, 160.2±21.9, 1535±315.7, and 546.5±73.0 μM, respectively. The activities of these compounds were effectively inhibited by the hTRPA1 antagonists, ruthenium red and HC-030031. Although the five active compounds showed weaker calcium responses than allyl isothiocyanate (EC50=7.2±1.4 μM, our results suggest that these compounds from the stem and leaves of A.rugosa are specific and selective agonists of hTRPA1.
Yamamoto, Yuko; Hirai, Takaaki; Yamamoto, Eiji; Kawamura, Mayuko; Sato, Tomomi; Kitano, Hidemi; Matsuoka, Makoto; Ueguchi-Tanaka, Miyako
2010-01-01
To investigate gibberellin (GA) signaling using the rice (Oryza sativa) GA receptor GIBBERELLIN-INSENSITIVE DWARF1 (GID1) mutant gid1-8, we isolated a suppressor mutant, Suppressor of gid1-1 (Sgd-1). Sgd-1 is an intragenic mutant containing the original gid1-8 mutation (L45F) and an additional amino acid substitution (P99S) in the loop region. GID1P99S interacts with the rice DELLA protein SLENDER RICE1 (SLR1), even in the absence of GA. Substitution of the 99th Pro with other amino acids revealed that substitution with Ala (P99A) caused the highest level of GA-independent interaction. Physicochemical analysis using surface plasmon resonance revealed that GID1P99A has smaller Ka (association) and Kd (dissociation) values for GA4 than does wild-type GID1. This suggests that the GID1P99A lid is at least partially closed, resulting in both GA-independent and GA-hypersensitive interactions with SLR1. One of the three Arabidopsis thaliana GID1s, At GID1b, can also interact with DELLA proteins in the absence of GA, so we investigated whether GA-independent interaction of At GID1b depends on a mechanism similar to that of rice GID1P99A. Substitution of the loop region or a few amino acids of At GID1b with those of At GID1a diminished its GA-independent interaction with GAI while maintaining the GA-dependent interaction. Soybean (Glycine max) and Brassica napus also have GID1s similar to At GID1b, indicating that these unique GID1s occur in various dicots and may have important functions in these plants. PMID:21098733
Limou, Sophie; Delaneau, Olivier; van Manen, Daniëlle; An, Ping; Sezgin, Efe; Le Clerc, Sigrid; Coulonges, Cédric; Troyer, Jennifer L.; Veldink, Jan H.; van den Berg, Leonard H.; Spadoni, Jean-Louis; Taing, Lieng; Labib, Taoufik; Montes, Matthieu; Delfraissy, Jean-François; Schachter, François; O’Brien, Stephen J.; Buchbinder, Susan; van Natta, Mark L.; Jabs, Douglas A.; Froguel, Philippe; Schuitemaker, Hanneke; Winkler, Cheryl A.
2012-01-01
Background. To date, only mutations in CCR5 have been shown to confer resistance to human immunodeficiency virus type 1 (HIV-1) infection, and these explain only a small fraction of the observed variability in HIV susceptibility. Methods. We performed a meta-analysis between 2 independent European genomewide association studies, each comparing HIV-1 seropositive cases with normal population controls known to be HIV uninfected, to identify single-nucleotide polymorphisms (SNPs) associated with the HIV-1 acquisition phenotype. SNPs exhibiting P < 10−5 in this first stage underwent second-stage analysis in 2 independent US cohorts of European descent. Results. After the first stage, a single highly significant association was revealed for the chromosome 8 rs6996198 with HIV-1 acquisition and was replicated in both second-stage cohorts. Across the 4 groups, the rs6996198-T allele was consistently associated with a significant reduced risk of HIV-1 infection, and the global meta-analysis reached genomewide significance: Pcombined = 7.76 × 10−8. Conclusions. We provide strong evidence of association for a common variant with HIV-1 acquisition in populations of European ancestry. This protective signal against HIV-1 infection is the first identified outside the CCR5 nexus. First clues point to a potential functional role for a nearby candidate gene, CYP7B1, but this locus warrants further investigation. PMID:22362864
Chao de la Barca, Juan Manuel; Simard, Gilles; Sarzi, Emmanuelle; Chaumette, Tanguy; Rousseau, Guillaume; Chupin, Stéphanie; Gadras, Cédric; Tessier, Lydie; Ferré, Marc; Chevrollier, Arnaud; Desquiret-Dumas, Valérie; Gueguen, Naïg; Leruez, Stéphanie; Verny, Christophe; Miléa, Dan; Bonneau, Dominique; Amati-Bonneau, Patrizia; Procaccio, Vincent; Hamel, Christian; Lenaers, Guy; Reynier, Pascal; Prunier-Mirebeau, Delphine
2017-02-01
Dominant optic atrophy (MIM No. 165500) is a blinding condition related to mutations in OPA1, a gene encoding a large GTPase involved in mitochondrial inner membrane dynamics. Although several mouse models mimicking the disease have been developed, the pathophysiological mechanisms responsible for retinal ganglion cell degeneration remain poorly understood. Using a targeted metabolomic approach, we measured the concentrations of 188 metabolites in nine tissues, that is, brain, three types of skeletal muscle, heart, liver, retina, optic nerve, and plasma in symptomatic 11-month-old Opa1delTTAG/+ mice. Significant metabolic signatures were found only in the optic nerve and plasma of female mice. The optic nerve signature was characterized by altered concentrations of phospholipids, amino acids, acylcarnitines, and carnosine, whereas the plasma signature showed decreased concentrations of amino acids and sarcosine associated with increased concentrations of several phospholipids. In contrast, the investigation of 3-month-old presymptomatic Opa1delTTAG/+ mice showed no specific plasma signature but revealed a significant optic nerve signature in both sexes, although with a sex effect. The Opa1delTTAG/+ versus wild-type optic nerve signature was characterized by the decreased concentrations of 10 sphingomyelins and 10 lysophosphatidylcholines, suggestive of myelin sheath alteration, and by alteration in the concentrations of metabolites involved in neuroprotection, such as dimethylarginine, carnitine, spermine, spermidine, carnosine, and glutamate, suggesting a concomitant axonal metabolic dysfunction. Our comprehensive metabolomic investigations revealed in symptomatic as well as in presymptomatic Opa1delTTAG/+ mice, a specific sensitiveness of the optic nerve to Opa1 insufficiency, opening new routes for protective therapeutic strategies.
Directory of Open Access Journals (Sweden)
Fabio Carrilho Galvão
Full Text Available The putative eukaryotic translation initiation factor 5A (eIF5A is a highly conserved protein among archaea and eukaryotes that has recently been implicated in the elongation step of translation. eIF5A undergoes an essential and conserved posttranslational modification at a specific lysine to generate the residue hypusine. The enzymes deoxyhypusine synthase (Dys1 and deoxyhypusine hydroxylase (Lia1 catalyze this two-step modification process. Although several Saccharomyces cerevisiae eIF5A mutants have importantly contributed to the study of eIF5A function, no conditional mutant of Dys1 has been described so far. In this study, we generated and characterized the dys1-1 mutant, which showed a strong depletion of mutated Dys1 protein, resulting in more than 2-fold decrease in hypusine levels relative to the wild type. The dys1-1 mutant demonstrated a defect in total protein synthesis, a defect in polysome profile indicative of a translation elongation defect and a reduced association of eIF5A with polysomes. The growth phenotype of dys1-1 mutant is severe, growing only in the presence of 1 M sorbitol, an osmotic stabilizer. Although this phenotype is characteristic of Pkc1 cell wall integrity mutants, the sorbitol requirement from dys1-1 is not associated with cell lysis. We observed that the dys1-1 genetically interacts with the sole yeast protein kinase C (Pkc1 and Asc1, a component of the 40S ribosomal subunit. The dys1-1 mutant was synthetically lethal in combination with asc1Δ and overexpression of TIF51A (eIF5A or DYS1 is toxic for an asc1Δ strain. Moreover, eIF5A is more associated with translating ribosomes in the absence of Asc1 in the cell. Finally, analysis of the sensitivity to cell wall-perturbing compounds revealed a more similar behavior of the dys1-1 and asc1Δ mutants in comparison with the pkc1Δ mutant. These data suggest a correlated role for eIF5A and Asc1 in coordinating the translational control of a subset of m
MAO, JINGJIE; LI, ZUANFANG; LIN, RUHUI; ZHU, XIAOQIN; LIN, JIUMAO; PENG, JUN; CHEN, LIDIAN
2015-01-01
Spasticity is common in various central neurological conditions, including after a stroke. Such spasticity may cause additional problems, and often becomes a primary concern for afflicted individuals. A number of studies have identified nuclear factor (erythroid-derived 2)-like 2 (Nrf2) as a key regulator in the adaptive survival response to oxidative stress. Elevated expression of Nrf2, combined with heme oxygenase 1 (HO-1) resistance, in the central nervous system is known to elicit key internal and external oxidation protection. Gua Lou Gui Zhi decoction (GLGZD) is a popular traditional Chinese formula with a long history of clinical use in China for the treatment of muscular spasticity following a stroke, epilepsy or a spinal cord injury. However, the mechanism underlying the efficacy of the medicine remains unclear. In the present study, the antioxidative effects of GLGZD were evaluated and the underlying molecular mechanisms were investigated, using hydrogen peroxide (H2O2)-induced rat pheochromocytoma cells (PC12 cells) as an in vitro oxidative stress model of neural cells. Upon application of different concentrations of GLGZD, a 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay and ATP measurement were conducted to assess the impact on PC12 cell proliferation. In addition, inverted microscopy observations, and the MTT and ATP assessments, revealed that GLGZD attenuated H2O2-induced oxidative damage and signaling repression in PC12 cells. Furthermore, the mRNA and protein expression levels of Nrf2 and HO-1, which are associated with oxidative stress, were analyzed using reverse transcription quantitative polymerase chain reaction (PCR) and confocal microscopy. Confocal microscopy observations, as well as the quantitative PCR assay, revealed that GLGZD exerted a neuroprotective function against H2O2-induced oxidative damage in PC12 cells. Therefore, the results demonstrated that GLGZD protected PC12 cells injured by H2O2, which may be
Parental diabetes status reveals association of mitochondrial DNA haplogroup J1 with type 2 diabetes
Directory of Open Access Journals (Sweden)
Wainstein Julio
2009-06-01
Full Text Available Abstract Background Although mitochondrial dysfunction is consistently manifested in patients with Type 2 Diabetes mellitus (T2DM, the association of mitochondrial DNA (mtDNA sequence variants with T2DM varies among populations. These differences might stem from differing environmental influences among populations. However, other potentially important considerations emanate from the very nature of mitochondrial genetics, namely the notable high degree of partitioning in the distribution of human mtDNA variants among populations, as well as the interaction of mtDNA and nuclear DNA-encoded factors working in concert to govern mitochondrial function. We hypothesized that association of mtDNA genetic variants with T2DM could be revealed while controlling for the effect of additional inherited factors, reflected in family history information. Methods To test this hypothesis we set out to investigate whether mtDNA genetic variants will be differentially associated with T2DM depending on the diabetes status of the parents. To this end, association of mtDNA genetic backgrounds (haplogroups with T2DM was assessed in 1055 Jewish patients with and without T2DM parents ('DP' and 'HP', respectively. Results Haplogroup J1 was found to be 2.4 fold under-represented in the 'HP' patients (p = 0.0035. These results are consistent with a previous observation made in Finnish T2DM patients. Moreover, assessing the haplogroup distribution in 'DP' versus 'HP' patients having diabetic siblings revealed that haplogroup J1 was virtually absent in the 'HP' group. Conclusion These results imply the involvement of inherited factors, which modulate the susceptibility of haplogroup J1 to T2DM.
Directory of Open Access Journals (Sweden)
Hadar Israeli
2017-04-01
Full Text Available Cell entry of many enveloped viruses occurs by engagement with cellular receptors, followed by internalization into endocytic compartments and pH-induced membrane fusion. A previously unnoticed step of receptor switching was found to be critical during cell entry of two devastating human pathogens: Ebola and Lassa viruses. Our recent studies revealed the functional role of receptor switching to LAMP1 for triggering membrane fusion by Lassa virus and showed the involvement of conserved histidines in this switching, suggesting that other viruses from this family may also switch to LAMP1. However, when we investigated viruses that are genetically close to Lassa virus, we discovered that they cannot bind LAMP1. A crystal structure of the receptor-binding module from Morogoro virus revealed structural differences that allowed mapping of the LAMP1 binding site to a unique set of Lassa residues not shared by other viruses in its family, illustrating a key difference in the cell-entry mechanism of Lassa virus that may contribute to its pathogenicity.
A ChIP-chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response.
Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole
2009-03-01
IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP-chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response.
A ChIP–chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response
Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole
2009-01-01
IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP–chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response. PMID:19129219
Dindar, Gülcin; Anger, Andreas M; Mehlhorn, Christine; Hake, Sandra B; Janzen, Christian J
2014-11-12
DOT1 enzymes are conserved methyltransferases that catalyse the methylation of lysine 79 on histone H3 (H3K79). Most eukaryotes contain one DOT1 enzyme, whereas African trypanosomes have two homologues, DOT1A and DOT1B, with different enzymatic activities. DOT1A mediates mono- and dimethylation of H3K76, the homologue of H3K79 in other organisms, whereas DOT1B additionally catalyses H3K76 trimethylation. However, it is unclear how these different enzymatic activities are achieved. Here we employ a trypanosomal nucleosome reconstitution system and structure-guided homology modelling to identify critical residues within and outside the catalytic centre that modulate product specificity. Exchange of these residues transfers the product specificity from one enzyme to the other, and reveals the existence of distinct regulatory domains adjacent to the catalytic centre. Our study provides the first evidence that a few crucial residues in DOT1 enzymes are sufficient to catalyse methyl-state-specific reactions. These results might also have far-reaching consequences for the functional understanding of homologous enzymes in higher eukaryotes.
Directory of Open Access Journals (Sweden)
Biaoru Li
Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34
Covassin, L D; Siekmann, A F; Kacergis, M C; Laver, E; Moore, J C; Villefranc, J A; Weinstein, B M; Lawson, N D
2009-05-15
In this work we describe a forward genetic approach to identify mutations that affect blood vessel development in the zebrafish. By applying a haploid screening strategy in a transgenic background that allows direct visualization of blood vessels, it was possible to identify several classes of mutant vascular phenotypes. Subsequent characterization of mutant lines revealed that defects in Vascular endothelial growth factor (Vegf) signaling specifically affected artery development. Comparison of phenotypes associated with different mutations within a functional zebrafish Vegf receptor-2 ortholog (referred to as kdr-like, kdrl) revealed surprisingly varied effects on vascular development. In parallel, we identified an allelic series of mutations in phospholipase c gamma 1 (plcg1). Together with in vivo structure-function analysis, our results suggest a requirement for Plcg1 catalytic activity downstream of receptor tyrosine kinases. We further find that embryos lacking both maternal and zygotic plcg1 display more severe defects in artery differentiation but are otherwise similar to zygotic mutants. Finally, we demonstrate through mosaic analysis that plcg1 functions autonomously in endothelial cells. Together our genetic analyses suggest that Vegf/Plcg1 signaling acts at multiple time points and in different signaling contexts to mediate distinct aspects of artery development.
DNA Methylation as an Epigenetic Factor in the Development and Progression of Polycythemia Vera
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2007-01-01
Polycythemia vera (PV) is the most common myeloproliferative disorder with a yearly incidence of 28 per 1 million people and a slightly higher prevalence in males PV is characterized by clonal expansion of erythroid...
DEFF Research Database (Denmark)
Arnaud, Lionel; Saison, Carole; Helias, Virginie
2010-01-01
The congenital dyserythropoietic anemias (CDAs) are inherited red blood cell disorders whose hallmarks are ineffective erythropoiesis, hemolysis, and morphological abnormalities of erythroblasts in bone marrow. We have identified a missense mutation in KLF1 of patients with a hitherto unclassified...
Reduced evolutionary rates in HIV-1 reveal extensive latency periods among replicating lineages.
Immonen, Taina T; Leitner, Thomas
2014-10-16
HIV-1 can persist for the duration of a patient's life due in part to its ability to hide from the immune system, and from antiretroviral drugs, in long-lived latent reservoirs. Latent forms of HIV-1 may also be disproportionally involved in transmission. Thus, it is important to detect and quantify latency in the HIV-1 life cycle. We developed a novel molecular clock-based phylogenetic tool to investigate the prevalence of HIV-1 lineages that have experienced latency. The method removes alternative sources that may affect evolutionary rates, such as hypermutation, recombination, and selection, to reveal the contribution of generation-time effects caused by latency. Our method was able to recover latent lineages with high specificity and sensitivity, and low false discovery rates, even on relatively short branches on simulated phylogenies. Applying the tool to HIV-1 sequences from 26 patients, we show that the majority of phylogenetic lineages have been affected by generation-time effects in every patient type, whether untreated, elite controller, or under effective or failing treatment. Furthermore, we discovered extensive effects of latency in sequence data (gag, pol, and env) from reservoirs as well as in the replicating plasma population. To better understand our phylogenetic findings, we developed a dynamic model of virus-host interactions to investigate the proportion of lineages in the actively replicating population that have ever been latent. Assuming neutral evolution, our dynamic modeling showed that under most parameter conditions, it is possible for a few activated latent viruses to propagate so that in time, most HIV-1 lineages will have been latent at some time in their past. These results suggest that cycling in and out of latency plays a major role in the evolution of HIV-1. Thus, no aspect of HIV-1 evolution can be fully understood without considering latency - including treatment, drug resistance, immune evasion, transmission, and pathogenesis.
Directory of Open Access Journals (Sweden)
William P Lafuse
Full Text Available Leishmania donovani is a parasite that causes visceral leishmaniasis by infecting and replicating in macrophages of the bone marrow, spleen, and liver. Severe anemia and leucopenia is associated with the disease. Although immune defense mechanisms against the parasite have been studied, we have a limited understanding of how L. donovani alters hematopoiesis. In this study, we used Syrian golden hamsters to investigate effects of L. donovani infection on erythropoiesis. Infection resulted in severe anemia and leucopenia by 8 weeks post-infection. Anemia was associated with increased levels of serum erythropoietin, which indicates the hamsters respond to the anemia by producing erythropoietin. We found that infection also increased numbers of BFU-E and CFU-E progenitor populations in the spleen and bone marrow and differentially altered erythroid gene expression in these organs. In the bone marrow, the mRNA expression of erythroid differentiation genes (α-globin, β-globin, ALAS2 were inhibited by 50%, but mRNA levels of erythroid receptor (c-kit, EpoR and transcription factors (GATA1, GATA2, FOG1 were not affected by the infection. This suggests that infection has a negative effect on differentiation of erythroblasts. In the spleen, erythroid gene expression was enhanced by infection, indicating that the anemia activates a stress erythropoiesis response in the spleen. Analysis of cytokine mRNA levels in spleen and bone marrow found that IFN-γ mRNA is highly increased by L. donovani infection. Expression of the IFN-γ inducible cytokine, TNF-related apoptosis-inducing ligand (TRAIL, was also up-regulated. Since TRAIL induces erythroblasts apoptosis, apoptosis of bone marrow erythroblasts from infected hamsters was examined by flow cytometry. Percentage of erythroblasts that were apoptotic was significantly increased by L. donovani infection. Together, our results suggest that L. donovani infection inhibits erythropoiesis in the bone marrow by
Role of TRPA1 in acute cardiopulmonary toxicity of inhaled acrolein.
Conklin, Daniel J; Haberzettl, Petra; Jagatheesan, Ganapathy; Kong, Maiying; Hoyle, Gary W
2017-06-01
Acrolein is a highly toxic, volatile, unsaturated aldehyde generated during incomplete combustion as in tobacco smoke and indoor fires. Because the transient receptor potential ankyrin 1 (TRPA1) channel mediates tobacco smoke-induced lung injury, we assessed its role in high-level acrolein-induced toxicity in mice. Acrolein (100-275ppm, 10-30min) caused upper airway epithelial sloughing, bradypnea and oral gasping, hypothermia, cardiac depression and mortality. Male wild-type mice (WT, C57BL/6; 5-52weeks) were significantly more sensitive to high-level acrolein than age-matched, female WT mice. Both male and female TRPA1-null mice were more sensitive to acrolein-induced mortality than age- and sex-matched WT mice. Acrolein exposure increased lung weight:body weight ratios and lung albumin and decreased plasma albumin to a greater extent in TRPA1-null than in WT mice. Lung and plasma protein-acrolein adducts were not increased in acrolein-exposed TRPA1-null mice compared with WT mice. To assess TRPA1-dependent protective mechanisms, respiratory parameters were monitored by telemetry. TRPA1-null mice had a slower onset of breathing rate suppression ('respiratory braking') than WT mice suggesting TRPA1 mediates this protective response. Surprisingly, WT male mice treated either with a TRPA1 antagonist (HC030031; 200mg/kg) alone or with combined TRPA1 (100mg/kg) and TRPV1 (capsazepine, 10mg/kg) antagonists at 30min post-acrolein exposure (i.e., "real world" delay in treatment) were significantly protected from acrolein-induced mortality. These data show TRPA1 protects against high-level acrolein-induced toxicity in a sex-dependent manner. Post-exposure TRPA1 antagonism also protected against acrolein-induced mortality attesting to a complex role of TRPA1 in cardiopulmonary injury. Copyright © 2016 Elsevier Inc. All rights reserved.
Rasool, Javid; Geelani, Sajad; Khursheed; Yasir; Lone, Mohd Suhail; Shaban, Mohd
2014-03-01
Acute erythroleukemia is characterized by a predominant immature erythroid population and accounts for approximately 2-5 % of all cases of acute leukemia. Two subtypes are recognized based on the presence or absence of a significant myeloid component: erythroleukemia and pure erythroid leukemia. Erythroleukemia is predominantly a disease of adults, while pure erythroid leukemia can be seen in any age including children. Here is a case of pure erythroleukemia presenting mainly as late erythroblasts which was diagnosed on bone marrow examination, cytochemistry and was confirmed on immunophenotyping. Possibly this is the only case so for demonstrating deletion of long arm of chromosome 20 in pure erythroleukemia.
Ren, Xiang; Sun, Hong; Zhang, Chenghong; Li, Chen; Wang, Jinlei; Shen, Jie; Yu, Dong; Kong, Li
2016-07-01
The present study aimed to investigate the mechanisms that mediate the protective effects of pyridoxamine (PM) on light‑damaged retinal photoreceptor cells in diabetic mice. A high‑fat diet and streptozotocin were used to induce a mouse model of type II diabetes. During the experiment, mice were divided the mice into three types of group, as follows: Control groups (negative control and light‑damaged groups); experimental groups (diabetic and diabetic light‑damaged groups); and treatment groups (25, 50 and 100 mg/kg PM‑treated groups). Using hematoxylin‑eosin staining, the number of nuclear layer cells were counted. Western blotting and immunohistochemistry were performed to measure the levels of thioredoxin (Trx), phospho‑extracellular signal‑regulated kinase 1/2 (p‑Erk1/2), nuclear factor erythroid 2‑related factor 2 (Nrf2) and apoptosis signal‑regulating kinase 1 (ASK1). The photoreceptor cell count in the outer nuclear layer of the light‑damaged, diabetic control and diabetic light‑damaged groups were significantly reduced compared with the negative control group (PTrx, p‑Erk1/2 and Nrf2 expression levels (PTrx, p‑Erk1/2 and Nrf2 expression levels were significantly increased (PTrx, p‑Erk1/2 and Nrf2 expression, and the downregulation of ASK1 expression.
Gene array analysis of PD-1H overexpressing monocytes reveals a pro-inflammatory profile
Directory of Open Access Journals (Sweden)
Preeti Bharaj
2018-02-01
Full Text Available We have previously reported that overexpression of Programmed Death -1 Homolog (PD-1H in human monocytes leads to activation and spontaneous secretion of multiple pro inflammatory cytokines. Here we evaluate changes in monocytes gene expression after enforced PD-1H expression by gene array. The results show that there are significant alterations in 51 potential candidate genes that relate to immune response, cell adhesion and metabolism. Genes corresponding to pro-inflammatory cytokines showed the highest upregulation, 7, 3.2, 3.0, 5.8, 4.4 and 3.1 fold upregulation of TNF-α, IL-1 β, IFN-α, γ, λ and IL-27 relative to vector control. The data are in agreement with cytometric bead array analysis showing induction of proinflammatory cytokines, IL-6, IL-1β and TNF-α by PD-1H. Other genes related to inflammation, include transglutaminase 2 (TG2, NF-κB (p65 and p50 and toll like receptors (TLR 3 and 4 were upregulated 5, 4.5 and 2.5 fold, respectively. Gene set enrichment analysis (GSEA also revealed that signaling pathways related to inflammatory response, such as NFκB, AT1R, PYK2, MAPK, RELA, TNFR1, MTOR and proteasomal degradation, were significantly upregulated in response to PD-1H overexpression. We validated the results utilizing a standard inflammatory sepsis model in humanized BLT mice, finding that PD-1H expression was highly correlated with proinflammatory cytokine production. We therefore conclude that PD-1H functions to enhance monocyte activation and the induction of a pro-inflammatory gene expression profile.
Directory of Open Access Journals (Sweden)
Dan Jiang
Full Text Available Leaf morphology is closely associated with cell division. In rice, mutations in Narrow leaf 1 (NAL1 show narrow leaf phenotypes. Previous studies have shown that NAL1 plays a role in regulating vein patterning and increasing grain yield in indica cultivars, but its role in leaf growth and development remains unknown. In this report, we characterized two allelic mutants of NARROW LEAF1 (NAL1, nal1-2 and nal1-3, both of which showed a 50% reduction in leaf width and length, as well as a dwarf culm. Longitudinal and transverse histological analyses of leaves and internodes revealed that cell division was suppressed in the anticlinal orientation but enhanced in the periclinal orientation in the mutants, while cell size remained unaltered. In addition to defects in cell proliferation, the mutants showed abnormal midrib in leaves. Map-based cloning revealed that nal1-2 is a null allelic mutant of NAL1 since both the whole promoter and a 404-bp fragment in the first exon of NAL1 were deleted, and that a 6-bp fragment was deleted in the mutant nal1-3. We demonstrated that NAL1 functions in the regulation of cell division as early as during leaf primordia initiation. The altered transcript level of G1- and S-phase-specific genes suggested that NAL1 affects cell cycle regulation. Heterogeneous expression of NAL1 in fission yeast (Schizosaccharomyces pombe further supported that NAL1 affects cell division. These results suggest that NAL1 controls leaf width and plant height through its effects on cell division.
Energy Technology Data Exchange (ETDEWEB)
Reddy, T.V.; Daniel, F.B.
1994-09-01
Toxic effects of 1,3-Dinitrobenzene (1,3-DNB) in male and female F344 rats were evaluated by feeding powdered certified laboratory chow diet supplemented with varied concentrations of 1,3-DNB (0, 2.5, 10, 25, 75 and 150 mg/kg diet) for fourteen days. The average daily 1 ,3-DNB doses consumed were 0.21, 0.87, 2.02, 6.28 and 11.82 mg/kg b.w. for females and 0.21, 0.80, 1.98, 5.77 and 10.56 for males. Food consumption was significantly decreased in high dose animals of both sexes. Final body weights were not altered but relative organ weights were significantly changed in the 150 and 75 mg dose groups involving the spleen (males and females) and testes (males). Hematology and clinical chemistry studies indicated significantly increased values in both sexes relating to reticulocytes and methemoglobin in the 150 and 75 mg/kg dose groups while the red blood cell count, hemoglobin level and % hematocrit were decreased in these same groups. In addition, the levels of bilirubin, protein and albumin were increased in high dose males, Histopathological evaluations suggested that the susceptible organs for 1,3-DNB toxicity were kidneys (hyaline droplets), spleen (erythroid cell hyperplasia), brain (malacia and microgliosis), testes (seminiferous tubular degeneration). These changes were noted mainly in the 150 and 75 mg/kg dose groups except those changes involving the brain (150 mg/kg group only).
Directory of Open Access Journals (Sweden)
Taiga Miyazaki
2013-01-01
Full Text Available Proper protein folding in the endoplasmic reticulum (ER is vital in all eukaryotes. When misfolded proteins accumulate in the ER lumen, the transmembrane kinase/endoribonuclease Ire1 initiates splicing of HAC1 mRNA to generate the bZIP transcription factor Hac1, which subsequently activates its target genes to increase the protein-folding capacity of the ER. This cellular machinery, called the unfolded protein response (UPR, is believed to be an evolutionarily conserved mechanism in eukaryotes. In this study, we comprehensively characterized mutant phenotypes of IRE1 and other related genes in the human fungal pathogen Candida glabrata. Unexpectedly, Ire1 was required for the ER stress response independently of Hac1 in this fungus. C. glabrata Ire1 did not cleave mRNAs encoding Hac1 and other bZIP transcription factors identified in the C. glabrata genome. Microarray analysis revealed that the transcriptional response to ER stress is not mediated by Ire1, but instead is dependent largely on calcineurin signaling and partially on the Slt2 MAPK pathway. The loss of Ire1 alone did not confer increased antifungal susceptibility in C. glabrata contrary to UPR-defective mutants in other fungi. Taken together, our results suggest that the canonical Ire1-Hac1 UPR is not conserved in C. glabrata. It is known in metazoans that active Ire1 nonspecifically cleaves and degrades a subset of ER-localized mRNAs to reduce the ER load. Intriguingly, this cellular response could occur in an Ire1 nuclease-dependent fashion in C. glabrata. We also uncovered the attenuated virulence of the C. glabrata Δire1 mutant in a mouse model of disseminated candidiasis. This study has unveiled the unique evolution of ER stress response mechanisms in C. glabrata.
Arenillas, Leonor; Calvo, Xavier; Luño, Elisa; Senent, Leonor; Alonso, Esther; Ramos, Fernando; Ardanaz, María Teresa; Pedro, Carme; Tormo, Mar; Marco, Víctor; Montoro, Julia; Díez-Campelo, María; Brunet, Salut; Arrizabalaga, Beatriz; Xicoy, Blanca; Andreu, Rafael; Bonanad, Santiago; Jerez, Andrés; Nomdedeu, Benet; Ferrer, Ana; Sanz, Guillermo F; Florensa, Lourdes
2016-09-20
WHO classification of myeloid malignancies is based mainly on the percentage of bone marrow (BM) blasts. This is considered from total nucleated cells (TNCs), unless there is erythroid-hyperplasia (erythroblasts ≥ 50%), calculated from nonerythroid cells (NECs). In these instances, when BM blasts are ≥ 20%, the disorder is classified as erythroleukemia, and when BM blasts are < 20%, as myelodysplastic syndrome (MDS). In the latter, the percentage of blasts is considered from TNCs. We assessed the percentage of BM blasts from TNCs and NECs in 3,692 patients with MDS from the Grupo Español de Síndromes Mielodisplásicos, 465 patients with erythroid hyperplasia (MDS-E) and 3,227 patients without erythroid hyperplasia. We evaluated the relevance of both quantifications on classification and prognostication. By enumerating blasts systematically from NECs, 22% of patients with MDS-E and 12% with MDS from the whole series diagnosed within WHO categories with < 5% BM blasts, were reclassified into higher-risk categories and showed a poorer overall survival than did those who remained in initial categories (P = .006 and P = .001, respectively). Following WHO recommendations, refractory anemia with excess blasts (RAEB)-2 diagnosis is not possible in MDS-E, as patients with 10% to < 20% BM blasts from TNCs fulfill erythroleukemia criteria; however, by considering blasts from NECs, 72 patients were recoded as RAEB-2 and showed an inferior overall survival than did patients with RAEB-1 without erythroid hyperplasia. Recalculating the International Prognostic Scoring System by enumerating blasts from NECs in MDS-E and in the overall MDS population reclassified approximately 9% of lower-risk patients into higher-risk categories, which indicated the survival expected for higher-risk patients. Regardless of the presence of erythroid hyperplasia, calculating the percentage of BM blasts from NECs improves prognostic assessment of MDS. This fact should be considered in future
Guan, Yue
2017-05-11
Pyrrolysine (Pyl), the 22nd canonical amino acid, is only decoded and synthesized by a limited number of organisms in the domains Archaea and Bacteria. Pyl is encoded by the amber codon UAG, typically a stop codon. To date, all known Pyl-decoding archaea are able to carry out methylotrophic methanogenesis. The functionality of methylamine methyltransferases, an important component of corrinoid-dependent methyltransfer reactions, depends on the presence of Pyl. Here, we present a putative pyl gene cluster obtained from single-cell genomes of the archaeal Mediterranean Sea Brine Lakes group 1 (MSBL1) from the Red Sea. Functional annotation of the MSBL1 single cell amplified genomes (SAGs) also revealed a complete corrinoid-dependent methyl-transfer pathway suggesting that members of MSBL1 may possibly be capable of synthesizing Pyl and metabolizing methylated amines. This article is protected by copyright. All rights reserved.
Guan, Yue; Haroon, Mohamed; Alam, Intikhab; Ferry, James G.; Stingl, Ulrich
2017-01-01
Pyrrolysine (Pyl), the 22nd canonical amino acid, is only decoded and synthesized by a limited number of organisms in the domains Archaea and Bacteria. Pyl is encoded by the amber codon UAG, typically a stop codon. To date, all known Pyl-decoding archaea are able to carry out methylotrophic methanogenesis. The functionality of methylamine methyltransferases, an important component of corrinoid-dependent methyltransfer reactions, depends on the presence of Pyl. Here, we present a putative pyl gene cluster obtained from single-cell genomes of the archaeal Mediterranean Sea Brine Lakes group 1 (MSBL1) from the Red Sea. Functional annotation of the MSBL1 single cell amplified genomes (SAGs) also revealed a complete corrinoid-dependent methyl-transfer pathway suggesting that members of MSBL1 may possibly be capable of synthesizing Pyl and metabolizing methylated amines. This article is protected by copyright. All rights reserved.
Directory of Open Access Journals (Sweden)
Rosario D. C. Hirata
2011-09-01
Full Text Available Aims: The relationship between variants in SLCO1B1 and SLCO2B1 genes and lipid-lowering response to atorvastatin was investigated. Material and Methods: One-hundred-thirty-six unrelated individuals with hypercholesterolemia were selected and treated with atorvastatin (10 mg/day/4 weeks. They were genotyped with a panel of ancestry informative markers for individual African component of ancestry (ACA estimation by SNaPshot® and SLCO1B1 (c.388A>G, c.463C>A and c.521T>C and SLCO2B1 (−71T>C gene polymorphisms were identified by TaqMan® Real-time PCR. Results: Subjects carrying SLCO1B1 c.388GG genotype exhibited significantly high low-density lipoprotein (LDL cholesterol reduction relative to c.388AA+c.388AG carriers (41 vs. 37%, p = 0.034. Haplotype analysis revealed that homozygous of SLCO1B1*15 (c.521C and c.388G variant had similar response to statin relative to heterozygous and non-carriers. A multivariate logistic regression analysis confirmed that c.388GG genotype was associated with higher LDL cholesterol reduction in the study population (OR: 3.2, CI95%:1.3–8.0, p < 0.05. Conclusion: SLCO1B1 c.388A>G polymorphism causes significant increase in atorvastatin response and may be an important marker for predicting efficacy of lipid-lowering therapy.
Bertin, Samuel; Aoki-Nonaka, Yukari; Lee, Jihyung; de Jong, Petrus R; Kim, Peter; Han, Tiffany; Yu, Timothy; To, Keith; Takahashi, Naoki; Boland, Brigid S; Chang, John T; Ho, Samuel B; Herdman, Scott; Corr, Maripat; Franco, Alessandra; Sharma, Sonia; Dong, Hui; Akopian, Armen N; Raz, Eyal
2017-09-01
Transient receptor potential ankyrin-1 (TRPA1) and transient receptor potential vanilloid-1 (TRPV1) are calcium (Ca 2+ )-permeable ion channels mostly known as pain receptors in sensory neurons. However, growing evidence suggests their crucial involvement in the pathogenesis of IBD. We explored the possible contribution of TRPA1 and TRPV1 to T-cell-mediated colitis. We evaluated the role of Trpa1 gene deletion in two models of experimental colitis (ie, interleukin-10 knockout and T-cell-adoptive transfer models). We performed electrophysiological and Ca 2+ imaging studies to analyse TRPA1 and TRPV1 functions in CD4+ T cells. We used genetic and pharmacological approaches to evaluate TRPV1 contribution to the phenotype of Trpa1 -/- CD4+ T cells. We also analysed TRPA1 and TRPV1 gene expression and TRPA1 + TRPV1 + T cell infiltration in colonic biopsies from patients with IBD. We identified a protective role for TRPA1 in T-cell-mediated colitis. We demonstrated the functional expression of TRPA1 on the plasma membrane of CD4+ T cells and identified that Trpa1 -/- CD4+ T cells have increased T-cell receptor-induced Ca 2+ influx, activation profile and differentiation into Th1-effector cells. This phenotype was abrogated upon genetic deletion or pharmacological inhibition of the TRPV1 channel in mouse and human CD4+ T cells. Finally, we found differential regulation of TRPA1 and TRPV1 gene expression as well as increased infiltration of TRPA1 + TRPV1 + T cells in the colon of patients with IBD. Our study indicates that TRPA1 inhibits TRPV1 channel activity in CD4+ T cells, and consequently restrains CD4+ T-cell activation and colitogenic responses. These findings may therefore have therapeutic implications for human IBD. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Direct targets of pSTAT5 signalling in erythropoiesis.
Directory of Open Access Journals (Sweden)
Kevin R Gillinder
Full Text Available Erythropoietin (EPO acts through the dimeric erythropoietin receptor to stimulate proliferation, survival, differentiation and enucleation of erythroid progenitor cells. We undertook two complimentary approaches to find EPO-dependent pSTAT5 target genes in murine erythroid cells: RNA-seq of newly transcribed (4sU-labelled RNA, and ChIP-seq for pSTAT5 30 minutes after EPO stimulation. We found 302 pSTAT5-occupied sites: ~15% of these reside in promoters while the rest reside within intronic enhancers or intergenic regions, some >100kb from the nearest TSS. The majority of pSTAT5 peaks contain a central palindromic GAS element, TTCYXRGAA. There was significant enrichment for GATA motifs and CACCC-box motifs within the neighbourhood of pSTAT5-bound peaks, and GATA1 and/or KLF1 co-occupancy at many sites. Using 4sU-RNA-seq we determined the EPO-induced transcriptome and validated differentially expressed genes using dynamic CAGE data and qRT-PCR. We identified known direct pSTAT5 target genes such as Bcl2l1, Pim1 and Cish, and many new targets likely to be involved in driving erythroid cell differentiation including those involved in mRNA splicing (Rbm25, epigenetic regulation (Suv420h2, and EpoR turnover (Clint1/EpsinR. Some of these new EpoR-JAK2-pSTAT5 target genes could be used as biomarkers for monitoring disease activity in polycythaemia vera, and for monitoring responses to JAK inhibitors.
Qendro, Veneta; Bugos, Grace A; Lundgren, Debbie H; Glynn, John; Han, May H; Han, David K
2017-03-01
In order to gain mechanistic insights into multiple sclerosis (MS) pathogenesis, we utilized a multi-dimensional approach to test the hypothesis that mutations in myelin proteins lead to immune activation and central nervous system autoimmunity in MS. Mass spectrometry-based proteomic analysis of human MS brain lesions revealed seven unique mutations of PLP1; a key myelin protein that is known to be destroyed in MS. Surprisingly, in-depth genomic analysis of two MS patients at the genomic DNA and mRNA confirmed mutated PLP1 in RNA, but not in the genomic DNA. Quantification of wild type and mutant PLP RNA levels by qPCR further validated the presence of mutant PLP RNA in the MS patients. To seek evidence linking mutations in abundant myelin proteins and immune-mediated destruction of myelin, specific immune response against mutant PLP1 in MS patients was examined. Thus, we have designed paired, wild type and mutant peptide microarrays, and examined antibody response to multiple mutated PLP1 in sera from MS patients. Consistent with the idea of different patients exhibiting unique mutation profiles, we found that 13 out of 20 MS patients showed antibody responses against specific but not against all the mutant-PLP1 peptides. Interestingly, we found mutant PLP-directed antibody response against specific mutant peptides in the sera of pre-MS controls. The results from integrative proteomic, genomic, and immune analyses reveal a possible mechanism of mutation-driven pathogenesis in human MS. The study also highlights the need for integrative genomic and proteomic analyses for uncovering pathogenic mechanisms of human diseases. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Cashman, J.; Eaves, A.C.; Eaves, C.J.
1985-01-01
We have examined the cycling status of various classes of erythroid and granulopoietic progenitor populations maintained for many weeks in standard normal long-term human marrow cultures. These were initiated with a single inoculum of marrow aspirate and were routinely fed by weekly removal of half of the nonadherent cells and replacement of half of the growth medium. Progenitors of large erythroid colonies (more than eight erythroblast clusters) present in the nonadherent fraction and progenitors of small granulocyte/macrophage colonies (fewer than 500 cells) present in both the nonadherent and adherent fractions were found to be actively cycling at all times examined (28% to 63% kill following a 20-minute exposure to 20 microCi/mL of high specific activity 3 H-thymidine). In contrast, progenitors of large granulocyte/macrophage colonies (more than 500 cells) and progenitors of large erythroid colonies (more than eight erythroblast clusters), present in the adherent layer, consistently alternated between a quiescent state at the time of each weekly medium change and a proliferating state two to three days later (0% to 13% kill and 21% to 49% kill, respectively). Additional experiments revealed that the activation of primitive progenitors in the adherent layer was not dependent on the addition of fresh glutamine or hydrocortisone, nor on the physical manipulations involved in changing the growth medium. These studies provide the first direct evidence that normal long-term human marrow cultures support the continued turnover of a variety of early hematopoietic progenitor cell types. Further, they indicate that the proliferative activity of the most primitive of these progenitors is regulated by stage-specific cell-cell interactions that are subject to manipulation
Suspected myelodysplastic/myeloproliferative neoplasm in a feline leukemia virus-negative cat.
Weeden, Amy L; Taylor, Kyle R; Terrell, Scott P; Gallagher, Alexander E; Wamsley, Heather L
2016-12-01
A 10-year-old castrated Domestic Short-Haired cat was presented to a primary care veterinarian for a wellness examination and laboratory examination for monitoring of diabetes mellitus. The CBC revealed marked thrombocytosis, leukopenia and macrocytic, normochromic anemia. The cat tested negative for FeLV and feline immunodeficiency virus, but was positive for Mycoplasma haemominutum by PCR. Hematologic abnormalities were not responsive to therapy, so a repeat CBC and a bone marrow aspiration for cytology were performed. Additional blood smear findings included anisocytosis with megaloblastic erythroid precursors, large platelets, eosinophilic myelocytes and metamyelocytes, and rare unidentified blasts. The bone marrow smear was highly cellular, and the cytologic pattern was consistent with myelodysplastic syndrome with an erythroid predominance. At that time, 15% blasts were present. The cat was treated with a vitamin K 2 analog, doxycycline, and prednisolone, but without a clinical response. Within 3 months, euthanasia was elected due to declining quality of life, and a necropsy was performed. Postmortem bone marrow smears were highly cellular and dominated by monomorphic blasts of unknown line of origin (52%), persistent marked erythroid and megakaryocytic dysplasia, and ineffective erythropoiesis and granulopoiesis. Immunohistochemical, immunocytochemical, and cytochemical stains resulted in a diagnosis of acute myeloid leukemia of unclassified type. Additional histologic findings included mixed hepatitis with trematode infestation and lymphoplasmacytic interstitial nephritis with fibrosis. The marked thrombocytosis with myelodysplastic syndrome and the FeLV-negative status of this cat were unusual. The difficulty in classifying the myelodysplasia and subsequent leukemia highlights a need for further reporting and characterization of these types of disease. © 2016 American Society for Veterinary Clinical Pathology.
Directory of Open Access Journals (Sweden)
Marie-Florence Galliano
Full Text Available BACKGROUND: The multifunctional receptor LRP1 has been shown to bind and internalize a large number of protein ligands with biological importance such as the pan-protease inhibitor alpha2-macroglobulin (alpha2M. We recently identified Alpha2ML1, a new member of the alpha2M gene family, expressed in epidermis. alpha2ML1 might contribute to the regulation of desquamation through its inhibitory activity towards proteases of the chymotrypsin family, notably KLK7. The expression of LRP1 in epidermis as well as its ability to internalize alpha2ML1 was investigated. METHODS AND PRINCIPAL FINDINGS: In human epidermis, LRP1 is mainly expressed within the granular layer of the epidermis, which gathers the most differentiated keratinocytes, as shown by immunohistochemistry and immunofluorescence using two different antibodies. By using various experimental approaches, we show that the receptor binding domain of alpha2ML1 (RBDl is specifically internalized into the macrophage-like cell line RAW and colocalizes with LRP1 upon internalization. Coimmunoprecipitation assays demonstrate that RBDl binds LRP1 at the cell surface. Addition of RAP, a universal inhibitor of ligand binding to LRP1, prevents RBDl binding at the cell surface as well as internalization into RAW cells. Silencing Lrp1 expression with specific siRNA strongly reduces RBDl internalization. CONCLUSIONS AND SIGNIFICANCE: Keratinocytes of the upper differentiated layers of epidermis express LRP1 as well as alpha2ML1. Our study also reveals that alpha2ML1 is a new ligand for LRP1. Our findings are consistent with endocytosis by LRP1 of complexes formed between alpha2ML1 and proteases. LRP1 may thus control desquamation by regulating the biodisponibility of extracellular proteases.
Revuelta, M.V.; Kan, van J.A.L.; Kay, J.; Have, ten A.
2014-01-01
The A1 family of eukaryotic aspartic proteinases (APs) forms one of the 16 AP families. Although one of the best characterized families, the recent increase in genome sequence data has revealed many fungal AP homologs with novel sequence characteristics. This study was performed to explore the
Directory of Open Access Journals (Sweden)
Dipankar Bhattacharya
Full Text Available The dihydropyridine receptor (DHPR β1a subunit is essential for skeletal muscle excitation-contraction coupling, but the structural organization of β1a as part of the macromolecular DHPR-ryanodine receptor type I (RyR1 complex is still debatable. We used fluorescence resonance energy transfer (FRET to probe proximity relationships within the β1a subunit in cultured skeletal myotubes lacking or expressing RyR1. The fluorescein biarsenical reagent FlAsH was used as the FRET acceptor, which exhibits fluorescence upon binding to specific tetracysteine motifs, and enhanced cyan fluorescent protein (CFP was used as the FRET donor. Ten β1a reporter constructs were generated by inserting the CCPGCC FlAsH binding motif into five positions probing the five domains of β1a with either carboxyl or amino terminal fused CFP. FRET efficiency was largest when CCPGCC was positioned next to CFP, and significant intramolecular FRET was observed for all constructs suggesting that in situ the β1a subunit has a relatively compact conformation in which the carboxyl and amino termini are not extended. Comparison of the FRET efficiency in wild type to that in dyspedic (lacking RyR1 myotubes revealed that in only one construct (H458 CCPGCC β1a -CFP FRET efficiency was specifically altered by the presence of RyR1. The present study reveals that the C-terminal of the β1a subunit changes conformation in the presence of RyR1 consistent with an interaction between the C-terminal of β1a and RyR1 in resting myotubes.
Reproducibility of the World Health Organization 2008 criteria for myelodysplastic syndromes.
Senent, Leonor; Arenillas, Leonor; Luño, Elisa; Ruiz, Juan C; Sanz, Guillermo; Florensa, Lourdes
2013-04-01
The reproducibility of the World Health Organization 2008 classification for myelodysplastic syndromes is uncertain and its assessment was the major aim of this study. The different peripheral blood and bone marrow variables required for an adequate morphological classification were blindly evaluated by four cytomorphologists in samples from 50 patients with myelodysplastic syndromes. The degree of agreement among observers was calculated using intraclass correlation coefficient and the generalized kappa statistic for multiple raters. The degree of agreement for the percentages of blasts in bone marrow and peripheral blood, ring sideroblasts in bone marrow, and erythroid, granulocytic and megakaryocytic dysplastic cells was strong (P<0.001 in all instances). After stratifying the percentages according to the categories required for the assignment of World Health Organization subtypes, the degree of agreement was not statistically significant for cases with 5-9% blasts in bone marrow (P=0.07), 0.1-1% blasts in peripheral blood (P=0.47), or percentage of erythroid dysplastic cells (P=0.49). Finally, the interobserver concordance for World Health Organization-defined subtypes showed a moderate overall agreement (P<0.001), the reproducibility being lower for cases with refractory anemia with excess of blasts type 1 (P=0.05) and refractory anemia with ring sideroblasts (P=0.09). In conclusion, the reproducibility of the World Health Organization 2008 classification for myelodysplastic syndromes is acceptable but the defining criteria for blast cells and features of erythroid dysplasia need to be refined.
Silvaroli, Josie A; Arne, Jason M; Chelstowska, Sylwia; Kiser, Philip D; Banerjee, Surajit; Golczak, Marcin
2016-04-15
Important in regulating the uptake, storage, and metabolism of retinoids, cellular retinol-binding protein 1 (CRBP1) is essential for trafficking vitamin A through the cytoplasm. However, the molecular details of ligand uptake and targeted release by CRBP1 remain unclear. Here we report the first structure of CRBP1 in a ligand-free form as well as ultra-high resolution structures of this protein bound to either all-trans-retinol or retinylamine, the latter a therapeutic retinoid that prevents light-induced retinal degeneration. Superpositioning of human apo- and holo-CRBP1 revealed major differences within segments surrounding the entrance to the retinoid-binding site. These included α-helix II and hairpin turns between β-strands βC-βD and βE-βF as well as several side chains, such as Phe-57, Tyr-60, and Ile-77, that change their orientations to accommodate the ligand. Additionally, we mapped hydrogen bond networks inside the retinoid-binding cavity and demonstrated their significance for the ligand affinity. Analyses of the crystallographic B-factors indicated several regions with higher backbone mobility in the apoprotein that became more rigid upon retinoid binding. This conformational flexibility of human apo-CRBP1 facilitates interaction with the ligands, whereas the more rigid holoprotein structure protects the labile retinoid moiety during vitamin A transport. These findings suggest a mechanism of induced fit upon ligand binding by mammalian cellular retinol-binding proteins. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Bardoxolone methyl in type 2 diabetes and stage 4 chronic kidney disease
DEFF Research Database (Denmark)
de Zeeuw, Dick; Akizawa, Tadao; Audhya, Paul
2013-01-01
Although inhibitors of the renin-angiotensin-aldosterone system can slow the progression of diabetic kidney disease, the residual risk is high. Whether nuclear 1 factor (erythroid-derived 2)-related factor 2 activators further reduce this risk is unknown....
StaRProtein, A Web Server for Prediction of the Stability of Repeat Proteins
Xu, Yongtao; Zhou, Xu; Huang, Meilan
2015-01-01
Repeat proteins have become increasingly important due to their capability to bind to almost any proteins and the potential as alternative therapy to monoclonal antibodies. In the past decade repeat proteins have been designed to mediate specific protein-protein interactions. The tetratricopeptide and ankyrin repeat proteins are two classes of helical repeat proteins that form different binding pockets to accommodate various partners. It is important to understand the factors that define folding and stability of repeat proteins in order to prioritize the most stable designed repeat proteins to further explore their potential binding affinities. Here we developed distance-dependant statistical potentials using two classes of alpha-helical repeat proteins, tetratricopeptide and ankyrin repeat proteins respectively, and evaluated their efficiency in predicting the stability of repeat proteins. We demonstrated that the repeat-specific statistical potentials based on these two classes of repeat proteins showed paramount accuracy compared with non-specific statistical potentials in: 1) discriminate correct vs. incorrect models 2) rank the stability of designed repeat proteins. In particular, the statistical scores correlate closely with the equilibrium unfolding free energies of repeat proteins and therefore would serve as a novel tool in quickly prioritizing the designed repeat proteins with high stability. StaRProtein web server was developed for predicting the stability of repeat proteins. PMID:25807112
IL-15 deficient tax mice reveal a role for IL-1α in tumor immunity.
Directory of Open Access Journals (Sweden)
Daniel A Rauch
Full Text Available IL-15 is recognized as a promising candidate for tumor immunotherapy and has been described as both a promoter of cancer and a promoter of anti-cancer immunity. IL-15 was discovered in cells transformed by HTLV-1, the etiologic agent of adult T cell leukemia/lymphoma (ATL and the human retrovirus that carries the Tax oncogene. We have developed the TAX-LUC mouse model of ATL in which Tax expression drives both malignant transformation and luciferase expression, enabling non-invasive imaging of tumorigenesis in real time. To identify the role of IL-15 in spontaneous development of lymphoma in vivo, an IL-15(-/- TAX-LUC strain was developed and examined. The absence of IL-15 resulted in aggressive tumor growth and accelerated mortality and demonstrated that IL-15 was not required for Tax-mediated lymphoma but was essential for anti-tumor immunity. Further analysis revealed a unique transcriptional profile in tumor cells that arise in the absence of IL-15 that included a significant increase in the expression of IL-1α and IL-1α-regulated cytokines. Moreover, anti-IL-1α antibodies and an IL-1 receptor antagonist (Anakinra were used to interrogate the potential of IL-1α targeted therapies in this model. Taken together, these findings identify IL-15 and IL-1α as therapeutic targets in lymphoma.
Facchinetti, Francesco; Loriot, Yohann; Kuo, Mei-Shiue; Mahjoubi, Linda; Lacroix, Ludovic; Planchard, David; Besse, Benjamin; Farace, Françoise; Auger, Nathalie; Remon, Jordi; Scoazec, Jean-Yves; André, Fabrice; Soria, Jean-Charles; Friboulet, Luc
2016-12-15
The identification of molecular mechanisms conferring resistance to tyrosine kinase inhibitor (TKI) is a key step to improve therapeutic results for patients with oncogene addiction. Several alterations leading to EGFR and anaplastic lymphoma kinase (ALK) resistance to TKI therapy have been described in non-small cell lung cancer (NSCLC). Only two mutations in the ROS1 kinase domain responsible for crizotinib resistance have been described in patients thus far. A patient suffering from a metastatic NSCLC harboring an ezrin (EZR)-ROS1 fusion gene developed acquired resistance to the ALK/ROS1 inhibitor crizotinib. Molecular analysis (whole-exome sequencing, CGH) and functional studies were undertaken to elucidate the mechanism of resistance. Based on this case, we took advantage of the structural homology of ROS1 and ALK to build a predictive model for drug sensitivity regarding future ROS1 mutations. Sequencing revealed a dual mutation, S1986Y and S1986F, in the ROS1 kinase domain. Functional in vitro studies demonstrated that ROS1 harboring either the S1986Y or the S1986F mutation, while conferring resistance to crizotinib and ceritinib, was inhibited by lorlatinib (PF-06463922). The patient's clinical response confirmed the potency of lorlatinib against S1986Y/F mutations. The ROS1 S1986Y/F and ALK C1156Y mutations are homologous and displayed similar sensitivity patterns to ALK/ROS1 TKIs. We extended this analogy to build a model predicting TKI efficacy against potential ROS1 mutations. Clinical evidence, in vitro validation, and homology-based prediction provide guidance for treatment decision making for patients with ROS1-rearranged NSCLC who progressed on crizotinib. Clin Cancer Res; 22(24); 5983-91. ©2016 AACR. ©2016 American Association for Cancer Research.
Silva, Bruna Larissa Lago; Medeiros, Danila Lima; Soares, Ana Prates; Line, Sérgio Roberto Peres; Pinto, Maria das Graças Farias; Soares, Telma de Jesus; do Espírito Santo, Alexandre Ribeiro
2018-03-01
Type 1 diabetes mellitus (T1DM) largely affects children, occurring therefore at the same period of deciduous and permanent teeth development. The aim of this work was to investigate birefringence and morphology of the secretory stage enamel organic extracellular matrix (EOECM), and structural and mechanical features of mature enamel from T1DM rats. Adult Wistar rats were maintained alive for a period of 56 days after the induction of experimental T1DM with a single dose of streptozotocin (60 mg/kg). After proper euthanasia of the animals, fixed upper incisors were accurately processed, and secretory stage EOECM and mature enamel were analyzed by transmitted polarizing and bright field light microscopies (TPLM and BFLM), energy-dispersive x-ray (EDX) analysis, scanning electron microscopy (SEM), and microhardness testing. Bright field light microscopies and transmitted polarizing light microscopies showed slight morphological changes in the secretory stage EOECM from diabetic rats, which also did not exhibit statistically significant alterations in birefringence brightness when compared to control animals (P > .05). EDX analysis showed that T1DM induced statistically significant little increases in the amount of calcium and phosphorus in outer mature enamel (P .05). T1DM also caused important ultrastructural alterations in mature enamel as revealed by SEM and induced a statistically significant reduction of about 13.67% in its microhardness at 80 μm from dentin-enamel junction (P enamel development, leading to alterations in mature enamel ultrastructure and in its mechanical features. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Wang, Yang; Zhang, Rongmin; Li, Jiyun; Wu, Zuowei; Yin, Wenjuan; Schwarz, Stefan; Tyrrell, Jonathan M; Zheng, Yongjun; Wang, Shaolin; Shen, Zhangqi; Liu, Zhihai; Liu, Jianye; Lei, Lei; Li, Mei; Zhang, Qidi; Wu, Congming; Zhang, Qijing; Wu, Yongning; Walsh, Timothy R; Shen, Jianzhong
2017-02-06
By 2030, the global population will be 8.5 billion, placing pressure on international poultry production, of which China is a key producer 1 . From April 2017, China will implement the withdrawal of colistin as a growth promoter, removing over 8,000 tonnes per year from the Chinese farming sector 2 . To understand the impact of banning colistin and the epidemiology of multi-drug-resistant (MDR) Escherichia coli (using bla NDM and mcr-1 as marker genes), we sampled poultry, dogs, sewage, wild birds and flies. Here, we show that mcr-1, but not bla NDM , is prevalent in hatcheries, but bla NDM quickly contaminates flocks through dogs, flies and wild birds. We also screened samples directly for resistance genes to understand the true breadth and depth of the environmental and animal resistome. Direct sample testing for bla NDM and mcr-1 in hatcheries, commercial farms, a slaughterhouse and supermarkets revealed considerably higher levels of positive samples than the bla NDM - and mcr-1-positive E. coli, indicating a substantial segment of unseen resistome-a phenomenon we have termed the 'phantom resistome'. Whole-genome sequencing identified common bla NDM -positive E. coli shared among farms, flies, dogs and farmers, providing direct evidence of carbapenem-resistant E. coli transmission and environmental contamination.
Directory of Open Access Journals (Sweden)
Kathrin Elisabeth Paulus
2011-08-01
Full Text Available Complex plant N-glycans containing β1,2-xylose and core α1,3-fucose are regarded as the major class of the so-called ‘carbohydrate cross-reactive determinants’ reactive with IgE antibodies in sera of many allergic patients, but their clinical relevance is still under debate. Plant glycosyltransferases, β1,2-xylosyltransferase (XylT and core α1,3-fucosyltransferase (FucT are responsible for the transfer of β1,2-linked xylose and core α1,3-linked fucose residues to N-glycans of glycoproteins, respectively. To test the clinical relevance of ß 1,2-xylose containing epitopes, expression of the tomato β1,2-xylosyltransferase was down-regulated by RNA interference (RNAi in transgenic plants. Fruits harvested from these transgenic plants were analysed for accumulation of XylT mRNA, abundance of ß1,2-xylose epitopes and their allergenic potential. Based on qPCR analysis XylT mRNA levels were reduced up to 10-fold in independent transgenic lines as compared to untransformed control, whereas no xylosylated N-glycans could be revealed by MS analysis. Immunoblotting using anti-xylose-specific IgG antibodies revealed a strong reduction of ß1,2-xylose containing epitopes. Incubating protein extracts from untransformed controls and XylT_RNAi plants with sera from tomato allergic patients showed a patient-specific reduction in IgE binding, indicating a reduced allergenic potential of XylT_RNAi tomato fruits, in vitro. To elucidate the clinical relevance of ß1,2-xylose containing complex N-glycans skin prick tests were performed demonstrating a reduced responsiveness of tomato allergic patients, in vivo. This study provides strong evidence for the clinical relevance of ß1,2-xylose containing epitopes in vivo.
Directory of Open Access Journals (Sweden)
Fabiana Perna
2015-04-01
Full Text Available Epigenetic regulation of key transcriptional programs is a critical mechanism that controls hematopoietic development, and, thus, aberrant expression patterns or mutations in epigenetic regulators occur frequently in hematologic malignancies. We demonstrate that the Polycomb protein L3MBTL1, which is monoallelically deleted in 20q- myeloid malignancies, represses the ability of stem cells to drive hematopoietic-specific transcriptional programs by regulating the expression of SMAD5 and impairing its recruitment to target regulatory regions. Indeed, knockdown of L3MBTL1 promotes the development of hematopoiesis and impairs neural cell fate in human pluripotent stem cells. We also found a role for L3MBTL1 in regulating SMAD5 target gene expression in mature hematopoietic cell populations, thereby affecting erythroid differentiation. Taken together, we have identified epigenetic priming of hematopoietic-specific transcriptional networks, which may assist in the development of therapeutic approaches for patients with anemia.
Directory of Open Access Journals (Sweden)
Bruix Marta
2010-01-01
Full Text Available Abstract Background Some functions of 4.1R in non-erythroid cells are directly related with its distinct sub-cellular localisation during cell cycle phases. During mitosis, 4.1R is implicated in cell cycle progression and spindle pole formation, and co-localizes with NuMA1. However, during interphase 4.1R is located in the nucleus and only partially co-localizes with NuMA1. Results We have characterized by NMR the structural features of the C-terminal domain of 4.1R and those of the minimal region (the last 64 residues involved in the interaction with NuMA1. This subdomain behaves as an intrinsically unfolded protein containing a central region with helical tendency. The specific residues implicated in the interaction with NuMA1 have been mapped by NMR titrations and involve the N-terminal and central helical regions. The segment of NuMA1 that interacts with 4.1R is phosphorylated during mitosis. Interestingly, NMR data indicates that the phosphorylation of NuMA1 interacting peptide provokes a change in the interaction mechanism. In this case, the recognition occurs through the central helical region as well as through the C-terminal region of the subdomain meanwhile the N-terminal region do not interact. Conclusions These changes in the interaction derived from the phosphorylation state of NuMA1 suggest that phosphorylation can act as subtle mechanism of temporal and spatial regulation of the complex 4.1R-NuMA1 and therefore of the processes where both proteins play a role.
Goitia, Veronica; Oquendo, Marcial; Stratton, Robert
2015-01-01
Introduction. More than 60 cases of 7p22 duplications and deletions have been reported with over 16 of them occurring without concomitant chromosomal abnormalities. Patient and Methods. We report a 29-month-old male diagnosed with autism. Whole genome chromosome SNP microarray (REVEAL) demonstrated a 1.3?Mb interstitial duplication of 7p22.1 ->p22.1 arr 7p22.1 (5,436,367?6,762,394), the second smallest interstitial 7p duplication reported to date. This interval included 14 OMIM annotated gene...
Gepp, Barbara; Lengger, Nina; Bublin, Merima; Hemmer, Wolfgang; Breiteneder, Heimo; Radauer, Christian
2014-07-01
Characterization of IgE-binding epitopes of allergens and determination of their patient-specific relevance is crucial for the diagnosis and treatment of allergy. We sought to assess the contribution of specific surface areas of the major birch pollen allergen Bet v 1.0101 to binding IgE of individual patients. Four distinct areas of Bet v 1 representing in total 81% of its surface were grafted onto the scaffold of its homolog, Api g 1.0101, to yield the chimeras Api-Bet-1 to Api-Bet-4. The chimeras were expressed in Escherichia coli and purified. IgE binding of 64 sera from Bet v 1-sensitized subjects with birch pollen allergy was determined by using direct ELISA. Specificity was assessed by means of inhibition ELISA. rApi g 1.0101, Api-Bet-1, Api-Bet-2, Api-Bet-3, and Api-Bet-4 bound IgE from 44%, 89%, 80%, 78%, and 48% of the patients, respectively. By comparing the amount of IgE binding to the chimeras and to rApi g 1.0101, 81%, 70%, 75%, and 45% of the patients showed significantly enhanced IgE binding to Api-Bet-1, Api-Bet-2, Api-Bet-3, and Api-Bet-4, respectively. The minority (8%) of the sera revealed enhanced IgE binding exclusively to a single chimera, whereas 31% showed increased IgE binding to all 4 chimeras compared with rApi g 1.0101. The chimeras inhibited up to 70% of IgE binding to rBet v 1.0101, confirming the specific IgE recognition of the grafted regions. The Bet v 1-specific IgE response is polyclonal, and epitopes are spread across the entire Bet v 1 surface. Furthermore, the IgE recognition profile of Bet v 1 is highly patient specific. Copyright © 2014 The Authors. Published by Mosby, Inc. All rights reserved.
Iqbal, Z.; Vandeweyer, G.; Voet, M. van der; Waryah, A.M.; Zahoor, M.Y.; Besseling, J.A.; Roca, L.T.; Silfhout, A.T. van; Nijhof, B.; Kramer, J.M.; Aa, N. van der; Ansar, M.; Peeters, H.; Helsmoortel, C.; Gilissen, C.F.H.A.; Vissers, L.E.L.M.; Veltman, J.A.; Brouwer, A.P.M. de; Kooy, R. van; Riazuddin, S.; Schenck, A.; Bokhoven, H. van; Rooms, L.
2013-01-01
AnkyrinG, encoded by the ANK3 gene, is involved in neuronal development and signaling. It has previously been implicated in bipolar disorder and schizophrenia by association studies. Most recently, de novo missense mutations in this gene were identified in autistic patients. However, the causative
Saha, Debarchana; Koli, Swanand; Reddy, Kudumula Venkata Rami
2017-06-01
Hemoglobin (Hb), a major protein involved in transport of oxygen (O 2 ), is expressed by erythroid lineages. Until recently, it was not known whether non-erythroid cells express Hb. The objective was to evaluate the expression and functional significance of Hb-α and Hb-β in human primary vaginal epithelial cells (hPVECs) and decipher downstream signaling. RT-PCR, qRT-PCR, flow cytometry, Western blot, immunofluorescence were used to evaluate the expression of Hb-α, Hb-β, and nuclear factor E2-related factor-2(Nrf2) after hydrogen peroxide (H 2 O 2 ) induction. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay were used to determine the binding efficiency of Nrf2 on the Hb-α promoter. Stimulation of hPVECs and human vaginal epithelial cell line, VK2/E6E7 with H 2 O 2 augmented the expression of Hb-α, Hb-β, Nrf2, heme oxygenase-1 (HO-1), and reactive oxygen species (ROS). Treatment of these cells with Nrf2 inhibitor, trigonelline (Trig) inhibited Hb-α and Hb-β expressions. Hb-α and Hb-β overexpression downregulated H 2 O 2 -induced ROS. The presence of Nrf2 binding domain was demonstrated within Hb-α promoter. The results revealed for the first time that Hb-α and Hb-β were induced by oxidative stress through the activation of Nrf2. Overexpression of Hb-α and Hb-β ameliorated H 2 O 2 -induced oxidative stress, indicating one of the possible mechanism(s) to protect hPVECS from oxidative stress. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Egan, Jan B.; Barrett, Michael T.; Champion, Mia D.; Middha, Sumit; Lenkiewicz, Elizabeth; Evers, Lisa; Francis, Princy; Schmidt, Jessica; Shi, Chang-Xin; Van Wier, Scott; Badar, Sandra; Ahmann, Gregory; Kortuem, K. Martin; Boczek, Nicole J.; Fonseca, Rafael; Craig, David W.; Carpten, John D.; Borad, Mitesh J.; Stewart, A. Keith
2014-01-01
Liposarcoma is the most common soft tissue sarcoma, but little is known about the genomic basis of this disease. Given the low cell content of this tumor type, we utilized flow cytometry to isolate the diploid normal and aneuploid tumor populations from a well-differentiated liposarcoma prior to array comparative genomic hybridization and whole genome sequencing. This work revealed massive highly focal amplifications throughout the aneuploid tumor genome including MDM2, a gene that has previously been found to be amplified in well-differentiated liposarcoma. Structural analysis revealed massive rearrangement of chromosome 12 and 11 gene fusions, some of which may be part of double minute chromosomes commonly present in well-differentiated liposarcoma. We identified a hotspot of genomic instability localized to a region of chromosome 12 that includes a highly conserved, putative L1 retrotransposon element, LOC100507498 which resides within a gene cluster (NAV3, SYT1, PAWR) where 6 of the 11 fusion events occurred. Interestingly, a potential gene fusion was also identified in amplified DDR2, which is a potential therapeutic target of kinase inhibitors such as dastinib, that are not routinely used in the treatment of patients with liposarcoma. Furthermore, 7 somatic, damaging single nucleotide variants have also been identified, including D125N in the PTPRQ protein. In conclusion, this work is the first to report the entire genome of a well-differentiated liposarcoma with novel chromosomal rearrangements associated with amplification of therapeutically targetable genes such as MDM2 and DDR2. PMID:24505276
Directory of Open Access Journals (Sweden)
Jan B Egan
Full Text Available Liposarcoma is the most common soft tissue sarcoma, but little is known about the genomic basis of this disease. Given the low cell content of this tumor type, we utilized flow cytometry to isolate the diploid normal and aneuploid tumor populations from a well-differentiated liposarcoma prior to array comparative genomic hybridization and whole genome sequencing. This work revealed massive highly focal amplifications throughout the aneuploid tumor genome including MDM2, a gene that has previously been found to be amplified in well-differentiated liposarcoma. Structural analysis revealed massive rearrangement of chromosome 12 and 11 gene fusions, some of which may be part of double minute chromosomes commonly present in well-differentiated liposarcoma. We identified a hotspot of genomic instability localized to a region of chromosome 12 that includes a highly conserved, putative L1 retrotransposon element, LOC100507498 which resides within a gene cluster (NAV3, SYT1, PAWR where 6 of the 11 fusion events occurred. Interestingly, a potential gene fusion was also identified in amplified DDR2, which is a potential therapeutic target of kinase inhibitors such as dastinib, that are not routinely used in the treatment of patients with liposarcoma. Furthermore, 7 somatic, damaging single nucleotide variants have also been identified, including D125N in the PTPRQ protein. In conclusion, this work is the first to report the entire genome of a well-differentiated liposarcoma with novel chromosomal rearrangements associated with amplification of therapeutically targetable genes such as MDM2 and DDR2.
Jao, Li-En; Appel, Bruce; Wente, Susan R
2012-04-01
In humans, GLE1 is mutated in lethal congenital contracture syndrome 1 (LCCS1) leading to prenatal death of all affected fetuses. Although the molecular roles of Gle1 in nuclear mRNA export and translation have been documented, no animal models for this disease have been reported. To elucidate the function of Gle1 in vertebrate development, we used the zebrafish (Danio rerio) model system. gle1 mRNA is maternally deposited and widely expressed. Altering Gle1 using an insertional mutant or antisense morpholinos results in multiple defects, including immobility, small eyes, diminished pharyngeal arches, curved body axis, edema, underdeveloped intestine and cell death in the central nervous system. These phenotypes parallel those observed in LCCS1 human fetuses. Gle1 depletion also results in reduction of motoneurons and aberrant arborization of motor axons. Unexpectedly, the motoneuron deficiency results from apoptosis of neural precursors, not of differentiated motoneurons. Mosaic analyses further indicate that Gle1 activity is required extrinsically in the environment for normal motor axon arborization. Importantly, the zebrafish phenotypes caused by Gle1 deficiency are only rescued by expressing wild-type human GLE1 and not by the disease-linked Fin(Major) mutant form of GLE1. Together, our studies provide the first functional characterization of Gle1 in vertebrate development and reveal its essential role in actively dividing cells. We propose that defective GLE1 function in human LCCS1 results in both neurogenic and non-neurogenic defects linked to the apoptosis of proliferative organ precursors.
Direct interaction of the Usher syndrome 1G protein SANS and myomegalin in the retina.
Overlack, Nora; Kilic, Dilek; Bauss, Katharina; Märker, Tina; Kremer, Hannie; van Wijk, Erwin; Wolfrum, Uwe
2011-10-01
The human Usher syndrome (USH) is the most frequent cause of combined hereditary deaf-blindness. USH is genetically heterogeneous with at least 11 chromosomal loci assigned to 3 clinical types, USH1-3. We have previously demonstrated that all USH1 and 2 proteins in the eye and the inner ear are organized into protein networks by scaffold proteins. This has contributed essentially to our current understanding of the function of USH proteins and explains why defects in proteins of different families cause very similar phenotypes. We have previously shown that the USH1G protein SANS (scaffold protein containing ankyrin repeats and SAM domain) contributes to the periciliary protein network in retinal photoreceptor cells. This study aimed to further elucidate the role of SANS by identifying novel interaction partners. In yeast two-hybrid screens of retinal cDNA libraries we identified 30 novel putative interacting proteins binding to the central domain of SANS (CENT). We confirmed the direct binding of the phosphodiesterase 4D interacting protein (PDE4DIP), a Golgi associated protein synonymously named myomegalin, to the CENT domain of SANS by independent assays. Correlative immunohistochemical and electron microscopic analyses showed a co-localization of SANS and myomegalin in mammalian photoreceptor cells in close association with microtubules. Based on the present results we propose a role of the SANS-myomegalin complex in microtubule-dependent inner segment cargo transport towards the ciliary base of photoreceptor cells. Copyright © 2011 Elsevier B.V. All rights reserved.
Namani, Akhileshwar; Matiur Rahaman, Md; Chen, Ming; Tang, Xiuwen
2018-01-06
NRF2 is the key regulator of oxidative stress in normal cells and aberrant expression of the NRF2 pathway due to genetic alterations in the KEAP1 (Kelch-like ECH-associated protein 1)-NRF2 (nuclear factor erythroid 2 like 2)-CUL3 (cullin 3) axis leads to tumorigenesis and drug resistance in many cancers including head and neck squamous cell cancer (HNSCC). The main goal of this study was to identify specific genes regulated by the KEAP1-NRF2-CUL3 axis in HNSCC patients, to assess the prognostic value of this gene signature in different cohorts, and to reveal potential biomarkers. RNA-Seq V2 level 3 data from 279 tumor samples along with 37 adjacent normal samples from patients enrolled in the The Cancer Genome Atlas (TCGA)-HNSCC study were used to identify upregulated genes using two methods (altered KEAP1-NRF2-CUL3 versus normal, and altered KEAP1-NRF2-CUL3 versus wild-type). We then used a new approach to identify the combined gene signature by integrating both datasets and subsequently tested this signature in 4 independent HNSCC datasets to assess its prognostic value. In addition, functional annotation using the DAVID v6.8 database and protein-protein interaction (PPI) analysis using the STRING v10 database were performed on the signature. A signature composed of a subset of 17 genes regulated by the KEAP1-NRF2-CUL3 axis was identified by overlapping both the upregulated genes of altered versus normal (251 genes) and altered versus wild-type (25 genes) datasets. We showed that increased expression was significantly associated with poor survival in 4 independent HNSCC datasets, including the TCGA-HNSCC dataset. Furthermore, Gene Ontology, Kyoto Encyclopedia of Genes and Genomes, and PPI analysis revealed that most of the genes in this signature are associated with drug metabolism and glutathione metabolic pathways. Altogether, our study emphasizes the discovery of a gene signature regulated by the KEAP1-NRF2-CUL3 axis which is strongly associated with
International Nuclear Information System (INIS)
Bujak, Emil; Pretto, Francesca; Ritz, Danilo; Gualandi, Laura; Wulhfard, Sarah; Neri, Dario
2014-01-01
There is a considerable interest for the discovery and characterization of tumor-associated antigens, which may facilitate antibody-based pharmacodelivery strategies. Thrombospondin-1 and thrombospondin-2 are homologous secreted proteins, which have previously been reported to be overexpressed during remodeling typical for wound healing and tumor progression and to possibly play a functional role in cell proliferation, migration and apoptosis. To our knowledge, a complete immunohistochemical characterization of thrombospondins levels in normal rodent tissues has not been reported so far. Using antibody phage technology, we have generated and characterized monoclonal antibodies specific to murine thrombospondin-1 and thrombospondin-2, two antigens which share 62% aminoacid identity. An immunofluorescence analysis revealed that both antigens are virtually undetectable in normal mouse tissues, except for a weak staining of heart tissue by antibodies specific to thrombospondin-1. The analysis also showed that thrombospondin-1 was strongly expressed in 5/7 human tumors xenografted in nude mice, while it was only barely detectable in 3/8 murine tumors grafted in immunocompetent mice. By contrast, a high-affinity antibody to thrombospondin-2 revealed a much lower level of expression of this antigen in cancer specimens. Our analysis resolves ambiguities related to conflicting reports on thrombosponding expression in health and disease. Based on our findings, thrombospondin-1 (and not thrombospondin-2) may be considered as a target for antibody-based pharmacodelivery strategies, in consideration of its low expression in normal tissues and its upregulation in cancer. - Highlights: • High affinity monoclonal antibodies to murine and human TSP1 and 2 were raised. • Both antigens are virtually undetectable in normal mouse tissues. • Strong positivity of human tumor xenografts for TSP1 was detected. • Study revealed much lower level of TSP2 expression in cancer specimens
Energy Technology Data Exchange (ETDEWEB)
Bujak, Emil [Department of Chemistry and Applied Biosciences, Swiss Federal Institute of Technology (ETH Zürich), Vladimir-Prelog-Weg 2, CH-8093 Zurich (Switzerland); Pretto, Francesca; Ritz, Danilo; Gualandi, Laura; Wulhfard, Sarah [Philochem AG, Libernstrasse 3, CH-8112 Otelfingen (Switzerland); Neri, Dario, E-mail: neri@pharma.ethz.ch [Department of Chemistry and Applied Biosciences, Swiss Federal Institute of Technology (ETH Zürich), Vladimir-Prelog-Weg 2, CH-8093 Zurich (Switzerland)
2014-09-10
There is a considerable interest for the discovery and characterization of tumor-associated antigens, which may facilitate antibody-based pharmacodelivery strategies. Thrombospondin-1 and thrombospondin-2 are homologous secreted proteins, which have previously been reported to be overexpressed during remodeling typical for wound healing and tumor progression and to possibly play a functional role in cell proliferation, migration and apoptosis. To our knowledge, a complete immunohistochemical characterization of thrombospondins levels in normal rodent tissues has not been reported so far. Using antibody phage technology, we have generated and characterized monoclonal antibodies specific to murine thrombospondin-1 and thrombospondin-2, two antigens which share 62% aminoacid identity. An immunofluorescence analysis revealed that both antigens are virtually undetectable in normal mouse tissues, except for a weak staining of heart tissue by antibodies specific to thrombospondin-1. The analysis also showed that thrombospondin-1 was strongly expressed in 5/7 human tumors xenografted in nude mice, while it was only barely detectable in 3/8 murine tumors grafted in immunocompetent mice. By contrast, a high-affinity antibody to thrombospondin-2 revealed a much lower level of expression of this antigen in cancer specimens. Our analysis resolves ambiguities related to conflicting reports on thrombosponding expression in health and disease. Based on our findings, thrombospondin-1 (and not thrombospondin-2) may be considered as a target for antibody-based pharmacodelivery strategies, in consideration of its low expression in normal tissues and its upregulation in cancer. - Highlights: • High affinity monoclonal antibodies to murine and human TSP1 and 2 were raised. • Both antigens are virtually undetectable in normal mouse tissues. • Strong positivity of human tumor xenografts for TSP1 was detected. • Study revealed much lower level of TSP2 expression in cancer specimens
Ghosh, Debolina; LeVault, Kelsey R; Brewer, Gregory J
2014-01-01
To determine whether glutathione (GSH) loss or increased reactive oxygen species (ROS) are more important to neuron loss, aging, and Alzheimer's disease (AD), we stressed or boosted GSH levels in neurons isolated from aging 3xTg-AD neurons compared with those from age-matched nontransgenic (non-Tg) neurons. Here, using titrating with buthionine sulfoximine, an inhibitor of γ-glutamyl cysteine synthetase (GCL), we observed that GSH depletion increased neuronal death of 3xTg-AD cultured neurons at increasing rates across the age span, whereas non-Tg neurons were resistant to GSH depletion until old age. Remarkably, the rate of neuron loss with ROS did not increase in old age and was the same for both genotypes, which indicates that cognitive deficits in the AD model were not caused by ROS. Therefore, we targeted for neuroprotection activation of the redox sensitive transcription factor, nuclear erythroid-related factor 2 (Nrf2) by 18 alpha glycyrrhetinic acid to stimulate GSH synthesis through GCL. This balanced stimulation of a number of redox enzymes restored the lower levels of Nrf2 and GCL seen in 3xTg-AD neurons compared with those of non-Tg neurons and promoted translocation of Nrf2 to the nucleus. By combining the Nrf2 activator together with the NADH precursor, nicotinamide, we increased neuron survival against amyloid beta stress in an additive manner. These stress tests and neuroprotective treatments suggest that the redox environment is more important for neuron survival than ROS. The dual neuroprotective treatment with nicotinamide and an Nrf2 inducer indicates that these age-related and AD-related changes are reversible. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Yunjie Zhao
Full Text Available The zinc-binding Bbox1 domain in protein MID1, a member of the TRIM family of proteins, facilitates the ubiquitination of the catalytic subunit of protein phosphatase 2A and alpha4, a protein regulator of PP2A. The natural mutation of residue A130 to a valine or threonine disrupts substrate recognition and catalysis. While NMR data revealed the A130T mutant Bbox1 domain failed to coordinate both structurally essential zinc ions and resulted in an unfolded structure, the unfolding mechanism is unknown. Principle component analysis revealed that residue A130 served as a hinge point between the structured β-strand-turn-β-strand (β-turn-β and the lasso-like loop sub-structures that constitute loop1 of the ββα-RING fold that the Bbox1 domain adopts. Backbone RMSD data indicate significant flexibility and departure from the native structure within the first 5 ns of the molecular dynamics (MD simulation for the A130V mutant (>6 Å and after 30 ns for A130T mutant (>6 Å. Overall RMSF values were higher for the mutant structures and showed increased flexibility around residues 125 and 155, regions with zinc-coordinating residues. Simulated pKa values of the sulfhydryl group of C142 located near A130 suggested an increased in value to ~9.0, paralleling the increase in the apparent dielectric constants for the small cavity near residue A130. Protonation of the sulfhydryl group would disrupt zinc-coordination, directly contributing to unfolding of the Bbox1. Together, the increased motion of residues of loop 1, which contains four of the six zinc-binding cysteine residues, and the increased pKa of C142 could destabilize the structure of the zinc-coordinating residues and contribute to the unfolding.
The onset of hemoglobin synthesis in spleens of irradiated mice after bone marrow transplantation
International Nuclear Information System (INIS)
Ponka, P.; Fuchs, O.; Borova, J.; Necas, E.
1977-01-01
Messenger RNA (mRNA) for globin was isolated from spleens of irradiated mice in which erythroid differentiation was induced by a bone marrow graft. The globin mRNA was isolated either by means of sucrose gradients of reticulocyte polysomal RNA or by affinity chromatography of total spleen RNA on poly (U)-sepharose. The globin mRNA was tested in a wheat embryo cell-free system. The appearance of mRNA in the spleen erythroid colonies was correlated with other parameters of erythroid differentiation such as globin synthesis, activity of delta-aminolevulinic acid synthetase and iron uptake. Poly(A) containing mRNA did appear already on the 3rd day after grafting. However, significant translational activity of globin mRNA could be demonstrated only one day later together with increase in globin synthesis and delta-aminolevulinic acid synthetase and enhanced iron uptake. In the second part of this study mouse spleen cells rich in erythroid elements were incubated with a specific heme synthesis inhibitor (isonicotinic acid hydrazide, INH) and the synthesis of 9 S RNA was estimated. It was found that a 40-minute incubation with INH reduced uridine incorporation into 9 S RNA fraction by about 40%. (author)
Mielograma de ratas com disfunção tireoidiana
Directory of Open Access Journals (Sweden)
R.D Castro
2011-10-01
Full Text Available The cells of the myelo id, lymphoid , and erythroid lineage s of the bone marrow were quantified in rats with hypo and hyperthyroidism. Fifteen Wistar rats were divided into three groups: hypothyroid (n=5, hyperthyroid (n=5 , and control (n=5. Three months after the onset of the treatment s, euthanasia was performed . Bone marrow was aspirated from femurs of each animal to perform smear s that were stained with Quick Panoptic. T he percentage s of rubroblast, prorubrocyte, metarubrocyte, myeloblast, promyelocytes, metamyelocytes, myel ocytes, segmented, eosinophils, basophils, lymphocytes, plasma cells and monocytes in were determined a total of 500 cells. The bone marrow of animals with hypothyroidism had hypoplasia. The myeloid:erythroid ratio was higher in animals with thyroid dysfun ction. In hypo and hyperthyroidism, there was a significant reduction of the percentage of rubrocyte, metarubrocyte , and lymphocytes and increase of myelocytes and segmented cells. In hypothyroidism, there was a significant increase in the percentage of me tamyelocytes. It is c oncluded that both hypo and hyperfunction of thyroid increase the myeloid:erythroid ratio by increasing the number of cells of the myeloid lineage and reducing the cells of the erythroid lineage.
Ahluwalia, M; Donovan, H; Singh, N; Butcher, L; Erusalimsky, J D
2010-10-01
Anagrelide is a selective inhibitor of megakaryocytopoiesis used to treat thrombocytosis in patients with chronic myeloproliferative disorders. The effectiveness of anagrelide in lowering platelet counts is firmly established, but its primary mechanism of action remains elusive. Here, we have evaluated whether anagrelide interferes with the major signal transduction cascades stimulated by thrombopoietin in the hematopoietic cell line UT-7/mpl and in cultured CD34(+) -derived human hematopoietic cells. In addition, we have used quantitative mRNA expression analysis to assess whether the drug affects the levels of known transcription factors that control megakaryocytopoiesis. In UT-7/mpl cells, anagrelide (1μm) did not interfere with MPL-mediated signaling as monitored by its lack of effect on JAK2 phosphorylation. Similarly, the drug did not affect the phosphorylation of STAT3, ERK1/2 or AKT in either UT-7/mpl cells or primary hematopoietic cells. In contrast, during thrombopoietin-induced megakaryocytic differentiation of normal hematopoietic cultures, anagrelide (0.3μm) reduced the rise in the mRNA levels of the transcription factors GATA-1 and FOG-1 as well as those of the downstream genes encoding FLI-1, NF-E2, glycoprotein IIb and MPL. However, the drug showed no effect on GATA-2 or RUNX-1 mRNA expression. Furthermore, anagrelide did not diminish the rise in GATA-1 and FOG-1 expression during erythropoietin-stimulated erythroid differentiation. Cilostamide, an exclusive and equipotent phosphodiesterase III (PDEIII) inhibitor, did not alter the expression of these genes. Anagrelide suppresses megakaryocytopoiesis by reducing the expression levels of GATA-1 and FOG-1 via a PDEIII-independent mechanism that is differentiation context-specific and does not involve inhibition of MPL-mediated early signal transduction events. © 2010 International Society on Thrombosis and Haemostasis.
Cryo-EM Structure of a KCNQ1/CaM Complex Reveals Insights into Congenital Long QT Syndrome.
Sun, Ji; MacKinnon, Roderick
2017-06-01
KCNQ1 is the pore-forming subunit of cardiac slow-delayed rectifier potassium (I Ks ) channels. Mutations in the kcnq1 gene are the leading cause of congenital long QT syndrome (LQTS). Here, we present the cryoelectron microscopy (cryo-EM) structure of a KCNQ1/calmodulin (CaM) complex. The conformation corresponds to an "uncoupled," PIP 2 -free state of KCNQ1, with activated voltage sensors and a closed pore. Unique structural features within the S4-S5 linker permit uncoupling of the voltage sensor from the pore in the absence of PIP 2 . CaM contacts the KCNQ1 voltage sensor through a specific interface involving a residue on CaM that is mutated in a form of inherited LQTS. Using an electrophysiological assay, we find that this mutation on CaM shifts the KCNQ1 voltage-activation curve. This study describes one physiological form of KCNQ1, depolarized voltage sensors with a closed pore in the absence of PIP 2 , and reveals a regulatory interaction between CaM and KCNQ1 that may explain CaM-mediated LQTS. Copyright © 2017 Elsevier Inc. All rights reserved.
Variants in the ASB10 Gene Are Associated with Primary Open Angle Glaucoma
Micheal, S.; Ayub, H.; Islam, F.; Siddiqui, S.N.; Khan, W.A.; Akhtar, F.; Qamar, R.; Khan, M.I.; Hollander, A.I. den
2015-01-01
BACKGROUND: Recently nonsynonymous coding variants in the ankyrin repeats and suppressor of cytokine signaling box-containing protein 10 (ASB10) gene were found to be associated with primary open angle glaucoma (POAG) in cohorts from Oregon and Germany, but this finding was not confirmed in an
DeMille, Desiree; Bikman, Benjamin T; Mathis, Andrew D; Prince, John T; Mackay, Jordan T; Sowa, Steven W; Hall, Tacie D; Grose, Julianne H
2014-07-15
Per-Arnt-Sim (PAS) kinase is a sensory protein kinase required for glucose homeostasis in yeast, mice, and humans, yet little is known about the molecular mechanisms of its function. Using both yeast two-hybrid and copurification approaches, we identified the protein-protein interactome for yeast PAS kinase 1 (Psk1), revealing 93 novel putative protein binding partners. Several of the Psk1 binding partners expand the role of PAS kinase in glucose homeostasis, including new pathways involved in mitochondrial metabolism. In addition, the interactome suggests novel roles for PAS kinase in cell growth (gene/protein expression, replication/cell division, and protein modification and degradation), vacuole function, and stress tolerance. In vitro kinase studies using a subset of 25 of these binding partners identified Mot3, Zds1, Utr1, and Cbf1 as substrates. Further evidence is provided for the in vivo phosphorylation of Cbf1 at T211/T212 and for the subsequent inhibition of respiration. This respiratory role of PAS kinase is consistent with the reported hypermetabolism of PAS kinase-deficient mice, identifying a possible molecular mechanism and solidifying the evolutionary importance of PAS kinase in the regulation of glucose homeostasis. © 2014 DeMille et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Bodero, Marcia; Hoogenboom, Ron L A P; Bovee, Toine F H; Portier, Liza; de Haan, Laura; Peijnenburg, Ad; Hendriksen, Peter J M
2018-02-01
A study with DNA microarrays was performed to investigate the effects of two diarrhetic and one azaspiracid shellfish poison, okadaic acid (OA), dinophysistoxin-1 (DTX-1) and azaspiracid-1 (AZA-1) respectively, on the whole-genome mRNA expression of undifferentiated intestinal Caco-2 cells. Previously, the most responding genes were used to develop a dedicated array tube test to screen shellfish samples on the presence of these toxins. In the present study the whole genome mRNA expression was analyzed in order to reveal modes of action and obtain hints on potential biomarkers suitable to be used in alternative bioassays. Effects on key genes in the most affected pathways and processes were confirmed by qPCR. OA and DTX-1 induced almost identical effects on mRNA expression, which strongly indicates that OA and DTX-1induce similar toxic effects. Biological interpretation of the microarray data indicates that both compounds induce hypoxia related pathways/processes, the unfolded protein response (UPR) and endoplasmic reticulum (ER) stress. The gene expression profile of AZA-1 is different and shows increased mRNA expression of genes involved in cholesterol synthesis and glycolysis, suggesting a different mode of action for this toxin. Future studies should reveal whether identified pathways provide suitable biomarkers for rapid detection of DSPs in shellfish. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
DEFF Research Database (Denmark)
Leinøe, Eva; Nielsen, Ove Juul; Jønson, Lars
2016-01-01
-threatening coagulation disorder causing recurrent venous thromboembolic events, severe thrombocytopenia, and subdural hematomas. Whole-exome sequencing revealed a frameshift mutation (C3AR1 c.355-356dup, p.Asp119Alafs*19) resulting in a premature stop codon in C3AR1 (Complement Component 3a Receptor 1). Based...
Studies of the erythroid inductive microenvironment in vitro
International Nuclear Information System (INIS)
van Zant, G.; Goldwasser, E.; Pech, N.
1977-01-01
Spleen cells from radiated mice (XS), but not from normal mice (NS), when combined with mouse marrow cells in vitro, had two effects on hemoglobin synthesis: (1) increased baseline, and (2) augmented erythropoietin-induced, hemoglobin formation. Spleen cells from normal and radiated rats caused increased hemoglobin synthesis by rat marrow cells in a dose-dependent manner. In addition, lung and thymus cells from radiated rats, but not from normal rats, caused increased hemoglobin synthesis by rat marrow cells. Rat NS augmented hemoglobin formation by mouse marrow, but neither mouse NS nor mouse XS had an effect on rat marrow. Medium from rat NS cultures stimulated hemoglobin synthesis when added to rat marrow cells. The increases in baseline, and in the response to erythropoietin, were dependent on the amount of ''conditioned medium.'' The substance in the medium responsible for these effects was not erythropoietin
Proteomic Profiling in the Brain of CLN1 Disease Model Reveals Affected Functional Modules.
Tikka, Saara; Monogioudi, Evanthia; Gotsopoulos, Athanasios; Soliymani, Rabah; Pezzini, Francesco; Scifo, Enzo; Uusi-Rauva, Kristiina; Tyynelä, Jaana; Baumann, Marc; Jalanko, Anu; Simonati, Alessandro; Lalowski, Maciej
2016-03-01
Neuronal ceroid lipofuscinoses (NCL) are the most commonly inherited progressive encephalopathies of childhood. Pathologically, they are characterized by endolysosomal storage with different ultrastructural features and biochemical compositions. The molecular mechanisms causing progressive neurodegeneration and common molecular pathways linking expression of different NCL genes are largely unknown. We analyzed proteome alterations in the brains of a mouse model of human infantile CLN1 disease-palmitoyl-protein thioesterase 1 (Ppt1) gene knockout and its wild-type age-matched counterpart at different stages: pre-symptomatic, symptomatic and advanced. For this purpose, we utilized a combination of laser capture microdissection-based quantitative liquid chromatography tandem mass spectrometry (MS) and matrix-assisted laser desorption/ionization time-of-flight MS imaging to quantify/visualize the changes in protein expression in disease-affected brain thalamus and cerebral cortex tissue slices, respectively. Proteomic profiling of the pre-symptomatic stage thalamus revealed alterations mostly in metabolic processes and inhibition of various neuronal functions, i.e., neuritogenesis. Down-regulation in dynamics associated with growth of plasma projections and cellular protrusions was further corroborated by findings from RNA sequencing of CLN1 patients' fibroblasts. Changes detected at the symptomatic stage included: mitochondrial functions, synaptic vesicle transport, myelin proteome and signaling cascades, such as RhoA signaling. Considerable dysregulation of processes related to mitochondrial cell death, RhoA/Huntington's disease signaling and myelin sheath breakdown were observed at the advanced stage of the disease. The identified changes in protein levels were further substantiated by bioinformatics and network approaches, immunohistochemistry on brain tissues and literature knowledge, thus identifying various functional modules affected in the CLN1 childhood
Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication
Energy Technology Data Exchange (ETDEWEB)
Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo [Food and Drug Administration, Silver Spring, MD (United States); Yamada, Kenneth M. [National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Food and Drug Administration, Silver Spring, MD (United States)
2017-03-15
We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.
Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication
International Nuclear Information System (INIS)
Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo; Yamada, Kenneth M.; Dhawan, Subhash
2017-01-01
We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.
Kloth, Katja; Denecke, Jonas; Hempel, Maja; Johannsen, Jessika; Strom, Tim M; Kubisch, Christian; Lessel, Davor
2017-09-01
Ankyrin-G, encoded by ANK3, plays an important role in neurodevelopment and neuronal function. There are multiple isoforms of Ankyrin-G resulting in differential tissue expression and function. Heterozygous missense mutations in ANK3 have been associated with autism spectrum disorder. Further, in three siblings a homozygous frameshift mutation affecting only the longest isoform and a patient with a balanced translocation disrupting all isoforms were documented. The latter four patients were affected by a variable degree of intellectual disability, attention deficit hyperactivity disorder and autism. Here, we report on a boy with speech impairment, intellectual disability, autistic features, macrocephaly, macrosomia, chronic hunger and an altered sleeping pattern. By trio-whole-exome sequencing, we identified the first de novo nonsense mutation affecting all ANK3 transcripts. Thus, our data expand the phenotype of ANK3-associated diseases and suggest an isoform-based, phenotypic continuum between dominant and recessive ANK3-associated pathologies. Copyright © 2017. Published by Elsevier Masson SAS.
Directory of Open Access Journals (Sweden)
Vachev T.I.
2015-06-01
Full Text Available Schizophrenia (SZ is a chronic neuropsychiatric disorder characterized by affective, neuromorphological and cognitive impairment, deteriorated social functioning and psychosis with underlying molecular abnormalities, including gene expression changes. Observations have suggested that fasciculation and elongation protein ζ-1 (FEZ1 may be implicated in the pathogenesis of schizophrenia. Nevertheless, our current knowledge of the expression of FEZ1 in peripheral blood of schizophrenia patients remains unclear. The purpose of this study was to identify the characteristic gene expression patterns of FEZ1 in peripheral blood samples from schizophrenia patients. We performed quantitative reverse-transcriptase (qRT-PCR analysis using peripheral blood from drug-free schizophrenia patients (n = 29 and age and gender-matched general population controls (n = 24. For the identification of FEZ1 gene expression patterns, we applied a comparative threshold cycle (CT method. A statistically significant difference of FEZ1 mRNA level was revealed in schizophrenia subjects compared to healthy controls (p = 0.0034. To the best of our knowledge, this study is the first describing a down-regulation of FEZ1 gene expression in peripheral blood of patients with schizophrenia. Our results suggested a possible functional role of FEZ1 in the pathogenesis of schizophrenia and confirmed the utility of peripheral blood samples for molecular profiling of psychiatric disorders including schizophrenia. The current study describes FEZ1 gene expression changes in peripheral blood of patients with schizophrenia with significantly down-regulation of FEZ1 mRNA. Thus, our results provide support for a model of SZ pathogenesis that includes the effects of FEZ1 expression.
Directory of Open Access Journals (Sweden)
Bruno Aquino
2017-05-01
Full Text Available Kinases are primary regulators of plant metabolism and excellent targets for plant breeding. However, most kinases, including the abundant receptor-like kinases (RLK, have no assigned role. SIRK1 is a leucine-rich repeat receptor-like kinase (LRR-RLK, the largest family of RLK. In Arabidopsis thaliana, SIRK1 (AtSIRK1 is phosphorylated after sucrose is resupplied to sucrose-starved seedlings and it modulates the sugar response by phosphorylating several substrates. In maize, the ZmSIRK1 expression is altered in response to drought stress. In neither Arabidopsis nor in maize has the function of SIRK1 been completely elucidated. As a first step toward the biochemical characterization of ZmSIRK1, we obtained its recombinant kinase domain, demonstrated that it binds AMP-PNP, a non-hydrolysable ATP-analog, and solved the structure of ZmSIRK1- AMP-PNP co-crystal. The ZmSIRK1 crystal structure revealed a unique conformation for the activation segment. In an attempt to find inhibitors for ZmSIRK1, we screened a focused small molecule library and identified six compounds that stabilized ZmSIRK1 against thermal melt. ITC analysis confirmed that three of these compounds bound to ZmSIRK1 with low micromolar affinity. Solving the 3D structure of ZmSIRK1-AMP-PNP co-crystal provided information on the molecular mechanism of ZmSIRK1 activity. Furthermore, the identification of small molecules that bind this kinase can serve as initial backbone for development of new potent and selective ZmSIRK1 antagonists.
Luo, Lan; Zhen, Lifeng; Xu, Yatao; Yang, Yongxia; Feng, Suxiang; Wang, Shumei; Liang, Shengwang
2016-06-20
Stroke is a leading cause of death and disability in the world. However, current therapies are limited. Naodesheng, a widely used traditional Chinese medicine prescription, has shown a good clinical curative effect on ischemic stroke. Also, Naodesheng has been suggested to have neuroprotective effect on focal cerebral ischemia rats, but the underlying molecular mechanism remains unclear. The present study was designed to evaluate the effect of Naodesheng bioactive extract on the metabolic changes in brain tissue, plasma and urine induced by cerebral ischemia perfusion injury, and explore the possible metabolic mechanisms by using a (1)H NMR-based metabonomics approach. A middle cerebral artery occlusion rat model was established and confirmed by the experiments of neurobehavioral abnormality evaluation, brain tissue TTC staining and pathological examination. The metabolic changes in brain tissue, plasma and urine were then assessed by a (1)H NMR technique combined with multivariate statistical analysis method. These NMR data showed that cerebral ischemia reperfusion induced great metabolic disorders in brain tissue, plasma and urine metabolisms. However, Naodesheng bioactive extract could reverse most of the imbalanced metabolites. Meanwhile, it was found that both the medium and high dosages of Naodesheng bioactive extract were more effective on the metabolic changes than the low dosage, consistent with histopathological assessments. These results revealed that Naodesheng had protective effect on ischemic stroke rats and the underlying mechanisms involved multiple metabolic pathways, including energy metabolism, amino acid metabolism, oxidative stress and inflammatory injury. The present study could provide evidence that metabonomics revealed its capacity to evaluate the holistic efficacy of traditional Chinese medicine and explore the underlying mechanisms. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)
2015-10-23
p70 ribosomal S6 kinase 1 (S6K1) is an important serine/threonine kinase and downstream target of the mechanistic target of rapamycin complex 1 (mTORC1) signaling pathway. PF-4708671 is a specific inhibitor of S6K1, and prevents S6K1-mediated phosphorylation of the S6 protein. PF-4708671 treatment often leads to apoptotic cell death. However, the protective mechanism against PF-4708671-induced cell death has not been elucidated. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is essential for protecting cells against oxidative stress. p62, an adaptor protein in the autophagic process, enhances Nrf2 activation through the impairment of Keap1 activity. In this study, we showed that PF-4708671 induces autophagic Keap1 degradation-mediated Nrf2 activation in p62-dependent manner. Furthermore, p62-dependent Nrf2 activation plays a crucial role in protecting cells from PF-4708671-mediated apoptosis. - Highlights: • PF-4708671, a S6K1-specific inhibitor, prevents S6K1-mediated S6 phosphorylation. • However, PF-4708671 treatment often leads to apoptotic cell death. • Protective mechanism against PF-4708671-induced cell death remains to be elucidated. • PF-4708671 induced p62-dependent, autophagic Keap1 degradation-mediated Nrf2 activation. • p62-dependent Nrf2 activation protects cells from PF-4708671-mediated apoptosis.
Cui, Jiajun; Meng, Xianfeng; Gao, Xudong; Tan, Guangxuan
2010-03-01
Pokemon, which stands for POK erythroid myeloid ontogenic factor, can regulate expression of many genes and plays an important role in tumorigenesis. Curcumin, a natural and non-toxic yellow compound, has capacity for antioxidant, free radical scavenger, anti-inflammatory properties. Recent studies shows it is a potential inhibitor of cell proliferation in a variety of tumour cells. To investigate whether curcumin can regulate the expression of Pokemon, a series of experiments were carried out. Transient transfection experiments demonstrated that curcumin could decrease the activity of the Pokemon promoter. Western blot analysis suggested that curcumin could significantly decrease the expression of the Pokemon. Overexpression of Sp1 could enhance the activity of the Pokemon promoter, whereas knockdown of Sp1 could decrease its activity. More important, we also found that curcumin could decrease the expression of the Pokemon by suppressing the stimulation of the Sp1 protein. Therefore, curcumin is a potential reagent for tumour therapy which may target Pokemon.
Possible involvement of miRNAs in tropism of Parvovirus B19.
Anbarlou, Azadeh; AkhavanRahnama, Mahshid; Atashi, Amir; Soleimani, Masoud; Arefian, Ehsan; Gallinella, Giorgio
2016-03-01
Human Parvovirus B19 (PVB19) is one of the most important pathogens that targets erythroid lineage. Many factors were mentioned for restriction to erythroid progenitor cells (EPCs). Previous studies showed that in non-permissive cells VP1 and VP2 (structural proteins) mRNAs were detected but could not translate to proteins. A bioinformatics study showed that this inhibition might be due to specific microRNAs (miRNAs) present in non-permissive cells but not in permissive EPCs. To confirm the hypothesis, we evaluated the effect of miRNAs on VP expression. CD34(+) HSCs were separated from cord blood. Then, CD34(+) cells were treated with differentiation medium to obtain CD36(+) EPCs. To evaluate the effect of miRNAs on VP expression in MCF7 and HEK-293 cell lines (non-permissive cells) and CD36(+) EPCs, dual luciferase assay was performed in presence of shRNAs against Dicer and Drosha to disrupt miRNA biogenesis. QRT-PCR was performed to check down-regulation of Dicer and Drosha after transfection. All measurements were done in triplicate. Data means were compared using one-way ANOVAs. MicroRNA prediction was done by the online microRNA prediction tools. No significant difference was shown in luciferase activity of CD36(+) EPCs after co-transfection with shRNAs, while it was significant in non-permissive cells. Our study revealed that miRNAs may be involved in inhibition of VP expression in non-permissive cells, although further studies are required to demonstrate which miRNAs exactly are involved in regulation of PVB19 replication.
ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN
Directory of Open Access Journals (Sweden)
Marco Gabbianelli
2009-11-01
In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF. In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.
H4K20me0 marks post-replicative chromatin and recruits the TONSL₋MMS22L DNA repair complex
Energy Technology Data Exchange (ETDEWEB)
Saredi, Giulia; Huang, Hongda; Hammond, Colin M.; Alabert, Constance; Bekker-Jensen, Simon; Forne, Ignasi; Reverón-Gómez, Nazaret; Foster, Benjamin M.; Mlejnkova, Lucie; Bartke, Till; Cejka, Petr; Mailand, Niels; Imhof, Axel; Patel, Dinshaw J.; Groth, Anja [UCopenhagen; (MSKCC); (ICL); (LMU); (Zurich)
2016-06-22
Here, we report that after DNA replication, chromosomal processes including DNA repair and transcription take place in the context of sister chromatids. While cell cycle regulation can guide these processes globally, mechanisms to distinguish pre- and post-replicative states locally remain unknown. In this paper we reveal that new histones incorporated during DNA replication provide a signature of post-replicative chromatin, read by the human TONSL–MMS22L1, 2, 3, 4 homologous recombination complex. We identify the TONSL ankyrin repeat domain (ARD) as a reader of histone H4 tails unmethylated at K20 (H4K20me0), which are specific to new histones incorporated during DNA replication and mark post-replicative chromatin until the G2/M phase of the cell cycle. Accordingly, TONSL–MMS22L binds new histones H3–H4 both before and after incorporation into nucleosomes, remaining on replicated chromatin until late G2/M. H4K20me0 recognition is required for TONSL–MMS22L binding to chromatin and accumulation at challenged replication forks and DNA lesions. Consequently, TONSL ARD mutants are toxic, compromising genome stability, cell viability and resistance to replication stress. Finally, together, these data reveal a histone-reader-based mechanism for recognizing the post-replicative state, offering a new angle to understand DNA repair with the potential for targeted cancer therapy.
Reconstituted NALP1 inflammasome reveals two-step mechanism of caspase-1 activation.
Faustin, Benjamin; Lartigue, Lydia; Bruey, Jean-Marie; Luciano, Frederic; Sergienko, Eduard; Bailly-Maitre, Beatrice; Volkmann, Niels; Hanein, Dorit; Rouiller, Isabelle; Reed, John C
2007-03-09
Interleukin (IL)-1beta maturation is accomplished by caspase-1-mediated proteolysis, an essential element of innate immunity. NLRs constitute a recently recognized family of caspase-1-activating proteins, which contain a nucleotide-binding oligomerization domain and leucine-rich repeat (LRR) domains and which assemble into multiprotein complexes to create caspase-1-activating platforms called "inflammasomes." Using purified recombinant proteins, we have reconstituted the NALP1 inflammasome and have characterized the requirements for inflammasome assembly and caspase-1 activation. Oligomerization of NALP1 and activation of caspase-1 occur via a two-step mechanism, requiring microbial product, muramyl-dipeptide, a component of peptidoglycan, followed by ribonucleoside triphosphates. Caspase-1 activation by NALP1 does not require but is enhanced by adaptor protein ASC. The findings provide the biochemical basis for understanding how inflammasome assembly and function are regulated, and shed light on NALP1 as a direct sensor of bacterial components in host defense against pathogens.
Directory of Open Access Journals (Sweden)
Shokat Kevan M
2008-09-01
Full Text Available Abstract Background Neurons assemble into a functional network through a sequence of developmental processes including neuronal polarization and synapse formation. In Caenorhabditis elegans, the serine/threonine SAD-1 kinase is essential for proper neuronal polarity and synaptic organization. To determine if SAD-1 activity regulates the establishment or maintenance of these neuronal structures, we examined its temporal requirements using a chemical-genetic method that allows for selective and reversible inactivation of its kinase activity in vivo. Results We generated a PP1 analog-sensitive variant of SAD-1. Through temporal inhibition of SAD-1 kinase activity we show that its activity is required for the establishment of both neuronal polarity and synaptic organization. However, while SAD-1 activity is needed strictly when neurons are polarizing, the temporal requirement for SAD-1 is less stringent in synaptic organization, which can also be re-established during maintenance. Conclusion This study reports the first temporal analysis of a neural kinase activity using the chemical-genetic system. It reveals that neuronal polarity and synaptic organization have distinct temporal requirements for SAD-1.
Lucato, Christina M; Halls, Michelle L; Ooms, Lisa M; Liu, Heng-Jia; Mitchell, Christina A; Whisstock, James C; Ellisdon, Andrew M
2015-08-21
The P-Rex (phosphatidylinositol (3,4,5)-trisphosphate (PIP3)-dependent Rac exchanger) family (P-Rex1 and P-Rex2) of the Rho guanine nucleotide exchange factors (Rho GEFs) activate Rac GTPases to regulate cell migration, invasion, and metastasis in several human cancers. The family is unique among Rho GEFs, as their activity is regulated by the synergistic binding of PIP3 and Gβγ at the plasma membrane. However, the molecular mechanism of this family of multi-domain proteins remains unclear. We report the 1.95 Å crystal structure of the catalytic P-Rex1 DH-PH tandem domain in complex with its cognate GTPase, Rac1 (Ras-related C3 botulinum toxin substrate-1). Mutations in the P-Rex1·Rac1 interface revealed a critical role for this complex in signaling downstream of receptor tyrosine kinases and G protein-coupled receptors. The structural data indicated that the PIP3/Gβγ binding sites are on the opposite surface and markedly removed from the Rac1 interface, supporting a model whereby P-Rex1 binding to PIP3 and/or Gβγ releases inhibitory C-terminal domains to expose the Rac1 binding site. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun; Oh, Won Keun
2017-01-01
Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata , and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (A β ) 42 -induced microglial activation related to Nrf2 and nuclear factor κ B (NF- κ B)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular A β 42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1 β , prostaglandin (PG)E 2 , and nitric oxide (NO) because of artificial phagocytic A β 42 . It decreased pNF- κ B accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits A β 42 -overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.
Directory of Open Access Journals (Sweden)
Ji Yeon Seo
2017-01-01
Full Text Available Therapeutic approach of Alzheimer’s disease (AD has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1/nuclear factor (erythroid-derived 2-like 2 (Nrf2-mediated heme oxygenase (HO-1-inducing effects and the inhibitory activity of amyloid beta (Aβ42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL-6, IL-1β, prostaglandin (PGE2, and nitric oxide (NO because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS and cyclooxygenase II (COX-II in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.
Thaenkham, U; Phuphisut, O; Nuamtanong, S; Yoonuan, T; Sa-Nguankiat, S; Vonghachack, Y; Belizario, V Y; Dung, D T; Dekumyoy, P; Waikagul, J
2017-09-01
Haplorchis taichui is an intestinal heterophyid fluke that is pathogenic to humans. It is widely distributed in Asia, with a particularly high prevalence in Indochina. Previous work revealed that the lack of gene flow between three distinct populations of Vietnamese H. taichui can be attributed to their geographic isolation with no interconnected river basins. To test the hypothesis that interconnected river basins allow gene flow between otherwise isolated populations of H. taichui, as previously demonstrated for another trematode, Opisthorchis viverrini, we compared the genetic structures of seven populations of H. taichui from various localities in the lower Mekong Basin, in Thailand and Laos, with those in Vietnam, using the mitochondrial cytochrome c oxidase subunit 1 (COX1) gene. To determine the gene flow between these H. taichui populations, we calculated their phylogenetic relationships, genetic distances and haplotype diversity. Each population showed very low nucleotide diversity at this locus. However, high levels of genetic differentiation between the populations indicated very little gene flow. A phylogenetic analysis divided the populations into four clusters that correlated with the country of origin. The negligible gene flow between the Thai and Laos populations, despite sharing the Mekong Basin, caused us to reject our hypothesis. Our data suggest that the distribution of H. taichui populations was incidentally associated with national borders.
Rautenbach, Yolandi; Goddard, Amelia; Clift, Sarah J
2017-03-01
A 2.5-year-old spayed female American Pit Bull Terrier dog presented with a primary complaint of chronic refractory ascites. The dog's CBC displayed a moderate to severe macrocytic, hypochromic, nonregenerative anemia, and a moderate leukopenia as result of a moderate neutropenia and monocytopenia. Microscopic examination of the blood smear showed marked anisocytosis, mild polychromasia, mild acanthocytosis and ovalocytosis, moderate schistocytosis and poikilocytosis, and 4 metarubricytes/100 WBC. Abdominal ultrasonography revealed a homogenous, mild to moderately hyperechoic appearing liver as well as marked amounts of speckled anechoic to slightly hypoechoic peritoneal fluid. Cytology of the ascitic fluid demonstrated a sterile transudate, with evidence of a chronic inflammatory reaction as well as erythroid and myeloid precursor cells, and a few megakaryocytes with occasional micromegakaryocytes. Histologic sections of bone marrow, spleen, and liver were examined, using routine H&E stains, as well as a variety of immunohistochemistry and other special stains. Histopathology of the bone marrow and spleen revealed varying degrees of fibrosis, erythroid, and myeloid hyperplasia, as well as multiple small hyperplastic clusters of megakaryocytes. The megakaryocytes displayed many features of atypia such as increased cytoplasmic basophilia and occasional abnormal chromatin clumping with mitoses. Histopathologic examination of the liver disclosed evidence of mild extramedullary hematopoiesis. This case represents the first report of canine idiopathic myelofibrosis associated with peritoneal extramedullary hematopoiesis, resulting in refractory ascites. Although idiopathic myelofibrosis is a relatively rare condition in dogs, this case demonstrates that ascites caused by peritoneal implants of hematopoietic tissue may be the initial manifestation of myelofibrosis. © 2016 American Society for Veterinary Clinical Pathology.
Ben-Rebeh, Imen; Grati, Mhamed; Bonnet, Crystel; Bouassida, Walid; Hadjamor, Imen; Ayadi, Hammadi; Ghorbel, Abdelmonem; Petit, Christine; Masmoudi, Saber
2016-01-01
Usher syndrome accounts for about 50% of all hereditary deaf-blindness cases. The most severe form of this syndrome, Usher syndrome type I (USH1), is characterized by profound congenital sensorineural deafness, vestibular dysfunction, and retinitis pigmentosa. Six USH1 genes have been identified, MYO7A, CDH23, PCDH15, USH1C, SANS, and CIB2, encoding myosin VIIA, cadherin-23, protocadherin-15, harmonin, scaffold protein containing ankyrin repeats and a sterile alpha motif (SAM) domain, and calcium- and integrin-binding member 2, respectively. In the present study, we recruited four Tunisian families with a diagnosis of USH1, together with healthy unrelated controls. Affected members underwent detailed audiologic and ocular examinations. We used the North African Deafness (NADf) chip to search for known North African mutations associated with USH. Then, we selected microsatellite markers covering USH1 known loci to genotype the DNA samples. Finally, we performed DNA sequencing of three known USH1 genes: MYO7A, PCDH15, and USH1C. Four biallelic mutations, all single base changes, were found in the MYO7A, USH1C, and PCDH15 genes. These mutations consist of a previously reported splicing defect c.470+1G>A in MYO7A, three novel variants, including two nonsense (p.Arg3X and p.Arg134X) in USH1C and PCDH15, respectively, and one frameshift (p.Lys615Asnfs*6) in MYO7A. We found a remarkable genetic heterogeneity in the studied families with USH1 with a variety of mutations, among which three were novel. These novel mutations will be included in the NADf mutation screening chip that will allow a higher diagnosis efficiency of this extremely genetically heterogeneous disease. Ultimately, efficient molecular diagnosis of USH in a patient's early childhood is of utmost importance, allowing better educational and therapeutic management.
Lischka, Katharina; Ladel, Simone; Luksch, Harald; Weigel, Stefan
2018-02-15
The midbrain is an important subcortical area involved in distinct functions such as multimodal integration, movement initiation, bottom-up, and top-down attention. Our group is particularly interested in cellular computation of multisensory integration. We focus on the visual part of the avian midbrain, the optic tectum (TeO, counterpart to mammalian superior colliculus). This area has a layered structure with the great advantage of distinct input and output regions. In chicken, the TeO is organized in 15 layers where visual input targets the superficial layers while auditory input terminates in deeper layers. One specific cell type, the Shepherd's crook neuron (SCN), extends dendrites in both input regions. The characteristic feature of these neurons is the axon origin at the apical dendrite. The molecular identity of this characteristic region and thus, the site of action potential generation are of particular importance to understand signal flow and cellular computation in this neuron. We present immunohistochemical data of structural proteins (NF200, Ankyrin G, and Myelin) and ion channels (Pan-Na v , Na v 1.6, and K v 3.1b). NF200 is strongly expressed in the axon. Ankyrin G is mainly expressed at the axon initial segment (AIS). Myelination starts after the AIS as well as the distribution of Na v channels on the axon. The subtype Na v 1.6 has a high density in this region. K v 3.1b is restricted to the soma, the primary neurite and the axon branch. The distribution of functional molecules in SCNs provides insight into the information flow and the integration of sensory modalities in the TeO of the avian midbrain. © 2017 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Rouyer-Fessard, P.; Garel, M.C.; Domenget, C.; Guetarni, D.; Bachir, D.; Colonna, P.; Beuzard, Y.
1989-01-01
The soluble pool of alpha hemoglobin chains present in blood or bone marrow cells was measured with a new affinity method using a specific probe, beta A hemoglobin chain labeled with [ 3 H]N-ethylmaleimide. This pool of soluble alpha chains was 0.067 ± 0.017% of hemoglobin in blood of normal adult, 0.11 ± 0.03% in heterozygous beta thalassemia and ranged from 0.26 to 1.30% in homozygous beta thalassemia intermedia. This elevated pool of soluble alpha chains observed in human beta thalassemia intermedia decreased 33-fold from a value of 10% of total hemoglobin in bone marrow cells to 0.3% in the most dense red blood cells. The amount of insoluble alpha chains was measured by using the polyacrylamide gel electrophoresis in urea and Triton X-100. In beta thalassemia intermedia the amount of insoluble alpha chains was correlated with the decreased spectrin content of red cell membrane and was associated with a decrease in ankyrin and with other abnormalities of the electrophoretic pattern of membrane proteins. The loss and topology of the reactive thiol groups of membrane proteins was determined by using [ 3 H]N-ethylmaleimide added to membrane ghosts prior to urea and Triton X-100 electrophoresis. Spectrin and ankyrin were the major proteins with the most important decrease of thiol groups
Vancauwenberghe, Eric; Noyer, Lucile; Derouiche, Sandra; Lemonnier, Loïc; Gosset, Pierre; Sadofsky, Laura R; Mariot, Pascal; Warnier, Marine; Bokhobza, Alexandre; Slomianny, Christian; Mauroy, Brigitte; Bonnal, Jean-Louis; Dewailly, Etienne; Delcourt, Philippe; Allart, Laurent; Desruelles, Emilie; Prevarskaya, Natalia; Roudbaraki, Morad
2017-08-01
Previous studies showed the effects of resveratrol (RES) on several cancer cells, including prostate cancer (PCa) cell apoptosis without taking into consideration the impact of the tumor microenvironment (TME). The TME is composed of cancer cells, endothelial cells, blood cells, and cancer-associated fibroblasts (CAF), the main source of growth factors. The latter cells might modify in the TME the impact of RES on tumor cells via secreted factors. Recent data clearly show the impact of CAF on cancer cells apoptosis resistance via secreted factors. However, the effects of RES on PCa CAF have not been studied so far. We have investigated here for the first time the effects of RES on the physiology of PCa CAF in the context of TME. Using a prostate cancer CAF cell line and primary cultures of CAF from prostate cancers, we show that RES activates the N-terminal mutated Transient Receptor Potential Ankyrin 1 (TRPA1) channel leading to an increase in intracellular calcium concentration and the expression and secretion of growth factors (HGF and VEGF) without inducing apoptosis in these cells. Interestingly, in the present work, we also show that when the prostate cancer cells were co-cultured with CAF, the RES-induced cancer cell apoptosis was reduced by 40%, an apoptosis reduction canceled in the presence of the TRPA1 channel inhibitors. The present work highlights CAF TRPA1 ion channels as a target for RES and the importance of the channel in the epithelial-stromal crosstalk in the TME leading to resistance to the RES-induced apoptosis. © 2017 Wiley Periodicals, Inc.
Transcription factors: normal and malignant development of blood cells
National Research Council Canada - National Science Library
Ravid, Katya; Licht, Jonathan
2001-01-01
... and the Development of the Erythroid Lineage James J. Bieker 71 II TRANSCRIPTION FACTORS AND THE MYELOID LINEAGE 85 6 RUNX1(AML1) and CBFB: Genes Required for the Development of All Definitive Hematopoietic Lineages 87 Nancy A. Speck and Elaine Dzierzak 7 PU.1 and the Development of the Myeloid Lineage Daniel G. Tenen 103 vvi CONTENTS 8 CCAAT/Enhancer-...
Best, Sarah A; De Souza, David P; Kersbergen, Ariena; Policheni, Antonia N; Dayalan, Saravanan; Tull, Dedreia; Rathi, Vivek; Gray, Daniel H; Ritchie, Matthew E; McConville, Malcolm J; Sutherland, Kate D
2018-04-03
The lung presents a highly oxidative environment, which is tolerated through engagement of tightly controlled stress response pathways. A critical stress response mediator is the transcription factor nuclear factor erythroid-2-related factor 2 (NFE2L2/NRF2), which is negatively regulated by Kelch-like ECH-associated protein 1 (KEAP1). Alterations in the KEAP1/NRF2 pathway have been identified in 23% of lung adenocarcinomas, suggesting that deregulation of the pathway is a major cancer driver. We demonstrate that inactivation of Keap1 and Pten in the mouse lung promotes adenocarcinoma formation. Notably, metabolites identified in the plasma of Keap1 f/f /Pten f/f tumor-bearing mice indicate that tumorigenesis is associated with reprogramming of the pentose phosphate pathway. Furthermore, the immune milieu was dramatically changed by Keap1 and Pten deletion, and tumor regression was achieved utilizing immune checkpoint inhibition. Thus, our study highlights the ability to exploit both metabolic and immune characteristics in the detection and treatment of lung tumors harboring KEAP1/NRF2 pathway alterations. Copyright © 2018 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Szeto, Samuel S. W.; Reinke, Stacey N.; Lemire, Bernard D.
2011-01-01
The application of metabolomics to human and animal model systems is poised to provide great insight into our understanding of disease etiology and the metabolic changes that are associated with these conditions. However, metabolomic studies have also revealed that there is significant, inherent biological variation in human samples and even in samples from animal model systems where the animals are housed under carefully controlled conditions. This inherent biological variability is an important consideration for all metabolomics analyses. In this study, we examined the biological variation in 1 H NMR-based metabolic profiling of two model systems, the yeast Saccharomyces cerevisiae and the nematode Caenorhabditis elegans. Using relative standard deviations (RSD) as a measure of variability, our results reveal that both model systems have significant amounts of biological variation. The C. elegans metabolome possesses greater metabolic variance with average RSD values of 29 and 39%, depending on the food source that was used. The S. cerevisiae exometabolome RSD values ranged from 8% to 12% for the four strains examined. We also determined whether biological variation occurs between pairs of phenotypically identical yeast strains. Multivariate statistical analysis allowed us to discriminate between pair members based on their metabolic phenotypes. Our results highlight the variability of the metabolome that exists even for less complex model systems cultured under defined conditions. We also highlight the efficacy of metabolic profiling for defining these subtle metabolic alterations.
In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.
Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A
2008-01-01
Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.
Heme oxygenase-1 deletion affects stress erythropoiesis.
Directory of Open Access Journals (Sweden)
Yu-An Cao
Full Text Available Homeostatic erythropoiesis leads to the formation of mature red blood cells under non-stress conditions, and the production of new erythrocytes occurs as the need arises. In response to environmental stimuli, such as bone marrow transplantation, myelosuppression, or anemia, erythroid progenitors proliferate rapidly in a process referred to as stress erythropoiesis. We have previously demonstrated that heme oxygenase-1 (HO-1 deficiency leads to disrupted stress hematopoiesis. Here, we describe the specific effects of HO-1 deficiency on stress erythropoiesis.We used a transplant model to induce stress conditions. In irradiated recipients that received hmox(+/- or hmox(+/+ bone marrow cells, we evaluated (i the erythrocyte parameters in the peripheral blood; (ii the staining intensity of CD71-, Ter119-, and CD49d-specific surface markers during erythroblast differentiation; (iii the patterns of histological iron staining; and (iv the number of Mac-1(+-cells expressing TNF-α. In the spleens of mice that received hmox(+/- cells, we show (i decreases in the proerythroblast, basophilic, and polychromatophilic erythroblast populations; (ii increases in the insoluble iron levels and decreases in the soluble iron levels; (iii increased numbers of Mac-1(+-cells expressing TNF-α; and (iv decreased levels of CD49d expression in the basophilic and polychromatophilic erythroblast populations.As reflected by effects on secreted and cell surface proteins, HO-1 deletion likely affects stress erythropoiesis through the retention of erythroblasts in the erythroblastic islands of the spleen. Thus, HO-1 may serve as a therapeutic target for controlling erythropoiesis, and the dysregulation of HO-1 may be a predisposing condition for hematologic diseases.
Placental abruption possibly due to parvovirus B19 infection.
Kawabe, Ayaka; Takai, Yasushi; Tamaru, Jun-Ichi; Samejima, Kouki; Seki, Hiroyuki
2016-01-01
There is concern about the development of anemia-associated fetal hydrops associated with maternal parvovirus B19 infection. Parvovirus B19 infection occurs via the globoside (P antigen) receptor, the main glycolipid of erythroid cells, which induces apoptosis. Similar findings have been reported for the P antigen of globoside-containing placental trophoblast cells. A 32-year-old woman was infected with human parvovirus B19 at week 32 of pregnancy, and had severe anemia at week 34. At week 37, an emergency cesarean section was performed because of sudden abdominal pain and fetal bradycardia; placental abruption was found. A live male infant was delivered with no sign of fetal hydrops or fetal infection. Placental tissue was positive for parvovirus B19 according to polymerase chain reaction. Immunohistochemical analysis using caspase-related M30 CytoDEATH monoclonal antibody revealed M30 staining of the placental villous trophoblasts. Placental trophoblasts and erythroid precursor cells have been reported to express globoside (P antigen), which is necessary for parvovirus B19 infectivity, and to show apoptotic activity as a result of infection. Placentas from three other pregnancies with documented abruption showed no M30 staining. The present case strongly suggests an association between placental abruption and apoptosis resulting from parvovirus B19 infection.
Directory of Open Access Journals (Sweden)
Adriana Ribeiro Carneiro
2012-09-01
Full Text Available Dengue fever is the most important arbovirus infection found in tropical regions around the world. Dispersal of the vector and an increase in migratory flow between countries have led to large epidemics and severe clinical outcomes, such as dengue haemorrhagic fever and dengue shock syndrome. This study analysed the genetic variability of the dengue virus serotype 1 (DENV-1 in Brazil with regard to the full-length structural genes C/prM/M/E among 34 strains isolated during epidemics that occurred in the country between 1994-2011. Virus phylogeny and time of divergence were also evaluated with only the E gene of the strains isolated from 1994-2008. An analysis of amino acid differences between these strains and the French Guiana strain (FGA/89 revealed the presence of important nonsynonymous substitutions in the amino acid sequences, including residues E297 (Met→Thr and E338 (Ser→Leu. A phylogenetic analysis of E proteins comparing the studied isolates and other strains selected from the GenBank database showed that the Brazilian DENV-1 strains since 1982 belonged to genotype V. This analysis also showed that different introductions of strains from the 1990s represented lineage replacement, with the identification of three lineages that cluster all isolates from the Americas. An analysis of the divergence time of DENV-1 indicated that the lineage circulating in Brazil emerged from an ancestral lineage that originated approximately 44.35 years ago.
Carneiro, Adriana Ribeiro; Cruz, Ana Cecília Ribeiro; Vallinoto, Marcelo; Melo, Diego de Vasconcelos; Ramos, Rommel Thiago J; Medeiros, Daniele Barbosa Almeida; Silva, Eliana Vieira Pinto da; Vasconcelos, Pedro Fernando da Costa
2012-09-01
Dengue fever is the most important arbovirus infection found in tropical regions around the world. Dispersal of the vector and an increase in migratory flow between countries have led to large epidemics and severe clinical outcomes, such as dengue haemorrhagic fever and dengue shock syndrome. This study analysed the genetic variability of the dengue virus serotype 1 (DENV-1) in Brazil with regard to the full-length structural genes C/prM/M/E among 34 strains isolated during epidemics that occurred in the country between 1994-2011. Virus phylogeny and time of divergence were also evaluated with only the E gene of the strains isolated from 1994-2008. An analysis of amino acid differences between these strains and the French Guiana strain (FGA/89) revealed the presence of important nonsynonymous substitutions in the amino acid sequences, including residues E297 (Met→Thr) and E338 (Ser→Leu). A phylogenetic analysis of E proteins comparing the studied isolates and other strains selected from the GenBank database showed that the Brazilian DENV-1 strains since 1982 belonged to genotype V. This analysis also showed that different introductions of strains from the 1990s represented lineage replacement, with the identification of three lineages that cluster all isolates from the Americas. An analysis of the divergence time of DENV-1 indicated that the lineage circulating in Brazil emerged from an ancestral lineage that originated approximately 44.35 years ago.
Damiani, Isabelle; Morreel, Kris; Danoun, Saïda; Goeminne, Geert; Yahiaoui, Nabila; Marque, Christiane; Kopka, Joachim; Messens, Eric; Goffner, Deborah; Boerjan, Wout; Boudet, Alain-Michel; Rochange, Soizic
2005-11-01
In angiosperms, lignin is built from two main monomers, coniferyl and sinapyl alcohol, which are incorporated respectively as G and S units in the polymer. The last step of their synthesis has so far been considered to be performed by a family of dimeric cinnamyl alcohol dehydrogenases (CAD2). However, previous studies on Eucalyptus gunnii xylem showed the presence of an additional, structurally unrelated, monomeric CAD form named CAD1. This form reduces coniferaldehyde to coniferyl alcohol, but is inactive on sinapaldehyde. In this paper, we report the functional characterization of CAD1 in tobacco (Nicotiana tabacum L.). Transgenic tobacco plants with reduced CAD1 expression were obtained through an RNAi strategy. These plants displayed normal growth and development, and detailed biochemical studies were needed to reveal a role for CAD1. Lignin analyses showed that CAD1 down-regulation does not affect Klason lignin content, and has a moderate impact on G unit content of the non-condensed lignin fraction. However, comparative metabolic profiling of the methanol-soluble phenolic fraction from basal xylem revealed significant differences between CAD1 down-regulated and wild-type plants. Eight compounds were less abundant in CAD1 down-regulated lines, five of which were identified as dimers or trimers of monolignols, each containing at least one moiety derived from coniferyl alcohol. In addition, 3-trans-caffeoyl quinic acid accumulated in the transgenic plants. Together, our results support a significant contribution of CAD1 to the synthesis of coniferyl alcohol in planta, along with the previously characterized CAD2 enzymes.
Comparison of the transport of QX-314 through TRPA1, TRPM8, and TRPV1 channels
Directory of Open Access Journals (Sweden)
Nakagawa H
2013-03-01
Full Text Available Hiroshi Nakagawa,1 Akio Hiura2 1Dentistry for Persons with Disability, Tokushima University Hospital, Tokushima, Japan; 2Department of Oral Histology, School of Dentistry, University of Tokushima, Tokushima, Japan Background: It has been demonstrated that N-ethyl-lidocaine (QX-314 can target the transient receptor protein vanilloid 1 (TRPV1 nociceptors when coadministered with capsaicin, resulting in a selective block of the nociceptors. Capsaicin is problematic in therapeutic use because it induces firing of nociceptors. The present study aimed to search for substitutes for capsaicin. We also examined the transportability of QX-314 into nociceptive neurons, through the pores of transient receptor potential ankyrin 1 (TRPA1, transient receptor potential melastatin-8 (TRPM8, and TRPV1. Methods: To investigate the effect on TRPA1, injections of a vehicle, allyl isothiocyanate (AITC, QX-314, or AITC/QX-314 were made into the hind paws of rats. The effects of menthol and capsaicin on the opening of TRPM8 and TRPV1 were also examined and compared with the potency of QX-314. To examine inhibition of the antinociceptive effect by capsaicin/QX-314, capsazepine (50 µg/mL; 10 µL was injected 30 minutes prior to capsaicin/QX-314 (10 µL injection. Thermal sensitivity was investigated by the Hargreaves method. 5(6-carboxyfluorescein (FAM-conjugated QX-314 was used as a tracer to examine how many and which kind of dorsal root ganglia accumulate this molecule. QX-314-FAM, capsaicin/QX-314-FAM, AITC/QX-314-FAM, and menthol/QX-314-FAM were injected into the paw. Two weeks after injections, dorsal root ganglia were removed and sectioned with a cryostat. Results: The capsaicin/QX-314 group induced longer withdrawal-response latency at 60 to 300 minutes after injection than the control. Both menthol only and menthol/QX-314 injections showed analgesia 10 to 60 minutes after injection. No significant difference was seen between the capsazepine/capsaicin/QX-314
[Mastitis revealing Churg-Strauss syndrome].
Dannepond, C; Le Fourn, E; de Muret, A; Ouldamer, L; Carmier, D; Machet, L
2014-01-01
Churg-Strauss syndrome often involves the skin, and this may sometimes reveal the disease. A 25-year-old woman was referred to a gynaecologist for inflammation of the right breast with breast discharge. Cytological analysis of the liquid showed numerous inflammatory cells, particularly polymorphonuclear eosinophils and neutrophils. Ultrasound examination of the breast was consistent with galactophoritis. CRP was normal, and hypereosinophilia was seen. The patient was subsequently referred to a dermatology unit. Skin examination revealed inflammation of the entire breast, which was painful, warm and erythematous; the border was oedematous with blisters. Necrotic lesions were also present on the thumbs and knees. Skin biopsy of the breast showed a dermal infiltrate with abundant infiltrate of polymorphonuclear eosinophils, including patchy necrosis and intraepidermal vesicles. Histological examination of a biopsy sample from a thumb revealed eosinophilic granuloma and leukocytoclastic vasculitis. The patient was also presenting asthma, pulmonary infiltrates and mononeuropathy at L3, consistent with Churg-Strauss syndrome. Breast involvement in Churg-Strauss syndrome is very rare (only one other case has been reported). This is the first case in which the breast condition revealed the disease. Cutaneous involvement of the breast is, however, also compatible with Wells' cellulitis. The lesions quickly disappeared with 1mg/kg/d oral prednisolone. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Spans, Lien; Van den Broeck, Thomas; Smeets, Elien; Prekovic, Stefan; Thienpont, Bernard; Lambrechts, Diether; Karnes, R Jeffrey; Erho, Nicholas; Alshalalfa, Mohammed; Davicioni, Elai; Helsen, Christine; Gevaert, Thomas; Tosco, Lorenzo; Haustermans, Karin; Lerut, Evelyne; Joniau, Steven; Claessens, Frank
2016-04-26
The clinical heterogeneity of prostate cancer (PCa) makes it difficult to identify those patients that could benefit from more aggressive treatments. As a contribution to a better understanding of the genomic changes in the primary tumor that are associated with the development of high-risk disease, we performed exome sequencing and copy number determination of a clinically homogeneous cohort of 47 high-risk PCas. We confirmed recurrent mutations in SPOP, PTEN and TP53 among the 850 point mutations we detected. In seven cases, we discovered genomic aberrations in the TET1 (Ten-Eleven Translocation 1) gene which encodes a DNA hydroxymethylase than can modify methylated cytosines in genomic DNA and thus is linked with gene expression changes. TET1 protein levels were reduced in tumor versus non-tumor prostate tissue in 39 of 40 cases. The clinical relevance of changes in TET1 levels was demonstrated in an independent PCa cohort, in which low TET1 mRNA levels were significantly associated with worse metastases-free survival. We also demonstrate a strong reduction in hydroxymethylated DNA in tumor tissue in 27 of 41 cases. Furthermore, we report the first exploratory (h)MeDIP-Seq analyses of eight high-risk PCa samples. This reveals a large heterogeneity in hydroxymethylation changes in tumor versus non-tumor genomes which can be linked with cell polarity.
International Nuclear Information System (INIS)
Kim, Hyun Won
2011-01-01
Adenylate kinase-like activity and phosphotransferase-like activity from F 1 -ATPase of Escherichia coli was revealed by 31 P NMR spectroscopy. Incubation of F 1 -ATPase with ADP in the presence of Mg 2+ shows the appearance of 31 P resonances from AMP and Pi, suggesting generation of AMP and ATP by adenylate kinase-like activity and the subsequent hydrolysis to Pi. Incubation of F1-ATPase with ADP in the presence of methanol shows additional peak from methyl phosphate, suggesting phosphotransferase-like activity of F 1 -ATPase. Both adenylate kinase-like activity and phosphotransferase-like activity has not been reported from F 1 -ATPase of Escherichia coli. 31 P NMR could be a valuable tool for the investigation of phosphorous related enzyme
Directory of Open Access Journals (Sweden)
Peng Xu
2017-03-01
Full Text Available Human parvovirus B19 (B19V infection of primary human erythroid progenitor cells (EPCs arrests infected cells at both late S-phase and G2-phase, which contain 4N DNA. B19V infection induces a DNA damage response (DDR that facilitates viral DNA replication but is dispensable for cell cycle arrest at G2-phase; however, a putative C-terminal transactivation domain (TAD2 within NS1 is responsible for G2-phase arrest. To fully understand the mechanism underlying B19V NS1-induced G2-phase arrest, we established two doxycycline-inducible B19V-permissive UT7/Epo-S1 cell lines that express NS1 or NS1mTAD2, and examined the function of the TAD2 domain during G2-phase arrest. The results confirm that the NS1 TAD2 domain plays a pivotal role in NS1-induced G2-phase arrest. Mechanistically, NS1 transactivated cellular gene expression through the TAD2 domain, which was itself responsible for ATR (ataxia-telangiectasia mutated and Rad3-related activation. Activated ATR phosphorylated CDC25C at serine 216, which in turn inactivated the cyclin B/CDK1 complex without affecting nuclear import of the complex. Importantly, we found that the ATR-CHK1-CDC25C-CDK1 pathway was activated during B19V infection of EPCs, and that ATR activation played an important role in B19V infection-induced G2-phase arrest.
Fischer, Cristine D B; Gräf, Tiago; Ikuta, Nilo; Lehmann, Fernanda K M; Passos, Daniel T; Makiejczuk, Aline; Silveira, Marcos A T; Fonseca, André S K; Canal, Cláudio W; Lunge, Vagner R
2016-07-01
Canine distemper virus (CDV) is a highly contagious pathogen for domestic dogs and several wild carnivore species. In Brazil, natural infection of CDV in dogs is very high due to the large non-vaccinated dog population, a scenario that calls for new studies on the molecular epidemiology. This study investigates the phylodynamics and amino-acid signatures of CDV epidemic in South America by analyzing a large dataset compiled from publicly available sequences and also by collecting new samples from Brazil. A population of 175 dogs with canine distemper (CD) signs was sampled, from which 89 were positive for CDV, generating 42 new CDV sequences. Phylogenetic analysis of the new and publicly available sequences revealed that Brazilian sequences mainly clustered in South America 1 (SA1) clade, which has its origin estimated to the late 1980's. The reconstruction of the demographic history in SA1 clade showed an epidemic expanding until the recent years, doubling in size every nine years. SA1 clade epidemic distinguished from the world CDV epidemic by the emergence of the R580Q strain, a very rare and potentially detrimental substitution in the viral genome. The R580Q substitution was estimated to have happened in one single evolutionary step in the epidemic history in SA1 clade, emerging shortly after introduction to the continent. Moreover, a high prevalence (11.9%) of the Y549H mutation was observed among the domestic dogs sampled here. This finding was associated (p<0.05) with outcome-death and higher frequency in mixed-breed dogs, the later being an indicator of a continuous exchange of CDV strains circulating among wild carnivores and domestic dogs. The results reported here highlight the diversity of the worldwide CDV epidemic and reveal local features that can be valuable for combating the disease. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ingrid de Souza Freire
2014-09-01
Full Text Available The insecticidal properties of Cry-endotoxins from Bacillus thuringiensis (Bt have long been used as spore-crystals in commercial spray formulations for insect control. Recently, some Bt-endotoxin genes have been cloned in many different plants. Toxicological evaluations of three spore-crystal endotoxins, BtCry1Ia, BtCry10Aa and BtCry1Ba6 from B. thuringiensis, were carried out on mice to understand their adverse effects on hematological systems and on genetic material. These three spore-crystals have shown toxic activity to the boll weevil, which is one of the most aggressive pests of the cotton crop. Cry1Ia, Cry10Aa and Cry1Ba6 did not increase the micronucleus frequency in the peripheral erythrocytes of mice and did not cause changes in the frequency of polychromatic erythrocytes. However, some hematologic disburbances were observed, specifically related to Cry1Ia and Cry1Ba6, respectively, for the erythroid and lymphoid lineage. Thus, although the profile of such adverse side effects can be related to their high level of exposure, which is not commonly found in the environment, results showed that these Bt spore-crystals were not harmless to mice, indicating that each spore-crystal endotoxin presents a characteristic profile of toxicity and might be investigated individually.
DEFF Research Database (Denmark)
Vishnubalaji, Radhakrishnan; Manikandan, Muthurangan; Fahad, Mohamed
2018-01-01
enrichment related to DNA damage, MAPK, FAK, oxidative stress response, and Wnt signalling. ALDH+ cells showed enhanced ROS stress resistance, whereas MAPK/FAK pathway pharmacologic inhibition limited their survival. Conversely, 5-fluorouracil increased the ALDH+ cell fraction among the SW403, HCT116 and SW.......006) and poor DFS (p = 0.05), thus implicating ALDH1A1 and POU5F1 in CRC prognosis. Our data reveal distinct molecular signature of ALDH+ CSCs in CRC and suggest pathways relevant for successful targeted therapies and management of CRC....
Directory of Open Access Journals (Sweden)
Ferdinando Mannello
2008-01-01
Full Text Available Background: Erythropoietin (Epo is an important regulator of erythropoiesis, and controls proliferation and differentiation of both erythroid and non-erythroid tissues. Epo is actively synthesized by breast cells during lactation, and also plays a role in breast tissues promoting hypoxia-induced cancer initiation. Our aims are to perform an exploratory investigation on the Epo accumulation in breast secretions from healthy and cancer patients and its localization in breast cancer cells.
Reduced migration of MLH1 deficient colon cancer cells depends on SPTAN1.
Hinrichsen, Inga; Ernst, Benjamin Philipp; Nuber, Franziska; Passmann, Sandra; Schäfer, Dieter; Steinke, Verena; Friedrichs, Nicolaus; Plotz, Guido; Zeuzem, Stefan; Brieger, Angela
2014-01-24
Defects in the DNA mismatch repair (MMR) protein MLH1 are frequently observed in sporadic and hereditary colorectal cancers (CRC). Affected tumors generate much less metastatic potential than the MLH1 proficient forms. Although MLH1 has been shown to be not only involved in postreplicative MMR but also in several MMR independent processes like cytoskeletal organization, the connection between MLH1 and metastasis remains unclear. We recently identified non-erythroid spectrin αII (SPTAN1), a scaffolding protein involved in cell adhesion and motility, to interact with MLH1. In the current study, the interaction of MLH1 and SPTAN1 and its potential consequences for CRC metastasis was evaluated. Nine cancer cell lines as well as fresh and paraffin embedded colon cancer tissue from 12 patients were used in gene expression studies of SPTAN1 and MLH1. Co-expression of SPTAN1 and MLH1 was analyzed by siRNA knock down of MLH1 in HeLa, HEK293, MLH1 positive HCT116, SW480 and LoVo cells. Effects on cellular motility were determined in MLH1 deficient HCT116 and MLH1 deficient HEK293T compared to their MLH1 proficient sister cells, respectively. MLH1 deficiency is clearly associated with SPTAN1 reduction. Moreover, siRNA knock down of MLH1 decreased the mRNA level of SPTAN1 in HeLa, HEK293 as well as in MLH1 positive HCT116 cells, which indicates a co-expression of SPTAN1 by MLH1. In addition, cellular motility of MLH1 deficient HCT116 and MLH1 deficient HEK293T cells was impaired compared to the MLH1 proficient sister clones. Consequently, overexpression of SPTAN1 increased migration of MLH1 deficient cells while knock down of SPTAN1 decreased cellular mobility of MLH1 proficient cells, indicating SPTAN1-dependent migration ability. These data suggest that SPTAN1 levels decreased in concordance with MLH1 reduction and impaired cellular mobility in MLH1 deficient colon cancer cells. Therefore, aggressiveness of MLH1-positive CRC might be related to SPTAN1.
Regulation of human heme oxygenase-1 gene expression under thermal stress.
Okinaga, S; Takahashi, K; Takeda, K; Yoshizawa, M; Fujita, H; Sasaki, H; Shibahara, S
1996-06-15
Heme oxygenase-1 is an essential enzyme in heme catabolism, and its human gene promoter contains a putative heat shock element (HHO-HSE). This study was designed to analyze the regulation of human heme oxygenase-1 gene expression under thermal stress. The amounts of heme oxygenase-1 protein were not increased by heat shock (incubation at 42 degrees C) in human alveolar macrophages and in a human erythroblastic cell line, YN-1-0-A, whereas heat shock protein 70 (HSP70) was noticeably induced. However, heat shock factor does bind in vitro to HHO-HSE and the synthetic HHO-HSE by itself is sufficient to confer the increase in the transient expression of a reporter gene upon heat shock. The deletion of the sequence, located downstream from HHO-HSE, resulted in the activation of a reporter gene by heat shock. These results suggest that HHO-HSE is potentially functional but is repressed in vivo. Interestingly, heat shock abolished the remarkable increase in the levels of heme oxygenase-1 mRNA in YN-1-0-A cells treated with hemin or cadmium, in which HSP70 mRNA was noticeably induced. Furthermore, transient expression assays showed that heat shock inhibits the cadmium-mediated activation of the heme oxygenase-1 promoter, whereas the HSP70 gene promoter was activated upon heat shock. Such regulation of heme oxygenase-1 under thermal stress may be of physiologic significance in erythroid cells.
Effect of acetaminophen on osteoblastic differentiation and migration of MC3T3-E1 cells.
Nakatsu, Yoshihiro; Nakagawa, Fumio; Higashi, Sen; Ohsumi, Tomoko; Shiiba, Shunji; Watanabe, Seiji; Takeuchi, Hiroshi
2018-02-01
N-acetyl-p-aminophenol (APAP, acetaminophen, paracetamol) is a widely used analgesic/antipyretic with weak inhibitory effects on cyclooxygenase (COX) compared to non-steroidal anti-inflammatory drugs (NSAIDs). The mechanism of action of APAP is mediated by its metabolite that activates transient receptor potential channels, including transient receptor potential vanilloid 1 (TRPV1) and TRP ankyrin 1 (TRPA1) or the cannabinoid receptor type 1 (CB1). However, the exact molecular mechanism and target underlying the cellular actions of APAP remain unclear. Therefore, we investigated the effect of APAP on osteoblastic differentiation and cell migration, with a particular focus on TRP channels and CB1. Effects of APAP on osteoblastic differentiation and cell migration of MC3T3-E1, a mouse pre-osteoblast cell line, were assessed by the increase in alkaline phosphatase (ALP) activity, and both wound-healing and transwell-migration assays, respectively. APAP dose-dependently inhibited osteoblastic differentiation, which was well correlated with the effects on COX activity compared with other NSAIDs. In contrast, cell migration was promoted by APAP, and this effect was not correlated with COX inhibition. None of the agonists or antagonists of TRP channels and the CB receptor affected the APAP-induced cell migration, while the effect of APAP on cell migration was abolished by down-regulating TRPV4 gene expression. APAP inhibited osteoblastic differentiation via COX inactivation while it promoted cell migration independently of previously known targets such as COX, TRPV1, TRPA1 channels, and CB receptors, but through the mechanism involving TRPV4. APAP may have still unidentified molecular targets that modify cellular functions. Copyright © 2017 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Tesli, Martin; Koefoed, Pernille; Athanasiu, Lavinia
2011-01-01
Genetic variants in ankyrin 3 (ANK3) have recently been shown to be associated with bipolar disorder (BD). We genotyped three ANK3 SNPs previously found to be associated with BD (rs10994336, rs1938526, and rs9804190) in a Scandinavian BD case–control sample (N¿=¿854/2,614). Due to evidence...
Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S
2008-07-01
Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.
International Nuclear Information System (INIS)
Kreja, L.; Weinsheimer, W.; Nothdurft, W.
1991-01-01
The in vitro radiation response to 280-kV x-rays (does rate 72 cGy/min) of multipotent hemopoietic progenitor cells, mixed colony-forming units (CFU-mix), from canine bone marrow was assayed and compared to the radiation response characteristics of early erythroid progenitors, erythroid burst-forming units (BFU-E). To improve the colony-forming efficiency, the effect of various bone marrow cell separation techniques on colony formation of both progenitors was examined. The separation of bone marrow aspirates by discontinuous buoyant gradient centrifugation using the lymphocyte separation medium Lymphoprep with a density of 1.070 g/ml allowed the establishment of reproducible survival curves. The survival curves for both progenitors were strictly exponential, and CFU-mix were found to be more radiosensitive (D0 = 12 ± 2 cGy) than BFU-E (D0 = 16 ± 2 cGy)
Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation
International Nuclear Information System (INIS)
Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han
2015-01-01
Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death
Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation
Energy Technology Data Exchange (ETDEWEB)
Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)
2015-09-25
Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death.
Directory of Open Access Journals (Sweden)
Meiya eLiu
2016-04-01
Full Text Available Rice bean (Vigna umbellata VuMATE1 appears to be constitutively expressed at vascular system but root apex, and Al stress extends its expression to root apex. Whether VuMATE1 participates in both Al tolerance and Fe nutrition, and how VuMATE1 expression is regulated is of great interest. In this study, the role of VuMATE1 in Fe nutrition was characterized through in planta complementation assays. The transcriptional regulation of VuMATE1 was investigated through promoter analysis and promoter-GUS reporter assays. The results showed that the expression of VuMATE1 was regulated by Al stress but not Fe status. Complementation of frd3-1 with VuMATE1 under VuMATE1 promoter could not restore phenotype, but restored with 35SCaMV promoter. Immunostaining of VuMATE1 revealed abnormal localization of VuMATE1 in vasculature. In planta GUS reporter assay identified Al-responsive cis-acting elements resided between -1228 and -574 bp. Promoter analysis revealed several cis-acting elements, but transcription is not simply regulated by one of these elements. We demonstrated that cis regulation of VuMATE1 expression is involved in Al tolerance mechanism, while not involved in Fe nutrition. These results reveal the evolution of VuMATE1 expression for better adaptation of rice bean to acidic soils where Al stress imposed but Fe deficiency pressure released.
Huang, Richard Y-C; Krystek, Stanley R; Felix, Nathan; Graziano, Robert F; Srinivasan, Mohan; Pashine, Achal; Chen, Guodong
2018-01-01
TL1A, a tumor necrosis factor-like cytokine, is a ligand for the death domain receptor DR3. TL1A, upon binding to DR3, can stimulate lymphocytes and trigger secretion of proinflammatory cytokines. Therefore, blockade of TL1A/DR3 interaction may be a potential therapeutic strategy for autoimmune and inflammatory diseases. Recently, the anti-TL1A monoclonal antibody 1 (mAb1) with a strong potency in blocking the TL1A/DR3 interaction was identified. Here, we report on the use of hydrogen/deuterium exchange mass spectrometry (HDX-MS) to obtain molecular-level details of mAb1's binding epitope on TL1A. HDX coupled with electron-transfer dissociation MS provided residue-level epitope information. The HDX dataset, in combination with solvent accessible surface area (SASA) analysis and computational modeling, revealed a discontinuous epitope within the predicted interaction interface of TL1A and DR3. The epitope regions span a distance within the approximate size of the variable domains of mAb1's heavy and light chains, indicating it uses a unique mechanism of action to block the TL1A/DR3 interaction.
Musante, Ilaria; Mattinzoli, Deborah; Otescu, Lavinia Alexandra; Bossi, Simone; Ikehata, Masami; Gentili, Chiara; Cangemi, Giuliana; Gatti, Cinzia; Emionite, Laura; Messa, Piergiorgio; Ravazzolo, Roberto; Rastaldi, Maria Pia; Riccardi, Daniela; Puliti, Aldamaria
2017-01-01
Recent increasing evidence supports a role for neuronal type signaling in bone. Specifically glutamate receptors have been found in cells responsible for bone remodeling, namely the osteoblasts and the osteoclasts. While most studies have focused on ionotropic glutamate receptors, the relevance of the metabotropic glutamate signaling in bone is poorly understood. Specifically type 1 metabotropic glutamate (mGlu1) receptors are expressed in bone, but the effect of its ablation on skeletal development has never been investigated. Here we report that Grm1 crv4/crv4 mice, homozygous for an inactivating mutation of the mGlu1 receptor, and mainly characterized by ataxia and renal dysfunction, exhibit decreased body weight, bone length and bone mineral density compared to wild type (WT) animals. Blood analyses of the affected mice demonstrate the absence of changes in circulating factors, such as vitamin D and PTH, suggesting renal damage is not the main culprit of the skeletal phenotype. Cultures of osteoblasts lacking functional mGlu1 receptors exhibit less homogeneous collagen deposition than WT cells, and present increased expression of osteocalcin, a marker of osteoblast maturation. These data suggest that the skeletal damage is directly linked to the absence of the receptor, which in turn leads to osteoblasts dysfunction and earlier maturation. Accordingly, skeletal histomorphology suggests that Grm1 crv4/crv4 mice exhibit enhanced bone maturation, resulting in premature fusion of the growth plate and shortened long bones, and further slowdown of bone apposition rate compared to the WT animals. In summary, this work reveals novel functions of mGlu1 receptors in the bone and indicates that in osteoblasts mGlu1 receptors are necessary for production of normal bone matrix, longitudinal bone growth, and normal skeletal development. Copyright © 2016 Elsevier Inc. All rights reserved.
Abd El Motteleb, Dalia M; Ibrahim, Islam A A E-H; Elshazly, Shimaa M
2017-11-15
Hepatic fibrosis is a potential health problem that may end with life-threatening cirrhosis and primary liver cancer. Recent studies point out to the protective effects of silent information regulator1 (SIRT1), against different models of organs fibrosis. This work aimed to investigate the possible protective effect of sildenafil (SIRT1 activator) against hepatic fibrosis induced by bile duct ligation (BDL). Firstly, three different doses of sildenafil (5, 10, 20mg/kg/day) were investigated; to detect the most protective one against BDL induced liver dysfunction and hepatic fibrosis. The most protective dose is then used; to study its effect on BDL induced SIRT1 downregulation, imbalance of oxidant/antioxidant status, increased inflammatory cytokines and fibrosis. Sildenafil (20mg/kg/day) was the most protective one, it caused upregulation of SIRT1, reduction of hepatic malondialdehyde (MDA) content, increase in expression of nuclear factor erythroid 2-related factor 2 (Nrf2), hemeoxygenease (HO)-1, reduced glutathione (GSH) content and superoxide dismutase (SOD) activity. Hepatic content of tumor necrosis factor-α (TNF-α) and nuclear factor κB (NFκB) expression & content displayed significant reductions with sildenafil treatment, Furthermore, sildenafil caused marked reductions of transforming growth factor (TGF)-β content, expression of plasminogen activator inhibitor-1 (PAI-1), matrix metalloproteinase-9 (MMP-9), tissue inhibitor of metalloproteinase-1 (TIMP-1), α-smooth muscle actin (α-SMA), fibronectin, collagen I (α1) and hydroxyproline content. However, sildenafil protective effects were significantly reduced by co-administration of EX527 (SIRT1 inhibitor). Our work showed, for the first time that, sildenafil has promising protective effects against BDL induced liver dysfunction and hepatic fibrosis. These effects may be, in part, mediated by up regulation of SIRT1. Copyright © 2017. Published by Elsevier Inc.