WorldWideScience

Sample records for erbb-2 selective small

  1. Engineering of bispecific affinity proteins with high affinity for ERBB2 and adaptable binding to albumin.

    Directory of Open Access Journals (Sweden)

    Johan Nilvebrant

    Full Text Available The epidermal growth factor receptor 2, ERBB2, is a well-validated target for cancer diagnostics and therapy. Recent studies suggest that the over-expression of this receptor in various cancers might also be exploited for antibody-based payload delivery, e.g. antibody drug conjugates. In such strategies, the full-length antibody format is probably not required for therapeutic effect and smaller tumor-specific affinity proteins might be an alternative. However, small proteins and peptides generally suffer from fast excretion through the kidneys, and thereby require frequent administration in order to maintain a therapeutic concentration. In an attempt aimed at combining ERBB2-targeting with antibody-like pharmacokinetic properties in a small protein format, we have engineered bispecific ERBB2-binding proteins that are based on a small albumin-binding domain. Phage display selection against ERBB2 was used for identification of a lead candidate, followed by affinity maturation using second-generation libraries. Cell surface display and flow-cytometric sorting allowed stringent selection of top candidates from pools pre-enriched by phage display. Several affinity-matured molecules were shown to bind human ERBB2 with sub-nanomolar affinity while retaining the interaction with human serum albumin. Moreover, parallel selections against ERBB2 in the presence of human serum albumin identified several amino acid substitutions that dramatically modulate the albumin affinity, which could provide a convenient means to control the pharmacokinetics. The new affinity proteins competed for ERBB2-binding with the monoclonal antibody trastuzumab and recognized the native receptor on a human cancer cell line. Hence, high affinity tumor targeting and tunable albumin binding were combined in one small adaptable protein.

  2. Cannabinoids reduce ErbB2-driven breast cancer progression through Akt inhibition

    Directory of Open Access Journals (Sweden)

    Flores Juana M

    2010-07-01

    Full Text Available Abstract Background ErbB2-positive breast cancer is characterized by highly aggressive phenotypes and reduced responsiveness to standard therapies. Although specific ErbB2-targeted therapies have been designed, only a small percentage of patients respond to these treatments and most of them eventually relapse. The existence of this population of particularly aggressive and non-responding or relapsing patients urges the search for novel therapies. The purpose of this study was to determine whether cannabinoids might constitute a new therapeutic tool for the treatment of ErbB2-positive breast tumors. We analyzed their antitumor potential in a well established and clinically relevant model of ErbB2-driven metastatic breast cancer: the MMTV-neu mouse. We also analyzed the expression of cannabinoid targets in a series of 87 human breast tumors. Results Our results show that both Δ9-tetrahydrocannabinol, the most abundant and potent cannabinoid in marijuana, and JWH-133, a non-psychotropic CB2 receptor-selective agonist, reduce tumor growth, tumor number, and the amount/severity of lung metastases in MMTV-neu mice. Histological analyses of the tumors revealed that cannabinoids inhibit cancer cell proliferation, induce cancer cell apoptosis, and impair tumor angiogenesis. Cannabinoid antitumoral action relies, at least partially, on the inhibition of the pro-tumorigenic Akt pathway. We also found that 91% of ErbB2-positive tumors express the non-psychotropic cannabinoid receptor CB2. Conclusions Taken together, these results provide a strong preclinical evidence for the use of cannabinoid-based therapies for the management of ErbB2-positive breast cancer.

  3. CRISPR-assisted receptor deletion reveals distinct roles for ERBB2 and ERBB3 in skin keratinocytes.

    Science.gov (United States)

    Dahlhoff, Maik; Gaborit, Nadège; Bultmann, Sebastian; Leonhardt, Heinrich; Yarden, Yosef; Schneider, Marlon R

    2017-10-01

    While the epidermal growth factor receptor (EGFR) is an established regulator of skin development and homeostasis, the functions of the related tyrosine kinase receptors ERBB2 and ERBB3 in this tissue have only recently been examined. Previously reported, skin-specific deletion of each of these receptors in mice resulted in similar defects in keratinocyte proliferation and migration, resulting in impaired wound healing and tumorigenesis. Because both ERBB2 and ERBB3 are targets for treating an array of cancer types, it is important to examine the consequences of receptor inhibition in human keratinocytes. Here, we employed the CRISPR/Cas9 technology to generate HaCaT cells (an established human keratinocyte cell line) lacking ERBB2 or ERBB3. HaCaT clones lacking ERBB2 or ERBB3 showed comparable reductions in cell proliferation as assessed by BrdU staining. Apoptosis, in contrast, was reduced in ERBB3-deficient HaCaT cells only. Assessment of cell migration using a wound healing (scratch) assay showed that the closure of the wound gaps was completed by 48 h in mock and in ERBB3 knockout clones. In contrast, this process was considerably delayed in ERBB2 knockout clones, and a complete closure of the gap in the latter cells did not occur before 72 h. In conclusion, both ERBB2 and ERBB3 are essential for normal proliferation of skin keratinocytes, but in contrast to ERBB3, ERBB2 is essential for migration of human keratinocytes. These observations might bear significance to patient adverse effects of therapeutic agents targeting ERBB2 and ERBB3. © 2017 Federation of European Biochemical Societies.

  4. ErbB2, but not ErbB1, reinitiates proliferation and induces luminal repopulation in epithelial acini

    Energy Technology Data Exchange (ETDEWEB)

    Muthuswamy, Senthil K; Li, Dongmei; Lelievre, Sophie; Bissell, Mina J; Brugge, Joan S

    2001-08-08

    Both ErbB1 and ErbB2 are overexpressed or amplified in breast tumors. To examine the effects of activating ErbB receptors in a context that mimics polarized epithelial cells in vivo, we activated ErbB1 and ErbB2 homodimers in preformed, growth-arrested mammary acini cultured in three-dimensional basement membrane gels. Activation of ErbB2, but not that of ErbB1, led to a reinitiation of cell proliferation and altered the properties of mammary acinar structures. These altered structures share several properties with early-stage tumors, including a loss of proliferative suppression, an absence of lumen, retention of the basement membrane and a lack of invasive properties. ErbB2 activation also disrupted tight junctions and the cell polarity of polarized epithelia, whereas ErbB1 activation did not have any effect. Our results indicate that ErbB receptors differ in their ability to induce early stages of mammary carcinogenesis in vitro and this three-dimensional model system can reveal biological activities of oncogenes that cannot be examined in vitro in standard transformation assays.

  5. Role of Erbin in ErbB2-dependent breast tumor growth

    Science.gov (United States)

    Tao, Yanmei; Shen, Chengyong; Luo, Shiwen; Traoré, Wilfried; Marchetto, Sylvie; Santoni, Marie-Josée; Xu, Linlin; Wu, Biao; Shi, Chao; Mei, Jinghong; Bates, Ryan; Liu, Xihui; Zhao, Kai; Xiong, Wen-Cheng; Borg, Jean-Paul; Mei, Lin

    2014-01-01

    ErbB2 (v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2), a receptor tyrosine kinase of the ErbB family, is overexpressed in around 25% of breast cancers. In addition to forming a heterodimer with other ErbB receptors in response to ligand stimulation, ErbB2 can be activated in a ligand-independent manner. We report here that Erbin, an ErbB2-interacting protein that was thought to act as an antitumor factor, is specifically expressed in mammary luminal epithelial cells and facilitates ErbB2-dependent proliferation of breast cancer cells and tumorigenesis in MMTV-neu transgenic mice. Disruption of their interaction decreases ErbB2-dependent proliferation, and deletion of the PDZ domain in Erbin hinders ErbB2-dependent tumor development in MMTV-neu mice. Mechanistically, Erbin forms a complex with ErbB2, promotes its interaction with the chaperon protein HSP90, and thus prevents its degradation. Finally, ErbB2 and Erbin expression correlates in human breast tumor tissues. Together, these observations establish Erbin as an ErbB2 regulator for breast tumor formation and progression. PMID:25288731

  6. Neratinib induces ErbB2 ubiquitylation and endocytic degradation via HSP90 dissociation in breast cancer cells.

    Science.gov (United States)

    Zhang, Yingqiu; Zhang, Jinrui; Liu, Congcong; Du, Sha; Feng, Lu; Luan, Xuelin; Zhang, Yayun; Shi, Yulin; Wang, Taishu; Wu, Yue; Cheng, Wei; Meng, Songshu; Li, Man; Liu, Han

    2016-11-28

    Receptor tyrosine kinase ErbB2/HER2 is frequently observed to be overexpressed in human cancers, leading to over activation of downstream signaling modules. HER2 positive is a major type of breast cancer for which ErbB2 targeting is already proving to be an effective therapeutic strategy. Apart from antibodies against ErbB2, the small molecule tyrosine kinase inhibitor lapatinib has had successful clinical outcomes, and other inhibitors such as neratinib are currently undergoing clinical investigations. In this study we report the effects of lapatinib and neratinib on the mRNA and protein levels of the ErbB2 receptor. We provide evidence that neratinib-induced down regulation of ErbB2 occurs through ubiquitin-mediated endocytic sorting and lysosomal degradation. At the mechanistic level, neratinib treatment leads to HSP90 release from ErbB2 and its subsequent ubiquitylation and endocytic degradation. Our findings provide novel insights into the mechanism of ErbB2 inhibition by neratinib. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Aberrations of ERBB2 and TOP2A Genes in Breast Cancer

    DEFF Research Database (Denmark)

    Nielsen, Kirsten Vang; Müller, Sven; Møller, Susanne

    2009-01-01

    genes and the other by having amplification of ERBB2 and deletion of TOP2A. The characteristics are compared to findings on paired ERBB2 and TOP2A data from 649 patients with invasive breast cancer from a previously published biomarker study. The physical localization of FISH signals in metaphase...... spreads from cell lines showed that simultaneous amplification is not a simple co-amplification of a whole amplicon containing both genes. Most gene signals are translocated to abnormal marker chromosomes. ERBB2 genes but not TOP2A genes are present in tandem amplicons, leading to a higher ERBB2 ratio....... This observation was confirmed by patient FISH data: among 276 (43% of all patients) abnormal tumors, 67% had different ERBB2 and TOP2A status. ERBB2 amplification with normal TOP2A status was found in 36% of the abnormal tumors (15% of all patients). Simultaneous amplification of both genes was found in 28...

  8. A novel mutation in the tyrosine kinase domain of ERBB2 in hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Bekaii-Saab, Tanios; Williams, Nita; Plass, Christoph; Calero, Miguel Villalona; Eng, Charis

    2006-01-01

    Several studies showed that gain-of-function somatic mutations affecting the catalytic domain of EGFR in non-small cell lung carcinomas were associated with response to gefitinib and erlotinib, both EGFR-tyrosine kinase inhibitors. In addition, 4% of non-small cell lung carcinomas were shown to have ERBB2 mutations in the kinase domain. In our study, we sought to determine if similar respective gain-of-function EGFR and ERBB2 mutations were present in hepatoma and/or biliary cancers. We extracted genomic DNA from 40 hepatoma (18) and biliary cancers (22) samples, and 44 adenocarcinomas of the lung, this latter as a positive control for mutation detection. We subjected those samples to PCR-based semi-automated double stranded nucleotide sequencing targeting exons 18–21 of EGFR and ERBB2. All samples were tested against matched normal DNA. We found 11% of hepatoma, but no biliary cancers, harbored a novel ERBB2 H878Y mutation in the activating domain. These newly described mutations may play a role in predicting response to EGFR-targeted therapy in hepatoma and their role should be explored in prospective studies

  9. Small tyrosine kinase inhibitors interrupt EGFR signaling by interacting with erbB3 and erbB4 in glioblastoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Carrasco-Garcia, Estefania; Saceda, Miguel [Instituto de Biologia Molecular y Celular, Universidad Miguel Hernandez, 03202 Elche (Alicante) (Spain); Unidad de Investigacion, Hospital General Universitario de Elche, 03203 Elche (Alicante) (Spain); Grasso, Silvina; Rocamora-Reverte, Lourdes; Conde, Mariano; Gomez-Martinez, Angeles [Instituto de Biologia Molecular y Celular, Universidad Miguel Hernandez, 03202 Elche (Alicante) (Spain); Garcia-Morales, Pilar [Instituto de Biologia Molecular y Celular, Universidad Miguel Hernandez, 03202 Elche (Alicante) (Spain); Unidad de Investigacion, Hospital General Universitario de Elche, 03203 Elche (Alicante) (Spain); Ferragut, Jose A. [Instituto de Biologia Molecular y Celular, Universidad Miguel Hernandez, 03202 Elche (Alicante) (Spain); Martinez-Lacaci, Isabel, E-mail: imlacaci@umh.es [Instituto de Biologia Molecular y Celular, Universidad Miguel Hernandez, 03202 Elche (Alicante) (Spain); Unidad AECC de Investigacion Traslacional en Cancer, Hospital Universitario Virgen de la Arrixaca, 30120 Murcia (Spain)

    2011-06-10

    Signaling through the epidermal growth factor receptor (EGFR) is relevant in glioblastoma. We have determined the effects of the EGFR inhibitor AG1478 in glioblastoma cell lines and found that U87 and LN-229 cells were very sensitive to this drug, since their proliferation diminished and underwent a marked G{sub 1} arrest. T98 cells were a little more refractory to growth inhibition and A172 cells did not undergo a G{sub 1} arrest. This G{sub 1} arrest was associated with up-regulation of p27{sup kip1}, whose protein turnover was stabilized. EGFR autophosphorylation was blocked with AG1478 to the same extent in all the cell lines. Other small-molecule EGFR tyrosine kinase inhibitors employed in the clinic, such as gefitinib, erlotinib and lapatinib, were able to abrogate proliferation of glioblastoma cell lines, which underwent a G{sub 1} arrest. However, the EGFR monoclonal antibody, cetuximab had no effect on cell proliferation and consistently, had no effect on cell cycle either. Similarly, cetuximab did not inhibit proliferation of U87 {Delta}EGFR cells or primary glioblastoma cell cultures, whereas small-molecule EGFR inhibitors did. Activity of downstream signaling molecules of EGFR such as Akt and especially ERK1/2 was interrupted with EGFR tyrosine kinase inhibitors, whereas cetuximab treatment could not sustain this blockade over time. Small-molecule EGFR inhibitors were able to prevent phosphorylation of erbB3 and erbB4, whereas cetuximab only hindered EGFR phosphorylation, suggesting that EGFR tyrosine kinase inhibitors may mediate their anti-proliferative effects through other erbB family members. We can conclude that small-molecule EGFR inhibitors may be a therapeutic approach for the treatment of glioblastoma patients.

  10. Selective Inhibition of Tumor Growth by Clonal NK Cells Expressing an ErbB2/HER2-Specific Chimeric Antigen Receptor

    Science.gov (United States)

    Schönfeld, Kurt; Sahm, Christiane; Zhang, Congcong; Naundorf, Sonja; Brendel, Christian; Odendahl, Marcus; Nowakowska, Paulina; Bönig, Halvard; Köhl, Ulrike; Kloess, Stephan; Köhler, Sylvia; Holtgreve-Grez, Heidi; Jauch, Anna; Schmidt, Manfred; Schubert, Ralf; Kühlcke, Klaus; Seifried, Erhard; Klingemann, Hans G; Rieger, Michael A; Tonn, Torsten; Grez, Manuel; Wels, Winfried S

    2015-01-01

    Natural killer (NK) cells are an important effector cell type for adoptive cancer immunotherapy. Similar to T cells, NK cells can be modified to express chimeric antigen receptors (CARs) to enhance antitumor activity, but experience with CAR-engineered NK cells and their clinical development is still limited. Here, we redirected continuously expanding and clinically usable established human NK-92 cells to the tumor-associated ErbB2 (HER2) antigen. Following GMP-compliant procedures, we generated a stable clonal cell line expressing a humanized CAR based on ErbB2-specific antibody FRP5 harboring CD28 and CD3ζ signaling domains (CAR 5.28.z). These NK-92/5.28.z cells efficiently lysed ErbB2-expressing tumor cells in vitro and exhibited serial target cell killing. Specific recognition of tumor cells and antitumor activity were retained in vivo, resulting in selective enrichment of NK-92/5.28.z cells in orthotopic breast carcinoma xenografts, and reduction of pulmonary metastasis in a renal cell carcinoma model, respectively. γ-irradiation as a potential safety measure for clinical application prevented NK cell replication, while antitumor activity was preserved. Our data demonstrate that it is feasible to engineer CAR-expressing NK cells as a clonal, molecularly and functionally well-defined and continuously expandable cell therapeutic agent, and suggest NK-92/5.28.z cells as a promising candidate for use in adoptive cancer immunotherapy. PMID:25373520

  11. ERBB2 mutations associated with solid variant of high-grade invasive lobular breast carcinomas.

    Science.gov (United States)

    Deniziaut, Gabrielle; Tille, Jean Christophe; Bidard, François-Clément; Vacher, Sophie; Schnitzler, Anne; Chemlali, Walid; Trémoulet, Laurence; Fuhrmann, Laetitia; Cottu, Paul; Rouzier, Roman; Bièche, Ivan; Vincent-Salomon, Anne

    2016-11-08

    ERBB2 and ERBB3 somatic gain-of-function mutations, which may be targeted by anti-ERBB2 therapies, were reported by high-throughput sequencing studies in 1% and 2% of invasive breast cancers respectively. Our study aims to determine ERBB2 and ERBB3 mutations frequencies in grade 3 and/or ERBB2-positive invasive lobular breast carcinomas (ILC). All the 529 ILC surgically-excised registered at Institut Curie in the years 2005 to 2008 were reviewed. Thirty-nine grade 3 ERBB2-negative ILC and 16 ERBB2-positive ILC were retrieved and subjected to Sanger sequencing of the ERBB2 and ERBB3 activation mutation hotspots (ERBB2: exons 8, 17, 19, 20, 21; ERBB3: exons 3, 6, 7, 8). Among the 39 grade 3 ERBB2-negative ILC, six tumors were found to have at least one detectable ERBB2 activating mutation (incidence rate: 15%, 95%CI [4%-27%]). No ERBB2 mutation was found among the 16 ERBB2-positive ILC. No ERBB3 mutation was found in any of the 55 ILC. ERBB2 mutations were statistically associated with solid ILC features (p=0.01). Survival analyses showed no significant prognostic impact of ERBB2 mutations. Our study demonstrates that high grade ERBB2-negative ILC display a high frequency of ERBB2 mutations, and should be subjected to systematic genetic screening.

  12. ErbB2 resembles an autoinhibited invertebrate epidermal growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado, Diego; Klein, Daryl E.; Lemmon, Mark A.; (UPENN-MED)

    2009-09-25

    The orphan receptor tyrosine kinase ErbB2 (also known as HER2 or Neu) transforms cells when overexpressed, and it is an important therapeutic target in human cancer. Structural studies have suggested that the oncogenic (and ligand-independent) signalling properties of ErbB2 result from the absence of a key intramolecular 'tether' in the extracellular region that autoinhibits other human ErbB receptors, including the epidermal growth factor (EGF) receptor. Although ErbB2 is unique among the four human ErbB receptors, here we show that it is the closest structural relative of the single EGF receptor family member in Drosophila melanogaster (dEGFR). Genetic and biochemical data show that dEGFR is tightly regulated by growth factor ligands, yet a crystal structure shows that it, too, lacks the intramolecular tether seen in human EGFR, ErbB3 and ErbB4. Instead, a distinct set of autoinhibitory interdomain interactions hold unliganded dEGFR in an inactive state. All of these interactions are maintained (and even extended) in ErbB2, arguing against the suggestion that ErbB2 lacks autoinhibition. We therefore suggest that normal and pathogenic ErbB2 signalling may be regulated by ligands in the same way as dEGFR. Our findings have important implications for ErbB2 regulation in human cancer, and for developing therapeutic approaches that target novel aspects of this orphan receptor.

  13. Chimeric DNA Vaccines against ErbB2{sup +} Carcinomas: From Mice to Humans

    Energy Technology Data Exchange (ETDEWEB)

    Quaglino, Elena; Riccardo, Federica; Macagno, Marco; Bandini, Silvio; Cojoca, Rodica; Ercole, Elisabetta [Molecular Biotechnology Center, Department of Clinical and Biological Sciences, University of Turin, 10126 Turin (Italy); Amici, Augusto [Department of Molecular Cellular and Animal Biology, University of Camerino, 62032 Camerino (Italy); Cavallo, Federica, E-mail: federica.cavallo@unito.it [2 Department of Molecular Cellular and Animal Biology, University of Camerino, 62032 Camerino (Italy)

    2011-08-10

    DNA vaccination exploits a relatively simple and flexible technique to generate an immune response against microbial and tumor-associated antigens (TAAs). Its effectiveness is enhanced by the application of an electrical shock in the area of plasmid injection (electroporation). In our studies we exploited a sophisticated electroporation device approved for clinical use (Cliniporator, IGEA, Carpi, Italy). As the target antigen is an additional factor that dramatically modulates the efficacy of a vaccine, we selected ErbB2 receptor as a target since it is an ideal oncoantigen. It is overexpressed on the cell membrane by several carcinomas for which it plays an essential role in driving their progression. Most oncoantigens are self-tolerated molecules. To circumvent immune tolerance we generated two plasmids (RHuT and HuRT) coding for chimeric rat/human ErbB2 proteins. Their immunogenicity was compared in wild type mice naturally tolerant for mouse ErbB2, and in transgenic mice that are also tolerant for rat or human ErbB2. In several of these mice, RHuT and HuRT elicited a stronger anti-tumor response than plasmids coding for fully human or fully rat ErbB2. The ability of heterologous moiety to blunt immune tolerance could be exploited to elicit a significant immune response in patients. A clinical trial to delay the recurrence of ErbB2{sup +} carcinomas of the oral cavity, oropharynx and hypopharynx is awaiting the approval of the Italian authorities.

  14. A combination of Trastuzumab and 17-AAG induces enhanced ubiquitinylation and lysosomal pathway-dependent ErbB2 degradation and cytotoxicity in ErbB2-overexpressing breast cancer cells.

    Science.gov (United States)

    Raja, Srikumar M; Clubb, Robert J; Bhattacharyya, Mitra; Dimri, Manjari; Cheng, Hao; Pan, Wei; Ortega-Cava, Cesar; Lakku-Reddi, Alagarsamy; Naramura, Mayumi; Band, Vimla; Band, Hamid

    2008-10-01

    ErbB2 (or Her2/Neu) overexpression in breast cancer signifies poorer prognosis, yet it has provided an avenue for targeted therapy as demonstrated by the success of the humanized monoclonal antibody Trastuzumab (Herceptin). Resistance to Trastuzumab and eventual failure in most cases, however, necessitate alternate ErbB2-targeted therapies. HSP90 inhibitors such as 17-allylaminodemethoxygeldanamycin (17-AAG), potently downregulate the cell surface ErbB2. While the precise mechanisms of Trastuzumab or 17-AAG action remain unclear, ubiquitinylation-dependent proteasomal or lysosomal degradation of ErbB2 appears to play a substantial role. As Trastuzumab and 17-AAG induce the recruitment of distinct E3 ubiquitin ligases, Cbl and CHIP respectively, to ErbB2, we hypothesized that 17-AAG and Trastuzumab combination could induce a higher level of ubiquitinylation and downregulation of ErbB2 as compared to single drug treatments. We present biochemical and cell biological evidence that combined 17-AAG and Trastuzumab treatment of ErbB2-overexpressing breast cancer cell lines leads to enhanced ubiquitinylation, downregulation from the cell surface and lysosomal degradation of ErbB2. Importantly, combined 17-AAG and Trastuzumab treatment induced synergistic growth arrest and cell death specifically in ErbB2-overexpressing but not in ErbB2-low breast cancer cells. Our results suggest the 17-AAG and Trastuzumab combination as a mechanism-based combinatorial targeted therapy for ErbB2-overexpressing breast cancer patients.

  15. ERBB-2 overexpression as a risk factor for malignant phaeochromocytomas and paraganglinomas.

    Science.gov (United States)

    Wang, Weiqing; Zhong, Xu; Ye, Lei; Qi, Yan; Su, TingWei; Wei, Qing; Xie, Jing; Jiang, Lei; Jiang, Yiran; Zhou, Weiwei; Cui, Bin; Ning, Guang

    2016-06-01

    There are currently no good histological or molecular markers to differentiate benign from malignant phaeochromocytomas and paraganglinomas (PPGLs). Our previous cross-sectional study observed that ERBB-2 overexpression was associated with malignant PPGLs. This study aimed to evaluate the predictive value of ERBB-2 overexpression for metastasis in PPGLs in a large population. A total of 262 patients diagnosed as PPGLs in our institution between 2002 and 2012 were included. We analysed ERBB-2 protein expression in the primary PPGL tumours by immunohistochemistry (IHC) and ERBB-2 amplification by fluorescence in situ hybridization (FISH). Direct Sanger sequencing was performed to examine ERBB-2 exon 20 mutations. The occurrence of malignant PPGLs was documented in the follow-up period. Kaplan-Meier analysis and Cox proportional hazard models were used to evaluate the association between ERBB-2 overexpression and metastasis of PPGLs. Twenty-six (9·9%) patients had ERBB-2 overexpression in their primary PPGL tumours, which was significantly associated with ERBB-2 amplification (17/25, 68%). No ERBB-2 mutation was found. At a median follow-up of 4·5 years, a total of 23 malignant PPGLs were documented, including eight (30·8%) patients in the ERBB-2 overexpression group and 15 (6·4%) patients in the ERBB-2-negative group. The incidence rate of metastasis was 5·3 per 100 person-years vs 1·4 per 100 person-years in the ERBB-2 overexpression and ERBB-2-negative groups (P overexpression was associated with decreased metastasis-free survival (P = 0·001, log-rank test). After adjusting for primary tumour size and location, Cox regression analysis revealed that ERBB-2 overexpression was independently associated with risk of malignant PPGLs (HR = 2·78; 95% CI, 1·12-6·90; P = 0·028). Patients harbouring tumours with ERBB-2 overexpression have a significantly higher risk of developing malignant PPGLs. © 2016 John Wiley & Sons Ltd.

  16. Ibrutinib (ImbruvicaTM) potently inhibits ErbB receptor phosphorylation and cell viability of ErbB2-positive breast cancer cells.

    Science.gov (United States)

    Grabinski, Nicole; Ewald, Florian

    2014-12-01

    Ibrutinib (formerly PCI-32765) is a specific, irreversible, and potent inhibitor of Burton's tyrosine kinase (BTK) developed for the treatment of several forms of blood cancer. It is now an FDA-approved drug marketed under the name Imbruvica(TM) (Pharmacyclics, Inc.) and successfully used as an orally administered second-line drug in the treatment of mantle cell lymphoma. Since BTK is predominantly expressed in hematopoietic cells, the sensitivity of solid tumor cells to Ibrutinib has not been analyzed. In this study, we determined the effect of Ibrutinib on breast cancer cells. We demonstrate that Ibrutinib efficiently reduces the phosphorylation of the receptor tyrosine kinases ErbB1, ErbB2 and ErbB3, thereby suppressing AKT and MAPK signaling in ErbB2-positive (ErbB2+) breast cancer cell lines. Treatment with Ibrutinib significantly reduced the viability of ErbB2+ cell lines with IC50 values at nanomolar concentrations, suggesting therapeutic potential of Ibrutinib in breast cancer. Combined treatment with Ibrutinib and the dual PI3K/mTOR inhibitor BEZ235 synergistically reduces cell viability of ErbB2+ breast cancer cells. Combination indices below 0.25 at 50% inhibition of cell viability were determined by the Chou-Talalay method. Therefore, the combination of Ibrutinib and canonical PI3K pathway inhibitors could be a new and effective approach in the treatment of breast cancer with activated ErbB receptors. Ibrutinib could thus become a valuable component of targeted therapy in aggressive ErbB2+ breast cancer.

  17. ERBB2 in Cat Mammary Neoplasias Disclosed a Positive Correlation between RNA and Protein Low Expression Levels: A Model for erbB-2 Negative Human Breast Cancer

    Science.gov (United States)

    Abreu, Rui M. V.; Bastos, Estela; Amorim, Irina; Gut, Ivo G.; Gärtner, Fátima; Chaves, Raquel

    2013-01-01

    Human ERBB2 is a proto-oncogene that codes for the erbB-2 epithelial growth factor receptor. In human breast cancer (HBC), erbB-2 protein overexpression has been repeatedly correlated with poor prognosis. In more recent works, underexpression of this gene has been described in HBC. Moreover, it is also recognised that oncogenes that are commonly amplified or deleted encompass point mutations, and some of these are associated with HBC. In cat mammary lesions (CMLs), the overexpression of ERBB2 (27%–59.6%) has also been described, mostly at the protein level and although cat mammary neoplasias are considered to be a natural model of HBC, molecular information is still scarce. In the present work, a cat ERBB2 fragment, comprising exons 10 to 15 (ERBB2_10–15) was achieved for the first time. Allelic variants and genomic haplotype analyses were also performed, and differences between normal and CML populations were observed. Three amino acid changes, corresponding to 3 non-synonymous genomic sequence variants that were only detected in CMLs, were proposed to damage the 3D structure of the protein. We analysed the cat ERBB2 gene at the DNA (copy number determination), mRNA (expression levels assessment) and protein levels (in extra- and intra protein domains) in CML samples and correlated the last two evaluations with clinicopathological features. We found a positive correlation between the expression levels of the ERBB2 RNA and erbB-2 protein, corresponding to the intracellular region. Additionally, we detected a positive correlation between higher mRNA expression and better clinical outcome. Our results suggest that the ERBB2 gene is post-transcriptionally regulated and that proteins with truncations and single point mutations are present in cat mammary neoplastic lesions. We would like to emphasise that the recurrent occurrence of low erbB-2 expression levels in cat mammary tumours, suggests the cat mammary neoplasias as a valuable model for erbB-2 negative HBC

  18. Examining the protective role of ErbB2 modulation in human-induced pluripotent stem cell-derived cardiomyocytes.

    Science.gov (United States)

    Eldridge, Sandy; Guo, Liang; Mussio, Jodie; Furniss, Mike; Hamre, John; Davis, Myrtle

    2014-10-01

    Human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are being used as an in vitro model system in cardiac biology and in drug discovery (e.g., cardiotoxicity testing). Qualification of these cells for use in mechanistic investigations will require detailed evaluations of cardiomyocyte signaling pathways and cellular responses. ErbB signaling and the ligand neuregulin play critical roles in survival and functional integrity of cardiac myocytes. As such, we sought to characterize the expression and activity of the ErbB family of receptors. Antibody microarray analysis performed on cell lysates derived from maturing hiPSC-CMs detected expression of ∼570 signaling proteins. EGFR/ErbB1, HER2/ErbB2, and ErbB4, but not ErbB3 receptors, of the epidermal growth factor receptor family were confirmed by Western blot. Activation of ErbB signaling by neuregulin-1β (NRG, a natural ligand for ErbB4) and its modulation by trastuzumab (a monoclonal anti-ErbB2 antibody) and lapatinib (a small molecule ErbB2 tyrosine kinase inhibitor) were evaluated through assessing phosphorylation of AKT and Erk1/2, two major downstream kinases of ErbB signaling, using nanofluidic proteomic immunoassay. Downregulation of ErbB2 expression by siRNA silencing attenuated NRG-induced AKT and Erk1/2 phosphorylation. Activation of ErbB signaling with NRG, or inhibition with trastuzumab, alleviated or aggravated doxorubicin-induced cardiomyocyte damage, respectively, as assessed by a real-time cellular impedance analysis and ATP measurement. Collectively, these results support the expanded use of hiPSC-CMs to examine mechanisms of cardiotoxicity and support the value of using these cells in early assessments of cardiotoxicity or efficacy. Published by Oxford University Press on behalf of Toxicological Sciences 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  19. Erbb2 up-regulation of ADAM12 expression accelerates skin cancer progression.

    Science.gov (United States)

    Rao, Velidi H; Vogel, Kristen; Yanagida, Jodi K; Marwaha, Nitin; Kandel, Amrit; Trempus, Carol; Repertinger, Susan K; Hansen, Laura A

    2015-10-01

    Solar ultraviolet (UV) radiation can cause severe damage to the skin and is the primary cause of most skin cancer. UV radiation causes DNA damage leading to mutations and also activates the Erbb2/HER2 receptor through indirect mechanisms involving reactive oxygen species. We hypothesized that Erbb2 activation accelerates the malignant progression of UV-induced skin cancer. Following the induction of benign squamous papillomas by UV exposure of v-ras(Ha) transgenic Tg.AC mice, mice were treated topically with the Erbb2 inhibitor AG825 and tumor progression monitored. AG825 treatment reduced tumor volume, increased tumor regression, and delayed the development of malignant squamous cell carcinoma (SCC). Progression to malignancy was associated with increased Erbb2 and ADAM12 (A Disintegin And Metalloproteinase 12) transcripts and protein, while inhibition of Erbb2 blocked the increase in ADAM12 message upon malignant progression. Similarly, human SCC and SCC cell lines had increased ADAM12 protein and transcripts when compared to normal controls. To determine whether Erbb2 up-regulation of ADAM12 contributed to malignant progression of skin cancer, Erbb2 expression was modulated in cultured SCC cells using forced over-expression or siRNA targeting, demonstrating up-regulation of ADAM12 by Erbb2. Furthermore, ADAM12 transfection or siRNA targeting revealed that ADAM12 increased both the migration and invasion of cutaneous SCC cells. Collectively, these results suggest Erbb2 up-regulation of ADAM12 as a novel mechanism contributing to the malignant progression of UV-induced skin cancer. Inhibition of Erbb2/HER2 reduced tumor burden, increased tumor regression, and delayed the progression of benign skin tumors to malignant SCC in UV-exposed mice. Inhibition of Erbb2 suppressed the increase in metalloproteinase ADAM12 expression in skin tumors, which in turn increased migration and tumor cell invasiveness. © 2014 Wiley Periodicals, Inc.

  20. Small molecule ErbB inhibitors decrease proliferative signaling and promote apoptosis in philadelphia chromosome-positive acute lymphoblastic leukemia.

    Directory of Open Access Journals (Sweden)

    Mary E Irwin

    Full Text Available The presence of the Philadelphia chromosome in patients with acute lymphoblastic leukemia (Ph(+ALL is a negative prognostic indicator. Tyrosine kinase inhibitors (TKI that target BCR/ABL, such as imatinib, have improved treatment of Ph(+ALL and are generally incorporated into induction regimens. This approach has improved clinical responses, but molecular remissions are seen in less than 50% of patients leaving few treatment options in the event of relapse. Thus, identification of additional targets for therapeutic intervention has potential to improve outcomes for Ph+ALL. The human epidermal growth factor receptor 2 (ErbB2 is expressed in ~30% of B-ALLs, and numerous small molecule inhibitors are available to prevent its activation. We analyzed a cohort of 129 ALL patient samples using reverse phase protein array (RPPA with ErbB2 and phospho-ErbB2 antibodies and found that activity of ErbB2 was elevated in 56% of Ph(+ALL as compared to just 4.8% of Ph(-ALL. In two human Ph+ALL cell lines, inhibition of ErbB kinase activity with canertinib resulted in a dose-dependent decrease in the phosphorylation of an ErbB kinase signaling target p70S6-kinase T389 (by 60% in Z119 and 39% in Z181 cells at 3 µM. Downstream, phosphorylation of S6-kinase was also diminished in both cell lines in a dose-dependent manner (by 91% in both cell lines at 3 µM. Canertinib treatment increased expression of the pro-apoptotic protein Bim by as much as 144% in Z119 cells and 49% in Z181 cells, and further produced caspase-3 activation and consequent apoptotic cell death. Both canertinib and the FDA-approved ErbB1/2-directed TKI lapatinib abrogated proliferation and increased sensitivity to BCR/ABL-directed TKIs at clinically relevant doses. Our results suggest that ErbB signaling is an additional molecular target in Ph(+ALL and encourage the development of clinical strategies combining ErbB and BCR/ABL kinase inhibitors for this subset of ALL patients.

  1. Preubiquitinated chimeric ErbB2 is constitutively endocytosed and subsequently degraded in lysosomes

    Energy Technology Data Exchange (ETDEWEB)

    Vuong, Tram Thu [Institute of Clinical Medicine, University of Oslo, Rikshospitalet, 0027 Oslo (Norway); Berger, Christian [Department of Pathology, Oslo University Hospital, Rikshospitalet, P.O. Box 4950 Nydalen, 0424 Oslo (Norway); Bertelsen, Vibeke; Rødland, Marianne Skeie [Institute of Clinical Medicine, University of Oslo, Rikshospitalet, 0027 Oslo (Norway); Stang, Espen [Department of Pathology, Oslo University Hospital, Rikshospitalet, P.O. Box 4950 Nydalen, 0424 Oslo (Norway); Madshus, Inger Helene, E-mail: i.h.madshus@medisin.uio.no [Institute of Clinical Medicine, University of Oslo, Rikshospitalet, 0027 Oslo (Norway); Department of Pathology, Oslo University Hospital, Rikshospitalet, P.O. Box 4950 Nydalen, 0424 Oslo (Norway)

    2013-02-01

    The oncoprotein ErbB2 is endocytosis-deficient, probably due to its interaction with Heat shock protein 90. We previously demonstrated that clathrin-dependent endocytosis of ErbB2 is induced upon incubation of cells with Ansamycin derivatives, such as geldanamycin and its derivative 17-AAG. Furthermore, we have previously demonstrated that a preubiquitinated chimeric EGFR (EGFR-Ub{sub 4}) is constitutively endocytosed in a clathrin-dependent manner. We now demonstrate that also an ErbB2-Ub{sub 4} chimera is endocytosed constitutively and clathrin-dependently. Upon expression, the ErbB2-Ub{sub 4} was further ubiquitinated, and by Western blotting, we demonstrated the formation of both Lys48-linked and Lys63-linked polyubiquitin chains. ErbB2-Ub{sub 4} was constitutively internalized and eventually sorted to late endosomes and lysosomes where the fusion protein was degraded. ErbB2-Ub{sub 4} was not cleaved prior to internalization. Interestingly, over-expression of Ubiquitin Interaction Motif-containing dominant negative fragments of the clathrin adaptor proteins epsin1 and Eps15 negatively affected endocytosis of ErbB2. Altogether, this argues that ubiquitination is sufficient to induce clathrin-mediated endocytosis and lysosomal degradation of the otherwise plasma membrane localized ErbB2. Also, it appears that C-terminal cleavage is not required for endocytosis. -- Highlights: ► A chimera containing ErbB2 and a tetra-Ubiquitin chain internalizes constitutively. ► Receptor fragmentation is not required for endocytosis of ErbB2. ► Ubiquitination is sufficient to induce endocytosis and degradation of ErbB2. ► ErbB2-Ub4 is internalized clathrin-dependently.

  2. Preubiquitinated chimeric ErbB2 is constitutively endocytosed and subsequently degraded in lysosomes

    International Nuclear Information System (INIS)

    Vuong, Tram Thu; Berger, Christian; Bertelsen, Vibeke; Rødland, Marianne Skeie; Stang, Espen; Madshus, Inger Helene

    2013-01-01

    The oncoprotein ErbB2 is endocytosis-deficient, probably due to its interaction with Heat shock protein 90. We previously demonstrated that clathrin-dependent endocytosis of ErbB2 is induced upon incubation of cells with Ansamycin derivatives, such as geldanamycin and its derivative 17-AAG. Furthermore, we have previously demonstrated that a preubiquitinated chimeric EGFR (EGFR-Ub 4 ) is constitutively endocytosed in a clathrin-dependent manner. We now demonstrate that also an ErbB2-Ub 4 chimera is endocytosed constitutively and clathrin-dependently. Upon expression, the ErbB2-Ub 4 was further ubiquitinated, and by Western blotting, we demonstrated the formation of both Lys48-linked and Lys63-linked polyubiquitin chains. ErbB2-Ub 4 was constitutively internalized and eventually sorted to late endosomes and lysosomes where the fusion protein was degraded. ErbB2-Ub 4 was not cleaved prior to internalization. Interestingly, over-expression of Ubiquitin Interaction Motif-containing dominant negative fragments of the clathrin adaptor proteins epsin1 and Eps15 negatively affected endocytosis of ErbB2. Altogether, this argues that ubiquitination is sufficient to induce clathrin-mediated endocytosis and lysosomal degradation of the otherwise plasma membrane localized ErbB2. Also, it appears that C-terminal cleavage is not required for endocytosis. -- Highlights: ► A chimera containing ErbB2 and a tetra-Ubiquitin chain internalizes constitutively. ► Receptor fragmentation is not required for endocytosis of ErbB2. ► Ubiquitination is sufficient to induce endocytosis and degradation of ErbB2. ► ErbB2-Ub4 is internalized clathrin-dependently.

  3. ErbB polymorphisms: Insights and implications for response to targeted cancer therapeutics

    Directory of Open Access Journals (Sweden)

    Moulay A Alaoui-Jamali

    2015-02-01

    Full Text Available Advances in high-throughput genomic-scanning have expanded the repertory of genetic variations in DNA sequences encoding ErbB tyrosine kinase receptors in humans, including single nucleotide polymorphisms (SNPs, polymorphic repetitive elements, microsatellite variations, small-scale insertions and deletions. The ErbB family members: EGFR, ErbB2, ErbB3 and ErbB4 receptors are established as drivers of many aspects of tumor initiation and progression to metastasis. This knowledge has provided rationales for the development of an arsenal of anti-ErbB therapeutics, ranging from small molecule kinase inhibitors to monoclonal antibodies. Anti-ErbB agents are becoming the cornerstone therapeutics for the management of cancers that overexpress hyperactive variants of ErbB receptors, in particular ErbB2-positive breast cancer and non-small cell lung carcinomas. However, their clinical benefit has been limited to a subset of patients due to a wide heterogeneity in drug response despite the expression of the ErbB targets, attributed to intrinsic (primary and to acquired (secondary resistance. Somatic mutations in ErbB tyrosine kinase domains have been extensively investigated in preclinical and clinical setting as determinants for either high sensitivity or resistance to anti-ErbB therapeutics. In contrast, only scant information is available on the impact of SNPs, which are widespread in genes encoding ErbB receptors, on receptor structure and activity, and their predictive values for drug susceptibility. This review aims to briefly update polymorphic variations in genes encoding ErbB receptors based on recent advances in deep sequencing technologies, and to address challenging issues for a better understanding of the functional impact of single versus combined SNPs in ErbB genes to receptor topology, receptor-drug interaction, and drug susceptibility. The potential of exploiting SNPs in the era of stratified targeted therapeutics is discussed.

  4. The role of ERBB2 gene polymorphisms in leprosy susceptibility

    Directory of Open Access Journals (Sweden)

    Jamile Leão Rêgo

    2015-03-01

    Full Text Available Mycobacterium leprae infects skin and peripheral nerves causing deformities and disability. The M. leprae bacterium binds to ErbB2 on the Schwann cell surface causing demyelination and favoring spread of the bacilli and causing nerve injury. Polymorphisms at the ERBB2 gene were previously investigated as genetic risk factors for leprosy in two Brazilian populations but with inconsistent results. Herein we extend the analysis of ERBB2 variants to a third geographically distinct population in Brazil. Our results show that there is no association between the genotyped SNPs and the disease (p > 0.05 in this population. A gene set or pathway analysis under the genomic region of ERBB2 will be necessary to clarify its regulation under M. leprae stimulus.

  5. Growth inhibitory effects of the dual ErbB1/ErbB2 tyrosine kinase inhibitor PKI-166 on human prostate cancer xenografts.

    Science.gov (United States)

    Mellinghoff, Ingo K; Tran, Chris; Sawyers, Charles L

    2002-09-15

    Experiments with human prostate cancer cell lines have shown that forced overexpression of the ErbB2-receptor tyrosine kinase (RTK) promotes androgen-independent growth and increases androgen receptor-transcriptional activity in a ligand-independent fashion. To investigate the relationship between ErbB-RTK signaling and androgen in genetically unmanipulated human prostate cancer, we performed biochemical and biological studies with the dual ErbB1/ErbB2 RTK inhibitor PKI-166 using human prostate cancer xenograft models with isogenic sublines reflecting the transition from androgen-dependent to androgen-independent growth. In the presence of low androgen concentrations, PKI-166 showed profound growth-inhibitory effects on tumor growth, which could be partially reversed by androgen add-back. At physiological androgen concentrations, androgen withdrawal greatly enhanced the ability of PKI-166 to retard tumor growth. The level of extracellular signal-regulated kinase activation correlated with the response to PKI-166 treatment, whereas the expression levels of ErbB1 and ErbB2 did not. These results suggest that ErbB1/ErbB2 RTKs play an important role in the biology of androgen-independent prostate cancer and provide a rationale for clinical evaluation of inhibitors targeted to this pathway.

  6. Role of ErbB receptors in cancer cell migration and invasion

    Directory of Open Access Journals (Sweden)

    Aline eAppert-Collin

    2015-11-01

    Full Text Available Growth factors mediate their diverse biologic responses (regulation of cellular proliferation, differentiation, migration and survival by binding to and activating cell-surface receptors with intrinsic protein kinase activity named Receptor Tyrosine Kinases (RTKs. About 60 RTKs have been identified and can be classified into more than 16 different receptor families. Their activity is normally tightly controlled and regulated. Overexpression of RTK proteins or functional alterations caused by mutations in the corresponding genes or abnormal stimulation by autocrine growth factor loops contribute to constitutive RTK signaling, resulting in alterations in the physiological activities of cells. The ErbB receptor family of RTKs comprises four distinct receptors: the EGFR (also known as ErbB1/HER1, ErbB2 (neu, HER2, ErbB3 (HER3 and ErbB4 (HER4. ErbB family members are often overexpressed, amplified, or mutated in many forms of cancer, making them important therapeutic targets. EGFR has been found to be amplified in gliomas and non-small-cell lung carcinoma while ErbB2 amplifications are seen in breast, ovarian, bladder, non-small-cell lung carcinoma, as well as several other tumor types. Several data have shown that ErbB receptor family and its downstream pathway regulate epithelial-mesenchymal transition, migration, and tumor invasion by modulating extracellular matrix components. Recent findings indicate that extracellular matrix components such as matrikines bind specifically to EGF receptor and promote cell invasion. In this review, we will present an in-depth overview of the structure, mechanisms, cell signaling, and functions of ErbB family receptors in cell adhesion and migration. Furthermore, we will describe in a last part the new strategies developed in anti-cancer therapy to inhibit ErbB family receptor activation.

  7. ErbB-2 nuclear function in breast cancer growth, metastasis and resistance to therapy.

    Science.gov (United States)

    Elizalde, Patricia V; Cordo Russo, Rosalía I; Chervo, Maria F; Schillaci, Roxana

    2016-12-01

    Approximately 15-20% of breast cancers (BC) show either membrane overexpression of ErbB-2 (MErbB-2), a member of the ErbBs family of receptor tyrosine kinases, or ERBB2 gene amplification. Until the development of MErbB-2-targeted therapies, this BC subtype, called ErbB-2-positive, was associated with increased metastatic potential and poor prognosis. Although these therapies have significantly improved overall survival and cure rates, resistance to available drugs is still a major clinical issue. In its classical mechanism, MErbB-2 activates downstream signaling cascades, which transduce its effects in BC. The fact that ErbB-2 is also present in the nucleus of BC cells was discovered over twenty years ago. Also, compelling evidence revealed a non-canonical function of nuclear ErbB-2 as a transcriptional regulator. As a deeper understanding of nuclear ErbB-2 actions would be crucial to the disclosure of its role as a biomarker and a target of therapy in BC, we will here review its function in BC, in particular, its role in growth, metastatic spreading and response to currently available MErbB-2-positive BC therapies. © 2016 Society for Endocrinology.

  8. Significance of ERBB2 overexpression in therapeutic resistance and cancer-specific survival in muscle-invasive bladder cancer patients treated with chemoradiation-based selective bladder-sparing approach.

    Science.gov (United States)

    Inoue, Masaharu; Koga, Fumitaka; Yoshida, Soichiro; Tamura, Tomoki; Fujii, Yasuhisa; Ito, Eisaku; Kihara, Kazunori

    2014-10-01

    To investigate the associations of ERBB 2 overexpression with chemoradiation therapy (CRT) resistance and cancer-specific survival (CSS) in muscle-invasive bladder cancer (MIBC) patients treated with the CRT-based bladder-sparing protocol. From 1997 to 2012, 201 patients with cT2-4aN0M0 bladder cancer were treated with CRT (40 Gy with concurrent cisplatin) following transurethral resection of bladder tumor (TURBT). Basically, patients with tumors that showed good CRT response and were amenable to segmental resection underwent partial cystectomy (PC) with pelvic lymph node dissection for bladder preservation; otherwise, radical cystectomy (RC) was recommended. Included in this study were 119 patients in whom TURBT specimens were available for immunohistochemical analysis of ERBB 2 expression. Following CRT, 30 and 65 patients underwent PC or RC, respectively; the remaining 24 patients did not undergo cystectomy. Tumors were defined as CRT-resistant when patients did not achieve complete response after CRT. Associations of ERBB 2 overexpression with CRT resistance and CSS were evaluated. CRT resistance was observed clinically in 56% (67 of 119 patients) and pathologically (in cystectomy specimens) in 55% (52 of 95 patients). ERBB 2 overexpression was observed in 45 patients (38%). On multivariate analysis, ERBB 2 overexpression was an independent predictor for CRT resistance clinically (odds ratio, 3.6; P=.002) and pathologically (odds ratio, 2.9; P=.031). ERBB 2 overexpression was associated with shorter CSS (5-year CSS rates, 56% vs 87% for the ERBB 2 overexpression group vs the others; P=.001). ERBB 2 overexpression was also an independent risk factor for bladder cancer death at all time points of our bladder-sparing protocol (pre-CRT, post-CRT, and post-cystectomy). ERBB 2 overexpression appears relevant to CRT resistance and unfavorable CSS in MIBC patients treated with the CRT-based bladder-sparing protocol. ERBB 2-targeting treatment may improve the outcomes

  9. Significance of ERBB2 Overexpression in Therapeutic Resistance and Cancer-Specific Survival in Muscle-Invasive Bladder Cancer Patients Treated With Chemoradiation-Based Selective Bladder-Sparing Approach

    International Nuclear Information System (INIS)

    Inoue, Masaharu; Koga, Fumitaka; Yoshida, Soichiro; Tamura, Tomoki; Fujii, Yasuhisa; Ito, Eisaku; Kihara, Kazunori

    2014-01-01

    Purpose: To investigate the associations of ERBB 2 overexpression with chemoradiation therapy (CRT) resistance and cancer-specific survival (CSS) in muscle-invasive bladder cancer (MIBC) patients treated with the CRT-based bladder-sparing protocol. Methods and Materials: From 1997 to 2012, 201 patients with cT2-4aN0M0 bladder cancer were treated with CRT (40 Gy with concurrent cisplatin) following transurethral resection of bladder tumor (TURBT). Basically, patients with tumors that showed good CRT response and were amenable to segmental resection underwent partial cystectomy (PC) with pelvic lymph node dissection for bladder preservation; otherwise, radical cystectomy (RC) was recommended. Included in this study were 119 patients in whom TURBT specimens were available for immunohistochemical analysis of ERBB 2 expression. Following CRT, 30 and 65 patients underwent PC or RC, respectively; the remaining 24 patients did not undergo cystectomy. Tumors were defined as CRT-resistant when patients did not achieve complete response after CRT. Associations of ERBB 2 overexpression with CRT resistance and CSS were evaluated. Results: CRT resistance was observed clinically in 56% (67 of 119 patients) and pathologically (in cystectomy specimens) in 55% (52 of 95 patients). ERBB 2 overexpression was observed in 45 patients (38%). On multivariate analysis, ERBB 2 overexpression was an independent predictor for CRT resistance clinically (odds ratio, 3.6; P=.002) and pathologically (odds ratio, 2.9; P=.031). ERBB 2 overexpression was associated with shorter CSS (5-year CSS rates, 56% vs 87% for the ERBB 2 overexpression group vs the others; P=.001). ERBB 2 overexpression was also an independent risk factor for bladder cancer death at all time points of our bladder-sparing protocol (pre-CRT, post-CRT, and post-cystectomy). Conclusions: ERBB 2 overexpression appears relevant to CRT resistance and unfavorable CSS in MIBC patients treated with the CRT-based bladder

  10. Contribution of EGFR and ErbB-3 Heterodimerization to the EGFR Mutation-Induced Gefitinib- and Erlotinib-Resistance in Non-Small-Cell Lung Carcinoma Treatments.

    Directory of Open Access Journals (Sweden)

    Debby D Wang

    Full Text Available EGFR mutation-induced drug resistance has become a major threat to the treatment of non-small-cell lung carcinoma. Essentially, the resistance mechanism involves modifications of the intracellular signaling pathways. In our work, we separately investigated the EGFR and ErbB-3 heterodimerization, regarded as the origin of intracellular signaling pathways. On one hand, we combined the molecular interaction in EGFR heterodimerization with that between the EGFR tyrosine kinase and its inhibitor. For 168 clinical subjects, we characterized their corresponding EGFR mutations using molecular interactions, with three potential dimerization partners (ErbB-2, IGF-1R and c-Met of EGFR and two of its small molecule inhibitors (gefitinib and erlotinib. Based on molecular dynamics simulations and structural analysis, we modeled these mutant-partner or mutant-inhibitor interactions using binding free energy and its components. As a consequence, the mutant-partner interactions are amplified for mutants L858R and L858R_T790M, compared to the wild type EGFR. Mutant delL747_P753insS represents the largest difference between the mutant-IGF-1R interaction and the mutant-inhibitor interaction, which explains the shorter progression-free survival of an inhibitor to this mutant type. Besides, feature sets including different energy components were constructed, and efficient regression trees were applied to map these features to the progression-free survival of an inhibitor. On the other hand, we comparably examined the interactions between ErbB-3 and its partners (EGFR mutants, IGF-1R, ErbB-2 and c-Met. Compared to others, c-Met shows a remarkably-strong binding with ErbB-3, implying its significant role in regulating ErbB-3 signaling. Moreover, EGFR mutants corresponding to poor clinical outcomes, such as L858R_T790M, possess lower binding affinities with ErbB-3 than c-Met does. This may promote the communication between ErbB-3 and c-Met in these cancer cells. The

  11. Cdk2-Null Mice Are Resistant to ErbB-2-Induced Mammary Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Dipankar Ray

    2011-05-01

    Full Text Available The concept of targeting G1 cyclin-dependent kinases (CDKs in breast cancer treatments is supported by the fact that the genetic ablation of Cdk4 had minimal impacts on normal cell proliferation in majority of cell types, resulting in near-normal mouse development, whereas such loss of Cdk4 completely abrogated ErbB-2/neu-induced mammary tumorigenesis in mice. In most human breast cancer tissues, another G1-regulatory CDK, CDK2, is also hyperactivated by various mechanisms and is believed to be an important therapeutic target. In this report, we provide genetic evidence that CDK2 is essential for proliferation and oncogenesis of murine mammary epithelial cells. We observed that 87% of Cdk2-null mice were protected from ErbB-2-induced mammary tumorigenesis. Mouse embryonic fibroblasts isolated from Cdk2-null mouse showed resistance to various oncogene-induced transformation. Previously, we have reported that hemizygous loss of Cdc25A, the major activator of CDK2, can also protect mice from ErbB-2-induced mammary tumorigenesis [Cancer Res (2007 67(14: 6605–11]. Thus, we propose that CDC25A-CDK2 pathway is critical for the oncogenic action of ErbB-2 in mammary epithelial cells, in a manner similar to Cyclin D1/CDK4 pathway.

  12. Update on HER-2 as a target for cancer therapy: The ERBB2 promoter and its exploitation for cancer treatment

    International Nuclear Information System (INIS)

    Hurst, Helen C

    2001-01-01

    Overexpression of the ERBB2 proto-oncogene is associated with amplification of the gene in breast cancer but increased activity of the promoter also plays a significant role. Members of two transcription factor families (AP-2 and Ets) show increased binding to the promoter in over-expressing cells. Consequently, strategies have been devised to target promoter activity, either through the DNA binding sites for these factors, or through another promoter sequence, a polypurine-polypyrimidine repeat structure. The promoter has also been exploited for its tumour-specific activity to direct the accumulation of cytotoxic compounds selectively within cancer cells. Our current understanding of the ERBB2 promoter is reviewed and the status of these therapeutic avenues is discussed

  13. Self-renewal of human embryonic stem cells requires insulin-like growth factor-1 receptor and ERBB2 receptor signaling

    Science.gov (United States)

    Wang, Linlin; Schulz, Thomas C.; Sherrer, Eric S.; Dauphin, Derek S.; Shin, Soojung; Nelson, Angelique M.; Ware, Carol B.; Zhan, Mei; Song, Chao-Zhong; Chen, Xiaoji; Brimble, Sandii N.; McLean, Amanda; Galeano, Maria J.; Uhl, Elizabeth W.; D'Amour, Kevin A.; Chesnut, Jonathan D.; Rao, Mahendra S.

    2007-01-01

    Despite progress in developing defined conditions for human embryonic stem cell (hESC) cultures, little is known about the cell-surface receptors that are activated under conditions supportive of hESC self-renewal. A simultaneous interrogation of 42 receptor tyrosine kinases (RTKs) in hESCs following stimulation with mouse embryonic fibroblast (MEF) conditioned medium (CM) revealed rapid and prominent tyrosine phosphorylation of insulin receptor (IR) and insulin-like growth factor-1 receptor (IGF1R); less prominent tyrosine phosphorylation of epidermal growth factor receptor (EGFR) family members, including ERBB2 and ERBB3; and trace phosphorylation of fibroblast growth factor receptors. Intense IGF1R and IR phosphorylation occurred in the absence of MEF conditioning (NCM) and was attributable to high concentrations of insulin in the proprietary KnockOut Serum Replacer (KSR). Inhibition of IGF1R using a blocking antibody or lentivirus-delivered shRNA reduced hESC self-renewal and promoted differentiation, while disruption of ERBB2 signaling with the selective inhibitor AG825 severely inhibited hESC proliferation and promoted apoptosis. A simple defined medium containing an IGF1 analog, heregulin-1β (a ligand for ERBB2/ERBB3), fibroblast growth factor-2 (FGF2), and activin A supported long-term growth of multiple hESC lines. These studies identify previously unappreciated RTKs that support hESC proliferation and self-renewal, and provide a rationally designed medium for the growth and maintenance of pluripotent hESCs. PMID:17761519

  14. Small Molecule Tyrosine Kinase Inhibitors of ErbB2/HER2/Neu in the Treatment of Aggressive Breast Cancer

    Directory of Open Access Journals (Sweden)

    Richard L. Schroeder

    2014-09-01

    Full Text Available The human epidermal growth factor receptor 2 (HER2 is a member of the erbB class of tyrosine kinase receptors. These proteins are normally expressed at the surface of healthy cells and play critical roles in the signal transduction cascade in a myriad of biochemical pathways responsible for cell growth and differentiation. However, it is widely known that amplification and subsequent overexpression of the HER2 encoding oncogene results in unregulated cell proliferation in an aggressive form of breast cancer known as HER2-positive breast cancer. Existing therapies such as trastuzumab (Herceptin® and lapatinib (Tyverb/Tykerb®, a monoclonal antibody inhibitor and a dual EGFR/HER2 kinase inhibitor, respectively, are currently used in the treatment of HER2-positive cancers, although issues with high recurrence and acquired resistance still remain. Small molecule tyrosine kinase inhibitors provide attractive therapeutic targets, as they are able to block cell signaling associated with many of the proposed mechanisms for HER2 resistance. In this regard we aim to present a review on the available HER2 tyrosine kinase inhibitors, as well as those currently in development. The use of tyrosine kinase inhibitors as sequential or combinatorial therapeutic strategies with other HER family inhibitors is also discussed.

  15. Breast cancer metastasis driven by ErbB2 and 14-3-3ξ: A division of labor

    OpenAIRE

    Wang, Yingqun

    2010-01-01

    Metastasis remains the leading cause of cancer morbidity and mortality. ErbB2, a metastasis-promoting oncoprotein, is overexpressed in 50–60% of noninvasive ductal carcinoma in situ (DCIS). However, only 25% of invasive breast cancer (IBC) overexpress ErbB2, indicating that ErbB2 alone is not sufficient to drive metastasis and additional risk factors are necessary for the progression of ErbB2-overexpressing DCIS to IBC. A recent study published in Cancer Cell identified 14-3-3ξ as a risk fact...

  16. OCAM regulates embryonic spinal cord stem cell proliferation by modulating ErbB2 receptor.

    Directory of Open Access Journals (Sweden)

    Loïc Deleyrolle

    Full Text Available The proliferation and differentiation of neural stem cells are tightly controlled by intrinsic and extrinsic cues. Cell adhesion molecules are increasingly recognized as regulators of these processes. Here we report the expression of the olfactory cell adhesion molecule (OCAM/NCAM2/RNCAM during mouse spinal cord development and in neural stem cells cultured as neurospheres. OCAM is also weakly expressed in the dormant adult stem cell niche around the central canal and is overexpressed after spinal cord injury. Both transmembrane (TM and glycosylphosphatidylinositol (GPI-linked isoforms are present in neurospheres. Electron microscopy and internalisation experiments revealed a dynamic trafficking of OCAM between the membrane and intracellular compartments. After differentiation, OCAM remains in neurons and oligodendrocytes whereas no expression is detected in astrocytes. Using OCAM knockout (KO mice, we found that mutant spinal cord stem cells showed an increased proliferation and self-renewal rates although no effect on differentiation was observed. This effect was reversed by lentivirus-mediated re-introduction of OCAM. Mechanistically, we identified the ErbB2/Neu/HER2 protein as being implicated in the enhanced proliferation of mutant cells. ErbB2 protein expression and phosphorylation level were significantly increased in KO cells whereas no difference was observed at the mRNA level. Overexpression of ErbB2 in wild-type and mutant cells also increased their growth while reintroduction of OCAM in mutant cells reduced the level of phosphorylated ErbB2. These results indicate that OCAM exerts a posttranscriptional control on the ErbB2 signalling in spinal cord stem cells. This study adds further support for considering cell adhesion molecules as regulators of the ErbB signalling.

  17. Clinical relevance of ErbB-2/HER2 nuclear expression in breast cancer

    International Nuclear Information System (INIS)

    Schillaci, Roxana; Charreau, Eduardo H; Maronna, Esteban; Roa, Juan C; Elizalde, Patricia V; Guzmán, Pablo; Cayrol, Florencia; Beguelin, Wendy; Díaz Flaqué, María C; Proietti, Cecilia J; Pineda, Viviana; Palazzi, Jorge; Frahm, Isabel

    2012-01-01

    The biological relevance of nuclear ErbB-2/HER2 (NuclErbB-2) presence in breast tumors remains unexplored. In this study we assessed the clinical significance of ErbB-2 nuclear localization in primary invasive breast cancer. The reporting recommendations for tumor marker prognostic studies (REMARK) guidelines were used as reference. Tissue microarrays from a cohort of 273 primary invasive breast carcinomas from women living in Chile, a Latin American country, were examined for membrane (MembErbB-2) and NuclErbB-2 expression by an immunofluorescence (IF) protocol we developed. ErbB-2 expression was also evaluated by immunohistochemistry (IHC) with a series of antibodies. Correlation between NuclErbB-2 and MembErbB-2, and between NuclErbB-2 and clinicopathological characteristics of tumors was studied. The prognostic value of NuclErbB-2 in overall survival (OS) was evaluated using Kaplan-Meier method, and Cox model was used to explore NuclErbB-2 as independent prognostic factor for OS. The IF protocol we developed showed significantly higher sensitivity for detection of NuclErbB-2 than IHC procedures, while its specificity and sensitivity to detect MembErbB-2 were comparable to those of IHC procedures. We found 33.6% NuclErbB-2 positivity, 14.2% MembErbB-2 overexpression by IF, and 13.0% MembErbB-2 prevalence by IHC in our cohort. We identified NuclErbB-2 positivity as a significant independent predictor of worse OS in patients with MembErbB-2 overexpression. NuclErbB-2 was also a biomarker of lower OS in tumors that overexpress MembErbB-2 and lack steroid hormone receptors. We revealed a novel role for NuclErbB-2 as an independent prognostic factor of poor clinical outcome in MembErbB-2-positive breast tumors. Our work indicates that patients presenting NuclErbB-2 may need new therapeutic strategies involving specific blockage of ErbB-2 nuclear migration

  18. Clinical relevance of ErbB-2/HER2 nuclear expression in breast cancer

    Directory of Open Access Journals (Sweden)

    Schillaci Roxana

    2012-02-01

    Full Text Available Abstract Background The biological relevance of nuclear ErbB-2/HER2 (NuclErbB-2 presence in breast tumors remains unexplored. In this study we assessed the clinical significance of ErbB-2 nuclear localization in primary invasive breast cancer. The reporting recommendations for tumor marker prognostic studies (REMARK guidelines were used as reference. Methods Tissue microarrays from a cohort of 273 primary invasive breast carcinomas from women living in Chile, a Latin American country, were examined for membrane (MembErbB-2 and NuclErbB-2 expression by an immunofluorescence (IF protocol we developed. ErbB-2 expression was also evaluated by immunohistochemistry (IHC with a series of antibodies. Correlation between NuclErbB-2 and MembErbB-2, and between NuclErbB-2 and clinicopathological characteristics of tumors was studied. The prognostic value of NuclErbB-2 in overall survival (OS was evaluated using Kaplan-Meier method, and Cox model was used to explore NuclErbB-2 as independent prognostic factor for OS. Results The IF protocol we developed showed significantly higher sensitivity for detection of NuclErbB-2 than IHC procedures, while its specificity and sensitivity to detect MembErbB-2 were comparable to those of IHC procedures. We found 33.6% NuclErbB-2 positivity, 14.2% MembErbB-2 overexpression by IF, and 13.0% MembErbB-2 prevalence by IHC in our cohort. We identified NuclErbB-2 positivity as a significant independent predictor of worse OS in patients with MembErbB-2 overexpression. NuclErbB-2 was also a biomarker of lower OS in tumors that overexpress MembErbB-2 and lack steroid hormone receptors. Conclusions We revealed a novel role for NuclErbB-2 as an independent prognostic factor of poor clinical outcome in MembErbB-2-positive breast tumors. Our work indicates that patients presenting NuclErbB-2 may need new therapeutic strategies involving specific blockage of ErbB-2 nuclear migration.

  19. Ibrutinib Inhibits ERBB Receptor Tyrosine Kinases and HER2-Amplified Breast Cancer Cell Growth.

    Science.gov (United States)

    Chen, Jun; Kinoshita, Taisei; Sukbuntherng, Juthamas; Chang, Betty Y; Elias, Laurence

    2016-12-01

    Ibrutinib is a potent, small-molecule Bruton tyrosine kinase (BTK) inhibitor developed for the treatment of B-cell malignancies. Ibrutinib covalently binds to Cys481 in the ATP-binding domain of BTK. This cysteine residue is conserved among 9 other tyrosine kinases, including HER2 and EGFR, which can be targeted. Screening large panels of cell lines demonstrated that ibrutinib was growth inhibitory against some solid tumor cells, including those inhibited by other HER2/EGFR inhibitors. Among sensitive cell lines, breast cancer lines with HER2 overexpression were most potently inhibited by ibrutinib (ibrutinib coincided with downregulation of phosphorylation on HER2 and EGFR and their downstream targets, AKT and ERK. Irreversible inhibition of HER2 and EGFR in breast cancer cells was established after 30-minute incubation above 100 nmol/L or following 2-hour incubation at lower concentrations. Furthermore, ibrutinib inhibited recombinant HER2 and EGFR activity that was resistant to dialysis and rapid dilution, suggesting an irreversible interaction. The dual activity toward TEC family (BTK and ITK) and ERBB family kinases was unique to ibrutinib, as ERBB inhibitors do not inhibit or covalently bind BTK or ITK. Xenograft studies with HER2 + MDA-MB-453 and BT-474 cells in mice in conjunction with determination of pharmacokinetics demonstrated significant exposure-dependent inhibition of growth and key signaling molecules at levels that are clinically achievable. Ibrutinib's unique dual spectrum of activity against both TEC family and ERBB kinases suggests broader applications of ibrutinib in oncology. Mol Cancer Ther; 15(12); 2835-44. ©2016 AACR. ©2016 American Association for Cancer Research.

  20. Transcriptional profiling of ErbB signalling in mammary luminal epithelial cells - interplay of ErbB and IGF1 signalling through IGFBP3 regulation

    International Nuclear Information System (INIS)

    Worthington, Jenny; Bertani, Mariana; Chan, Hong-Lin; Gerrits, Bertran; Timms, John F

    2010-01-01

    Members of the ErbB family of growth factor receptors are intricately linked with epithelial cell biology, development and tumourigenesis; however, the mechanisms involved in their downstream signalling are poorly understood. Indeed, it is unclear how signal specificity is achieved and the relative contribution each receptor has to specific gene expression. Gene expression profiling of a human mammary luminal epithelial cell model of ErbB2-overexpression was carried out using cDNA microarrays with a common RNA reference approach to examine long-term overlapping and differential responses to EGF and heregulin beta1 treatment in the context of ErbB2 overexpression. Altered gene expression was validated using quantitative real time PCR and/or immunoblotting. One gene of interest was targeted for further characterisation, where the effects of siRNA-mediated silencing on IGF1-dependent signalling and cellular phenotype were examined and compared to the effects of loss of ErbB2 expression. 775 genes were differentially expressed and clustered in terms of their growth factor responsiveness. As well as identifying uncharacterized genes as novel targets of ErbB2-dependent signalling, ErbB2 overexpression augmented the induction of multiple genes involved in proliferation (e.g. MYC, MAP2K1, MAP2K3), autocrine growth factor signalling (VEGF, PDGF) and adhesion/cytoskeletal regulation (ZYX, THBS1, VCL, CNN3, ITGA2, ITGA3, NEDD9, TAGLN), linking them to the hyper-poliferative and altered adhesive phenotype of the ErbB2-overexpressing cells. We also report ErbB2-dependent down-regulation of multiple interferon-stimulated genes that may permit ErbB2-overexpressing cells to resist the anti-proliferative action of interferons. Finally, IGFBP3 was unique in its pattern of regulation and we further investigated a possible role for IGFBP3 down-regulation in ErbB2-dependent transformation through suppressed IGF1 signalling. We show that IGF1-dependent signalling and proliferation were

  1. ErbB2 Pathway Activation upon Smad4 Loss Promotes Lung Tumor Growth and Metastasis

    Directory of Open Access Journals (Sweden)

    Jian Liu

    2015-03-01

    Full Text Available Lung cancer remains the leading cause of cancer death. Genome sequencing of lung tumors from patients with squamous cell carcinoma has identified SMAD4 to be frequently mutated. Here, we use a mouse model to determine the molecular mechanisms by which Smad4 loss leads to lung cancer progression. Mice with ablation of Pten and Smad4 in airway epithelium develop metastatic adenosquamous tumors. Comparative transcriptomic and in vivo cistromic analyses determine that loss of PTEN and SMAD4 results in ELF3 and ErbB2 pathway activation due to decreased expression of ERRFI1, a negative regulator of ERBB2 in mouse and human cells. The combinatorial inhibition of ErbB2 and Akt signaling attenuate tumor progression and cell invasion, respectively. Expression profile analysis of human lung tumors substantiated the importance of the ErbB2/Akt/ELF3 signaling pathway as both a prognostic biomarker and a therapeutic drug target for treating lung cancer.

  2. Development of an ErbB4 monoclonal antibody that blocks neuregulin-1-induced ErbB4 activation in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Okazaki, Shogo [Division of Gene Regulation, Institute for Advanced Medical Research, School of Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582 (Japan); Nakatani, Fumi [Cell Biology Laboratory, Department of Pharmaceutical Sciences, Faculty of Pharmacy, Kinki University, Higashiosaka, Osaka 577-8502 Japan (Japan); Masuko, Kazue; Tsuchihashi, Kenji [Division of Gene Regulation, Institute for Advanced Medical Research, School of Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582 (Japan); Ueda, Shiho; Masuko, Takashi [Cell Biology Laboratory, Department of Pharmaceutical Sciences, Faculty of Pharmacy, Kinki University, Higashiosaka, Osaka 577-8502 Japan (Japan); Saya, Hideyuki [Division of Gene Regulation, Institute for Advanced Medical Research, School of Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582 (Japan); Nagano, Osamu, E-mail: osmna@sb3.so-net.ne.jp [Division of Gene Regulation, Institute for Advanced Medical Research, School of Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582 (Japan)

    2016-01-29

    The use of monoclonal antibodies (mAbs) for cancer therapy is one of the most important strategies for current cancer treatment. The epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases, which regulates cancer cell proliferation, survival, and migration, is a major molecular target for antibody-based therapy. ErbB4/HER4, which contains a ligand-binding extracellular region, is activated by several ligands, including neuregulins (NRGs), heparin-binding EGF-like growth factor, betacellulin and epiregulin. Although there are clinically approved antibodies for ErbB1 and ErbB2, there are no available therapeutic mAbs for ErbB4, and it is not known whether ErbB4 is a useful target for antibody-based cancer therapy. In this study, we developed an anti-ErbB4 mAb (clone P6-1) that suppresses NRG-dependent activation of ErbB4 and examined its effect on breast cancer cell proliferation in the extracellular matrix. - Highlights: • We newly generated four clones of human ErbB4 specific mAb. • ErbB4 mAb clone P6-1 blocks ErbB4 phosphorylation induced by NRG-1. • ErbB4 mAb clone P6-1 suppresses NRG-1-promoted breast cancer cells proliferation on three dimensional culture condition.

  3. Development of an ErbB4 monoclonal antibody that blocks neuregulin-1-induced ErbB4 activation in cancer cells

    International Nuclear Information System (INIS)

    Okazaki, Shogo; Nakatani, Fumi; Masuko, Kazue; Tsuchihashi, Kenji; Ueda, Shiho; Masuko, Takashi; Saya, Hideyuki; Nagano, Osamu

    2016-01-01

    The use of monoclonal antibodies (mAbs) for cancer therapy is one of the most important strategies for current cancer treatment. The epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases, which regulates cancer cell proliferation, survival, and migration, is a major molecular target for antibody-based therapy. ErbB4/HER4, which contains a ligand-binding extracellular region, is activated by several ligands, including neuregulins (NRGs), heparin-binding EGF-like growth factor, betacellulin and epiregulin. Although there are clinically approved antibodies for ErbB1 and ErbB2, there are no available therapeutic mAbs for ErbB4, and it is not known whether ErbB4 is a useful target for antibody-based cancer therapy. In this study, we developed an anti-ErbB4 mAb (clone P6-1) that suppresses NRG-dependent activation of ErbB4 and examined its effect on breast cancer cell proliferation in the extracellular matrix. - Highlights: • We newly generated four clones of human ErbB4 specific mAb. • ErbB4 mAb clone P6-1 blocks ErbB4 phosphorylation induced by NRG-1. • ErbB4 mAb clone P6-1 suppresses NRG-1-promoted breast cancer cells proliferation on three dimensional culture condition.

  4. [Bacterial synthesis, purification, and solubilization of transmembrane segments of ErbB family members].

    Science.gov (United States)

    Goncharuk, M V; Shul'ga, A A; Ermoliuk, Ia S; Tkach, E N; Goncharuk, S A; Pustovalova, Iu E; Mineev, K S; Bocharov, É V; Maslennikov, I V; Arsen'ev, A S; Kirpichnikov, M P

    2011-01-01

    A family of epidermal growth factor receptors, ErbB, represents an important class of receptor tyrosine kinases, playing a leading role in cellular growth, development and differentiation. Transmembrane domains of these receptors transduce biochemical signals across plasma membrane via lateral homo- and heterodimerization. Relatively small size of complexes of ErbB transmembrane domains with detergents or lipids allows one to study their detailed spatial structure using three-dimensional heteronuclear high-resolution NMR spectroscopy. Here, we describe the effective expression system and purification procedure for preparative-scale production of transmembrane peptides from four representatives of ErbB family, ErbB1, ErbB2, ErbB3, ErbB4, for structural studies. The recombinant peptides were produced in Escherichia coli BL21(DE3)pLysS as C-terminal extensions of thioredoxin A. The fusion protein cleavage was accomplished with the light subunit of human enterokinase. Several (10-30) milligrams of purified isotope-labeled transmembrane peptides were isolated with the use of a simple and convenient procedure, which consists of consecutive steps of immobilized metal affinity chromatography and cation-exchange chromatography. The purified peptides were reconstituted in lipid/detergent environment (micelles or bicelles) and characterized using dynamic light scattering, CD and NMR spectroscopy. The data obtained indicate that the purified ErbB transmembrane peptides are suitable for structural and dynamic studies of their homo- and heterodimer complexes using high resolution NMR spectroscopy.

  5. Endocytic down-regulation of ErbB2 is stimulated by cleavage of its C-terminus

    DEFF Research Database (Denmark)

    Lerdrup, Mads; Bruun, Silas; Grandal, Michael Vibo

    2007-01-01

    inhibition of HSP90 with geldanamycin this cleavage is accompanied by proteasome-dependent endocytosis of ErbB2. However, it is unknown whether C-terminal cleavage is linked to endocytosis. To study ErbB2 cleavage and endocytic trafficking, we fused yellow fluorescent protein (YFP) and cyan fluorescent...

  6. Pertuzumab Increases 17-AAG-Induced Degradation of ErbB2, and This Effect Is Further Increased by Combining Pertuzumab with Trastuzumab

    Science.gov (United States)

    Hughes, Juliana Bentes; Rødland, Marianne Skeie; Hasmann, Max; Madshus, Inger Helene; Stang, Espen

    2012-01-01

    ErbB2 is an important oncogenic protein involved in carcinogenesis of, among others, breast, gastric, and ovarian carcinoma. Over-expression of ErbB2 is found in almost 20% of breast cancers, and this results in proliferative and anti-apoptotic signalling. ErbB2 is therefore an important treatment target. Antibodies recognizing full-length ErbB2 are clinically established, and drugs targeting the ErbB2 stabilizing heat shock protein 90 (Hsp90) are under clinical evaluation. We have investigated effects of the ErbB2-binding antibodies trastuzumab and pertuzumab alone and in combination, as well as the effect of the antibodies in combination with the Hsp90 inhibitor 17-AAG. Our results confirm the notion that combination of different ErbB2-binding antibodies more efficiently down-regulates ErbB2 than does one antibody in isolation. Additionally, our data demonstrate that ErbB2 is most efficiently down-regulated upon incubation with anti-ErbB2 antibodies in combination with Hsp90 inhibitors. The combination of anti-ErbB2 antibodies, and especially the combination of antibodies with 17-AAG, did also increase the inhibition of Akt activation of either agent, which could suggest an anti-proliferative effect. In such case, combining these agents could be beneficial in treatment of tumors not responding to trastuzumab only. PMID:24281706

  7. Pertuzumab Increases 17-AAG-Induced Degradation of ErbB2, and This Effect Is Further Increased by Combining Pertuzumab with Trastuzumab

    Directory of Open Access Journals (Sweden)

    Juliana Bentes Hughes

    2012-06-01

    Full Text Available ErbB2 is an important oncogenic protein involved in carcinogenesis of, among others, breast, gastric, and ovarian carcinoma. Over-expression of ErbB2 is found in almost 20% of breast cancers, and this results in proliferative and anti-apoptotic signalling. ErbB2 is therefore an important treatment target. Antibodies recognizing full-length ErbB2 are clinically established, and drugs targeting the ErbB2 stabilizing heat shock protein 90 (Hsp90 are under clinical evaluation. We have investigated effects of the ErbB2-binding antibodies trastuzumab and pertuzumab alone and in combination, as well as the effect of the antibodies in combination with the Hsp90 inhibitor 17-AAG. Our results confirm the notion that combination of different ErbB2-binding antibodies more efficiently down-regulates ErbB2 than does one antibody in isolation. Additionally, our data demonstrate that ErbB2 is most efficiently down-regulated upon incubation with anti-ErbB2 antibodies in combination with Hsp90 inhibitors. The combination of anti-ErbB2 antibodies, and especially the combination of antibodies with 17-AAG, did also increase the inhibition of Akt activation of either agent, which could suggest an anti-proliferative effect. In such case, combining these agents could be beneficial in treatment of tumors not responding to trastuzumab only.

  8. Negative transcriptional control of ERBB2 gene by MBP-1 and HDAC1: diagnostic implications in breast cancer

    International Nuclear Information System (INIS)

    Contino, Flavia; Mazzarella, Claudia; Ferro, Arianna; Lo Presti, Mariavera; Roz, Elena; Lupo, Carmelo; Perconti, Giovanni; Giallongo, Agata; Feo, Salvatore

    2013-01-01

    The human ERBB2 gene is frequently amplified in breast tumors, and its high expression is associated with poor prognosis. We previously reported a significant inverse correlation between Myc promoter-binding protein-1 (MBP-1) and ERBB2 expression in primary breast invasive ductal carcinoma (IDC). MBP-1 is a transcriptional repressor of the c-MYC gene that acts by binding to the P2 promoter; only one other direct target of MBP-1, the COX2 gene, has been identified so far. To gain new insights into the functional relationship linking MBP-1 and ERBB2 in breast cancer, we have investigated the effects of MBP-1 expression on endogenous ERBB2 transcript and protein levels, as well as on transcription promoter activity, by transient-transfection of SKBr3 cells. Reporter gene and chromatin immunoprecipitation assays were used to dissect the ERBB2 promoter and identify functional MBP-1 target sequences. We also investigated the relative expression of MBP-1 and HDAC1 in IDC and normal breast tissues by immunoblot analysis and immunohistochemistry. Transfection experiments and chromatin immunoprecipitation assays in SKBr3 cells indicated that MBP-1 negatively regulates the ERBB2 gene by binding to a genomic region between nucleotide −514 and −262 of the proximal promoter; consistent with this, a concomitant recruitment of HDAC1 and loss of acetylated histone H4 was observed. In addition, we found high expression of MBP-1 and HDAC1 in normal tissues and a statistically significant inverse correlation with ErbB2 expression in the paired tumor samples. Altogether, our in vitro and in vivo data indicate that the ERBB2 gene is a novel MBP-1 target, and immunohistochemistry analysis of primary tumors suggests that the concomitant high expression of MBP-1 and HDAC1 may be considered a diagnostic marker of cancer progression for breast IDC

  9. Comprehensive Binary Interaction Mapping of SH2 Domains via Fluorescence Polarization Reveals Novel Functional Diversification of ErbB Receptors

    Science.gov (United States)

    Ciaccio, Mark F.; Chuu, Chih-pin; Jones, Richard B.

    2012-01-01

    First-generation interaction maps of Src homology 2 (SH2) domains with receptor tyrosine kinase (RTK) phosphosites have previously been generated using protein microarray (PM) technologies. Here, we developed a large-scale fluorescence polarization (FP) methodology that was able to characterize interactions between SH2 domains and ErbB receptor phosphosites with higher fidelity and sensitivity than was previously achieved with PMs. We used the FP assay to query the interaction of synthetic phosphopeptides corresponding to 89 ErbB receptor intracellular tyrosine sites against 93 human SH2 domains and 2 phosphotyrosine binding (PTB) domains. From 358,944 polarization measurements, the affinities for 1,405 unique biological interactions were determined, 83% of which are novel. In contrast to data from previous reports, our analyses suggested that ErbB2 was not more promiscuous than the other ErbB receptors. Our results showed that each receptor displays unique preferences in the affinity and location of recruited SH2 domains that may contribute to differences in downstream signaling potential. ErbB1 was enriched versus the other receptors for recruitment of domains from RAS GEFs whereas ErbB2 was enriched for recruitment of domains from tyrosine and phosphatidyl inositol phosphatases. ErbB3, the kinase inactive ErbB receptor family member, was predictably enriched for recruitment of domains from phosphatidyl inositol kinases and surprisingly, was enriched for recruitment of domains from tyrosine kinases, cytoskeletal regulatory proteins, and RHO GEFs but depleted for recruitment of domains from phosphatidyl inositol phosphatases. Many novel interactions were also observed with phosphopeptides corresponding to ErbB receptor tyrosines not previously reported to be phosphorylated by mass spectrometry, suggesting the existence of many biologically relevant RTK sites that may be phosphorylated but below the detection threshold of standard mass spectrometry procedures. This

  10. Comprehensive binary interaction mapping of SH2 domains via fluorescence polarization reveals novel functional diversification of ErbB receptors.

    Directory of Open Access Journals (Sweden)

    Ronald J Hause

    Full Text Available First-generation interaction maps of Src homology 2 (SH2 domains with receptor tyrosine kinase (RTK phosphosites have previously been generated using protein microarray (PM technologies. Here, we developed a large-scale fluorescence polarization (FP methodology that was able to characterize interactions between SH2 domains and ErbB receptor phosphosites with higher fidelity and sensitivity than was previously achieved with PMs. We used the FP assay to query the interaction of synthetic phosphopeptides corresponding to 89 ErbB receptor intracellular tyrosine sites against 93 human SH2 domains and 2 phosphotyrosine binding (PTB domains. From 358,944 polarization measurements, the affinities for 1,405 unique biological interactions were determined, 83% of which are novel. In contrast to data from previous reports, our analyses suggested that ErbB2 was not more promiscuous than the other ErbB receptors. Our results showed that each receptor displays unique preferences in the affinity and location of recruited SH2 domains that may contribute to differences in downstream signaling potential. ErbB1 was enriched versus the other receptors for recruitment of domains from RAS GEFs whereas ErbB2 was enriched for recruitment of domains from tyrosine and phosphatidyl inositol phosphatases. ErbB3, the kinase inactive ErbB receptor family member, was predictably enriched for recruitment of domains from phosphatidyl inositol kinases and surprisingly, was enriched for recruitment of domains from tyrosine kinases, cytoskeletal regulatory proteins, and RHO GEFs but depleted for recruitment of domains from phosphatidyl inositol phosphatases. Many novel interactions were also observed with phosphopeptides corresponding to ErbB receptor tyrosines not previously reported to be phosphorylated by mass spectrometry, suggesting the existence of many biologically relevant RTK sites that may be phosphorylated but below the detection threshold of standard mass spectrometry

  11. Ligand stimulation of ErbB4 and a constitutively-active ErbB4 mutant result in different biological responses in human pancreatic tumor cell lines

    International Nuclear Information System (INIS)

    Mill, Christopher P.; Gettinger, Kathleen L.; Riese, David J.

    2011-01-01

    Pancreatic cancer is the fourth leading cause of cancer death in the United States. Indeed, it has been estimated that 37,000 Americans will die from this disease in 2010. Late diagnosis, chemoresistance, and radioresistance of these tumors are major reasons for poor patient outcome, spurring the search for pancreatic cancer early diagnostic and therapeutic targets. ErbB4 (HER4) is a member of the ErbB family of receptor tyrosine kinases (RTKs), a family that also includes the Epidermal Growth Factor Receptor (EGFR/ErbB1/HER1), Neu/ErbB2/HER2, and ErbB3/HER3. These RTKs play central roles in many human malignancies by regulating cell proliferation, survival, differentiation, invasiveness, motility, and apoptosis. In this report we demonstrate that human pancreatic tumor cell lines exhibit minimal ErbB4 expression; in contrast, these cell lines exhibit varied and in some cases abundant expression and basal tyrosine phosphorylation of EGFR, ErbB2, and ErbB3. Expression of a constitutively-dimerized and -active ErbB4 mutant inhibits clonogenic proliferation of CaPan-1, HPAC, MIA PaCa-2, and PANC-1 pancreatic tumor cell lines. In contrast, expression of wild-type ErbB4 in pancreatic tumor cell lines potentiates stimulation of anchorage-independent colony formation by the ErbB4 ligand Neuregulin 1β. These results illustrate the multiple roles that ErbB4 may be playing in pancreatic tumorigenesis and tumor progression.

  12. ErbB2 Pathway Activation upon Smad4 Loss Promotes Lung Tumor Growth and Metastasis.

    Science.gov (United States)

    Liu, Jian; Cho, Sung-Nam; Akkanti, Bindu; Jin, Nili; Mao, Jianqiang; Long, Weiwen; Chen, Tenghui; Zhang, Yiqun; Tang, Ximing; Wistub, Ignacio I; Creighton, Chad J; Kheradmand, Farrah; DeMayo, Francesco J

    2015-03-03

    Lung cancer remains the leading cause of cancer death. Genome sequencing of lung tumors from patients with squamous cell carcinoma has identified SMAD4 to be frequently mutated. Here, we use a mouse model to determine the molecular mechanisms by which Smad4 loss leads to lung cancer progression. Mice with ablation of Pten and Smad4 in airway epithelium develop metastatic adenosquamous tumors. Comparative transcriptomic and in vivo cistromic analyses determine that loss of PTEN and SMAD4 results in ELF3 and ErbB2 pathway activation due to decreased expression of ERRFI1, a negative regulator of ERBB2 in mouse and human cells. The combinatorial inhibition of ErbB2 and Akt signaling attenuate tumor progression and cell invasion, respectively. Expression profile analysis of human lung tumors substantiated the importance of the ErbB2/Akt/ELF3 signaling pathway as both a prognostic biomarker and a therapeutic drug target for treating lung cancer. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Cell cycle synchronization and BrdU incorporation as a tool to study the possible selective elimination of ErbB1 gene in the micronuclei in A549 cells

    International Nuclear Information System (INIS)

    Lauand, C.; Niero, E.L.; Dias, V.M.; Machado-Santelli, G.M.

    2015-01-01

    Lung cancer often exhibits molecular changes, such as the overexpression of the ErbB1 gene that encodes epidermal growth factor receptor (EGFR). ErbB1 amplification and mutation are associated with tumor aggressiveness and low response to therapy. The aim of the present study was to design a schedule to synchronize the cell cycle of A549 cell line (a non-small cell lung cancer) and to analyze the possible association between the micronuclei (MNs) and the extrusion of ErbB1 gene extra-copies. After double blocking, by the process of fetal bovine serum deprivation and vincristine treatment, MNs formation was monitored with 5-bromo-2-deoxyuridine (BrdU) incorporation, which is an S-phase marker. Statistical analyses allowed us to infer that MNs may arise both in mitosis as well as in interphase. The MNs were able to replicate their DNA and this process seemed to be non-synchronous with the main cell nuclei. The presence of ErbB1 gene in the MNs was evaluated by fluorescent in situ hybridization (FISH). ErbB1 sequences were detected in the MNs, but a relation between the MNs formation and extrusion of amplified ErbB1could not be established. The present study sought to elucidate the meaning of MNs formation and its association with the elimination of oncogenes or other amplified sequences from the tumor cells

  14. Cell cycle synchronization and BrdU incorporation as a tool to study the possible selective elimination of ErbB1 gene in the micronuclei in A549 cells

    Energy Technology Data Exchange (ETDEWEB)

    Lauand, C.; Niero, E.L.; Dias, V.M.; Machado-Santelli, G.M. [Departamento de Biologia Celular e do Desenvolvimento, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, SP (Brazil)

    2015-03-06

    Lung cancer often exhibits molecular changes, such as the overexpression of the ErbB1 gene that encodes epidermal growth factor receptor (EGFR). ErbB1 amplification and mutation are associated with tumor aggressiveness and low response to therapy. The aim of the present study was to design a schedule to synchronize the cell cycle of A549 cell line (a non-small cell lung cancer) and to analyze the possible association between the micronuclei (MNs) and the extrusion of ErbB1 gene extra-copies. After double blocking, by the process of fetal bovine serum deprivation and vincristine treatment, MNs formation was monitored with 5-bromo-2-deoxyuridine (BrdU) incorporation, which is an S-phase marker. Statistical analyses allowed us to infer that MNs may arise both in mitosis as well as in interphase. The MNs were able to replicate their DNA and this process seemed to be non-synchronous with the main cell nuclei. The presence of ErbB1 gene in the MNs was evaluated by fluorescent in situ hybridization (FISH). ErbB1 sequences were detected in the MNs, but a relation between the MNs formation and extrusion of amplified ErbB1could not be established. The present study sought to elucidate the meaning of MNs formation and its association with the elimination of oncogenes or other amplified sequences from the tumor cells.

  15. Impact of somatic PI3K pathway and ERBB family mutations on pathological complete response (pCR) in HER2-positive breast cancer patients who received neoadjuvant HER2-targeted therapies.

    LENUS (Irish Health Repository)

    Toomey, Sinead

    2017-07-27

    The Cancer Genome Atlas analysis revealed that somatic EGFR, receptor tyrosine-protein kinase erbB-2 (ERBB2), Erb-B2 receptor tyrosine kinase 3 (ERBB3) and Erb-B2 receptor tyrosine kinase 4 (ERBB4) gene mutations (ERBB family mutations) occur alone or co-occur with somatic mutations in the gene encoding the phosphatidylinositol 3-kinase (PI3K) catalytic subunit (PIK3CA) in 19% of human epidermal growth factor receptor 2 (HER2)-positive breast cancers. Because ERBB family mutations can activate the PI3K\\/AKT pathway and likely have similar canonical signalling effects to PI3K pathway mutations, we investigated their combined impact on response to neoadjuvant HER2-targeted therapies.

  16. Human CD3+ T-Cells with the Anti-ERBB2 Chimeric Antigen Receptor Exhibit Efficient Targeting and Induce Apoptosis in ERBB2 Overexpressing Breast Cancer Cells

    Science.gov (United States)

    Munisvaradass, Rusheni; Kumar, Suresh; Govindasamy, Chandramohan; Alnumair, Khalid S.; Mok, Pooi Ling

    2017-01-01

    Breast cancer is a common malignancy among women. The innate and adaptive immune responses failed to be activated owing to immune modulation in the tumour microenvironment. Decades of scientific study links the overexpression of human epidermal growth factor receptor 2 (ERBB2) antigen with aggressive tumours. The Chimeric Antigen Receptor (CAR) coding for specific tumour-associated antigens could initiate intrinsic T-cell signalling, inducing T-cell activation, and cytotoxic activity without the need for major histocompatibility complex recognition. This renders CAR as a potentially universal immunotherapeutic option. Herein, we aimed to establish CAR in CD3+ T-cells, isolated from human peripheral blood mononucleated cells that could subsequently target and induce apoptosis in the ERBB2 overexpressing human breast cancer cell line, SKBR3. Constructed CAR was inserted into a lentiviral plasmid containing a green fluorescent protein tag and produced as lentiviral particles that were used to transduce activated T-cells. Transduced CAR-T cells were then primed with SKBR3 cells to evaluate their functionality. Results showed increased apoptosis in SKBR3 cells co-cultured with CAR-T cells compared to the control (non–transduced T-cells). This study demonstrates that CAR introduction helps overcome the innate limitations of native T-cells leading to cancer cell apoptosis. We recommend future studies should focus on in vivo cytotoxicity of CAR-T cells against ERBB2 expressing tumours. PMID:28885562

  17. A moderate elevation of circulating levels of IGF-I does not alter ErbB2 induced mammary tumorigenesis

    International Nuclear Information System (INIS)

    Dearth, Robert K; Kuiatse, Isere; Wang, Yu-Fen; Liao, Lan; Hilsenbeck, Susan G; Brown, Powel H; Xu, Jianming; Lee, Adrian V

    2011-01-01

    Epidemiological evidence suggests that moderately elevated levels of circulating insulin-like growth factor-I (IGF-I) are associated with increased risk of breast cancer in women. How circulating IGF-I may promote breast cancer incidence is unknown, however, increased IGF-I signaling is linked to trastuzumab resistance in ErbB2 positive breast cancer. Few models have directly examined the effect of moderately high levels of circulating IGF-I on breast cancer initiation and progression. The purpose of this study was to assess the ability of circulating IGF-I to independently initiate mammary tumorigenesis and/or accelerate the progression of ErbB2 mediated mammary tumor growth. We crossed heterozygous TTR-IGF-I mice with heterozygous MMTV-ErbB2 mice to generate 4 different genotypes: TTR-IGF-I/MMTV-ErbB2 (bigenic), TTR-IGF-I only, MMTV-ErbB2 only, and wild type (wt). Virgin females were palpated twice a week and harvested when tumors reached 1000 mm 3 . For study of normal development, blood and tissue were harvested at 4, 6 and 9 weeks of age in TTR-IGF-I and wt mice. TTR-IGF-I and TTR-IGF-I/ErbB2 bigenic mice showed a moderate 35% increase in circulating total IGF-I compared to ErbB2 and wt control mice. Elevation of circulating IGF-I had no effect upon pubertal mammary gland development. The transgenic increase in IGF-I alone wasn't sufficient to initiate mammary tumorigenesis. Elevated circulating IGF-I had no effect upon ErbB2-induced mammary tumorigenesis or metastasis, with median time to tumor formation being 30 wks and 33 wks in TTR-IGF-I/ErbB2 bigenic and ErbB2 mice respectively (p = 0.65). Levels of IGF-I in lysates from ErbB2/TTR-IGF-I tumors compared to ErbB2 was elevated in a similar manner to the circulating IGF-I, however, there was no effect on the rate of tumor growth (p = 0.23). There were no morphological differences in tumor type (solid adenocarcinomas) between bigenic and ErbB2 mammary glands. Using the first transgenic animal model to

  18. ErbB2 regulates NHEJ repair pathway by affecting erbB1-triggered IR-induced Akt activity

    International Nuclear Information System (INIS)

    Toulany, Mahmoud; Peter Rodemann, H.

    2009-01-01

    We have already reported that erbBl-PI3K-AKT signaling is an important pathway in regulating radiation sensitivity and DNA double strand break repair of human tumor cells. In the present study using small interfering RNA and pharmacological inhibitors in non-small cell lung cancer cell lines we investigated the role of Aktl on radiation-induced DNA-PKcs activity and DNA-double strand break (DNA-DSB) repair. Likewise, the function of erbB2 as hetrodimerization partner of erbBl in radiation-induced Akt activity and regulation of DNA-dsb repair through DNA-PKcs was evaluated. In A549 and H460 transfected with AKTl-siRNA radiation-induced phosphorylation of DNA-PKcs the key enzyme regulating NHEJ repair pathway was markedly inhibited. In both cell lines downregulation of Aktl led to a significant enhancement of residual DNA-DSB, i.e. impaired DNA-DSB repair. Interestingly, in cells transfected with DNA-PKcs-siRNA a lack of effect of AKTl-siRNA on enhancement of residual DNA-DSBs was observed. This results indicate that Aktl regulates NHEJ repair in a DNA-PKcs dependent manner

  19. Activation of EGFR and ERBB2 by Helicobacter pylori Results in Survival of Gastric Epithelial Cells with DNA Damage

    Science.gov (United States)

    Chaturvedi, Rupesh; Asim, Mohammad; Piazuelo, M. Blanca; Yan, Fang; Barry, Daniel P.; Sierra, Johanna Carolina; Delgado, Alberto G.; Hill, Salisha; Casero, Robert A.; Bravo, Luis E.; Dominguez, Ricardo L.; Correa, Pelayo; Polk, D. Brent; Washington, M. Kay; Rose, Kristie L.; Schey, Kevin L.; Morgan, Douglas R.; Peek, Richard M.; Wilson, Keith T.

    2014-01-01

    BACKGROUND & AIMS The gastric cancer-causing pathogen Helicobacter pylori upregulates spermine oxidase (SMOX) in gastric epithelial cells, causing oxidative stress-induced apoptosis and DNA damage. A subpopulation of SMOXhigh cells are resistant to apoptosis, despite their high levels of DNA damage. Because epidermal growth factor receptor (EGFR) activation can regulate apoptosis, we determined its role in SMOX-mediated effects. METHODS SMOX, apoptosis, and DNA damage were measured in gastric epithelial cells from H pylori-infected Egfrwa5 mice (which have attenuated EGFR activity), Egfr wild-type mice, or in infected cells incubated with EGFR inhibitors or deficient in EGFR. Phosphoproteomic analysis was performed. Two independent tissue microarrays containing each stage of disease, from gastritis to carcinoma, and gastric biopsies from Colombian and Honduran cohorts were analyzed by immunohistochemistry. RESULTS SMOX expression and DNA damage were decreased, and apoptosis increased in H pylori-infected Egfrwa5 mice. H pylori-infected cells with deletion or inhibition of EGFR had reduced levels of SMOX, DNA damage, and DNA damagehigh apoptosislow cells. Phosphoproteomic analysis revealed increased EGFR and ERBB2 signaling. Immunoblot analysis demonstrated the presence of a phosphorylated (p)EGFR–ERBB2 heterodimer and pERBB2; knockdown of ErbB2 facilitated apoptosis of DNA damagehigh apoptosislow cells. SMOX was increased in all stages of gastric disease, peaking in tissues with intestinal metaplasia, whereas pEGFR, pEGFR–ERBB2, and pERBB2 were increased predominantly in tissues demonstrating gastritis or atrophic gastritis. Principal component analysis separated gastritis tissues from patients with cancer vs those without cancer. pEGFR, pEGFR–ERBB2, pERBB2, and SMOX were increased in gastric samples from patients whose disease progressed to intestinal metaplasia or dysplasia, compared with patients whose disease did not progress. CONCLUSIONS In an analysis

  20. Inhibition of ErbB2 by receptor tyrosine kinase inhibitors causes myofibrillar structural damage without cell death in adult rat cardiomyocytes

    International Nuclear Information System (INIS)

    Pentassuglia, Laura; Graf, Michael; Lane, Heidi; Kuramochi, Yukio; Cote, Gregory; Timolati, Francesco; Sawyer, Douglas B.; Zuppinger, Christian; Suter, Thomas M.

    2009-01-01

    Inhibition of ErbB2 (HER2) with monoclonal antibodies, an effective therapy in some forms of breast cancer, is associated with cardiotoxicity, the pathophysiology of which is poorly understood. Recent data suggest, that dual inhibition of ErbB1 (EGFR) and ErbB2 signaling is more efficient in cancer therapy, however, cardiac safety of this therapeutic approach is unknown. We therefore tested an ErbB1-(CGP059326) and an ErbB1/ErbB2-(PKI166) tyrosine kinase inhibitor in an in-vitro system of adult rat ventricular cardiomyocytes and assessed their effects on 1. cell viability, 2. myofibrillar structure, 3. contractile function, and 4. MAPK- and Akt-signaling alone or in combination with Doxorubicin. Neither CGP nor PKI induced cardiomyocyte necrosis or apoptosis. PKI but not CGP caused myofibrillar structural damage that was additive to that induced by Doxorubicin at clinically relevant doses. These changes were associated with an inhibition of excitation-contraction coupling. PKI but not CGP decreased p-Erk1/2, suggesting a role for this MAP-kinase signaling pathway in the maintenance of myofibrils. These data indicate that the ErbB2 signaling pathway is critical for the maintenance of myofibrillar structure and function. Clinical studies using ErbB2-targeted inhibitors for the treatment of cancer should be designed to include careful monitoring for cardiac dysfunction.

  1. Data on the effect of in vivo knockdown using artificial ErbB3 miRNA on Remak bundle structure

    Directory of Open Access Journals (Sweden)

    Yuki Miyamoto

    2017-06-01

    Full Text Available Mature Schwann cells, the peripheral nervous system (PNS glial cells, have two major roles for neuronal axons (Bunge, 1993 [1]. For large diameter axons, Schwann cells form myelin sheaths with multiple layers. For small diameter axons, they form Remak bundle composed only of single layer of the Schwann cell plasma membrane. In the PNS, ErbB3 forms a dimer with ErbB2 on the Schwann cell plasma membrane. ErbB3 plays a key role in myelination by myelinating Schwann cells, that is to say, its role in myelin thickness. Herein we provide the data regarding the effect of in vivo knockdown of ErbB3 on the thickness between an axon and a neighboring axon in Remak bundle, which is formed by non-myelinating Schwann cells. Since ErbB3 knockout mice are embryonically lethal, Schwann cell lineage-specific transgenic mice transcribing ErbB3 shRNA with an artificial miRNA backbone were generated and used in these experiments (Torii et al., 2014 [2].

  2. ErbB2-Driven Breast Cancer Cell Invasion Depends on a Complex Signaling Network Activating Myeloid Zinc Finger-1-Dependent Cathepsin B Expression

    DEFF Research Database (Denmark)

    Rafn, Bo; Nielsen, Christian Thomas Friberg; Andersen, Sofie Hagel

    2012-01-01

    Aberrant ErbB2 receptor tyrosine kinase activation in breast cancer is strongly linked to an invasive disease. The molecular basis of ErbB2-driven invasion is largely unknown. We show that cysteine cathepsins B and L are elevated in ErbB2 positive primary human breast cancer and function...... as effectors of ErbB2-induced invasion in vitro. We identify Cdc42-binding protein kinase beta, extracellular regulated kinase 2, p21-activated protein kinase 4, and protein kinase C alpha as essential mediators of ErbB2-induced cysteine cathepsin expression and breast cancer cell invasiveness. The identified...

  3. RUNX1 positively regulates the ErbB2/HER2 signaling pathway through modulating SOS1 expression in gastric cancer cells.

    Science.gov (United States)

    Mitsuda, Yoshihide; Morita, Ken; Kashiwazaki, Gengo; Taniguchi, Junichi; Bando, Toshikazu; Obara, Moeka; Hirata, Masahiro; Kataoka, Tatsuki R; Muto, Manabu; Kaneda, Yasufumi; Nakahata, Tatsutoshi; Liu, Pu Paul; Adachi, Souichi; Sugiyama, Hiroshi; Kamikubo, Yasuhiko

    2018-04-23

    The dual function of runt-related transcriptional factor 1 (RUNX1) as an oncogene or oncosuppressor has been extensively studied in various malignancies, yet its role in gastric cancer remains elusive. Up-regulation of the ErbB2/HER2 signaling pathway is frequently-encountered in gastric cancer and contributes to the maintenance of these cancer cells. This signaling cascade is partly mediated by son of sevenless homolog (SOS) family, which function as adaptor proteins in the RTK cascades. Herein we report that RUNX1 regulates the ErbB2/HER2 signaling pathway in gastric cancer cells through transactivating SOS1 expression, rendering itself an ideal target in anti-tumor strategy toward this cancer. Mechanistically, RUNX1 interacts with the RUNX1 binding DNA sequence located in SOS1 promoter and positively regulates it. Knockdown of RUNX1 led to the decreased expression of SOS1 as well as dephosphorylation of ErbB2/HER2, subsequently suppressed the proliferation of gastric cancer cells. We also found that our novel RUNX inhibitor (Chb-M') consistently led to the deactivation of the ErbB2/HER2 signaling pathway and was effective against several gastric cancer cell lines. Taken together, our work identified a novel interaction of RUNX1 and the ErbB2/HER2 signaling pathway in gastric cancer, which can potentially be exploited in the management of this malignancy.

  4. Hsp90 inhibitor 17-AAG reduces ErbB2 levels and inhibits proliferation of the trastuzumab resistant breast tumor cell line JIMT-1.

    Science.gov (United States)

    Zsebik, Barbara; Citri, Ami; Isola, Jorma; Yarden, Yosef; Szöllosi, János; Vereb, György

    2006-04-15

    ErbB2, a member of the EGF receptor family of tyrosine kinases is overexpressed on many tumor cells of epithelial origin and is the molecular target of trastuzumab (Herceptin), the first humanized antibody used in the therapy of solid tumors. Trastuzumab, which is thought to act, at least in part, by downregulating ErbB2 expression is only effective in approximately 30-40% of ErbB2 positive breast tumors. Geldanamycin and its derivative 17-AAG are potential antitumor agents capable of downregulating client proteins of Hsp90, including ErbB2. To investigate the ability of 17-AAG to downregulate ErbB2 in trastuzumab resistant breast cancer cells and the possibility of 17-AAG and trastuzumab potentiating each other's effect, the recently established trastuzumab resistant breast cancer cell line, JIMT-1 was compared to the known trastuzumab sensitive SKBR-3 line. Baseline and stimulus-evoked dimerization and activation levels of ErbB2, and the effects of trastuzumab and 17-AAG alone and in combination on cell proliferation and apoptosis, as well as on ErbB2 expression and phosphorylation have been measured. Baseline activation and amenability to activation and downregulation by trastuzumab was much lower in the resistant line. However, 17-AAG enhanced ErbB2 homodimerization after 5-10 min of treatment in both cell lines, and decreased proliferation with an IC50 of 70 nM for SKBR-3 and 10nM for JIMT-1. Thus, 17-AAG may be a useful drug in trastuzumab resistant ErbB2 overexpressing tumors. The antiproliferative effect of 17-AAG was positively correlated with phosphorylation and downregulation of ErbB2 and was dominated by apoptosis, although, especially at higher doses, necrosis was also present. Interestingly, IC50 values for ErbB2 downregulation and phosphorylation, in the 30-40 nM range, were not significantly different for the two cell lines. This observation and the negative correlation between resting ErbB2 levels and the antiproliferative effect of 17-AAG may

  5. Detection of erbB2 copy number variations in plasma of patients with esophageal carcinoma

    International Nuclear Information System (INIS)

    Andolfo, Immacolata; Orditura, Michele; Ciardiello, Fortunato; De Vita, Fernando; Zollo, Massimo; Petrosino, Giuseppe; Vecchione, Loredana; De Antonellis, Pasqualino; Capasso, Mario; Montanaro, Donatella; Gemei, Marica; Troncone, Giancarlo; Iolascon, Achille

    2011-01-01

    Mortality is high in patients with esophageal carcinoma as tumors are rarely detected before the disease has progressed to an advanced stage. Here, we sought to isolate cell-free DNA released into the plasma of patients with esophageal carcinoma, to analyze copy number variations of marker genes in the search for early detection of tumor progression. Plasma of 41 patients with esophageal carcinoma was prospectively collected before tumor resection and chemotherapy. Our dataset resulted heterogeneous for clinical data, resembling the characteristics of the tumor. DNA from the plasma was extracted to analyze copy number variations of the erbB2 gene using real-time PCR assays. The real-time PCR assays for erbB2 gene showed significant (P = 0.001) copy number variations in the plasma of patients with esophageal carcinoma, as compared to healthy controls with high sensitivity (80%) and specificity (95%). These variations in erbB2 were negatively correlated to the progression free survival of these patients (P = 0.03), and revealed a further risk category stratification of patients with low VEGF expression levels. The copy number variation of erbB2 gene from plasma can be used as prognostic marker for early detection of patients at risk of worse clinical outcome in esophageal cancer

  6. Prolyl isomerase Pin1 is highly expressed in Her2-positive breast cancer and regulates erbB2 protein stability

    Directory of Open Access Journals (Sweden)

    Lu Kun

    2008-12-01

    Full Text Available Abstract Overexpression of HER-2/Neu occurs in about 25–30% of breast cancer patients and is indicative of poor prognosis. While Her2/Neu overexpression is primarily a result of erbB2 amplification, it has recently been recognized that erbB2 levels are also regulated on the protein level. However, factors that regulate Her2/Neu protein stability are less well understood. The prolyl isomerase Pin1 catalyzes the isomerization of specific pSer/Thr-Pro motifs that have been phosphorylated in response to mitogenic signaling. We have previously reported that Pin1-catalyzed post-phosphorylational modification of signal transduction modulates the oncogenic pathways downstream from c-neu. The goal of this study was to examine the expression of prolyl isomerase Pin1 in human Her2+ breast cancer, and to study if Pin1 affects the expression of Her2/Neu itself. Methods Immunohistochemistry for Her2 and Pin1 were performed on two hundred twenty-three human breast cancers, with 59% of the specimen from primary cancers and 41% from metastatic sites. Pin1 inhibition was achieved using siRNA in Her2+ breast cancer cell lines, and its effects were studied using cell viability assays, immunoblotting and immunofluorescence. Results Sixty-four samples (28.7% stained positive for Her2 (IHC 3+, and 54% (122/223 of all breast cancers stained positive for Pin1. Of the Her2-positive cancers 40 (62.5% were also Pin1-positive, based on strong nuclear or nuclear and cytoplasmic staining. Inhibition of Pin1 via RNAi resulted in significant suppression of Her2-positive tumor cell growth in BT474, SKBR3 and AU565 cells. Pin1 inhibition greatly increased the sensitivity of Her2-positive breast cancer cells to the mTOR inhibitor Rapamycin, while it did not increase their sensitivity to Trastuzumab, suggesting that Pin1 might act on Her2 signaling. We found that Pin1 interacted with the protein complex that contains ubiquitinated erbB2 and that Pin1 inhibition accelerated erbB2

  7. Electrocardiographic Characterization of Cardiac Hypertrophy in Mice that Overexpress the ErbB2 Receptor Tyrosine Kinase

    DEFF Research Database (Denmark)

    Sysa-Shah, Polina; Sørensen, Lars L; Abraham, M Roselle

    2015-01-01

    , the ECG recordings of ErbB2(tg) mice were characterized by higher P- and R-wave amplitudes, broader QRS complexes, inverted T waves, and ST interval depression. Pearson's correlation matrix analysis of combined WT and ErbB2(tg) data revealed significant correlation between heart weight and the ECG...... parameters of QT interval (corrected for heart rate), QRS interval, ST height, R amplitude, P amplitude, and PR interval. In addition, the left ventricular posterior wall thickness as determined by echocardiography correlated with ECG-determined ST height, R amplitude, QRS interval; echocardiographic left...... ventricular mass correlated with ECG-determined ST height and PR interval. In summary, we have determined phenotypic ECG criteria to differentiate ErbB2(tg) from WT genotypes in 98.8% of mice. This inexpensive and time-efficient ECG-based phenotypic method might be applied to differentiate between genotypes...

  8. The ectodomain of cadherin-11 binds to erbB2 and stimulates Akt phosphorylation to promote cranial neural crest cell migration.

    Directory of Open Access Journals (Sweden)

    Ketan Mathavan

    Full Text Available During development, a multi-potent group of cells known as the cranial neural crest (CNC migrate to form craniofacial structures. Proper migration of these cells requires proteolysis of cell adhesion molecules, such as cadherins. In Xenopus laevis, preventing extracellular cleavage of cadherin-11 impairs CNC migration. However, overexpression of the soluble cleavage product (EC1-3 is capable of rescuing this phenotype. The mechanism by which EC1-3 promotes CNC migration has not been investigated until now. Here we show that EC1-3 stimulates phosphorylation of Akt, a target of PI3K, in X.laevis CNC. Through immunoprecipitation experiments, we determined that EC1-3 interacts with all ErbB receptors, PDGFRα, and FGFR1. Of these receptors, only ErbB2 was able to produce an increase in Akt phosphorylation upon treatment with a recombinant EC1-3. This increase was abrogated by mubritinib, an inhibitor of ErbB2. We were able to recapitulate this decrease in Akt phosphorylation in vivo by knocking down ErbB2 in CNC cells. Knockdown of the receptor also significantly reduced CNC migration in vivo. We confirmed the importance of ErbB2 and ErbB receptor signaling in CNC migration using mubritinib and canertinib, respectively. Mubritinib and the PI3K inhibitor LY294002 significantly decreased cell migration while canertinib nearly prevented it altogether. These data show that ErbB2 and Akt are important for CNC migration and implicate other ErbB receptors and Akt-independent signaling pathways. Our findings provide the first example of a functional interaction between the extracellular domain of a type II classical cadherin and growth factor receptors.

  9. Novel Peptide/Protein Delivery System Targeting erbB2-Overexpressing Breast Cancer Cells

    National Research Council Canada - National Science Library

    Yu, Dihua

    2002-01-01

    .... During this funding year, we focused on the delivery of erbB2 signal-blocking ESP peptides (objective 2) . Because of the complexity of biotin-penetratin-AHNP-ESP, the synthesis was unsuccessful...

  10. Effect of acute acid-base disturbances on ErbB1/2 tyrosine phosphorylation in rabbit renal proximal tubules.

    Science.gov (United States)

    Skelton, Lara A; Boron, Walter F

    2013-12-15

    The renal proximal tubule (PT) is a major site for maintaining whole body pH homeostasis and is responsible for reabsorbing ∼80% of filtered HCO3(-), the major plasma buffer, into the blood. The PT adapts its rate of HCO3(-) reabsorption (JHCO3(-)) in response to acute acid-base disturbances. Our laboratory previously showed that single isolated perfused PTs adapt JHCO3(-) in response to isolated changes in basolateral (i.e., blood side) CO2 and HCO3(-) concentrations but, surprisingly, not to pH. The response to CO2 concentration can be blocked by the ErbB family tyrosine kinase inhibitor PD-168393. In the present study, we exposed enriched rabbit PT suspensions to five acute acid-base disturbances for 5 and 20 min using a panel of phosphotyrosine (pY)-specific antibodies to determine the influence of each disturbance on pan-pY, ErbB1-specific pY (four sites), and ErbB2-specific pY (two sites). We found that each acid-base treatment generated a distinct temporal pY pattern. For example, the summated responses of the individual ErbB1/2-pY sites to each disturbance showed that metabolic acidosis (normal CO2 concentration and reduced HCO3(-) concentration) produced a transient summated pY decrease (5 vs. 20 min), whereas metabolic alkalosis produced a transient increase. Respiratory acidosis (normal HCO3(-) concentration and elevated CO2 concentration) had little effect on summated pY at 5 min but produced an elevation at 20 min, whereas respiratory alkalosis produced a reduction at 20 min. Our data show that ErbB1 and ErbB2 in the PT respond to acute acid-base disturbances, consistent with the hypothesis that they are part of the signaling cascade.

  11. Bloch Surface Waves Biosensors for High Sensitivity Detection of Soluble ERBB2 in a Complex Biological Environment.

    Science.gov (United States)

    Sinibaldi, Alberto; Sampaoli, Camilla; Danz, Norbert; Munzert, Peter; Sonntag, Frank; Centola, Fabio; Occhicone, Agostino; Tremante, Elisa; Giacomini, Patrizio; Michelotti, Francesco

    2017-08-17

    We report on the use of one-dimensional photonic crystals to detect clinically relevant concentrations of the cancer biomarker ERBB2 in cell lysates. Overexpression of the ERBB2 protein is associated with aggressive breast cancer subtypes. To detect soluble ERBB2, we developed an optical set-up which operates in both label-free and fluorescence modes. The detection approach makes use of a sandwich assay, in which the one-dimensional photonic crystals sustaining Bloch surface waves are modified with monoclonal antibodies, in order to guarantee high specificity during the biological recognition. We present the results of exemplary protein G based label-free assays in complex biological matrices, reaching an estimated limit of detection of 0.5 ng/mL. On-chip and chip-to-chip variability of the results is addressed too, providing repeatability rates. Moreover, results on fluorescence operation demonstrate the capability to perform high sensitive cancer biomarker assays reaching a resolution of 0.6 ng/mL, without protein G assistance. The resolution obtained in both modes meets international guidelines and recommendations (15 ng/mL) for ERBB2 quantification assays, providing an alternative tool to phenotype and diagnose molecular cancer subtypes.

  12. Common ERBB2 polymorphisms and risk of breast cancer in a white British population: a case–control study

    International Nuclear Information System (INIS)

    Benusiglio, Patrick R; Ponder, Bruce AJ; Lesueur, Fabienne; Luccarini, Craig; Conroy, Donald M; Shah, Mitul; Easton, Douglas F; Day, Nick E; Dunning, Alison M; Pharoah, Paul D

    2005-01-01

    About two-thirds of the excess familial risk associated with breast cancer is still unaccounted for and may be explained by multiple weakly predisposing alleles. A gene thought to be involved in low-level predisposition to the disease is ERBB2 (HER2). This gene is involved in cell division, differentiation, and apoptosis and is frequently amplified in breast tumours. Its amplification correlates with poor prognosis. Moreover, the coding polymorphism I655V has previously been associated with an increased risk of breast cancer. We aimed to determine if common polymorphisms (frequency ≥ 5%) in ERBB2 were associated with breast cancer risk in a white British population. Five single-nucleotide polymorphisms (SNPs) were selected for study: SNP 1 near the promoter, SNP 2 in intron 1, SNP 3 in intron 4, SNP 4 in exon 17 (I655V), and SNP 5 in exon 27 (A1170P). We tested their association with breast cancer in a large case–control study (n = 2192 cases and 2257 controls). There were no differences in genotype frequencies between cases and controls for any of the SNPs examined. To investigate the possibility that a common polymorphism not included in our study might be involved in breast cancer predisposition, we also constructed multilocus haplotypes. Our set of SNPs generated all existing (n = 6) common haplotypes and no differences were seen in haplotype frequencies between cases and controls (P = 0.44). In our population, common ERBB2 polymorphisms are not involved in predisposition to breast cancer

  13. Poly (A+ transcriptome assessment of ERBB2-induced alterations in breast cell lines.

    Directory of Open Access Journals (Sweden)

    Dirce Maria Carraro

    Full Text Available We report the first quantitative and qualitative analysis of the poly (A⁺ transcriptome of two human mammary cell lines, differentially expressing (human epidermal growth factor receptor an oncogene over-expressed in approximately 25% of human breast tumors. Full-length cDNA populations from the two cell lines were digested enzymatically, individually tagged according to a customized method for library construction, and simultaneously sequenced by the use of the Titanium 454-Roche-platform. Comprehensive bioinformatics analysis followed by experimental validation confirmed novel genes, splicing variants, single nucleotide polymorphisms, and gene fusions indicated by RNA-seq data from both samples. Moreover, comparative analysis showed enrichment in alternative events, especially in the exon usage category, in ERBB2 over-expressing cells, data indicating regulation of alternative splicing mediated by the oncogene. Alterations in expression levels of genes, such as LOX, ATP5L, GALNT3, and MME revealed by large-scale sequencing were confirmed between cell lines as well as in tumor specimens with different ERBB2 backgrounds. This approach was shown to be suitable for structural, quantitative, and qualitative assessment of complex transcriptomes and revealed new events mediated by ERBB2 overexpression, in addition to potential molecular targets for breast cancer that are driven by this oncogene.

  14. ErbB4 localization to cardiac myocyte nuclei, and its role in myocyte DNA damage response

    International Nuclear Information System (INIS)

    Icli, Basak; Bharti, Ajit; Pentassuglia, Laura; Peng, Xuyang; Sawyer, Douglas B.

    2012-01-01

    Highlights: ► ErbB4 localizes to cardiac myocyte nuclei as a full-length receptor. ► Cardiac myocytes express predominantly JM-a/CYT-1 ErbB4. ► Myocyte p53 activation in response to doxorubicin requires ErbB4 activity. -- Abstract: The intracellular domain of ErbB4 receptor tyrosine kinase is known to translocate to the nucleus of cells where it can regulate p53 transcriptional activity. The purpose of this study was to examine whether ErbB4 can localize to the nucleus of adult rat ventricular myocytes (ARVM), and regulate p53 in these cells. We demonstrate that ErbB4 does locate to the nucleus of cardiac myocytes as a full-length protein, although nuclear location occurs as a full-length protein that does not require Protein Kinase C or γ-secretase activity. Consistent with this we found that only the non-cleavable JM-b isoform of ErbB4 is expressed in ARVM. Doxorubicin was used to examine ErbB4 role in regulation of a DNA damage response in ARVM. Doxorubicin induced p53 and p21 was suppressed by treatment with AG1478, an EGFR and ErbB4 kinase inhibitor, or suppression of ErbB4 expression with small interfering RNA. Thus ErbB4 localizes to the nucleus as a full-length protein, and plays a role in the DNA damage response induced by doxorubicin in cardiac myocytes.

  15. Comparative immunohistochemical expression of β-catenin, EGFR, ErbB2, and p63 in adamantinomatous and papillary craniopharyngiomas

    International Nuclear Information System (INIS)

    Eshebaa, Gh.E.; Hassan, A.A.

    2015-01-01

    Craniopharyngiomas (CPs) are rare epithelial tumors located mainly in the sellar/parasellar region. CPs have been classified into histopathologically, genetically, clinically and prognostically two distinctive subtypes: adamantinomatous and papillary variants. Aim To determine the immunohistochemical expression of β-catenin, EGFR, ErbB2, and p63 in adamantinomatous and papillary CPs. Materials and methods β-Catenin, EGFR, ErbB2, and p63 immunostaining was performed on paraffin embedded tissue sections of 25 CPs including 18 adamantinomatous craniopharyngioma (ACP) and 7 cases of papillary craniopharyngiomas (PCPs). Results 17 cases (94%) of ACP exhibited strong nuclear/cytoplasmic expression of β-catenin. On the contrary, all cases of PCP showed exclusively membranous expression (ρ value <0.0001). Regarding EGFR, 15 (83%) and 5 cases (71%) of APC and PCP respectively were positive. On the other hand, only 3 cases (17%) of APC and none of PCP exhibited positivity for ErbB2. p63 over-expression was observed in 16 cases of ACP (89%) and 6 cases of PCP (86%). However, the distribution of p63 staining was diffuse in ACP, while in PCP; the staining was mainly restricted to the basal cell layer. Conclusion Nuclear accumulation of β-catenin is a diagnostic hallmark of the ACP and is very helpful in the differential diagnosis between both ACP and PCP in the setting of small biopsies. Moreover, the restricted nuclear β-catenin accumulation in the cohesive cell clusters within the whorl-like areas supports that aberrant β-catenin expression may play a role in the morphogenesis of ACP.

  16. Interaction with epsin 1 regulates the constitutive clathrin-dependent internalization of ErbB3.

    Science.gov (United States)

    Szymanska, Monika; Fosdahl, Anne Marthe; Raiborg, Camilla; Dietrich, Markus; Liestøl, Knut; Stang, Espen; Bertelsen, Vibeke

    2016-06-01

    In contrast to other members of the EGF receptor family, ErbB3 is constitutively internalized in a clathrin-dependent manner. Previous studies have shown that ErbB3 does not interact with the coated pit localized adaptor complex 2 (AP-2), and that ErbB3 lacks two AP-2 interacting internalization signals identified in the EGF receptor. Several other clathrin-associated sorting proteins which may recruit cargo into coated pits have, however, been identified, and the study was performed to identify adaptors needed for constitutive internalization of ErbB3. A high-throughput siRNA screen was used to identify adaptor proteins needed for internalization of ErbB3. Upon knock-down of candidate proteins internalization of ErbB3 was identified using an antibody-based internalization assay combined with automatic fluorescence microscopy. Among 29 candidates only knock-down of epsin 1 turned out to inhibit ErbB3. Epsin 1 has ubiquitin interacting motifs (UIMs) and we show that ErbB3 interacts with an epsin 1 deletion mutant containing these UIMs. In support of an ErbB3-epsin 1 UIM dependent interaction, we show that ErbB3 is constitutively ubiquitinated, but that both ubiquitination and the ErbB3-epsin 1 interaction increase upon ligand binding. Altogether the results are consistent with a model whereby both constitutive and ligand-induced internalization of ErbB3 are regulated through interaction with epsin 1. Internalization is an important regulator of growth factor receptor mediated signaling and the current study identify mechanisms regulating plasma membrane turnover of ErbB3. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. The sorting protein PACS-2 promotes ErbB signalling by regulating recycling of the metalloproteinase ADAM17

    DEFF Research Database (Denmark)

    Dombernowsky, Sarah Louise; Samsøe-Petersen, Jacob; Petersen, Camilla Hansson

    2015-01-01

    The metalloproteinase ADAM17 activates ErbB signalling by releasing ligands from the cell surface, a key step underlying epithelial development, growth and tumour progression. However, mechanisms acutely controlling ADAM17 cell-surface availability to modulate the extent of ErbB ligand release....... PACS-2 co-localizes with ADAM17 on early endosomes and PACS-2 knockdown decreases the recycling and stability of internalized ADAM17. Hence, PACS-2 sustains ADAM17 cell-surface activity by diverting ADAM17 away from degradative pathways. Interestingly, Pacs2-deficient mice display significantly reduced...

  18. Polypeptide-based nanogels co-encapsulating a synergistic combination of doxorubicin with 17-AAG show potent anti-tumor activity in ErbB2-driven breast cancer models.

    Science.gov (United States)

    Desale, Swapnil S; Raja, Srikumar M; Kim, Jong Oh; Mohapatra, Bhopal; Soni, Kruti S; Luan, Haitao; Williams, Stetson H; Bielecki, Timothy A; Feng, Dan; Storck, Matthew; Band, Vimla; Cohen, Samuel M; Band, Hamid; Bronich, Tatiana K

    2015-06-28

    ErbB2-driven breast cancers constitute 20-25% of the cases diagnosed within the USA. The humanized anti-ErbB2 monoclonal antibody, Trastuzumab (Herceptin™; Genentech), with chemotherapy is the current standard of treatment. Novel agents and strategies continue to be explored, given the challenges posed by Trastuzumab-resistance development in most patients. The HSP90 inhibitor, 17-allylaminodemethoxygeldanamycin (17-AAG), which induces ErbB2 degradation and attenuates downstream oncogenic signaling, is one such agent that showed significant promise in early phase I and II clinical trials. Its low water solubility, potential toxicities and undesirable side effects observed in patients, partly due to the Cremophor-based formulation, have been discouraging factors in the advancement of this promising drug into clinical use. Encapsulation of 17-AAG into polymeric nanoparticle formulations, particularly in synergistic combination with conventional chemotherapeutics, represents an alternative approach to overcome these problems. Herein, we report an efficient co-encapsulation of 17-AAG and doxorubicin, a clinically well-established and effective modality in breast cancer treatment, into biodegradable and biocompatible polypeptide-based nanogels. Dual drug-loaded nanogels displayed potent cytotoxicity in a breast cancer cell panel and exerted selective synergistic anticancer activity against ErbB2-overexpressing breast cancer cell lines. Analysis of ErbB2 degradation confirmed efficient 17-AAG release from nanogels with activity comparable to free 17-AAG. Furthermore, nanogels containing both 17-AAG and doxorubicin exhibited superior antitumor efficacy in vivo in an ErbB2-driven xenograft model compared to the combination of free drugs. These studies demonstrate that polypeptide-based nanogels can serve as novel nanocarriers for encapsulating 17-AAG along with other chemotherapeutics, providing an opportunity to overcome solubility issues and thereby exploit its full

  19. Decreased internalisation of erbB1 mutants in lung cancer is linked with a mechanism conferring sensitivity to gefitinib.

    Science.gov (United States)

    Hendriks, B S; Griffiths, G J; Benson, R; Kenyon, D; Lazzara, M; Swinton, J; Beck, S; Hickinson, M; Beusmans, J M; Lauffenburger, D; de Graaf, D

    2006-11-01

    A majority of gefitinib (IRESSA)-responsive tumours in non-small cell lung cancer have been found to carry mutations in ErbB1. Previously, it has been observed that internalisation-deficient ErbB1 receptors are strong drivers of oncogenesis. Using a computational model of ErbB1 trafficking and signalling, it is found that a deficiency in ErbB1 internalisation is sufficient to explain the observed signalling phenotype of these gefitinib-responsive ErbB1 mutants in lung cancer cell lines. Experimental tests confirm that gefitinib-sensitive cell lines with and without ErbB1 mutations exhibit markedly slower internalisation rates than gefitinib-insensitive cell lines. Moreover, the computational model demonstrates that reduced ErbB1 internalisation rates are mechanistically linked to upregulated AKT signalling. Experimentally it is confirmed that impaired internalisation of ErbB1 is associated with increased AKT activity, which can be blocked by gefitinib. On the basis of these experimental and computational results, it is surmised that gefitinib sensitivity is a marker of a reliance on AKT signalling for cell survival that may be brought about by impaired ErbB1 internalisation.

  20. Defining the ATM-mediated barrier to tumorigenesis in somatic mammary cells following ErbB2 activation.

    Science.gov (United States)

    Reddy, Jay P; Peddibhotla, Sirisha; Bu, Wen; Zhao, Jing; Haricharan, Svasti; Du, Yi-Chieh Nancy; Podsypanina, Katrina; Rosen, Jeffrey M; Donehower, Larry A; Li, Yi

    2010-02-23

    p53, apoptosis, and senescence are frequently activated in preneoplastic lesions and are barriers to progression to malignancy. These barriers have been suggested to result from an ATM-mediated DNA damage response (DDR), which may follow oncogene-induced hyperproliferation and ensuing DNA replication stress. To elucidate the currently untested role of DDR in breast cancer initiation, we examined the effect of oncogene expression in several murine models of breast cancer. We did not observe a detectable DDR in early hyperplastic lesions arising in transgenic mice expressing several different oncogenes. However, DDR signaling was strongly induced in preneoplastic lesions arising from individual mammary cells transduced in vivo by retroviruses expressing either PyMT or ErbB2. Thus, activation of an oncogene after normal tissue development causes a DDR. Furthermore, in this somatic ErbB2 tumor model, ATM, and thus DDR, is required for p53 stabilization, apoptosis, and senescence. In palpable tumors in this model, p53 stabilization and apoptosis are lost, but unexpectedly senescence remains in many tumor cells. Thus, this murine model fully recapitulates early DDR signaling; the eventual suppression of its endpoints in tumorigenesis provides compelling evidence that ErbB2-induced aberrant mammary cell proliferation leads to an ATM-mediated DDR that activates apoptosis and senescence, and at least the former must be overcome to progress to malignancy. This in vivo study also uncovers an unexpected effect of ErbB2 activation previously known for its prosurvival roles, and suggests that protection of the ATM-mediated DDR-p53 signaling pathway may be important in breast cancer prevention.

  1. Modulation of the Neuregulin 1/ErbB system after skeletal muscle denervation and reinnervation.

    Science.gov (United States)

    Morano, Michela; Ronchi, Giulia; Nicolò, Valentina; Fornasari, Benedetta Elena; Crosio, Alessandro; Perroteau, Isabelle; Geuna, Stefano; Gambarotta, Giovanna; Raimondo, Stefania

    2018-03-22

    Neuregulin 1 (NRG1) is a growth factor produced by both peripheral nerves and skeletal muscle. In muscle, it regulates neuromuscular junction gene expression, acetylcholine receptor number, muscle homeostasis and satellite cell survival. NRG1 signalling is mediated by the tyrosine kinase receptors ErbB3 and ErbB4 and their co-receptors ErbB1 and ErbB2. The NRG1/ErbB system is well studied in nerve tissue after injury, but little is known about this system in skeletal muscle after denervation/reinnervation processes. Here, we performed a detailed time-course expression analysis of several NRG1 isoforms and ErbB receptors in the rat superficial digitorum flexor muscle after three types of median nerve injuries of different severities. We found that ErbB receptor expression was correlated with the innervated state of the muscle, with upregulation of ErbB2 clearly associated with the denervation state. Interestingly, the NRG1 isoforms were differently regulated depending on the nerve injury type, leading to the hypothesis that both the NRG1α and NRG1β isoforms play a key role in the muscle reaction to injury. Indeed, in vitro experiments with C2C12 atrophic myotubes revealed that both NRG1α and NRG1β treatment influences the best-known atrophic pathways, suggesting that NRG1 might play an anti-atrophic role.

  2. Hyaluronan-induced masking of ErbB2 and CD44-enhanced trastuzumab internalisation in trastuzumab resistant breast cancer.

    Science.gov (United States)

    Pályi-Krekk, Zsuzsanna; Barok, Márk; Isola, Jorma; Tammi, Markku; Szöllosi, János; Nagy, Peter

    2007-11-01

    Although trastuzumab, a recombinant humanised anti-ErbB2 antibody, is widely used in the treatment of breast cancer, neither its mechanism of action, nor the factors leading to resistance are fully understood. We have previously shown that antibody-dependent cellular cytotoxicity is pivotal in the in vivo effect of trastuzumab against JIMT-1, a cell line showing in vitro resistance to the antibody, and suggested that masking of the trastuzumab-binding epitope by MUC-4, a cell surface mucin, took place. Here, we further explored the role of masking of ErbB2 in connection with CD44 expression and synthesis of its ligand, hyaluronan. We show that high expression of CD44 observed in JIMT-1 cells correlates with ErbB2 downregulation in vivo, while siRNA-mediated inhibition of CD44 expression leads to decreased rate of trastuzumab internalisation and low cell proliferation in vitro. An inhibitor of hyaluronan synthesis, 4-methylumbelliferon (4-MU) significantly reduced the hyaluronan level of JIMT-1 cells both in vivo and in vitro leading to enhanced binding of trastuzumab to ErbB2 and increased ErbB2 down-regulation. Furthermore, the inhibitory effect of trastuzumab on the growth of JIMT-1 xenografts was significantly increased by 4-MU treatment. Our results point to the importance of the CD44-hyaluronan pathway in the escape of tumour cells from receptor-oriented therapy.

  3. [Construction of the lentiviral expression vector for anti-p185(erbB2) mouse/human chimeric antibody].

    Science.gov (United States)

    Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi

    2013-04-01

    This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.

  4. A peptide antagonist of ErbB receptors, Inherbin3, induces neurite outgrowth from rat cerebellar granule neurons through ErbB1 inhibition

    DEFF Research Database (Denmark)

    Xu, Ruodan; Pankratova, Stanislava; Christiansen, Søren Hofman

    2013-01-01

    ErbB receptors not only function in cancer, but are also key developmental regulators in the nervous system. We previously identified an ErbB1 peptide antagonist, Inherbin3, that is capable of inhibiting tumor growth in vitro and in vivo. In this study, we found that inhibition of ErbB1 kinase ac...

  5. Polysomy of chromosome 17 in breast cancer tumors showing an overexpression of ERBB2: a study of 175 cases using fluorescence in situ hybridization and immunohistochemistry

    International Nuclear Information System (INIS)

    Salido, Marta; Solé, Francesc; Tusquets, Ignasi; Corominas, Josep M; Suarez, Marta; Espinet, Blanca; Corzo, Cristina; Bellet, Meritxell; Fabregat, Xavier; Serrano, Sergi

    2005-01-01

    One of the most common genetic aberrations associated with breast cancer is the amplification and overexpression of the ERBB2 proto-oncogene located at chromosome 17, bands q12-21. The amplification/overexpression occurs in 25 to 30% of all breast cancers. In breast cancer, aneusomy of chromosome 17, either monosomy or polysomy, is frequently observed by conventional cytogenetics and fluorescence in situ hybridization (FISH). The aim of this study was to discover whether or not numerical aberrations on chromosome 17 have a correlation to the amplification or overexpression of the ERBB2 gene and to analyze their clinical implications in subgroups showing 2+ or 3+ positive scores by immunohistochemistry (IHC). We used FISH on a series of 175 formalin-fixed paraffin-embedded breast carcinomas to detect ERBB2 amplification, using a dual-probe system for the simultaneous enumeration of the ERBB2 gene and the centromeric region of chromosome 17, as well as using IHC to detect overexpression. We analyzed clinical and pathological variables in a subgroup of patients with 2+ and 3+ IHC scores (147 patients), to describe any differences in clinicopathological characteristics between polysomic and non-polysomic cases with the use of the χ 2 test. We found 13% of cases presenting polysomy, and three cases presented monosomy 17 (2%). According to the status of the ERBB2 gene, instances of polysomy 17 were more frequently observed in non-amplified cases than in FISH-amplified cases, suggesting that the mechanism for ERBB2 amplification is independent of polysomy 17. Polysomy 17 was detected in patients with 2+ and 3+ IHC scores. We found that nodal involvement was more frequent in polysomic than in non-polysomic cases (P = 0.046). The determination of the copy number of chromosome 17 should be incorporated into the assesment of ERBB2 status. It might also be helpful to differentiate a subgroup of breast cancer patients with polysomy of chromosome 17 and overexpression of ERBB2

  6. Anti-metastasis activity of black rice anthocyanins against breast cancer: analyses using an ErbB2 positive breast cancer cell line and tumoral xenograft model.

    Science.gov (United States)

    Luo, Li-Ping; Han, Bin; Yu, Xiao-Ping; Chen, Xiang-Yan; Zhou, Jie; Chen, Wei; Zhu, Yan-Feng; Peng, Xiao-Li; Zou, Qiang; Li, Sui-Yan

    2014-01-01

    Increasing evidence from animal, epidemiological and clinical investigations suggest that dietary anthocyanins have potential to prevent chronic diseases, including cancers. It is also noteworthy that human epidermal growth factor receptor 2 (ErbB2) protein overexpression or ErbB2 gene amplification has been included as an indicator for metastasis and higher risk of recurrence for breast cancer. The present experiments investigated the anti-metastasis effects of black rice anthocyanins (BRACs) on ErbB2 positive breast cancer cells in vivo and in vitro. Oral administration of BRACs (150 mg/kg/day) reduced transplanted tumor growth, inhibited pulmonary metastasis, and decreased lung tumor nodules in BALB/c nude mice bearing ErbB2 positive breast cancer cell MDA-MB-453 xenografts. The capacity for migration, adhesion, motility and invasion was also inhibited by BRACs in MDA-MB-453 cells in a concentration dependent manner, accompanied by decreased activity of a transfer promoting factor, urokinase-type plasminogen activator (u-PA). Together, our results indicated that BRACs possess anti-metastasis potential against ErbB2 positive human breast cancer cells in vivo and in vitro through inhibition of metastasis promoting molecules.

  7. SOX9 regulates ERBB signalling in pancreatic cancer development.

    Science.gov (United States)

    Grimont, Adrien; Pinho, Andreia V; Cowley, Mark J; Augereau, Cécile; Mawson, Amanda; Giry-Laterrière, Marc; Van den Steen, Géraldine; Waddell, Nicola; Pajic, Marina; Sempoux, Christine; Wu, Jianmin; Grimmond, Sean M; Biankin, Andrew V; Lemaigre, Frédéric P; Rooman, Ilse; Jacquemin, Patrick

    2015-11-01

    The transcription factor SOX9 was recently shown to stimulate ductal gene expression in pancreatic acinar-to-ductal metaplasia and to accelerate development of premalignant lesions preceding pancreatic ductal adenocarcinoma (PDAC). Here, we investigate how SOX9 operates in pancreatic tumourigenesis. We analysed genomic and transcriptomic data from surgically resected PDAC and extended the expression analysis to xenografts from PDAC samples and to PDAC cell lines. SOX9 expression was manipulated in human cell lines and mouse models developing PDAC. We found genetic aberrations in the SOX9 gene in about 15% of patient tumours. Most PDAC samples strongly express SOX9 protein, and SOX9 levels are higher in classical PDAC. This tumour subtype is associated with better patient outcome, and cell lines of this subtype respond to therapy targeting epidermal growth factor receptor (EGFR/ERBB1) signalling, a pathway essential for pancreatic tumourigenesis. In human PDAC, high expression of SOX9 correlates with expression of genes belonging to the ERBB pathway. In particular, ERBB2 expression in PDAC cell lines is stimulated by SOX9. Inactivating Sox9 expression in mice confirmed its role in PDAC initiation; it demonstrated that Sox9 stimulates expression of several members of the ERBB pathway and is required for ERBB signalling activity. By integrating data from patient samples and mouse models, we found that SOX9 regulates the ERBB pathway throughout pancreatic tumourigenesis. Our work opens perspectives for therapy targeting tumourigenic mechanisms. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  8. Intermittent hypoxia induces the proliferation of rat vascular smooth muscle cell with the increases in epidermal growth factor family and erbB2 receptor

    International Nuclear Information System (INIS)

    Kyotani, Yoji; Ota, Hiroyo; Itaya-Hironaka, Asako; Yamauchi, Akiyo; Sakuramoto-Tsuchida, Sumiyo; Zhao, Jing; Ozawa, Kentaro; Nagayama, Kosuke; Ito, Satoyasu; Takasawa, Shin; Kimura, Hiroshi; Uno, Masayuki; Yoshizumi, Masanori

    2013-01-01

    Obstructive sleep apnea is characterized by intermittent hypoxia (IH), and associated with cardiovascular diseases, such as stroke and heart failure. These cardiovascular diseases have a relation to atherosclerosis marked by the proliferation of vascular smooth muscle cells (VSMCs). In this study, we investigated the influence of IH on cultured rat aortic smooth muscle cell (RASMC). The proliferation of RASMC was significantly increased by IH without changing the level of apoptosis. In order to see what induces RASMC proliferation, we investigated the influence of normoxia (N)-, IH- and sustained hypoxia (SH)-treated cell conditioned media on RASMC proliferation. IH-treated cell conditioned medium significantly increased RASMC proliferation compared with N-treated cell conditioned medium, but SH-treated cell conditioned medium did not. We next investigated the epidermal growth factor (EGF) family as autocrine growth factors. Among the EGF family, we found significant increases in mRNAs for epiregulin (ER), amphiregulin (AR) and neuregulin-1 (NRG1) in IH-treated cells and mature ER in IH-treated cell conditioned medium. We next investigated the changes in erbB family receptors that are receptors for ER, AR and NRG1, and found that erbB2 receptor mRNA and protein expressions were increased by IH, but not by SH. Phosphorylation of erbB2 receptor at Tyr-1248 that mediates intracellular signaling for several physiological effects including cell proliferation was increased by IH, but not by SH. In addition, inhibitor for erbB2 receptor suppressed IH-induced cell proliferation. These results provide the first demonstration that IH induces VSMC proliferation, and suggest that EGF family, such as ER, AR and NRG1, and erbB2 receptor could be involved in the IH-induced VSMC proliferation. - Highlights: ●In vitro system for intermittent hypoxia (IH) and sustained hypoxia (SH). ●IH, but not SH, induces the proliferation of rat vascular smooth muscle cell. ●Epiregulin m

  9. Intermittent hypoxia induces the proliferation of rat vascular smooth muscle cell with the increases in epidermal growth factor family and erbB2 receptor

    Energy Technology Data Exchange (ETDEWEB)

    Kyotani, Yoji, E-mail: cd147@naramed-u.ac.jp [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Department of Pharmacy, Nara Medical University Hospital, Kashihara 634-8522 (Japan); Ota, Hiroyo [Second Department of Internal Medicine, Nara Medical University School of Medicine, Kashihara 634-8522 (Japan); Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Itaya-Hironaka, Asako; Yamauchi, Akiyo; Sakuramoto-Tsuchida, Sumiyo [Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Zhao, Jing; Ozawa, Kentaro; Nagayama, Kosuke; Ito, Satoyasu [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Takasawa, Shin [Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Kimura, Hiroshi [Second Department of Internal Medicine, Nara Medical University School of Medicine, Kashihara 634-8522 (Japan); Uno, Masayuki [Department of Pharmacy, Nara Medical University Hospital, Kashihara 634-8522 (Japan); Yoshizumi, Masanori [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan)

    2013-11-15

    Obstructive sleep apnea is characterized by intermittent hypoxia (IH), and associated with cardiovascular diseases, such as stroke and heart failure. These cardiovascular diseases have a relation to atherosclerosis marked by the proliferation of vascular smooth muscle cells (VSMCs). In this study, we investigated the influence of IH on cultured rat aortic smooth muscle cell (RASMC). The proliferation of RASMC was significantly increased by IH without changing the level of apoptosis. In order to see what induces RASMC proliferation, we investigated the influence of normoxia (N)-, IH- and sustained hypoxia (SH)-treated cell conditioned media on RASMC proliferation. IH-treated cell conditioned medium significantly increased RASMC proliferation compared with N-treated cell conditioned medium, but SH-treated cell conditioned medium did not. We next investigated the epidermal growth factor (EGF) family as autocrine growth factors. Among the EGF family, we found significant increases in mRNAs for epiregulin (ER), amphiregulin (AR) and neuregulin-1 (NRG1) in IH-treated cells and mature ER in IH-treated cell conditioned medium. We next investigated the changes in erbB family receptors that are receptors for ER, AR and NRG1, and found that erbB2 receptor mRNA and protein expressions were increased by IH, but not by SH. Phosphorylation of erbB2 receptor at Tyr-1248 that mediates intracellular signaling for several physiological effects including cell proliferation was increased by IH, but not by SH. In addition, inhibitor for erbB2 receptor suppressed IH-induced cell proliferation. These results provide the first demonstration that IH induces VSMC proliferation, and suggest that EGF family, such as ER, AR and NRG1, and erbB2 receptor could be involved in the IH-induced VSMC proliferation. - Highlights: ●In vitro system for intermittent hypoxia (IH) and sustained hypoxia (SH). ●IH, but not SH, induces the proliferation of rat vascular smooth muscle cell. ●Epiregulin m

  10. Detection of survivin, carcinoembryonic antigen and ErbB2 level in oral squamous cell carcinoma patients.

    Science.gov (United States)

    Li, Shu-Xia; Yang, Yan-Qi; Jin, Li-Jian; Cai, Zhi-Gang; Sun, Zheng

    2016-01-01

    The aim of this study was to detect the survivin, carcinoembryonic antigen (CEA) and ErbB2 in the saliva, serum and local tumor-exfoliated cells of oral squamous cell carcinoma (OSCC) patients, for providing reliable tumor markers for the early detection of oral malignant cancer. The saliva, serum, and local tumor-exfoliated cell samples of 26 OSCC patients without chemotherapy and 10 non-cancer patients were collected in Department of Oral and Maxillofacial Surgery, School of Stomatology, Peking University. The contents of survivin, CEA and ErbB2 using were detected usingenzyme-linked immunosorbent assay. The survivin and CEA levels in saliva and local tumor-exfoliated cells of OSCC patients were significantly higher than those in the non-cancer patients (P oral malignant cancer.

  11. Solution structure of the human Grb7-SH2 domain/erbB2 peptide complex and structural basis for Grb7 binding to ErbB2

    International Nuclear Information System (INIS)

    Ivancic, Monika; Daly, Roger J.; Lyons, Barbara A.

    2003-01-01

    The solution structure of the hGrb7-SH2 domain in complex with a ten amino acid phosphorylated peptide ligand representative of the erbB2 receptor tyrosine kinase (pY1139) is presented as determined by nuclear magnetic resonance methods. The hGrb7-SH2 domain structure reveals the Src homology 2 domain topology consisting of a central β-sheet capped at each end by an α-helix. The presence of a four residue insertion in the region between β-strand E and the EF loop and resulting influences on the SH2 domain/peptide complex structure are discussed. The binding conformation of the erbB2 peptide is in a β-turn similar to that found in phosphorylated tyrosine peptides bound to the Grb2-SH2 domain. To our knowledge this is only the second example of an SH2 domain binding its naturally occurring ligands in a turn, instead of extended, conformation. Close contacts between residues responsible for binding specificity in hGrb7-SH2 and the erbB2 peptide are characterized and the potential effect of mutation of these residues on the hGrb7-SH2 domain structure is discussed

  12. Disruption of ERBB2IP is not associated with dystrophic epidermolysis bullosa in both father and son carrying a balanced 5;13 translocation.

    Science.gov (United States)

    Stefanova, Margarita; Zemke, Katrin; Dimitrov, Boyan; Has, Christina; Kern, Johannes S; Bruckner-Tuderman, Leena; Kutsche, Kerstin

    2005-10-01

    Mutations in the type VII collagen gene (COL7A1) cause autosomal recessive and autosomal dominant inherited dystrophic epidermolysis bullosa (DEB). We report a family with three individuals who present blistering, scarring, hypo- and hyperpigmentation, and nail dystrophy suggestive for DEB. Whereas father and son carry a 5;13 translocation, the daughter shows a normal karyotype. Segregation analysis revealed that all affected family members inherited the same COL7A1 allele. Mutation analysis disclosed a heterozygous missense mutation, c.6227G > A (p.G2076D), in COL7A1 in all affected individuals. Delineation of the translocation breakpoints showed that the ERBB2IP (erbb2 interacting protein or Erbin) gene is disrupted in 5q13.1 and GPC6 in 13q32. GPC6 encodes glypican 6 belonging to a family of cell surface heparan sulfate proteoglycans. The binding partners of Erbin, BP230 (BPAG1) and the integrin beta4 subunit, both involved in hemidesmosome (HD) function, and the presence of Erbin in HD suggested that it plays a role in establishment and maintenance of cell-basement membrane adhesions. However, loss of function of one ERBB2IP copy or expression of a putative novel ERBB2IP fusion protein did not apparently modulate the DEB phenotype in both translocation patients. Nonetheless, one cannot yet exclude that ERBB2IP is a candidate for human blistering disorders such as epidermolysis bullosa.

  13. Antipsychotic potential of quinazoline ErbB1 inhibitors in a schizophrenia model established with neonatal hippocampal lesioning.

    Science.gov (United States)

    Mizuno, Makoto; Iwakura, Yuriko; Shibuya, Masako; Zheng, Yingjun; Eda, Takeyoshi; Kato, Taisuke; Takasu, Yohei; Nawa, Hiroyuki

    2010-01-01

    Hyper-signaling of the epidermal growth factor receptor family (ErbB) is implicated in the pathophysiology of schizophrenia. Various quinazoline inhibitors targeting ErbB1 or ErbB2 - 4 have been developed as anti-cancer agents and might be useful for antipsychotic treatment. In the present study, we used an animal model of schizophrenia established by neonatal hippocampal lesioning and evaluated the neurobehavioral consequences of ErbB1-inhibitor treatment. Subchronic administration of the ErbB1 inhibitor ZD1839 to the cerebroventricle of rats receiving neonatal hippocampal lesioning ameliorated deficits in prepulse inhibition as well as those in the latent inhibition of tone-dependent fear learning. There were no apparent adverse effects on basal learning scores or locomotor activity, however. The administration of other ErbB1 inhibitors, PD153035 and OSI-774, similarly attenuated the prepulse inhibition impairment of this animal model. In parallel, there were decreases in ErbB1 phosphorylation in animals treated with ErbB1 inhibitors. These results indicate an antipsychotic potential of quinazoline ErbB1 inhibitors. ErbB receptor tyrosine kinases may be novel therapeutic targets for schizophrenia or its related psychotic symptoms.

  14. Neratinib, an irreversible ErbB receptor tyrosine kinase inhibitor, in patients with advanced ErbB2-positive breast cancer.

    Science.gov (United States)

    Burstein, Harold J; Sun, Yan; Dirix, Luc Y; Jiang, Zefei; Paridaens, Robert; Tan, Antoinette R; Awada, Ahmad; Ranade, Anantbhushan; Jiao, Shunchang; Schwartz, Gary; Abbas, Richat; Powell, Christine; Turnbull, Kathleen; Vermette, Jennifer; Zacharchuk, Charles; Badwe, Rajendra

    2010-03-10

    Neratinib is an oral, irreversible pan-ErbB receptor tyrosine kinase inhibitor. The efficacy and safety of neratinib were evaluated in two cohorts of patients with advanced ErbB2-positive breast cancer-those with and those without prior trastuzumab treatment-in an open-label, multicenter, phase II trial. Patients in the two cohorts (prior trastuzumab, n = 66; no prior trastuzumab, n = 70) received oral neratinib 240 mg once daily. The primary end point was the 16-week progression-free survival (PFS) rate for the evaluable population (prior trastuzumab, n = 63; no prior trastuzumab, n = 64), as assessed by independent review. The 16-week PFS rates were 59% for patients with prior trastuzumab treatment and 78% for patients with no prior trastuzumab treatment. Median PFS was 22.3 and 39.6 weeks, respectively. Objective response rates were 24% among patients with prior trastuzumab treatment and 56% in the trastuzumab-naïve cohort. The most common adverse events were diarrhea, nausea, vomiting, and fatigue. Diarrhea was the most frequent grades 3 to 4 adverse event, occurring in 30% of patients with prior trastuzumab treatment and in 13% of patients with no prior trastuzumab treatment, which prompted dose reductions in 29% and 4% of patients, respectively, but treatment discontinuation in only one patient. No neratinib-related, grades 3 or 4 cardiotoxicity was reported. Oral neratinib showed substantial clinical activity and was reasonably well tolerated among both heavily pretreated and trastuzumab-naïve patients who had advanced, ErbB2-positive breast cancer. Diarrhea was the most common adverse effect but was manageable with antidiarrheal agents and dose modification.

  15. Expression of Eag1 K+ channel and ErbBs in human pituitary adenomas: cytoskeleton arrangement patterns in cultured cells.

    Science.gov (United States)

    del Pliego, Margarita González; Aguirre-Benítez, Elsa; Paisano-Cerón, Karina; Valdovinos-Ramírez, Irene; Rangel-Morales, Carlos; Rodríguez-Mata, Verónica; Solano-Agama, Carmen; Martín-Tapia, Dolores; de la Vega, María Teresa; Saldoval-Balanzario, Miguel; Camacho, Javier; Mendoza-Garrido, María Eugenia

    2013-01-01

    Pituitary adenomas can invade surrounded tissue, but the mechanism remains elusive. Ether à go-go-1 (Eag1) potassium channel and epidermal growth factor receptors (ErbB1 and ErbB2) have been associated to invasive phenotypes or poor prognosis in cancer patients. However, cells arrange their cytoskeleton in order to acquire a successful migration pattern. We have studied ErbBs and Eag1 expression, and cytoskeleton arrangements in 11 human pituitary adenomas. Eag1, ErbB1 and ErbB2 expression were studied by immunochemistry in tissue and cultured cells. The cytoskeleton arrangement was analyzed in cultured cells by immunofluorescence. Normal pituitary tissue showed ErbB2 expression and Eag1 only in few cells. However, Eag1 and ErbB2 were expressed in all the tumors analyzed. ErbB1 expression was observed variable and did not show specificity for a tumor characteristic. Cultured cells from micro- and macro-adenomas clinically functional organize their cytoskeleton suggesting a mesenchymal pattern, and a round leucocyte/amoeboid pattern from invasive clinically silent adenoma. Pituitary tumors over-express EGF receptors and the ErbB2 repeated expression suggests is a characteristic of adenomas. Eag 1 was express, in different extent, and could be a therapeutic target. The cytoskeleton arrangements observed suggest that pituitary tumor cells acquire different patterns: mesenchymal, and leucocyte/amoeboid, the last observed in the invasive adenomas. Amoeboid migration pattern has been associated with high invasion capacity.

  16. The neuregulin receptor ErbB-4 interacts with PDZ-containing proteins at neuronal synapses

    Science.gov (United States)

    Garcia, Rolando A. G.; Vasudevan, Kuzhalini; Buonanno, Andres

    2000-01-01

    Neuregulins regulate the expression of ligand- and voltage-gated channels in neurons and skeletal muscle by the activation of their cognate tyrosine kinase receptors, ErbB 1–4. The subcellular distribution and mechanisms that regulate the localization of ErbB receptors are unknown. We have found that ErbB receptors are present in brain subcellular fractions enriched for postsynaptic densities (PSD). The ErbB-4 receptor is unique among the ErbB proteins because its C-terminal tail (T-V-V) conforms to a sequence that binds to a protein motif known as the PDZ domain. Using the yeast two-hybrid system, we found that the C-terminal region of ErbB-4 interacts with the three related membrane-associated guanylate kinases (MAGUKs) PSD-95/SAP90, PSD-93/chapsyn-110, and SAP 102, which harbor three PDZ domains, as well as with β2-syntrophin, which has a single PDZ domain. As with N-methyl-d-aspartate (NMDA) receptors, ErbB4 interacts with the first two PDZ domains of PSD-95. Using coimmunoprecipitation assays, we confirmed the direct interactions between ErbB-4 and PSD-95 in transfected heterologous cells, as well as in vivo, where both proteins are coimmunoprecipitated from brain lysates. Moreover, evidence for colocalization of these proteins was also observed by immunofluorescence in cultured hippocampal neurons. ErbB-4 colocalizes with PSD-95 and NMDA receptors at a subset of excitatory synapses apposed to synaptophysin-positive presynaptic terminals. The capacity of ErbB receptors to interact with PDZ-domain proteins at cell junctions is conserved from invertebrates to mammals. As discussed, the interactions found between receptor tyrosine kinases and MAGUKs at neuronal synapses may have important implications for activity-dependent plasticity. PMID:10725395

  17. A single amino acid substitution is sufficient to modify the mitogenic properties of the epidermal growth factor receptor to resemble that of gp185erbB-2

    DEFF Research Database (Denmark)

    Di Fiore, P P; Helin, K; Kraus, M H

    1992-01-01

    The epidermal growth factor (EGF) receptor (EGFR) and the erbB-2 gene product, gp185erbB-2, exhibit distinct abilities to stimulate mitogenesis in different target cells. By using chimeric molecules between these two receptors, we have previously shown that their intracellular juxtamembrane regio...

  18. The irreversible ERBB1/2/4 inhibitor neratinib interacts with the BCL-2 inhibitor venetoclax to kill mammary cancer cells.

    Science.gov (United States)

    Booth, Laurence; Roberts, Jane L; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Poklepovic, Andrew; Dent, Paul

    2018-03-04

    The irreversible ERBB1/2/4 inhibitor, neratinib, down-regulates the expression of ERBB1/2/4 as well as the levels of MCL-1 and BCL-XL. Venetoclax (ABT199) is a BCL-2 inhibitor. At physiologic concentrations neratinib interacted in a synergistic fashion with venetoclax to kill HER2 + and TNBC mammary carcinoma cells. This was associated with the drug-combination: reducing the expression and phosphorylation of ERBB1/2/3; in an eIF2α-dependent fashion reducing the expression of MCL-1 and BCL-XL and increasing the expression of Beclin1 and ATG5; and increasing the activity of the ATM-AMPKα-ULK1 S317 pathway which was causal in the formation of toxic autophagosomes. Although knock down of BAX or BAK reduced drug combination lethality, knock down of BAX and BAK did not prevent the drug combination from increasing autophagosome and autolysosome formation. Knock down of ATM, AMPKα, Beclin1 or over-expression of activated mTOR prevented the induction of autophagy and in parallel suppressed tumor cell killing. Knock down of ATM, AMPKα, Beclin1 or cathepsin B prevented the drug-induced activation of BAX and BAK whereas knock down of BID was only partially inhibitory. A 3-day transient exposure of established estrogen-independent HER2 + BT474 mammary tumors to neratinib or venetoclax did not significantly alter tumor growth whereas exposure to [neratinib + venetoclax] caused a significant 7-day suppression of growth by day 19. The drug combination neither altered animal body mass nor behavior. We conclude that venetoclax enhances neratinib lethality by facilitating toxic BH3 domain protein activation via autophagy which enhances the efficacy of neratinib to promote greater levels of cell killing.

  19. ERBB2 mutation is associated with a worse prognosis in patients with CDH1 altered invasive lobular cancer of the breast.

    Science.gov (United States)

    Ping, Zheng; Siegal, Gene P; Harada, Shuko; Eltoum, Isam-Eldin; Youssef, Mariam; Shen, Tiansheng; He, Jianbo; Huang, Yingjie; Chen, Dongquan; Li, Yiping; Bland, Kirby I; Chang, Helena R; Shen, Dejun

    2016-12-06

    E-cadherin (CDH1) is a glycoprotein that mediates adhesion between epithelial cells and also suppresses cancer invasion. Mutation or deletion of the CDH1 gene has been reported in 30-60% cases of invasive lobular carcinoma (ILC). However, little is known about genomic differences between ILC with and without a CDH1 alteration. Therefore, we analyzed whole genome sequencing data of 169 ILC cases from The Cancer Genome Atlas (TCGA) to address this deficiency. Our study shows that CDH1 gene was altered in 59.2% (100/169) of ILC. No significant difference was identified between CDH1-altered and -unaltered ILC cases for any of the examined demographic, clinical or pathologic characteristics, including histologic grade, tumor stage, lymph node metastases, or ER/PR/HER2 states. Seven recurrent mutations (PTEN, MUC16, ERBB2, FAT4, PCDHGA2, HERC1 and FLNC) and four chromosomal changes with recurrent copy number variation (CNV) (11q13, 17q12-21, 8p11 and 8q11) were found in ILC, which correlated with a positive or negative CDH1 alteration status, respectively. The prevalence of the most common breast cancer driver abnormalities including TP53 and PIK3CA mutations and MYC and ERBB2 amplifications showed no difference between the two groups. However, CDH1-altered ILC with an ERBB2 mutation shows a significantly worse prognosis compared to its counterparts without such a mutation. Our study suggests that CDH1-altered ILC patients with ERBB2 mutations may represent an actionable group of patients who could benefit from targeted breast cancer therapy.

  20. Crystallization and preliminary crystallographic studies of the single-chain variable fragment of antibody chA21 in complex with an N-terminal fragment of ErbB2

    International Nuclear Information System (INIS)

    Liu, Yang; Zhou, Huihao; Zhu, Juanjuan; Gao, Yongxiang; Niu, Liwen; Liu, Jing; Teng, Maikun

    2009-01-01

    An antibody–antigen complex consisting of a single-chain variable fragment of the potential therapeutic antibody chA21 and an N-terminal fragment (residues 1–192) of the human ErbB2 extracellular domain was expressed, purified and crystallized. X-ray diffraction data were collected to 2.45 Å resolution. ErbB2 is a transmembrane tyrosine kinase, the overexpression of which causes abnormality and disorder in cell signalling and leads to cell transformation. Previously, an anti-ErbB2 single-chain chimeric antibody chA21 that specifically inhibits the growth of ErbB2-overexpressing cancer cells in vitro and in vivo was developed. Here, an antibody–antigen complex consisting of the single-chain variable fragment (scFv) of chA21 and an N-terminal fragment (residues 1–192, named EP I) of the ErbB2 extracellular domain was crystallized using the sitting-drop vapour-diffusion method. An X-ray diffraction data set was collected to 2.45 Å resolution from a single flash-cooled crystal; the crystal belonged to space group P2 1 2 1 2 1

  1. Clinical Significance of ErbB Receptor Family in Urothelial Carcinoma of the Bladder: A Systematic Review and Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Yuh-Shyan Tsai

    2012-01-01

    Full Text Available The prognostic importance of examining ErbB receptor family expression in human bladder cancer remains uncertain. Using published evidence, we examined the clinical value and the updated results of clinical trials targeting ErbB receptor family members. Twenty-seven articles from 65 references related to ErbB receptor expression assessment in bladder cancer were reviewed. The estimates included the association significance, hazard ratios, and 95% confidence intervals (CIs from actuarial curves and survival analyses. A meta-analysis was done on those reports using univariate log-rank tests or a Cox-regression model. The methods of analysis and study subjects chosen varied widely among studies. The overall risks of disease progression for patients with EGFR or ErbB2 overexpression were 4.5 (95% CI: 2.5–8.4 and 1.1 (95% CI: 0.6–1.9, and the risks of mortality were 3.0 (95% CI: 1.6–5.9 and 1.1 (95% CI: 1.0–1.2, respectively. However, the significance of coexpression patterns of the ErbB receptor family remains controversial. None of six clinical trials yielded convincing results for blockading ErbB receptor signaling in urothelial carcinoma. The results of this analysis suggest that assessing co-expression patterns of the ErbB family may provide better prognostic information for bladder cancer patients.

  2. Vitamin E analogs trigger apoptosis in HER2/erbB2-overexpressing breast cancer cells by signaling via the mitochondrial pathway

    Czech Academy of Sciences Publication Activity Database

    Wang, X.-F.; Witting, P. K.; Salvatore, B.A.; Neužil, Jiří

    2005-01-01

    Roč. 326, č. 4 (2005), s. 282-289 ISSN 0006-291X Institutional research plan: CEZ:AV0Z5052915; CEZ:AV0Z50520514 Keywords : vitamin E analogs * apoptosis * ErbB2 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.000, year: 2005

  3. Screening to Identify Commonly Used Chinese Herbs That Affect ERBB2 and ESR1 Gene Expression Using the Human Breast Cancer MCF-7 Cell Line

    Directory of Open Access Journals (Sweden)

    Jen-Hwey Chiu

    2014-01-01

    Full Text Available Aim. Our aim the was to screen the commonly used Chinese herbs in order to detect changes in ERBB2 and ESR1 gene expression using MCF-7 cells. Methods. Using the MCF-7 human breast cancer cell line, cell cytotoxicity and proliferation were evaluated by MTT and trypan blue exclusion assays, respectively. A luciferase reporter assay was established by transient transfecting MCF-7 cells with plasmids containing either the ERBB2 or the ESR1 promoter region linked to the luciferase gene. Chinese herbal extracts were used to treat the cells at 24 h after transfection, followed by measurement of their luciferase activity. The screening results were verified by Western blotting to measure HER2 and ERα protein expression. Results. At concentrations that induced little cytotoxicity, thirteen single herbal extracts and five compound recipes were found to increase either ERBB2 or ESR1 luciferase activity. By Western blotting, Si-Wu-Tang, Kuan-Shin-Yin, and Suan-Tsao-Ren-Tang were found to increase either HER2 or ERα protein expression. In addition, Ligusticum chuanxiong was shown to have a great effect on ERBB2 gene expression and synergistically with estrogen to stimulate MCF-7 cell growth. Conclusion. Our results provide important information that should affect clinical treatment strategies among breast cancer patients who are receiving hormonal or targeted therapies.

  4. The negative cell cycle regulator, Tob (transducer of ErbB-2), is involved in motor skill learning

    International Nuclear Information System (INIS)

    Wang Xinming; Gao Xiang; Zhang Xuehan; Tu Yanyang; Jin Meilei; Zhao Guoping; Yu Lei; Jing Naihe; Li Baoming

    2006-01-01

    Tob (transducer of ErbB-2) is a negative cell cycle regulator with anti-proliferative activity in peripheral tissues. Our previous study identified Tob as a protein involved in hippocampus-dependent memory consolidation (M.L. Jin, X.M. Wang, Y.Y. Tu, X.H. Zhang, X. Gao, N. Guo, Z.Q. Xie, G.P. Zhao, N.H. Jing, B.M. Li, Y.Yu, The negative cell cycle regulator, Tob (Transducer of ErbB-2), is a multifunctional protein involved in hippocampus-dependent learning and memory, Neuroscience 131 (2005) 647-659). Here, we provide evidence that Tob in the central nervous system is engaged in acquisition of motor skill. Tob has a relatively high expression in the cerebellum. Tob expression is up-regulated in the cerebellum after rats receive training on a rotarod-running task. Rats infused with Tob antisense oligonucleotides into the 4th ventricle exhibit a severe deficit in running on a rotating rod or walking across a horizontally elevated beam

  5. ErbB2 and NFκB overexpression as predictors of chemoradiation resistance and putative targets to overcome resistance in muscle-invasive bladder cancer.

    Directory of Open Access Journals (Sweden)

    Fumitaka Koga

    Full Text Available Radical cystectomy for muscle-invasive bladder cancer (MIBC patients frequently impairs their quality of life (QOL due to urinary diversion. To improve their QOL, a bladder-sparing alternative strategy using chemoradiation has been developed. In bladder-sparing protocols, complete response (CR to induction chemoradiation is a prerequisite for bladder preservation and favorable survival. Thus predicting chemoradiation resistance and overcoming it would increase individual MIBC patients' chances of bladder preservation. The aim of this study is to investigate putative molecular targets for treatment aimed at improving chemoradiation response. Expression levels of erbB2, NFκB, p53, and survivin were evaluated immunohistochemically in pretreatment biopsy samples from 35 MIBC patients in whom chemoradiation sensitivity had been pathologically evaluated in cystectomy specimens, and associations of these expression levels with chemoradiation sensitivity and cancer-specific survival (CSS were investigated. Of the 35 patients, 11 (31% achieved pathological CR, while tumors in the remaining 24 patients (69% were chemoradiation-resistant. Multivariate analysis identified erbB2 and NFκB overexpression and hydronephrosis as significant and independent risk factors for chemoradiation resistance with respective relative risks of 11.8 (P = 0.014, 15.4 (P = 0.024 and 14.3 (P = 0.038. The chemoradiation resistance rate was 88.5% for tumors overexpressing erbB2 and/or NFκB, but only 11.1% for those negative for both (P <0.0001. The 5-year CSS rate was 74% overall. Through multivariate analysis, overexpression of erbB2 and/or NFκB was identified as an independent risk factor for bladder cancer death with marginal significance (hazard ratio 21.5, P = 0.056 along with chemoradiation resistance (P = 0.003 and hydronephrosis (P = 0.018. The 5-year CSS rate for the 11 patients achieving pathological CR was 100%, while that for the 24 with

  6. A Common Variant in ERBB4 Regulates GABA Concentrations in Human Cerebrospinal Fluid

    NARCIS (Netherlands)

    Luykx, Jurjen J.; Vinkers, Christiaan H.; Bakker, Steven C.; Visser, Wouter F.; van Boxmeer, Loes; Strengman, Eric; van Eijk, Kristel R.; Lens, Judith A.; Borgdorff, Paul; Keijzers, Peter; Kappen, Teus H.; van Dongen, Eric P. A.; Bruins, Peter; Verhoeven, Nanda M.; de Koning, Tom J.; Kahn, Rene S.; Ophoff, Roel A.

    The neuregulin 1 (NRG1) receptor ErbB4 is involved in the development of cortical inhibitory GABAergic circuits and NRG1-ErbB4 signaling has been implicated in schizophrenia (SCZ). A magnetic resonance spectroscopy (H-1-MRS) study has demonstrated that a single-nucleotide polymorphism in ERBB4,

  7. RhNRG-1β Protects the Myocardium against Irradiation-Induced Damage via the ErbB2-ERK-SIRT1 Signaling Pathway.

    Directory of Open Access Journals (Sweden)

    Anxin Gu

    Full Text Available Radiation-induced heart disease (RIHD, which is a serious side effect of the radiotherapy applied for various tumors due to the inevitable irradiation of the heart, cannot be treated effectively using current clinical therapies. Here, we demonstrated that rhNRG-1β, an epidermal growth factor (EGF-like protein, protects myocardium tissue against irradiation-induced damage and preserves cardiac function. rhNRG-1β effectively ameliorated irradiation-induced myocardial nuclear damage in both cultured adult rat-derived cardiomyocytes and rat myocardium tissue via NRG/ErbB2 signaling. By activating ErbB2, rhNRG-1β maintained mitochondrial integrity, ATP production, respiratory chain function and the Krebs cycle status in irradiated cardiomyocytes. Moreover, the protection of irradiated cardiomyocytes and myocardium tissue by rhNRG-1β was at least partly mediated by the activation of the ErbB2-ERK-SIRT1 signaling pathway. Long-term observations further showed that rhNRG-1β administered in the peri-irradiation period exerts continuous protective effects on cardiac pump function, the myocardial energy metabolism, cardiomyocyte volume and interstitial fibrosis in the rats receiving radiation via NRG/ErbB2 signaling. Our findings indicate that rhNRG-1β can protect the myocardium against irradiation-induced damage and preserve cardiac function via the ErbB2-ERK-SIRT1 signaling pathway.

  8. A peptide conjugate of vitamin E succinate targets breast cancer cells with high erbB2 expression

    Czech Academy of Sciences Publication Activity Database

    Wang, X. F.; Birringer, M.; Dong, L.F.; Vepřek, Pavel; Low, P.; Swettenham, E.; Stantic, M.; Yuan, L. H.; Zobalová, Renata; Wu, K.; Ledvina, Miroslav; Ralph, S.J.; Neužil, Jiří

    2007-01-01

    Roč. 67, č. 7 (2007), s. 3337-3344 ISSN 0008-5472 R&D Projects: GA MZe QF3115 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50520514 Keywords : vitamin e E * erbB2 * breast cancer Subject RIV: CC - Organic Chemistry Impact factor: 7.672, year: 2007

  9. The ErbB family and androgen receptor signaling are targets of Celecoxib in prostate cancer.

    Science.gov (United States)

    Brizzolara, Antonella; Benelli, Roberto; Venè, Roberta; Barboro, Paola; Poggi, Alessandro; Tosetti, Francesca; Ferrari, Nicoletta

    2017-08-01

    Inflammation plays a central role in prostate cancer (PCa) development through significant crosstalk between the COX-2-ErbB family receptor network and androgen receptor (AR)-EGFR signaling pathways. The purpose of this work was to determine the ability of the COX-2 inhibitor Celecoxib to modulate the EGFR-AR signaling pathway in androgen-dependent PCa cells and to provide a rationale for its beneficial use in chemopreventive strategies. Functional studies of Celecoxib activity were performed on LNCaP prostate cancer cells. Western blotting, gene expression analysis, dual-luciferase reporter assay and ELISA were applied to assess the Celecoxib mechanisms of action. We found that Celecoxib, through EGF and amphiregulin (AREG) induction, caused EGFR and ErbB2 activation and consequent degradation associated with the inhibition of androgenic signaling. By upregulating the E3 ubiquitin ligase Nrdp1, Celecoxib also efficiently downregulated ErbB3, which is strongly implicated in castration-resistant prostate cancer. Lastly, Celecoxib directly regulated AR transcription and translation independent of ErbB activation by downregulating the RNA binding protein heterogeneous nuclear ribonucleoprotein K (hnRNP K). The simultaneous suppression of ErbB kinases and androgen signaling by Celecoxib represents a novel strategy to interrupt the vicious cycle of AR/ErbB cross-talk with the primary purpose of undermining their resilient signaling in prostate cancer progression. Our data provide important premises for the chemopreventive use of Celecoxib in the clinical management of prostate cancer. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Transducer of ERBB2.1 (TOB1) as a Tumor Suppressor: A Mechanistic Perspective.

    Science.gov (United States)

    Lee, Hun Seok; Kundu, Juthika; Kim, Ryong Nam; Shin, Young Kee

    2015-12-15

    Transducer of ERBB2.1 (TOB1) is a tumor-suppressor protein, which functions as a negative regulator of the receptor tyrosine-kinase ERBB2. As most of the other tumor suppressor proteins, TOB1 is inactivated in many human cancers. Homozygous deletion of TOB1 in mice is reported to be responsible for cancer development in the lung, liver, and lymph node, whereas the ectopic overexpression of TOB1 shows anti-proliferation, and a decrease in the migration and invasion abilities on cancer cells. Biochemical studies revealed that the anti-proliferative activity of TOB1 involves mRNA deadenylation and is associated with the reduction of both cyclin D1 and cyclin-dependent kinase (CDK) expressions and the induction of CDK inhibitors. Moreover, TOB1 interacts with an oncogenic signaling mediator, β-catenin, and inhibits β-catenin-regulated gene transcription. TOB1 antagonizes the v-akt murine thymoma viral oncogene (AKT) signaling and induces cancer cell apoptosis by activating BCL2-associated X (BAX) protein and inhibiting the BCL-2 and BCL-XL expressions. The tumor-specific overexpression of TOB1 results in the activation of other tumor suppressor proteins, such as mothers against decapentaplegic homolog 4 (SMAD4) and phosphatase and tensin homolog-10 (PTEN), and blocks tumor progression. TOB1-overexpressing cancer cells have limited potential of growing as xenograft tumors in nude mice upon subcutaneous implantation. This review addresses the molecular basis of TOB1 tumor suppressor function with special emphasis on its regulation of intracellular signaling pathways.

  11. Transducer of ERBB2.1 (TOB1 as a Tumor Suppressor: A Mechanistic Perspective

    Directory of Open Access Journals (Sweden)

    Hun Seok Lee

    2015-12-01

    Full Text Available Transducer of ERBB2.1 (TOB1 is a tumor-suppressor protein, which functions as a negative regulator of the receptor tyrosine-kinase ERBB2. As most of the other tumor suppressor proteins, TOB1 is inactivated in many human cancers. Homozygous deletion of TOB1 in mice is reported to be responsible for cancer development in the lung, liver, and lymph node, whereas the ectopic overexpression of TOB1 shows anti-proliferation, and a decrease in the migration and invasion abilities on cancer cells. Biochemical studies revealed that the anti-proliferative activity of TOB1 involves mRNA deadenylation and is associated with the reduction of both cyclin D1 and cyclin-dependent kinase (CDK expressions and the induction of CDK inhibitors. Moreover, TOB1 interacts with an oncogenic signaling mediator, β-catenin, and inhibits β-catenin-regulated gene transcription. TOB1 antagonizes the v-akt murine thymoma viral oncogene (AKT signaling and induces cancer cell apoptosis by activating BCL2-associated X (BAX protein and inhibiting the BCL-2 and BCL-XL expressions. The tumor-specific overexpression of TOB1 results in the activation of other tumor suppressor proteins, such as mothers against decapentaplegic homolog 4 (SMAD4 and phosphatase and tensin homolog-10 (PTEN, and blocks tumor progression. TOB1-overexpressing cancer cells have limited potential of growing as xenograft tumors in nude mice upon subcutaneous implantation. This review addresses the molecular basis of TOB1 tumor suppressor function with special emphasis on its regulation of intracellular signaling pathways.

  12. ERBB oncogene proteins as targets for monoclonal antibodies.

    Science.gov (United States)

    Polanovski, O L; Lebedenko, E N; Deyev, S M

    2012-03-01

    General properties of the family of tyrosine kinase ERBB receptors are considered in connection with their role in the generation of cascades of signal transduction in normal and tumor cells. Causes of acquisition of oncogene features by genes encoding these receptors and their role in tumorigenesis are analyzed. Anti-ERBB monoclonal antibodies approved for therapy are described in detail, and mechanisms of their antitumor activity and development of resistance to them are reviewed. The existing and the most promising strategies for creating and using monoclonal antibodies and their derivatives for therapy of cancer are discussed.

  13. Breast cancer cells can switch between estrogen receptor alpha and ErbB signaling and combined treatment against both signaling pathways postpones development of resistance

    DEFF Research Database (Denmark)

    Sonne-Hansen, Katrine; Norrie, Ida C; Emdal, Kristina Bennet

    2010-01-01

    circumvent development of resistance. Limited effects were observed when targeting EGFR and ErbB2 with the monoclonal antibodies cetuximab, trastuzumab, and pertuzumab, whereas the pan-ErbB inhibitor CI-1033 selectively inhibited growth of fulvestrant resistant cell lines. CI-1033 inhibited Erk but not Akt...

  14. ErbB Proteins as Molecular Target of Dietary Phytochemicals in Malignant Diseases

    Directory of Open Access Journals (Sweden)

    Alexandru Filippi

    2017-01-01

    Full Text Available ErbB proteins overexpression, in both normal and mutated forms, is associated with invasive forms of cancer prone to metastasis and with stronger antiapoptotic mechanisms and therefore more challenging to treat. Downstream effectors of ErbB receptors mediating these phenotypic traits include MAPK, STAT, and PI3K/AKT/mTOR pathways. Various phytochemical compounds were studied for their large number of biological effects including anticancer activity. Among these compounds, epigallocatechin-3-gallate (EGCG, the main catechin from green tea leaves, and curcumin, component of the curry powder, constituted the object of numerous studies. Both compounds were shown to act directly either on ErbB expression, or on their downstream signaling molecules. In this paper we aim to review the involvement of ErbB proteins in cancer as well as the biologic activity of EGCG and curcumin in ErbB expressing and overexpressing malignancies. The problems arising in the administration of the two compounds due to their reduced bioavailability when orally administered, as well as the progress made in this field, from using novel formulations to improved dosing regimens or improved synthetic analogs, are also discussed.

  15. p53, erbB-2 and K-ras gene alterations are rare in spontaneous and plutonium-239-induced canine lung neoplasia

    International Nuclear Information System (INIS)

    Tierney, L.A.; Hahn, F.F.; Lechner, J.F.

    1996-01-01

    Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to 239 PuO 2 and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185 erbB2 ) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and 239 PuO 2 -induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs

  16. Dynamic ErbB4 Activity in Hippocampal-Prefrontal Synchrony and Top-Down Attention in Rodents.

    Science.gov (United States)

    Tan, Zhibing; Robinson, Heath L; Yin, Dong-Min; Liu, Yu; Liu, Fang; Wang, Hongsheng; Lin, Thiri W; Xing, Guanglin; Gan, Lin; Xiong, Wen-Cheng; Mei, Lin

    2018-04-18

    Top-down attention is crucial for meaningful behaviors and impaired in various mental disorders. However, its underpinning regulatory mechanisms are poorly understood. We demonstrate that the hippocampal-prefrontal synchrony associates with levels of top-down attention. Both attention and synchrony are reduced in mutant mice of ErbB4, a receptor of neuregulin-1. We used chemical genetic and optogenetic approaches to inactivate ErbB4 kinase and ErbB4+ interneurons, respectively, both of which reduce gamma-aminobutyric acid (GABA) activity. Such inhibitions in the hippocampus impair both hippocampal-prefrontal synchrony and top-down attention, whereas those in the prefrontal cortex alter attention, but not synchrony. These observations identify a role of ErbB4-dependent GABA activity in the hippocampus in synchronizing the hippocampal-prefrontal pathway and demonstrate that acute, dynamic ErbB4 signaling is required to command top-down attention. Because both neuregulin-1 and ErbB4 are susceptibility genes of schizophrenia and major depression, our study contributes to a better understanding of these disorders. VIDEO ABSTRACT. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Endothelial ErbB4 deficit induces alterations in exploratory behavior and brain energy metabolism in mice.

    Science.gov (United States)

    Wu, Gang; Liu, Xiu-Xiu; Lu, Nan-Nan; Liu, Qi-Bing; Tian, Yun; Ye, Wei-Feng; Jiang, Guo-Jun; Tao, Rong-Rong; Han, Feng; Lu, Ying-Mei

    2017-06-01

    The receptor tyrosine kinase ErbB4 is present throughout the primate brain and has a distinct functional profile. In this study, we investigate the potential role of endothelial ErbB4 receptor signaling in the brain. Here, we show that the endothelial cell-specific deletion of ErbB4 induces decreased exploratory behavior in adult mice. However, the water maze task for spatial memory and the memory reconsolidation test reveal no changes; additionally, we observe no impairment in CaMKII phosphorylation in Cdh5Cre;ErbB4 f/f mice, which indicates that the endothelial ErbB4 deficit leads to decreased exploratory activity rather than direct memory deficits. Furthermore, decreased brain metabolism, which was measured using micro-positron emission tomography, is observed in the Cdh5Cre;ErbB4 f/f mice. Consistently, the immunoblot data demonstrate the downregulation of brain Glut1, phospho-ULK1 (Ser555), and TIGAR in the endothelial ErbB4 conditional knockout mice. Collectively, our findings suggest that endothelial ErbB4 plays a critical role in regulating brain function, at least in part, through maintaining normal brain energy homeostasis. Targeting ErbB4 or the modulation of endothelial ErbB4 signaling may represent a rational pharmacological approach to treat neurological disorders. © 2017 John Wiley & Sons Ltd.

  18. Increased level of phosphorylated akt measured by chemiluminescence-linked immunosorbent assay is a predictor of poor prognosis in primary breast cancer overexpressing ErbB-2

    International Nuclear Information System (INIS)

    Cicenas, Jonas; Urban, Patrick; Vuaroqueaux, Vincent; Labuhn, Martin; Küng, Willy; Wight, Edward; Mayhew, Mark; Eppenberger, Urs; Eppenberger-Castori, Serenella

    2005-01-01

    Akt1, Akt2 and Akt3 kinases are downstream components of phosphoinositol 3-kinase derived signals from receptor tyrosine kinases, which influence cell growth, proliferation and survival. Akt2 overexpression and amplification have been described in breast, ovarian and pancreatic cancers. The present study was designed to investigate the prognostic significance of activated Akt in primary breast cancer and its association with other tumour biomarkers. Using a two-site chemiluminescence-linked immunosorbent assay, we measured the quantitative expression levels of total phosphorylated (P-S473) Akt (Akt1/Akt2/Akt3) on cytosol fractions obtained from fresh frozen tissue samples of 156 primary breast cancer patients. Akt phosphorylation was not associated with nodal status or ErbB-2 protein expression levels. High levels of phosphorylated Akt correlated (P < 0.01) with poor prognosis, and the significance of this correlation increased (P < 0.001) in the subset of patients with ErbB-2 overexpressing tumours. In addition, phosphorylated Akt was found to be associated with mRNA expression levels of several proliferation markers (e.g. thymidylate synthase), measured using quantitative real-time RT-PCR. Our findings demonstrate that, in breast cancer patients, Akt activation is associated with tumour proliferation and poor prognosis, particularly in the subset of patients with ErbB2-overexpressing tumours

  19. ErbB1-4-dependent EGF/neuregulin signals and their cross talk in the central nervous system: pathological implications in schizophrenia and Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Yuriko eIwakura

    2013-02-01

    Full Text Available Ligands for ErbB1-4 receptor tyrosine kinases, such as epidermal growth factor (EGF and neuregulins, regulate brain development and function. Thus, abnormalities in their signaling are implicated in the etiology or pathology of schizophrenia and Parkinson’s disease. Among the ErbB receptors, ErbB1 and ErbB4 are expressed in dopamine and GABA neurons, while ErbB1, 2, and/or 3 are mainly present in oligodendrocytes, astrocytes and their precursors. Thus, deficits in ErbB signaling might contribute to schizophrenia neuropathology stemming from these cell types. By incorporating the latest cancer molecular biology as well as our recent progress, we discuss signal cross talk between the ErbB1-4 subunits and their neurobiological functions in each cell type. The potential contribution of virus-derived cytokines (virokines that mimic EGF and neuregulin-1 in brain diseases are also discussed.

  20. Activation of ErbB3, EGFR and Erk is essential for growth of human breast cancer cell lines with acquired resistance to fulvestrant

    DEFF Research Database (Denmark)

    Frogne, Thomas; Benjaminsen, Rikke; Sonne-Hansen, Katrine

    2008-01-01

    cell lines concomitant with inhibition of Erk and unaltered Akt activation. In concert, inhibition of Erk with U0126 preferentially reduced growth of resistant cell lines. Treatment with ErbB3 neutralizing antibodies inhibited ErbB3 activation and resulted in a modest but statistically significant...... activation was observed only in the parental MCF-7 cells. The downstream kinases pAkt and pErk were increased in five of seven and in all seven resistant cell lines, respectively. Treatment with the EGFR inhibitor gefitinib preferentially inhibited growth and reduced the S phase fraction in the resistant...... growth inhibition of two resistant cell lines. These data indicate that ligand activated ErbB3 and EGFR, and Erk signaling play important roles in fulvestrant resistant cell growth. Furthermore, the decreased level of ErbB4 in resistant cells may facilitate heterodimerization of ErbB3 with EGFR and ErbB2...

  1. The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib.

    Science.gov (United States)

    Booth, Laurence; Roberts, Jane L; Poklepovic, Andrew; Kirkwood, John; Sander, Cindy; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Dent, Paul

    2018-02-01

    The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins.

  2. Identification of a novel antagonist of the ErbB1 receptor capable of inhibiting migration of human glioblastoma cells

    DEFF Research Database (Denmark)

    Staberg, Mikkel; Riemer, Christian; Xu, Ruodan

    2013-01-01

    B1 targeting peptide, termed Herfin-1, was designed based on a model of the tertiary structure of the EGF-EGFR ternary complex. The binding kinetics of this peptide were determined employing surface plasmon resonance analyses. ErbB1-4 expression and phosphorylation in human glioblastoma cell lines U...... processing. RESULTS: The present study shows that Herfin-1 functions as an ErbB1 antagonist. It binds to the extracellular domain of ErbB1 with a KD value of 361 nM. In U87 and U118 cells, both expressing high levels of ErbB1, Herfin-1 inhibits EGF-induced ErbB1 phosphorylation and cell migration....... Additionally, Herfin-1 was found to increase neurite outgrowth in cerebellar granule neurons, likely through the inhibition of a sustained weak ErbB1 activation. CONCLUSIONS: Targeting the ErbB1 receptor dimerization interface is a promising strategy to inhibit receptor activation in ErbB1-expressing glioma...

  3. Neratinib Plus Paclitaxel vs Trastuzumab Plus Paclitaxel in Previously Untreated Metastatic ERBB2-Positive Breast Cancer: The NEfERT-T Randomized Clinical Trial.

    Science.gov (United States)

    Awada, Ahmad; Colomer, Ramon; Inoue, Kenichi; Bondarenko, Igor; Badwe, Rajendra A; Demetriou, Georgia; Lee, Soo-Chin; Mehta, Ajay O; Kim, Sung-Bae; Bachelot, Thomas; Goswami, Chanchal; Deo, Suryanarayan; Bose, Ron; Wong, Alvin; Xu, Feng; Yao, Bin; Bryce, Richard; Carey, Lisa A

    2016-12-01

    Efficacious ERBB2 (formerly HER2 or HER2/neu)-directed treatments, in addition to trastuzumab and lapatinib, are needed. To determine whether neratinib, an irreversible pan-ERBB tyrosine kinase inhibitor, plus paclitaxel improves progression-free survival compared with trastuzumab plus paclitaxel in the first-line treatment of recurrent and/or metastatic ERBB2-positive breast cancer. In the randomized, controlled, open-label NEfERT-T trial conducted from August 2009 to December 2014 at 188 centers in 34 countries in Europe, Asia, Africa, and North America, 479 women with previously untreated recurrent and/or metastatic ERBB2-positive breast cancer were randomized to 1 of 2 treatment arms (neratinib-paclitaxel [n = 242] or trastuzumab-paclitaxel [n = 237]). Women with asymptomatic central nervous system metastases were eligible, and randomization was stratified by prior trastuzumab and lapatinib exposure, hormone-receptor status, and region. Women received neratinib (240 mg/d orally) or trastuzumab (4 mg/kg then 2 mg/kg weekly), each combined with paclitaxel (80 mg/m2 on days 1, 8, and 15 every 28 days). Primary prophylaxis for diarrhea was not mandatory. The primary outcome was progression-free survival. Secondary end points were response rate, clinical benefit rate, duration of response, frequency, and time to symptomatic and/or progressive central nervous system lesions, and safety. The intent-to-treat population comprised 479 women 18 years or older (neratinib-paclitaxel, n = 242; trastuzumab-paclitaxel, n = 237) randomized and stratified in their respective treatment arms by prior trastuzumab and lapatinib exposure, hormone-receptor status, and region. Median progression-free survival was 12.9 months (95% CI, 11.1-14.9) with neratinib-paclitaxel and 12.9 months (95% CI, 11.1-14.8) with trastuzumab-paclitaxel (hazard ratio [HR], 1.02; 95% CI, 0.81-1.27; P =.89). With neratinib-paclitaxel, the incidence of central nervous system recurrences was

  4. Down-Regulation of Neuregulin1/ErbB4 Signaling in the Hippocampus Is Critical for Learning and Memory.

    Science.gov (United States)

    Tian, Jia; Geng, Fei; Gao, Feng; Chen, Yi-Hua; Liu, Ji-Hong; Wu, Jian-Lin; Lan, Yu-Jie; Zeng, Yuan-Ning; Li, Xiao-Wen; Yang, Jian-Ming; Gao, Tian-Ming

    2017-08-01

    Hippocampal function is important for learning and memory, and dysfunction of the hippocampus has been linked to the pathophysiology of neuropsychiatric diseases such as schizophrenia. Neuregulin1 (NRG1) and ErbB4, two susceptibility genes for schizophrenia, reportedly modulate long-term potentiation (LTP) at hippocampal Schaffer collateral (SC)-CA1 synapses. However, little is known regarding the contribution of hippocampal NRG1/ErbB4 signaling to learning and memory function. Here, quantitative real-time PCR and Western blotting were used to assess the mRNA and protein levels of NRG1 and ErbB4. Pharmacological and genetic approaches were used to manipulate NRG1/ErbB4 signaling, following which learning and memory behaviors were evaluated using the Morris water maze, Y-maze test, and the novel object recognition test. Spatial learning was found to reduce hippocampal NRG1 and ErbB4 expression. The blockade of NRG1/ErbB4 signaling in hippocampal CA1, either by neutralizing endogenous NRG1 or inhibiting/ablating ErbB4 receptor activity, enhanced hippocampus-dependent spatial learning, spatial working memory, and novel object recognition memory. Accordingly, administration of exogenous NRG1 impaired those functions. More importantly, the specific ablation of ErbB4 in parvalbumin interneurons also improved learning and memory performance. The manipulation of NRG1/ErbB4 signaling in the present study revealed that NRG1/ErbB4 activity in the hippocampus is critical for learning and memory. These findings might provide novel insights on the pathophysiological mechanisms of schizophrenia and a new target for the treatment of Alzheimer's disease, which is characterized by a progressive decline in cognitive function.

  5. ErbB3 mRNA leukocyte levels as a biomarker for major depressive disorder

    Directory of Open Access Journals (Sweden)

    Milanesi Elena

    2012-09-01

    Full Text Available Abstract Background In recent years, the identification of peripheral biomarkers that are associated with psychiatric diseases, such as Major Depressive Disorder (MDD, has become relevant because these biomarkers may improve the efficiency of the differential diagnosis process and indicate targets for new antidepressant drugs. Two recent candidate genes, ErbB3 and Fgfr1, are growth factors whose mRNA levels have been found to be altered in the leukocytes of patients that are affected by bipolar disorder in a depressive state. On this basis, the aim of the study was to determine if ErbB3 and Fgfr1 mRNA levels could be a biomarkers of MDD. Methods We measured by Real Time PCR ErbB3 and Fgfr1 mRNA expression levels in leukocytes of MDD patients compared with controls. Successively, to assess whether ErbB3 mRNA levels were influenced by previous antidepressant treatment we stratified our patients sample in two cohorts, comparing drug-naive versus drug-free patients. Moreover, we evaluated the levels of the transcript in MDD patients after 12 weeks of antidepressant treatment, and in prefrontal cortex of rats stressed and treated with an antidepressant drug of the same class. Results These results showed that ErbB3 but not Fgfr1 mRNA levels were reduced in leukocytes of MDD patients compared to healthy subjects. Furthermore, ErbB3 levels were not affected by antidepressant treatment in either human or animal models Conclusions Our data suggest that ErbB3 might be considered as a biomarker for MDD and that its deficit may underlie the pathopsysiology of the disease and is not a consequence of treatment. Moreover the study supports the usefulness of leukocytes as a peripheral system for identifying biomarkers in psychiatric diseases.

  6. miR-125b acts as a tumor suppressor in chondrosarcoma cells by the sensitization to doxorubicin through direct targeting the ErbB2-regulated glucose metabolism.

    Science.gov (United States)

    Tang, Xian-ye; Zheng, Wei; Ding, Min; Guo, Kai-jin; Yuan, Feng; Feng, Hu; Deng, Bin; Sun, Wei; Hou, Yang; Gao, Lu

    2016-01-01

    Chondrosarcoma is the second most common type of primary bone malignancy in the United States after osteosarcoma. Surgical resections of these tumors are the only effective treatment to chondrosarcoma patients due to their resistance to conventional chemo- and radiotherapy. In this study, miR-125b was found to perform its tumor-suppressor function to inhibit glucose metabolism via the direct targeting of oncogene, ErbB2. We report miR-125b was downregulated in both chondrosarcoma patient samples and cell lines. The total 20 Asian chondrosarcoma patients showed significantly downregulated miR-125b expression compared with normal tissues. Meanwhile, miR-125 was downregulated in chondrosarcoma cells and doxorubicin resistant cells. Overexpression of miR-125 enhanced the sensitivity of both parental and doxorubicin resistant cells to doxorubicin through direct targeting on the ErbB2-mediated upregulation of glycolysis in chondrosarcoma cells. Moreover, restoration of the expression of ErbB2 and glucose metabolic enzymes in miR-125 pretransfected cells recovered the susceptibility to doxorubicin. Our study will provide a novel aspect on the overcoming chemoresistance in human chondrosarcoma cells and may help in the development of therapeutic strategies for the treatments of patients.

  7. Towards the emerging crosstalk: ERBB family and steroid hormones.

    Science.gov (United States)

    D'Uva, Gabriele; Lauriola, Mattia

    2016-02-01

    Growth factors acting through receptor tyrosine kinases (RTKs) of ERBB family, along with steroid hormones (SH) acting through nuclear receptors (NRs), are critical signalling mediators of cellular processes. Deregulations of ERBB and steroid hormone receptors are responsible for several diseases, including cancer, thus demonstrating the central role played by both systems. This review will summarize and shed light on an emerging crosstalk between these two important receptor families. How this mutual crosstalk is attained, such as through extensive genomic and non-genomic interactions, will be addressed. In light of recent studies, we will describe how steroid hormones are able to fine-tune ERBB feedback loops, thus impacting on cellular output and providing a new key for understanding the complexity of biological processes in physiological or pathological conditions. In our understanding, the interactions between steroid hormones and RTKs deserve further attention. A system biology approach and advanced technologies for the analysis of RTK-SH crosstalk could lead to major advancements in molecular medicine, providing the basis for new routes of pharmacological intervention in several diseases, including cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. The genetic and regulatory architecture of ERBB3-type 1 diabetes susceptibility locus

    DEFF Research Database (Denmark)

    Kaur, Simranjeet; Mirza, Aashiq H.; Brorsson, Caroline Anna

    2016-01-01

    -producing INS-1E cells and the genetic and regulatory architecture of the ERBB3 locus to provide insights to how rs2292239 may confer disease susceptibility. rs2292239 strongly correlated with residual β-cell function and metabolic control in children with T1D. ERBB3 locus associated lncRNA (NONHSAG011351...

  9. The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib

    OpenAIRE

    Booth, Laurence; Roberts, Jane L.; Poklepovic, Andrew; Kirkwood, John; Sander, Cindy; Avogadri-Connors, Francesca; Cutler Jr, Richard E.; Lalani, Alshad S.; Dent, Paul

    2017-01-01

    ABSTRACT The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFR...

  10. Molecularly targeted therapy for the treatment of head and neck cancer: a review of the ErbB family inhibitors

    Directory of Open Access Journals (Sweden)

    Sacco AG

    2016-04-01

    Full Text Available Assuntina G Sacco,1 Francis P Worden2 1Department of Internal Medicine, Division of Hematology/Oncology, University of California at San Diego Moores Cancer Center, La Jolla, CA, USA; 2Department of Internal Medicine, Division of Hematology/Oncology, University of Michigan Health System, Ann Arbor, MI, USA Abstract: The majority of patients with head and neck squamous cell carcinoma (HNSCC present with locally advanced disease, which requires site-specific combinations of surgery, radiation, and chemotherapy. Despite aggressive therapy, survival outcomes remain poor, and treatment-related morbidity is not negligible. For patients with recurrent or metastatic disease, therapeutic options are further limited and prognosis is dismal. With this in mind, molecularly targeted therapy provides a promising approach to optimizing treatment efficacy while minimizing associated toxicity. The ErbB family of receptors (ie, epidermal growth factor receptor [EGFR], ErbB2/human epidermal growth factor receptor [HER]-2, ErbB3/HER3, and ErbB4/HER4 is known to contribute to oncogenic processes, such as cellular proliferation and survival. EGFR, specifically, is upregulated in more than 90% of HNSCC, has been implicated in radiation resistance, and correlates with poorer clinical outcomes. The central role of EGFR in the pathogenesis of HNSCC suggests that inhibition of this pathway represents an attractive treatment strategy. As a result, EGFR inhibition has been extensively studied, with the emergence of two classes of drug therapy: monoclonal antibodies and tyrosine kinase inhibitors. While the monoclonal antibody cetuximab is currently the only US Food and Drug Administration–approved EGFR inhibitor for the treatment of HNSCC, numerous investigational drugs are being evaluated in clinical trials. This paper will review the role of the ErbB family in the pathogenesis of HNSCC, as well as the evidence-based data for the use of ErbB family inhibition in clinical

  11. A novel mouse monoclonal antibody targeting ErbB2 suppresses breast cancer growth

    Energy Technology Data Exchange (ETDEWEB)

    Kawa, Seiji [Division of Oncology, Institute of Medical Science, University of Tokyo, Shirokanedai 4-6-1, Minato-ku, Tokyo 108-8639 (Japan); Matsushita, Hirohisa; Ohbayashi, Hirokazu [Department of Research and Development, Nichirei Biosciences Inc., Tokyo 104-8402 (Japan); Semba, Kentaro [Department of Life Science and Medical Bio-Science, School of Science and Engineering, Waseda University, Tokyo 169-8555 (Japan); Yamamoto, Tadashi, E-mail: tyamamot@ims.u-tokyo.ac.jp [Division of Oncology, Institute of Medical Science, University of Tokyo, Shirokanedai 4-6-1, Minato-ku, Tokyo 108-8639 (Japan)

    2009-07-03

    Overexpression of ErbB2 in breast cancer is associated with increased recurrence and worse prognosis. Accumulating evidences suggest that molecular targeted therapy is a promising anticancer strategy. In this study, we produced a novel anti-ErbB2 monoclonal antibody, 6G10, that recognized an epitope distinct from the trastuzumab binding site. 6G10 induced aggregation of BT474 breast cancer cells and inhibited proliferation of various breast cancer cell lines including BT474. A growth inhibition assay showed that 6G10 had EC{sub 50} values comparable to trastuzumab, indicating that the drugs have a similar level of potency. Furthermore, intraperitoneal administration of 6G10 completely inhibited the growth of xenografted tumors derived from BT474 and SK-BR-3 cells. These data suggested that 6G10 has great therapeutic potential and could be administered to patients alternatively, or synergistically, with trastuzumab.

  12. Modeling ERBB receptor-regulated G1/S transition to find novel targets for de novo trastuzumab resistance

    Directory of Open Access Journals (Sweden)

    Thieffry Denis

    2009-01-01

    Full Text Available Abstract Background In breast cancer, overexpression of the transmembrane tyrosine kinase ERBB2 is an adverse prognostic marker, and occurs in almost 30% of the patients. For therapeutic intervention, ERBB2 is targeted by monoclonal antibody trastuzumab in adjuvant settings; however, de novo resistance to this antibody is still a serious issue, requiring the identification of additional targets to overcome resistance. In this study, we have combined computational simulations, experimental testing of simulation results, and finally reverse engineering of a protein interaction network to define potential therapeutic strategies for de novo trastuzumab resistant breast cancer. Results First, we employed Boolean logic to model regulatory interactions and simulated single and multiple protein loss-of-functions. Then, our simulation results were tested experimentally by producing single and double knockdowns of the network components and measuring their effects on G1/S transition during cell cycle progression. Combinatorial targeting of ERBB2 and EGFR did not affect the response to trastuzumab in de novo resistant cells, which might be due to decoupling of receptor activation and cell cycle progression. Furthermore, examination of c-MYC in resistant as well as in sensitive cell lines, using a specific chemical inhibitor of c-MYC (alone or in combination with trastuzumab, demonstrated that both trastuzumab sensitive and resistant cells responded to c-MYC perturbation. Conclusion In this study, we connected ERBB signaling with G1/S transition of the cell cycle via two major cell signaling pathways and two key transcription factors, to model an interaction network that allows for the identification of novel targets in the treatment of trastuzumab resistant breast cancer. Applying this new strategy, we found that, in contrast to trastuzumab sensitive breast cancer cells, combinatorial targeting of ERBB receptors or of key signaling intermediates does not

  13. PAX2 is activated by estradiol in breast cancer cells of the luminal subgroup selectively, to confer a low invasive phenotype

    Science.gov (United States)

    2011-01-01

    Background Metastasis is the leading cause of death among breast cancer patients. Identifying key cellular factors controlling invasion and metastasis of breast cancer cells should pave the way to new therapeutic strategies efficiently interfering with the metastatic process. PAX2 (paired box 2) transcription factor is expressed by breast cancer cells in vivo and recently, it was shown to negatively regulate the expression of ERBB2 (erythroblastic leukemia viral oncogene homolog 2, HER-2/neu), a well-documented pro-invasive and pro-metastastic gene, in luminal/ERalpha-positive (ERα+) breast cancer cells. The objective of the present study was to investigate a putative role for PAX2 in the control of luminal breast cancer cells invasion, and to begin to characterize its regulation. Results PAX2 activity was higher in cell lines from luminal compared to non-luminal subtype, and activation of PAX2 by estradiol was selectively achieved in breast cancer cell lines of the luminal subtype. This process was blocked by ICI 182780 and could be antagonized by IGF-1. Knockdown of PAX2 in luminal MCF-7 cells completely abrogated estradiol-induced downregulation of ERBB2 and decrease of cell invasion, whereas overexpression of PAX2 in these cells enhanced estradiol effects on ERBB2 levels and cell invasion. Conclusions The study demonstrates that PAX2 activation by estradiol is selectively achieved in breast cancer cells of the luminal subtype, via ERα, and identifies IGF-1 as a negative regulator of PAX2 activity in these cells. Further, it reveals a new role for PAX2 in the maintenance of a low invasive behavior in luminal breast cancer cells upon exposure to estradiol, and shows that overexpression and activation of PAX2 in these cells is sufficient to reduce their invasive ability. PMID:22168360

  14. A Novel Screen for Suppressors of Breast Tumor Cell Growth Using an Oriented Random Peptide Library Method to Identify Inhibitors of the ErbB2 Tyrosine Kinase

    National Research Council Canada - National Science Library

    Carraway, Kermit

    1998-01-01

    .... To identify potential antagonists, the extracellular ligand binding domain of the ErbB2 is immobilized on a column support, and used to affinity purify cyclic peptides from oriented random peptide libraries...

  15. A Novel Screen for Suppressors of Breast Tumor Cell Growth Using an Oriented Random Peptide Library Method to Identify Inhibitors of the ErbB2 Tyrosine Kinase

    National Research Council Canada - National Science Library

    Carraway, Kermit

    1999-01-01

    .... To identify potential antagonists, the extracellular ligand binding domain of the ErbB2 is immobilized on a column support, and used to affinity purify cyclic peptides from oriented random peptide libraries...

  16. tabAnti-HER2 (erbB-2) oncogene effects of phenolic compounds directly isolated from commercial Extra-Virgin Olive Oil (EVOO)

    International Nuclear Information System (INIS)

    Menendez, Javier A; Vazquez-Martin, Alejandro; Garcia-Villalba, Rocio; Carrasco-Pancorbo, Alegria; Oliveras-Ferraros, Cristina; Fernandez-Gutierrez, Alberto; Segura-Carretero, Antonio

    2008-01-01

    The effects of the olive oil-rich Mediterranean diet on breast cancer risk might be underestimated when HER2 (ERBB2) oncogene-positive and HER2-negative breast carcinomas are considered together. We here investigated the anti-HER2 effects of phenolic fractions directly extracted from Extra Virgin Olive Oil (EVOO) in cultured human breast cancer cell lines. Solid phase extraction followed by semi-preparative high-performance liquid chromatography (HPLC) was used to isolate phenolic fractions from commercial EVOO. Analytical capillary electrophoresis coupled to mass spectrometry was performed to check for the composition and to confirm the identity of the isolated fractions. EVOO polyphenolic fractions were tested on their tumoricidal ability against HER2-negative and HER2-positive breast cancer in vitro models using MTT, crystal violet staining, and Cell Death ELISA assays. The effects of EVOO polyphenolic fractions on the expression and activation status of HER2 oncoprotein were evaluated using HER2-specific ELISAs and immunoblotting procedures, respectively. Among the fractions mainly containing the single phenols hydroxytyrosol and tyrosol, the polyphenol acid elenolic acid, the lignans (+)-pinoresinol and 1-(+)-acetoxypinoresinol, and the secoiridoids deacetoxy oleuropein aglycone, ligstroside aglycone, and oleuropein aglycone, all the major EVOO polyphenols (i.e. secoiridoids and lignans) were found to induce strong tumoricidal effects within a micromolar range by selectively triggering high levels of apoptotic cell death in HER2-overexpressors. Small interfering RNA-induced depletion of HER2 protein and lapatinib-induced blockade of HER2 tyrosine kinase activity both significantly prevented EVOO polyphenols-induced cytotoxicity. EVOO polyphenols drastically depleted HER2 protein and reduced HER2 tyrosine autophosphorylation in a dose- and time-dependent manner. EVOO polyphenols-induced HER2 downregulation occurred regardless the molecular mechanism

  17. tabAnti-HER2 (erbB-2 oncogene effects of phenolic compounds directly isolated from commercial Extra-Virgin Olive Oil (EVOO

    Directory of Open Access Journals (Sweden)

    Carrasco-Pancorbo Alegria

    2008-12-01

    Full Text Available Abstract Background The effects of the olive oil-rich Mediterranean diet on breast cancer risk might be underestimated when HER2 (ERBB2 oncogene-positive and HER2-negative breast carcinomas are considered together. We here investigated the anti-HER2 effects of phenolic fractions directly extracted from Extra Virgin Olive Oil (EVOO in cultured human breast cancer cell lines. Methods Solid phase extraction followed by semi-preparative high-performance liquid chromatography (HPLC was used to isolate phenolic fractions from commercial EVOO. Analytical capillary electrophoresis coupled to mass spectrometry was performed to check for the composition and to confirm the identity of the isolated fractions. EVOO polyphenolic fractions were tested on their tumoricidal ability against HER2-negative and HER2-positive breast cancer in vitro models using MTT, crystal violet staining, and Cell Death ELISA assays. The effects of EVOO polyphenolic fractions on the expression and activation status of HER2 oncoprotein were evaluated using HER2-specific ELISAs and immunoblotting procedures, respectively. Results Among the fractions mainly containing the single phenols hydroxytyrosol and tyrosol, the polyphenol acid elenolic acid, the lignans (+-pinoresinol and 1-(+-acetoxypinoresinol, and the secoiridoids deacetoxy oleuropein aglycone, ligstroside aglycone, and oleuropein aglycone, all the major EVOO polyphenols (i.e. secoiridoids and lignans were found to induce strong tumoricidal effects within a micromolar range by selectively triggering high levels of apoptotic cell death in HER2-overexpressors. Small interfering RNA-induced depletion of HER2 protein and lapatinib-induced blockade of HER2 tyrosine kinase activity both significantly prevented EVOO polyphenols-induced cytotoxicity. EVOO polyphenols drastically depleted HER2 protein and reduced HER2 tyrosine autophosphorylation in a dose- and time-dependent manner. EVOO polyphenols-induced HER2 downregulation

  18. Ablating ErbB4 in PV neurons attenuates synaptic and cognitive deficits in an animal model of Alzheimer's disease.

    Science.gov (United States)

    Zhang, Heng; Zhang, Ling; Zhou, Dongming; He, Xiao; Wang, Dongpi; Pan, Hongyu; Zhang, Xiaoqin; Mei, Yufei; Qian, Qi; Zheng, Tingting; Jones, Frank E; Sun, Binggui

    2017-10-01

    Accumulation of amyloid β (Aβ) induces neuronal, synaptic, and cognitive deficits in patients and animal models of Alzheimer's disease (AD). The underlying mechanisms, however, remain to be fully elucidated. In the present study, we found that Aβ interacted with ErbB4, a member of the receptor tyrosine kinase family and mainly expressed in GABAergic interneurons. Deleting ErbB4 in parvalbumin-expressing neurons (PV neurons) significantly attenuated oligomeric Aβ-induced suppression of long term potentiation (LTP). Furthermore, specific ablation of ErbB4 in PV neurons via Cre/loxP system greatly improved spatial memory and synaptic plasticity in the hippocampus of hAPP-J20 mice. The deposition of Aβ detected by 3D6 and Thioflavin S staining and the proteolytic processing of hAPP analyzed by western blotting were not affected in the hippocampus of hAPP-J20 mice by deleting ErbB4 in PV neurons. Our data suggested that ErbB4 in PV neurons mediated Aβ-induced synaptic and cognitive dysfunctions without affecting Aβ levels. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. [Neratinib + Valproate] exposure permanently reduces ERBB1 and RAS expression in 4T1 mammary tumors and enhances M1 macrophage infiltration

    OpenAIRE

    Booth, Laurence; Roberts, Jane L.; Rais, Rumeesa; Kirkwood, John; Avogadri-Connors, Francesca; Cutler, Richard E.; Lalani, Alshad S.; Poklepovic, Andrew; Dent, Paul

    2017-01-01

    The irreversible ERBB1/2/4 inhibitor neratinib has been shown in vitro to rapidly reduce the expression of ERBB1/2/4 and RAS proteins via autophagic/lysosomal degradation. We have recently demonstrated that neratinib and valproate interact to suppress the growth of 4T1 mammary tumors but had not defined whether the [neratinib + valproate] drug combination, in a mouse, had altered the biology of the 4T1 cells. Exposure of 4T1 mammary tumors to [neratinib + valproate] for three days resulted, t...

  20. Epidermal Growth Factor Cytoplasmic Domain Affects ErbB Protein Degradation by the Lysosomal and Ubiquitin-Proteasome Pathway in Human Cancer Cells

    Directory of Open Access Journals (Sweden)

    Aleksandra Glogowska

    2012-05-01

    Full Text Available The cytoplasmic domains of EGF-like ligands, including EGF cytoplasmic domain (EGFcyt, have important biological functions. Using specific constructs and peptides of human EGF cytoplasmic domain, we demonstrate that EGFcyt facilitates lysosomal and proteasomal protein degradation, and this coincided with growth inhibition of human thyroid and glioma carcinoma cells. EGFcyt and exon 22–23-encoded peptide (EGF22.23 enhanced procathepsin B (procathB expression and procathB-mediated lysosomal degradation of EGFR/ErbB1 as determined by inhibitors for procathB and the lysosomal ATPase inhibitor BafA1. Presence of mbEGFctF, EGFcyt, EGF22.23, and exon 23-encoded peptides suppressed the expression of the deubiqitinating enzyme ubiquitin C-terminal hydrolase-L1 (UCH-L1. This coincided with hyperubiquitination of total cellular proteins and ErbB1/2 and reduced proteasome activity. Upon small interfering RNA-mediated silencing of endogenously expressed UCH-L1, a similar hyperubiquitinylation phenotype, reduced ErbB1/2 content, and attenuated growth was observed. The exon 23-encoded peptide region of EGFcyt was important for these biologic actions. Structural homology modeling of human EGFcyt showed that this molecular region formed an exposed surface loop. Peptides derived from this EGFcyt loop structure may aid in the design of novel peptide therapeutics aimed at inhibiting growth of cancer cells.

  1. The irreversible ERBB1/2/4 inhibitor neratinib interacts with the PARP1 inhibitor niraparib to kill ovarian cancer cells.

    Science.gov (United States)

    Booth, Laurence; Roberts, Jane L; Samuel, Peter; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Poklepovic, Andrew; Dent, Paul

    2018-06-03

    The irreversible ERBB1/2/4 inhibitor neratinib has been shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET, PDGFRα and mutant RAS proteins via autophagic degradation. Neratinib interacted in an additive to synergistic fashion with the approved PARP1 inhibitor niraparib to kill ovarian cancer cells. Neratinib and niraparib caused the ATM-dependent activation of AMPK which in turn was required to cause mTOR inactivation, ULK-1 activation and ATG13 phosphorylation. The drug combination initially increased autophagosome levels followed later by autolysosome levels. Preventing autophagosome formation by expressing activated mTOR or knocking down of Beclin1, or knock down of the autolysosome protein cathepsin B, reduced drug combination lethality. The drug combination caused an endoplasmic reticulum stress response as judged by enhanced eIF2α phosphorylation that was responsible for reducing MCL-1 and BCL-XL levels and increasing ATG5 and Beclin1 expression. Knock down of BIM, but not of BAX or BAK, reduced cell killing. Expression of activated MEK1 prevented the drug combination increasing BIM expression and reduced cell killing. Downstream of the mitochondrion, drug lethality was partially reduced by knock down of AIF, but expression of dominant negative caspase 9 was not protective. Our data demonstrate that neratinib and niraparib interact to kill ovarian cancer cells through convergent DNA damage and endoplasmic reticulum stress signaling. Cell killing required the induction of autophagy and was cathepsin B and AIF -dependent, and effector caspase independent.

  2. A peptide antagonist of the ErbB1 receptor inhibits receptor activation, tumor cell growth and migration in vitro and xenograft tumor growth in vivo

    DEFF Research Database (Denmark)

    Xu, Ruodan; Povlsen, Gro Klitgaard; Soroka, Vladislav

    2010-01-01

    The epidermal growth factor family of receptor tyrosine kinases (ErbBs) plays essential roles in tumorigenesis and cancer disease progression, and therefore has become an attractive target for structure-based drug design. ErbB receptors are activated by ligand-induced homo- and heterodimerization...... constitutes part of the dimerization arm of ErbB3. Inherbin3 binds to the extracellular domains of all four ErbB receptors, with the lowest peptide binding affinity for ErbB4. Inherbin3 functions as an antagonist of epidermal growth factor (EGF)-ErbB1 signaling. We show that Inherbin3 inhibits EGF-induced Erb....... Structural studies have revealed that ErbB receptor dimers are stabilized by receptor-receptor interactions, primarily mediated by a region in the second extracellular domain, termed the "dimerization arm". The present study is the first biological characterization of a peptide, termed Inherbin3, which...

  3. A Novel Pathway to Down-Regulate ErbB Signaling in Mammary Epithelial

    National Research Council Canada - National Science Library

    Duan, Lei

    2001-01-01

    .... Based on these observations, this proposal is investigating the role of Cbl-mediated ubiquitination as a signal for targeting activated ErbB receptors to lysosomes where they undergo degradation...

  4. AST1306, a novel irreversible inhibitor of the epidermal growth factor receptor 1 and 2, exhibits antitumor activity both in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Hua Xie

    Full Text Available Despite the initial response to the reversible, ATP-competitive quinazoline inhibitors that target ErbB-family, such a subset of cancer patients almost invariably develop resistance. Recent studies have provided compelling evidence that irreversible ErbB inhibitors have the potential to override this resistance. Here, we found that AST1306, a novel anilino-quinazoline compound, inhibited the enzymatic activities of wild-type epidermal growth factor receptor (EGFR and ErbB2 as well as EGFR resistant mutant in both cell-free and cell-based systems. Importantly, AST1306 functions as an irreversible inhibitor, most likely through covalent interaction with Cys797 and Cys805 in the catalytic domains of EGFR and ErbB2, respectively. Further studies showed that AST1306 inactivated pathways downstream of these receptors and thereby inhibited the proliferation of a panel of cancer cell lines. Although the activities of EGFR and ErbB2 were similarly sensitive to AST1306, ErbB2-overexpressing cell lines consistently exhibited more sensitivity to AST1306 antiproliferative effects. Consistent with this, knockdown of ErbB2, but not EGFR, decreased the sensitivity of SK-OV-3 cells to AST1306. In vivo, AST1306 potently suppressed tumor growth in ErbB2-overexpressing adenocarcinoma xenograft and FVB-2/N(neu transgenic breast cancer mouse models, but weakly inhibited the growth of EGFR-overexpressing tumor xenografts. Tumor growth inhibition induced by a single dose of AST1306 in the SK-OV-3 xenograft model was accompanied by a rapid (within 2 h and sustained (≥24 h inhibition of both EGFR and ErbB2, consistent with an irreversible inhibition mechanism. Taken together, these results establish AST1306 as a selective, irreversible ErbB2 and EGFR inhibitor whose growth-inhibitory effects are more potent in ErbB2-overexpressing cells.

  5. Model-based global sensitivity analysis as applied to identification of anti-cancer drug targets and biomarkers of drug resistance in the ErbB2/3 network

    Science.gov (United States)

    Lebedeva, Galina; Sorokin, Anatoly; Faratian, Dana; Mullen, Peter; Goltsov, Alexey; Langdon, Simon P.; Harrison, David J.; Goryanin, Igor

    2012-01-01

    High levels of variability in cancer-related cellular signalling networks and a lack of parameter identifiability in large-scale network models hamper translation of the results of modelling studies into the process of anti-cancer drug development. Recently global sensitivity analysis (GSA) has been recognised as a useful technique, capable of addressing the uncertainty of the model parameters and generating valid predictions on parametric sensitivities. Here we propose a novel implementation of model-based GSA specially designed to explore how multi-parametric network perturbations affect signal propagation through cancer-related networks. We use area-under-the-curve for time course of changes in phosphorylation of proteins as a characteristic for sensitivity analysis and rank network parameters with regard to their impact on the level of key cancer-related outputs, separating strong inhibitory from stimulatory effects. This allows interpretation of the results in terms which can incorporate the effects of potential anti-cancer drugs on targets and the associated biological markers of cancer. To illustrate the method we applied it to an ErbB signalling network model and explored the sensitivity profile of its key model readout, phosphorylated Akt, in the absence and presence of the ErbB2 inhibitor pertuzumab. The method successfully identified the parameters associated with elevation or suppression of Akt phosphorylation in the ErbB2/3 network. From analysis and comparison of the sensitivity profiles of pAkt in the absence and presence of targeted drugs we derived predictions of drug targets, cancer-related biomarkers and generated hypotheses for combinatorial therapy. Several key predictions have been confirmed in experiments using human ovarian carcinoma cell lines. We also compared GSA-derived predictions with the results of local sensitivity analysis and discuss the applicability of both methods. We propose that the developed GSA procedure can serve as a

  6. Exercise training and return to a well-balanced diet activate the neuregulin 1/ErbB pathway in skeletal muscle of obese rats

    Science.gov (United States)

    Ennequin, Gaël; Boisseau, Nathalie; Caillaud, Kevin; Chavanelle, Vivien; Gerbaix, Maude; Metz, Lore; Etienne, Monique; Walrand, Stéphane; Masgrau, Aurélie; Guillet, Christelle; Courteix, Daniel; Niu, Airu; Li, Yi-Ping; Capel, Fréderic; Sirvent, Pascal

    2015-01-01

    Some studies suggest that the signalling pathway of neuregulin 1 (NRG1), a protein involved in the regulation of skeletal muscle metabolism, could be altered by nutritional and exercise interventions. We hypothesized that diet-induced obesity could lead to alterations of the NRG1 signalling pathway and that chronic exercise could improve NRG1 signalling in rat skeletal muscle. To test this hypothesis, male Wistar rats received a high fat/high sucrose (HF/HS) diet for 16 weeks. At the end of this period, NRG1 and ErbB expression/activity in skeletal muscle was assessed. The obese rats then continued the HF/HS diet or were switched to a well-balanced diet. Moreover, in both groups, half of the animals also performed low intensity treadmill exercise training. After another 8 weeks, NRG1 and ErbB expression/activity in skeletal muscle were tested again. The 16 week HF/HS diet induced obesity, but did not significantly affect the NRG1/ErbB signalling pathway in rat skeletal muscle. Conversely, after the switch to a well-balanced diet, NRG1 cleavage ratio and ErbB4 amount were increased. Chronic exercise training also promoted NRG1 cleavage, resulting in increased ErbB4 phosphorylation. This result was associated with increased protein expression and phosphorylation ratio of the metalloprotease ADAM17, which is involved in NRG1 shedding. Similarly, in vitro stretch-induced activation of ADAM17 in rat myoblasts induced NRG1 cleavage and ErbB4 activation. These results show that low intensity endurance training and well-balanced diet activate the NRG1-ErbB4 pathway, possibly via the metalloprotease ADAM17, in skeletal muscle of diet-induced obese rats. PMID:25820551

  7. In silico prediction of ErbB signal activation from receptor expression ...

    Indian Academy of Sciences (India)

    85

    Annals of biomedical engineering 35 1012-1025. Machado D, Costa RS, Rocha M, Ferreira EC, Tidor B, Rocha I 2011 Modeling formalisms in Systems Biology. AMB Express 1 45. McCabe Pryor M, et al. 2015 Orchestration of ErbB3 signaling through heterointeractions and homointeractions. Mol Biol Cell 26 4109-4123.

  8. Familial versus mass selection in small populations

    Directory of Open Access Journals (Sweden)

    Couvet Denis

    2003-07-01

    Full Text Available Abstract We used diffusion approximations and a Markov-chain approach to investigate the consequences of familial selection on the viability of small populations both in the short and in the long term. The outcome of familial selection was compared to the case of a random mating population under mass selection. In small populations, the higher effective size, associated with familial selection, resulted in higher fitness for slightly deleterious and/or highly recessive alleles. Conversely, because familial selection leads to a lower rate of directional selection, a lower fitness was observed for more detrimental genes that are not highly recessive, and with high population sizes. However, in the long term, genetic load was almost identical for both mass and familial selection for populations of up to 200 individuals. In terms of mean time to extinction, familial selection did not have any negative effect at least for small populations (N ≤ 50. Overall, familial selection could be proposed for use in management programs of small populations since it increases genetic variability and short-term viability without impairing the overall persistence times.

  9. Novel targeted approaches to treating biliary tract cancer: the dual epidermal growth factor receptor and ErbB-2 tyrosine kinase inhibitor NVP-AEE788 is more efficient than the epidermal growth factor receptor inhibitors gefitinib and erlotinib.

    Science.gov (United States)

    Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel

    2006-08-01

    Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer

  10. Analysis of copy number loss of the ErbB4 receptor tyrosine kinase in glioblastoma.

    Directory of Open Access Journals (Sweden)

    DeAnalisa C Jones

    Full Text Available Current treatments for glioblastoma multiforme (GBM-an aggressive form of brain cancer-are minimally effective and yield a median survival of 14.6 months and a two-year survival rate of 30%. Given the severity of GBM and the limitations of its treatment, there is a need for the discovery of novel drug targets for GBM and more personalized treatment approaches based on the characteristics of an individual's tumor. Most receptor tyrosine kinases-such as EGFR-act as oncogenes, but publicly available data from the Cancer Cell Line Encyclopedia (CCLE indicates copy number loss in the ERBB4 RTK gene across dozens of GBM cell lines, suggesting a potential tumor suppressor role. This loss is mutually exclusive with loss of its cognate ligand NRG1 in CCLE as well, more strongly suggesting a functional role. The availability of higher resolution copy number data from clinical GBM patients in The Cancer Genome Atlas (TCGA revealed that a region in Intron 1 of the ERBB4 gene was deleted in 69.1% of tumor samples harboring ERBB4 copy number loss; however, it was also found to be deleted in the matched normal tissue samples from these GBM patients (n = 81. Using the DECIPHER Genome Browser, we also discovered that this mutation occurs at approximately the same frequency in the general population as it does in the disease population. We conclude from these results that this loss in Intron 1 of the ERBB4 gene is neither a de novo driver mutation nor a predisposing factor to GBM, despite the indications from CCLE. A biological role of this significantly occurring genetic alteration is still unknown. While this is a negative result, the broader conclusion is that while copy number data from large cell line-based data repositories may yield compelling hypotheses, careful follow up with higher resolution copy number assays, patient data, and general population analyses are essential to codify initial hypotheses prior to investing experimental resources.

  11. A phase I study with neratinib (HKI-272), an irreversible pan ErbB receptor tyrosine kinase inhibitor, in patients with solid tumors.

    Science.gov (United States)

    Wong, Kwok-K; Fracasso, Paula M; Bukowski, Ronald M; Lynch, Thomas J; Munster, Pamela N; Shapiro, Geoffrey I; Jänne, Pasi A; Eder, Joseph P; Naughton, Michael J; Ellis, Matthew J; Jones, Suzanne F; Mekhail, Tarek; Zacharchuk, Charles; Vermette, Jennifer; Abbas, Richat; Quinn, Susan; Powell, Christine; Burris, Howard A

    2009-04-01

    The dose-limiting toxicities, maximum tolerated dose, pharmacokinetic profile, and preliminary antitumor activity of neratinib (HKI-272), an irreversible pan ErbB inhibitor, were determined in patients with advanced solid tumors. Neratinib was administered orally as a single dose, followed by a 1-week observation period, and then once daily continuously. Planned dose escalation was 40, 80, 120, 180, 240, 320, 400, and 500 mg. For pharmacokinetic analysis, timed blood samples were collected after administration of the single dose and after the first 14 days of continuous daily administration. Dose-limiting toxicity was grade 3 diarrhea, which occurred in one patient treated with 180 mg and in four patients treated with 400 mg neratinib; hence, the maximum tolerated dose was determined to be 320 mg. Other common neratinib-related toxicities included nausea, vomiting, fatigue, and anorexia. Exposure to neratinib was dose dependent, and the pharmacokinetic profile of neratinib supports a once-a-day dosing regimen. Partial response was observed for 8 (32%) of the 25 evaluable patients with breast cancer. Stable disease >or=24 weeks was observed in one evaluable breast cancer patient and 6 (43%) of the 14 evaluable non-small cell lung cancer patients. The maximum tolerated dose of once-daily oral neratinib is 320 mg. The most common neratinib-related toxicity was diarrhea. Antitumor activity was observed in patients with breast cancer who had previous treatment with trastuzumab, anthracyclines, and taxanes, and tumors with a baseline ErbB-2 immunohistochemical staining intensity of 2+ or 3+. The antitumor activity, tolerable toxicity profile, and pharmacokinetic properties of neratinib warrant its further evaluation.

  12. [Neratinib + Valproate] exposure permanently reduces ERBB1 and RAS expression in 4T1 mammary tumors and enhances M1 macrophage infiltration.

    Science.gov (United States)

    Booth, Laurence; Roberts, Jane L; Rais, Rumeesa; Kirkwood, John; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Poklepovic, Andrew; Dent, Paul

    2018-01-19

    The irreversible ERBB1/2/4 inhibitor neratinib has been shown in vitro to rapidly reduce the expression of ERBB1/2/4 and RAS proteins via autophagic/lysosomal degradation. We have recently demonstrated that neratinib and valproate interact to suppress the growth of 4T1 mammary tumors but had not defined whether the [neratinib + valproate] drug combination, in a mouse, had altered the biology of the 4T1 cells. Exposure of 4T1 mammary tumors to [neratinib + valproate] for three days resulted, two weeks later, in tumors that expressed less ERBB1, K-RAS, N-RAS, indoleamine-pyrrole 2,3-dioxygenase (IDO-1), ornithine decarboxylase (ODC) and had increased Class I MHCA expression. Tumors previously exposed to [neratinib + valproate] grew more slowly than those exposed to vehicle control and contained more CD8+ cells and activated NK cells. M1 but not M2 macrophage infiltration was significantly enhanced by the drug combination. In vitro exposure of 4T1 tumor cells to [neratinib + valproate] variably reduced the expression of histone deacetylases 1-11. In vivo , prior exposure of tumors to [neratinib + valproate] permanently reduced the expression of HDACs 1-3, 6 and 10. Combined knock down of HDACs 1/2/3 or of 3/10 rapidly reduced the expression IDO-1, and ODC and increased the expression of MHCA. H&E staining of normal tissues at animal nadir revealed no obvious cyto-architectural differences between control and drug-treated animals. We conclude that [neratinib + valproate] evolves 4T1 tumors to grow more slowly and to be more sensitive to checkpoint immunotherapy antibodies.

  13. ErbB receptors and cell polarity: New pathways and paradigms for understanding cell migration and invasion

    International Nuclear Information System (INIS)

    Feigin, Michael E.; Muthuswamy, Senthil K.

    2009-01-01

    The ErbB family of receptor tyrosine kinases is involved in initiation and progression of a number of human cancers, and receptor activation or overexpression correlates with poor patient survival. Research over the past two decades has elucidated the molecular mechanisms underlying ErbB-induced tumorigenesis, which has resulted in the development of effective targeted therapies. ErbB-induced signal transduction cascades regulate a wide variety of cell processes, including cell proliferation, apoptosis, cell polarity, migration and invasion. Within tumors, disruption of these core processes, through cooperative oncogenic lesions, results in aggressive, metastatic disease. This review will focus on the ErbB signaling networks that regulate migration and invasion and identify a potential role for cell polarity pathways during cancer progression

  14. Mammary gland cancer in a colony of beagle dogs: Inheritance, and p53 ampersand erbB-2 expression

    International Nuclear Information System (INIS)

    Kelly, G.; Griffith, W.C.; Muggenburg, Tierney, L.A.; Lechner, J.F.; Hahn, F.F.

    1994-01-01

    One American woman in nine will be diagnosed with breast cancer in her lifetime. This somber statistic translates into 182,000 new diagnoses and 46,000 deaths per year. Efforts to decrease breast cancer mortality have focused on early detection and improved treatment. Such efforts would be facilitated by the identification of individuals predisposed to the disease. A family history of the disease can increase a woman's risk for developing breast cancer by two- to six-fold. Inheritance of this disease is consistent with at least one susceptibility locus on chromosome 17 (17q12-21) with incomplete penetrance. However, other mechanisms of inherited susceptibility also contribute to the high incidence of the disease. The purpose of the present study was to characterize familial pattern of mammary cancer development in the dog colony. In addition, the expression of the p53 tumor supressor gene and c-erbB2 (p185 erbB2 ) oncogene proteins, which are frequently altered in human breast cancer, were examined in dogs susceptible and resistant to mammary cancer

  15. Sox2 promotes survival of satellite glial cells in vitro

    International Nuclear Information System (INIS)

    Koike, Taro; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao

    2015-01-01

    Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling

  16. Sox2 promotes survival of satellite glial cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Koike, Taro, E-mail: koiket@hirakata.kmu.ac.jp; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao

    2015-08-14

    Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling.

  17. ERBB4 Mutations that Disrupt the Neuregulin-ErbB4 Pathway Cause Amyotrophic Lateral Sclerosis Type 19

    Science.gov (United States)

    Takahashi, Yuji; Fukuda, Yoko; Yoshimura, Jun; Toyoda, Atsushi; Kurppa, Kari; Moritoyo, Hiroyoko; Belzil, Veronique V.; Dion, Patrick A.; Higasa, Koichiro; Doi, Koichiro; Ishiura, Hiroyuki; Mitsui, Jun; Date, Hidetoshi; Ahsan, Budrul; Matsukawa, Takashi; Ichikawa, Yaeko; Moritoyo, Takashi; Ikoma, Mayumi; Hashimoto, Tsukasa; Kimura, Fumiharu; Murayama, Shigeo; Onodera, Osamu; Nishizawa, Masatoyo; Yoshida, Mari; Atsuta, Naoki; Sobue, Gen; Fifita, Jennifer A.; Williams, Kelly L.; Blair, Ian P.; Nicholson, Garth A.; Gonzalez-Perez, Paloma; Brown, Robert H.; Nomoto, Masahiro; Elenius, Klaus; Rouleau, Guy A.; Fujiyama, Asao; Morishita, Shinichi; Goto, Jun; Tsuji, Shoji

    2013-01-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurological disorder characterized by the degeneration of motor neurons and typically results in death within 3–5 years from onset. Familial ALS (FALS) comprises 5%–10% of ALS cases, and the identification of genes associated with FALS is indispensable to elucidating the molecular pathogenesis. We identified a Japanese family affected by late-onset, autosomal-dominant ALS in which mutations in genes known to be associated with FALS were excluded. A whole- genome sequencing and parametric linkage analysis under the assumption of an autosomal-dominant mode of inheritance with incomplete penetrance revealed the mutation c.2780G>A (p. Arg927Gln) in ERBB4. An extensive mutational analysis revealed the same mutation in a Canadian individual with familial ALS and a de novo mutation, c.3823C>T (p. Arg1275Trp), in a Japanese simplex case. These amino acid substitutions involve amino acids highly conserved among species, are predicted as probably damaging, and are located within a tyrosine kinase domain (p. Arg927Gln) or a C-terminal domain (p. Arg1275Trp), both of which mediate essential functions of ErbB4 as a receptor tyrosine kinase. Functional analysis revealed that these mutations led to a reduced autophosphorylation of ErbB4 upon neuregulin-1 (NRG-1) stimulation. Clinical presentations of the individuals with mutations were characterized by the involvement of both upper and lower motor neurons, a lack of obvious cognitive dysfunction, and relatively slow progression. This study indicates that disruption of the neuregulin-ErbB4 pathway is involved in the pathogenesis of ALS and potentially paves the way for the development of innovative therapeutic strategies such using NRGs or their agonists to upregulate ErbB4 functions. PMID:24119685

  18. Discovery, validation and characterization of Erbb4 and Nrg1 haplotypes using data from three genome-wide association studies of schizophrenia.

    Directory of Open Access Journals (Sweden)

    Zeynep Sena Agim

    Full Text Available Schizophrenia is one of the most common and complex neuropsychiatric disorders, which is contributed both by genetic and environmental exposures. Recently, it is shown that NRG1-mediated ErbB4 signalling regulates many important cellular and molecular processes such as cellular growth, differentiation and death, particularly in myelin-producing cells, glia and neurons. Recent association studies have revealed genomic regions of NRG1 and ERBB4, which are significantly associated with risk of developing schizophrenia; however, inconsistencies exist in terms of validation of findings between distinct populations. In this study, we aim to validate the previously identified regions and to discover novel haplotypes of NRG1 and ERBB4 using logistic regression models and Haploview analyses in three independent datasets from GWAS conducted on European subjects, namely, CATIE, GAIN and nonGAIN. We identified a significant 6-kb block in ERBB4 between chromosome locations 212,156,823 and 212,162,848 in CATIE and GAIN datasets (p = 0.0206 and 0.0095, respectively. In NRG1, a significant 25-kb block, between 32,291,552 and 32,317,192, was associated with risk of schizophrenia in all CATIE, GAIN, and nonGAIN datasets (p = 0.0005, 0.0589, and 0.0143, respectively. Fine mapping and FastSNP analysis of genetic variation located within significantly associated regions proved the presence of binding sites for several transcription factors such as SRY, SOX5, CEPB, and ETS1. In this study, we have discovered and validated haplotypes of ERBB4 and NRG1 in three independent European populations. These findings suggest that these haplotypes play an important role in the development of schizophrenia by affecting transcription factor binding affinity.

  19. Stable RNA interference of ErbB-2 gene synergistic with epirubicin suppresses breast cancer growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Hu Xiaoqu; Su Fengxi; Qin Li; Jia Weijuan; Gong Chang; Yu Fengyan; Guo Jujiang; Song Erwei

    2006-01-01

    Overexpression of human epidermal growth factor receptor-2 (Her2, ErbB-2) contributes to the progression and metastasis of breast cancer, implying that Her2 gene is a suitable target of RNA interference (RNAi) for breast cancer therapy. Here, we employed plasmid-mediated expression of 2 different Her2-shRNAs (pU6-Her2shRNAs) efficiently silenced the target gene expression on Her2 expressing SKBR-3 breast cancer cells in both mRNA and protein levels. Consequently, pU6-Her2shRNA increased apoptosis and reduced proliferation of SKBR-3 cells assayed by TUNEL and MTT, respectively. In vivo, intra-tumor injection of pU6-Her2shRNA inhibited the growth of SKBR-3 tumors inoculated subcutaneously in nude mice. Furthermore, pU6-Her2shRNA synergized the tumor suppression effect of epirubicin to SKBR-3 cells in vitro and implanted subcutaneously in nude mice. Therefore, we concluded that stable silencing of Her2 gene expression with plasmid expressing shRNA may hold great promise as a novel therapy for Her2 expressing breast cancers alone or in combination with anthracycline chemotherapy

  20. The combi-targeting concept: synthesis of stable nitrosoureas designed to inhibit the epidermal growth factor receptor (EGFR).

    Science.gov (United States)

    Domarkas, Juozas; Dudouit, Fabienne; Williams, Christopher; Qiyu, Qiu; Banerjee, Ranjita; Brahimi, Fouad; Jean-Claude, Bertrand Jacques

    2006-06-15

    According to the "combi-targeting" concept, the EGFR tyrosine kinase (TK) inhibitory potency of compounds termed "combi-molecules" is critical for selective growth inhibition of tumor cells with disordered expression of EGFR or its closest family member erbB2. Here we report on the optimization of the EGFR TK inhibitory potency of the combi-molecules of the nitrosourea class by comparison with their aminoquinazoline and ureidoquinazoline precursors. This led to the discovery of a new structural parameter that influences their EGFR TK inhibitory potency, i.e., the torsion angle between the plane of the quinazoline ring and the ureido or the nitrosoureido moiety of the synthesized drugs. Compounds (3'-Cl and Br series) with small angles (0.5-3 degrees ) were generally stronger EGFR TK inhibitors than those with large angles (18-21 degrees ). This was further corroborated by ligand-receptor van der Waals interaction calculations that showed significant binding hindrance imposed by large torsion angles in the narrow ATP cleft of EGFR. Selective antiproliferative studies in a pair of mouse fibroblast NIH3T3 cells, one of which NIH3T3/neu being transfected with the erbB2 oncogene, showed that IC(50) values for inhibition of EGFR TK could be good predictors of their selective potency against the serum-stimulated growth of the erbB2-tranfected cell line (Pearson r = 0.8). On the basis of stability (t(1/2)), EGFR TK inhibitory potency (IC(50)), and selective erbB2 targeting, compound 23, a stable nitrosourea, was considered to have the structural requirements for further development.

  1. Exercise training and return to a well-balanced diet activate the neuregulin 1/ErbB pathway in skeletal muscle of obese rats.

    Science.gov (United States)

    Ennequin, Gaël; Boisseau, Nathalie; Caillaud, Kevin; Chavanelle, Vivien; Gerbaix, Maude; Metz, Lore; Etienne, Monique; Walrand, Stéphane; Masgrau, Aurélie; Guillet, Christelle; Courteix, Daniel; Niu, Airu; Li, Yi-Ping; Capel, Fréderic; Sirvent, Pascal

    2015-06-15

    Some studies suggest that neuregulin 1 (NRG1) could be involved in the regulation of skeletal muscle energy metabolism in rodents. Here we assessed whether unbalanced diet is associated with alterations of the NRG1 signalling pathway and whether exercise and diet might restore NRG1 signalling in skeletal muscle of obese rats. We show that diet-induced obesity does not impair NRG1 signalling in rat skeletal muscle. We also report that endurance training and a well-balanced diet activate the NRG1 signalling in skeletal muscle of obese rats, possibly via a new mechanism mediated by the protease ADAM17. These results suggest that some beneficial effects of physical activity and diet in obese rats could be partly explained by stimulation of the NRG1 signalling pathway. Some studies suggest that the signalling pathway of neuregulin 1 (NRG1), a protein involved in the regulation of skeletal muscle metabolism, could be altered by nutritional and exercise interventions. We hypothesized that diet-induced obesity could lead to alterations of the NRG1 signalling pathway and that chronic exercise could improve NRG1 signalling in rat skeletal muscle. To test this hypothesis, male Wistar rats received a high fat/high sucrose (HF/HS) diet for 16 weeks. At the end of this period, NRG1 and ErbB expression/activity in skeletal muscle was assessed. The obese rats then continued the HF/HS diet or were switched to a well-balanced diet. Moreover, in both groups, half of the animals also performed low intensity treadmill exercise training. After another 8 weeks, NRG1 and ErbB expression/activity in skeletal muscle were tested again. The 16 week HF/HS diet induced obesity, but did not significantly affect the NRG1/ErbB signalling pathway in rat skeletal muscle. Conversely, after the switch to a well-balanced diet, NRG1 cleavage ratio and ErbB4 amount were increased. Chronic exercise training also promoted NRG1 cleavage, resulting in increased ErbB4 phosphorylation. This result was

  2. Multiple facets of sialomucin complex/MUC4, a membrane mucin and erbb2 ligand, in tumors and tissues (Y2K update).

    Science.gov (United States)

    Carraway, K L; Price-Schiavi, S A; Komatsu, M; Idris, N; Perez, A; Li, P; Jepson, S; Zhu, X; Carvajal, M E; Carraway, C A

    2000-01-01

    Sialomucin complex (SMC, MUC4) is a high Mr glycoprotein heterodimer, composed of mucin (ASGP-1) and transmembrane (ASGP-2) subunits. ASGP-2 contains two EGF-like domains and acts as an intramembrane ligand for the receptor tyrosine kinase ErbB2. Transfection studies with SMC DNAs showed that SMC expression could markedly reduce both cell-cell and cell-matrix interactions in vitro and increase the growth of primary tumors and the formation of metastatic foci of human A375 melanoma cells as xenotransplants in nude mice, possibly through the ability to suppress apoptosis. SMC is expressed in most vulnerable epithelia as a protective agent, which is found in both membrane and soluble forms at luminal surfaces and secreted into fluids such as milk and tears. SMC appears to be constitutively expressed by most accessible epithelia, notable exceptions being the mammary gland and uterine luminal epithelium, in which it is tightly regulated during pregnancy. Down-regulation at the luminal uterine surface appears necessary for blastocyst implantation. TGF-b is a potent repressor of SMC expression in the mammary gland and uterus, though by different mechanisms. These combined results suggest that SMC has multiple functions in epithelia and is tightly regulated in those tissues where its special functions are required.

  3. Densely Packed, Ultra Small SnO Nanoparticles for Enhanced Activity and Selectivity in Electrochemical CO2 Reduction.

    Science.gov (United States)

    Gu, Jun; Héroguel, Florent; Luterbacher, Jeremy; Hu, Xile

    2018-03-05

    Controlling the selectivity in electrochemical CO 2 reduction is an unsolved challenge. While tin (Sn) has emerged as a promising non-precious catalyst for CO 2 electroreduction, most Sn-based catalysts produce formate as the major product, which is less desirable than CO in terms of separation and further use. Tin monoxide (SnO) nanoparticles supported on carbon black were synthesized and assembled and their application in CO 2 reduction was studied. Remarkably high selectivity and partial current densities for CO formation were obtained using these SnO nanoparticles compared to other Sn catalysts. The high activity is attributed to the ultra-small size of the nanoparticles (2.6 nm), while the high selectivity is attributed to a local pH effect arising from the dense packing of nanoparticles in the conductive carbon black matrix. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Reliable PCR quantitation of estrogen, progesterone and ERBB2 receptor mRNA from formalin-fixed, paraffin-embedded tissue is independent of prior macro-dissection

    DEFF Research Database (Denmark)

    Tramm, Trine; Hennig, Guido; Kyndi, Marianne

    2013-01-01

    Gene expression analysis on messenger RNA (mRNA) purified from formalin-fixed, paraffin-embedded tissue is increasingly used for research purposes. Tissue heterogeneity may question specificity and interpretation of results from mRNA isolated from a whole slide section, and thresholds for minimal...... tumor content in the paraffin block or macrodissection are used to avoid contamination from non-neoplastic tissue. The aim was to test if mRNA from tissue surrounding breast cancer affected quantification of estrogen receptor α (ESR1), progesterone receptor (PGR) and human epidermal growth factor...... receptor 2 (ERBB2), by comparing gene expression from whole slide and tumor-enriched sections, and correlating gene expression from whole slide sections with corresponding immunohistochemistry. Gene expression, based on mRNA extracted from a training set (36 paraffin blocks) and two validation sets (133...

  5. Hot spot mutations in Finnish non-small cell lung cancers.

    Science.gov (United States)

    Mäki-Nevala, Satu; Sarhadi, Virinder Kaur; Rönty, Mikko; Kettunen, Eeva; Husgafvel-Pursiainen, Kirsti; Wolff, Henrik; Knuuttila, Aija; Knuutila, Sakari

    2016-09-01

    Non-small cell lung cancer (NSCLC) is a common cancer with a poor prognosis. The aim of this study was to screen Finnish NSCLC tumor samples for common cancer-related mutations by targeted next generation sequencing and to determine their concurrences and associations with clinical features. Sequencing libraries were prepared from DNA isolated from formalin-fixed, paraffin-embedded tumor material of 425 patients using the AmpliSeq Colon and Lung panel covering mutational hot spot regions of 22 cancer genes. Sequencing was performed with the Ion Torrent Personal Genome Machine (PGM). Data analysis of the hot spot mutations revealed mutations in 77% of the patients, with 7% having 3 or more mutations reported in the Catalogue of Somatic Mutations in Cancer (COSMIC) database. Two of the most frequently mutated genes were TP53 (46%) and KRAS (25%). KRAS codon 12 mutations were the most recurrently occurring mutations. EGFR mutations were significantly associated with adenocarcinoma, female gender and never/light-smoking history; CTNNB1 mutations with light ex-smokers, PIK3CA and TP53 mutations with squamous cell carcinoma, and KRAS with adenocarcinoma. TP53 mutations were most prevalent in current smokers and ERBB2, ERBB4, PIK3CA, NRAS, NOTCH1, FBWX7, PTEN and STK11 mutations occurred exclusively in a group of ever-smokers, however the association was not statistically significant. No mutation was found that associated with asbestos exposure. Finnish NSCLC patients have a similar mutation profile as other Western patients, however with a higher frequency of BRAF mutations but a lower frequency of STK11 and ERBB2 mutations. Moreover, TP53 mutations occurred frequently with other gene mutations, most commonly with KRAS, MET, EGFR and PIK3CA mutations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  6. The Na+/H+ exchanger NHE1, but not the Na+, HCO3- cotransporter NBCn1, regulates motility of MCF7 breast cancer cells expressing constitutively active ErbB2

    DEFF Research Database (Denmark)

    Lauritzen, Gitte; Stock, Christian-Martin; Lemaire, Justine

    2012-01-01

    We and others have shown central roles of the Na(+)/H(+) exchanger NHE1 in cell motility. The aim of this study was to determine the roles of NHE1 and of the Na(+), HCO(3)(-) cotransporter NBCn1 in motility of serum-starved MCF-7 breast cancer cells expressing constitutively active ErbB2 (¿NErbB2...

  7. Exogenous HGF Bypasses the Effects of ErbB Inhibition on Tumor Cell Viability in Medulloblastoma Cell Lines.

    Directory of Open Access Journals (Sweden)

    Walderik W Zomerman

    Full Text Available Recent clinical trials investigating receptor tyrosine kinase (RTK inhibitors showed a limited clinical response in medulloblastoma. The present study investigated the role of micro-environmental growth factors expressed in the brain, such as HGF and EGF, in relation to the effects of hepatocyte growth factor receptor (MET and epidermal growth factor receptor family (ErbB1-4 inhibition in medulloblastoma cell lines. Medulloblastoma cell lines were treated with tyrosine kinase inhibitors crizotinib or canertinib, targeting MET and ErbB1-4, respectively. Upon treatment, cells were stimulated with VEGF-A, PDGF-AB, HGF, FGF-2 or EGF. Subsequently, we measured cell viability and expression levels of growth factors and downstream signaling proteins. Addition of HGF or EGF phosphorylated MET or EGFR, respectively, and demonstrated phosphorylation of Akt and ERK1/2 as well as increased tumor cell viability. Crizotinib and canertinib both inhibited cell viability and phosphorylation of Akt and ERK1/2. Specifically targeting MET using shRNA's resulted in decreased cell viability. Interestingly, addition of HGF to canertinib significantly enhanced cell viability as well as phosphorylation of Akt and ERK1/2. The HGF-induced bypass of canertinib was reversed by addition of crizotinib. HGF protein was hardly released by medulloblastoma cells itself. Addition of canertinib did not affect RTK cell surface or growth factor expression levels. This manuscript points to the bypassing capacity of exogenous HGF in medulloblastoma cell lines. It might be of great interest to anticipate on these results in developing novel clinical trials with a combination of MET and EGFR inhibitors in medulloblastoma.

  8. GP2 is selectively expressed by small intestinal CD103+CD11b+ cDC

    DEFF Research Database (Denmark)

    Müller-Luda, Katarzyna; Ahmadi, Fatemeh; Ohno, Hiroshi

    DC in the small intestine. Moreover, GP2 expressing cDC in the small intestine were dramatically reduced in the setting of intestinal inflammation. We have previously shown that mice with an IRF4 deletion in CD11c+ cells (Cd11c-cre.Irf4 fl/fl mice) have reduced numbers of small intestinal CD103+CD11b+ c......DC. Interesting, we found that GP2+ CD103+CD11b+ cDC were dramatically reduced in these mice. Finally, to address the in vivo role of GP2 expression by cDC, we have generated mice with a selective deletion of GP2 in CD103+CD11b+ cDC (huLangerin-cre.gp2 fl/fl  mice). Results from these ongoing studies...

  9. Phase III study of afatinib or cisplatin plus pemetrexed in patients with metastatic lung adenocarcinoma with EGFR mutations.

    LENUS (Irish Health Repository)

    Sequist, Lecia V

    2013-09-20

    The LUX-Lung 3 study investigated the efficacy of chemotherapy compared with afatinib, a selective, orally bioavailable ErbB family blocker that irreversibly blocks signaling from epidermal growth factor receptor (EGFR\\/ErbB1), human epidermal growth factor receptor 2 (HER2\\/ErbB2), and ErbB4 and has wide-spectrum preclinical activity against EGFR mutations. A phase II study of afatinib in EGFR mutation-positive lung adenocarcinoma demonstrated high response rates and progression-free survival (PFS).

  10. Small prizes increased healthful school lunch selection in a Midwestern school district.

    Science.gov (United States)

    Siegel, Robert; Lockhart, Mary Kate; Barnes, Allison S; Hiller, Elizabeth; Kipp, Roger; Robison, Debora L; Ellsworth, Samantha C; Hudgens, Michelle E

    2016-04-01

    As obesity has become a pressing health issue for American children, greater attention has been focused on how schools can be used to improve how students eat. Previously, we piloted the use of small prizes in an elementary school cafeteria to improve healthful food selection. We hoped to increase healthful food selection in all the elementary schools of a small school district participating in the United States Department of Agriculture Lunch Program by offering prizes to children who selected a Power Plate (PP), which consisted of an entrée with whole grains, a fruit, a vegetable, and plain low-fat milk. In this study, the PP program was introduced to 3 schools sequentially over an academic year. During the kickoff week, green, smiley-faced emoticons were placed by preferred foods, and children were given a prize daily if they chose a PP on that day. After the first week, students were given a sticker or temporary tattoo 2 days a week if they selected a PP. Combining data from the 3 schools in the program, students increased PP selection from 4.5% at baseline to 49.4% (p small prizes as rewards dramatically improves short-term healthful food selection in elementary school children.

  11. Adjuvant letrozole versus tamoxifen according to centrally-assessed ERBB2 status for postmenopausal women with endocrine-responsive early breast cancer: supplementary results from the BIG 1-98 randomised trial

    DEFF Research Database (Denmark)

    Regan, M.M.; Lykkesfeldt, A.E.; Dell'Orto, P.

    2008-01-01

    Background The Breast International Group (BIG) 1-98 trial (a randomised double-blind phase III trial) has shown that letrozole significantly improves disease-free survival (DFS) compared with tamoxifen in postmenopausal women with endocrine-responsive early breast cancer. Our aim was to establish...... whether the benefit of letrozole versus tamoxifen differs according to the ERBB2 status of tumours. Methods The BIG 1-98 trial consists of four treatment groups that compare 5 years of monotherapy with letrozole or tamoxifen, and sequential administration of one drug for 2 years followed by the other drug...... for 3 years. Our study includes data from the 4922 patients randomly assigned to the two monotherapy treatment groups (letrozole or tamoxifen for 5 years; 51 months median follow-up [range

  12. HER2 monoclonal antibodies that do not interfere with receptor heterodimerization-mediated signaling induce effective internalization and represent valuable components for rational antibody-drug conjugate design.

    Science.gov (United States)

    de Goeij, Bart E C G; Peipp, Matthias; de Haij, Simone; van den Brink, Edward N; Kellner, Christian; Riedl, Thilo; de Jong, Rob; Vink, Tom; Strumane, Kristin; Bleeker, Wim K; Parren, Paul W H I

    2014-01-01

    The human epidermal growth factor receptor (HER)2 provides an excellent target for selective delivery of cytotoxic drugs to tumor cells by antibody-drug conjugates (ADC) as has been clinically validated by ado-trastuzumab emtansine (Kadcyla(TM)). While selecting a suitable antibody for an ADC approach often takes specificity and efficient antibody-target complex internalization into account, the characteristics of the optimal antibody candidate remain poorly understood. We studied a large panel of human HER2 antibodies to identify the characteristics that make them most suitable for an ADC approach. As a model toxin, amenable to in vitro high-throughput screening, we employed Pseudomonas exotoxin A (ETA') fused to an anti-kappa light chain domain antibody. Cytotoxicity induced by HER2 antibodies, which were thus non-covalently linked to ETA', was assessed for high and low HER2 expressing tumor cell lines and correlated with internalization and downmodulation of HER2 antibody-target complexes. Our results demonstrate that HER2 antibodies that do not inhibit heterodimerization of HER2 with related ErbB receptors internalize more efficiently and show greater ETA'-mediated cytotoxicity than antibodies that do inhibit such heterodimerization. Moreover, stimulation with ErbB ligand significantly enhanced ADC-mediated tumor kill by antibodies that do not inhibit HER2 heterodimerization. This suggests that the formation of HER2/ErbB-heterodimers enhances ADC internalization and subsequent killing of tumor cells. Our study indicates that selecting HER2 ADCs that allow piggybacking of HER2 onto other ErbB receptors provides an attractive strategy for increasing ADC delivery and tumor cell killing capacity to both high and low HER2 expressing tumor cells.

  13. Selective Targeting of CTNBB1-, KRAS- or MYC-Driven Cell Growth by Combinations of Existing Drugs.

    Directory of Open Access Journals (Sweden)

    Joost C M Uitdehaag

    Full Text Available The aim of combination drug treatment in cancer therapy is to improve response rate and to decrease the probability of the development of drug resistance. Preferably, drug combinations are synergistic rather than additive, and, ideally, drug combinations work synergistically only in cancer cells and not in non-malignant cells. We have developed a workflow to identify such targeted synergies, and applied this approach to selectively inhibit the proliferation of cell lines with mutations in genes that are difficult to modulate with small molecules. The approach is based on curve shift analysis, which we demonstrate is a more robust method of determining synergy than combination matrix screening with Bliss-scoring. We show that the MEK inhibitor trametinib is more synergistic in combination with the BRAF inhibitor dabrafenib than with vemurafenib, another BRAF inhibitor. In addition, we show that the combination of MEK and BRAF inhibitors is synergistic in BRAF-mutant melanoma cells, and additive or antagonistic in, respectively, BRAF-wild type melanoma cells and non-malignant fibroblasts. This combination exemplifies that synergistic action of drugs can depend on cancer genotype. Next, we used curve shift analysis to identify new drug combinations that specifically inhibit cancer cell proliferation driven by difficult-to-drug cancer genes. Combination studies were performed with compounds that as single agents showed preference for inhibition of cancer cells with mutations in either the CTNNB1 gene (coding for β-catenin, KRAS, or cancer cells expressing increased copy numbers of MYC. We demonstrate that the Wnt-pathway inhibitor ICG-001 and trametinib acted synergistically in Wnt-pathway-mutant cell lines. The ERBB2 inhibitor TAK-165 was synergistic with trametinib in KRAS-mutant cell lines. The EGFR/ERBB2 inhibitor neratinib acted synergistically with the spindle poison docetaxel and with the Aurora kinase inhibitor GSK-1070916 in cell lines

  14. Selective Targeting of CTNNB1-, KRAS- or MYC-Driven Cell Growth by Combinations of Existing Drugs

    Science.gov (United States)

    Uitdehaag, Joost C. M.; de Roos, Jeroen A. D. M.; van Doornmalen, Antoon M.; Prinsen, Martine B. W.; Spijkers-Hagelstein, Jill A. P.; de Vetter, Judith R. F.; de Man, Jos; Buijsman, Rogier C.; Zaman, Guido J. R.

    2015-01-01

    The aim of combination drug treatment in cancer therapy is to improve response rate and to decrease the probability of the development of drug resistance. Preferably, drug combinations are synergistic rather than additive, and, ideally, drug combinations work synergistically only in cancer cells and not in non-malignant cells. We have developed a workflow to identify such targeted synergies, and applied this approach to selectively inhibit the proliferation of cell lines with mutations in genes that are difficult to modulate with small molecules. The approach is based on curve shift analysis, which we demonstrate is a more robust method of determining synergy than combination matrix screening with Bliss-scoring. We show that the MEK inhibitor trametinib is more synergistic in combination with the BRAF inhibitor dabrafenib than with vemurafenib, another BRAF inhibitor. In addition, we show that the combination of MEK and BRAF inhibitors is synergistic in BRAF-mutant melanoma cells, and additive or antagonistic in, respectively, BRAF-wild type melanoma cells and non-malignant fibroblasts. This combination exemplifies that synergistic action of drugs can depend on cancer genotype. Next, we used curve shift analysis to identify new drug combinations that specifically inhibit cancer cell proliferation driven by difficult-to-drug cancer genes. Combination studies were performed with compounds that as single agents showed preference for inhibition of cancer cells with mutations in either the CTNNB1 gene (coding for β-catenin), KRAS, or cancer cells expressing increased copy numbers of MYC. We demonstrate that the Wnt-pathway inhibitor ICG-001 and trametinib acted synergistically in Wnt-pathway-mutant cell lines. The ERBB2 inhibitor TAK-165 was synergistic with trametinib in KRAS-mutant cell lines. The EGFR/ERBB2 inhibitor neratinib acted synergistically with the spindle poison docetaxel and with the Aurora kinase inhibitor GSK-1070916 in cell lines with MYC amplification

  15. Selective orthosteric free fatty acid receptor 2 (FFA2) agonists: identification of the structural and chemical requirements for selective activation of FFA2 versus FFA3

    DEFF Research Database (Denmark)

    Schmidt, Johannes; Smith, Nicola J; Christiansen, Elisabeth

    2011-01-01

    given its size. Propionate, however, does not discriminate between FFA2 and the closely related receptor FFA3 (GPR41). To identify FFA2 selective ligands and understand the molecular basis for FFA2 selectivity, a targeted library of small carboxylic acids (SCAs) was examined using holistic, label...

  16. Safety and efficacy of neratinib (HKI-272) plus vinorelbine in the treatment of patients with ErbB2-positive metastatic breast cancer pretreated with anti-HER2 therapy.

    Science.gov (United States)

    Awada, A; Dirix, L; Manso Sanchez, L; Xu, B; Luu, T; Diéras, V; Hershman, D L; Agrapart, V; Ananthakrishnan, R; Staroslawska, E

    2013-01-01

    Neratinib (HKI-272) is a potent irreversible pan-ErbB tyrosine kinase inhibitor with clinical activity in patients with ErbB2/HER2-positive breast cancer. Phase I of this open-label, phase I/II study investigated the maximum tolerated dose (MTD) of oral neratinib (160 or 240 mg/day) plus vinorelbine (25 mg/m2; days 1 and 8 of each 21-day cycle) in patients with solid tumors. Phase II assessed the safety, clinical activity, and pharmacokinetics of the combination in patients with HER2-positive metastatic breast cancer; the primary efficacy end point was objective response (OR). In phase I (n=12), neratinib (240 mg) plus vinorelbine (25 mg/m2) was established as the MTD. In phase II, 79 patients with HER2-positive metastatic breast cancer were treated at the MTD. The most common treatment-related adverse events were diarrhea (96%), neutropenia (54%), and nausea (50%). Three patients discontinued treatment due to diarrhea. No clinically important skin side-effects were observed. The OR rate in assessable phase II patients was 41% (no prior lapatinib) and 8% (prior lapatinib). There was no evidence of pharmacokinetic interaction between neratinib and vinorelbine. Neratinib plus vinorelbine showed promising antitumor activity and no unexpected toxic effects in HER2-positive metastatic breast cancer patients. Trial registration ClinicalTrials.gov #NCT00706030.

  17. Arctic Small Rodents Have Diverse Diets and Flexible Food Selection.

    Directory of Open Access Journals (Sweden)

    Eeva M Soininen

    Full Text Available The ecology of small rodent food selection is poorly understood, as mammalian herbivore food selection theory has mainly been developed by studying ungulates. Especially, the effect of food availability on food selection in natural habitats where a range of food items are available is unknown. We studied diets and selectivity of grey-sided voles (Myodes rufocanus and tundra voles (Microtus oeconomus, key herbivores in European tundra ecosystems, using DNA metabarcoding, a novel method enabling taxonomically detailed diet studies. In order to cover the range of food availabilities present in the wild, we employed a large-scale study design for sampling data on food availability and vole diets. Both vole species had ingested a range of plant species and selected particularly forbs and grasses. Grey-sided voles also selected ericoid shrubs and tundra voles willows. Availability of a food item rarely affected its utilization directly, although seasonal changes of diets and selection suggest that these are positively correlated with availability. Moreover, diets and selectivity were affected by availability of alternative food items. These results show that the focal sub-arctic voles have diverse diets and flexible food preferences and rarely compensate low availability of a food item with increased searching effort. Diet diversity itself is likely to be an important trait and has previously been underrated owing to methodological constraints. We suggest that the roles of alternative food item availability and search time limitations for small rodent feeding ecology should be investigated.Annotated Checklist of the Panarctic Flora (PAF, Vascular plants. Available at: http://nhm2.uio.no/paf/, accessed 15.6.2012.

  18. Change in HER2 (ERBB2) gene status after taxane-based chemotherapy for breast cancer: polyploidization can lead to diagnostic pitfalls with potential impact for clinical management.

    Science.gov (United States)

    Valent, Alexander; Penault-Llorca, Frédérique; Cayre, Anne; Kroemer, Guido

    2013-01-01

    The status of the HER2 (ERBB2) gene in breast cancer is not static and may change among the primary tumor, lymph node metastases, and distant metastases. This status change can be a consequence of the natural evolution of the tumor or can be induced by therapy. The HER2 gene status is, in the majority of cases, established at the moment of diagnosis. After chemotherapy, monitoring HER2 status can be a challenge because of ploidy changes induced by drugs. The cytogeneticist or the pathologist can face real difficulties in distinguishing between a true HER2 amplification and HER2 copy number increase by polyploidization. We performed a HER2 genetic examination by fluorescence in situ hybridization (FISH) of invasive breast cancers before and after taxane treatment. The majority of patients (91%) were HER2-negative both at diagnosis and after treatment. Thirty of 344 patients (9%) whose tumors were initially HER2-negative were found by FISH to have supernumerary HER2 gene copies (up to 15 copies) after neoadjuvant chemotherapy. This HER2 copy increase could not be attributed to true gene amplifications and instead reflected polyploidization events, which presumably affected all chromosomes. Indeed, when we used other FISH probes, we found other gene copy numbers to parallel those of HER2. We recommend careful checking of invasive breast carcinomas by supplementary FISH probes if the copy number of the HER2 gene is >6. This procedure allows the discrimination of specific HER2 gene amplifications and global increases in ploidy. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Evaluation of nutraceutical properties of selected small millets.

    Science.gov (United States)

    Rao, B Raghavendra; Nagasampige, Manojkumar H; Ravikiran, M

    2011-04-01

    The aim of this study was to evaluate the nutraceutical properties and nutritional value of grains of four selected small millets viz. finger millet, foxtail millet, prosomillet and khodomillet. The qualitative analysis of phytochemicals viz. phenolics, flavonoids, alkaloids and saponins present in the four small millets was done. The water-soluble proteins, crude fiber content and the reducing power of the grains of these four millets were analyzed. The khodomillet showed maximum phenolic content (10.3%) and foxtail millet showed minimum phenolics (2.5%). As far as reducing capacity was concerned, finger millet was highest (5.7%). The prosomillet showed least reducing property (2.6%). The finger millet (391.3 mg/g each) showed maximum reducing sugar content. The prosomillet showed minimum reducing sugar (195 mg/g). The foxtail millet showed maximum protein content (305.76 mg/g) and prosomillet showed minimum protein content (144.23 mg/g). The khodomillet showed maximum crude fiber content (14.3%).The finger millet showed maximum reducing sugar content (391.3 mg/g) whereas, the khodomillet showed minimum reducing sugar (130.43 mg/g).

  20. Protein-Trap Insertional Mutagenesis Uncovers New Genes Involved in Zebrafish Skin Development, Including a Neuregulin 2a-Based ErbB Signaling Pathway Required during Median Fin Fold Morphogenesis.

    Directory of Open Access Journals (Sweden)

    Stephanie E Westcot

    Full Text Available Skin disorders are widespread, but available treatments are limited. A more comprehensive understanding of skin development mechanisms will drive identification of new treatment targets and modalities. Here we report the Zebrafish Integument Project (ZIP, an expression-driven platform for identifying new skin genes and phenotypes in the vertebrate model Danio rerio (zebrafish. In vivo selection for skin-specific expression of gene-break transposon (GBT mutant lines identified eleven new, revertible GBT alleles of genes involved in skin development. Eight genes--fras1, grip1, hmcn1, msxc, col4a4, ahnak, capn12, and nrg2a--had been described in an integumentary context to varying degrees, while arhgef25b, fkbp10b, and megf6a emerged as novel skin genes. Embryos homozygous for a GBT insertion within neuregulin 2a (nrg2a revealed a novel requirement for a Neuregulin 2a (Nrg2a-ErbB2/3-AKT signaling pathway governing the apicobasal organization of a subset of epidermal cells during median fin fold (MFF morphogenesis. In nrg2a mutant larvae, the basal keratinocytes within the apical MFF, known as ridge cells, displayed reduced pAKT levels as well as reduced apical domains and exaggerated basolateral domains. Those defects compromised proper ridge cell elongation into a flattened epithelial morphology, resulting in thickened MFF edges. Pharmacological inhibition verified that Nrg2a signals through the ErbB receptor tyrosine kinase network. Moreover, knockdown of the epithelial polarity regulator and tumor suppressor lgl2 ameliorated the nrg2a mutant phenotype. Identifying Lgl2 as an antagonist of Nrg2a-ErbB signaling revealed a significantly earlier role for Lgl2 during epidermal morphogenesis than has been described to date. Furthermore, our findings demonstrated that successive, coordinated ridge cell shape changes drive apical MFF development, making MFF ridge cells a valuable model for investigating how the coordinated regulation of cell polarity

  1. Protein-Trap Insertional Mutagenesis Uncovers New Genes Involved in Zebrafish Skin Development, Including a Neuregulin 2a-Based ErbB Signaling Pathway Required during Median Fin Fold Morphogenesis.

    Science.gov (United States)

    Westcot, Stephanie E; Hatzold, Julia; Urban, Mark D; Richetti, Stefânia K; Skuster, Kimberly J; Harm, Rhianna M; Lopez Cervera, Roberto; Umemoto, Noriko; McNulty, Melissa S; Clark, Karl J; Hammerschmidt, Matthias; Ekker, Stephen C

    2015-01-01

    Skin disorders are widespread, but available treatments are limited. A more comprehensive understanding of skin development mechanisms will drive identification of new treatment targets and modalities. Here we report the Zebrafish Integument Project (ZIP), an expression-driven platform for identifying new skin genes and phenotypes in the vertebrate model Danio rerio (zebrafish). In vivo selection for skin-specific expression of gene-break transposon (GBT) mutant lines identified eleven new, revertible GBT alleles of genes involved in skin development. Eight genes--fras1, grip1, hmcn1, msxc, col4a4, ahnak, capn12, and nrg2a--had been described in an integumentary context to varying degrees, while arhgef25b, fkbp10b, and megf6a emerged as novel skin genes. Embryos homozygous for a GBT insertion within neuregulin 2a (nrg2a) revealed a novel requirement for a Neuregulin 2a (Nrg2a)-ErbB2/3-AKT signaling pathway governing the apicobasal organization of a subset of epidermal cells during median fin fold (MFF) morphogenesis. In nrg2a mutant larvae, the basal keratinocytes within the apical MFF, known as ridge cells, displayed reduced pAKT levels as well as reduced apical domains and exaggerated basolateral domains. Those defects compromised proper ridge cell elongation into a flattened epithelial morphology, resulting in thickened MFF edges. Pharmacological inhibition verified that Nrg2a signals through the ErbB receptor tyrosine kinase network. Moreover, knockdown of the epithelial polarity regulator and tumor suppressor lgl2 ameliorated the nrg2a mutant phenotype. Identifying Lgl2 as an antagonist of Nrg2a-ErbB signaling revealed a significantly earlier role for Lgl2 during epidermal morphogenesis than has been described to date. Furthermore, our findings demonstrated that successive, coordinated ridge cell shape changes drive apical MFF development, making MFF ridge cells a valuable model for investigating how the coordinated regulation of cell polarity and cell shape

  2. Next-Generation Sequencing to Detect Deletion of RB1 and ERBB4 Genes in Chromophobe Renal Cell Carcinoma: A Potential Role in Distinguishing Chromophobe Renal Cell Carcinoma from Renal Oncocytoma.

    Science.gov (United States)

    Liu, Qingqing; Cornejo, Kristine M; Cheng, Liang; Hutchinson, Lloyd; Wang, Mingsheng; Zhang, Shaobo; Tomaszewicz, Keith; Cosar, Ediz F; Woda, Bruce A; Jiang, Zhong

    2018-04-01

    Overlapping morphologic, immunohistochemical, and ultrastructural features make it difficult to diagnose chromophobe renal cell carcinoma (ChRCC) and renal oncocytoma (RO). Because ChRCC is a malignant tumor, whereas RO is a tumor with benign behavior, it is important to distinguish these two entities. We aimed to identify genetic markers that distinguish ChRCC from RO by using next-generation sequencing (NGS). NGS for hotspot mutations or gene copy number changes was performed on 12 renal neoplasms, including seven ChRCC and five RO cases. Matched normal tissues from the same patients were used to exclude germline variants. Rare hotspot mutations were found in cancer-critical genes (TP53 and PIK3CA) in ChRCC but not RO. The NGS gene copy number analysis revealed multiple abnormalities. The two most common deletions were tumor-suppressor genes RB1 and ERBB4 in ChRCC but not RO. Fluorescence in situ hybridization was performed on 65 cases (ChRCC, n = 33; RO, n = 32) to verify hemizygous deletion of RB1 (17/33, 52%) or ERBB4 (11/33, 33%) in ChRCC, but not in RO (0/32, 0%). In total, ChRCCs (23/33, 70%) carry either a hemizygous deletion of RB1 or ERBB4. The combined use of RB1 and ERBB4 fluorescence in situ hybridization to detect deletion of these genes may offer a highly sensitive and specific assay to distinguish ChRCC from RO. Copyright © 2018 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  3. Checklist/Guide to Selecting a Small Computer.

    Science.gov (United States)

    Bennett, Wilma E.

    This 322-point checklist was designed to help executives make an intelligent choice when selecting a small computer for a business. For ease of use the questions have been divided into ten categories: Display Features, Keyboard Features, Printer Features, Controller Features, Software, Word Processing, Service, Training, Miscellaneous, and Costs.…

  4. Evaluation of nutraceutical properties of selected small millets

    Directory of Open Access Journals (Sweden)

    B Raghavendra Rao

    2011-01-01

    Full Text Available Objective: The aim of this study was to evaluate the nutraceutical properties and nutritional value of grains of four selected small millets viz. finger millet, foxtail millet, prosomillet and khodomillet. Materials and Methods: The qualitative analysis of phytochemicals viz. phenolics, flavonoids, alkaloids and saponins present in the four small millets was done. The water-soluble proteins, crude fiber content and the reducing power of the grains of these four millets were analyzed. Results and Conclusions: The khodomillet showed maximum phenolic content (10.3% and foxtail millet showed minimum phenolics (2.5%. As far as reducing capacity was concerned, finger millet was highest (5.7%. The prosomillet showed least reducing property (2.6%. The finger millet (391.3 mg/g each showed maximum reducing sugar content. The prosomillet showed minimum reducing sugar (195 mg/g. The foxtail millet showed maximum protein content (305.76 mg/g and prosomillet showed minimum protein content (144.23 mg/g. The khodomillet showed maximum crude fiber content (14.3%.The finger millet showed maximum reducing sugar content (391.3 mg/g whereas, the khodomillet showed minimum reducing sugar (130.43 mg/g.

  5. Targeted deep sequencing of mucinous ovarian tumors reveals multiple overlapping RAS-pathway activating mutations in borderline and cancerous neoplasms

    International Nuclear Information System (INIS)

    Mackenzie, Robertson; Kommoss, Stefan; Winterhoff, Boris J.; Kipp, Benjamin R.; Garcia, Joaquin J.; Voss, Jesse; Halling, Kevin; Karnezis, Anthony; Senz, Janine; Yang, Winnie; Prigge, Elena-Sophie; Reuschenbach, Miriam; Doeberitz, Magnus Von Knebel; Gilks, Blake C.; Huntsman, David G.; Bakkum-Gamez, Jamie; McAlpine, Jessica N.; Anglesio, Michael S.

    2015-01-01

    Mucinous ovarian tumors represent a distinct histotype of epithelial ovarian cancer. The rarest (2-4 % of ovarian carcinomas) of the five major histotypes, their genomic landscape remains poorly described. We undertook hotspot sequencing of 50 genes commonly mutated in human cancer across 69 mucinous ovarian tumors. Our goals were to establish the overall frequency of cancer-hotspot mutations across a large cohort, especially those tumors previously thought to be “RAS-pathway alteration negative”, using highly-sensitive next-generation sequencing as well as further explore a small number of cases with apparent heterogeneity in RAS-pathway activating alterations. Using the Ion Torrent PGM platform, we performed next generation sequencing analysis using the v2 Cancer Hotspot Panel. Regions of disparate ERBB2-amplification status were sequenced independently for two mucinous carcinoma (MC) cases, previously established as showing ERBB2 amplification/overexpression heterogeneity, to assess the hypothesis of subclonal populations containing either KRAS mutation or ERBB2 amplification independently or simultaneously. We detected mutations in KRAS, TP53, CDKN2A, PIK3CA, PTEN, BRAF, FGFR2, STK11, CTNNB1, SRC, SMAD4, GNA11 and ERBB2. KRAS mutations remain the most frequently observed alteration among MC (64.9 %) and mucinous borderline tumors (MBOT) (92.3 %). TP53 mutation occurred more frequently in carcinomas than borderline tumors (56.8 % and 11.5 %, respectively), and combined IHC and mutation data suggest alterations occur in approximately 68 % of MC and as many as 20 % of MBOT. Proven and potential RAS-pathway activating changes were observed in all but one MC. Concurrent ERBB2 amplification and KRAS mutation were observed in a substantial number of cases (7/63 total), as was co-occurrence of KRAS and BRAF mutations (one case). Microdissection of ERBB2-amplified regions of tumors harboring KRAS mutation suggests these alterations are occurring in the same cell

  6. Disruption of the ErbB signaling in adolescence increases striatal dopamine levels and affects learning and hedonic-like behavior in the adult mouse.

    Science.gov (United States)

    Golani, Idit; Tadmor, Hagar; Buonanno, Andres; Kremer, Ilana; Shamir, Alon

    2014-11-01

    The ErbB signaling pathway has been genetically and functionally implicated in schizophrenia. Numerous findings support the dysregulation of Neuregulin (NRG) and epidermal growth factor (EGF) signaling in schizophrenia. However, it is unclear whether alterations of these pathways in the adult brain or during development are involved in the pathophysiology of schizophrenia. Herein we characterized the behavioral profile and molecular changes resulting from pharmacologically blocking the ErbB signaling pathway during a critical period in the development of decision making, planning, judgments, emotions, social cognition and cognitive skills, namely adolescence. We demonstrate that chronic administration of the pan-ErbB kinase inhibitor JNJ-28871063 (JNJ) to adolescent mice elevated striatal dopamine levels and reduced preference for sucrose without affecting locomotor activity and exploratory behavior. In adulthood, adolescent JNJ-treated mice continue to consume less sucrose and needed significantly more correct-response trials to reach the learning criterion during the discrimination phase of the T-maze reversal learning task than their saline-injected controls. In addition, JNJ mice exhibited deficit in reference memory but not in working memory as measured in the radial arm maze. Inhibition of the pathway during adolescence did not affect exploratory behavior and locomotor activity in the open field, social interaction, social memory, and reversal learning in adult mice. Our data suggest that alteration of ErbB signaling during adolescence resulted in changes in the dopaminergic systems that emerge in pathological learning and hedonic behavior in adulthood, and pinpoints the possible role of the pathway in the development of cognitive skills and motivated behavior. Copyright © 2014 Elsevier B.V. and ECNP. All rights reserved.

  7. Small Prizes Increased Plain Milk and Vegetable Selection by Elementary School Children without Adversely Affecting Total Milk Purchase

    Directory of Open Access Journals (Sweden)

    Megan Emerson

    2017-02-01

    Full Text Available (1 Background: Pediatric obesity continues to be a major public health issue. Poor food selection in the school cafeteria is a risk factor. Chocolate or strawberry flavored milk is favored by the majority of elementary school students. Previous health promotion efforts have led to increased selection of plain milk, but may compromise total milk purchased. In our study, we examined the effectiveness of small prizes as incentives to improve healthy food and beverage selection by elementary school students; (2 Methods: In a small Midwestern school district, small prizes were given to elementary school students who selected a “Power Plate” (PP, the healthful combination of a plain milk, a fruit, a vegetable and an entrée with whole grain over two academic school years; (3 Results: PP selection increased from 0.05 per student to 0.19, a 271% increase (p < 0.001. All healthful foods had increased selection with plain milk having the greatest increase, 0.098 per student to 0.255, a 159% increase (p < 0.001; (4 Total milk purchased increased modestly from 0.916 to 0.956 per student (p = 0.000331. Conclusion: Giving small prizes as a reward for healthful food selection substantially improves healthful food selection and the effect is sustainable over two academic years.

  8. Microscopic description of orbital-selective spin ordering in BaMn2As2

    Science.gov (United States)

    Craco, L.; Carara, S. S.

    2018-05-01

    Using generalized gradient approximation+dynamical mean-field theory, we provide a microscopic description of orbital-selective spin ordering in the tetragonal manganese pnictide BaMn2As2 . We demonstrate the coexistence of local moments and small band-gap electronic states in the parent compound. We also explore the role played by electron/hole doping, showing that the Mott insulating state is rather robust to small removal of electron charge carriers similar to cuprate oxide superconductors. Good qualitative accord between theory and angle-resolved photoemission as well as electrical transport provides support to our view of orbital-selective spin ordering in BaMn2As2 . Our proposal is expected to be an important step to understanding the emergent correlated electronic structure of materials with persisting ordered localized moments coexisting with Coulomb reconstructed nonmagnetic electronic states.

  9. In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

    Science.gov (United States)

    Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

    2017-12-14

    Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  10. Micromesh-selection for the ALTAS New Small Wheel Micromegas detectors

    CERN Document Server

    Kuger, Fabian; The ATLAS collaboration

    2016-01-01

    With New Small Wheel Upgrade scheduled for the next long LHC shutdown the innermost end-cap regions of the ATLAS Muon system will be equipped with eight layers of Micromegas detectors. The single quadruplet modules will be up to 2,5m long and 2,2m wide. A key component of a Micromegas are fine conductive meshes, dividing the gas volume into a drift and an amplification region. The selection of the correct mesh is an important design objective, effecting various detector aspects. Among others the electrical field configuration, electron losses during mesh transition and gas flow within the detectors have been studied. Mechanical stability requirements and production process related constrains have been investiaged in close colaboration with industrial partners.

  11. optimal selection of hydraulic turbines for small hydro electric power

    African Journals Online (AJOL)

    eobe

    Keywords: optimal selection, SHP turbine, flow duration curve, energy efficiency, annual capacity factor. 1. INTRODUCTION ... depleted, with adverse environmental impacts downstream ..... Technologies, Financing Cogeneration and Small -.

  12. HER3 signaling and targeted therapy in cancer

    Directory of Open Access Journals (Sweden)

    Rosalin Mishra

    2018-05-01

    Full Text Available ERBB family members including epidermal growth factor receptor (EGFR also known as HER1, ERBB2/HER2/Neu, ERBB3/HER3 and ERBB4/HER4 are aberrantly activated in multiple cancers and hence serve as drug targets and biomarkers in modern precision therapy. The therapeutic potential of HER3 has long been underappreciated, due to impaired kinase activity and relatively low expression in tumors. However, HER3 has received attention in recent years as it is a crucial heterodimeric partner for other EGFR family members and has the potential to regulate EGFR/HER2-mediated resistance. Upregulation of HER3 is associated with several malignancies where it fosters tumor progression via interaction with different receptor tyrosine kinases (RTKs. Studies also implicate HER3 contributing significantly to treatment failure, mostly through the activation of PI3K/AKT, MAPK/ERK and JAK/STAT pathways. Moreover, activating mutations in HER3 have highlighted the role of HER3 as a direct therapeutic target. Therapeutic targeting of HER3 includes abrogating its dimerization partners’ kinase activity using small molecule inhibitors (lapatinib, erlotinib, gefitinib, afatinib, neratinib or direct targeting of its extracellular domain. In this review, we focus on HER3-mediated signaling, its role in drug resistance and discuss the latest advances to overcome resistance by targeting HER3 using mono- and bispecific antibodies and small molecule inhibitors.

  13. Real-time monitoring of nitric oxide (NO) and pO2 levels under ischemic conditions associated with small bowel ischemia/reperfusion injury using selective electrodes for NO and oxygen molecules.

    Science.gov (United States)

    Watanabe, T; Owada, S; Kobayashi, H; Ishiuchi, A; Nakano, H; Asakuta, T; Shimamura, T; Asano, T; Koizumi, S; Jinnouchi, Y; Katayama, M; Kamibayasi, M; Murakami, E; Otsubo, T

    2007-12-01

    The present study demonstrated the feasibility of monitoring nitric oxide (NO) and pO2 levels under ischemic conditions associated with small bowel ischemia/reperfusion (I/R) injury through the use of selective electrodes for NO and oxygen molecules. NO levels gradually increased during ischemia. When reperfusion was started, the NO level decreased suddenly and returned to pre-ischemia values within 10 minutes. After clamping, pO2 decreased rapidly. When reperfusion was started, pO2 increased suddenly, returning to pre-ischemia values within 10 minutes. We concluded that it is feasible to monitor NO and pO2 levels under ischemic conditions of small bowel I/R injury through the use of electrodes selective for NO and oxygen molecules.

  14. Optimized high-throughput microRNA expression profiling provides novel biomarker assessment of clinical prostate and breast cancer biopsies

    Directory of Open Access Journals (Sweden)

    Fedele Vita

    2006-06-01

    Full Text Available Abstract Background Recent studies indicate that microRNAs (miRNAs are mechanistically involved in the development of various human malignancies, suggesting that they represent a promising new class of cancer biomarkers. However, previously reported methods for measuring miRNA expression consume large amounts of tissue, prohibiting high-throughput miRNA profiling from typically small clinical samples such as excision or core needle biopsies of breast or prostate cancer. Here we describe a novel combination of linear amplification and labeling of miRNA for highly sensitive expression microarray profiling requiring only picogram quantities of purified microRNA. Results Comparison of microarray and qRT-PCR measured miRNA levels from two different prostate cancer cell lines showed concordance between the two platforms (Pearson correlation R2 = 0.81; and extension of the amplification, labeling and microarray platform was successfully demonstrated using clinical core and excision biopsy samples from breast and prostate cancer patients. Unsupervised clustering analysis of the prostate biopsy microarrays separated advanced and metastatic prostate cancers from pooled normal prostatic samples and from a non-malignant precursor lesion. Unsupervised clustering of the breast cancer microarrays significantly distinguished ErbB2-positive/ER-negative, ErbB2-positive/ER-positive, and ErbB2-negative/ER-positive breast cancer phenotypes (Fisher exact test, p = 0.03; as well, supervised analysis of these microarray profiles identified distinct miRNA subsets distinguishing ErbB2-positive from ErbB2-negative and ER-positive from ER-negative breast cancers, independent of other clinically important parameters (patient age; tumor size, node status and proliferation index. Conclusion In sum, these findings demonstrate that optimized high-throughput microRNA expression profiling offers novel biomarker identification from typically small clinical samples such as breast

  15. Mechanisms of resistance to HER family targeting antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Kruser, Tim J. [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, WI (United States); Wheeler, Deric L., E-mail: dlwheeler@wisc.edu [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, WI (United States)

    2010-04-15

    The epidermal growth factor (EGF) family of receptor tyrosine kinases consists of four members: EGFR (HER1/ErbB1), HER2/neu (ErbB2), HER3 (ErbB3) and HER4 (ErbB4). Receptor activation via ligand binding leads to downstream signaling that influence cell proliferation, angiogenesis, invasion and metastasis. Aberrant expression or activity of EGFR and HER2 have been strongly linked to the etiology of several human epithelial cancers including but not limited to head and neck squamous cell carcinoma (HNSCC), non-small cell lung cancer (NSCLC), colorectal cancer (CRC), and breast cancer. With this, intense efforts have been made to inhibit the activity of the EGFR and HER2 by designing antibodies against the ligand binding domains (cetuximab, panitumumab and trastuzumab) or small molecules against the tyrosine kinase domains (erlotinib, gefitinib, and lapatinib). Both approaches have shown considerable clinical promise. However, increasing evidence suggests that the majority of patients do not respond to these therapies, and those who show initial response ultimately become refractory to treatment. While mechanisms of resistance to tyrosine kinase inhibitors have been extensively studied, resistance to monoclonal antibodies is less well understood, both in the laboratory and in the clinical setting. In this review, we discuss resistance to antibody-based therapies against the EGFR and HER2, similarities between these resistance profiles, and strategies to overcome resistance to HER family targeting monoclonal antibody therapy.

  16. Identification of novel selective V2 receptor non-peptide agonists.

    Science.gov (United States)

    Del Tredici, Andria L; Vanover, Kim E; Knapp, Anne E; Bertozzi, Sine M; Nash, Norman R; Burstein, Ethan S; Lameh, Jelveh; Currier, Erika A; Davis, Robert E; Brann, Mark R; Mohell, Nina; Olsson, Roger; Piu, Fabrice

    2008-10-30

    Peptides with agonist activity at the vasopressin V(2) receptor are used clinically to treat fluid homeostasis disorders such as polyuria and central diabetes insipidus. Of these peptides, the most commonly used is desmopressin, which displays poor bioavailability as well as potent activity at the V(1b) receptor, with possible stress-related adverse effects. Thus, there is a strong need for the development of small molecule chemistries with selective V(2) receptor agonist activity. Using the functional cell-based assay Receptor Selection and Amplification Technology (R-SAT((R))), a screening effort identified three small molecule chemotypes (AC-94544, AC-88324, and AC-110484) with selective agonist activity at the V(2) receptor. One of these compounds, AC-94544, displayed over 180-fold selectivity at the V(2) receptor compared to related vasopressin and oxytocin receptors and no activity at 28 other G protein-coupled receptors (GPCRs). All three compounds also showed partial agonist activity at the V(2) receptor in a cAMP accumulation assay. In addition, in a rat model of central diabetes insipidus, AC-94544 was able to significantly reduce urine output in a dose-dependent manner. Thus, AC-94544, AC-88324, and AC-110484 represent novel opportunities for the treatment of disorders associated with V(2) receptor agonist deficiency.

  17. Bioinformatics in cancer therapy and drug design

    International Nuclear Information System (INIS)

    Horbach, D.Y.; Usanov, S.A.

    2005-01-01

    One of the mechanisms of external signal transduction (ionizing radiation, toxicants, stress) to the target cell is the existence of membrane and intracellular proteins with intrinsic tyrosine kinase activity. No wonder that etiology of malignant growth links to abnormalities in signal transduction through tyrosine kinases. The epidermal growth factor receptor (EGFR) tyrosine kinases play fundamental roles in development, proliferation and differentiation of tissues of epithelial, mesenchymal and neuronal origin. There are four types of EGFR: EGF receptor (ErbB1/HER1), ErbB2/Neu/HER2, ErbB3/HER3 and ErbB4/HER4. Abnormal expression of EGFR, appearance of receptor mutants with changed ability to protein-protein interactions or increased tyrosine kinase activity have been implicated in the malignancy of different types of human tumors. Bioinformatics is currently using in investigation on design and selection of drugs that can make alterations in structure or competitively bind with receptors and so display antagonistic characteristics. (authors)

  18. Bioinformatics in cancer therapy and drug design

    Energy Technology Data Exchange (ETDEWEB)

    Horbach, D Y [International A. Sakharov environmental univ., Minsk (Belarus); Usanov, S A [Inst. of bioorganic chemistry, National academy of sciences of Belarus, Minsk (Belarus)

    2005-05-15

    One of the mechanisms of external signal transduction (ionizing radiation, toxicants, stress) to the target cell is the existence of membrane and intracellular proteins with intrinsic tyrosine kinase activity. No wonder that etiology of malignant growth links to abnormalities in signal transduction through tyrosine kinases. The epidermal growth factor receptor (EGFR) tyrosine kinases play fundamental roles in development, proliferation and differentiation of tissues of epithelial, mesenchymal and neuronal origin. There are four types of EGFR: EGF receptor (ErbB1/HER1), ErbB2/Neu/HER2, ErbB3/HER3 and ErbB4/HER4. Abnormal expression of EGFR, appearance of receptor mutants with changed ability to protein-protein interactions or increased tyrosine kinase activity have been implicated in the malignancy of different types of human tumors. Bioinformatics is currently using in investigation on design and selection of drugs that can make alterations in structure or competitively bind with receptors and so display antagonistic characteristics. (authors)

  19. In Vivo 18-FDG/18-Choline-Mediated Cerenkov Radiation Energy Transfer (CRET) Multiplexed Optical Imaging for Human Prostate Carcinoma Detection and Staging

    Science.gov (United States)

    2017-12-01

    Missouri System Columbia MO 65211-3020 REPORT DATE: December 2017 TYPE OF REPORT: Final PREPARED FOR: U.S. Army Medical Research and...U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION...cancer xenografts. We have selected peptides from bacteriophage display libraries that target TF and ErbB2/ErbB3. The peptides have been attached to

  20. Airfoil selection methodology for Small Wind Turbines

    DEFF Research Database (Denmark)

    Salgado Fuentes, Valentin; Troya, Cesar; Moreno, Gustavo

    2016-01-01

    On wind turbine technology, the aerodynamic performance is fundamental to increase efficiency. Nowadays there are several databases with airfoils designed and simulated for different applications; that is why it is necessary to select those suitable for a specific application. This work presents...... a new methodology for airfoil selection used in feasibility and optimization of small wind turbines with low cut-in speed. On the first stage, airfoils data is tested on XFOIL software to check its compatibility with the simulator; then, arithmetic mean criteria is recursively used to discard...... underperformed airfoils; the best airfoil data was exported to Matlab for a deeper analysis. In the second part, data points were interpolated using "splines" to calculate glide ratio and stability across multiple angles of attack, those who present a bigger steadiness were conserved. As a result, 3 airfoils...

  1. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    Directory of Open Access Journals (Sweden)

    Annamaria eRuscito

    2016-05-01

    Full Text Available Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012 notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed

  2. 76 FR 26948 - Small Business Jobs Act Tour: Selected Provisions Having an Effect on Government Contracting

    Science.gov (United States)

    2011-05-10

    ...] Small Business Jobs Act Tour: Selected Provisions Having an Effect on Government Contracting AGENCY: U.S... INFORMATION CONTACT: Richard L. Miller, Small Business Job's Act Tour-Office of Government Contracting and..., concerning the Small Business Act Tour: Selected Provisions Having an Effect on Government that announced a...

  3. Discovery of new erbB4 inhibitors: Repositioning an orphan chemical library by inverse virtual screening.

    Science.gov (United States)

    Giordano, Assunta; Forte, Giovanni; Massimo, Luigia; Riccio, Raffaele; Bifulco, Giuseppe; Di Micco, Simone

    2018-04-12

    Inverse Virtual Screening (IVS) is a docking based approach aimed to the evaluation of the virtual ability of a single compound to interact with a library of proteins. For the first time, we applied this methodology to a library of synthetic compounds, which proved to be inactive towards the target they were initially designed for. Trifluoromethyl-benzenesulfonamides 3-21 were repositioned by means of IVS identifying new lead compounds (14-16, 19 and 20) for the inhibition of erbB4 in the low micromolar range. Among these, compound 20 exhibited an interesting value of IC 50 on MCF7 cell lines, thus validating IVS in lead repurposing. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  4. A genome-wide RNAi screen identifies novel targets of neratinib sensitivity leading to neratinib and paclitaxel combination drug treatments.

    Science.gov (United States)

    Seyhan, Attila A; Varadarajan, Usha; Choe, Sung; Liu, Yan; McGraw, John; Woods, Matthew; Murray, Stuart; Eckert, Amy; Liu, Wei; Ryan, Terence E

    2011-06-01

    ErbB2 is frequently activated in tumors, and influences a wide array of cellular functions, including proliferation, apoptosis, cell motility and adhesion. HKI-272 (neratinib) is a small molecule pan-kinase inhibitor of the ErbB family of receptor tyrosine kinases, and shows strong antiproliferative activity in ErbB2-overexpressing breast cancer cells. We undertook a genome-wide pooled lentiviral RNAi screen to identify synthetic lethal or enhancer (synthetic modulator screen) genes that interact with neratinib in a human breast cancer cell line (SKBR-3). These genes upon knockdown would modulate cell viability in the presence of subeffective concentrations of neratinib. We discovered a diverse set of genes whose depletion selectively impaired or enhanced the viability of SKBR-3 cells in the presence of neratinib. We observed diverse pathways including EGFR, hypoxia, cAMP, and protein ubiquitination that, when co-treated with RNAi and neratinib, resulted in arrest of cell proliferation. Examining the changes of these genes and their protein products also led to a rationale for clinically relevant drug combination treatments. Treatment of cells with either paclitaxel or cytarabine in combination with neratinib resulted in a strong antiproliferative effect. The identification of novel mediators of cellular response to neratinib and the development of potential drug combination treatments have expanded our understanding of neratinib's mode-of-action for the development of more effective therapeutic regimens. Notably, our findings support a paclitaxel and neratinib phase III clinical trial in breast cancer patients.

  5. Promiscuity and selectivity of small-molecule inhibitors across TAM receptor tyrosine kinases in pediatric leukemia.

    Science.gov (United States)

    Liu, Mao-Hua; Chen, Shi-Bing; Yu, Juan; Liu, Cheng-Jun; Zhang, Xiao-Jing

    2017-08-01

    The TAM receptor tyrosine kinase family member Mer has been recognized as an attractive therapeutic target for pediatric leukemia. Beside Mer the family contains other two kinases, namely, Tyro3 and Axl, which are highly homologues with Mer and thus most existing small-molecule inhibitors show moderate or high promiscuity across the three kinases. Here, the structural basis and energetic property of selective binding of small-molecule inhibitors to the three kinases were investigated at molecular level. It is found that the selectivity is primarily determined by the size, shape and configuration of kinase's ATP-binding site; the Mer and Axl possess a small, closed active pocket as compared to the bulky, open pocket of Tyro3. The location and conformation of active-site residues of Mer and Axl are highly consistent, suggesting that small-molecule inhibitors generally have a low Mer-over-Axl selectivity and a high Mer-over-Tyro3 selectivity. We demonstrated that the difference in ATP binding potency to the three kinases is also responsible for inhibitor selectivity. We also found that the long-range interactions and allosteric effect arising from rest of the kinase's active site can indirectly influence inhibitor binding and selectivity. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Complex Behavior in a Selective Aging Neuron Model Based on Small World Networks

    International Nuclear Information System (INIS)

    Zhang Guiqing; Chen Tianlun

    2008-01-01

    Complex behavior in a selective aging simple neuron model based on small world networks is investigated. The basic elements of the model are endowed with the main features of a neuron function. The structure of the selective aging neuron model is discussed. We also give some properties of the new network and find that the neuron model displays a power-law behavior. If the brain network is small world-like network, the mean avalanche size is almost the same unless the aging parameter is big enough.

  7. Expression of oncogen c-erbB-2 (neu/HER-2) in human breast cancer

    International Nuclear Information System (INIS)

    Michelin, Severino C.; Mayo, Jose

    2000-01-01

    Breast cancer continues to be one of the leading causes of death from cancer among women and represents the most serious challenge to therapeutic control. Amplification and overexpression of the c-erbB-2 proto-oncogene occurs in as many as 30 % of all breast cancers and has been correlated with lymph node metastasis and poor prognosis in breast cancer patients. This gene know as neu, HER-2 or c-erbB-2 in among those most frequently altered in human cancer. It was first identified as a transforming gene activated in chemically induced rat neuroectodermal tumors. Early critical studies linked changes in erbB-2 expression and gene copy number to several human cancer, notably breast, ovarian and gastric cancer. Owing to its accessible location at the cell surface, erbB-2 is now under intensive scrutiny as a therapeutic target. In this review we will summarize the involvement of the c-erbB-2 gene in tumorigenesis. (author)

  8. Grb2 mediates semaphorin-4D-dependent RhoA inactivation.

    Science.gov (United States)

    Sun, Tianliang; Krishnan, Rameshkumar; Swiercz, Jakub M

    2012-08-01

    Signaling through the semaphorin 4D (Sema4D) receptor plexin-B1 is modulated by its interaction with tyrosine kinases ErbB-2 and Met. In cells expressing the plexin-B1-ErbB-2 receptor complex, ligand stimulation results in the activation of small GTPase RhoA and stimulation of cellular migration. By contrast, in cells expressing plexin-B1 and Met, ligand stimulation results in an association with the RhoGTPase-activating protein p190 RhoGAP and subsequent RhoA inactivation--a process that involves the tyrosine phosphorylation of plexin-B1 by Met. Inactivation of RhoA is necessary for Sema4D-mediated inhibition of cellular migration. It is, however, unknown how plexin-B1 phosphorylation regulates RhoGAP interaction and activity. Here we show that the activation of plexin-B1 by Sema4D and its subsequent tyrosine phosphorylation by Met creates a docking site for the SH2 domain of growth factor receptor bound-2 (Grb2). Grb2 is thereby recruited into the plexin-B1 receptor complex and, through its SH3 domain, interacts with p190 RhoGAP and mediates RhoA deactivation. Phosphorylation of plexin-B1 by Met and the recruitment of Grb2 have no effect on the R-RasGAP activity of plexin-B1, but are required for Sema4D-induced, RhoA-dependent antimigratory effects of Sema4D on breast cancer cells. These data show Grb2 as a direct link between plexin and p190-RhoGAP-mediated downstream signaling.

  9. Status of small ruminant production in six selected communities in ...

    African Journals Online (AJOL)

    The study examined the status of small ruminant production in some selected communities in Delta State vis-à-vis identifying the type of people involved in it; their response to modern livestock practices and determining factors affecting their stock size. Data were obtained from 90 respondents. Results of data analysis ...

  10. Small-molecule AT2 receptor agonists

    DEFF Research Database (Denmark)

    Hallberg, Mathias; Sumners, Colin; Steckelings, U Muscha

    2018-01-01

    The discovery of the first selective, small-molecule ATR receptor (AT2R) agonist compound 21 (C21) (8) that is now extensively studied in a large variety of in vitro and in vivo models is described. The sulfonylcarbamate derivative 8, encompassing a phenylthiofen scaffold is the drug-like agonist...... with the highest affinity for the AT2R reported to date (Ki = 0.4 nM). Structure-activity relationships (SAR), regarding different biaryl scaffolds and functional groups attached to these scaffolds and with a particular focus on the impact of various para substituents displacing the methylene imidazole group of 8......, are discussed. Furthermore, the consequences of migration of the methylene imidazole group and presumed structural requirements for ligands that are aimed as AT2R agonists (e.g. 8) or AT2R antagonists (e.g. 9), respectively, are briefly addressed. A summary of the pharmacological actions of C21 (8) is also...

  11. Hydrogen purification by selective methanation of CO in CO/CO2/H2

    DEFF Research Database (Denmark)

    Andersen, Anne Mette; Johannessen, Tue; Livbjerg, Hans

    down through the reactor and inside the catalyst pellets/particles. The small particles, which have a rather high effectiveness factor with respect to methanation of CO, have a high CO selectivity, whereas the larger pellets have very low selectivity even at high CO inlet concentrations. Negative...... of reaction kinetics and pore diffusion is crucial for interpreting the experimental data. We have found that the selectivity decreases by increasing the reactor temperature or catalyst particle size and when the CO inlet concentration is reduced. As a result, the selectivity drops significantly...... in an integral reactor operating at high CO-conversion. The lower limit of CO concentration in the outlet is determined by the quasi-equilibrium between CO removal and CO production from CO2....

  12. A Capture-SELEX Strategy for Multiplexed Selection of RNA Aptamers Against Small Molecules

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Doessing, Holger B.; Long, Katherine S.

    2018-01-01

    -SELEX, a selection strategy that uses an RNA library to yield ligand-responsive RNA aptamers targeting small organic molecules in solution. To demonstrate the power of this method we selected several aptamers with specificity towards either the natural sweetener rebaudioside A or the food-coloring agent carminic...

  13. Daytime habitat selection for juvenile parr brown trout (Salmo trutta in small lowland streams

    Directory of Open Access Journals (Sweden)

    Conallin J.

    2014-03-01

    Full Text Available Physical habitat is important in determining the carrying capacity of juvenile brown trout, and within freshwater management. Summer daytime physical habitat selection for the parr lifestage (7–20 cm juvenile brown trout (Salmo trutta was assessed in 6 small lowland streams. Habitat preference was determined for the four variables; water velocity, water depth, substrate and cover, and the preferences for physical habitat selection were expressed in terms of habitat suitability indices (HSI’s. The statistical confidence of HSI’s was evaluated using power analysis. It was found that a minimum of 22 fish observations was needed to have statistical confidence in the HSIs for water depth, and a minimum of 92 fish observations for water velocity during daytime summer conditions. Generally parr were utilising the deeper habitats, indicating preference for deeper water. Cover was also being selected for at all sites, but selection was inconsistent among sites for the variables substrate and velocity. The results indicate that during daytime summer conditions water depth is a significant variable for parr habitat selection in these small lowland streams, with cover also being important. Therefore, daytime refugia may be a critical limiting factor for parr in small lowland streams, and important for stream management actions under the Water Framework Directive.

  14. Technology selection for offshore underwater small modular reactors

    International Nuclear Information System (INIS)

    Shivan, Koroush; Ballinger, Ronald; Buongiorno, Jacopo; Forsberg, Charles; Kazimi, Mujid; Todreas, Neil

    2016-01-01

    This work examines the most viable nuclear technology options for future underwater designs that would meet high safety standards as well as good economic potential, for construction in the 2030-2040 time frame. The top five concepts selected from a survey of 13 nuclear technologies were compared to a small modular pressurized water reactor (PWR) designed with a conventional layout. In order of smallest to largest primary system size where the reactor and all safety systems are contained, the top five designs were: (1) a lead-bismuth fast reactor based on the Russian SVBR-100; (2) a novel organic cooled reactor; (3) an innovative superheated water reactor; (4) a boiling water reactor based on Toshiba's LSBWR; and (5) an integral PWR featuring compact steam generators. A similar study on potential attractive power cycles was also performed. A condensing and recompression supercritical CO 2 cycle and a compact steam Rankine cycle were designed. It was found that the hull size required by the reactor, safety systems and power cycle can be significantly reduced (50-80%) with the top five designs compared to the conventional PWR. Based on the qualitative economic consideration, the organic cooled reactor and boiling water reactor designs are expected to be the most cost effective options

  15. Technology selection for offshore underwater small modular reactors

    Energy Technology Data Exchange (ETDEWEB)

    Shivan, Koroush; Ballinger, Ronald; Buongiorno, Jacopo; Forsberg, Charles; Kazimi, Mujid; Todreas, Neil [Dept. of Nuclear Science and Engineering, Massachusetts Institute of Technology, Cambridge (United States)

    2016-12-15

    This work examines the most viable nuclear technology options for future underwater designs that would meet high safety standards as well as good economic potential, for construction in the 2030-2040 time frame. The top five concepts selected from a survey of 13 nuclear technologies were compared to a small modular pressurized water reactor (PWR) designed with a conventional layout. In order of smallest to largest primary system size where the reactor and all safety systems are contained, the top five designs were: (1) a lead-bismuth fast reactor based on the Russian SVBR-100; (2) a novel organic cooled reactor; (3) an innovative superheated water reactor; (4) a boiling water reactor based on Toshiba's LSBWR; and (5) an integral PWR featuring compact steam generators. A similar study on potential attractive power cycles was also performed. A condensing and recompression supercritical CO{sub 2} cycle and a compact steam Rankine cycle were designed. It was found that the hull size required by the reactor, safety systems and power cycle can be significantly reduced (50-80%) with the top five designs compared to the conventional PWR. Based on the qualitative economic consideration, the organic cooled reactor and boiling water reactor designs are expected to be the most cost effective options.

  16. Technology Selection for Offshore Underwater Small Modular Reactors

    Directory of Open Access Journals (Sweden)

    Koroush Shirvan

    2016-12-01

    Full Text Available This work examines the most viable nuclear technology options for future underwater designs that would meet high safety standards as well as good economic potential, for construction in the 2030–2040 timeframe. The top five concepts selected from a survey of 13 nuclear technologies were compared to a small modular pressurized water reactor (PWR designed with a conventional layout. In order of smallest to largest primary system size where the reactor and all safety systems are contained, the top five designs were: (1 a lead–bismuth fast reactor based on the Russian SVBR-100; (2 a novel organic cooled reactor; (3 an innovative superheated water reactor; (4 a boiling water reactor based on Toshiba's LSBWR; and (5 an integral PWR featuring compact steam generators. A similar study on potential attractive power cycles was also performed. A condensing and recompression supercritical CO2 cycle and a compact steam Rankine cycle were designed. It was found that the hull size required by the reactor, safety systems and power cycle can be significantly reduced (50–80% with the top five designs compared to the conventional PWR. Based on the qualitative economic consideration, the organic cooled reactor and boiling water reactor designs are expected to be the most cost effective options.

  17. Transcriptome Analysis on Single Small Yellow Follicles Reveals That Wnt4 Is Involved in Chicken Follicle Selection

    Directory of Open Access Journals (Sweden)

    Yiya Wang

    2017-11-01

    Full Text Available Ovarian follicle selection is an important process impacting the laying performance and fecundity of hens, and is regulated by follicle-stimulating hormone (FSH through binding to its receptor [follicle-stimulating hormone receptor (FSHR]. In laying hens, the small yellow follicle (6–8 mm in diameter with the highest expression of FSHR will be recruited into the preovulatory hierarchy during ovarian follicle development. The study of molecular mechanism of chicken follicle selection is helpful for the identification of genes underlying egg-laying traits in chicken and other poultry species. Herein, the transcriptomes of chicken small yellow follicles differing in the mRNA expression of FSHR were compared, and a total of 17,993 genes were identified in 3 pairs of small yellow follicles. The Wnt signaling pathway was significantly enriched in the follicles with the greatest fold change in FSHR expression. In this pathway, the expression level of Wnt4 mRNA was significantly upregulated with a log2(fold change of 2.12. We further investigated the expression, function, and regulation of Wnt4 during chicken follicle selection and found that Wnt4 mRNA reached its peak in small yellow follicles; Wnt4 stimulated the proliferation of follicular granulosa cells (GCs, increased the expression of StAR and CYP11A1 mRNA in prehierarchical and hierarchical follicles, increased the expression of FSHR mRNA, and decreased the expression of anti-Müllerian hormone and OCLN mRNA. Treatment with FSH significantly increased Wnt4 expression in GCs. Moreover, Wnt4 facilitated the effects of FSH on the production of progesterone (P4 and the mRNA expression of steroidogenic enzyme genes in the GCs of hierarchical follicles, but inhibited the effects of FSH in the GCs of prehierarchical follicles. Collectively, these data suggest that Wnt4 plays an important role in chicken follicle selection by stimulating GC proliferation and steroidogenesis. This study provides a

  18. Competition and habitat selection in a forest-floor small mammal fauna

    Energy Technology Data Exchange (ETDEWEB)

    Dueser, R D [Univ. of Virginia, Charlottesville; Hallett, J G

    1980-01-01

    In a study of habitat exploitation in a forest-floor small mammal community, we have collected habitat and population data for Peromyscus leucopus, Ochrotomys nuttalli, and Tamias striatus. Using multiple regression analysis, researchers estimate the effects of habitat selection and competition on the local distributions of these species during three seasons. Each of the partial regression coefficients relating the density of an independent species to the density of the dependent species is negative. This result indicates that competition is pervasive among these species. Competitive ability and habitat selectivity both increase in the order Peromyscus-Tamias-Ochrotomys. Peromyscus is a poorly competitive habitat generalist, Ochrotomys is a strongly competitive habitat specialist, and Tamias is intermediate in both respects. The competitive hierarchy is stable between seasons. These results both confirm the conclusions reached in previous studies of this small mammal community and suggest the design of experiments to further clarify the mode and consequences of interaction between these species.

  19. Selective small-molecule inhibitors as chemical tools to define the roles of matrix metalloproteinases in disease.

    Science.gov (United States)

    Meisel, Jayda E; Chang, Mayland

    2017-11-01

    The focus of this article is to highlight novel inhibitors and current examples where the use of selective small-molecule inhibitors has been critical in defining the roles of matrix metalloproteinases (MMPs) in disease. Selective small-molecule inhibitors are surgical chemical tools that can inhibit the targeted enzyme; they are the method of choice to ascertain the roles of MMPs and complement studies with knockout animals. This strategy can identify targets for therapeutic development as exemplified by the use of selective small-molecule MMP inhibitors in diabetic wound healing, spinal cord injury, stroke, traumatic brain injury, cancer metastasis, and viral infection. This article is part of a Special Issue entitled: Matrix Metalloproteinases edited by Rafael Fridman. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Cow genotyping strategies for genomic selection in a small dairy cattle population.

    Science.gov (United States)

    Jenko, J; Wiggans, G R; Cooper, T A; Eaglen, S A E; Luff, W G de L; Bichard, M; Pong-Wong, R; Woolliams, J A

    2017-01-01

    This study compares how different cow genotyping strategies increase the accuracy of genomic estimated breeding values (EBV) in dairy cattle breeds with low numbers. In these breeds, few sires have progeny records, and genotyping cows can improve the accuracy of genomic EBV. The Guernsey breed is a small dairy cattle breed with approximately 14,000 recorded individuals worldwide. Predictions of phenotypes of milk yield, fat yield, protein yield, and calving interval were made for Guernsey cows from England and Guernsey Island using genomic EBV, with training sets including 197 de-regressed proofs of genotyped bulls, with cows selected from among 1,440 genotyped cows using different genotyping strategies. Accuracies of predictions were tested using 10-fold cross-validation among the cows. Genomic EBV were predicted using 4 different methods: (1) pedigree BLUP, (2) genomic BLUP using only bulls, (3) univariate genomic BLUP using bulls and cows, and (4) bivariate genomic BLUP. Genotyping cows with phenotypes and using their data for the prediction of single nucleotide polymorphism effects increased the correlation between genomic EBV and phenotypes compared with using only bulls by 0.163±0.022 for milk yield, 0.111±0.021 for fat yield, and 0.113±0.018 for protein yield; a decrease of 0.014±0.010 for calving interval from a low base was the only exception. Genetic correlation between phenotypes from bulls and cows were approximately 0.6 for all yield traits and significantly different from 1. Only a very small change occurred in correlation between genomic EBV and phenotypes when using the bivariate model. It was always better to genotype all the cows, but when only half of the cows were genotyped, a divergent selection strategy was better compared with the random or directional selection approach. Divergent selection of 30% of the cows remained superior for the yield traits in 8 of 10 folds. Copyright © 2017 American Dairy Science Association. Published by

  1. Identification of a selective small molecule inhibitor of breast cancer stem cells.

    Science.gov (United States)

    Germain, Andrew R; Carmody, Leigh C; Morgan, Barbara; Fernandez, Cristina; Forbeck, Erin; Lewis, Timothy A; Nag, Partha P; Ting, Amal; VerPlank, Lynn; Feng, Yuxiong; Perez, Jose R; Dandapani, Sivaraman; Palmer, Michelle; Lander, Eric S; Gupta, Piyush B; Schreiber, Stuart L; Munoz, Benito

    2012-05-15

    A high-throughput screen (HTS) with the National Institute of Health-Molecular Libraries Small Molecule Repository (NIH-MLSMR) compound collection identified a class of acyl hydrazones to be selectively lethal to breast cancer stem cell (CSC) enriched populations. Medicinal chemistry efforts were undertaken to optimize potency and selectivity of this class of compounds. The optimized compound was declared as a probe (ML239) with the NIH Molecular Libraries Program and displayed greater than 20-fold selective inhibition of the breast CSC-like cell line (HMLE_sh_Ecad) over the isogenic control line (HMLE_sh_GFP). Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Gram-scale solution-phase synthesis of selective sodium bicarbonate Co-transport Inhibitor S0859

    DEFF Research Database (Denmark)

    Larsen, Ann Møller; Krogsgaard-Larsen, Niels; Lauritzen, Gitte

    2012-01-01

    Na+-coupled HCO3- transporters (NBCs) mediate the transport of bicarbonate ions across cell membranes and are thus ubiquitous regulators of intracellular pH. NBC dysregulation is associated with a range of diseases; for instance, NBCn1 is strongly up-regulated in a model of ErbB2-dependent breast...

  3. A Holistic In silico Approach to Develop Novel Inhibitors Targeting ...

    African Journals Online (AJOL)

    Purpose: To design a dual inhibitor of natural origin capable of targeting ErbB1 and ErbB2 kinases for the treatment of lung cancer. Method: Advanced In silico drug designing techniques were explored in this study. Sequence and structure analysis of ErbB1 and ErbB2 was followed by three dimensional (3D) ...

  4. Selected List of Books and Journals for the Small Medical Library

    Science.gov (United States)

    Brandon, Alfred N.

    2012-01-01

    This list of 358 books and 123 journals is intended as a selection aid for the small library of a hospital, medical society, clinic, or similar organization. Books and journals are arranged by subject, with the books followed by an author index, and the journals by an alphabetical title listing. PMID:23509428

  5. Evaluating gaze-based interface tools to facilitate point-and-select tasks with small targets

    DEFF Research Database (Denmark)

    Skovsgaard, Henrik; Mateo, Julio C.; Hansen, John Paulin

    2011-01-01

    -and-select tasks. We conducted two experiments comparing the performance of dwell, magnification and zoom methods in point-and-select tasks with small targets in single- and multiple-target layouts. Both magnification and zoom showed higher hit rates than dwell. Hit rates were higher when using magnification than...

  6. Selective small-molecule inhibition of an RNA structural element

    Energy Technology Data Exchange (ETDEWEB)

    Howe, John A.; Wang, Hao; Fischmann, Thierry O.; Balibar, Carl J.; Xiao, Li; Galgoci, Andrew M.; Malinverni, Juliana C.; Mayhood, Todd; Villafania, Artjohn; Nahvi, Ali; Murgolo, Nicholas; Barbieri, Christopher M.; Mann, Paul A.; Carr, Donna; Xia, Ellen; Zuck, Paul; Riley, Dan; Painter, Ronald E.; Walker, Scott S.; Sherborne, Brad; de Jesus, Reynalda; Pan, Weidong; Plotkin, Michael A.; Wu, Jin; Rindgen, Diane; Cummings, John; Garlisi, Charles G.; Zhang, Rumin; Sheth, Payal R.; Gill, Charles J.; Tang, Haifeng; Roemer , Terry (Merck)

    2015-09-30

    Riboswitches are non-coding RNA structures located in messenger RNAs that bind endogenous ligands, such as a specific metabolite or ion, to regulate gene expression. As such, riboswitches serve as a novel, yet largely unexploited, class of emerging drug targets. Demonstrating this potential, however, has proven difficult and is restricted to structurally similar antimetabolites and semi-synthetic analogues of their cognate ligand, thus greatly restricting the chemical space and selectivity sought for such inhibitors. Here we report the discovery and characterization of ribocil, a highly selective chemical modulator of bacterial riboflavin riboswitches, which was identified in a phenotypic screen and acts as a structurally distinct synthetic mimic of the natural ligand, flavin mononucleotide, to repress riboswitch-mediated ribB gene expression and inhibit bacterial cell growth. Our findings indicate that non-coding RNA structural elements may be more broadly targeted by synthetic small molecules than previously expected.

  7. Design of a Low-Cost 2-Axes Fluxgate Magnetometer for Small Satellite Applications

    Directory of Open Access Journals (Sweden)

    Su-Jeoung Kim

    2005-03-01

    Full Text Available This paper addresses the design and analysis results of a 2-axes magnetometer for attitude determination of small satellite. A low-cost and efficient 2-axes fluxgate magnetometer was selected as the most suitable attitude sensor for LEO microsatellites which require a low-to-medium level pointing accuracy. An optimization trade-off study has been performed for the development of 2-axes fluxgate magnetometer. All the relevant parameters such as permeability, demagnetization factor, coil diameter, core thickness, and number of coil turns were considered for the sizing of a small satellite magnetometer. The magnetometer which is designed, manufactured, and tested in-house as described in this paper satisfies linearity requirement for determining attitude position of small satellites. On the basis of magnetometer which is designed in Space System Research Lab. (SSRL, commercial magnetometer will be developed.

  8. FOXP3 is a novel transcriptional repressor for the breast cancer oncogene SKP2.

    Science.gov (United States)

    Zuo, Tao; Liu, Runhua; Zhang, Huiming; Chang, Xing; Liu, Yan; Wang, Lizhong; Zheng, Pan; Liu, Yang

    2007-12-01

    S-phase kinase-associated protein 2 (SKP2) is a component of the E3 ubiquitin ligase SKP1-Cul1-Fbox complex. Overexpression of SKP2 results in cell cycle dysregulation and carcinogenesis; however, the genetic lesions that cause this upregulation are poorly understood. We recently demonstrated that forkhead box P3 (FOXP3) is an X-linked breast cancer suppressor and an important repressor of the oncogene ERBB2/HER2. Since FOXP3 suppresses tumor growth regardless of whether the tumors overexpress ERBB2/HER2, additional FOXP3 targets may be involved in its tumor suppressor activity. Here, we show that mammary carcinomas from mice heterozygous for a Foxp3 mutation exhibited increased Skp2 expression. Ectopic expression of FOXP3 in mouse mammary cancer cells repressed SKP2 expression with a corresponding increase in p27 and polyploidy. Conversely, siRNA silencing of the FOXP3 gene in human mammary epithelial cells increased SKP2 expression. We also show that Foxp3 directly interacted with and repressed the Skp2 promoter. Moreover, the analysis of over 200 primary breast cancer samples revealed an inverse correlation between FOXP3 and SKP2 levels. Finally, we demonstrated that downregulation of SKP2 was critical for FOXP3-mediated growth inhibition in breast cancer cells that do not overexpress ERBB2/HER2. Our data provide genetic, biochemical, and functional evidence that FOXP3 is a novel transcriptional repressor for the oncogene SKP2.

  9. Expanding Possibilities for Intervention against Small Ruminant Lentiviruses through Genetic Marker-Assisted Selective Breeding

    Directory of Open Access Journals (Sweden)

    Donald P. Knowles

    2013-06-01

    Full Text Available Small ruminant lentiviruses include members that infect sheep (ovine lentivirus [OvLV]; also known as ovine progressive pneumonia virus/maedi-visna virus and goats (caprine arthritis encephalitis virus [CAEV]. Breed differences in seroprevalence and proviral concentration of OvLV had suggested a strong genetic component in susceptibility to infection by OvLV in sheep. A genetic marker test for susceptibility to OvLV has been developed recently based on the TMEM154 gene with validation data from over 2,800 sheep representing nine cohorts. While no single genotype has been shown to have complete resistance to OvLV, consistent association in thousands of sheep from multiple breeds and management conditions highlight a new strategy for intervention by selective breeding. This genetic marker-assisted selection (MAS has the potential to be a useful addition to existing viral control measures. Further, the discovery of multiple additional genomic regions associated with susceptibility to or control of OvLV suggests that additional genetic marker tests may be developed to extend the reach of MAS in the future. This review will cover the strengths and limitations of existing data from host genetics as an intervention and outline additional questions for future genetic research in sheep, goats, small ruminant lentiviruses, and their host-pathogen interactions.

  10. Expanding Possibilities for Intervention against Small Ruminant Lentiviruses through Genetic Marker-Assisted Selective Breeding

    Science.gov (United States)

    White, Stephen N.; Knowles, Donald P.

    2013-01-01

    Small ruminant lentiviruses include members that infect sheep (ovine lentivirus [OvLV]; also known as ovine progressive pneumonia virus/maedi-visna virus) and goats (caprine arthritis encephalitis virus [CAEV]). Breed differences in seroprevalence and proviral concentration of OvLV had suggested a strong genetic component in susceptibility to infection by OvLV in sheep. A genetic marker test for susceptibility to OvLV has been developed recently based on the TMEM154 gene with validation data from over 2,800 sheep representing nine cohorts. While no single genotype has been shown to have complete resistance to OvLV, consistent association in thousands of sheep from multiple breeds and management conditions highlight a new strategy for intervention by selective breeding. This genetic marker-assisted selection (MAS) has the potential to be a useful addition to existing viral control measures. Further, the discovery of multiple additional genomic regions associated with susceptibility to or control of OvLV suggests that additional genetic marker tests may be developed to extend the reach of MAS in the future. This review will cover the strengths and limitations of existing data from host genetics as an intervention and outline additional questions for future genetic research in sheep, goats, small ruminant lentiviruses, and their host-pathogen interactions. PMID:23771240

  11. Structure-based network analysis of activation mechanisms in the ErbB family of receptor tyrosine kinases: the regulatory spine residues are global mediators of structural stability and allosteric interactions.

    Directory of Open Access Journals (Sweden)

    Kevin A James

    Full Text Available The ErbB protein tyrosine kinases are among the most important cell signaling families and mutation-induced modulation of their activity is associated with diverse functions in biological networks and human disease. We have combined molecular dynamics simulations of the ErbB kinases with the protein structure network modeling to characterize the reorganization of the residue interaction networks during conformational equilibrium changes in the normal and oncogenic forms. Structural stability and network analyses have identified local communities integrated around high centrality sites that correspond to the regulatory spine residues. This analysis has provided a quantitative insight to the mechanism of mutation-induced "superacceptor" activity in oncogenic EGFR dimers. We have found that kinase activation may be determined by allosteric interactions between modules of structurally stable residues that synchronize the dynamics in the nucleotide binding site and the αC-helix with the collective motions of the integrating αF-helix and the substrate binding site. The results of this study have pointed to a central role of the conserved His-Arg-Asp (HRD motif in the catalytic loop and the Asp-Phe-Gly (DFG motif as key mediators of structural stability and allosteric communications in the ErbB kinases. We have determined that residues that are indispensable for kinase regulation and catalysis often corresponded to the high centrality nodes within the protein structure network and could be distinguished by their unique network signatures. The optimal communication pathways are also controlled by these nodes and may ensure efficient allosteric signaling in the functional kinase state. Structure-based network analysis has quantified subtle effects of ATP binding on conformational dynamics and stability of the EGFR structures. Consistent with the NMR studies, we have found that nucleotide-induced modulation of the residue interaction networks is not

  12. Hyperspectral small animal fluorescence imaging: spectral selection imaging

    Science.gov (United States)

    Leavesley, Silas; Jiang, Yanan; Patsekin, Valery; Hall, Heidi; Vizard, Douglas; Robinson, J. Paul

    2008-02-01

    Molecular imaging is a rapidly growing area of research, fueled by needs in pharmaceutical drug-development for methods for high-throughput screening, pre-clinical and clinical screening for visualizing tumor growth and drug targeting, and a growing number of applications in the molecular biology fields. Small animal fluorescence imaging employs fluorescent probes to target molecular events in vivo, with a large number of molecular targeting probes readily available. The ease at which new targeting compounds can be developed, the short acquisition times, and the low cost (compared to microCT, MRI, or PET) makes fluorescence imaging attractive. However, small animal fluorescence imaging suffers from high optical scattering, absorption, and autofluorescence. Much of these problems can be overcome through multispectral imaging techniques, which collect images at different fluorescence emission wavelengths, followed by analysis, classification, and spectral deconvolution methods to isolate signals from fluorescence emission. We present an alternative to the current method, using hyperspectral excitation scanning (spectral selection imaging), a technique that allows excitation at any wavelength in the visible and near-infrared wavelength range. In many cases, excitation imaging may be more effective at identifying specific fluorescence signals because of the higher complexity of the fluorophore excitation spectrum. Because the excitation is filtered and not the emission, the resolution limit and image shift imposed by acousto-optic tunable filters have no effect on imager performance. We will discuss design of the imager, optimizing the imager for use in small animal fluorescence imaging, and application of spectral analysis and classification methods for identifying specific fluorescence signals.

  13. 40 CFR Appendix A to Subpart F of... - Sampling Plans for Selective Enforcement Auditing of Small Nonroad Engines

    Science.gov (United States)

    2010-07-01

    ... Enforcement Auditing of Small Nonroad Engines A Appendix A to Subpart F of Part 90 Protection of Environment...-IGNITION ENGINES AT OR BELOW 19 KILOWATTS Selective Enforcement Auditing Pt. 90, Subpt. F, App. A Appendix A to Subpart F of Part 90—Sampling Plans for Selective Enforcement Auditing of Small Nonroad Engines...

  14. Genome wide single cell analysis of chemotherapy resistant metastatic cells in a case of gastroesophageal adenocarcinoma

    International Nuclear Information System (INIS)

    Hjortland, Geir Olav; Fodstad, Oystein; Smeland, Sigbjorn; Hovig, Eivind; Meza-Zepeda, Leonardo A; Beiske, Klaus; Ree, Anne H; Tveito, Siri; Hoifodt, Hanne; Bohler, Per J; Hole, Knut H; Myklebost, Ola

    2011-01-01

    Metastatic progression due to development or enrichment of therapy-resistant tumor cells is eventually lethal. Molecular characterization of such chemotherapy resistant tumor cell clones may identify markers responsible for malignant progression and potential targets for new treatment. Here, in a case of stage IV adenocarcinoma of the gastroesophageal junction, we report the successful genome wide analysis using array comparative genomic hybridization (CGH) of DNA from only fourteen tumor cells using a bead-based single cell selection method from a bone metastasis progressing during chemotherapy. In a case of metastatic adenocarcinoma of the gastroesophageal junction, the progression of bone metastasis was observed during a chemotherapy regimen of epirubicin, oxaliplatin and capecitabine, whereas lung-, liver and lymph node metastases as well as the primary tumor were regressing. A bone marrow aspirate sampled at the site of progressing metastasis in the right iliac bone was performed, and single cell molecular analysis using array-CGH of Epithelial Specific Antigen (ESA)-positive metastatic cells, and revealed two distinct regions of amplification, 12p12.1 and 17q12-q21.2 amplicons, containing the KRAS (12p) and ERBB2 (HER2/NEU) (17q) oncogenes. Further intrapatient tumor heterogeneity of these highlighted gene copy number changes was analyzed by fluorescence in situ hybridization (FISH) in all available primary and metastatic tumor biopsies, and ErbB2 protein expression was investigated by immunohistochemistry. ERBB2 was heterogeneously amplified by FISH analysis in the primary tumor, as well as liver and bone metastasis, but homogenously amplified in biopsy specimens from a progressing bone metastasis after three initial cycles of chemotherapy, indicating a possible enrichment of erbB2 positive tumor cells in the progressing bone marrow metastasis during chemotherapy. A similar amplification profile was detected for wild-type KRAS, although more heterogeneously

  15. Ectoparasites of small ruminants in three selected agro-ecological sites of Tigray Region, Ethiopia.

    Science.gov (United States)

    Mulugeta, Y; Yacob, Hailu T; Ashenafi, Hagos

    2010-08-01

    A study on ectoparasites of small ruminants in three selected agro-ecological sites of Tigray Region, Ethiopia disclosed an overall prevalence of 55.5% and 58% in each examined 750 sheep and goats, respectively. In the sheep population, Melophagus ovinus (19.1%), tick infestations (16%), Damalinia ovis (15.3%), Linognathus africanus (11.5%), and Ctenocephalides felis (9%) were the major ectoparasites. The major ectoparasites identified in goats were tick infestations (29.7%), L. africanus (27.9%), Sarcoptes scabiei var. caprae (12.5%), C. felis (11.1%), and Demodex caprae (6.8%). In sheep, there was a statistically significant difference (P ovinus, L. africanus, and ticks between midland and highland. In goats, the risk of Sarcoptes scabiei var. caprae infestation in midland (odds ratio (OR) = 17.2, P < 0.001) and lowland (OR = 5.2, P < 0.001) was 17.2 times and 5.2 times, respectively, higher than the highland. Favorable climatic conditions, backward level of management, poor level of consciousness and awareness of farmers, and weak animal health extension services are believed to have contributed for widespread distribution and occurrences of ectoparasites. The growing threat of ectoparasites to small ruminant production and the tanning industry needs well-coordinated and urgent control intervention.

  16. Transmembrane α-Helix 2 and 7 Are Important for Small Molecule-Mediated Activation of the GLP-1 Receptor

    DEFF Research Database (Denmark)

    Underwood, Christina Rye; Møller Knudsen, Sanne; Schjellerup Wulff, Birgitte

    2011-01-01

    Glucagon-like peptide-1 (GLP-1) activates the GLP-1 receptor (GLP-1R), which belongs to family B of the G-protein-coupled receptors. We previously identified a selective small molecule ligand, compound 2, that acted as a full agonist and allosteric modulator of GLP-1R. In this study, the structur......Glucagon-like peptide-1 (GLP-1) activates the GLP-1 receptor (GLP-1R), which belongs to family B of the G-protein-coupled receptors. We previously identified a selective small molecule ligand, compound 2, that acted as a full agonist and allosteric modulator of GLP-1R. In this study......, the structurally related small molecule, compound 3, stimulated cAMP production from GLP-1R, but not from the homologous glucagon receptor (GluR). The receptor selectivity encouraged a chimeric receptor approach to identify domains important for compound 3-mediated activation of GLP-1R. A subsegment of the GLP-1R...... transmembrane domain containing TM2 to TM5 was sufficient to transfer compound 3 responsiveness to GluR. Therefore, divergent residues in this subsegment of GLP-1R and GluR are responsible for the receptor selectivity of compound 3. Functional analyses of other chimeric receptors suggested that the existence...

  17. Privacy problems in the small sample selection

    Directory of Open Access Journals (Sweden)

    Loredana Cerbara

    2013-05-01

    Full Text Available The side of social research that uses small samples for the production of micro data, today finds some operating difficulties due to the privacy law. The privacy code is a really important and necessary law because it guarantees the Italian citizen’s rights, as already happens in other Countries of the world. However it does not seem appropriate to limit once more the possibilities of the data production of the national centres of research. That possibilities are already moreover compromised due to insufficient founds is a common problem becoming more and more frequent in the research field. It would be necessary, therefore, to include in the law the possibility to use telephonic lists to select samples useful for activities directly of interest and importance to the citizen, such as the collection of the data carried out on the basis of opinion polls by the centres of research of the Italian CNR and some universities.

  18. An open-label, two-stage, phase II study of bevacizumab and lapatinib in children with recurrent or refractory ependymoma: a collaborative ependymoma research network study (CERN).

    Science.gov (United States)

    DeWire, Mariko; Fouladi, Maryam; Turner, David C; Wetmore, Cynthia; Hawkins, Cynthia; Jacobs, Carmen; Yuan, Ying; Liu, Diane; Goldman, Stewart; Fisher, Paul; Rytting, Michael; Bouffet, Eric; Khakoo, Yasmin; Hwang, Eugene I; Foreman, Nicholas; Stewart, Clinton F; Gilbert, Mark R; Gilbertson, Richard; Gajjar, Amar

    2015-05-01

    Co-expression of ERBB2 and ERBB4, reported in 75% of pediatric ependymomas, correlates with worse overall survival. Lapatinib, a selective ERBB1 and ERBB2 inhibitor has produced prolonged disease stabilization in patients with ependymoma in a phase I study. Bevacizumab exposure in ependymoma xenografts leads to ablation of tumor self-renewing cells, arresting growth. Thus, we conducted an open-label, phase II study of bevacizumab and lapatinib in children with recurrent ependymomas. Patients ≤ 21 years of age with recurrent ependymoma received lapatinib orally twice daily (900 mg/m(2)/dose to the first 10 patients, and then 700 mg/m(2)/dose) and bevacizumab 10 mg/kg intravenously on days 1 and 15 of a 28-day course. Lapatinib serum trough levels were analyzed prior to each course. Total and phosphorylated VEGFR2 expression was measured in peripheral blood mononuclear cells (PBMCs) before doses 1 and 2 of bevacizumab and 24-48 h following dose 2 of bevacizumab. Twenty-four patients with a median age of 10 years (range 2-21 years) were enrolled; 22 were eligible and 20 evaluable for response. Thirteen had anaplastic ependymoma. There were no objective responses; 4 patients had stable disease for ≥ 4 courses (range 4-14). Grade 3 toxicities included rash, elevated ALT, and diarrhea. Grade 4 toxicities included peri-tracheostomy hemorrhage (n = 1) and elevated creatinine phosphokinase (n = 1). The median lapatinib pre-dose trough concentration was 3.72 µM. Although the combination of bevacizumab and lapatinib was well tolerated in children with recurrent ependymoma, it proved ineffective.

  19. Alterations in cell growth and signaling in ErbB3 binding protein-1 (Ebp1 deficient mice

    Directory of Open Access Journals (Sweden)

    Lee Myounghee

    2008-12-01

    Full Text Available Abstract Background The ErbB3 binding protein-1 (Ebp1 belongs to a family of DNA/RNA binding proteins implicated in cell growth, apoptosis and differentiation. However, the physiological role of Ebp1 in the whole organism is not known. Therefore, we generated Ebp1-deficient mice carrying a gene trap insertion in intron 2 of the Ebp1 (pa2g4 gene. Results Ebp1-/- mice were on average 30% smaller than wild type and heterozygous sex matched littermates. Growth retardation was apparent from Day 10 until Day 30. IGF-1 production and IGBP-3 and 4 protein levels were reduced in both embryo fibroblasts and adult knock-out mice. The proliferation of fibroblasts derived from Day 12.5 knock out embryos was also decreased as compared to that of wild type cells. Microarray expression analysis revealed changes in genes important in cell growth including members of the MAPK signal transduction pathway. In addition, the expression or activation of proliferation related genes such as AKT and the androgen receptor, previously demonstrated to be affected by Ebp1 expression in vitro, was altered in adult tissues. Conclusion These results indicate that Ebp1 can affect growth in an animal model, but that the expression of proliferation related genes is cell and context specific. The Ebp1-/- mouse line represents a new in vivo model to investigate Ebp1 function in the whole organism.

  20. Ets2 in tumor fibroblasts promotes angiogenesis in breast cancer.

    Directory of Open Access Journals (Sweden)

    Julie A Wallace

    Full Text Available Tumor fibroblasts are active partners in tumor progression, but the genes and pathways that mediate this collaboration are ill-defined. Previous work demonstrates that Ets2 function in stromal cells significantly contributes to breast tumor progression. Conditional mouse models were used to study the function of Ets2 in both mammary stromal fibroblasts and epithelial cells. Conditional inactivation of Ets2 in stromal fibroblasts in PyMT and ErbB2 driven tumors significantly reduced tumor growth, however deletion of Ets2 in epithelial cells in the PyMT model had no significant effect. Analysis of gene expression in fibroblasts revealed a tumor- and Ets2-dependent gene signature that was enriched in genes important for ECM remodeling, cell migration, and angiogenesis in both PyMT and ErbB2 driven-tumors. Consistent with these results, PyMT and ErbB2 tumors lacking Ets2 in fibroblasts had fewer functional blood vessels, and Ets2 in fibroblasts elicited changes in gene expression in tumor endothelial cells consistent with this phenotype. An in vivo angiogenesis assay revealed the ability of Ets2 in fibroblasts to promote blood vessel formation in the absence of tumor cells. Importantly, the Ets2-dependent gene expression signatures from both mouse models were able to distinguish human breast tumor stroma from normal stroma, and correlated with patient outcomes in two whole tumor breast cancer data sets. The data reveals a key function for Ets2 in tumor fibroblasts in signaling to endothelial cells to promote tumor angiogenesis. The results highlight the collaborative networks that orchestrate communication between stromal cells and tumor cells, and suggest that targeting tumor fibroblasts may be an effective strategy for developing novel anti-angiogenic therapies.

  1. High-throughput platform assay technology for the discovery of pre-microrna-selective small molecule probes.

    Science.gov (United States)

    Lorenz, Daniel A; Song, James M; Garner, Amanda L

    2015-01-21

    MicroRNAs (miRNA) play critical roles in human development and disease. As such, the targeting of miRNAs is considered attractive as a novel therapeutic strategy. A major bottleneck toward this goal, however, has been the identification of small molecule probes that are specific for select RNAs and methods that will facilitate such discovery efforts. Using pre-microRNAs as proof-of-concept, herein we report a conceptually new and innovative approach for assaying RNA-small molecule interactions. Through this platform assay technology, which we term catalytic enzyme-linked click chemistry assay or cat-ELCCA, we have designed a method that can be implemented in high throughput, is virtually free of false readouts, and is general for all nucleic acids. Through cat-ELCCA, we envision the discovery of selective small molecule ligands for disease-relevant miRNAs to promote the field of RNA-targeted drug discovery and further our understanding of the role of miRNAs in cellular biology.

  2. Small serine recombination systems ParA-MRS and CinH-RS2 perform precise excision of plastid DNA

    Science.gov (United States)

    Selectable marker genes (SMGs) are necessary for selection of transgenic plants. However, once stable transformants have been identified, the marker gene is no longer needed. In this study, we demonstrate the use of the small serine recombination systems, ParA-MRS and CinH-RS2, to precisely excise ...

  3. Novel Drugs that Target ErbB2

    Science.gov (United States)

    2012-05-01

    of pharmacological properties including antiviral, antibacterial, anti-inflammatory, antimalarial and anticancer activities (1, 2). BA also inhibits...expression and the overall mechanisms associated with the anticancer activity of BA. We also investigated the role of BA in triple-negative MDA-MB-231...expression and the overall mechanisms associated with the anticancer activity of BA. In addition, we also investigated the role of BA in triple-negative

  4. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression.

    Science.gov (United States)

    Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S

    2016-01-15

    The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

  5. Ultrasound of selected pathologies of the small intestine

    Directory of Open Access Journals (Sweden)

    Andrzej Smereczyński

    2013-06-01

    Full Text Available Intestines, especially the small bowel, are rarely subject to US assessment due to the presence of gases and chyme. The aim of this paper was to analyze ultrasound images in selected pathologies of the small intestine in adults, including the aspects of differential diagnosis. Material and methods: In 2001–2012, abdominal ultrasound examinations were conducted in 176 patients with the following small bowel diseases: Crohn’s disease (n=35, small bowel obstruction (n=35, yersiniosis (n=28, infectious diarrhea (n=26, bacterial overgrowth syndrome (n=25, coeliac disease (n=15 and small bowel ischemia (n=12. During examinations patients were fasting and no other particular preparations were needed. Convex transducers of 3.5–6 MHz and linear ones of 7–12 MHz were used. The assessment of the small intestine in four abdominal quadrants constituted an integral element of the examination. The following features of the small bowel ultrasound presentation were subject to analysis: thickness and perfusion of the walls, presence of thickened folds in the jejunum, reduction of their number, presence of fluid and gas contents in the intestine, its peristaltic activity, jejunization of the ileum and enteroenteric intussusception. Furthermore, the size of the mesenteric lymph nodes and the width of the superior mesenteric artery were determined and the peritoneal cavity was evaluated in terms of the presence of free fluid. Results: Statistically significant differences were obtained between the thickness of the small intestine in Crohn’s disease or in ischemic conditions and the thickness in the remaining analyzed pathological entities. Small bowel obstruction was manifested by the presence of distended loops due to gas and fluid as well as by severe peristaltic contractions occurring periodically. In the course of ischemic disease, the intestinal walls were thickened without the signs of increased perfusion and

  6. Selective catalytic reduction (SCR) NOx control for small natural gas-fired prime movers

    International Nuclear Information System (INIS)

    Shareef, G.S.; Stone, D.K.; Ferry, K.R.; Johnson, K.L.; Locke, K.S.

    1992-01-01

    The application of selective catalytic reduction (SCR) to small natural gas-fired prime movers at cogeneration facilities and compressor stations could possibly increase due to regulatory forces to limit NO x from such sources. The natural gas industry is presently without a current database with which to evaluate the cost and operating characteristics of SCR under the conditions anticipated for small prime movers. This paper presents the results from a two-phase study undertaken to document SCR applications with emphasis on SCR system performance and costs. The database of small natural gas-fired prime mover SCR experience, focusing on prime mover characterization, SCR system performance, and SCR system costs will be described. Result from analysis of performance and cost data will be discussed, including analytical tools developed to project SCR system performance and costs

  7. Classic selective sweeps revealed by massive sequencing in cattle.

    Directory of Open Access Journals (Sweden)

    Saber Qanbari

    2014-02-01

    Full Text Available Human driven selection during domestication and subsequent breed formation has likely left detectable signatures within the genome of modern cattle. The elucidation of these signatures of selection is of interest from the perspective of evolutionary biology, and for identifying domestication-related genes that ultimately may help to further genetically improve this economically important animal. To this end, we employed a panel of more than 15 million autosomal SNPs identified from re-sequencing of 43 Fleckvieh animals. We mainly applied two somewhat complementary statistics, the integrated Haplotype Homozygosity Score (iHS reflecting primarily ongoing selection, and the Composite of Likelihood Ratio (CLR having the most power to detect completed selection after fixation of the advantageous allele. We find 106 candidate selection regions, many of which are harboring genes related to phenotypes relevant in domestication, such as coat coloring pattern, neurobehavioral functioning and sensory perception including KIT, MITF, MC1R, NRG4, Erbb4, TMEM132D and TAS2R16, among others. To further investigate the relationship between genes with signatures of selection and genes identified in QTL mapping studies, we use a sample of 3062 animals to perform four genome-wide association analyses using appearance traits, body size and somatic cell count. We show that regions associated with coat coloring significantly (P<0.0001 overlap with the candidate selection regions, suggesting that the selection signals we identify are associated with traits known to be affected by selection during domestication. Results also provide further evidence regarding the complexity of the genetics underlying coat coloring in cattle. This study illustrates the potential of population genetic approaches for identifying genomic regions affecting domestication-related phenotypes and further helps to identify specific regions targeted by selection during speciation, domestication and

  8. Practically Efficient Blind Speech Separation Using Frequency Band Selection Based on Magnitude Squared Coherence and a Small Dodecahedral Microphone Array

    Directory of Open Access Journals (Sweden)

    Kazunobu Kondo

    2012-01-01

    Full Text Available Small agglomerative microphone array systems have been proposed for use with speech communication and recognition systems. Blind source separation methods based on frequency domain independent component analysis have shown significant separation performance, and the microphone arrays are small enough to make them portable. However, the level of computational complexity involved is very high because the conventional signal collection and processing method uses 60 microphones. In this paper, we propose a band selection method based on magnitude squared coherence. Frequency bands are selected based on the spatial and geometric characteristics of the microphone array device which is strongly related to the dodecahedral shape, and the selected bands are nonuniformly spaced. The estimated reduction in the computational complexity is 90% with a 68% reduction in the number of frequency bands. Separation performance achieved during our experimental evaluation was 7.45 (dB (signal-to-noise ratio and 2.30 (dB (cepstral distortion. These results show improvement in performance compared to the use of uniformly spaced frequency band.

  9. The structure of XIAP BIR2: understanding the selectivity of the BIR domains

    Energy Technology Data Exchange (ETDEWEB)

    Lukacs, Christine, E-mail: cmlukacs230@gmail.com; Belunis, Charles; Crowther, Robert; Danho, Waleed; Gao, Lin; Goggin, Barry; Janson, Cheryl A.; Li, Shirley; Remiszewski, Stacy; Schutt, Andrew [Hoffmann-La Roche, 340 Kingsland Street, Nutley, NJ 07110 (United States); Thakur, Manish K.; Singh, Saroj K.; Swaminathan, Srinivasan; Pandey, Rajat; Tyagi, Rajiv; Gosu, Ramachandraiah; Kamath, Ajith V. [Jubilant Biosys Ltd, Bangalore (India); Kuglstatter, Andreas, E-mail: cmlukacs230@gmail.com [Hoffmann-La Roche, 340 Kingsland Street, Nutley, NJ 07110 (United States)

    2013-09-01

    The high-resolution crystal structures of apo and peptide-bound XIAP BIR2 are presented and compared with BIR3 structures to understand their selectivity. This crystal system can be used to determine the structures of BIR2–inhibitor complexes. XIAP, a member of the inhibitor of apoptosis family of proteins, is a critical regulator of apoptosis. Inhibition of the BIR domain–caspase interaction is a promising approach towards treating cancer. Previous work has been directed towards inhibiting the BIR3–caspase-9 interaction, which blocks the intrinsic apoptotic pathway; selectively inhibiting the BIR2–caspase-3 interaction would also block the extrinsic pathway. The BIR2 domain of XIAP has successfully been crystallized; peptides and small-molecule inhibitors can be soaked into these crystals, which diffract to high resolution. Here, the BIR2 apo crystal structure and the structures of five BIR2–tetrapeptide complexes are described. The structural flexibility observed on comparing these structures, along with a comparison with XIAP BIR3, affords an understanding of the structural elements that drive selectivity between BIR2 and BIR3 and which can be used to design BIR2-selective inhibitors.

  10. Structural Basis for Selective Small Molecule Kinase Inhibition of Activated c-Met

    Energy Technology Data Exchange (ETDEWEB)

    Rickert, Keith W.; Patel, Sangita B.; Allison, Timothy J.; Byrne, Noel J.; Darke, Paul L.; Ford, Rachael E.; Guerin, David J.; Hall, Dawn L.; Kornienko, Maria; Lu, Jun; Munshi, Sanjeev K.; Reid, John C.; Shipman, Jennifer M.; Stanton, Elizabeth F.; Wilson, Kevin J.; Young, Jonathon R.; Soisson, Stephen M.; Lumb, Kevin J. (Merck)

    2012-03-15

    The receptor tyrosine kinase c-Met is implicated in oncogenesis and is the target for several small molecule and biologic agents in clinical trials for the treatment of cancer. Binding of the hepatocyte growth factor to the cell surface receptor of c-Met induces activation via autophosphorylation of the kinase domain. Here we describe the structural basis of c-Met activation upon autophosphorylation and the selective small molecule inhibiton of autophosphorylated c-Met. MK-2461 is a potent c-Met inhibitor that is selective for the phosphorylated state of the enzyme. Compound 1 is an MK-2461 analog with a 20-fold enthalpy-driven preference for the autophosphorylated over unphosphorylated c-Met kinase domain. The crystal structure of the unbound kinase domain phosphorylated at Tyr-1234 and Tyr-1235 shows that activation loop phosphorylation leads to the ejection and disorder of the activation loop and rearrangement of helix {alpha}C and the G loop to generate a viable active site. Helix {alpha}C adopts a orientation different from that seen in activation loop mutants. The crystal structure of the complex formed by the autophosphorylated c-Met kinase domain and compound 1 reveals a significant induced fit conformational change of the G loop and ordering of the activation loop, explaining the selectivity of compound 1 for the autophosphorylated state. The results highlight the role of structural plasticity within the kinase domain in imparting the specificity of ligand binding and provide the framework for structure-guided design of activated c-Met inhibitors.

  11. Selective Electron Beam Melting Manufacturing of Electrically Small Antennas

    Directory of Open Access Journals (Sweden)

    Saad Mufti

    2017-11-01

    Full Text Available Real estate pressures in modern electronics have resulted in the need for electrically small antennas, which have subsequently garnered interest amongst researchers and industry alike. These antennas are characterized by their largest dimensions translating to a fraction of the operating wavelength; such a diminutive size comes at the expense of reduced gain and efficiency, and a worse overall match to a corresponding power source. In order to compensate for this deterioration in performance, antenna designers must turn towards increasingly complex and voluminous geometries, well beyond the capabilities of traditional manufacturing techniques. We present voluminous metal antennas, based on a novel inverted-F design, and fabricated using the emergent selective electron beam melting manufacturing technique, a type of powder bed fusion process. As predicted by small antenna theory, simulation results presented show in increase in the antenna’s efficiency as it is voluminously expanded into the third dimension. Measurement results illustrate that key trends observed from simulations are upheld; however, further understanding of the electromagnetic properties of raw materials, in particular how these change during the printing process, is needed. Nevertheless, this type of additive manufacturing technique is suitable for rapid prototyping of novel and complex antenna geometries, and is a promising avenue for further research and maturation.

  12. The natural selection of organizational and safety culture within a small to medium sized enterprise (SME).

    Science.gov (United States)

    Brooks, Benjamin

    2008-01-01

    Small to Medium Sized Enterprises (SMEs) form the majority of Australian businesses. This study uses ethnographic research methods to describe the organizational culture of a small furniture-manufacturing business in southern Australia. Results show a range of cultural assumptions variously 'embedded' within the enterprise. In line with memetics - Richard Dawkin's cultural application of Charles Darwin's theory of Evolution by Natural Selection, the author suggests that these assumptions compete to be replicated and retained within the organization. The author suggests that dominant assumptions are naturally selected, and that the selection can be better understood by considering the cultural assumptions in reference to Darwin's original principles and Frederik Barth's anthropological framework of knowledge. The results are discussed with reference to safety systems, negative cultural elements called Cultural Safety Viruses, and how our understanding of this particular organizational culture might be used to build resistance to these viruses.

  13. A comparison of small-area estimation techniques to estimate selected stand attributes using LiDAR-derived auxiliary variables

    Science.gov (United States)

    Michael E. Goerndt; Vicente J. Monleon; Hailemariam. Temesgen

    2011-01-01

    One of the challenges often faced in forestry is the estimation of forest attributes for smaller areas of interest within a larger population. Small-area estimation (SAE) is a set of techniques well suited to estimation of forest attributes for small areas in which the existing sample size is small and auxiliary information is available. Selected SAE methods were...

  14. Targeted therapies in development for non-small cell lung cancer

    Directory of Open Access Journals (Sweden)

    Thanyanan Reungwetwattana

    2013-01-01

    Full Text Available The iterative discovery in various malignancies during the past decades that a number of aberrant tumorigenic processes and signal transduction pathways are mediated by "druggable" protein kinases has led to a revolutionary change in drug development. In non-small cell lung cancer (NSCLC, the ErbB family of receptors (e.g., EGFR [epidermal growth factor receptor], HER2 [human epidermal growth factor receptor 2], RAS (rat sarcoma gene, BRAF (v-raf murine sarcoma viral oncogene homolog B1, MAPK (mitogen-activated protein kinase c-MET (c-mesenchymal-epithelial transition, FGFR (fibroblast growth factor receptor, DDR2 (discoidin domain receptor 2, PIK3CA (phosphatidylinositol-4,5-bisphosphate3-kinase, catalytic subunit alpha, PTEN (phosphatase and tensin homolog, AKT (protein kinase B, ALK (anaplastic lym phoma kinase, RET (rearranged during transfection, ROS1 (reactive oxygen species 1 and EPH (erythropoietin-producing hepatoma are key targets of various agents currently in clinical development. These oncogenic targets exert their selective growth advantage through various intercommunicating pathways, such as through RAS/RAF/MEK, phosphoinositide 3-kinase/AKT/mammalian target of rapamycin and SRC-signal transduction and transcription signaling. The recent clinical studies, EGFR tyrosine kinase inhibitors and crizotinib were considered as strongly effective targeted therapies in metastatic NSCLC. Currently, five molecular targeted agents were approved for treatment of advanced NSCLC: Gefitinib, erlotinib and afatinib for positive EGFR mutation, crizotinib for positive echinoderm microtubule-associated protein-like 4 (EML4-ALK translocation and bevacizumab. Moreover, oncogenic mutant proteins are subject to regulation by protein trafficking pathways, specifically through the heat shock protein 90 system. Drug combinations affecting various nodes in these signaling and intracellular processes are predicted and demonstrated to be synergistic and

  15. LOXL2 induces aberrant acinar morphogenesis via ErbB2 signaling

    DEFF Research Database (Denmark)

    Chang, Joan; Nicolau, Monica; Cox, Thomas R

    2013-01-01

    Lysyl oxidase-like 2 (LOXL2) is a matrix remodeling enzyme that has been shown to play a key role in invasion and metastasis of breast carcinoma cells. However, very little is known about its role in normal tissue homeostasis. Here, we investigate the effects of LOXL2 expression in normal mammary...... epithelial cells in order to gain insight into how LOXL2 mediates cancer progression....

  16. NEOShield-2 Project: Final Results on Compositional Characterization of small NEOs

    Science.gov (United States)

    Barucci, Maria Antonieta; Perna, Davide; Fornasier, Sonia; Doressoundiram, Alain; Lantz, Cateline; Popescu, Marcel; Merlin, Frederic; Fulchignoni, Marcello

    2017-10-01

    NEOShield-2 project was selected in the framework of the European Commission H2020 program in answer to the call for “Access technologies and characterisation for Near Earth Objects (NEOs)”. NEOShield-2 project (2015-2017) is a follow-up of the first NEOShield (2012-2015) and includes 11 European Institutions and Industries. The main objectives of NEOShield-2 project are: i) technological development on techniques and instruments needed for GNC for possible asteroid missions and ii) characterization of NEOs of small sizes.Our team at LESIA is the leader of the entire observational program which involved complementary techniques to provide physical and compositional characterization of NEOs. Priority has been given to potential space-mission targets, optimized for mitigation or exploration missions. In this framework an agreement with the European Southern Observatory was signed to obtain Guaranteed Time Observations at the 3.6-meter NTT with an allocation of 30 nights to characterize by spectroscopy the composition of the smaller asteroids. The objects with an absolute magnitude larger than 20 were selected, with a priority for the very small newly discovered objects.We obtained more than 170 new spectra of NEOs. The observations were performed with EFOSC2 instrument. We covered the wavelength interval 0.4-0.92 microns, with a resolution of R=~200. The observed asteroids include 29 asteroids with diameters smaller than 100 meters and 71 with diameters between 100 and 300 m.The taxonomic type has been assigned for 137 individual objects. Our results on NEO mineralogical compositions provide a body of reference data directly applicable to the design and development of mitigation-relevant space missions. Within our survey, we found eight D-types with ΔV funding by European Commission Horizon 2020 program (contract No. PROTEC-2-2014-640351).

  17. Improving the economy-of-scale of small organic rankine cycle systems through appropriate working fluid selection

    International Nuclear Information System (INIS)

    White, Martin; Sayma, Abdulnaser I.

    2016-01-01

    Highlights: • Novel system model coupling turbine and ORC system performance. • Contour plots to characterise working fluid and turbine performance. • Changing working fluid can expand pump and turbine operating envelope. • Possible to improve the economy-of-scale through optimal working fluid selection. - Abstract: Organic Rankine cycles (ORC) are becoming a major research area within the field of sustainable energy systems. However, a major challenge facing the widespread implementation of small and mini-scale ORC systems is the economy-of-scale. To overcome this challenge requires single components that can be manufactured in large volumes and then implemented into a wide variety of different applications where the heat source conditions may vary. The aim of this paper is to investigate whether working fluid selection can improve the current economy-of-scale by enabling the same system components to be used in multiple ORC systems. This is done through coupling analysis and optimisation of the energy process, with a performance map for a small-scale ORC radial turbine. The performance map, obtained using CFD, is adapted to account for additional loss mechanisms not accounted for in the original CFD simulation before being non-dimensionalised using a modified similitude theory developed for subsonic ORC turbines. The updated performance map is then implemented into a thermodynamic model, enabling the construction of a single performance contour that displays the range of heat source conditions that can be accommodated by the existing turbine whilst using a particular working fluid. Constructing this performance map for a range of working fluids, this paper demonstrates that through selecting a suitable working fluid, the same turbine can efficiently utilise heat sources between 360 and 400 K, with mass flow rates ranging between 0.5 and 2.75 kg/s respectively. This corresponds to using the same turbine in ORC applications where the heat available ranges

  18. Improving gastric cancer preclinical studies using diverse in vitro and in vivo model systems

    International Nuclear Information System (INIS)

    Chang, Hae Ryung; Park, Hee Seo; Ahn, Young Zoo; Nam, Seungyoon; Jung, Hae Rim; Park, Sungjin; Lee, Sang Jin; Balch, Curt; Powis, Garth; Ku, Ja-Lok; Kim, Yon Hui

    2016-01-01

    “Biomarker-driven targeted therapy,” the practice of tailoring patients’ treatment to the expression/activity levels of disease-specific genes/proteins, remains challenging. For example, while the anti-ERBB2 monoclonal antibody, trastuzumab, was first developed using well-characterized, diverse in vitro breast cancer models (and is now a standard adjuvant therapy for ERBB2-positive breast cancer patients), trastuzumab approval for ERBB2-positive gastric cancer was largely based on preclinical studies of a single cell line, NCI-N87. Ensuing clinical trials revealed only modest patient efficacy, and many ERBB2-positive gastric cancer (GC) patients failed to respond at all (i.e., were inherently recalcitrant), or succumbed to acquired resistance. To assess mechanisms underlying GC insensitivity to ERBB2 therapies, we established a diverse panel of GC cells, differing in ERBB2 expression levels, for comprehensive in vitro and in vivo characterization. For higher throughput assays of ERBB2 DNA and protein levels, we compared the concordance of various laboratory quantification methods, including those of in vitro and in vivo genetic anomalies (FISH and SISH) and xenograft protein expression (Western blot vs. IHC), of both cell and xenograft (tissue-sectioned) microarrays. The biomarker assessment methods strongly agreed, as did correlation between RNA and protein expression. However, although ERBB2 genomic anomalies showed good in vitro vs. in vivo correlation, we observed striking differences in protein expression between cultured cells and mouse xenografts (even within the same GC cell type). Via our unique pathway analysis, we delineated a signaling network, in addition to specific pathways/biological processes, emanating from the ERBB2 signaling cascade, as a potential useful target of clinical treatment. Integrated analysis of public data from gastric tumors revealed frequent (10 – 20 %) amplification of the genes NFKBIE, PTK2, and PIK3CA, each of which

  19. Selective adsorption of cationic dyes by UiO-66-NH{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Qi; He, Qinqin; Lv, Mengmeng; Xu, Yanli; Yang, Hanbiao; Liu, Xueting, E-mail: wmlxt@163.com; Wei, Fengyu, E-mail: weifyliuj@163.com

    2015-02-01

    Graphical abstract: - Highlights: • Two Zr(IV)-based MOFs can remove cationic dyes more effectively than anionic dyes. • UiO-66 has higher selectivity for cationic dyes after modification with NH{sub 2}. • The mechanism for adsorption selectivity is rationally proposed. - Abstract: Herein, two zirconium(IV)-based MOFs UiO-66 and UiO-66-NH{sub 2} had been successfully prepared by a facile solvothermal method and were characterized by X-ray diffraction (XRD), field emission transmission electron microscopy (FETEM), N{sub 2} adsorption–desorption (BET), X-ray photoelectron spectroscopy (XPS), and zeta potential. They exhibit small size, large surface area, and can remove cationic dyes from aqueous solution more effectively than anionic dyes. This adsorption selectivity is due to the favorable electrostatic interactions between the adsorbents and cationic dyes. Furthermore, owing to the individual micropore structure of UiO-66-NH{sub 2} and its more negative zeta potential resulted from the charge balance for the protonation of –NH{sub 2}, UiO-66-NH{sub 2} displays much higher adsorption capacity for cationic dyes and lower adsorption capacity for anionic dyes than UiO-66.

  20. Selection of optimal treatment scheme for brain metastases of non-small cell lung cancer

    International Nuclear Information System (INIS)

    Dong Mingxin; Zhao Tong; Huang Jingzi; Yu Shukun; Ma Yan; Tian Zhongcheng; Jin Xiangshun; Quan Jizhong; Liu Jin; Wang Dongxu

    2006-01-01

    Objective: To select the optimal treatment scheme for brain metastases of non-small cell lung cancers (NSCLCs). Methods: Seventy-two NSCLC cases diagnosesd by pathology with brain metastases were randomly classified into three groups, Group I, 24 cases with whole brain conventional external fractioned irradiation of D T 36-41 Gy/4-5 w, Group II, 22 eases with y-knife treatment plus whole brain conventional external fractioned irradiation, and Group III, 26 cases with γ-knife plus whole brain conventional external fractioned irradiation in combination with chemotherapy of Vm-26. The surrounding area of tumor was strictly covered with 50% para-central-dosal curve in γ-knife treatment (D T 16-25 Gy with a mean of 16 Gy). The muirleaf collimator was selected according to the volume of tumors. Chemotherapy of Vm-26 (60 mg/m 2 d1-3) was applied during the treatment with whole brain conventional external fractioned irradiation (D T 19-29 Gy/2-3 w), 21 days in a period, 2 periods in total. Results: The median survival time was estimated to be 6.0 months (ranged from 1.2 to 19.0 months) in the Group I, 9.2 months (4.4-30 months) in the Group II, and 10.8 months (5.2-42.2 months) in the Group III. The 1-year and 2-year survival rates were 34.6% and 12.6% , 62.2% and 30.2%, and 70.8% and 35.6% respectively in Group I, Group II, and Group III, respectively. Conclusion: For brain metastases of NSCLC, γ-knife plus whole brain conventional external fractioned irradiation combined with treatment of Vm-26 had a significantly beneficial influence on improvement of the local control and 1-year and 2-year survival. There was no complaint about the side-effects of the treatment. (authors)

  1. [Construction of 2-dimensional tumor microvascular architecture phenotype in non-small cell lung cancer].

    Science.gov (United States)

    Liu, Jin-kang; Wang, Xiao-yi; Xiong, Zeng; Zhou, Hui; Zhou, Jian-hua; Fu, Chun-yan; Li, Bo

    2008-08-01

    To construct a technological platform of 2-dimensional tumor microvascular architecture phenotype (2D-TAMP) expression. Thirty samples of non-small cell lung cancer (NSCLC) were collected after surgery. The corresponding sections of tumor tissue specimens to the slice of CT perfusion imaging were selected. Immunohistochemical staining,Gomori methenamine silver stain, and electron microscope observation were performed to build a technological platform of 2D-TMAP expression by detecting the morphology and the integrity of basement membrane of microvasculature, microvascular density, various microvascular subtype, the degree of the maturity and lumenization of microvasculature, and the characteristics of immunogenetics of microvasculature. The technological platform of 2D-TMAP expression was constructed successfully. There was heterogeneity in 2D-TMAP expression of non-small cell lung cancer. The microvascular of NSCLC had certain characteristics. 2D-TMAP is a key technology that can be used to observe the overall state of micro-environment in tumor growth.

  2. Song tutoring in presinging zebra finch juveniles biases a small population of higher-order song-selective neurons toward the tutor song.

    Science.gov (United States)

    Adret, Patrice; Meliza, C Daniel; Margoliash, Daniel

    2012-10-01

    We explored physiological changes correlated with song tutoring by recording the responses of caudal nidopallium neurons of zebra finches aged P21-P24 (days post hatching) to a broad spectrum of natural and synthetic stimuli. Those birds raised with their fathers tended to show behavioral evidence of song memorization but not of singing; thus auditory responses were not confounded by the birds' own vocalizations. In study 1, 37 of 158 neurons (23%) in 17 of 22 tutored and untutored birds were selective for only 1 of 10 stimuli comprising broadband signals, early juvenile songs and calls, female calls, and adult songs. Approximately 30% of the selective neurons (12/37 neurons in 9 birds) were selective for adult conspecific songs. All these were found in the song system nuclei HVC and paraHVC. Of 122 neurons (17 birds) in tutored birds, all of the conspecific song-selective neurons (8 neurons in 6 birds) were selective for the adult tutor song; none was selective for unfamiliar song. In study 2 with a different sampling strategy, we found that 11 of 12 song-selective neurons in 6 of 7 birds preferred the tutor song; none preferred unfamiliar or familiar conspecific songs. Most of these neurons were found in caudal lateral nidopallium (NCL) below HVC. Thus by the time a bird begins to sing, there are small numbers of tutor song-selective neurons distributed in several forebrain regions. We hypothesize that a small population of higher-order auditory neurons is innately selective for complex features of behaviorally relevant stimuli and these responses are modified by specific perceptual/social experience during development.

  3. Identification of the functional binding pocket for compounds targeting small-conductance Ca2+-activated potassium channels

    Science.gov (United States)

    Zhang, Miao; Pascal, John M.; Schumann, Marcel; Armen, Roger S.; Zhang, Ji-fang

    2012-01-01

    Small- and intermediate-conductance Ca2+-activated potassium channels, activated by Ca2+-bound calmodulin, play an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potentials for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-EBIO class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class. PMID:22929778

  4. ErbB4 Overexpression as an Antagonist of ErbB2/HER2/Neu Induced Human Breast Cancer Cell Proliferation

    Science.gov (United States)

    2006-08-01

    advantage and evade therapeutic eradication. Death decisions within mammalian cells are primarily regulated by the interplay between proapoptotic and...BH3 domains either sensitize or activate mitochondrial apoptosis, serving as prototype cancer therapeutics . Cancer Cell 2002;2:183–92. 28. Bouillet P...Agricultural University, P. R. China, BS, Horticulture Positions and Honors 2005.5-Present Postdoctoral Fellow, Department of Molecular and Cellular

  5. Analytic theory for the selection of 2-D needle crystal at arbitrary Peclet number

    Science.gov (United States)

    Tanveer, Saleh

    1989-01-01

    An accurate analytic theory is presented for the velocity selection of a two-dimensional needle crystal for arbitrary Peclet number for small values of the surface tension parameter. The velocity selection is caused by the effect of transcendentally small terms which are determined by analytic continuation to the complex plane and analysis of nonlinear equations. The work supports the general conclusion of previous small Peclet number analytical results of other investigators, though there are some discrepancies in details. It also addresses questions raised on the validity of selection theory owing to assumptions made on shape corrections at large distances from the tip.

  6. Permeability and Selectivity of PPO/Graphene Composites as Mixed Matrix Membranes for CO2 Capture and Gas Separation

    Directory of Open Access Journals (Sweden)

    Riccardo Rea

    2018-01-01

    Full Text Available We fabricated novel composite (mixed matrix membranes based on a permeable glassy polymer, Poly(2,6-dimethyl-1,4-phenylene oxide (PPO, and variable loadings of few-layer graphene, to test their potential in gas separation and CO2 capture applications. The permeability, selectivity and diffusivity of different gases as a function of graphene loading, from 0.3 to 15 wt %, was measured at 35 and 65 °C. Samples with small loadings of graphene show a higher permeability and He/CO2 selectivity than pure PPO, due to a favorable effect of the nanofillers on the polymer morphology. Higher amounts of graphene lower the permeability of the polymer, due to the prevailing effect of increased tortuosity of the gas molecules in the membrane. Graphene also allows dramatically reducing the increase of permeability with temperature, acting as a “stabilizer” for the polymer matrix. Such effect reduces the temperature-induced loss of size-selectivity for He/N2 and CO2/N2, and enhances the temperature-induced increase of selectivity for He/CO2. The study confirms that, as observed in the case of other graphene-based mixed matrix glassy membranes, the optimal concentration of graphene in the polymer is below 1 wt %. Below such threshold, the morphology of the nanoscopic filler added in solution affects positively the glassy chains packing, enhancing permeability and selectivity, and improving the selectivity of the membrane at increasing temperatures. These results suggest that small additions of graphene to polymers can enhance their permselectivity and stabilize their properties.

  7. Road network selection for small-scale maps using an improved centrality-based algorithm

    Directory of Open Access Journals (Sweden)

    Roy Weiss

    2014-12-01

    Full Text Available The road network is one of the key feature classes in topographic maps and databases. In the task of deriving road networks for products at smaller scales, road network selection forms a prerequisite for all other generalization operators, and is thus a fundamental operation in the overall process of topographic map and database production. The objective of this work was to develop an algorithm for automated road network selection from a large-scale (1:10,000 to a small-scale database (1:200,000. The project was pursued in collaboration with swisstopo, the national mapping agency of Switzerland, with generic mapping requirements in mind. Preliminary experiments suggested that a selection algorithm based on betweenness centrality performed best for this purpose, yet also exposed problems. The main contribution of this paper thus consists of four extensions that address deficiencies of the basic centrality-based algorithm and lead to a significant improvement of the results. The first two extensions improve the formation of strokes concatenating the road segments, which is crucial since strokes provide the foundation upon which the network centrality measure is computed. Thus, the first extension ensures that roundabouts are detected and collapsed, thus avoiding interruptions of strokes by roundabouts, while the second introduces additional semantics in the process of stroke formation, allowing longer and more plausible strokes to built. The third extension detects areas of high road density (i.e., urban areas using density-based clustering and then locally increases the threshold of the centrality measure used to select road segments, such that more thinning takes place in those areas. Finally, since the basic algorithm tends to create dead-ends—which however are not tolerated in small-scale maps—the fourth extension reconnects these dead-ends to the main network, searching for the best path in the main heading of the dead-end.

  8. Fattori di crescita e recettori tirosin chinasici nelle neoplasie e displasie degli animali domestici

    OpenAIRE

    Muscatello, Luisa Vera

    2016-01-01

    La perdita della comunicazione cellulare può portare ad una crescita deregolata e dunque alla trasformazione neoplastica. Gli scopi dello studio di dottorato sono stati di individuare il rapporto funzionale di alcuni fattori di crescita (FC) e dei loro recettori (RTC) in tipi di neoplasie e displasie degli animali domestici, quali: 1. Amplificazione del proto-oncogene ERBB2 e sovra-espressione del RTC erb-b2. in tumori mammari della gatta. 2. Espressione di erb-b2, di recettori ormonal...

  9. Ten-year diameter and basal area growth of trees surrounding small group selection openings

    Science.gov (United States)

    Philip M. McDonald; Martin W. Ritchie; Celeste S. Abbott

    1996-01-01

    The effects of small openings in forest stands has interested silviculturists and ecologists for years. Interest generally has centered on the vegetation in the openings, not on that immediately outside of them. Quantitative information on the growth of trees adjacent to group-selection openings, although often mentioned in forestry textbooks as contributing to cost...

  10. D2D-Enabled Small Cell Network Control Scheme Based on the Dynamic Stackelberg Game

    Directory of Open Access Journals (Sweden)

    Sungwook Kim

    2017-01-01

    Full Text Available For current and future cellular networks, small cell structure with licensed and unlicensed bandwidth, caching content provisioning, and device-to-device (D2D communications is seen as a necessary architecture. Recently, a series of control methods have been developed to address a myriad of challenges in next-generation small cell networks. In this study, we focus on the design of novel D2D-enabled small cell network control scheme by allowing caching and unlicensed D2D communications. Motivated by game theory and learning algorithm, the proposed scheme adaptively selects caching contents and splits the available bandwidth for licensed and unlicensed communications. Under dynamically changing network environments, we capture the dynamics of the network system and design a new dynamic Stackelberg game model. Based on a hierarchical and feedback based control manner, small base stations and users can be leaders or followers dynamically while improving 5G network performance. Simulations and performance analysis verify the efficiency of the proposed scheme, showing that our approach can outperform existing schemes by about 5%~15% in terms of bandwidth utilization, cache hit ratio, and system throughput.

  11. Increased Level of Phosphorylated ShcA Measured by Chemiluminescence-Linked Immunoassay Is a Predictor of Good Prognosis in Primary Breast Cancer Expressing Low Levels of Estrogen Receptor

    International Nuclear Information System (INIS)

    Cicenas, Jonas; Küng, Willy; Eppenberger, Urs; Eppenberger-Castori, Serenella

    2010-01-01

    The SH2 domain-containing adaptor protein ShcA is a proto-oncogene involved in growth factor receptor signaling. The role of phosphorylated ShcA is to link receptor tyrosine kinases with the SH2-containing adaptor protein Grb2, thus facilitating signal transduction from receptor tyrosine kinases to Ras, leading to MAPK activation. The present study was designed to investigate the prognostic significance of phosphorylated ShcA in primary breast cancer and its association in the interactions between the ER and ErbB2 pathways. Using a two-site chemiluminescence-linked immunosorbent assay, we detected the quantitative expression levels of total tyrosine- and threonine-phosphorylated ShcA in cytosol fractions obtained from fresh frozen tissue samples of 153 selected primary breast cancer patients. ShcA phosphorylation was not associated with nodal status, estrogen receptor (ER) status or grading. High levels of both tyrosine (pYShcA) and serine (pSShcA) phosphorylated ShcA correlated with good prognosis (p < 0.01), with respect to both disease-free (DFS) and overall survival (OS). In addition, pShcA levels were found to correlate with threonine-phosphorylated ErbB2 and inversely with phosphorylated Akt (pAkt), as well as ErbB2 and ER expression levels. Our findings demonstrate that ShcA activation in primary breast cancer patients correlates with low levels of ER, and is associated with good prognosis

  12. Daytime habitat selection for juvenile parr brown trout (Salmo trutta) in small lowland streams

    DEFF Research Database (Denmark)

    Conallin, J.; Boegh, E.; Olsen, M.

    2014-01-01

    Physical habitat is important in determining the carrying capacity of juvenile brown trout, and within freshwater management. Summer daytime physical habitat selection for the parr lifestage (7-20 cm) juvenile brown trout (Salmo trutta) was assessed in 6 small lowland streams. Habitat preference...... was determined for the four variables; water velocity, water depth, substrate and cover, and the preferences for physical habitat selection were expressed in terms of habitat suitability indices (HSI's). The statistical confidence of HSI's was evaluated using power analysis. It was found that a minimum of 22...... fish observations was needed to have statistical confidence in the HSIs for water depth, and a minimum of 92 fish observations for water velocity during daytime summer conditions. Generally parr were utilising the deeper habitats, indicating preference for deeper water. Cover was also being selected...

  13. Selective formation of VO2(A) or VO2(R) polymorph by controlling the hydrothermal pressure

    International Nuclear Information System (INIS)

    Ji Shidong; Zhang Feng; Jin Ping

    2011-01-01

    Missing VO 2 (A) usually occurs during the preparation of VO 2 polymorphs. This leads to an ambiguous understanding of the transformation between VO 2 polymorphs. The calculation of the ground state energies for different VO 2 polymorphs indicated that there is only a small energy gap between VO 2 (A) and VO 2 (R), which destined that the transformation from VO 2 (A) to VO 2 (R) should be pressure sensitive. This hypothesis was verified during the synthesizing of VO 2 polymorphs by reducing V 2 O 5 with oxalic acid through hydrothermal treatment process. Selective formation of pure phase VO 2 (A) or VO 2 (R) was achieved by controlling the hydrothermal pressure through varying the filling ratio at 270 deg. C. It was found that a filling ratio over 0.5 favors the formation of pure VO 2 (R) while a reduced filling ratio to 0.4 or lower results in the formation of VO 2 (A). Based on our experiments, VO 2 (B) nanobelts were always first formed and then it transformed to VO 2 (A) by assembling process at increased temperature or extended reaction time. Under further higher pressure, the VO 2 (A) transformed spontaneously to VO 2 (R) initialized from the volume shrinkage due to the formation of denser VO 2 (R). - Graphical abstract: Selective formation of VO 2 (A) or VO 2 (R) could be achieved by controlling the system pressure through varying the filling ratio during hydrothermal treatment. Highlights: → Selective formation of VO 2 polymorphs by controlling hydrothermal pressure. → Ground state energy characteristics were revealed for the first time. → Phase transformation mechanism was clearly elucidated.

  14. ORNL R and D on advanced small and medium power reactors: selected topics

    International Nuclear Information System (INIS)

    White, J.D.; Trauger, D.B.

    1989-01-01

    From 1984-1985, ORNL studied several innovative small and medium power nuclear concepts with respect to viability. Criteria for assessment of market attractiveness were developed and are described here. Using these criteria and descriptions of selected advanced reactor concepts, an assessment of their projected market viability in the time period 2000-2010 was made. All of these selected concepts could be considered as having the potential for meeting the criteria but, in most cases, considerable R and D would be required to reduce uncertainties. This work and later studies of safety and licensing of advanced, passively safe reactor concepts by ORNL are described. The results of these studies are taken into account in most of the current (FY 1989) work at ORNL on advanced reactors. A brief outline of this current work is given. One of the current R and D efforts at ORNL which addresses the operability and safety of advanced reactors is the Advanced Controls Program. Selected topics from this Program are described

  15. ORNL R and D on advanced small and medium power reactors: Selected topics

    International Nuclear Information System (INIS)

    White, J.D.; Trauger, D.B.

    1988-01-01

    From 1984-1985, ORNL studied several innovative small and medium power nuclear concepts with respect to viability. Criteria for assessment of market attractiveness were developed and are described here. Using these criteria and descriptions of selected advanced reactor concepts, and assessment of their projected market viability in the time period 2000-2010 was made. All of these selected concepts could be considered as having the potential for meeting the criteria but, in most cases, considerable RandD would be required to reduce uncertainties. This work and later studies of safety and licensing of advanced, passively safe reactor concepts by ORNL are described. The results of these studies are taken into account in most of the current (FY 1989) work at ORNL on advanced reactors. A brief outline of this current work is given. One of the current RandD efforts at ORNL which addresses the operability and safety of advanced reactors is the Advanced Controls Program. Selected topics from this Program are described. 13 refs., 1 fig

  16. Sediment sources in a small agricultural catchment: A composite fingerprinting approach based on the selection of potential sources

    Science.gov (United States)

    Zhou, Huiping; Chang, Weina; Zhang, Longjiang

    2016-08-01

    Fingerprinting techniques have been widely used as a reasonable and reliable means for investigating sediment sources, especially in relatively large catchments in which there are significant differences in surface materials. However, the discrimination power of fingerprint properties for small catchments, in which the surface materials are relatively homogeneous and human interference is marked, may be affected by fragmentary or confused source information. Using fingerprinting techniques can be difficult, and there is still a need for further studies to verify the effectiveness of such techniques in these small catchments. A composite fingerprinting approach was used in this study to investigate the main sources of sediment output, as well as their relative contributions, from a small catchment (30 km2) with high levels of farming and mining activities. The impact of the selection of different potential sediment sources on the derivation of composite fingerprints and its discrimination power were also investigated by comparing the results from different combinations of potential source types. The initial source types and several samples that could cause confusion were adjusted. These adjustments improved the discrimination power of the composite fingerprints. The results showed that the composite fingerprinting approach used in this study had a discriminatory efficiency of 89.2% for different sediment sources and that the model had a mean goodness of fit of 0.90. Cultivated lands were the main sediment source. The sediment contribution of the studied cultivated lands ranged from 39.9% to 87.8%, with a mean of 76.6%, for multiple deposited sediment samples. The mean contribution of woodlands was 21.7%. Overall, the sediment contribution from mining and road areas was relatively low. The selection of potential sources is an important factor in the application of fingerprinting techniques and warrants more attention in future studies, as is the case with other

  17. Performance Comparisons and Down Selection of Small Motors for Two-Blade Heliogyro Solar Sail 6U CubeSat

    Science.gov (United States)

    Wiwattananon, Peerawan; Bryant, Robert G.

    2015-01-01

    This report compiles a review of 130 commercial small scale motors (piezoelectric and electric motors) and almost 20 researched-type small scale piezoelectricmotors for potential use in a 2 blades Heliogyro Solar Sail 6U CubeSat. In this application, a motor and gearhead (drive system) will deploy a roll of solar sailthin film (2 um thick)accommodated in a 2U CubeSat (100 x 200 x 100 mm) housing. The application requirements are: space rated, output torque at fulldeployment of 0.8 Nm, reel speed of 3 rpm, drive system weight limited to 150 grams, diameter limited to 50 mm, and the length not to exceed 40 mm. The 50mm diameter limit was imposed as motors with larger diameters would likely weigh too much and use more space on the satellite wall. This would limit theamount of the payload. The motors performance are compared between small scale, volume within 3x102 cm3 (3x105 mm3), commercial electric DC motors,commercial piezoelectric motors, and researched-type (non-commercial) piezoelectric motors extracted from scientific and product literature. The comparisonssuggest that piezoelectric motors without a gearhead exhibit larger output torque with respect to their volume and weight and require less input power toproduce high torque. A commercially available electric motor plus a gearhead was chosen through a proposed selection process to meet the applications designrequirements.

  18. An Anti-Oncogenic Role for Decorin in Mammary Carcinoma

    National Research Council Canada - National Science Library

    Iozzo, Renato V

    2004-01-01

    .... In the preliminary data that support the basis of this proposal, we discovered that decorin causes a functional inactivation of the oncogenic ErbB2 protein in mammary carcinoma cells overexpressing ErbB2...

  19. Pseudolisthesis secondary to small L5

    International Nuclear Information System (INIS)

    Bagheri, Mohammad Hadi; Hosseini, Mehrdad Mohammad; Foroughi, Amin Aboulhassani

    2011-01-01

    Rationale and objective: Small AP diameter of L5 can mimic spondylolisthesis in lumbosacral MRI. The aim of the present study was to evaluate the prevalence of small L5 mimicking spondylolisthesis in lumbosacral MRI of the patients referred to an imaging center by any symptoms. Association between small anteroposterior diameter of L5 and presence and absence of unilateral or bilateral spondylolysis at L5 were also evaluated. Materials and methods: 2000 lumbosacral MRI of the patients referred to an imaging center for any reasons were evaluated. The posterior step of L5 was measured and the cases with posterior step of more than 2 mm were selected. These cases were evaluated for presence or absence of spondylolysis. Results: Small anteroposterior diameters of L5 were detected in 38 cases (2%), mimicking the spondylolisthesis in lumbosacral MRI. The prevalence of small L5 in lumbosacral MRI of the patients referred by any symptoms was about 2%. In these selected cases, 6 (15.8%) show unilateral spondylolysis and 5 (13.1%) show bilateral spondylolysis. Conclusion: Pseudospondylolisthesis secondary to small AP diameter of L5 has prevalence of about 2% in lumbosacral MRI of cases referred for any reasons and can be overlooked in reporting of LS MRI. There was an association between small anteroposterior diameter of L5 and presence of spondylolysis at L5.

  20. Cinnamides as selective small-molecule inhibitors of a cellular model of breast cancer stem cells.

    Science.gov (United States)

    Germain, Andrew R; Carmody, Leigh C; Nag, Partha P; Morgan, Barbara; Verplank, Lynn; Fernandez, Cristina; Donckele, Etienne; Feng, Yuxiong; Perez, Jose R; Dandapani, Sivaraman; Palmer, Michelle; Lander, Eric S; Gupta, Piyush B; Schreiber, Stuart L; Munoz, Benito

    2013-03-15

    A high-throughput screen (HTS) was conducted against stably propagated cancer stem cell (CSC)-enriched populations using a library of 300,718 compounds from the National Institutes of Health (NIH) Molecular Libraries Small Molecule Repository (MLSMR). A cinnamide analog displayed greater than 20-fold selective inhibition of the breast CSC-like cell line (HMLE_sh_Ecad) over the isogenic control cell line (HMLE_sh_eGFP). Herein, we report structure-activity relationships of this class of cinnamides for selective lethality towards CSC-enriched populations. Copyright © 2013. Published by Elsevier Ltd.

  1. Defense Small Business Innovation Research Program (SBIR). Abstracts of Phase 2 Awards, 1984.

    Science.gov (United States)

    165 proposals for funding in Phase II of the Small Business Innovation Research (SBIR) Program. These proposals were selected from those submitted by... small research and development firms awarded Phase I contracts from the FY 1984 solicitation. In order to make information available on the technical

  2. Hydrogen selective membrane for the natural gas system. Development of CO{sub 2}-selective biogas membrane. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Vestboe, A.P.

    2012-02-15

    the goal to develop membrane materials that are suitable for the removal of CO{sub 2}. Emphasis was put on selecting materials that are commercially available and that can be easily processed into membranes in a large scale. Membrane modules were produced from many capillary tubes of the membranes in order to achieve a system for removing CO{sub 2} in a larger scale. A certain technology was developed in which the membrane material was improved upon by adding certain nanoporous particles called zeolites. A choice was made in thermoplastic polyurethane, and a supplier was found in BASF. This is a rather cheap material and a certain grade of their products was found to offer a reasonable high selectivity of 16 while couple with a high permeability. A zeolite was selected in Linde Type 4A, which has pores that are on the molecular size exactly between CO{sub 2} and CH{sub 4}. By adding these particles, a molecular sieving effect was obtained. It was found that the selectivity was increased by 50% and the permeability of the finished material was 24 Barrer, which is a rather high number when coupled with this selectivity. A success was achieved in the development of a technology in which zeolite articles could be blended with a large range of polymers in such a way that there were no voids around the zeolite particles, but a tight adhesive was obtained. This made it possible to not lose selectivity due to bypassing of gaseous molecules around the zeolite particles. It was found that this technology could be passed over from a small laboratory scale compounder to a large scale compounder-extruder. In going from small-scale membranes used for laboratory testing to industry sized membrane modules a number of designs were considered. A design which consisted of large bundles of capillary tubes were found to be the best suitable solution and was used in the further development. These capillary tubes were made in such a way, that there was a strong carrier tube of a highly

  3. The structure of normal ionic micelles by interpretation of small-angle neutron scattering data from selectively labeled (2H, 19F) surfactant solutions

    International Nuclear Information System (INIS)

    Berr, S.S.

    1986-12-01

    We have determined the structure of micelles formed in water by several classes of ionic surfactants under a variety of experimental conditions using small-angle neutron scattering (SANS) techniques. Contrast between the micelles and the solvent was achieved through either selective deuteration or fluorination of the surfactant, or through the use of D 2 O. Interpretation of SANS data was facilitated by the use of Hayter, Penfold, and Hansen's rescaled Mean Spherical Approximation theory to calculate the scattering due to interparticle interactions. We have devised a number of micelle models, both spherical and ellipsoidal, to account for the scattering due to single micelles. It was found that changing the solvent from H 2 O to D 2 O results in the formation of larger micelles due to changes in the solvent-surfactant hydrocarbon interactions. This solvent isotope effect increased as the length of the alkyl chain increased. The fractional micellar charge did not change with respect to isotopic composition of solvent. We found that alkyltrimethylammonium bromide surfactants form drier micelles than do the sodium alkyl sulfate surfactants of equal chain length. Also, all micelles studied were found to be dry near the critical micelle concentration (cmc) and to become increasingly wetter as the concentration increased. The increase in aggregation number with respect to the square root of surfactant concentration was found to be linear for all systems studied. 80 figs

  4. FoxA1 as a lineage-specific oncogene in luminal type breast cancer

    International Nuclear Information System (INIS)

    Yamaguchi, Noritaka; Ito, Emi; Azuma, Sakura; Honma, Reiko; Yanagisawa, Yuka; Nishikawa, Akira; Kawamura, Mika; Imai, Jun-ichi

    2008-01-01

    The forkhead transcription factor FoxA1 is thought to be involved in mammary tumorigenesis. However, the precise role of FoxA1 in breast cancer development is controversial. We examined expression of FoxA1 in 35 human breast cancer cell lines and compared it with that of ErbB2, a marker of poor prognosis in breast cancer. We found that FoxA1 is expressed at high levels in all ErbB2-positive cell lines and a subset of ErbB2-negative cell lines. Down-regulation of FoxA1 by RNA interference significantly suppressed proliferation of ErbB2-negative and FoxA1-positive breast cancer cell lines. Down-regulation of FoxA1 also enhanced the toxic effect of Herceptin on ErbB2-positive cell lines through induction of apoptosis. Taken together with previous data that FoxA1 is a marker of luminal cells in mammary gland, our present results suggest that FoxA1 plays an important role as a lineage-specific oncogene in proliferation of cancer cells derived from mammary luminal cells

  5. Trichostatin A suppresses lung adenocarcinoma development in Grg1 overexpressing transgenic mice

    International Nuclear Information System (INIS)

    Liu, Ju; Li, Yan; Dong, Fengyun; Li, Liqun; Masuda, Takahiro; Allen, Thaddeus D.; Lobe, Corrinne G.

    2015-01-01

    Trichostatin A (TSA) is a histone deacetylase inhibitor and a potential therapeutic for various malignancies. The in vivo effect of TSA, however, has not been investigated in a transgenic lung cancer model. Previously, we generated transgenic mice with overexpression of Groucho-related-gene 1 (Grg1) and these mice all developed mucinous lung adenocarcinoma. Grg1 is a transcriptional co-repressor protein, the function of which is thought to depend on HDAC activity. However, functions outside the nucleus have also been proposed. We tested the supposition that Grg1-induced tumorigenesis is HDAC-dependent by assaying the therapeutic effect of TSA in the Grg1 transgenic mouse model. We found that TSA significantly inhibited lung tumorigenesis in Grg1 transgenic mice (p < 0.01). TSA did not affect overall Grg1 protein levels, but instead reduced ErbB1 and ErbB2 expression, which are upregulated by Grg1 in the absence of TSA. We confirmed this effect in A549 cells. Furthermore, lapatinib, an inhibitor of both ErbB1 and ErbB2, effectively masked the effect of TSA on the inhibition of A549 cell proliferation and migration, suggesting TSA does work, at least in part, by downregulating ErbB receptors. We additionally found that TSA reduced the expression of VEGF and VEGFR2, but not basic FGF and FGFR1. Our findings indicate that TSA effectively inhibits Grg1-induced lung tumorigenesis through the down-regulation of ErbB1 and ErbB2, as well as reduced VEGF signaling. This suggests TSA and other HDAC inhibitors could have therapeutic value in the treatment of lung cancers with Grg1 overexpression. - Highlights: • TSA suppresses lung tumorigenesis in Grg1 overexpressing transgenic mice. • TSA does not affect overall Grg1 protein levels in the mice and in A549 cells. • TSA reduces ErbB1 and ErbB2 expression in the mice and in A549 cells. • Lapatinib masks TSA-induced inhibition of A549 cell proliferation and migration. • TSA inhibits VEGF signaling, but not basic FGF

  6. Trichostatin A suppresses lung adenocarcinoma development in Grg1 overexpressing transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ju, E-mail: ju.liu@sdu.edu.cn [Medical Research Center, Shandong Provincial Qianfoshan Hospital, Shandong University, 16766 Jingshi Road, Jinan (China); Molecular and Cellular Biology Division, Sunnybrook Health Science Centre, University of Toronto, 2075 Bayview Avenue, Toronto, Ontario M4N 3M5 (Canada); Li, Yan [Children' s Health Care Center, Shandong Provincial Qianfoshan Hospital, Shandong University, 16766 Jingshi Road, Jinan, Shandong 250014 (China); Dong, Fengyun; Li, Liqun [Medical Research Center, Shandong Provincial Qianfoshan Hospital, Shandong University, 16766 Jingshi Road, Jinan (China); Masuda, Takahiro; Allen, Thaddeus D. [Molecular and Cellular Biology Division, Sunnybrook Health Science Centre, University of Toronto, 2075 Bayview Avenue, Toronto, Ontario M4N 3M5 (Canada); Lobe, Corrinne G. [Molecular and Cellular Biology Division, Sunnybrook Health Science Centre, University of Toronto, 2075 Bayview Avenue, Toronto, Ontario M4N 3M5 (Canada); Miami Mice Research Corp., MaRS Centre, Heritage Bldg., 101 College Street, Toronto, Ontario M5G 1L7 (Canada)

    2015-08-07

    Trichostatin A (TSA) is a histone deacetylase inhibitor and a potential therapeutic for various malignancies. The in vivo effect of TSA, however, has not been investigated in a transgenic lung cancer model. Previously, we generated transgenic mice with overexpression of Groucho-related-gene 1 (Grg1) and these mice all developed mucinous lung adenocarcinoma. Grg1 is a transcriptional co-repressor protein, the function of which is thought to depend on HDAC activity. However, functions outside the nucleus have also been proposed. We tested the supposition that Grg1-induced tumorigenesis is HDAC-dependent by assaying the therapeutic effect of TSA in the Grg1 transgenic mouse model. We found that TSA significantly inhibited lung tumorigenesis in Grg1 transgenic mice (p < 0.01). TSA did not affect overall Grg1 protein levels, but instead reduced ErbB1 and ErbB2 expression, which are upregulated by Grg1 in the absence of TSA. We confirmed this effect in A549 cells. Furthermore, lapatinib, an inhibitor of both ErbB1 and ErbB2, effectively masked the effect of TSA on the inhibition of A549 cell proliferation and migration, suggesting TSA does work, at least in part, by downregulating ErbB receptors. We additionally found that TSA reduced the expression of VEGF and VEGFR2, but not basic FGF and FGFR1. Our findings indicate that TSA effectively inhibits Grg1-induced lung tumorigenesis through the down-regulation of ErbB1 and ErbB2, as well as reduced VEGF signaling. This suggests TSA and other HDAC inhibitors could have therapeutic value in the treatment of lung cancers with Grg1 overexpression. - Highlights: • TSA suppresses lung tumorigenesis in Grg1 overexpressing transgenic mice. • TSA does not affect overall Grg1 protein levels in the mice and in A549 cells. • TSA reduces ErbB1 and ErbB2 expression in the mice and in A549 cells. • Lapatinib masks TSA-induced inhibition of A549 cell proliferation and migration. • TSA inhibits VEGF signaling, but not basic FGF

  7. Small molecules as therapy for uveitis: a selected perspective of new and developing agents.

    Science.gov (United States)

    Pleyer, Uwe; Algharably, Engi Abdel-Hady; Feist, Eugen; Kreutz, Reinhold

    2017-09-01

    Intraocular inflammation (uveitis) remains a significant burden of legal blindness. Because of its immune mediated and chronic recurrent nature, common therapy includes corticosteroids, disease-modifying anti-rheumatic drugs and more recently biologics as immune modulatory agents. The purpose of this article is to identify the role of new treatment approaches focusing on small molecules as therapeutic option in uveitis. Areas covered: A MEDLINE database search was conducted through February 2017 using the terms 'uveitis' and 'small molecule'. To provide ongoing and future perspectives in treatment options, also clinical trials as registered at ClinicalTrials.gov were included. Both, results from experimental as well as clinical research in this field were included. Since this field is rapidly evolving, a selection of promising agents had to be made. Expert opinion: Small molecules may interfere at different steps of the inflammatory cascade and appear as an interesting option in the treatment algorithm of uveitis. Because of their highly targeted molecular effects and their favorable bioavailability with the potential of topical application small molecules hold great promise. Nevertheless, a careful evaluation of these agents has to be made, since current experience is almost exclusively based on experimental uveitis models and few registered trials.

  8. Prey Selection of Scandinavian Wolves: Single Large or Several Small?

    Science.gov (United States)

    Sand, Håkan; Eklund, Ann; Zimmermann, Barbara; Wikenros, Camilla; Wabakken, Petter

    2016-01-01

    Research on large predator-prey interactions are often limited to the predators' primary prey, with the potential for prey switching in systems with multiple ungulate species rarely investigated. We evaluated wolf (Canis lupus) prey selection at two different spatial scales, i.e., inter- and intra-territorial, using data from 409 ungulate wolf-kills in an expanding wolf population in Scandinavia. This expansion includes a change from a one-prey into a two-prey system with variable densities of one large-sized ungulate; moose (Alces alces) and one small-sized ungulate; roe deer (Capreolus capreolus). Among wolf territories, the proportion of roe deer in wolf kills was related to both pack size and roe deer density, but not to moose density. Pairs of wolves killed a higher proportion of roe deer than did packs, and wolves switched to kill more roe deer as their density increased above a 1:1 ratio in relation to the availability of the two species. At the intra-territorial level, wolves again responded to changes in roe deer density in their prey selection whereas we found no effect of snow depth, time during winter, or other predator-related factors on the wolves' choice to kill moose or roe deer. Moose population density was only weakly related to intra-territorial prey selection. Our results show that the functional response of wolves on moose, the species hitherto considered as the main prey, was strongly dependent on the density of a smaller, alternative, ungulate prey. The impact of wolf predation on the prey species community is therefore likely to change with the composition of the multi-prey species community along with the geographical expansion of the wolf population.

  9. A Diagnostic Decision Support System for BMP Selection in Small Urban Watersheds

    Science.gov (United States)

    Wang, Y.; Montas, H. J.; Leisnham, P.; Shirmohammadi, A.; Brubaker, K. L.; Reiling, S.

    2013-12-01

    Overall water quality in the United States has improved since the establishment of the Clean Water Act in 1972. While waste water and other point source discharge treatments are expanding and improving in quality, non-point source pollution remains a problem. Best Management Practices (BMPs) are structural and nonstructural methods to mitigate these problems. Much attention has focused on non-point source pollutants in rural areas, where agricultural activities increase the nutrients (fertilizers), toxics (pesticides), and sediments in surface water. Urban and suburban areas also suffer from severe water quantity and quality problems, largely due to stormwater. Low Impact Development (LID), a series of spatially distributed and engineered small-scale hydrologic controls, is an appropriate approach to reduce flow rate and improve urban stormwater quality before it discharges into surface water bodies. This research sought to develop a Diagnostic Decision Support System (DDSS) for urban BMP/LID selection. The process-based hydrologic model, Soil and Water Assessment Tool (SWAT), was used to simulate the hydrologic processes and to estimate related water quality variables. A logic based simple method was developed to identify the critical water quality and quantity hotspots using the SWAT outputs for multiple Hydrologic Response Units (HRUs) within the study watershed. The DDSS consisted of two parts: a Diagnostic Expert System (DES), which identifies the most likely reasons for excessive pollutants; and a Prescriptive Expert System (PES), which selects the best set of spatially distributed BMPs. The DDSS is tested in Watts Branch, a small urban subwatershed in metropolitan Washington D.C. A SWAT model for the watershed was calibrated and validated first. The DDSS was then applied. The final selected series of BMPs was simulated again in the SWAT model for a ten-year period to quantify their effectiveness. The identified hotspots, possible reasons, and BMP solutions

  10. A DSS framework for maintaining relevant features of the Small Business B2C Websites

    OpenAIRE

    Khatun, Madhury; Miah, Shah Jahan

    2016-01-01

    Managers are heavily engaged in strategic decision-making for businesses, particularly in a changing environment. One of the most important decisions for online small businesses, as part of their strategic planning, is selecting relevant features on their websites, both to attract and interact with consumers. However, only a few Australian small businesses use strategic tools for selecting their website features. As a result, businesses lose potential domestic sales in the business-to-consume...

  11. Stability of a Model Explaining Selected Extramusical Influences on Solo and Small-Ensemble Festival Ratings

    Science.gov (United States)

    Bergee, Martin J.; Westfall, Claude R.

    2005-01-01

    This is the third study in a line of inquiry whose purpose has been to develop a theoretical model of selected extra musical variables' influence on solo and small-ensemble festival ratings. Authors of the second of these (Bergee & McWhirter, 2005) had used binomial logistic regression as the basis for their model-formulation strategy. Their…

  12. Ionization of small molecules by state-selected neon (3P0, 3P2) metastable atoms in the 0.06

    NARCIS (Netherlands)

    Berg, van den F.T.M.; Schonenberg, J.H.M.; Beijerinck, H.C.W.

    1987-01-01

    The velocity dependence and absolute values of the total ionisation cross section for the molecules H2, N2, O2, NO, CO, N2O, CO2, and CH4 by metastable Ne* (3P0) and Ne* (3P2) atoms at collision energies ranging from 0.06 to 6.0 eV have been measured in a crossed beam experiment. State selection of

  13. 48 CFR 19.202-2 - Locating small business sources.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Locating small business... SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS Policies 19.202-2 Locating small business sources. The contracting officer must, to the extent practicable, encourage maximum participation by small business...

  14. Increased Level of Phosphorylated ShcA Measured by Chemiluminescence-Linked Immunoassay Is a Predictor of Good Prognosis in Primary Breast Cancer Expressing Low Levels of Estrogen Receptor

    Directory of Open Access Journals (Sweden)

    Serenella Eppenberger-Castori

    2010-03-01

    Full Text Available The SH2 domain-containing adaptor protein ShcA is a proto-oncogene involved in growth factor receptor signaling. The role of phosphorylated ShcA is to link receptor tyrosine kinases with the SH2-containing adaptor protein Grb2, thus facilitating signal transduction from receptor tyrosine kinases to Ras, leading to MAPK activation. The present study was designed to investigate the prognostic significance of phosphorylated ShcA in primary breast cancer and its association in the interactions between the ER and ErbB2 pathways. Using a two-site chemiluminescence-linked immunosorbent assay, we detected the quantitative expression levels of total tyrosine- and threonine-phosphorylated ShcA in cytosol fractions obtained from fresh frozen tissue samples of 153 selected primary breast cancer patients. ShcA phosphorylation was not associated with nodal status, estrogen receptor (ER status or grading. High levels of both tyrosine (pYShcA and serine (pSShcA phosphorylated ShcA correlated with good prognosis (p < 0.01, with respect to both disease-free (DFS and overall survival (OS. In addition, pShcA levels were found to correlate with threonine-phosphorylated ErbB2 and inversely with phosphorylated Akt (pAkt, as well as ErbB2 and ER expression levels. Our findings demonstrate that ShcA activation in primary breast cancer patients correlates with low levels of ER, and is associated with good prognosis.

  15. The NAICS Code Selection Process And Small Business Participation

    Science.gov (United States)

    2016-03-01

    small business , small disadvantaged business , and women -owned small business concerns. Such concerns must also have the maximum practicable... businesses a contracting officer can utilize. A woman-owned small business is a small business that is at least 51% owned by one or more women (FAR...2015). Firms considered for the Woman-Owned Small Business Program operate in industries the SBA has determined to be underrepresented by women

  16. 48 CFR 319.202-2 - Locating small business sources.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Locating small business... SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS Policies 319.202-2 Locating small business sources. (a) OPDIVs shall foster, to the extent practicable, maximum participation by small businesses in HHS acquisitions...

  17. 48 CFR 2919.202-2 - Locating small business sources.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Locating small business... SOCIOECONOMIC PROGRAMS SMALL BUSINESS AND SMALL DISADVANTAGED BUSINESS CONCERNS Policies 2919.202-2 Locating small business sources. Any procurement conducted on an unrestricted basis will include solicitations to...

  18. Characterization of the effects of cyclooxygenase-2 inhibition in the regulation of apoptosis in human small and non-small cell lung cancer cell lines.

    LENUS (Irish Health Repository)

    Alam, Mahmood

    2012-02-03

    BACKGROUND: Cyclooxygenase-2 enzyme (COX-2) is overexpressed in human non-small cell lung cancer (NSCLC) but is not expressed in small cell lung cancer. Selective COX-2 inhibitors have been shown to induce apoptosis in NSCLC cells, an effect which is associated with the regulation of intracellular MAP kinase (MAPK) signal pathways. Our aims were to characterize the effects of COX-2 inhibition by rofecoxib on apoptosis in human NSCLC and small cell lung cancer cell lines. METHODS: The human NSCLC cell line NCI-H2126 and small cell lung cancer cell line DMS-79 were used. Constitutive COX-2 protein levels were first determined by Western blot test. Levels of apoptosis were evaluated by using propidium iodide staining on FACScan analysis after incubation of NCI-H2126 and DMS-79 with p38 MAPK inhibitor SB202190 (25 ?microM), NF-kappaB inhibitor SN50 (75 microg\\/mL), and rofecoxib at 100 and 250 microM. All statistical analysis was performed by analysis of variance. RESULTS: Western blot test confirmed the presence of COX-2 enzyme in NCI-H2126 and absence in DMS-79. Interestingly, rofecoxib treatment demonstrated a dose-dependent increase in apoptosis in both cell lines. Given this finding, the effect of rofecoxib on NF-kappaB and p38 MAPK pathways was also examined. Apoptosis in both cell lines was unaltered by SN50, either alone or in combination with rofecoxib. A similar phenomenon was observed in NCI-H2126 cells treated with SB202190, either alone or in combination with rofecoxib. In contrast, p38 MAPK inhibition greatly upregulated DMS-79 apoptosis in a manner that was unaltered by the addition of rofecoxib. CONCLUSIONS: Rofecoxib led to a dose-dependent increase in apoptosis in both tumor cell lines. This effect occurred independently of COX-2, NF-kappaB, and p38 MAPK pathways in DMS-79 cells. As such, rofecoxib must act on alternative pathways to regulate apoptosis in human small cell lung cancer cells.

  19. Furan-2-ylmethylene thiazolidinediones as novel, potent, and selective inhibitors of phosphoinositide 3-kinase gamma.

    Science.gov (United States)

    Pomel, Vincent; Klicic, Jasna; Covini, David; Church, Dennis D; Shaw, Jeffrey P; Roulin, Karen; Burgat-Charvillon, Fabienne; Valognes, Delphine; Camps, Montserrat; Chabert, Christian; Gillieron, Corinne; Françon, Bernard; Perrin, Dominique; Leroy, Didier; Gretener, Denise; Nichols, Anthony; Vitte, Pierre Alain; Carboni, Susanna; Rommel, Christian; Schwarz, Matthias K; Rückle, Thomas

    2006-06-29

    Class I phosphoinositide 3-kinases (PI3Ks), in particular PI3Kgamma, have become attractive drug targets for inflammatory and autoimmune diseases. Here, we disclose a novel series of furan-2-ylmethylene thiazolidinediones as selective, ATP-competitive PI3Kgamma inhibitors. Structure-based design and X-ray crystallography of complexes formed by inhibitors bound to PI3Kgamma identified key pharmacophore features for potency and selectivity. An acidic NH group on the thiazolidinedione moiety and a hydroxy group on the furan-2-yl-phenyl part of the molecule play crucial roles in binding to PI3K and contribute to class IB PI3K selectivity. Compound 26 (AS-252424), a potent and selective small-molecule PI3Kgamma inhibitor emerging from these efforts, was further profiled in three different cellular PI3K assays and shown to be selective for class IB PI3K-mediated cellular effects. Oral administration of 26 in a mouse model of acute peritonitis led to a significant reduction of leukocyte recruitment.

  20. Discovery of new candidate genes for rheumatoid arthritis through integration of genetic association data with expression pathway analysis.

    Science.gov (United States)

    Shchetynsky, Klementy; Diaz-Gallo, Lina-Marcella; Folkersen, Lasse; Hensvold, Aase Haj; Catrina, Anca Irinel; Berg, Louise; Klareskog, Lars; Padyukov, Leonid

    2017-02-02

    Here we integrate verified signals from previous genetic association studies with gene expression and pathway analysis for discovery of new candidate genes and signaling networks, relevant for rheumatoid arthritis (RA). RNA-sequencing-(RNA-seq)-based expression analysis of 377 genes from previously verified RA-associated loci was performed in blood cells from 5 newly diagnosed, non-treated patients with RA, 7 patients with treated RA and 12 healthy controls. Differentially expressed genes sharing a similar expression pattern in treated and untreated RA sub-groups were selected for pathway analysis. A set of "connector" genes derived from pathway analysis was tested for differential expression in the initial discovery cohort and validated in blood cells from 73 patients with RA and in 35 healthy controls. There were 11 qualifying genes selected for pathway analysis and these were grouped into two evidence-based functional networks, containing 29 and 27 additional connector molecules. The expression of genes, corresponding to connector molecules was then tested in the initial RNA-seq data. Differences in the expression of ERBB2, TP53 and THOP1 were similar in both treated and non-treated patients with RA and an additional nine genes were differentially expressed in at least one group of patients compared to healthy controls. The ERBB2, TP53. THOP1 expression profile was successfully replicated in RNA-seq data from peripheral blood mononuclear cells from healthy controls and non-treated patients with RA, in an independent collection of samples. Integration of RNA-seq data with findings from association studies, and consequent pathway analysis implicate new candidate genes, ERBB2, TP53 and THOP1 in the pathogenesis of RA.

  1. Diffusion effects on volume-selective NMR at small length scales

    International Nuclear Information System (INIS)

    Gaedke, Achim

    2009-01-01

    In this thesis, the interplay between diffusion and relaxation effects in spatially selective NMR experiments at short length scales is explored. This is especially relevant in the context of both conventional and mechanically detected MRI at (sub)micron resolution in biological specimens. Recent results on selectively excited very thin slices showed an in-slice-magnetization recovery orders of magnitude faster than the longitudinal relaxation time T1. However, those experiments were run on fully relaxed samples while MRI and especially mechanically detected NMR experiments are typically run in a periodic fashion with repetition times far below T1. The main purpose of this work therefore was to extend the study of the interplay between diffusion and longitudinal relaxation to periodic excitations. In some way, this is inverse phenomenon to the DESIRE (Diffusive Enhancement of SIgnal and REsolution) approach, proposed 1992 by Lauterbur. Experiments on periodically excited thin slices were carried out at a dedicated static field gradient cryomagnet with magnetic field gradients up to 180 T/m. In order to obtain plane slices, an appropriate isosurface of the gradient magnet had to be identified. It was found at a field of 3.8 T with a gradient of 73 T/m. In this field, slices down to a thickness of 3.2 μm could be excited. The detection of the NMR signal was done using FIDs instead of echoes as the excitation bandwidth of those thin slices is sufficiently small to observe FIDs which are usually considered to be elusive to detection in such strong static field gradients. A simulation toolbox based on the full Bloch-Torrey-equation was developed to describe the excitation and the formation of NMR signals under those unusual conditions as well as the interplay of diffusion and magnetization recovery. Both the experiments and the simulations indicate that diffusion effects lead to a strongly enhanced magnetization modulation signal also under periodic excitation

  2. Involvement of Chromatin Remodeling Genes and the Rho GTPases RhoB and CDC42 in Ovarian Clear Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Nicolai Skovbjerg Arildsen

    2017-05-01

    Full Text Available ObjectiveOvarian clear cell carcinomas (OCCCs constitute a rare ovarian cancer subtype with distinct clinical features, but may nonetheless be difficult to distinguish morphologically from other subtypes. There is limited knowledge of genetic events driving OCCC tumorigenesis beyond ARID1A, which is reportedly mutated in 30–50% of OCCCs. We aimed to further characterize OCCCs by combined global transcriptional profiling and targeted deep sequencing of a panel of well-established cancer genes. Increased knowledge of OCCC-specific genetic aberrations may help in guiding development of targeted treatments and ultimately improve patient outcome.MethodsGene expression profiling of formalin-fixed, paraffin-embedded (FFPE tissue from a cohort of the major ovarian cancer subtypes (cohort 1; n = 67 was performed using whole-genome cDNA-mediated Annealing, Selection, extension and Ligation (WG-DASL bead arrays, followed by pathway, gene module score, and gene ontology analyses, respectively. A second FFPE cohort of 10 primary OCCCs was analyzed by targeted DNA sequencing of a panel of 60 cancer-related genes (cohort 2. Non-synonymous and non-sense variants affecting single-nucleotide variations and insertions or deletions were further analyzed. A tissue microarray of 43 OCCCs (cohort 3 was used for validation by immunohistochemistry and chromogenic in situ hybridization.ResultsGene expression analyses revealed a distinct OCCC profile compared to other histological subtypes, with, e.g., ERBB2, TFAP2A, and genes related to cytoskeletal actin regulation being overexpressed in OCCC. ERBB2 was, however, not overexpressed on the protein level and ERBB2 amplification was rare in the validation cohort. Targeted deep sequencing revealed non-synonymous variants or insertions/deletions in 11/60 cancer-related genes. Genes involved in chromatin remodeling, including ARID1A, SPOP, and KMT2D were frequently mutated across OCCC tumors.ConclusionOCCCs appear

  3. Prey Selection of Scandinavian Wolves: Single Large or Several Small?

    Directory of Open Access Journals (Sweden)

    Håkan Sand

    Full Text Available Research on large predator-prey interactions are often limited to the predators' primary prey, with the potential for prey switching in systems with multiple ungulate species rarely investigated. We evaluated wolf (Canis lupus prey selection at two different spatial scales, i.e., inter- and intra-territorial, using data from 409 ungulate wolf-kills in an expanding wolf population in Scandinavia. This expansion includes a change from a one-prey into a two-prey system with variable densities of one large-sized ungulate; moose (Alces alces and one small-sized ungulate; roe deer (Capreolus capreolus. Among wolf territories, the proportion of roe deer in wolf kills was related to both pack size and roe deer density, but not to moose density. Pairs of wolves killed a higher proportion of roe deer than did packs, and wolves switched to kill more roe deer as their density increased above a 1:1 ratio in relation to the availability of the two species. At the intra-territorial level, wolves again responded to changes in roe deer density in their prey selection whereas we found no effect of snow depth, time during winter, or other predator-related factors on the wolves' choice to kill moose or roe deer. Moose population density was only weakly related to intra-territorial prey selection. Our results show that the functional response of wolves on moose, the species hitherto considered as the main prey, was strongly dependent on the density of a smaller, alternative, ungulate prey. The impact of wolf predation on the prey species community is therefore likely to change with the composition of the multi-prey species community along with the geographical expansion of the wolf population.

  4. Prey Selection of Scandinavian Wolves: Single Large or Several Small?

    Science.gov (United States)

    Eklund, Ann; Zimmermann, Barbara; Wikenros, Camilla; Wabakken, Petter

    2016-01-01

    Research on large predator-prey interactions are often limited to the predators’ primary prey, with the potential for prey switching in systems with multiple ungulate species rarely investigated. We evaluated wolf (Canis lupus) prey selection at two different spatial scales, i.e., inter- and intra-territorial, using data from 409 ungulate wolf-kills in an expanding wolf population in Scandinavia. This expansion includes a change from a one-prey into a two-prey system with variable densities of one large-sized ungulate; moose (Alces alces) and one small-sized ungulate; roe deer (Capreolus capreolus). Among wolf territories, the proportion of roe deer in wolf kills was related to both pack size and roe deer density, but not to moose density. Pairs of wolves killed a higher proportion of roe deer than did packs, and wolves switched to kill more roe deer as their density increased above a 1:1 ratio in relation to the availability of the two species. At the intra-territorial level, wolves again responded to changes in roe deer density in their prey selection whereas we found no effect of snow depth, time during winter, or other predator-related factors on the wolves’ choice to kill moose or roe deer. Moose population density was only weakly related to intra-territorial prey selection. Our results show that the functional response of wolves on moose, the species hitherto considered as the main prey, was strongly dependent on the density of a smaller, alternative, ungulate prey. The impact of wolf predation on the prey species community is therefore likely to change with the composition of the multi-prey species community along with the geographical expansion of the wolf population. PMID:28030549

  5. The distribution of the therapeutic monoclonal antibodies cetuximab and trastuzumab within solid tumors

    International Nuclear Information System (INIS)

    Lee, Carol M; Tannock, Ian F

    2010-01-01

    Poor distribution of some anticancer drugs in solid tumors may limit their anti-tumor activity. Here we used immunohistochemistry to quantify the distribution of the therapeutic monoclonal antibodies cetuximab and trastuzumab in relation to blood vessels and to regions of hypoxia in human tumor xenografts. The antibodies were injected into mice implanted with human epidermoid carcinoma A431 or human breast carcinoma MDA-MB-231 transfected with ERBB2 (231-H2N) that express high levels of ErbB1 and ErbB2 respectively, or wild-type MDA-MB-231, which expresses intermediate levels of ErbB1 and low levels of ErbB2. The distribution of cetuximab in A431 xenografts and trastuzumab in 231-H2N xenografts was time and dose dependent. At early intervals after injection of 1 mg cetuximab into A431 xenografts, the concentration of cetuximab decreased with increasing distance from blood vessels, but became more uniformly distributed at later times; there remained however limited distribution and binding in hypoxic regions of tumors. Injection of lower doses of cetuximab led to heterogeneous distributions. Similar results were observed with trastuzumab in 231-H2N xenografts. In MDA-MB-231 xenografts, which express lower levels of ErbB1, homogeneity of distribution of cetuximab was achieved more rapidly. Cetuximab and trastuzumab distribute slowly, but at higher doses achieve a relatively uniform distribution after about 24 hours, most likely due to their long half-lives in the circulation. There remains poor distribution within hypoxic regions of tumors

  6. Small-conductance Ca2+-activated potassium type 2 channels regulate the formation of contextual fear memory.

    Directory of Open Access Journals (Sweden)

    Saravana R K Murthy

    Full Text Available Small-conductance, Ca2+ activated K+ channels (SK channels are expressed at high levels in brain regions responsible for learning and memory. In the current study we characterized the contribution of SK2 channels to synaptic plasticity and to different phases of hippocampal memory formation. Selective SK2 antisense-treatment facilitated basal synaptic transmission and theta-burst induced LTP in hippocampal brain slices. Using the selective SK2 antagonist Lei-Dab7 or SK2 antisense probes, we found that hippocampal SK2 channels are critical during two different time windows: 1 blockade of SK2 channels before the training impaired fear memory, whereas, 2 blockade of SK2 channels immediately after the training enhanced contextual fear memory. We provided the evidence that the post-training cleavage of the SK2 channels was responsible for the observed bidirectional effect of SK2 channel blockade on memory consolidation. Thus, Lei-Dab7-injection before training impaired the C-terminal cleavage of SK2 channels, while Lei-Dab7 given immediately after training facilitated the C-terminal cleavage. Application of the synthetic peptide comprising a leucine-zipper domain of the C-terminal fragment to Jurkat cells impaired SK2 channel-mediated currents, indicating that the endogenously cleaved fragment might exert its effects on memory formation by blocking SK2 channel-mediated currents. Our present findings suggest that SK2 channel proteins contribute to synaptic plasticity and memory not only as ion channels but also by additionally generating a SK2 C-terminal fragment, involved in both processes. The modulation of fear memory by down-regulating SK2 C-terminal cleavage might have applicability in the treatment of anxiety disorders in which fear conditioning is enhanced.

  7. Dual Selectivity Expressed in [2+2+1] Dynamic Clipping of Unsymmetrical [2]Catenanes

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yi

    2010-06-11

    A {pi}-templated dynamic [2+2+1] clipping protocol is established for the synthesis of [2]catenanes from two parts dialdehyde, two parts diamine and one part tetracationic cyclophane. It is further diversified for the selective formation of an unsymmetrical [2]catenane showing great translational selectivity by employing two different dialdehydes in a one-pot reaction. The dual selectivity and the dynamic nature are verified by {sup 1}H NMR spectroscopy, X-ray single crystal structural studies and exchange experiments.

  8. "small ACCELERATORS" 24 May - 2 June 2005

    CERN Multimedia

    2005-01-01

    CERN Accelerator School and Kernfysisch Versneller Instituut (KVI) Groningen, the Netherlands announce a course on "Small Accelerators", Hotel Golden Tulip Drenthe, Zeegse, the Netherlands, 24 May - 2 June 2005. This specialised course is dedicated to the physics and the main applications of small accelerators. The course will review the different accelerator types as well as their specificities in terms of accelerator physics.

  9. A Holistic In silico Approach to Develop Novel Inhibitors Targeting ...

    African Journals Online (AJOL)

    Keywords: Receptor tyrosine kinases, ErbB1, ErbB2, Natural products, Pharmacophore, Docking,. Cancer therapy. ... The incidence of lung cancer worldwide is 13 %. The highest ..... urinary bladder contraction and salivation are mediated via ...

  10. Application of small intestine decompression combined with oral feeding in middle and late period of malignant small bowel obstruction.

    Science.gov (United States)

    Li, Dechun; Du, Hongtao; Shao, Guoqing; Guo, Yongtuan; Lu, Wan; Li, Ruihong

    2017-07-01

    The application value of small intestine decompression combined with oral feeding in the middle and late period of malignant small bowel obstruction was examined. A total of 22 patients with advanced malignant small bowel obstruction were included in the present study. An ileus tube was inserted via the nose under fluoroscopy into the obstructed small intestine of each patient. At the same time, the insertion depth the of the catheter was adjusted. When the catheter was blocked, small bowel selective angiography was performed to determine the location and cause of the obstruction and the extent of the obstruction, and to determine the length of the small intestine in the site of obstruction, and to select the variety and tolerance of enteral nutrition. We observed the decompression tube flow and ease of intestinal obstruction. In total, 20 patients were treated with oral enteral nutrition after abdominal distension, and 22 cases were treated by the nose to observe the drainage and the relief of intestinal obstruction. The distal end of the catheter was placed in a predetermined position. The symptoms of intestinal obstruction were relieved 1-4 days after decompression. The 22 patients with selective angiography of the small intestine showed positive X-ray signs: 18 patients with oral enteral nutrition therapy had improved the nutritional situation 2 weeks later. In 12 cases, where there was anal defecation exhaust, 2 had transient removal of intestinal obstruction catheter. In conclusion, this comprehensive treatment based on small intestine decompression combined with enteral nutrition is expected to become a new therapeutic approach and method for the treatment of patients with advanced tumor small bowel obstruction.

  11. Discovery of MK-3697: a selective orexin 2 receptor antagonist (2-SORA) for the treatment of insomnia.

    Science.gov (United States)

    Roecker, Anthony J; Reger, Thomas S; Mattern, M Christa; Mercer, Swati P; Bergman, Jeffrey M; Schreier, John D; Cube, Rowena V; Cox, Christopher D; Li, Dansu; Lemaire, Wei; Bruno, Joseph G; Harrell, C Meacham; Garson, Susan L; Gotter, Anthony L; Fox, Steven V; Stevens, Joanne; Tannenbaum, Pamela L; Prueksaritanont, Thomayant; Cabalu, Tamara D; Cui, Donghui; Stellabott, Joyce; Hartman, George D; Young, Steven D; Winrow, Christopher J; Renger, John J; Coleman, Paul J

    2014-10-15

    Orexin receptor antagonists have demonstrated clinical utility for the treatment of insomnia. The majority of clinical efforts to date have focused on the development of dual orexin receptor antagonists (DORAs), small molecules that antagonize both the orexin 1 and orexin 2 receptors. Our group has recently disclosed medicinal chemistry efforts to identify highly potent, orally bioavailable selective orexin 2 receptor antagonists (2-SORAs) that possess acceptable profiles for clinical development. Herein we report additional SAR studies within the 'triaryl' amide 2-SORA series focused on improvements in compound stability in acidic media and time-dependent inhibition of CYP3A4. These studies resulted in the discovery of 2,5-disubstituted isonicotinamide 2-SORAs such as compound 24 that demonstrated improved stability and TDI profiles as well as excellent sleep efficacy across species. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Overcurrent protection of transformers. Part 2: Traditional and new fusing philosophies for small and large transformers

    Energy Technology Data Exchange (ETDEWEB)

    Cook, C. J.; Niemira, J. K.

    2003-07-01

    New and traditional fusing philosophies for protecting transformers are discussed. This second in a two-part paper covers selection criteria for a transformer-primary fuse to protect the transformer consistent with industry-accepted through-fault protection curves. Also covered are the principles of coordination as they relate to the proper selection of the primary-side fuse and power fuses and the principles underlying the protection of load-side conductors and cables. The critical nature of secondary fault protection on small three-phase transformers used on industrial, commercial, and institutional power systems, as well as small-to-medium size three-phase power transformers used in utility substations is emphasized, in view of the long lead time and expense involved in replacing these transformers. In contrast, no special protection recommendations are made for small-kVA overhead distribution transformers, since they are not considered likely to experience secondary faults, and the rare faults that do occur will not likely be detected and cleared by the primary fuse. Also of importance is the fact that these transformers are inexpensive and readily available. Overall, large fuse rating, used in combination with a tank-mounted surge arrester is recommended, because it can provide better transformer protection than the smaller fuse ratings traditionally employed. 4 refs., 2 tabs., 4 figs.

  13. Phenotypic and Genetic Characterization of Circulating Tumor Cells by Combining Immunomagnetic Selection and FICTION Techniques

    Science.gov (United States)

    Campos, María; Prior, Celia; Warleta, Fernando; Zudaire, Isabel; Ruíz-Mora, Jesús; Catena, Raúl; Calvo, Alfonso; Gaforio, José J.

    2008-01-01

    The presence of circulating tumor cells (CTCs) in breast cancer patients has been proven to have clinical relevance. Cytogenetic characterization of these cells could have crucial relevance for targeted cancer therapies. We developed a method that combines an immunomagnetic selection of CTCs from peripheral blood with the fluorescence immunophenotyping and interphase cytogenetics as a tool for investigation of neoplasm (FICTION) technique. Briefly, peripheral blood (10 ml) from healthy donors was spiked with a predetermined number of human breast cancer cells. Nucleated cells were separated by double density gradient centrifugation of blood samples. Tumor cells (TCs) were immunomagnetically isolated with an anti-cytokeratin antibody and placed onto slides for FICTION analysis. For immunophenotyping and genetic characterization of TCs, a mixture of primary monoclonal anti-pancytokeratin antibodies was used, followed by fluorescent secondary antibodies, and finally hybridized with a TOP2A/HER-2/CEP17 multicolor probe. Our results show that TCs can be efficiently isolated from peripheral blood and characterized by FICTION. Because genetic amplification of TOP2A and ErbB2 (HER-2) in breast cancer correlates with response to anthracyclines and herceptin therapies, respectively, this novel methodology could be useful for a better classification of patients according to the genetic alterations of CTCs and for the application of targeted therapies. (J Histochem Cytochem 56:667–675, 2008) PMID:18413646

  14. Developing and Validating a Rapid Small-Scale Column Test Procedure for GAC Selection using Reconstituted Lyophilized NOM

    Science.gov (United States)

    Cost effective design and operation of Granular Activated Carbon (GAC) facilities requires the selection of GAC that is optimal for a specific site. Rapid small-scale column tests (RSSCTs) are widely used for GAC assessment due to several advantages, including the ability to simu...

  15. Molecular characterization of apocrine salivary duct carcinoma.

    Science.gov (United States)

    Chiosea, Simion I; Williams, Lindsay; Griffith, Christopher C; Thompson, Lester D R; Weinreb, Ilan; Bauman, Julie E; Luvison, Alyssa; Roy, Somak; Seethala, Raja R; Nikiforova, Marina N

    2015-06-01

    Contemporary classification and treatment of salivary duct carcinoma (SDC) require its thorough molecular characterization. Thirty apocrine SDCs were analyzed by the Ion Ampliseq Cancer HotSpot panel v2 for mutations in 50 cancer-related genes. Mutational findings were corroborated by immunohistochemistry (eg, TP53, BRAF, β-catenin, estrogen, and androgen receptors) or Sanger sequencing/SNaPshot polymerase chain reaction. ERBB2 (HER2), PTEN, FGFR1, CDKN2A/P16, CMET, EGFR, MDM2, and PIK3CA copy number changes were studied by fluorescence in situ hybridization. TP53 mutations (15/27, 56%), PTEN loss (11/29, 38%, including 2 cases with PTEN mutation), PIK3CA hotspot mutations (10/30, 33%), HRAS hotspot mutations (10/29; 34%), and ERBB2 amplification (9/29, 31%, including 1 case with mutation) represented the 5 most common abnormalities. There was no correlation between genetic changes and clinicopathologic parameters. There was substantial overlap between genetic changes: 8 of 9 cases with ERBB2 amplification also harbored a PIK3CA, HRAS, and TP53 mutation and/or PTEN loss. Six of 10 cases with PIK3CA mutation also had an HRAS mutation. These findings provide a molecular rationale for dual targeting of mitogen-activated protein kinase and phosphoinositide 3-kinase pathways in SDC. FGFR1 amplification (3/29, 10%) represents a new potential target. On the basis of studies of breast carcinomas, the efficacy of anti-ERBB2 therapy will likely be decreased in SDC with ERBB2 amplification co-occurring with PIK3CA mutation or PTEN loss. Therefore, isolated ERBB2 testing is insufficient for theranostic stratification of apocrine SDC. On the basis of the prevalence and type of genetic changes, apocrine SDC appears to resemble one subtype of breast carcinoma-"luminal androgen receptor positive/molecular apocrine."

  16. Selective small-chemical inhibitors of protein arginine methyltransferase 5 with anti-lung cancer activity.

    Directory of Open Access Journals (Sweden)

    Gui-Mei Kong

    Full Text Available Protein arginine methyltransferase 5 (PRMT5 plays critical roles in a wide variety of biological processes, including tumorigenesis. By screening a library of small chemical compounds, we identified eight compounds that selectively inhibit the PRMT5 enzymatic activity, with IC50 values ranging from 0.1 to 6 μM. Molecular docking simulation and site-directed mutagenesis indicated that identified compounds target the substrate-binding site in PRMT5. Treatment of lung cancer cells with identified inhibitors led to inhibition of the symmetrical arginine methylation of SmD3 and histones and the cellular proliferation. Oral administration of the inhibitor demonstrated antitumor activity in a lung tumor xenograft model. Thus, identified PRMT5-specific small-molecule inhibitors would help elucidate the biological roles of PRMT5 and serve as lead compounds for future drug development.

  17. Influence of small particles inclusion on selective laser melting of Ti-6Al-4V powder

    Science.gov (United States)

    Gong, Haijun; Dilip, J. J. S.; Yang, Li; Teng, Chong; Stucker, Brent

    2017-12-01

    The particle size distribution and powder morphology of metallic powders have an important effect on powder bed fusion based additive manufacturing processes, such as selective laser melting (SLM). The process development and parameter optimization require a fundamental understanding of the influence of powder on SLM. This study introduces a pre-alloyed titanium alloy Ti-6Al-4V powder, which has a certain amount of small particles, for SLM. The influence of small particle inclusion is investigated through microscopy of surface topography, elemental and microstructural analysis, and mechanical testing, compared to the Ti-6Al-4V powder provided by SLM machine vendor. It is found that the small particles inclusion in Ti-6Al-4V powder has a noticeable effect on extra laser energy absorption, which may develop imperfections and deteriorate the SLM fatigue performance.

  18. RVX-297- a novel BD2 selective inhibitor of BET bromodomains

    Energy Technology Data Exchange (ETDEWEB)

    Kharenko, Olesya A., E-mail: olesya@zenithepigenetics.com [Zenith Epigenetics, Suite 300, 4820 Richard Road SW, Calgary, Alberta, T3E 6L1 (Canada); Gesner, Emily M.; Patel, Reena G.; Norek, Karen [Zenith Epigenetics, Suite 300, 4820 Richard Road SW, Calgary, Alberta, T3E 6L1 (Canada); White, Andre; Fontano, Eric; Suto, Robert K. [Xtal BioStructures, Inc., 12 Michigan Dr., Natick, MA 01760 (United States); Young, Peter R.; McLure, Kevin G.; Hansen, Henrik C. [Zenith Epigenetics, Suite 300, 4820 Richard Road SW, Calgary, Alberta, T3E 6L1 (Canada)

    2016-08-12

    Bromodomains are epigenetic readers that specifically bind to the acetyl lysine residues of histones and transcription factors. Small molecule BET bromodomain inhibitors can disrupt this interaction which leads to potential modulation of several disease states. Here we describe the binding properties of a novel BET inhibitor RVX-297 that is structurally related to the clinical compound RVX-208, currently undergoing phase III clinical trials for the treatment of cardiovascular diseases, but is distinctly different in its biological and pharmacokinetic profiles. We report that RVX-297 preferentially binds to the BD2 domains of the BET bromodomain and Extra Terminal (BET) family of protein. We demonstrate the differential binding modes of RVX-297 in BD1 and BD2 domains of BRD4 and BRD2 using X-ray crystallography, and describe the structural differences driving the BD2 selective binding of RVX-297. The isothermal titration calorimetry (ITC) data illustrate the related differential thermodynamics of binding of RVX-297 to single as well as dual BET bromodomains. - Highlights: • A novel inhibitor of BET bromodomains, RVX-297 is described. • The differential binding modes of RVX-297 in BD1 and BD2 domains of BRD4 and BRD2 using X-ray crystallography are described. • RVX-297 preferentially binds to the BD2 domains of the BET bromodomains. • The structural and thermodynamic properties of the BD2 selective binding of RVX-297 are characterized.

  19. HDAC inhibitors enhance neratinib activity and when combined enhance the actions of an anti-PD-1 immunomodulatory antibody in vivo

    OpenAIRE

    Booth, Laurence; Roberts, Jane L.; Poklepovic, Andrew; Avogadri-Connors, Francesca; Cutler, Richard E.; Lalani, Alshad S.; Dent, Paul

    2017-01-01

    Patients whose NSCLC tumors become afatinib resistant presently have few effective therapeutic options to extend their survival. Afatinib resistant NSCLC cells were sensitive to clinically relevant concentrations of the irreversible pan-HER inhibitor neratinib, but not by the first generation ERBB1/2/4 inhibitor lapatinib. In multiple afatinib resistant NSCLC clones, HDAC inhibitors reduced the expression of ERBB1/3/4, but activated c-SRC, which resulted in higher total levels of ERBB1/3 phos...

  20. Flexible metal-organic framework compounds: In situ studies for selective CO{sub 2} capture

    Energy Technology Data Exchange (ETDEWEB)

    Allen, A.J., E-mail: andrew.allen@nist.gov [Material Measurement Laboratory, National Institute of Standards and Technology (NIST), Gaithersburg, MD 20899-8520 (United States); Espinal, L.; Wong-Ng, W. [Material Measurement Laboratory, National Institute of Standards and Technology (NIST), Gaithersburg, MD 20899-8520 (United States); Queen, W.L. [NIST Center for Neutron Research, Gaithersburg, MD 20899-6102 (United States); The Molecular Foundry, Lawrence Berkeley National Laboratory (LBNL), Berkeley, CA 94720 (United States); Brown, C.M. [NIST Center for Neutron Research, Gaithersburg, MD 20899-6102 (United States); Department of Chemical and Biomolecular Engineering, University of Delaware, Newark, DE 19716 (United States); Kline, S.R. [NIST Center for Neutron Research, Gaithersburg, MD 20899-6102 (United States); Kauffman, K.L. [National Energy Technology Laboratory (NETL), US Department of Energy, Pittsburgh, PA 15236 (United States); Culp, J.T. [National Energy Technology Laboratory (NETL), US Department of Energy, Pittsburgh, PA 15236 (United States); URS Corporation, South Park, PA 15219 (United States); Matranga, C. [National Energy Technology Laboratory (NETL), US Department of Energy, Pittsburgh, PA 15236 (United States)

    2015-10-25

    Results are presented that explore the dynamic structural changes occurring in two highly flexible nanocrystalline metal-organic framework (MOF) compounds during the adsorption and desorption of pure gases and binary mixtures. The Ni(1,2-bis(4-pyridyl)ethylene)[Ni(CN){sub 4}] and catena-bis(dibenzoylmethanato)-(4,4′-bipyridyl)nickel(II) chosen for this study are 3-D and 1-D porous coordination polymers (PCP) with a similar gate opening pressure response for CO{sub 2} isotherms at 303 K, but with differing degrees of flexibility for structural change to accommodate guest molecules. As such, they serve as a potential model system for evaluating the complex kinetics associated with dynamic structure changes occurring in response to gas adsorption in flexible MOF systems. Insights into the crystallographic changes occurring as the MOF pore structure expands and contracts in response to interactions with CO{sub 2}, N{sub 2}, and CO{sub 2}/N{sub 2} mixtures have been obtained from in situ small-angle neutron scattering and neutron diffraction, combined with ex situ X-ray diffraction structure measurements. The role of structure in carbon capture functionality is discussed with reference to the ongoing characterization challenges and a possible materials-by-design approach. - Graphical abstract: We present in situ small-angle neutron scattering results for two flexible metal-organic frameworks (MOFs). The figure shows that for one (NiBpene, high CO{sub 2} adsorption) the intensity of the Bragg peak for the expandable d-spacing most associated with CO{sub 2} adsorption varies approximately with the isotherm, while for the other (NiDBM-Bpy, high CO{sub 2} selectivity) the d-spacing, itself, varies with the isotherm. The cartoons show the proposed modes of structural change. - Highlights: • Dynamic structures of two flexible MOF CO{sub 2} sorbent compounds are compared in situ. • These porous solid sorbents serve as models for pure & dual gas adsorption. • Different

  1. Distinct Short-Range Order Is Inherent to Small Amorphous Calcium Carbonate Clusters (<2 nm)

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Shengtong [Physical Chemistry, University of Konstanz, Universitätsstrasse 10 78457 Konstanz Germany; School of Chemical Engineering, State Key Laboratory of Chemical Engineering, Shanghai Key Laboratory of Multiphase Materials Chemical Engineering, East China University of Science and Technology, 130 Meilong Road Shanghai 200237 P.R. China; Chevrier, Daniel M. [Department of Chemistry and Institute for Research in Materials, Dalhousie University, Halifax Nova Scotia B3H 4R2 Canada; Zhang, Peng [Department of Chemistry and Institute for Research in Materials, Dalhousie University, Halifax Nova Scotia B3H 4R2 Canada; Gebauer, Denis [Physical Chemistry, University of Konstanz, Universitätsstrasse 10 78457 Konstanz Germany; Cölfen, Helmut [Physical Chemistry, University of Konstanz, Universitätsstrasse 10 78457 Konstanz Germany

    2016-09-09

    Amorphous intermediate phases are vital precursors in the crystallization of many biogenic minerals. While inherent short-range orders have been found in amorphous calcium carbonates (ACCs) relating to different crystalline forms, it has never been clarified experimentally whether such orders already exist in very small clusters less than 2 nm in size. Here, we studied the stability and structure of 10,12-pentacosadiynoic acid (PCDA) protected ACC clusters with a core size of ca. 1.4 nm consisting of only seven CaCO3 units. Ligand concentration and structure are shown to be key factors in stabilizing the ACC clusters. More importantly, even in such small CaCO3 entities, a proto-calcite short-range order can be identified but with a relatively high degree of disorder that arises from the very small size of the CaCO3 core. Our findings support the notion of a structural link between prenucleation clusters, amorphous intermediates, and final crystalline polymorphs, which appears central to the understanding of polymorph selection.

  2. Ti atoms in Ru0.3Ti0.7O2 mixed oxides form active and selective sites for electrochemical chlorine evolution

    DEFF Research Database (Denmark)

    Karlsson, Rasmus K. B.; Hansen, Heine Anton; Bligaard, Thomas

    2014-01-01

    affected by the presence of small amounts of Ru dopant, whereas oxygen adsorption is relatively unaffected by Ti dopants in RuO2. The calculations also indicate that coordinatively unsaturated Ti sites on Ru-doped TiO2 and on Ru0.3Ti0.7O2 could form active and selective sites for Cl2 evolution....... These results suggest a reason for why DSA shows a higher chlorine selectivity than RuO2 and propose an experimental test of the hypothesis....

  3. Her4 and Her2/neu tyrosine kinase domains dimerize and activate in a reconstituted in vitro system.

    Science.gov (United States)

    Monsey, John; Shen, Wei; Schlesinger, Paul; Bose, Ron

    2010-03-05

    Her4 (ErbB-4) and Her2/neu (ErbB-2) are receptor-tyrosine kinases belonging to the epidermal growth factor receptor (EGFR) family. Crystal structures of EGFR and Her4 kinase domains demonstrate kinase dimerization and activation through an allosteric mechanism. The kinase domains form an asymmetric dimer, where the C-lobe surface of one monomer contacts the N-lobe of the other monomer. EGFR kinase dimerization and activation in vitro was previously reported using a nickel-chelating lipid-liposome system, and we now apply this system to all other members of the EGFR family. Polyhistidine-tagged Her4, Her2/neu, and Her3 kinase domains are bound to these nickel-liposomes and are brought to high local concentration, mimicking what happens to full-length receptors in vivo following ligand binding. Addition of nickel-liposomes to Her4 kinase domain results in 40-fold activation in kinase activity and marked enhancement of C-terminal tail autophosphorylation. Activation of Her4 shows a sigmoidal dependence on kinase concentration, consistent with a cooperative process requiring kinase dimerization. Her2/neu kinase activity is also activated by nickel-liposomes, and is increased further by heterodimerization with Her3 or Her4. The ability of Her3 and Her4 to heterodimerize and activate other family members is studied in vitro. Her3 kinase domain readily activates Her2/neu but is a poor activator of Her4, which differs from the prediction made by the asymmetric dimer model. Mutation of Her3 residues (952)ENI(954) to the corresponding sequence in Her4 enhanced the ability of Her3 to activate Her4, demonstrating that sequence differences on the C-lobe surface influence the heterodimerization and activation of ErbB kinase domains.

  4. Ultra-sensitive and selective detection of mercury ion (Hg2+) using free-standing silicon nanowire sensors

    Science.gov (United States)

    Jin, Yan; Gao, Anran; Jin, Qinghui; Li, Tie; Wang, Yuelin; Zhao, Jianlong

    2018-04-01

    In this paper, ultra-sensitive and highly selective Hg2+ detection in aqueous solutions was studied by free-standing silicon nanowire (SiNW) sensors. The all-around surface of SiNW arrays was functionalized with (3-Mercaptopropyl)trimethoxysilane serving as Hg2+ sensitive layer. Due to effective electrostatic control provided by the free-standing structure, a detection limit as low as 1 ppt was obtained. A linear relationship (R 2 = 0.9838) between log(CHg2+ ) and a device current change from 1 ppt to 5 ppm was observed. Furthermore, the developed SiNW sensor exhibited great selectivity for Hg2+ over other heavy metal ions, including Cd2+. Given the extraordinary ability for real-time Hg2+ detection, the small size and low cost of the SiNW device, it is expected to be a potential candidate in field detection of environmentally toxic mercury.

  5. 48 CFR 19.502-2 - Total small business set-asides.

    Science.gov (United States)

    2010-10-01

    ... small business set-asides shall not be made unless such a reasonable expectation exists (but see 19.502... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Total small business set... SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS Set-Asides for Small Business 19.502-2 Total small business set...

  6. Advances in molecular-based personalized non-small-cell lung cancer therapy: targeting epidermal growth factor receptor and mechanisms of resistance

    International Nuclear Information System (INIS)

    Jotte, Robert M; Spigel, David R

    2015-01-01

    Molecularly targeted therapies, directed against the features of a given tumor, have allowed for a personalized approach to the treatment of advanced non-small-cell lung cancer (NSCLC). The reversible epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) gefitinib and erlotinib had undergone turbulent clinical development until it was discovered that these agents have preferential activity in patients with NSCLC harboring activating EGFR mutations. Since then, a number of phase 3 clinical trials have collectively shown that EGFR-TKI monotherapy is more effective than combination chemotherapy as first-line therapy for EGFR mutation-positive advanced NSCLC. The next generation of EGFR-directed agents for EGFR mutation-positive advanced NSCLC is irreversible TKIs against EGFR and other ErbB family members, including afatinib, which was recently approved, and dacomitinib, which is currently being tested in phase 3 trials. As research efforts continue to explore the various proposed mechanisms of acquired resistance to EGFR-TKI therapy, agents that target signaling pathways downstream of EGFR are being studied in combination with EGFR TKIs in molecularly selected advanced NSCLC. Overall, the results of numerous ongoing phase 3 trials involving the EGFR TKIs will be instrumental in determining whether further gains in personalized therapy for advanced NSCLC are attainable with newer agents and combinations. This article reviews key clinical trial data for personalized NSCLC therapy with agents that target the EGFR and related pathways, specifically based on molecular characteristics of individual tumors, and mechanisms of resistance

  7. Selective and membrane-permeable small molecule inhibitors of nicotinamide N-methyltransferase reverse high fat diet-induced obesity in mice.

    Science.gov (United States)

    Neelakantan, Harshini; Vance, Virginia; Wetzel, Michael D; Wang, Hua-Yu Leo; McHardy, Stanton F; Finnerty, Celeste C; Hommel, Jonathan D; Watowich, Stanley J

    2018-01-01

    There is a critical need for new mechanism-of-action drugs that reduce the burden of obesity and associated chronic metabolic comorbidities. A potentially novel target to treat obesity and type 2 diabetes is nicotinamide-N-methyltransferase (NNMT), a cytosolic enzyme with newly identified roles in cellular metabolism and energy homeostasis. To validate NNMT as an anti-obesity drug target, we investigated the permeability, selectivity, mechanistic, and physiological properties of a series of small molecule NNMT inhibitors. Membrane permeability of NNMT inhibitors was characterized using parallel artificial membrane permeability and Caco-2 cell assays. Selectivity was tested against structurally-related methyltransferases and nicotinamide adenine dinucleotide (NAD + ) salvage pathway enzymes. Effects of NNMT inhibitors on lipogenesis and intracellular levels of metabolites, including NNMT reaction product 1-methylnicotianamide (1-MNA) were evaluated in cultured adipocytes. Effects of a potent NNMT inhibitor on obesity measures and plasma lipid were assessed in diet-induced obese mice fed a high-fat diet. Methylquinolinium scaffolds with primary amine substitutions displayed high permeability from passive and active transport across membranes. Importantly, methylquinolinium analogues displayed high selectivity, not inhibiting related SAM-dependent methyltransferases or enzymes in the NAD + salvage pathway. NNMT inhibitors reduced intracellular 1-MNA, increased intracellular NAD + and S-(5'-adenosyl)-l-methionine (SAM), and suppressed lipogenesis in adipocytes. Treatment of diet-induced obese mice systemically with a potent NNMT inhibitor significantly reduced body weight and white adipose mass, decreased adipocyte size, and lowered plasma total cholesterol levels. Notably, administration of NNMT inhibitors did not impact total food intake nor produce any observable adverse effects. These results support development of small molecule NNMT inhibitors as therapeutics to

  8. Small Column Ion Exchange

    International Nuclear Information System (INIS)

    Huff, Thomas

    2010-01-01

    Small Column Ion Exchange (SCIX) leverages a suite of technologies developed by DOE across the complex to achieve lifecycle savings. Technologies are applicable to multiple sites. Early testing supported multiple sites. Balance of SRS SCIX testing supports SRS deployment. A forma Systems Engineering Evaluation (SEE) was performed and selected Small Column Ion Exchange columns containing Crystalline Silicotitanate (CST) in a 2-column lead/lag configuration. SEE considered use of Spherical Resorcinol-Formaldehyde (sRF). Advantages of approach at SRS include: (1) no new buildings, (2) low volume of Cs waste in solid form compared to aqueous strip effluent; and availability of downstream processing facilities for immediate processing of spent resin.

  9. 16 CFR 1020.2 - What is the definition of “small business”?

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false What is the definition of âsmall businessâ? 1020.2 Section 1020.2 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION GENERAL SMALL BUSINESS § 1020.2 What is the definition of “small business”? As used in this part, the term small business means...

  10. Indomethacin causes prostaglandin D(2)-like and eotaxin-like selective responses in eosinophils and basophils.

    Science.gov (United States)

    Stubbs, Victoria E L; Schratl, Petra; Hartnell, Adele; Williams, Timothy J; Peskar, Bernhard A; Heinemann, Akos; Sabroe, Ian

    2002-07-19

    We investigated the actions of a panel of nonsteroidal anti-inflammatory drugs on eosinophils, basophils, neutrophils, and monocytes. Indomethacin alone was a potent and selective inducer of eosinophil and basophil shape change. In eosinophils, indomethacin induced chemotaxis, CD11b up-regulation, respiratory burst, and L-selectin shedding but did not cause up-regulation of CD63 expression. Pretreatment of eosinophils with indomethacin also enhanced subsequent eosinophil shape change induced by eotaxin, although treatment with higher concentrations of indomethacin resulted in a decrease in the expression of the major eosinophil chemokine receptor, CCR3. Indomethacin activities and cell selectivity closely resembled those of prostaglandin D(2) (PGD(2)). Eosinophil shape change in response to eotaxin was inhibited by pertussis toxin, but indomethacin- and PGD(2)-induced shape change responses were not. Treatment of eosinophils with specific inhibitors of phospholipase C (U-73122), phosphatidylinositol 3-kinase (LY-294002), and p38 mitogen-activated protein kinase (SB-202190) revealed roles for these pathways in indomethacin signaling. Indomethacin and its analogues may therefore provide a structural basis from which selective PGD(2) receptor small molecule antagonists may be designed and which may have utility in the treatment of allergic inflammatory disease.

  11. Mechanism-based screen for G1/S checkpoint activators identifies a selective activator of EIF2AK3/PERK signalling.

    Science.gov (United States)

    Stockwell, Simon R; Platt, Georgina; Barrie, S Elaine; Zoumpoulidou, Georgia; Te Poele, Robert H; Aherne, G Wynne; Wilson, Stuart C; Sheldrake, Peter; McDonald, Edward; Venet, Mathilde; Soudy, Christelle; Elustondo, Frédéric; Rigoreau, Laurent; Blagg, Julian; Workman, Paul; Garrett, Michelle D; Mittnacht, Sibylle

    2012-01-01

    Human cancers often contain genetic alterations that disable G1/S checkpoint control and loss of this checkpoint is thought to critically contribute to cancer generation by permitting inappropriate proliferation and distorting fate-driven cell cycle exit. The identification of cell permeable small molecules that activate the G1/S checkpoint may therefore represent a broadly applicable and clinically effective strategy for the treatment of cancer. Here we describe the identification of several novel small molecules that trigger G1/S checkpoint activation and characterise the mechanism of action for one, CCT020312, in detail. Transcriptional profiling by cDNA microarray combined with reverse genetics revealed phosphorylation of the eukaryotic initiation factor 2-alpha (EIF2A) through the eukaryotic translation initiation factor 2-alpha kinase 3 (EIF2AK3/PERK) as the mechanism of action of this compound. While EIF2AK3/PERK activation classically follows endoplasmic reticulum (ER) stress signalling that sets off a range of different cellular responses, CCT020312 does not trigger these other cellular responses but instead selectively elicits EIF2AK3/PERK signalling. Phosphorylation of EIF2A by EIF2A kinases is a known means to block protein translation and hence restriction point transit in G1, but further supports apoptosis in specific contexts. Significantly, EIF2AK3/PERK signalling has previously been linked to the resistance of cancer cells to multiple anticancer chemotherapeutic agents, including drugs that target the ubiquitin/proteasome pathway and taxanes. Consistent with such findings CCT020312 sensitizes cancer cells with defective taxane-induced EIF2A phosphorylation to paclitaxel treatment. Our work therefore identifies CCT020312 as a novel small molecule chemical tool for the selective activation of EIF2A-mediated translation control with utility for proof-of-concept applications in EIF2A-centered therapeutic approaches, and as a chemical starting point for

  12. The selective conservative management of small traumatic pneumothoraces following stab injuries is safe: experience from a high-volume trauma service in South Africa.

    Science.gov (United States)

    Kong, V Y; Oosthuizen, G V; Clarke, D L

    2015-02-01

    The selective conservative management of small pneumothoraces (PTXs) following stab injuries is controversial. We reviewed a cohort of patients managed conservatively in a high volume trauma service in South Africa. A retrospective review over a 2-year period identified 125 asymptomatic patients with small PTXs measuring chest radiograph who were managed conservatively. Of the 125 patients included in the study, 92% were male (115/125), and the median age for all patients was 21 years (19-24). Ninety-seven per cent (121/125) of the weapons involved were knives, and 3% (4/125) were screwdrivers. Sixty-one per cent of all injuries were on the left side. Eighty-two per cent (102/125) sustained a single stab, and 18% (23/125) had multiple stabs. Thirty-nine per cent (49/125) had a PTX <0.5 cm (Group A), 26% (32/125) were ≥ 0.5 to <1 cm (Group B), 19% (24/125) were ≥ 1 to <1.5 cm (Group C) and 15% (20/125) were ≥ 1.5 to <2 cm (Group D). Three per cent of all patients (4/125) eventually required ICDs (one in Group C, three in Group D). All four patients had ICDs in situ for 24 h. The remaining 97% (121/125) were all managed successfully by active clinical observation alone. There were no subsequent readmissions, morbidity or mortality as a direct result of our conservative approach. The selective conservative management of asymptomatic small PTXs from stab injuries is safe if undertaken in the appropriate setting.

  13. Small polarons in 2D perovskites

    KAUST Repository

    Cortecchia, Daniele; Yin, Jun; Birowosuto, Muhammad D.; Lo, Shu-Zee A.; Gurzadyan, Gagik G.; Bruno, Annalisa; Bredas, Jean-Luc; Soci, Cesare

    2017-01-01

    We demonstrate that white light luminescence in two-dimensional (2D) perovskites stems from photoinduced formation of small polarons confined at specific sites of the inorganic framework in the form of self-trapped electrons and holes. We discuss their application in white light emitting devices and X-ray scintillators.

  14. Small polarons in 2D perovskites

    KAUST Repository

    Cortecchia, Daniele

    2017-11-02

    We demonstrate that white light luminescence in two-dimensional (2D) perovskites stems from photoinduced formation of small polarons confined at specific sites of the inorganic framework in the form of self-trapped electrons and holes. We discuss their application in white light emitting devices and X-ray scintillators.

  15. EGF Prevents the Neuroendocrine Differentiation of LNCaP Cells Induced By Serum Deprivation: The Modulator Role of P13K/Akt

    Directory of Open Access Journals (Sweden)

    Rosa M. Martín-Orozco

    2007-08-01

    Full Text Available The primary focus of this investigation was to study the relationship between neuroendocrine (NE differentiation, epidermal growth factor (EGF because both have been implicated in the progression of prostate cancer. For this purpose, we used gefitinib, trastuzumab, which are inhibitors of EGF receptor (EGFR, ErbB2, respectively. EGF prevents NE differentiation induced by androgen depletion. This effect is prevented by gefitinib, which blocks the activation of EGFR, ErbB2, stimulation of mitogen-activated protein kinase (MAPK, cell proliferation induced by EGF. Conversely, trastuzumab does not inhibit the effect of EGF on EGFR phosphorylation, MAPK activity, cell proliferation, NE differentiation, although it reduces ErbB2 levels specifically, suggesting that ErbB2 is not necessary to inhibit NE differentiation. Prevention of NE differentiation by EGF is mediated by a MAPK-dependent mechanism, requires constitutive Akt activation. The abrogation of the PI3K/Akt pathway changes the role of EGF from inhibitor to inductor of NE differentiation. We show that EGFR tyrosine kinase, MAPK, PI3K inhibitors inhibit the cell proliferation stimulated by EGF but induce the acquisition of NE phenotype. Altogether, the present data should be borne in mind when designing new clinical schedules for the treatment of prostate cancer, including the use of ErbB receptors, associated signaling pathway inhibitors.

  16. Relay discovery and selection for large-scale P2P streaming.

    Directory of Open Access Journals (Sweden)

    Chengwei Zhang

    Full Text Available In peer-to-peer networks, application relays have been commonly used to provide various networking services. The service performance often improves significantly if a relay is selected appropriately based on its network location. In this paper, we studied the location-aware relay discovery and selection problem for large-scale P2P streaming networks. In these large-scale and dynamic overlays, it incurs significant communication and computation cost to discover a sufficiently large relay candidate set and further to select one relay with good performance. The network location can be measured directly or indirectly with the tradeoffs between timeliness, overhead and accuracy. Based on a measurement study and the associated error analysis, we demonstrate that indirect measurements, such as King and Internet Coordinate Systems (ICS, can only achieve a coarse estimation of peers' network location and those methods based on pure indirect measurements cannot lead to a good relay selection. We also demonstrate that there exists significant error amplification of the commonly used "best-out-of-K" selection methodology using three RTT data sets publicly available. We propose a two-phase approach to achieve efficient relay discovery and accurate relay selection. Indirect measurements are used to narrow down a small number of high-quality relay candidates and the final relay selection is refined based on direct probing. This two-phase approach enjoys an efficient implementation using the Distributed-Hash-Table (DHT. When the DHT is constructed, the node keys carry the location information and they are generated scalably using indirect measurements, such as the ICS coordinates. The relay discovery is achieved efficiently utilizing the DHT-based search. We evaluated various aspects of this DHT-based approach, including the DHT indexing procedure, key generation under peer churn and message costs.

  17. Small wind turbine purchasing guide : off-grid, residential, farm and small business applications

    International Nuclear Information System (INIS)

    2008-11-01

    Consumer interest in the environment and the economic advantages of using wind power are now driving interest in smaller wind turbines that range from micro battery-charging models to 300 kW tower-mounted turbines. Smaller turbines are also becoming increasingly accessible through major retail outlets. This guide discussed basic issues surrounding the purchasing, selection and installation of smaller wind turbines. Guidance related to site selection, permitting and approvals was provided, as well as recommendations related to maintenance and system performance. Information related to compliance, safety and setback and zoning restrictions was also presented. The guide was divided into 5 chapters: (1) an introduction to small wind turbines, (2) assessing site-specific expectations, (3) purchasing and permitting, (4) installation, operation and maintenance, and (6) a permitting checklist for small wind customers. Financial incentives for defraying the capital costs of small wind turbines were discussed, and guidance for determining electrical requirements was also provided. A glossary was included, as well as a list of local wind energy contractor and dealers. 3 tabs., 10 figs

  18. Composites of ionic liquid and amine-modified SAPO 34 improve CO2 separation of CO2-selective polymer membranes

    Science.gov (United States)

    Hu, Leiqing; Cheng, Jun; Li, Yannan; Liu, Jianzhong; Zhang, Li; Zhou, Junhu; Cen, Kefa

    2017-07-01

    Mixed matrix membranes with ionic liquids and molecular sieve particles had high CO2 permeabilities, but CO2 separation from small gas molecules such as H2 was dissatisfied because of bad interfacial interaction between ionic liquid and molecular sieve particles. To solve that, amine groups were introduced to modify surface of molecular sieve particles before loading with ionic liquid. SAPO 34 was adopted as the original filler, and four mixed matrix membranes with different fillers were prepared on the outer surface of ceramic hollow fibers. Both surface voids and hard agglomerations disappeared, and the surface became smooth after SAPO 34 was modified by amine groups and ionic liquid [P66614][2-Op]. Mixed matrix membranes with composites of amine-modified SAPO 34 and ionic liquid exhibited excellent CO2 permeability (408.9 Barrers) and CO2/H2 selectivity (22.1).

  19. EDDINGTON RATIO DISTRIBUTION OF X-RAY-SELECTED BROAD-LINE AGNs AT 1.0 < z < 2.2

    International Nuclear Information System (INIS)

    Suh, Hyewon; Hasinger, Günther; Steinhardt, Charles; Silverman, John D.; Schramm, Malte

    2015-01-01

    We investigate the Eddington ratio distribution of X-ray-selected broad-line active galactic nuclei (AGNs) in the redshift range 1.0 < z < 2.2, where the number density of AGNs peaks. Combining the optical and Subaru/Fiber Multi Object Spectrograph near-infrared spectroscopy, we estimate black hole masses for broad-line AGNs in the Chandra Deep Field South (CDF-S), Extended Chandra Deep Field South (E-CDF-S), and the XMM-Newton Lockman Hole (XMM-LH) surveys. AGNs with similar black hole masses show a broad range of AGN bolometric luminosities, which are calculated from X-ray luminosities, indicating that the accretion rate of black holes is widely distributed. We find a substantial fraction of massive black holes accreting significantly below the Eddington limit at z ≲ 2, in contrast to what is generally found for luminous AGNs at high redshift. Our analysis of observational selection biases indicates that the “AGN cosmic downsizing” phenomenon can be simply explained by the strong evolution of the comoving number density at the bright end of the AGN luminosity function, together with the corresponding selection effects. However, one might need to consider a correlation between the AGN luminosity and the accretion rate of black holes, in which luminous AGNs have higher Eddington ratios than low-luminosity AGNs, in order to understand the relatively small fraction of low-luminosity AGNs with high accretion rates in this epoch. Therefore, the observed downsizing trend could be interpreted as massive black holes with low accretion rates, which are relatively fainter than less-massive black holes with efficient accretion

  20. Selection of optimal multispectral imaging system parameters for small joint arthritis detection

    Science.gov (United States)

    Dolenec, Rok; Laistler, Elmar; Stergar, Jost; Milanic, Matija

    2018-02-01

    Early detection and treatment of arthritis is essential for a successful outcome of the treatment, but it has proven to be very challenging with existing diagnostic methods. Novel methods based on the optical imaging of the affected joints are becoming an attractive alternative. A non-contact multispectral imaging (MSI) system for imaging of small joints of human hands and feet is being developed. In this work, a numerical simulation of the MSI system is presented. The purpose of the simulation is to determine the optimal design parameters. Inflamed and unaffected human joint models were constructed with a realistic geometry and tissue distributions, based on a MRI scan of a human finger with a spatial resolution of 0.2 mm. The light transport simulation is based on a weighted-photon 3D Monte Carlo method utilizing CUDA GPU acceleration. An uniform illumination of the finger within the 400-1100 nm spectral range was simulated and the photons exiting the joint were recorded using different acceptance angles. From the obtained reflectance and transmittance images the spectral and spatial features most indicative of inflammation were identified. Optimal acceptance angle and spectral bands were determined. This study demonstrates that proper selection of MSI system parameters critically affects ability of a MSI system to discriminate the unaffected and inflamed joints. The presented system design optimization approach could be applied to other pathologies.

  1. [Expression of erythroblastic leukemia viral oncogene homolog 3 (ErbB-3) binding protein-1, matrix metalloproteinases, eplthelial cadherin in adenoid cystic carcinoma and correlation analysis].

    Science.gov (United States)

    Sun, Jian; Yu, You-cheng; Luo, Yi-xi; Tian, Zhen

    2012-12-01

    To investigate the expression of ErbB-3 binding protein-1 (EBP-1), matrix metalloproteinase 9 (MMP-9) and E-cadherin (E-cad) in adenoid cystic carcinoma and their correlation. Immunohistochemistry(PV6000 method) was used to detect EBP-1, MMP-9 and E-cad expression in 66 cases of adenoid cystic carcinoma tissues and matched para-cancerous normal tissues. In this study all cases were successfully followed up. The positive expression rate of EBP-1 in adenoid cystic carcinoma tissues was 85%. EBP-1 expression was significantly correlated to pathological pattern and clinical stage (P correlation between EBP-1 and E-cad expression, and positive correlation between EBP-1 and MMP-9. EBP-1 and its correlation with MMP-9 and E-cad may be used as useful indicators for clinical assessment of tumor biological behavior and prognosis in patients with adenoid cystic carcinoma.

  2. A novel core–shell nanocomposite Ni–Ca@mSiO_2 for benzophenone selective hydrogenation

    International Nuclear Information System (INIS)

    Han, Xue; Feng, Wenhui; Chu, Xiaoning; Chu, Hailong; Niu, Libo; Bai, Guoyi

    2017-01-01

    A novel core–shell nanocomposite Ni–Ca@mSiO_2 was first prepared by a modified Stöber method in this paper. It has a core–shell structure with Ni (about 8 nm in diameter) and Ca as the cores and mesoporous silica as the outer shell, as proven by the transmission electron microscopy. This nanocomposite exhibited good catalytic performance in the selective hydrogenation of benzophenone, with 96.1% conversion and 94.9% selectivity for benzhydrol under relatively mild reaction conditions. It was demonstrated that addition of small amounts of alkaline Ca can not only markedly improve the dispersion of the active species but also tune the acid–base property of this nanocomposite, resulting in the efficient suppression of benzhydrol dehydration to achieve a high selectivity. Furthermore, the core–shell nanocomposite Ni–Ca@mSiO_2 can be recycled four runs without appreciable loss of its initial activity, more stable than the traditional supported nanocatalyst Ni–Ca/mSiO_2. It was suggested that the outer mesoporous silica shell of Ni–Ca@mSiO_2 can prevent both the aggregation and the leaching of the active Ni species, accounting for its relatively good stability.

  3. Novel nonphosphorylated peptides with conserved sequences selectively bind to Grb7 SH2 domain with affinity comparable to its phosphorylated ligand.

    Directory of Open Access Journals (Sweden)

    Dan Zhang

    Full Text Available The Grb7 (growth factor receptor-bound 7 protein, a member of the Grb7 protein family, is found to be highly expressed in such metastatic tumors as breast cancer, esophageal cancer, liver cancer, etc. The src-homology 2 (SH2 domain in the C-terminus is reported to be mainly involved in Grb7 signaling pathways. Using the random peptide library, we identified a series of Grb7 SH2 domain-binding nonphosphorylated peptides in the yeast two-hybrid system. These peptides have a conserved GIPT/K/N sequence at the N-terminus and G/WD/IP at the C-terminus, and the region between the N-and C-terminus contains fifteen amino acids enriched with serines, threonines and prolines. The association between the nonphosphorylated peptides and the Grb7 SH2 domain occurred in vitro and ex vivo. When competing for binding to the Grb7 SH2 domain in a complex, one synthesized nonphosphorylated ligand, containing the twenty-two amino acid-motif sequence, showed at least comparable affinity to the phosphorylated ligand of ErbB3 in vitro, and its overexpression inhibited the proliferation of SK-BR-3 cells. Such nonphosphorylated peptides may be useful for rational design of drugs targeted against cancers that express high levels of Grb7 protein.

  4. Novel anti-HER2 monoclonal antibodies: synergy and antagonism with tumor necrosis factor-α

    Directory of Open Access Journals (Sweden)

    Ceran Ceyhan

    2012-10-01

    Full Text Available Abstract Background One-third of breast cancers display amplifications of the ERBB2 gene encoding the HER2 kinase receptor. Trastuzumab, a humanized antibody directed against an epitope on subdomain IV of the extracellular domain of HER2 is used for therapy of HER2-overexpressing mammary tumors. However, many tumors are either natively resistant or acquire resistance against Trastuzumab. Antibodies directed to different epitopes on the extracellular domain of HER2 are promising candidates for replacement or combinatorial therapy. For example, Pertuzumab that binds to subdomain II of HER2 extracellular domain and inhibits receptor dimerization is under clinical trial. Alternative antibodies directed to novel HER2 epitopes may serve as additional tools for breast cancer therapy. Our aim was to generate novel anti-HER2 monoclonal antibodies inhibiting the growth of breast cancer cells, either alone or in combination with tumor necrosis factor-α (TNF-α. Methods Mice were immunized against SK-BR-3 cells and recombinant HER2 extracellular domain protein to produce monoclonal antibodies. Anti-HER2 antibodies were characterized with breast cancer cell lines using immunofluorescence, flow cytometry, immunoprecipitation, western blot techniques. Antibody epitopes were localized using plasmids encoding recombinant HER2 protein variants. Antibodies, either alone or in combination with TNF-α, were tested for their effects on breast cancer cell proliferation. Results We produced five new anti-HER2 monoclonal antibodies, all directed against conformational epitope or epitopes restricted to the native form of the extracellular domain. When tested alone, some antibodies inhibited modestly but significantly the growth of SK-BR-3, BT-474 and MDA-MB-361 cells displaying ERBB2 amplification. They had no detectable effect on MCF-7 and T47D cells lacking ERBB2 amplification. When tested in combination with TNF-α, antibodies acted synergistically on SK-BR-3 cells

  5. Rapid phospho-turnover by receptor tyrosine kinases impacts downstream signaling and drug binding.

    Science.gov (United States)

    Kleiman, Laura B; Maiwald, Thomas; Conzelmann, Holger; Lauffenburger, Douglas A; Sorger, Peter K

    2011-09-02

    Epidermal growth factor receptors (ErbB1-4) are oncogenic receptor tyrosine kinases (RTKs) that regulate diverse cellular processes. In this study, we combine measurement and mathematical modeling to quantify phospho-turnover at ErbB receptors in human cells and to determine the consequences for signaling and drug binding. We find that phosphotyrosine residues on ErbB1 have half-lives of a few seconds and therefore turn over 100-1000 times in the course of a typical immediate-early response to ligand. Rapid phospho-turnover is also observed for EGF-activated ErbB2 and ErbB3, unrelated RTKs, and multiple intracellular adaptor proteins and signaling kinases. Thus, the complexes formed on the cytoplasmic tail of active receptors and the downstream signaling kinases they control are highly dynamic and antagonized by potent phosphatases. We develop a kinetic scheme for binding of anti-ErbB1 drugs to receptors and show that rapid phospho-turnover significantly impacts their mechanisms of action. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Oasis 2: improved online analysis of small RNA-seq data.

    Science.gov (United States)

    Rahman, Raza-Ur; Gautam, Abhivyakti; Bethune, Jörn; Sattar, Abdul; Fiosins, Maksims; Magruder, Daniel Sumner; Capece, Vincenzo; Shomroni, Orr; Bonn, Stefan

    2018-02-14

    Small RNA molecules play important roles in many biological processes and their dysregulation or dysfunction can cause disease. The current method of choice for genome-wide sRNA expression profiling is deep sequencing. Here we present Oasis 2, which is a new main release of the Oasis web application for the detection, differential expression, and classification of small RNAs in deep sequencing data. Compared to its predecessor Oasis, Oasis 2 features a novel and speed-optimized sRNA detection module that supports the identification of small RNAs in any organism with higher accuracy. Next to the improved detection of small RNAs in a target organism, the software now also recognizes potential cross-species miRNAs and viral and bacterial sRNAs in infected samples. In addition, novel miRNAs can now be queried and visualized interactively, providing essential information for over 700 high-quality miRNA predictions across 14 organisms. Robust biomarker signatures can now be obtained using the novel enhanced classification module. Oasis 2 enables biologists and medical researchers to rapidly analyze and query small RNA deep sequencing data with improved precision, recall, and speed, in an interactive and user-friendly environment. Oasis 2 is implemented in Java, J2EE, mysql, Python, R, PHP and JavaScript. It is freely available at https://oasis.dzne.de.

  7. Effect of spatial inhomogeneities on the membrane surface on receptor dimerization and signal initiation

    Directory of Open Access Journals (Sweden)

    Romica Kerketta

    2016-08-01

    Full Text Available Important signal transduction pathways originate on the plasma membrane, where microdomains may transiently entrap diffusing receptors. This results in a non-random distribution of receptors even in the resting state, which can be visualized as clusters by high resolution imaging methods. Here, we explore how spatial in-homogeneities in the plasma membrane might influence the dimerization and phosphorylation status of ErbB2 and ErbB3, two receptor tyrosine kinases that preferentially heterodimerize and are often co-expressed in cancer. This theoretical study is based upon spatial stochastic simulations of the two-dimensional membrane landscape, where variables include differential distributions and overlap of transient confinement zones (domains for the two receptor species. The in silico model is parameterized and validated using data from single particle tracking experiments. We report key differences in signaling output based on the degree of overlap between domains and the relative retention of receptors in such domains, expressed as escape probability. Results predict that a high overlap of domains, which favors transient co-confinement of both receptor species, will enhance the rate of hetero-interactions. Where domains do not overlap, simulations confirm expectations that homo-interactions are favored. Since ErbB3 is uniquely dependent on ErbB2 interactions for activation of its catalytic activity, variations in domain overlap or escape probability markedly alter the predicted patterns and time course of ErbB3 and ErbB2 phosphorylation. Taken together, these results implicate membrane domain organization as an important modulator of signal initiation, motivating the design of novel experimental approaches to measure these important parameters across a wider range of receptor systems.

  8. Receiver Operating Characteristic (ROC to Determine Cut-Off Points of Biomarkers in Lung Cancer Patients

    Directory of Open Access Journals (Sweden)

    Heidi L. Weiss

    2004-01-01

    Full Text Available The role of biomarkers in disease prognosis continues to be an important investigation in many cancer studies. In order for these biomarkers to have practical application in clinical decision making regarding patient treatment and follow-up, it is common to dichotomize patients into those with low vs. high expression levels. In this study, receiver operating characteristic (ROC curves, area under the curve (AUC of the ROC, sensitivity, specificity, as well as likelihood ratios were calculated to determine levels of growth factor biomarkers that best differentiate lung cancer cases versus control subjects. Selected cut-off points for p185erbB-2 and EGFR membrane appear to have good discriminating power to differentiate control tissues versus uninvolved tissues from patients with lung cancer (AUC = 89% and 90%, respectively; while AUC increased to at least 90% for selected cut-off points for p185erbB-2 membrane, EGFR membrane, and FASE when comparing between control versus carcinoma tissues from lung cancer cases. Using data from control subjects compared to patients with lung cancer, we presented a simple and intuitive approach to determine dichotomized levels of biomarkers and validated the value of these biomarkers as surrogate endpoints for cancer outcome.

  9. FOXP3 is a novel transcriptional repressor for the breast cancer oncogene SKP2

    OpenAIRE

    Zuo, Tao; Liu, Runhua; Zhang, Huiming; Chang, Xing; Liu, Yan; Wang, Lizhong; Zheng, Pan; Liu, Yang

    2007-01-01

    S-phase kinase-associated protein 2 (SKP2) is a component of the E3 ubiquitin ligase SKP1-Cul1-Fbox complex. Overexpression of SKP2 results in cell cycle dysregulation and carcinogenesis; however, the genetic lesions that cause this upregulation are poorly understood. We recently demonstrated that forkhead box P3 (FOXP3) is an X-linked breast cancer suppressor and an important repressor of the oncogene ERBB2/HER2. Since FOXP3 suppresses tumor growth regardless of whether the tumors overexpres...

  10. Technical validation of an RT-qPCR in vitro diagnostic test system for the determination of breast cancer molecular subtypes by quantification of ERBB2, ESR1, PGR and MKI67 mRNA levels from formalin-fixed paraffin-embedded breast tumor specimens.

    Science.gov (United States)

    Laible, Mark; Schlombs, Kornelia; Kaiser, Katharina; Veltrup, Elke; Herlein, Stefanie; Lakis, Sotiris; Stöhr, Robert; Eidt, Sebastian; Hartmann, Arndt; Wirtz, Ralph M; Sahin, Ugur

    2016-07-07

    MammaTyper is a novel CE-marked in vitro diagnostic RT-qPCR assay which assigns routinely processed breast cancer specimens into the molecular subtypes Luminal A-like, Luminal B-like (HER2 positive or negative), HER2 positive (non-luminal) and Triple negative (ductal) according to the mRNA expression of ERBB2, ESR1, PGR and MKI67 and the St Gallen consensus surrogate clinical definition. Until now and regarding formalin-fixed, paraffin-embedded material (FFPE), this has been a task mostly accomplished by immunohistochemistry (IHC). However the discrepancy rates of IHC for the four breast cancer biomarkers are frequently under debate, especially for Ki-67 which carries the highest degree of inter- and even intra-observer variability. Herein we describe a series of studies in FFPE specimens which aim to fully validate the analytical performance of the MammaTyper assay, including the site to site reproducibility of the individual marker measurements. Tumor RNA was extracted with the novel RNXtract RNA extraction kit. Synthetic RNA was used to assess the sensitivity of the RNXtract kit. DNA and RNA specific qPCR assays were used so as to determine analyte specificity of RNXtract. For the assessment of limit of blank, limit of detection, analytical measurement range and PCR efficiency of the MammaTyper kit serial dilutions of samples were used. Analytical precision studies of MammaTyper were built around two different real time PCR platforms and involved breast tumor samples belonging to different subtypes analyzed across multiple sites and under various stipulated conditions. The MammaTyper assay robustness was tested against RNA input variations, alternative extraction methods and tumor cell content. Individual assays were linear up to at least 32.33 and 33.56 Cqs (quantification cycles) for the two qPCR platforms tested. PCR efficiency ranged from 99 to 109 %. In qPCR platform 1, estimates for assay specific inter-site standard deviations (SD) were between 0.14 and

  11. Technical validation of an RT-qPCR in vitro diagnostic test system for the determination of breast cancer molecular subtypes by quantification of ERBB2, ESR1, PGR and MKI67 mRNA levels from formalin-fixed paraffin-embedded breast tumor specimens

    International Nuclear Information System (INIS)

    Laible, Mark; Schlombs, Kornelia; Kaiser, Katharina; Veltrup, Elke; Herlein, Stefanie; Lakis, Sotiris; Stöhr, Robert; Eidt, Sebastian; Hartmann, Arndt; Wirtz, Ralph M.; Sahin, Ugur

    2016-01-01

    MammaTyper is a novel CE-marked in vitro diagnostic RT-qPCR assay which assigns routinely processed breast cancer specimens into the molecular subtypes Luminal A-like, Luminal B-like (HER2 positive or negative), HER2 positive (non-luminal) and Triple negative (ductal) according to the mRNA expression of ERBB2, ESR1, PGR and MKI67 and the St Gallen consensus surrogate clinical definition. Until now and regarding formalin-fixed, paraffin-embedded material (FFPE), this has been a task mostly accomplished by immunohistochemistry (IHC). However the discrepancy rates of IHC for the four breast cancer biomarkers are frequently under debate, especially for Ki-67 which carries the highest degree of inter- and even intra-observer variability. Herein we describe a series of studies in FFPE specimens which aim to fully validate the analytical performance of the MammaTyper assay, including the site to site reproducibility of the individual marker measurements. Tumor RNA was extracted with the novel RNXtract RNA extraction kit. Synthetic RNA was used to assess the sensitivity of the RNXtract kit. DNA and RNA specific qPCR assays were used so as to determine analyte specificity of RNXtract. For the assessment of limit of blank, limit of detection, analytical measurement range and PCR efficiency of the MammaTyper kit serial dilutions of samples were used. Analytical precision studies of MammaTyper were built around two different real time PCR platforms and involved breast tumor samples belonging to different subtypes analyzed across multiple sites and under various stipulated conditions. The MammaTyper assay robustness was tested against RNA input variations, alternative extraction methods and tumor cell content. Individual assays were linear up to at least 32.33 and 33.56 Cqs (quantification cycles) for the two qPCR platforms tested. PCR efficiency ranged from 99 to 109 %. In qPCR platform 1, estimates for assay specific inter-site standard deviations (SD) were between 0.14 and 0

  12. Angiographic diagnosis of hemorrhage tumours of the small intestine

    International Nuclear Information System (INIS)

    Vadon, G.; Ehngloner, L.; Petri, K.

    1980-01-01

    2 angiographic investigations in small intestine tumors, accompanied with hemorrhage are considered. Conclusion is made that the most suitable moment for estimation of small intestine hemorrhage, according to the proper and literature data, is selective angiography. Wide application of the technique for preoperative detection of gastro-inestinal hemorrhage is recommended

  13. Identification of target genes of transcription factor activator protein 2 gamma in breast cancer cells

    International Nuclear Information System (INIS)

    Ailan, He; Shuanglin, Xiang; Xiangwen, Xiao; Daolong, Ren; Lu, Gan; Xiaofeng, Ding; Xi, Qiao; Xingwang, Hu; Rushi, Liu; Jian, Zhang

    2009-01-01

    Activator protein 2 gamma (AP-2γ) is a member of the transcription factor activator protein-2 (AP-2) family, which is developmentally regulated and plays a role in human neoplasia. AP-2γ has been found to be overexpressed in most breast cancers, and have a dual role to inhibit tumor initiation and promote tumor progression afterwards during mammary tumorigensis. To identify the gene targets that mediate its effects, we performed chromatin immunoprecipitation (ChIP) to isolate AP-2γ binding sites on genomic DNA from human breast cancer cell line MDA-MB-453. 20 novel DNA fragments proximal to potential AP-2γ targets were obtained. They are categorized into functional groups of carcinogenesis, metabolism and others. A combination of sequence analysis, reporter gene assays, quantitative real-time PCR, electrophoretic gel mobility shift assays and immunoblot analysis further confirmed the four AP-2γ target genes in carcinogenesis group: ErbB2, CDH2, HPSE and IGSF11. Our results were consistent with the previous reports that ErbB2 was the target gene of AP-2γ. Decreased expression and overexpression of AP-2γ in human breast cancer cells significantly altered the expression of these four genes, indicating that AP-2γ directly regulates them. This suggested that AP-2γ can coordinate the expression of a network of genes, involving in carcinogenesis, especially in breast cancer. They could serve as therapeutic targets against breast cancers in the future

  14. Ultra-small time-delay estimation via a weak measurement technique with post-selection

    International Nuclear Information System (INIS)

    Fang, Chen; Huang, Jing-Zheng; Yu, Yang; Li, Qinzheng; Zeng, Guihua

    2016-01-01

    Weak measurement is a novel technique for parameter estimation with higher precision. In this paper we develop a general theory for the parameter estimation based on a weak measurement technique with arbitrary post-selection. The weak-value amplification model and the joint weak measurement model are two special cases in our theory. Applying the developed theory, time-delay estimation is investigated in both theory and experiments. The experimental results show that when the time delay is ultra-small, the joint weak measurement scheme outperforms the weak-value amplification scheme, and is robust against not only misalignment errors but also the wavelength dependence of the optical components. These results are consistent with theoretical predictions that have not been previously verified by any experiment. (paper)

  15. Genomic selection in small dairy cattle populations

    DEFF Research Database (Denmark)

    Thomasen, Jørn Rind

    on optimization of genomc selction for a small dairy cattle breed such as Danish Jersey. Implementing genetic superior breeding schemes thus requires more accurate genomc predictions. Besides international collaboration, genotyping of cows is an efficient way to obtain more accurate genomic predictions...

  16. [First time revealed small formations of lungs (under 2 cm in diameter). Dynamic follow-up or surgery?

    Science.gov (United States)

    Pavlov, Yu V; Rybin, V K

    To develop the treatment algorithm in patients with first time revealed lung lesions smaller than 2 cm. The study included 110 patients with pathological lung lesions with small dimensions who have been treated in the Burdenko Clinic of Faculty Surgery for the period 1997-2013. All patients underwent surgical removal of lung tissue using different surgical approaches: 44 cases of videothoracoscopic resections, 43 video-assisted minithoracotomies, 23 minithoracotomies. There were 25 patients with lung cancer, 38 cases of benign tumours (hamartoma and tuberculoma) and 10 patients with disseminated tuberculosis thar required special treatment. Small pulmonary formations (from 0.5 to 2 cm) can be removed without morphological verification prior to surgery. Optimal surgical approach should be selected depending on the amount and size of formations. Management of solitary lung formation smaller than 0.5 cm that was newly diagnosed by computed tomography should include dynamic follow-up and performance of computed tomography in 3-6-12 months.

  17. Fluorine-Directed Glycosylation Enables the Stereocontrolled Synthesis of Selective SGLT2 Inhibitors for Type II Diabetes.

    Science.gov (United States)

    Sadurní, Anna; Kehr, Gerald; Ahlqvist, Marie; Wernevik, Johan; Sjögren, Helena Peilot; Kankkonen, Cecilia; Knerr, Laurent; Gilmour, Ryan

    2018-02-26

    Inhibition of the sodium-glucose co-transporters (SGLT1 and SGLT2) is a validated strategy to address the increasing prevalence of type II diabetes mellitus. However, achieving selective inhibition of human SGLT1 or SGLT2 remains challenging. Orally available small molecule drugs based on the d-glucose core of the natural product Gliflozin have proven to be clinically effective in this regard, effectively impeding glucose reabsorption. Herein, we disclose the influence of molecular editing with fluorine at the C2 position of the pyranose ring of Phlorizin analogues Remogliflozin Etabonate and Dapagliflozin (Farxiga ® ) to concurrently direct β-selective glycosylation, as is required for biological efficacy, and enhance aspects of the physicochemical profile. Given the abundance of glycosylated pharmaceuticals in diabetes therapy that contain a β-configured d-glucose nucleus, it is envisaged that this strategy may prove to be expansive. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Contribution of an alveolar cell of origin to the aggressive phenotype of pregnancy-associated breast cancer

    Science.gov (United States)

    Haricharan, Svasti; Hein, Sarah; Dong, Jie; Toneff, Michael; Aina, Olulana; Rao, Pulivarthi H.; Cardiff, Robert; Li, Yi

    2014-01-01

    Pregnancy-associated breast cancers (PABCs) are malignancies diagnosed during pregnancy or up to five years following parturition, and are usually aggressive, stroma-rich, and estrogen receptor/progesterone receptor-negative; but little is known about the cellular origin of PABCs or the mechanisms by which PABCs initiate. Using the RCAS retrovirus to deliver the ErbB2 oncogene into the mammary epithelium of our previous reported MMTV-tva transgenic mice, we detected human PABC-like tumors during pregnancy and lactation but not in involuted mice or in age-matched virgin mice. More importantly, by generating a WAP-tva transgenic line for expression of ErbB2 selectively in WAP+ mammary alveolar cells, we found that the resulting tumors exhibited the hallmarks of PABCs irrespective of the time since pregnancy and even in the absence of pregnancy. These data suggest that PABCs arise preferentially from an alveolar cell population that expands during pregnancy and lactation. This somatic mouse model may also be useful for preclinical testing of new prophylactic and therapeutic strategies against PABC. PMID:24317513

  19. A novel core–shell nanocomposite Ni–Ca@mSiO{sub 2} for benzophenone selective hydrogenation

    Energy Technology Data Exchange (ETDEWEB)

    Han, Xue; Feng, Wenhui; Chu, Xiaoning; Chu, Hailong; Niu, Libo; Bai, Guoyi, E-mail: baiguoyi@hotmail.com [Hebei University, Key Laboratory of Chemical Biology of Hebei Province, College of Chemistry and Environmental Science (China)

    2017-02-15

    A novel core–shell nanocomposite Ni–Ca@mSiO{sub 2} was first prepared by a modified Stöber method in this paper. It has a core–shell structure with Ni (about 8 nm in diameter) and Ca as the cores and mesoporous silica as the outer shell, as proven by the transmission electron microscopy. This nanocomposite exhibited good catalytic performance in the selective hydrogenation of benzophenone, with 96.1% conversion and 94.9% selectivity for benzhydrol under relatively mild reaction conditions. It was demonstrated that addition of small amounts of alkaline Ca can not only markedly improve the dispersion of the active species but also tune the acid–base property of this nanocomposite, resulting in the efficient suppression of benzhydrol dehydration to achieve a high selectivity. Furthermore, the core–shell nanocomposite Ni–Ca@mSiO{sub 2} can be recycled four runs without appreciable loss of its initial activity, more stable than the traditional supported nanocatalyst Ni–Ca/mSiO{sub 2}. It was suggested that the outer mesoporous silica shell of Ni–Ca@mSiO{sub 2} can prevent both the aggregation and the leaching of the active Ni species, accounting for its relatively good stability.

  20. A neuromorphic VLSI device for implementing 2-D selective attention systems.

    Science.gov (United States)

    Indiveri, G

    2001-01-01

    Selective attention is a mechanism used to sequentially select and process salient subregions of the input space, while suppressing inputs arriving from nonsalient regions. By processing small amounts of sensory information in a serial fashion, rather than attempting to process all the sensory data in parallel, this mechanism overcomes the problem of flooding limited processing capacity systems with sensory inputs. It is found in many biological systems and can be a useful engineering tool for developing artificial systems that need to process in real-time sensory data. In this paper we present a neuromorphic hardware model of a selective attention mechanism implemented on a very large scale integration (VLSI) chip, using analog circuits. The chip makes use of a spike-based representation for receiving input signals, transmitting output signals and for shifting the selection of the attended input stimulus over time. It can be interfaced to neuromorphic sensors and actuators, for implementing multichip selective attention systems. We describe the characteristics of the circuits used in the architecture and present experimental data measured from the system.

  1. A Small Molecule-Screening Pipeline to Evaluate the Therapeutic Potential of 2-Aminoimidazole Molecules Against Clostridium difficile

    Directory of Open Access Journals (Sweden)

    Rajani Thanissery

    2018-06-01

    Full Text Available Antibiotics are considered to be the first line of treatment for mild to moderately severe Clostridium difficile infection (CDI in humans. However, antibiotics are also risk factors for CDI as they decrease colonization resistance against C. difficile by altering the gut microbiota and metabolome. Finding compounds that selectively inhibit different stages of the C. difficile life cycle, while sparing the indigenous gut microbiota is important for the development of alternatives to standard antibiotic treatment. 2-aminoimidazole (2-AI molecules are known to disrupt bacterial protection mechanisms in antibiotic resistant bacteria such as Pseudomonas aeruginosa, Acinetobacter baumannii, and Staphylococcus aureus, but are yet to be evaluated against C. difficile. A comprehensive small molecule-screening pipeline was developed to investigate how novel small molecules affect different stages of the C. difficile life cycle (growth, toxin, and sporulation in vitro, and a library of commensal bacteria that are associated with colonization resistance against C. difficile. The initial screening tested the efficacy of eleven 2-AI molecules (compound 1 through 11 against C. difficile R20291 compared to a vancomycin (2 μg/ml control. Molecules were selected for their ability to inhibit C. difficile growth, toxin activity, and sporulation. Further testing included growth inhibition of other C. difficile strains (CD196, M68, CF5, 630, BI9, M120 belonging to distinct PCR ribotypes, and a commensal panel (Bacteroides fragilis, B. thetaiotaomicron, C. scindens, C. hylemonae, Lactobacillus acidophilus, L. gasseri, Escherichia coli, B. longum subsp. infantis. Three molecules compound 1 and 2, and 3 were microbicidal, whereas compounds 4, 7, 9, and 11 inhibited toxin activity without affecting the growth of C. difficile strains and the commensal microbiota. The antimicrobial and anti-toxin effects of 2-AI molecules need to be further characterized for mode of

  2. Selection of radioresistant cells by vitamin A deficiency in a small cell lung cancer cell line

    International Nuclear Information System (INIS)

    Terasaki, Takeo; Shimosato, Yukio; Wada, Makio; Yokota, Jun; Terada, Masaaki

    1990-01-01

    Radiation sensitivity of a human small cell lung cancer cell line, Lu-134-B cells, cultured in serum-supplemented medium and of cells transferred to and cultured in delipidized serum-supplemented (vitamin A-deficient) medium was studied. The cells cultured in serum-supplemented medium showed the phenotype of classic small cell lung cancer sensitive to radiation, while cells transferred to delipidized serum-supplemented medium showed partial squamous cell differentiation and became resistant to radiation. These results suggest that some small cell lung cancer cells in vitro change their morphology and radiosensitivity depending on the culture conditions. The change in radiosensitivity was reproducible, and was not reversible by culture of the radioresistant cells in delipidized serum-supplemented medium with addition of retinoic acid (vitamin A-sufficient medium) for two months, although squamous cells disappeared. Acquisition of radioresistancy was considered to occur as the result of clonal selective growth in delipidized medium of a minor cell population in the original cell culture, based on a study of chromosome number. It was also found that there was no association of myc-family oncogenes with the changes of radiosensitivity in this cell line. (author)

  3. Optimizing the selection of small-town wastewater treatment processes

    Science.gov (United States)

    Huang, Jianping; Zhang, Siqi

    2018-04-01

    Municipal wastewater treatment is energy-intensive. This high energy consumption causes high sewage treatment plant operating costs and increases the energy burden. To mitigate the adverse impacts of China’s development, sewage treatment plants should adopt effective energy-saving technologies. Artificial fortified natural water treatment and use of activated sludge and biofilm are all suitable technologies for small-town sewage treatment. This study features an analysis of the characteristics of small and medium-sized township sewage, an overview of current technologies, and a discussion of recent progress in sewage treatment. Based on this, an analysis of existing problems in municipal wastewater treatment is presented, and countermeasures to improve sewage treatment in small and medium-sized towns are proposed.

  4. RIP-seq of BmAgo2-associated small RNAs reveal various types of small non-coding RNAs in the silkworm, Bombyx mori

    Science.gov (United States)

    2013-01-01

    Background Small non-coding RNAs (ncRNAs) are important regulators of gene expression in eukaryotes. Previously, only microRNAs (miRNAs) and piRNAs have been identified in the silkworm, Bombyx mori. Furthermore, only ncRNAs (50-500nt) of intermediate size have been systematically identified in the silkworm. Results Here, we performed a systematic identification and analysis of small RNAs (18-50nt) associated with the Bombyx mori argonaute2 (BmAgo2) protein. Using RIP-seq, we identified various types of small ncRNAs associated with BmAGO2. These ncRNAs showed a multimodal length distribution, with three peaks at ~20nt, ~27nt and ~33nt, which included tRNA-, transposable element (TE)-, rRNA-, snoRNA- and snRNA-derived small RNAs as well as miRNAs and piRNAs. The tRNA-derived fragments (tRFs) were found at an extremely high abundance and accounted for 69.90% of the BmAgo2-associated small RNAs. Northern blotting confirmed that many tRFs were expressed or up-regulated only in the BmNPV-infected cells, implying that the tRFs play a prominent role by binding to BmAgo2 during BmNPV infection. Additional evidence suggested that there are potential cleavage sites on the D, anti-codon and TψC loops of the tRNAs. TE-derived small RNAs and piRNAs also accounted for a significant proportion of the BmAgo2-associated small RNAs, suggesting that BmAgo2 could be involved in the maintenance of genome stability by suppressing the activities of transposons guided by these small RNAs. Finally, Northern blotting was also used to confirm the Bombyx 5.8 s rRNA-derived small RNAs, demonstrating that various novel small RNAs exist in the silkworm. Conclusions Using an RIP-seq method in combination with Northern blotting, we identified various types of small RNAs associated with the BmAgo2 protein, including tRNA-, TE-, rRNA-, snoRNA- and snRNA-derived small RNAs as well as miRNAs and piRNAs. Our findings provide new clues for future functional studies of the role of small RNAs in insect

  5. Safety, efficacy and pharmacokinetics of neratinib (HKI-272) in Japanese patients with advanced solid tumors: a Phase 1 dose-escalation study.

    Science.gov (United States)

    Ito, Yoshinori; Suenaga, Mitsukuni; Hatake, Kiyohiko; Takahashi, Shunji; Yokoyama, Masahiro; Onozawa, Yusuke; Yamazaki, Kentaro; Hironaka, Shuichi; Hashigami, Kiyoshi; Hasegawa, Hirotaka; Takenaka, Nobuko; Boku, Narikazu

    2012-04-01

    Neratinib (HKI-272), a potent, irreversible, small-molecule, orally administered, pan-ErbB inhibitor that blocks signal transduction via inhibition of three epidermal growth factor receptors [ErbB1, ErbB2 (Her2) and ErbB4], is being developed for the treatment of solid tumors, including breast cancer. This Phase 1 dose-escalation study assessed the safety, tolerability, maximum-tolerated dose, antitumor activity and pharmacokinetics of neratinib in Japanese patients with advanced solid tumors. Patients received neratinib 80, 160, 240 or 320 mg orally; each patient enrolled in only one dose cohort. Patients received a single dose in week 1, followed by daily continuous doses. Blood samples collected were on days 1 and 21 for pharmacokinetic analyses. Twenty-one patients were enrolled (3 breast cancer; 17 colorectal cancer; 1 gastric cancer). Neratinib-related adverse events (all grades) included diarrhea (20 patients), fatigue (14 patients), nausea and abdominal pain (9 patients each) and anorexia (8 patients). Grade ≥3 neratinib-related adverse events in two or more patients were diarrhea and anorexia (two patients each). Dose-limiting toxicities were diarrhea and anorexia (two patients, 320 mg dose). The maximum-tolerated dose and recommended dose was neratinib 240 mg once daily. Of 21 evaluable patients, 2 with breast cancer had partial response, 3 had stable disease ≥24 weeks, 7 had stable disease ≥16 weeks and 9 had progressive disease. Pharmacokinetic analyses indicated that neratinib exposures increased with dose. The safety, efficacy and pharmacokinetic profiles of neratinib are consistent with those reported for non-Japanese patients and warrant further investigation of neratinib in Japanese patients with solid tumors.

  6. Alternative splicing enriched cDNA libraries identify breast cancer-associated transcripts

    Science.gov (United States)

    2010-01-01

    Background Alternative splicing (AS) is a central mechanism in the generation of genomic complexity and is a major contributor to transcriptome and proteome diversity. Alterations of the splicing process can lead to deregulation of crucial cellular processes and have been associated with a large spectrum of human diseases. Cancer-associated transcripts are potential molecular markers and may contribute to the development of more accurate diagnostic and prognostic methods and also serve as therapeutic targets. Alternative splicing-enriched cDNA libraries have been used to explore the variability generated by alternative splicing. In this study, by combining the use of trapping heteroduplexes and RNA amplification, we developed a powerful approach that enables transcriptome-wide exploration of the AS repertoire for identifying AS variants associated with breast tumor cells modulated by ERBB2 (HER-2/neu) oncogene expression. Results The human breast cell line (C5.2) and a pool of 5 ERBB2 over-expressing breast tumor samples were used independently for the construction of two AS-enriched libraries. In total, 2,048 partial cDNA sequences were obtained, revealing 214 alternative splicing sequence-enriched tags (ASSETs). A subset with 79 multiple exon ASSETs was compared to public databases and reported 138 different AS events. A high success rate of RT-PCR validation (94.5%) was obtained, and 2 novel AS events were identified. The influence of ERBB2-mediated expression on AS regulation was evaluated by capillary electrophoresis and probe-ligation approaches in two mammary cell lines (Hb4a and C5.2) expressing different levels of ERBB2. The relative expression balance between AS variants from 3 genes was differentially modulated by ERBB2 in this model system. Conclusions In this study, we presented a method for exploring AS from any RNA source in a transcriptome-wide format, which can be directly easily adapted to next generation sequencers. We identified AS transcripts

  7. Genetic Predictors of Response to Systemic Therapy in Esophagogastric Cancer.

    Science.gov (United States)

    Janjigian, Yelena Y; Sanchez-Vega, Francisco; Jonsson, Philip; Chatila, Walid K; Hechtman, Jaclyn F; Ku, Geoffrey Y; Riches, Jamie C; Tuvy, Yaelle; Kundra, Ritika; Bouvier, Nancy; Vakiani, Efsevia; Gao, Jianjiong; Heins, Zachary J; Gross, Benjamin E; Kelsen, David P; Zhang, Liying; Strong, Vivian E; Schattner, Mark; Gerdes, Hans; Coit, Daniel G; Bains, Manjit; Stadler, Zsofia K; Rusch, Valerie W; Jones, David R; Molena, Daniela; Shia, Jinru; Robson, Mark E; Capanu, Marinela; Middha, Sumit; Zehir, Ahmet; Hyman, David M; Scaltriti, Maurizio; Ladanyi, Marc; Rosen, Neal; Ilson, David H; Berger, Michael F; Tang, Laura; Taylor, Barry S; Solit, David B; Schultz, Nikolaus

    2018-01-01

    The incidence of esophagogastric cancer is rapidly rising, but only a minority of patients derive durable benefit from current therapies. Chemotherapy as well as anti-HER2 and PD-1 antibodies are standard treatments. To identify predictive biomarkers of drug sensitivity and mechanisms of resistance, we implemented prospective tumor sequencing of patients with metastatic esophagogastric cancer. There was no association between homologous recombination deficiency defects and response to platinum-based chemotherapy. Patients with microsatellite instability-high tumors were intrinsically resistant to chemotherapy but more likely to achieve durable responses to immunotherapy. The single Epstein-Barr virus-positive patient achieved a durable, complete response to immunotherapy. The level of ERBB2 amplification as determined by sequencing was predictive of trastuzumab benefit. Selection for a tumor subclone lacking ERBB2 amplification, deletion of ERBB2 exon 16, and comutations in the receptor tyrosine kinase, RAS, and PI3K pathways were associated with intrinsic and/or acquired trastuzumab resistance. Prospective genomic profiling can identify patients most likely to derive durable benefit to immunotherapy and trastuzumab and guide strategies to overcome drug resistance. Significance: Clinical application of multiplex sequencing can identify biomarkers of treatment response to contemporary systemic therapies in metastatic esophagogastric cancer. This large prospective analysis sheds light on the biological complexity and the dynamic nature of therapeutic resistance in metastatic esophagogastric cancers. Cancer Discov; 8(1); 49-58. ©2017 AACR. See related commentary by Sundar and Tan, p. 14 See related article by Pectasides et al., p. 37 This article is highlighted in the In This Issue feature, p. 1 . ©2017 American Association for Cancer Research.

  8. PAM50 Breast Cancer Subtyping by RT-qPCR and Concordance with Standard Clinical Molecular Markers

    Directory of Open Access Journals (Sweden)

    Bastien Roy RL

    2012-10-01

    Full Text Available Abstract Background Many methodologies have been used in research to identify the “intrinsic” subtypes of breast cancer commonly known as Luminal A, Luminal B, HER2-Enriched (HER2-E and Basal-like. The PAM50 gene set is often used for gene expression-based subtyping; however, surrogate subtyping using panels of immunohistochemical (IHC markers are still widely used clinically. Discrepancies between these methods may lead to different treatment decisions. Methods We used the PAM50 RT-qPCR assay to expression profile 814 tumors from the GEICAM/9906 phase III clinical trial that enrolled women with locally advanced primary invasive breast cancer. All samples were scored at a single site by IHC for estrogen receptor (ER, progesterone receptor (PR, and Her2/neu (HER2 protein expression. Equivocal HER2 cases were confirmed by chromogenic in situ hybridization (CISH. Single gene scores by IHC/CISH were compared with RT-qPCR continuous gene expression values and “intrinsic” subtype assignment by the PAM50. High, medium, and low expression for ESR1, PGR, ERBB2, and proliferation were selected using quartile cut-points from the continuous RT-qPCR data across the PAM50 subtype assignments. Results ESR1, PGR, and ERBB2 gene expression had high agreement with established binary IHC cut-points (area under the curve (AUC ≥ 0.9. Estrogen receptor positivity by IHC was strongly associated with Luminal (A and B subtypes (92%, but only 75% of ER negative tumors were classified into the HER2-E and Basal-like subtypes. Luminal A tumors more frequently expressed PR than Luminal B (94% vs 74% and Luminal A tumors were less likely to have high proliferation (11% vs 77%. Seventy-seven percent (30/39 of ER-/HER2+ tumors by IHC were classified as the HER2-E subtype. Triple negative tumors were mainly comprised of Basal-like (57% and HER2-E (30% subtypes. Single gene scoring for ESR1, PGR, and ERBB2 was more prognostic than the corresponding IHC markers as

  9. Catch and size selectivity of small-scale fishing gear for the smooth-hound shark Mustelus mustelus (Linnaeus, 1758 (Chondrichthyes: Triakidae from the Aegean Turkish coast

    Directory of Open Access Journals (Sweden)

    T. CEYHAN

    2010-10-01

    Full Text Available Catch rate, CPUE, biomass ratios and size selectivity from traditional longline and trammel nets of Turkish coastal small-scale fisheries were investigated in order to describe the Smooth-hound shark (Mustelus mustelus fishery. The SELECT method was used to estimate the selectivity parameters of a variety of models for the trammel nets inner panel of 150 and 170 mm mesh sizes. Catch composition and proportion of the species were significantly different in longline and trammel nets. While mean CPUE of longline was 119.2±14.3 kg/1000 hooks, these values for 150 and 170 mm trammel nets were 5.3±1.2 kg/1000 m of net and 12.7±3.9 kg/1000 m of net, respectively. Biomass ratios of the by catch to Smooth-hound catch were found to be 1:0.32 for 150 mm trammel net, 1:0.65 for longline and 1:0.73 for 170 mm trammel net. The estimated modal lengths and spreads were found to be 91.1 and 16.2 cm for 150 mm and 103.2 and 18.4 cm for 170 mm, respectively. The modal lengths of the species as well as the spread values increased with mesh size.

  10. The Role of Notch Signaling Pathway in Breast Cancer Pathogenesis

    Science.gov (United States)

    2005-07-01

    breast cancer cells, I tested whether ErbB2 overexpression will cooperate with Notch in HMLE cells. While overexpression of activated Notch1 failed to...tyrosine kinase upstream of Ras normally found overexpressed in many breast cancers , also failed to transform HMLE cells. These observations suggested...cooperation between Notch1IC and ErbB2 signaling in transforming HMLE cells. Breast cancers typically do not harbor oncogenic Ras mutations; nevertheless

  11. Comprehensive Genomic Profiling Facilitates Implementation of the National Comprehensive Cancer Network Guidelines for Lung Cancer Biomarker Testing and Identifies Patients Who May Benefit From Enrollment in Mechanism-Driven Clinical Trials.

    Science.gov (United States)

    Suh, James H; Johnson, Adrienne; Albacker, Lee; Wang, Kai; Chmielecki, Juliann; Frampton, Garrett; Gay, Laurie; Elvin, Julia A; Vergilio, Jo-Anne; Ali, Siraj; Miller, Vincent A; Stephens, Philip J; Ross, Jeffrey S

    2016-06-01

    The National Comprehensive Cancer Network (NCCN) guidelines for patients with metastatic non-small cell lung cancer (NSCLC) recommend testing for EGFR, BRAF, ERBB2, and MET mutations; ALK, ROS1, and RET rearrangements; and MET amplification. We investigated the feasibility and utility of comprehensive genomic profiling (CGP), a hybrid capture-based next-generation sequencing (NGS) test, in clinical practice. CGP was performed to a mean coverage depth of 576× on 6,832 consecutive cases of NSCLC (2012-2015). Genomic alterations (GAs) (point mutations, small indels, copy number changes, and rearrangements) involving EGFR, ALK, BRAF, ERBB2, MET, ROS1, RET, and KRAS were recorded. We also evaluated lung adenocarcinoma (AD) cases without GAs, involving these eight genes. The median age of the patients was 64 years (range: 13-88 years) and 53% were female. Among the patients studied, 4,876 (71%) harbored at least one GA involving EGFR (20%), ALK (4.1%), BRAF (5.7%), ERBB2 (6.0%), MET (5.6%), ROS1 (1.5%), RET (2.4%), or KRAS (32%). In the remaining cohort of lung AD without these known drivers, 273 cancer-related genes were altered in at least 0.1% of cases, including STK11 (21%), NF1 (13%), MYC (9.8%), RICTOR (6.4%), PIK3CA (5.4%), CDK4 (4.3%), CCND1 (4.0%), BRCA2 (2.5%), NRAS (2.3%), BRCA1 (1.7%), MAP2K1 (1.2%), HRAS (0.7%), NTRK1 (0.7%), and NTRK3 (0.2%). CGP is practical and facilitates implementation of the NCCN guidelines for NSCLC by enabling simultaneous detection of GAs involving all seven driver oncogenes and KRAS. Furthermore, without additional tissue use or cost, CGP identifies patients with "pan-negative" lung AD who may benefit from enrollment in mechanism-driven clinical trials. National Comprehensive Cancer Network guidelines for patients with metastatic non-small cell lung cancer (NSCLC) recommend testing for several genomic alterations (GAs). The feasibility and utility of comprehensive genomic profiling were studied in NSCLC and in lung adenocarcinoma

  12. Small systems at the LHC

    Science.gov (United States)

    Preghenella, Roberto

    2018-02-01

    In these proceedings, I report on a selection of recent LHC results in small systems from ALICE [1], ATLAS [2] and CMS [3] experiments. Due to the fact that the investigation of QCD in small systems at high multiplicity is becoming an increasingly large subject, interesting the heavy-ion community and more in general the high-energy physics community, not all the related topics can be discussed in this paper. The focus will be given to some of the measurements addressing the physics of collective phenomena in small systems and to the recent results on strangeness enhancement in proton-proton collisions. The reader must be informed that a large number of interesting results did not find space in the discussion reported here.

  13. Prey selection of lions Panthera leo in a small, enclosed reserve

    Directory of Open Access Journals (Sweden)

    R.J. Power

    2002-12-01

    Full Text Available Annual trends in numbers of ungulate species on a 15 km² reserve from 1993 to 1998, were evaluated in the context of lion Panthera leo reintroduction during 1996, and subsequent predation by them. The ungulate prey base was enumerated annually by aerial counts and a road count that took place during 1998. The lion prey record was obtained from direct observations of a radio-located pride of eight lions and daily reserve management records. All ungulate species that underwent precipituous declines were also the most important prey to lions, comprising over 80 % of their prey, and they were preyed upon according to their availability. Lion predation was causal for the declines in wildebeest Connochaetes taurinus, Blesbok Damaliscus pygargus phillipsi and Warthog Phacochoerus africana, while the decline in Kudu Tragelaphus strepsiceros was only partly ascribed to lions, as other non-lion related mortality sources were identified. The only ungulate species to increase subsequent to lion reintroduction was the Impala Aepyceros melampus, which was furthermore under-selected by lions. The uncontrolled population growth of Impala could have elicited ecological degradation, and it was advised to either not stock Impala, or otherwise control their numbers if lions are unable to do so. Lion hunting success and kill rate, were 21 % (n = 63 and 1 kill/4.4 days, respectively. Three bushpigs Potamochoerus larvatus were killed but not utilised,and this finding is corroborated by an intensive study in Kwazulu-Natal, and this aversion is discussed. Predators can cause unprecedented declines of their prey where the prey are confined to small reserves that have no refuge from predation. On an annual basis, prey may need to be augmented to sustain predators on small reserves

  14. Design and Discovery of Functionally Selective Serotonin 2C (5-HT2C) Receptor Agonists.

    Science.gov (United States)

    Cheng, Jianjun; McCorvy, John D; Giguere, Patrick M; Zhu, Hu; Kenakin, Terry; Roth, Bryan L; Kozikowski, Alan P

    2016-11-10

    On the basis of the structural similarity of our previous 5-HT 2C agonists with the melatonin receptor agonist tasimelteon and the putative biological cross-talk between serotonergic and melatonergic systems, a series of new (2,3-dihydro)benzofuran-based compounds were designed and synthesized. The compounds were evaluated for their selectivity toward 5-HT 2A , 5-HT 2B , and 5-HT 2C receptors in the calcium flux assay with the ultimate goal to generate selective 5-HT 2C agonists. Selected compounds were studied for their functional selectivity by comparing their transduction efficiency at the G protein signaling pathway versus β-arrestin recruitment. The most functionally selective compound (+)-7e produced weak β-arrestin recruitment and also demonstrated less receptor desensitization compared to serotonin in both calcium flux and phosphoinositide (PI) hydrolysis assays. We report for the first time that selective 5-HT 2C agonists possessing weak β-arrestin recruitment can produce distinct receptor desensitization properties.

  15. Association of Screening and Treatment With Breast Cancer Mortality by Molecular Subtype in US Women, 2000-2012.

    Science.gov (United States)

    Plevritis, Sylvia K; Munoz, Diego; Kurian, Allison W; Stout, Natasha K; Alagoz, Oguzhan; Near, Aimee M; Lee, Sandra J; van den Broek, Jeroen J; Huang, Xuelin; Schechter, Clyde B; Sprague, Brian L; Song, Juhee; de Koning, Harry J; Trentham-Dietz, Amy; van Ravesteyn, Nicolien T; Gangnon, Ronald; Chandler, Young; Li, Yisheng; Xu, Cong; Ergun, Mehmet Ali; Huang, Hui; Berry, Donald A; Mandelblatt, Jeanne S

    2018-01-09

    Given recent advances in screening mammography and adjuvant therapy (treatment), quantifying their separate and combined effects on US breast cancer mortality reductions by molecular subtype could guide future decisions to reduce disease burden. To evaluate the contributions associated with screening and treatment to breast cancer mortality reductions by molecular subtype based on estrogen-receptor (ER) and human epidermal growth factor receptor 2 (ERBB2, formerly HER2 or HER2/neu). Six Cancer Intervention and Surveillance Network (CISNET) models simulated US breast cancer mortality from 2000 to 2012 using national data on plain-film and digital mammography patterns and performance, dissemination and efficacy of ER/ERBB2-specific treatment, and competing mortality. Multiple US birth cohorts were simulated. Screening mammography and treatment. The models compared age-adjusted, overall, and ER/ERBB2-specific breast cancer mortality rates from 2000 to 2012 for women aged 30 to 79 years relative to the estimated mortality rate in the absence of screening and treatment (baseline rate); mortality reductions were apportioned to screening and treatment. In 2000, the estimated reduction in overall breast cancer mortality rate was 37% (model range, 27%-42%) relative to the estimated baseline rate in 2000 of 64 deaths (model range, 56-73) per 100 000 women: 44% (model range, 35%-60%) of this reduction was associated with screening and 56% (model range, 40%-65%) with treatment. In 2012, the estimated reduction in overall breast cancer mortality rate was 49% (model range, 39%-58%) relative to the estimated baseline rate in 2012 of 63 deaths (model range, 54-73) per 100 000 women: 37% (model range, 26%-51%) of this reduction was associated with screening and 63% (model range, 49%-74%) with treatment. Of the 63% associated with treatment, 31% (model range, 22%-37%) was associated with chemotherapy, 27% (model range, 18%-36%) with hormone therapy, and 4% (model range, 1

  16. Design of small centrifugal compressor test model for a supercritical CO2 compressor in the fast reactor power plant

    International Nuclear Information System (INIS)

    Muto, Y.; Ishizuka, T.; Aritomi, M.

    2008-01-01

    In order to clarify the CO 2 compressor performance in the vicinity of critical point, a research project has been started in Tokyo Institute of Technology based on Japanese government fund. This paper describes how fundamental parameters were selected and sizing of a small and high speed impeller of the test centrifugal compressor. The concept of canned type compressor structures provided with high speed electric motor and preliminary aerodynamic performance prediction are also given. (authors)

  17. Modifications and additions to selected TOUGH2 modules

    International Nuclear Information System (INIS)

    Wu, Y.S.; Mishra, A.K.

    1998-01-01

    The purpose of this report is to provide all software baseline documents necessary for the software qualification of the revised versions of the selected TOUGH2 modules, which include single-phase gas (EOS1G), effective continuum method (EOS3/ECM), saturated/unsaturated flow (EOS9), and radionuclide transport (T2R3D) modules of the TOUGH2 code. TOUGH2 is a numerical simulation code for multi-dimensional, coupled fluid and heat flow of multiphase, multicomponent fluid mixtures in porous and fractured media. This report augments the document Software Qualification of Selected TOUGH2 modules. This report contains the following sections: (1) requirement specifications and code development and (2) software validation test plan and results. These sections comprise sequential parts of Software Lifecycle, and should be used in conjunction with the TOUGH User's Guide, TOUGH2 documentation, TOUGH2 Software Qualification, and Software Qualification of Selected TOUGH2 modules. The version of TOUGH2 used with the software being qualified herein is the October 1996 Standard Version 1.2, as qualified in Wu et al. (1996) and housed at the Department of Energy's Energy Science and Technology Software Center (ESTSC) in Oak Ridge, Tennessee

  18. Macrodissection prior to closed system RT-qPCR is not necessary for estrogen receptor and HER2 concordance with IHC/FISH in breast cancer.

    Science.gov (United States)

    Gupta, Swati; Mani, Navin R; Carvajal-Hausdorf, Daniel E; Bossuyt, Veerle; Ho, Kenneth; Weidler, Jodi; Wong, Wendy; Rhees, Brian; Bates, Michael; Rimm, David L

    2018-06-01

    An on-demand, closed RT-qPCR, the GeneXpert (GX) system, has the potential to provide biomarker information in low-resourced settings and elsewhere. We used this system with a research use only version of the Breast Cancer STRAT4 cartridge that measures the mRNA expression levels of ERBB2, ESR1, PGR, and MKi67. Here we evaluated the impact of non-macrodissected (non m-d) versus macrodissected (m-d) samples using STRAT4 on formalin-fixed, paraffin-embedded (FFPE) core needle biopsies. Two cohorts were assessed: (1) 60 FFPE infiltrating ductal carcinoma (IDCA) cases and (2) 20 FFPE IDCA cases with ductal carcinoma in situ (DCIS) with a range of HER2 expression as determined by clinical immunohistochemistry and fluorescence in situ hybridization (IHC/FISH). We observed about half of the core needle biopsy area as invasive tumor in both IDCA (mean = 51.5%) and IDCA with DCIS (mean = 53.5%) cohorts, but also found the mRNA levels were independent of tumor area. We found excellent agreement of the mRNA transcript level between the paired samples, m-d versus non m-d, for ERBB2, ESR1, PGR, and MKi67 for both the IDCA and IDCA with DCIS cohorts. No significant difference (P > 0.99) was observed when we compared the mRNA transcript level between the paired samples m-d versus non m-d. In addition, we noted a significant concordance (P < 0.001) between RT-qPCR and IHC/FISH for HER2-positivity, ER-positivity, and PR-positivity, independent of specimen dissection. These data suggest that mRNA expression for ERBB2, ESR, and PGR is sufficiently low in surrounding tissue cells such that macrodissection is not required for assessment of key breast cancer mRNA markers and is independent of the amount of input tumor. This approach may be valuable in settings lacking pathology expertise or using specimen types, such as fine-needle aspirates, where it may be challenging to separate non-tumor from tumor tissue.

  19. Structure of the Human Dopamine D3 Receptor in Complex with a D2/D3 Selective Antagonist

    Energy Technology Data Exchange (ETDEWEB)

    Chien, Ellen Y.T.; Liu, Wei; Zhao, Qiang; Katritch, Vsevolod; Han, Gye Won; Hanson, Michael A.; Shi, Lei; Newman, Amy Hauck; Javitch, Jonathan A.; Cherezov, Vadim; Stevens, Raymond C. (Cornell); (Scripps); (NIDA); (Columbia); (UCSD); (Receptos)

    2010-11-30

    Dopamine modulates movement, cognition, and emotion through activation of dopamine G protein-coupled receptors in the brain. The crystal structure of the human dopamine D3 receptor (D3R) in complex with the small molecule D2R/D3R-specific antagonist eticlopride reveals important features of the ligand binding pocket and extracellular loops. On the intracellular side of the receptor, a locked conformation of the ionic lock and two distinctly different conformations of intracellular loop 2 are observed. Docking of R-22, a D3R-selective antagonist, reveals an extracellular extension of the eticlopride binding site that comprises a second binding pocket for the aryl amide of R-22, which differs between the highly homologous D2R and D3R. This difference provides direction to the design of D3R-selective agents for treating drug abuse and other neuropsychiatric indications.

  20. MET-2-Dependent H3K9 Methylation Suppresses Transgenerational Small RNA Inheritance.

    Science.gov (United States)

    Lev, Itamar; Seroussi, Uri; Gingold, Hila; Bril, Roberta; Anava, Sarit; Rechavi, Oded

    2017-04-24

    In C. elegans, alterations to chromatin produce transgenerational effects, such as inherited increase in lifespan and gradual loss of fertility. Inheritance of histone modifications can be induced by double-stranded RNA-derived heritable small RNAs. Here, we show that the mortal germline phenotype, which is typical of met-2 mutants, defective in H3K9 methylation, depends on HRDE-1, an argonaute that carries small RNAs across generations, and is accompanied by accumulated transgenerational misexpression of heritable small RNAs. We discovered that MET-2 inhibits small RNA inheritance, and, as a consequence, induction of RNAi in met-2 mutants leads to permanent RNAi responses that do not terminate even after more than 30 generations. We found that potentiation of heritable RNAi in met-2 animals results from global hyperactivation of the small RNA inheritance machinery. Thus, changes in histone modifications can give rise to drastic transgenerational epigenetic effects, by controlling the overall potency of small RNA inheritance. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Overexpression of CD44 accompanies acquired tamoxifen resistance in MCF7 cells and augments their sensitivity to the stromal factors, heregulin and hyaluronan

    Directory of Open Access Journals (Sweden)

    Hiscox Stephen

    2012-10-01

    Full Text Available Abstract Background Acquired resistance to endocrine therapy in breast cancer is a significant problem with relapse being associated with local and/or regional recurrence and frequent distant metastases. Breast cancer cell models reveal that endocrine resistance is accompanied by a gain in aggressive behaviour driven in part through altered growth factor receptor signalling, particularly involving erbB family receptors. Recently we identified that CD44, a transmembrane cell adhesion receptor known to interact with growth factor receptors, is upregulated in tamoxifen-resistant (TamR MCF7 breast cancer cells. The purpose of this study was to explore the consequences of CD44 upregulation in an MCF7 cell model of acquired tamoxifen resistance, specifically with respect to the hypothesis that CD44 may influence erbB activity to promote an adverse phenotype. Methods CD44 expression in MCF7 and TamR cells was assessed by RT-PCR, Western blotting and immunocytochemistry. Immunofluorescence and immunoprecipitation studies revealed CD44-erbB associations. TamR cells (± siRNA-mediated CD44 suppression or MCF7 cells (± transfection with the CD44 gene were treated with the CD44 ligand, hyaluronon (HA, or heregulin and their in vitro growth (MTT, migration (Boyden chamber and wound healing and invasion (Matrigel transwell migration determined. erbB signalling was assessed using Western blotting. The effect of HA on erbB family dimerisation in TamR cells was determined by immunoprecipitation in the presence or absence of CD44 siRNA. Results TamR cells overexpressed CD44 where it was seen to associate with erbB2 at the cell surface. siRNA-mediated suppression of CD44 in TamR cells significantly attenuated their response to heregulin, inhibiting heregulin-induced cell migration and invasion. Furthermore, TamR cells exhibited enhanced sensitivity to HA, with HA treatment resulting in modulation of erbB dimerisation, ligand-independent activation of erbB2

  2. Overexpression of CD44 accompanies acquired tamoxifen resistance in MCF7 cells and augments their sensitivity to the stromal factors, heregulin and hyaluronan

    International Nuclear Information System (INIS)

    Hiscox, Stephen; Gee, Julia; Baruha, Bedanta; Smith, Chris; Bellerby, Rebecca; Goddard, Lindy; Jordan, Nicola; Poghosyan, Zaruhi; Nicholson, Robert I; Barrett-Lee, Peter

    2012-01-01

    Acquired resistance to endocrine therapy in breast cancer is a significant problem with relapse being associated with local and/or regional recurrence and frequent distant metastases. Breast cancer cell models reveal that endocrine resistance is accompanied by a gain in aggressive behaviour driven in part through altered growth factor receptor signalling, particularly involving erbB family receptors. Recently we identified that CD44, a transmembrane cell adhesion receptor known to interact with growth factor receptors, is upregulated in tamoxifen-resistant (TamR) MCF7 breast cancer cells. The purpose of this study was to explore the consequences of CD44 upregulation in an MCF7 cell model of acquired tamoxifen resistance, specifically with respect to the hypothesis that CD44 may influence erbB activity to promote an adverse phenotype. CD44 expression in MCF7 and TamR cells was assessed by RT-PCR, Western blotting and immunocytochemistry. Immunofluorescence and immunoprecipitation studies revealed CD44-erbB associations. TamR cells (± siRNA-mediated CD44 suppression) or MCF7 cells (± transfection with the CD44 gene) were treated with the CD44 ligand, hyaluronon (HA), or heregulin and their in vitro growth (MTT), migration (Boyden chamber and wound healing) and invasion (Matrigel transwell migration) determined. erbB signalling was assessed using Western blotting. The effect of HA on erbB family dimerisation in TamR cells was determined by immunoprecipitation in the presence or absence of CD44 siRNA. TamR cells overexpressed CD44 where it was seen to associate with erbB2 at the cell surface. siRNA-mediated suppression of CD44 in TamR cells significantly attenuated their response to heregulin, inhibiting heregulin-induced cell migration and invasion. Furthermore, TamR cells exhibited enhanced sensitivity to HA, with HA treatment resulting in modulation of erbB dimerisation, ligand-independent activation of erbB2 and EGFR and induction of cell migration

  3. In Search of Small Molecule Inhibitors Targeting the Flexible CK2 Subunit Interface

    Directory of Open Access Journals (Sweden)

    Benoît Bestgen

    2017-02-01

    Full Text Available Protein kinase CK2 is a tetrameric holoenzyme composed of two catalytic (α and/or α’ subunits and two regulatory (β subunits. Crystallographic data paired with fluorescence imaging techniques have suggested that the formation of the CK2 holoenzyme complex within cells is a dynamic process. Although the monomeric CK2α subunit is endowed with a constitutive catalytic activity, many of the plethora of CK2 substrates are exclusively phosphorylated by the CK2 holoenzyme. This means that the spatial and high affinity interaction between CK2α and CK2β subunits is critically important and that its disruption may provide a powerful and selective way to block the phosphorylation of substrates requiring the presence of CK2β. In search of compounds inhibiting this critical protein–protein interaction, we previously designed an active cyclic peptide (Pc derived from the CK2β carboxy-terminal domain that can efficiently antagonize the CK2 subunit interaction. To understand the functional significance of this interaction, we generated cell-permeable versions of Pc, exploring its molecular mechanisms of action and the perturbations of the signaling pathways that it induces in intact cells. The identification of small molecules inhibitors of this critical interaction may represent the first-choice approach to manipulate CK2 in an unconventional way.

  4. Pembrolizumab in the treatment of metastatic non-small-cell lung cancer: patient selection and perspectives

    Directory of Open Access Journals (Sweden)

    Somasundaram A

    2017-01-01

    Full Text Available Ashwin Somasundaram, Timothy F Burns Division of Hematology/Oncology, Department of Medicine, University of Pittsburgh Cancer Institute, Pittsburgh, PA, USA Abstract: Lung cancer is the leading killer of both men and women in the US, and the 5-year survival remains poor. However, the approval of checkpoint blockade immunotherapy has shifted the treatment paradigm and provides hope for improved survival. The ability of non-small-cell lung cancer (NSCLC to evade the host immune system can be overcome by agents such as pembrolizumab (MK-3475/lambrolizumab, which is a monoclonal antibody targeting the programmed death 1 (PD-1 receptor. In early studies, treatment with pembrolizumab led to dramatic and durable responses in select patients (PD-L1+ tumors. This remarkable efficacy lead to approval of pembrolizumab in the second-line setting as response rates were almost doubled compared to standard of care (SOC chemotherapy. Most recently, data in the first-line setting from the KEYNOTE-024 study have redefined the SOC therapy for a selected subset of patients. In patients with ≥50% PD-L1+ tumors, pembrolizumab had a clear progression-free survival and overall survival benefit. Toxicity was mostly immune related and similar to checkpoint blockade toxicities observed in previous studies. The initial approval and subsequent studies of pembrolizumab required and utilized a companion diagnostic test, Dako’s IHC 22C3, to assess PD-L1 status of patients. The evaluation and scoring system of this assay has been used by other companies as a reference to develop their own assays, which may complicate selection of patients. Finally, the impact of pembrolizumab in NSCLC is growing as evidenced by the numerous, ongoing trials open for combinations with chemotherapy, chemoradiation, other immunotherapeutics, immunomodulators, tyrosine kinase inhibitors, PI3K inhibitors, MEK inhibitors, hypomethylating agents, and histone deacetylase inhibitors. Further studies

  5. TG101209, a small molecule JAK2-selective kinase inhibitor potently inhibits myeloproliferative disorder-associated JAK2V617F and MPLW515L/K mutations.

    Science.gov (United States)

    Pardanani, A; Hood, J; Lasho, T; Levine, R L; Martin, M B; Noronha, G; Finke, C; Mak, C C; Mesa, R; Zhu, H; Soll, R; Gilliland, D G; Tefferi, A

    2007-08-01

    JAK2V617F and MPLW515L/K represent recently identified mutations in myeloproliferative disorders (MPD) that cause dysregulated JAK-STAT signaling, which is implicated in MPD pathogenesis. We developed TG101209, an orally bioavailable small molecule that potently inhibits JAK2 (IC(50)=6 nM), FLT3 (IC(50)=25 nM) and RET (IC(50)=17 nM) kinases, with significantly less activity against other tyrosine kinases including JAK3 (IC(50)=169 nM). TG101209 inhibited growth of Ba/F3 cells expressing JAK2V617F or MPLW515L mutations with an IC(50) of approximately 200 nM. In a human JAK2V617F-expressing acute myeloid leukemia cell line, TG101209-induced cell cycle arrest and apoptosis, and inhibited phosphorylation of JAK2V617F, STAT5 and STAT3. Therapeutic efficacy of TG101209 was demonstrated in a nude mouse model. Furthermore, TG101209 suppressed growth of hematopoietic colonies from primary progenitor cells harboring JAK2V617F or MPL515 mutations.

  6. Role of Topoisomerases in Pediatric High Grade Osteosarcomas: TOP2A Gene Is One of the Unique Molecular Biomarkers of Chemoresponse

    Directory of Open Access Journals (Sweden)

    Natacha Entz-Werle

    2013-06-01

    Full Text Available Currently, the treatment of pediatric high-grade osteosarcomas systematically includes one topoisomerase IIα inhibitor. This chemotherapy is usually adapted to the response to the neo-adjuvant therapy after surgery. The current and unique marker of chemoresponsiveness is the percentage of viable residual cells in the surgical resection. This late patient management marker has to be evaluated earlier in the therapeutic history of the patients on initial biopsy. Therefore, new biomarkers, especially those involved in the topoisomerase IIα inhibitor response might be good candidates. Therefore, our study was designed to target TOP1, TOP2A and TOP2B genes in 105 fresh-frozen diagnostic biopsies by allelotyping and real-time quantitative PCR. Our analyses in those pediatric osteosarcomas, homogeneously treated, highlighted the frequent involvement of topo-isomerase genes. The main and most important observation was the statistical link between the presence of TOP2A amplification and the good response to neo-adjuvant chemotherapy. Compared to adult cancers, the 17q21 amplicon, including TOP2A and ERBB2 genes, seems to be differentially implicated in the osteosarcoma chemoresponsiveness. Surprisingly, there is no ERBB2 gene co-amplification and the patients harboring TOP2A amplification tend to show a worse survival, so TOP2A analyses remain a preliminary, but a good molecular approach for the evaluation at diagnosis of pediatric osteosarcoma chemoresponsiveness.

  7. HDAC inhibitors enhance neratinib activity and when combined enhance the actions of an anti-PD-1 immunomodulatory antibody in vivo.

    Science.gov (United States)

    Booth, Laurence; Roberts, Jane L; Poklepovic, Andrew; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Dent, Paul

    2017-10-27

    Patients whose NSCLC tumors become afatinib resistant presently have few effective therapeutic options to extend their survival. Afatinib resistant NSCLC cells were sensitive to clinically relevant concentrations of the irreversible pan-HER inhibitor neratinib, but not by the first generation ERBB1/2/4 inhibitor lapatinib. In multiple afatinib resistant NSCLC clones, HDAC inhibitors reduced the expression of ERBB1/3/4, but activated c-SRC, which resulted in higher total levels of ERBB1/3 phosphorylation. Neratinib also rapidly reduced the expression of ERBB1/2/3/4, c-MET and of mutant K-/N-RAS; K-RAS co-localized with phosphorylated ATG13 and with cathepsin B in vesicles. Combined exposure of cells to [neratinib + HDAC inhibitors] caused inactivation of mTORC1 and mTORC2, enhanced autophagosome and subsequently autolysosome formation, and caused an additive to greater than additive induction of cell death. Knock down of Beclin1 or ATG5 prevented HDAC inhibitors or neratinib from reducing ERBB1/3/4 and K-/N-RAS expression and reduced [neratinib + HDAC inhibitor] lethality. Neratinib and HDAC inhibitors reduced the expression of multiple HDAC proteins via autophagy that was causal in the reduced expression of PD-L1, PD-L2 and ornithine decarboxylase, and increased expression of Class I MHCA. In vivo , neratinib and HDAC inhibitors interacted to suppress the growth of 4T1 mammary tumors, an effect that was enhanced by an anti-PD-1 antibody. Our data support the premises that neratinib lethality can be enhanced by HDAC inhibitors, that neratinib may be a useful therapeutic tool in afatinib resistant NSCLC, and that [neratinib + HDAC inhibitor] exposure facilitates anti-tumor immune responses.

  8. The allele-frequency spectrum in a decoupled Moran model with mutation, drift, and directional selection, assuming small mutation rates.

    Science.gov (United States)

    Vogl, Claus; Clemente, Florian

    2012-05-01

    We analyze a decoupled Moran model with haploid population size N, a biallelic locus under mutation and drift with scaled forward and backward mutation rates θ(1)=μ(1)N and θ(0)=μ(0)N, and directional selection with scaled strength γ=sN. With small scaled mutation rates θ(0) and θ(1), which is appropriate for single nucleotide polymorphism data in highly recombining regions, we derive a simple approximate equilibrium distribution for polymorphic alleles with a constant of proportionality. We also put forth an even simpler model, where all mutations originate from monomorphic states. Using this model we derive the sojourn times, conditional on the ancestral and fixed allele, and under equilibrium the distributions of fixed and polymorphic alleles and fixation rates. Furthermore, we also derive the distribution of small samples in the diffusion limit and provide convenient recurrence relations for calculating this distribution. This enables us to give formulas analogous to the Ewens-Watterson estimator of θ for biased mutation rates and selection. We apply this theory to a polymorphism dataset of fourfold degenerate sites in Drosophila melanogaster. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Gram-scale solution-phase synthesis of selective sodium bicarbonate co-transport inhibitor S0859: in vitro efficacy studies in breast cancer cells.

    Science.gov (United States)

    Larsen, Ann M; Krogsgaard-Larsen, Niels; Lauritzen, Gitte; Olesen, Christina W; Honoré Hansen, Steen; Boedtkjer, Ebbe; Pedersen, Stine F; Bunch, Lennart

    2012-10-01

    Na(+)-coupled HCO(3)(-) transporters (NBCs) mediate the transport of bicarbonate ions across cell membranes and are thus ubiquitous regulators of intracellular pH. NBC dysregulation is associated with a range of diseases; for instance, NBCn1 is strongly up-regulated in a model of ErbB2-dependent breast cancer, a malignant and widespread cancer with no targeted treatment options, and single-nucleotide polymorphisms in NBCn1 genetically link to breast cancer development and hypertension. The N-cyanosulfonamide S0859 has been shown to selectively inhibit NBCs, and its availability on the gram scale is therefore of significant interest to the scientific community. Herein we describe a short and efficient synthesis of S0859 with an overall yield of 45 % from commercially available starting materials. The inhibitory effect of S0859 on recovery of intracellular pH after an acid load was verified in human and murine cancer cell lines in Ringer solutions. However, S0859 binds very strongly to components in plasma, and accordingly, measurements on isolated murine tissues showed no effect of S0859 at concentrations up to 50 μM. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. A multimarker qPCR platform for the characterisation of endometrial cancer.

    Science.gov (United States)

    Supernat, Anna; Łapińska-Szumczyk, Sylwia; Majewska, Hanna; Gulczyński, Jacek; Biernat, Wojciech; Wydra, Dariusz; Zaczek, Anna J

    2014-02-01

    The molecular background of endometrial cancer (EC) has not been fully elucidated. In the present study, we developed a quantitative PCR (qPCR) platform to examine the gene dosages of the potential molecular markers MGB1, TOP2A, ERBB1-4, MYC, CCND1, ESR1 and PI3K. The platform was applied in samples collected from 157 EC patients (stage I-IV) to verify its clinical utility and to examine the diagnostic and prognostic significance of the analysed biomarkers. The gene dosage pattern of the ERBB family and its downstream effectors PI3K and MYC showed particularly strong correlations with clinicopathological data. The ERBB PI3K/Akt pathway was upregulated in 31 (20%) of 156 cases. Activation of the ERBB PI3K/Akt pathway was positively correlated with a higher stage (p=0.001), higher grade (p=0.001), histological type II disease (p=0.0003) and metastases (p=0.02). The implemented hierarchical clustering revealed that cluster 2 was characterised by high copy numbers of the studied genes. Cluster 2 was associated with shorter overall survival (p=0.05). The platform was found to be a fast and simple method for direct analysis of the genes involved in uterine carcinogenesis, making it feasible for EC biology characterisation.

  11. TRAC-PD2 modeling of LOFT and PWR small cold-leg breaks

    International Nuclear Information System (INIS)

    Knight, T.D.; Willcutt, G.J.E. Jr.; Lime, J.F.

    1981-01-01

    The Transient Reactor Analysis Code (TRAC) is being developed at the Los Alamos National Laboratory to provide advanced best-estimate predictions of postulated accidents in light-water reactors. TRAC-PD2, the latest publicly released version of the code, is currently being tested against small-break and other transients in experimental facilities; it is also being used to analyze postulated accidents in commercial power reactors. Calculated results for LOFT small-break experiments are compared to data, and the results from two small-break calculations for two different reactor systems are presented. It is concluded that TRAC-PD2 is useful for the analysis of cold-leg small-break accidents

  12. Hepatic transplantation outcomes for carefully selected cirrhotic patients with hepatocellular carcinoma: experience at a small- to medium-volume centre.

    LENUS (Irish Health Repository)

    Qasim, A

    2012-02-01

    BACKGROUND: Hepatic transplantation outcomes for cirrhotic patients with hepatocellular carcinoma (HCC) at a small- to medium-volume centre are not fully known due to relative novelty of patient selection criteria. AIM: To determine hepatic transplantation outcomes for HCC at a small- to medium-volume centre. Patients and methods Hepatocellular carcinoma patients were listed for transplantation according to the International Guideline and further categorized as those fulfilling or exceeding Milan or University of San Francisco (UCSF) criteria on explanted liver morphology. Outcomes including mortality, retransplantation, and tumour recurrence rate were analysed. RESULTS: Twenty-six patients had HCC and on explanted liver morphology, Milan and UCSF criteria met 15 and 18 patients, respectively. Patients and graft survival at 3 months, 1 and 5 years were 100, 96, 84, and 88, 84, 77%, respectively. Outcomes favoured Milan criteria but did not reach statistical significance. CONCLUSIONS: Hepatic transplantation for HCC at a small-to medium-volume transplant centre had comparable survival outcomes to high-volume centres.

  13. Selective fluorescence quenching of 2,3-diazabicyclo[2.2.2]oct-2-ene by nucleotides.

    Science.gov (United States)

    Marquez, Cesar; Pischel, Uwe; Nau, Werner M

    2003-10-16

    [reaction: see text] The fluorescence quenching of 2,3-diazabicyclo[2.2.2]oct-2-ene (DBO) by nucleotides has been studied. The quenching mechanism was analyzed on the basis of deuterium isotope effects, tendencies for exciplex formation, and the quenching efficiency in the presence of a molecular container (cucurbit[7]uril). Exciplex-induced quenching appears to prevail for adenosine, cytidine, and uridine, while hydrogen abstraction becomes competitive for thymidine and guanosine. Compared to other fluorescent probes, DBO responds very selectively to the type of nucleotide.

  14. Microporous carbonaceous adsorbents for CO2 separation via selective adsorption

    KAUST Repository

    Zhao, Yunfeng; Liu, Xin; Han, Yu

    2015-01-01

    Selective adsorption of CO2 has important implications for many energy and environment-related processes, which require the separation of CO2 from other gases (e.g. N2 and CH4) with high uptakes and selectivity. The development of high

  15. Your fate is in your hands? Handedness, digit ratio (2D:4D), and selection to a national talent development system.

    Science.gov (United States)

    Baker, Joseph; Kungl, Ann-Marie; Pabst, Jan; Strauß, Bernd; Büsch, Dirk; Schorer, Jörg

    2013-01-01

    Over the past decade a small evidence base has highlighted the potential importance of seemingly innocuous variables related to one's hands, such as hand dominance and the relative length of the second and fourth digits (2D:4D ratio), to success in sport. This study compared 2D:4D digit ratio and handedness among handball players selected to advance in a national talent development system with those not selected. Participants included 480 youth handball players (240 females and 240 males) being considered as part of the talent selection programme for the German Youth National team. Hand dominance and digit ratio were compared to age-matched control data using standard t-tests. There was a greater proportion of left-handers compared to the normal population in males but not in females. There was also a lower digit ratio in both females and males. However, there were no differences between those selected for the next stage of talent development and those not selected on either handedness or digit ratio. These results add support for general effects for both digit ratio and handedness in elite handball; however, these factors seem inadequate to explain talent selection decisions at this level.

  16. Selective Assembly of Na,K-ATPase α2β2 Heterodimers in the Heart: DISTINCT FUNCTIONAL PROPERTIES AND ISOFORM-SELECTIVE INHIBITORS.

    Science.gov (United States)

    Habeck, Michael; Tokhtaeva, Elmira; Nadav, Yotam; Ben Zeev, Efrat; Ferris, Sean P; Kaufman, Randal J; Bab-Dinitz, Elizabeta; Kaplan, Jack H; Dada, Laura A; Farfel, Zvi; Tal, Daniel M; Katz, Adriana; Sachs, George; Vagin, Olga; Karlish, Steven J D

    2016-10-28

    The Na,K-ATPase α 2 subunit plays a key role in cardiac muscle contraction by regulating intracellular Ca 2+ , whereas α 1 has a more conventional role of maintaining ion homeostasis. The β subunit differentially regulates maturation, trafficking, and activity of α-β heterodimers. It is not known whether the distinct role of α 2 in the heart is related to selective assembly with a particular one of the three β isoforms. We show here by immunofluorescence and co-immunoprecipitation that α 2 is preferentially expressed with β 2 in T-tubules of cardiac myocytes, forming α 2 β 2 heterodimers. We have expressed human α 1 β 1 , α 2 β 1 , α 2 β 2 , and α 2 β 3 in Pichia pastoris, purified the complexes, and compared their functional properties. α 2 β 2 and α 2 β 3 differ significantly from both α 2 β 1 and α 1 β 1 in having a higher K 0.5 K + and lower K 0.5 Na + for activating Na,K-ATPase. These features are the result of a large reduction in binding affinity for extracellular K + and shift of the E 1 P-E 2 P conformational equilibrium toward E 1 P. A screen of perhydro-1,4-oxazepine derivatives of digoxin identified several derivatives (e.g. cyclobutyl) with strongly increased selectivity for inhibition of α 2 β 2 and α 2 β 3 over α 1 β 1 (range 22-33-fold). Molecular modeling suggests a possible basis for isoform selectivity. The preferential assembly, specific T-tubular localization, and low K + affinity of α 2 β 2 could allow an acute response to raised ambient K + concentrations in physiological conditions and explain the importance of α 2 β 2 for cardiac muscle contractility. The high sensitivity of α 2 β 2 to digoxin derivatives explains beneficial effects of cardiac glycosides for treatment of heart failure and potential of α 2 β 2 -selective digoxin derivatives for reducing cardiotoxicity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Mesostructure-Induced Selectivity in CO2 Reduction Catalysis.

    Science.gov (United States)

    Hall, Anthony Shoji; Yoon, Youngmin; Wuttig, Anna; Surendranath, Yogesh

    2015-12-02

    Gold inverse opal (Au-IO) thin films are active for CO2 reduction to CO with high efficiency at modest overpotentials and high selectivity relative to hydrogen evolution. The specific activity for hydrogen evolution diminishes by 10-fold with increasing porous film thickness, while CO evolution activity is largely unchanged. We demonstrate that the origin of hydrogen suppression in Au-IO films stems from the generation of diffusional gradients within the pores of the mesostructured electrode rather than changes in surface faceting or Au grain size. For electrodes with optimal mesoporosity, 99% selectivity for CO evolution can be obtained at overpotentials as low as 0.4 V. These results establish electrode mesostructuring as a complementary method for tuning selectivity in CO2-to-fuels catalysis.

  18. One-Pot Synthesis of Cu-Nanocluster-Decorated Brookite TiO2 Quasi-Nanocubes for Enhanced Activity and Selectivity of CO2 Photoreduction to CH4.

    Science.gov (United States)

    Jin, Jingpeng; Luo, Jiang; Zan, Ling; Peng, Tianyou

    2017-11-17

    A new kind of metallic Cu-loaded brookite TiO 2 composite, in which Cu nanoclusters with a small size of 1-3 nm are decorated on brookite TiO 2 quasi nanocube (BTN) surfaces (hereafter referred to as Cu-BTN), is synthesized via a one-pot hydrothermal process and then used as photocatalyst for CO 2 reduction. It was found that the decoration of Cu nanoclusters on BTN surfaces can improve the activity and selectivity of CO 2 photoreduction to CH 4 , and 1.5 % Cu-BTN gives a maximum overall photocatalytic activity (150.9 μmol g -1  h -1 ) for CO/CH 4 production, which is ≈11.4 and ≈3.3 times higher than those of pristine BTN (13.2 μmol g -1  h -1 ) and Ag-BTN (45.2 μmol g -1  h -1 ). Moreover, the resultant Cu-BTN products can promote the selective generation of CH 4 as compared to CO due to the number of surface oxygen vacancies and the CO 2 /H 2 O adsorption behavior, which differs from that of the pristine BTN. The present results demonstrate that brookite TiO 2 would be a potential effective photocatalyst for CO 2 photoreduction, and that Cu nanoclusters can act as an inexpensive and efficient co-catalyst alternative to the commonly used noble metals to improve the photoactivity and selectivity for CO 2 reduction to CH 4 . © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Nitrile in the Hole: Discovery of a Small Auxiliary Pocket in Neuronal Nitric Oxide Synthase Leading to the Development of Potent and Selective 2-Aminoquinoline Inhibitors.

    Science.gov (United States)

    Cinelli, Maris A; Li, Huiying; Chreifi, Georges; Poulos, Thomas L; Silverman, Richard B

    2017-05-11

    Neuronal nitric oxide synthase (nNOS) inhibition is a promising strategy to treat neurodegenerative disorders, but the development of nNOS inhibitors is often hindered by poor pharmacokinetics. We previously developed a class of membrane-permeable 2-aminoquinoline inhibitors and later rearranged the scaffold to decrease off-target binding. However, the resulting compounds had decreased permeability, low human nNOS activity, and low selectivity versus human eNOS. In this study, 5-substituted phenyl ether-linked aminoquinolines and derivatives were synthesized and assayed against purified NOS isoforms. 5-Cyano compounds are especially potent and selective rat and human nNOS inhibitors. Activity and selectivity are mediated by the binding of the cyano group to a new auxiliary pocket in nNOS. Potency was enhanced by methylation of the quinoline and by introduction of simple chiral moieties, resulting in a combination of hydrophobic and auxiliary pocket effects that yielded high (∼500-fold) n/e selectivity. Importantly, the Caco-2 assay also revealed improved membrane permeability over previous compounds.

  20. Contribution of an alveolar cell of origin to the high-grade malignant phenotype of pregnancy-associated breast cancer.

    Science.gov (United States)

    Haricharan, S; Hein, S M; Dong, J; Toneff, M J; Aina, O H; Rao, P H; Cardiff, R D; Li, Y

    2014-12-11

    Pregnancy-associated breast cancers (PABCs) are tumors diagnosed during pregnancy or up to 5 years following parturition, and are usually high-grade, connective tissue-rich, and estrogen receptor (ER)/progesterone receptor-negative. Little is known about the cellular origin of PABCs or the mechanisms by which PABCs are initiated. Using the RCAS retrovirus to deliver the ErbB2 oncogene into the mammary epithelium of our previously reported MMTV-tva transgenic mice, we detected high-grade, poorly differentiated, stroma-rich and ER-negative tumors during pregnancy and lactation. These high-grade and stroma-rich tumors were less frequent in involuted mice or in age-matched nulliparous mice. More importantly, by generating a WAP-tva transgenic line for expression of ErbB2 selectively in WAP(+) mammary alveolar cells, we found that tumors had similar morphological phenotypes (high grade, poorly differentiated, stroma-rich and ER-negative), irrespective of the time since pregnancy and even in the absence of pregnancy. These data suggest that PABCs arise preferentially from an alveolar cell population that expands during pregnancy and lactation. This somatic mouse model may also be useful for preclinical testing of new prophylactic and therapeutic strategies against PABC.

  1. Dual-Channel, Molecular-Sieving Core/Shell ZIF@MOF Architectures as Engineered Fillers in Hybrid Membranes for Highly Selective CO2 Separation.

    Science.gov (United States)

    Song, Zhuonan; Qiu, Fen; Zaia, Edmond W; Wang, Zhongying; Kunz, Martin; Guo, Jinghua; Brady, Michael; Mi, Baoxia; Urban, Jeffrey J

    2017-11-08

    A novel core/shell porous crystalline structure was prepared using a large pore metal organic framework (MOF, UiO-66-NH 2 , pore size, ∼ 0.6 nm) as core surrounded by a small pore zeolitic imidazolate framework (ZIF, ZIF-8, pore size, ∼ 0.4 nm) through a layer-by-layer deposition method and subsequently used as an engineered filler to construct hybrid polysulfone (PSF) membranes for CO 2 capture. Compared to traditional fillers utilizing only one type of porous material with rigid channels (either large or small), our custom designed core/shell fillers possess clear advantages via pore engineering: the large internal channels of the UiO-66-NH 2 MOFs create molecular highways to accelerate molecular transport through the membrane, while the thin shells with small pores (ZIF-8) or even smaller pores generated at the interface by the imperfect registry between the overlapping pores of ZIF and MOF enhance molecular sieving thus serving to distinguish slightly larger N 2 molecules (kinetic diameter, 0.364 nm) from smaller CO 2 molecules (kinetic diameter, 0.33 nm). The resultant core/shell ZIF@MOF and as-prepared hybrid PSF membranes were characterized by transmission electron microscopy, X-ray diffraction, wide-angle X-ray scattering, scanning electron microscopy, Fourier transform infrared, thermogravimetric analysis, differential scanning calorimetry, and contact angle tests. The dependence of the separation performance of the membranes on the MOF/ZIF ratio was also studied by varying the number of layers of ZIF coatings. The integrated PSF-ZIF@MOF hybrid membrane (40 wt % loading) with optimized ZIF coating cycles showed improved hydrophobicity and excellent CO 2 separation performance by simultaneously increasing CO 2 permeability (CO 2 permeability of 45.2 barrer, 710% higher than PSF membrane) and CO 2 /N 2 selectivity (CO 2 /N 2 selectivity of 39, 50% higher than PSF membrane), which is superior to most reported hybrid PSF membranes. The strategy of using

  2. The effect of Au on TiO2 catalyzed selective photocatalytic oxidation of cyclohexane

    NARCIS (Netherlands)

    Carneiro, J.T.; Carneiro, Joana T.; Savenije, Tom J.; Moulijn, Jacob A.; Mul, Guido

    2011-01-01

    Gold does not induce visible light activity of anatase Hombikat UV100 in the selective photo-oxidation of cyclohexane, as can be concluded from in situ attenuated total reflectance Fourier transform infrared (ATR-FTIR) measurements. Extremely small conductance values measured at 530 nm in Time

  3. Design, synthesis and characterisation of MAMC as a novel and selective cytochrome P450 2D6 substrate suitable for high throughput screening.

    NARCIS (Netherlands)

    Onderwater, R.C.A.; Venhorst, J.; Commandeur, J.N.M.; Vermeulen, N.P.E.

    1999-01-01

    In this study, a selective substrate for cytochrome P450 2D6 was designed using a small molecule model developed by M. J. De Groot et al. [(1997) Chem. Res. Toxicol. 10, 41-48]. The substrate, 7-methoxy-4- (aminomethyl)coumarin (MAMC), and its putative O-demethylated metabolite 7-

  4. A selective and simplified radioimmunoassay of 25-hydroxyvitamin D3

    International Nuclear Information System (INIS)

    Hummer, L.; Nilas, L.; Tjellesen, L.; Christiansen, C.

    1984-01-01

    A simple, non-chromatographic and selective assay for determination of 250 HD 3 in serum is described. The serum sample is deproteinated with acetonitrile and the supernatant purified over a small prepacked cartridge, Sep-pak. In the eluate from the cartridge, 250 HD 3 is measured by radioimmunoassay. The selectivity of the assay for 250 HD 3 is improved by adding vitamin D 2 to the antiserum; the assay is thus capable of measuring 250 HD 3 in serum samples containing up to a ratio of 250 HD 2 /250 HD 3 equal to 150. The simplicity, speed and the small amount of sample needed (0.5 ml) make this method suitable for use in a routine clinical laboratory. Because of its selectivity for 250 HD 3 the assay is a necessary prerequisite in the further investigation of metabolic discrimination between vitamins D 2 and D 3 . (author)

  5. Ribonucleoprotein organization of eukaryotic RNA. XXXII. U2 small nuclear RNA precursors and their accurate 3' processing in vitro as ribonucleoprotein particles.

    Science.gov (United States)

    Wieben, E D; Nenninger, J M; Pederson, T

    1985-05-05

    Biosynthetic precursors of U2 small nuclear RNA have been identified in cultured human cells by hybrid-selection of pulse-labeled RNA with cloned U2 DNA. These precursor molecules are one to approximately 16 nucleotides longer than mature U2 RNA and contain 2,2,7-trimethylguanosine "caps". The U2 RNA precursors are associated with proteins that react with a monoclonal antibody for antigens characteristic of small nuclear ribonucleoprotein particles. Like previously described precursors of U1 and U4 small nuclear RNAs, the pre-U2 RNAs are recovered in cytoplasmic fractions, although it is not known if this is their location in vivo. The precursors are processed to mature-size U2 RNA when cytoplasmic extracts are incubated in vitro at 37 degrees C. Mg2+ is required but ATP is not. The ribonucleoprotein structure of the pre-U2 RNA is maintained during the processing reaction in vitro, as are the 2,2,7-trimethylguanosine caps. The ribonucleoprotein organization is of major importance, as exogenous, protein-free U2 RNA precursors are degraded rapidly in the in vitro system. Two lines of evidence indicate that the conversion of U2 precursors to mature-size U2 RNA involves a 3' processing reaction. First, the reaction is unaffected by a large excess of mature U2 small nuclear RNP, whose 5' trimethylguanosine caps would be expected to compete for a 5' processing activity. Second, when pre-U2 RNA precursors are first stoichiometrically decorated with an antibody specific for 2,2,7-trimethylguanosine, the extent of subsequent processing in vitro is unaffected. These results provide the first demonstration of a eukaryotic RNA processing reaction in vitro occurring within a ribonucleoprotein particle.

  6. Down-expression of P2RX2, KCNQ5, ERBB3 and SOCS3 through DNA hypermethylation in elderly women with presbycusis.

    Science.gov (United States)

    Bouzid, Amal; Smeti, Ibtihel; Dhouib, Leila; Roche, Magali; Achour, Imen; Khalfallah, Aida; Gibriel, Abdullah Ahmed; Charfeddine, Ilhem; Ayadi, Hammadi; Lachuer, Joel; Ghorbel, Abdelmonem; Petit, Christine; Masmoudi, Saber

    2018-01-31

    Presbycusis, an age-related hearing impairment (ARHI), represents the most common sensory disability in adults. Today, the molecular mechanisms underlying presbycusis remain unclear. This is in particular due to the fact that ARHI is a multifactorial complex disorder resulting from several genomic factors interacting with lifelong cumulative effects of: disease, diet, and environment. Identification of novel biomarkers for presbycusis. We selectively ascertained 18 elderly unrelated women lacking environmental and metabolic risk factors. Subsequently, we screened for methylation map changes in blood samples of women with presbycusis as compared to controls, using reduced representation bisulfite sequencing. We focused on hypermethylated cytosine bases located in gene promoters and the first two exons. To elucidate the related gene expression changes, we performed transcriptomic study using gene expression microarray. Twenty-seven genes, known to be expressed in adult human cochlea, were found in the blood cells to be differentially hypermethylated with significant (p 30%) and down-expressed with fold change >1.2 (FDR presbycusis.

  7. Role of the Rubisco Small Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Spreitzer, Robert Joseph [Univ. of Nebraska, Lincoln, NE (United States)

    2016-11-05

    Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) catalyzes the rate-limiting step of CO2 fixation in photosynthesis. However, it is a slow enzyme, and O2 competes with CO2 at the active site. Oxygenation initiates the photorespiratory pathway, which also results in the loss of CO2. If carboxylation could be increased or oxygenation decreased, an increase in net CO2 fixation would be realized. Because Rubisco provides the primary means by which carbon enters all life on earth, there is much interest in engineering Rubisco to increase the production of food and renewable energy. Rubisco is located in the chloroplasts of plants, and it is comprised of two subunits. Much is known about the chloroplast-gene-encoded large subunit (rbcL gene), which contains the active site, but much less is known about the role of the nuclear-gene-encoded small subunit in Rubisco function (rbcS gene). Both subunits are coded by multiple genes in plants, which makes genetic engineering difficult. In the eukaryotic, green alga Chlamydomonas reinhardtii, it has been possible to eliminate all the Rubisco genes. These Rubisco-less mutants can be maintained by providing acetate as an alternative carbon source. In this project, focus has been placed on determining whether the small subunit might be a better genetic-engineering target for improving Rubisco. Analysis of a variable-loop structure (βA-βB loop) of the small subunit by genetic selection, directed mutagenesis, and construction of chimeras has shown that the small subunit can influence CO2/O2 specificity. X-ray crystal structures of engineered chimeric-loop enzymes have indicated that additional residues and regions of the small subunit may also contribute to Rubisco function. Structural dynamics of the small-subunit carboxyl terminus was also investigated. Alanine-scanning mutagenesis of the most-conserved small-subunit residues has identified a

  8. Diffusion-weighted magnetic resonance imaging combined with T2-weighted images in the detection of small breast cancer: a single-center multi-observer study.

    Science.gov (United States)

    Wu, Lian-Ming; Chen, Jie; Hu, Jiani; Gu, Hai-Yan; Xu, Jian-Rong; Hua, Jia

    2014-02-01

    Breast cancer is the most common cancer in women worldwide. However, it remains a difficult diagnosis problem to differentiate between benign and malignant breast lesions, especially in small early breast lesions. To assess the diagnostic value of diffusion-weighted imaging (DWI) combined with T2-weighted imaging (T2WI) for small breast cancer characterization. Fifty-eight patients (65 lesions) with a lesion breast magnetic resonance imaging (MRI) including DWI and histological analysis. Three observers with varying experience levels reviewed MRI. The probability of breast cancer in each lesion on MR images was recorded with a 5-point scale. Areas under the receiver-operating characteristic curve (AUCs) were compared by using the Z test; sensitivity and specificity were determined with the Z test after adjusting for data clustering. AUC of T2WI and DWI (Observer 1, 0.95; Observer 2, 0.91; Observer 3, 0.83) was greater than that of T2WI (Observer 1, 0.80; Observer 2, 0.74; Observer 3, 0.70) for all observers (P breast cancer characterization. It should be considered selectively in the preoperative evaluation of patients with small lesions of the breast.

  9. Synthesis, characterization, and application of Zn(NH 3)(CO3) for selective adsorptive separation of CO2

    Science.gov (United States)

    Khazeni, Naasser

    This study explores the potential of Zn(NH3)(CO3) for selective CO2 separation. It develops a novel, highly controllable, single-pot synthesis approach based on urea hydrolysis and solvothermal aging to increase the feasibility of synthesizing Zn(NH3)(CO3), determines the structure of Zn(NH3)(CO3) in detail through single crystal X-ray diffraction and powder X-ray diffraction analyses, and performs adsorption analyses for the compound using CO2, N 2, H2, O2, and CH4 as adsorptives. Through adsorptive characterization, a systematic adsorbent selection screening is performed to assess the potential application of Zn(NH3)(CO 3) for adsorptive separation of CO2 from an upstream gas mixture of power generation, hydrogen production, and natural gas industries. Structural analysis shows Zn(NH3)(CO3) to have an inorganic helical framework that consists of a small helix of (ZnOCO) 2 and a large helix of (ZnOCO)4 with two ammines (NH 3) pendant from every other zinc. In terms of adsorption capacity and CO2 selectivity, Zn(NH3)(CO3) adsorbed 0.550 mmole/g CO2 at 293 K and 4500 mmHg, but only 0.047 mmole/g N 2, 0.084 mmole/g H2, 0.207 mmole/g 02, and 0.060 mmole/g CH4 at the same temperature and pressure. This behavior demonstrates considerable equilibrium selectivities - 36, 31, 63, and 11 - for separating CO2 from CH4, CO2 from H 2, CO2 from N2, and CO2 from 02, respectively. During adsorption, the pendant ammines act as the gates of check-valves: applied pressure opens the gates for adsorption; and during desorption, the gates are closed, trapping the adsorbates, until a reduction of pressure to near-atmospheric levels. Therefore, Zn(NH3)(CO3) exhibits low-pressure H3 or H4 hysteresis, indicating that the Zn(NH3)(CO3) framework can achieve gas storage at near-atmospheric pressures. Additionally, the compound proves structurally stable, with an adsorption decrease of 0.8% after 20 adsorption/desorption cycles - a factor that, considered with the other characteristics of Zn

  10. Biofuels from stumps and small roundwood - Costs and CO{sub 2} benefits

    Energy Technology Data Exchange (ETDEWEB)

    Eriksson, Lisa Naeslund; Gustavsson, Leif [Ecotechnology, Department of Engineering, Physics and Mathematics, Mid Sweden University, SE-831 25 Oestersund (Sweden)

    2008-10-15

    In this study, we analysed and compared costs, primary energy use and CO{sub 2} benefits of recovering stumps and small roundwood from thinnings, together with logging residues. Small roundwood, chipped at a terminal or end-user, has a cost comparable to the chip system and a primary energy use comparable to the bundle system used for recovery of logging residues. The small roundwood system with roadside chipping is more expensive. As productivity in the cutting process improves, the small roundwood alternatives become more cost-effective. The stump system has costs in the same range as or lower than the chip and bundle systems. Forestry operations for stump and small roundwood recovery require considerable primary energy, but net recovery per hectare is much greater than for the chip and bundle systems, which means that more fossil fuel can be displaced per hectare of clearcut than with a chip or a bundle system. Stumps and small roundwood from thinnings can become as cost-effective as logging residues in the near future. Furthermore, when stumps and small roundwood from thinnings are also used to replace fossil fuels, the potential CO{sub 2} reduction will be about four times as great as when only logging residues are used with a traditional chip system. (author)

  11. Use of TOUGH2 on small computers

    Energy Technology Data Exchange (ETDEWEB)

    Antunez, E.; Pruess, K.; Moridis, G. [Lawrence Berkeley Laboratory, CA (United States)

    1995-03-01

    TOUGH2/PC has been tested extensively on different PC platforms (486-33, 486-66, Pentium-90), with encouraging results. TOUGH2 performance has also been tested in other 32-bit computers as the MacIntosh Quadra 800, and a workstation IBM RISC 6000. Results obtained with these machines are compared with PCs` performance. PC results for 3-D geothermal reservoir models are discussed, including: (a) a Cartesian; and (b) a geothermal reservoir model with 1,411 irregular grid blocks. Also discussed are the results of the TOUGH2-compiler performance tests conducted on small computer systems. Code modifications required to operate on 32-bit computers and its setup in each machine environment are described. It is concluded that in today`s market PCs provide the best price/performance alternative to conduct TOUGH2 numerical simulations.

  12. Eu(III)-functionalized MIL-124 as fluorescent probe for highly selectively sensing ions and organic small molecules especially for Fe(III) and Fe(II).

    Science.gov (United States)

    Xu, Xiao-Yu; Yan, Bing

    2015-01-14

    A layerlike MOF (MIL-124, orGa2(OH)4(C9O6H4)) has been prepared and chosen as a parent compound to encapsulate Eu(3+) cations by one uncoordinated carbonyl group in its pores. The Eu(3+)-incorporated sample (Eu(3+)@MIL-124) is fully characterized, which shows excellent luminescence and good fluorescence stability in water or other organic solvents. Subsequently, we choose Eu(3+)@MIL-124 as sensitive probe for sensing metal ions, anions, and organic small molecules because of its robust framework. Studying of the luminescence properties reveals that the complex Eu(3+)@MIL-124 was developed as a highly selective and sensitive probe for detection of Fe(3+) (detection limit, 0.28 μM) and Fe(2+) ions through fluorescence quenching of Eu(3+) and MOF over other metal ions. In connection to this, a probable sensing mechanism was also discussed in this paper. In addition, when Eu(3+)@MIL-124 was immersed in the different anions solutions and organic solvents, it also shows highly selective for Cr2O7(2-)(detection limit, 0.15 μM)and acetone. Remarkably, it is the first Eu-doped MOF to exhibit an excellent ability for the detection of Fe(3+) and Fe(2+) in an aqueous environment without any structural disintegration of the framework.

  13. Experimental technique of small angle neutron scattering

    International Nuclear Information System (INIS)

    Xia Qingzhong; Chen Bo

    2006-03-01

    The main parts of Small Angle Neutron Scattering (SANS) spectrometer, and their function and different parameters are introduced from experimental aspect. Detailed information is also introduced for SANS spectrometer 'Membrana-2'. Based on practical experiments, the fundamental requirements and working condition for SANS experiments, including sample preparation, detector calibration, standard sample selection and data preliminary process are described. (authors)

  14. Allosteric Inhibition of SHP2: Identification of a Potent, Selective, and Orally Efficacious Phosphatase Inhibitor

    Energy Technology Data Exchange (ETDEWEB)

    Fortanet, Jorge Garcia; Chen, Christine Hiu-Tung; Chen, Ying-Nan P.; Chen, Zhouliang; Deng, Zhan; Firestone, Brant; Fekkes, Peter; Fodor, Michelle; Fortin, Pascal D.; Fridrich, Cary; Grunenfelder, Denise; Ho, Samuel; Kang, Zhao B.; Karki, Rajesh; Kato, Mitsunori; Keen, Nick; LaBonte, Laura R.; Larrow, Jay; Lenoir, Francois; Liu, Gang; Liu, Shumei; Lombardo, Franco; Majumdar, Dyuti; Meyer, Matthew J.; Palermo, Mark; Perez, Lawrence; Pu, Minying; Ramsey, Timothy; Sellers, William R.; Shultz, Michael D.; Stams, Travis; Towler, Christopher; Wang, Ping; Williams, Sarah L.; Zhang, Ji-Hu; LaMarche, Matthew J. (Novartis)

    2016-09-08

    SHP2 is a nonreceptor protein tyrosine phosphatase (PTP) encoded by the PTPN11 gene involved in cell growth and differentiation via the MAPK signaling pathway. SHP2 also purportedly plays an important role in the programmed cell death pathway (PD-1/PD-L1). Because it is an oncoprotein associated with multiple cancer-related diseases, as well as a potential immunomodulator, controlling SHP2 activity is of significant therapeutic interest. Recently in our laboratories, a small molecule inhibitor of SHP2 was identified as an allosteric modulator that stabilizes the autoinhibited conformation of SHP2. A high throughput screen was performed to identify progressable chemical matter, and X-ray crystallography revealed the location of binding in a previously undisclosed allosteric binding pocket. Structure-based drug design was employed to optimize for SHP2 inhibition, and several new protein–ligand interactions were characterized. These studies culminated in the discovery of 6-(4-amino-4-methylpiperidin-1-yl)-3-(2,3-dichlorophenyl)pyrazin-2-amine (SHP099, 1), a potent, selective, orally bioavailable, and efficacious SHP2 inhibitor.

  15. Technological transfer. 2. Through developing small businesses

    Energy Technology Data Exchange (ETDEWEB)

    Berrie, T W; Leslie, D

    1978-12-01

    The transfer of small businesses to developing countries is proposed as the most effective way to build upon existing capabilities and small resources while benefiting the largest number of people. Labor-intensive small businesses require little capital investment and can bring immediate progress to both urban and rural areas. One drawback to this approach is the need for organizational effort by the government, although the Civil Service in India has been able to fill this function. Small businesses can be promoted through tax exemptions or benefits, the restriction of some manufacturing to small-scale industries, and government support of equipment research. This approach is less disruptive of social patterns and lifestyles than urbanization and its associated costs while still providing the opportunity for an improved standard of living. Electrification can be handled at the village level with diesel generators or by central power plants, although consumer cooperatives have worked better than the small business concept in this area.

  16. CO2-impacts of a small-scale consumers levy

    International Nuclear Information System (INIS)

    1995-02-01

    Because of a number of developments (altered budgets of Dutch ministries and implementation of environmental policy plans of energy distribution companies in the Netherlands) the 1993 analyses of the effects of a small-scale consumer levy on the emission of CO 2 are updated. First, attention is paid to the conservation impetus as a result of an increase of the energy price for small-scale consumers. Next, the effects that can occur as a consequence of the presently suggested form of the levy (in particular, the exemption of renewable energy and waste heat) are discussed. Subsequently, the alterations of other policy tools, that are necessary in case a higher effectiveness of conservation measures is realized, are dealt with. The direct effect of a higher energy price on the saving behavior of the small-scale consumers is calculated by means of the CENECA-model. 4 tabs., 1 appendix, 8 refs

  17. Trastuzumab Resistance: Role for Notch Signaling

    Directory of Open Access Journals (Sweden)

    Kinnari Mehta

    2009-01-01

    Full Text Available Epidermal growth factor receptor-2 (ErbB-2/HER2 is a potent breast oncogene that has been shown to be amplified in 20% of breast cancers. Overexpression of ErbB-2 predicts for aggressive tumor behavior, resistance to some cytotoxic and antihormonal therapies, and poor overall survival. Trastuzumab, the humanized, monoclonal antibody directed against ErbB-2 has shown tremendous efficacy and improved overall survival for women when combined with a taxane-based chemotherapy. However, resistance to trastuzumab remains a major concern, most notably in women with metastatic breast cancer. Numerous mechanisms that include overexpression of alternate receptor tyrosine kinases and/or loss of critical tumor suppressors have been proposed in the last several years to elucidate trastuzumab resistance. Here we review the many possible mechanisms of action that could contribute to resistance, and novel therapies to prevent or reverse the resistant phenotype. Moreover, we provide a critical role for Notch signaling cross-talk with overlapping or new signaling networks in trastuzumab-resistant breast.

  18. Selective detection of Co2+ by fluorescent nano probe: Diagnostic approach for analysis of environmental samples and biological activities

    Science.gov (United States)

    Mahajan, Prasad G.; Dige, Nilam C.; Desai, Netaji K.; Patil, Shivajirao R.; Kondalkar, Vijay V.; Hong, Seong-Karp; Lee, Ki Hwan

    2018-06-01

    Nowadays scientist over the world are engaging to put forth improved methods to detect metal ion in an aqueous medium based on fluorescence studies. A simple, selective and sensitive method was proposed for detection of Co2+ ion using fluorescent organic nanoparticles. We synthesized a fluorescent small molecule viz. 4,4‧-{benzene-1,4-diylbis-[(Z)methylylidenenitrilo]}dibenzoic acid (BMBA) to explore its suitability as sensor for Co2+ ion and biocompatibility in form of nanoparticles. Fluorescence nanoparticles (BMBANPs) prepared by simple reprecipitation method. Aggregation induced enhanced emission of BMBANPs exhibits the narrower particle size of 68 nm and sphere shape morphology. The selective fluorescence quenching was observed by addition of Co2+ and does not affected by presence of other coexisting ion solutions. The photo-physical properties, viz. UV-absorption, fluorescence emission, and lifetime measurements are in support of ligand-metal interaction followed by static fluorescence quenching phenomenon in emission of BMBANPs. Finally, we develop a simple analytical method for selective and sensitive determination of Co2+ ion in environmental samples. The cell culture E. coli, Bacillus sps., and M. tuberculosis H37RV strain in the vicinity of BMBANPs indicates virtuous anti-bacterial and anti-tuberculosis activity which is of additional novel application shown by prepared nanoparticles.

  19. Controlling selectivities in CO2 reduction through mechanistic understanding

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Xiang; Shi, Hui; Szanyi, János

    2017-09-11

    Catalytic CO2 conversion to energy carriers and intermediates is of utmost importance to energy and environmental goals. However, the lack of fundamental understanding of the reaction mechanism renders designing a selective catalyst inefficient. We performed operando FTIR/SSITKA experiments to understand the correlation between the kinetics of product formation and that of surface species conversion during CO2 reduction over Pd/Al2O3 catalysts. We found that the rate-determining step for CO formation is the conversion of adsorbed formate, while that for CH4 formation is the hydrogenation of adsorbed carbonyl. The balance of the hydrogenation kinetics between adsorbed formates and carbonyls governs the selectivities to CH4 and CO. We demonstrated how this knowledge can be used to design catalysts to achieve high selectivities to desired products.

  20. DREW-UCLA Breast Cancer Research and Training Program: Molecular/Cellular Pathogenesis Model

    Science.gov (United States)

    2007-03-01

    RHS1764-9209568) were designed corresponding to nucleotides 575 to 595 of the coding region (gccctggccgtgctagacaat) of Homo sapiens ERBB2 transcript...variant 1, mRNA sequence (NM_004448, NCBI database), and 2896 to 2917 of the coding region (gctgaactggtgtatgcagatt) of Homo sapiens ERBB2, transcript...responsible for alanine transport. Springer Apoptosis (2007) 12:593–612 599 * T ra n sp o rt V el o ci ty (n m o l/m g p ro te in /m in ) 0.0 0.5 1.0

  1. Tuning of CO2 Reduction Selectivity on Metal Electrocatalysts.

    Science.gov (United States)

    Wang, Yuhang; Liu, Junlang; Wang, Yifei; Al-Enizi, Abdullah M; Zheng, Gengfeng

    2017-11-01

    Climate change, caused by heavy CO 2 emissions, is driving new demands to alleviate the rising concentration of atmospheric CO 2 levels. Enlightened by the photosynthesis of green plants, photo(electro)chemical catalysis of CO 2 reduction, also known as artificial photosynthesis, is emerged as a promising candidate to address these demands and is widely investigated during the past decade. Among various artificial photosynthetic systems, solar-driven electrochemical CO 2 reduction is widely recognized to possess high efficiencies and potentials for practical application. The efficient and selective electroreduction of CO 2 is the key to the overall solar-to-chemical efficiency of artificial photosynthesis. Recent studies show that various metallic materials possess the capability to play as electrocatalysts for CO 2 reduction. In order to achieve high selectivity for CO 2 reduction products, various efforts are made including studies on electrolytes, crystal facets, oxide-derived catalysts, electronic and geometric structures, nanostructures, and mesoscale phenomena. In this Review, these methods for tuning the selectivity of CO 2 electrochemical reduction of metallic catalysts are summarized. The challenges and perspectives in this field are also discussed. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Studies of S-CO{sub 2} Power Plant Pipe Design for Small Modular Sodium-cooled Fast Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Min Seok; Ahn, Yoon Han; Lee, Jeong Ik [Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of)

    2014-10-15

    If SFR can be developed into the economical small modular reactor (SMR) for an export from Korea, the expected value can be greater. However, current SFR design may face difficulty in public acceptance due to the potential hazard from sodium-water reaction (SWR) when the current conventional steam Rankine cycle is utilized as a power conversion system for a SFR. In order to eliminate SWR, the Supercritical CO{sub 2} (S-CO{sub 2}) cycle has been proposed. Although there are many researches on S-CO{sub 2} cycle concept and turbomachinery, very few research works considered pipe selection criteria for the S-CO{sub 2} cycle. As one of the most important parts of the plant, this paper will discuss how to select a suitable pipe considering thermal expansion for the S-CO{sub 2} power plant and perform a conceptual design of SFR type SMR. The S-CO{sub 2} cycle can improve the safety of SFR as preventing the SWR by changing the working fluid. Additionally, not only the relatively high efficiency with 450-750 .deg. C turbine inlet temperature, but also the physically compact footprint are advantages of the S-CO{sub 2} cycle. However the pipe design is more complicated than existing power plant because it has high pressure and temperature conditions and needs high mass flow rate. By designing the piping system for a small modular -SFR, the compactness and simplicity of the S-CO{sub 2} cycle are re-confirmed. Moreover, in this paper, realistic and safe pipe design was conducted by considering thermal expansion in the high pressure and temperature conditions. Although total pipe pressure drop is somewhat high, the cycle thermal efficiency is still higher than the existing steam Rankine cycle. Additional study for a larger system such as 300MW class system in MIT report will be conducted in the future study. From the preliminary estimation when the S-CO{sub 2} system becomes large, the pipe diameter may exceed the current ASME standard. This means that more innovative approach

  3. Highly selective sieving of small gas molecules by using an ultra-microporous metal–organic framework membrane

    KAUST Repository

    Kang, Zixi; Xue, Ming; Fan, Lili; Huang, Lin; Guo, Lijia; Wei, Guoying; Chen, Banglin; Qiu, Shilun

    2014-01-01

    © 2014 The Royal Society of Chemistry. Two tailor-made microporous metal-organic framework (MOF) membranes were successfully fabricated on nickel screens by secondary growth. The effect of pore structures on gas separation was examined by means of single and binary gas permeation tests. The MOF JUC-150 membrane with its ultra-micropores showed marked preferential permeance to H2 relative to other gas molecules. The selectivity factors of this membrane were 26.3, 17.1 and 38.7 for H2/CH4, H2/N2 and H2/CO2, respectively, at room temperature. To the best of our knowledge, these values represent unprecedentedly high separation selectivity among those for all MOF membranes reported to date. The JUC-150 membrane also shows high thermal stability and outstanding separation performance at a high temperature of 200 °C. The separation performance of these membranes persists even after more than 1 year exposure to air. The superiority of the tailored pore size, high selectivity for H2 over other gases, significant stability and recyclability make these materials potential candidates for industrial H2 recycling applications.

  4. Highly selective sieving of small gas molecules by using an ultra-microporous metal–organic framework membrane

    KAUST Repository

    Kang, Zixi

    2014-09-12

    © 2014 The Royal Society of Chemistry. Two tailor-made microporous metal-organic framework (MOF) membranes were successfully fabricated on nickel screens by secondary growth. The effect of pore structures on gas separation was examined by means of single and binary gas permeation tests. The MOF JUC-150 membrane with its ultra-micropores showed marked preferential permeance to H2 relative to other gas molecules. The selectivity factors of this membrane were 26.3, 17.1 and 38.7 for H2/CH4, H2/N2 and H2/CO2, respectively, at room temperature. To the best of our knowledge, these values represent unprecedentedly high separation selectivity among those for all MOF membranes reported to date. The JUC-150 membrane also shows high thermal stability and outstanding separation performance at a high temperature of 200 °C. The separation performance of these membranes persists even after more than 1 year exposure to air. The superiority of the tailored pore size, high selectivity for H2 over other gases, significant stability and recyclability make these materials potential candidates for industrial H2 recycling applications.

  5. Selecting Sustainability Indicators for Small to Medium Sized Urban Water Systems Using Fuzzy-ELECTRE.

    Science.gov (United States)

    Chhipi-Shrestha, Gyan; Hewage, Kasun; Sadiq, Rehan

    2017-03-01

      Urban water systems (UWSs) are challenged by the sustainability perspective. Certain limitations of the sustainability of centralized UWSs and decentralized household level wastewater treatments can be overcome by managing UWSs at an intermediate scale, referred to as small to medium sized UWSs (SMUWSs). SMUWSs are different from large UWSs, mainly in terms of smaller infrastructure, data limitation, smaller service area, and institutional limitations. Moreover, sustainability assessment systems to evaluate the sustainability of an entire UWS are very limited and confined only to large UWSs. This research addressed the gap and has developed a set of 38 applied sustainability performance indicators (SPIs) by using fuzzy-Elimination and Choice Translating Reality (ELECTRE) I outranking method to assess the sustainability of SMUWSs. The developed set of SPIs can be applied to existing and new SMUWSs and also provides a flexibility to include additional SPIs in the future based on the same selection criteria.

  6. High epiregulin expression in human U87 glioma cells relies on IRE1α and promotes autocrine growth through EGF receptor

    International Nuclear Information System (INIS)

    Auf, Gregor; Vajkoczy, Peter; Seno, Masaharu; Bikfalvi, Andreas; Minchenko, Dmitri; Minchenko, Oleksandr; Moenner, Michel; Jabouille, Arnaud; Delugin, Maylis; Guérit, Sylvaine; Pineau, Raphael; North, Sophie; Platonova, Natalia; Maitre, Marlène; Favereaux, Alexandre

    2013-01-01

    Epidermal growth factor (EGF) receptors contribute to the development of malignant glioma. Here we considered the possible implication of the EGFR ligand epiregulin (EREG) in glioma development in relation to the activity of the unfolded protein response (UPR) sensor IRE1α. We also examined EREG status in several glioblastoma cell lines and in malignant glioma. Expression and biological properties of EREG were analyzed in human glioma cells in vitro and in human tumor xenografts with regard to the presence of ErbB proteins and to the blockade of IRE1α. Inactivation of IRE1α was achieved by using either the dominant-negative strategy or siRNA-mediated knockdown. EREG was secreted in high amounts by U87 cells, which also expressed its cognate EGF receptor (ErbB1). A stimulatory autocrine loop mediated by EREG was evidenced by the decrease in cell proliferation using specific blocking antibodies directed against either ErbB1 (cetuximab) or EREG itself. In comparison, anti-ErbB2 antibodies (trastuzumab) had no significant effect. Inhibition of IRE1α dramatically reduced EREG expression both in cell culture and in human xenograft tumor models. The high-expression rate of EREG in U87 cells was therefore linked to IRE1α, although being modestly affected by chemical inducers of the endoplasmic reticulum stress. In addition, IRE1-mediated production of EREG did not depend on IRE1 RNase domain, as neither the selective dominant-negative invalidation of the RNase activity (IRE1 kinase active) nor the siRNA-mediated knockdown of XBP1 had significant effect on EREG expression. Finally, chemical inhibition of c-Jun N-terminal kinases (JNK) using the SP600125 compound reduced the ability of cells to express EREG, demonstrating a link between the growth factor production and JNK activation under the dependence of IRE1α. EREG may contribute to glioma progression under the control of IRE1α, as exemplified here by the autocrine proliferation loop mediated in U87 cells by the

  7. PRIMUS: INFRARED AND X-RAY AGN SELECTION TECHNIQUES AT 0.2 < z < 1.2

    Energy Technology Data Exchange (ETDEWEB)

    Mendez, Alexander J.; Coil, Alison L.; Aird, James; Diamond-Stanic, Aleksandar M. [Center for Astrophysics and Space Sciences, Department of Physics, University of California, 9500 Gilman Dr., La Jolla, San Diego, CA 92093 (United States); Moustakas, John [Department of Physics and Astronomy, Siena College, 515 Loudon Road, Loudonville, NY 12211 (United States); Blanton, Michael R. [Center for Cosmology and Particle Physics, Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Cool, Richard J. [Observatories of the Carnegie Institution for Science, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Eisenstein, Daniel J. [Harvard College Observatory, 60 Garden St., Cambridge, MA 02138 (United States); Wong, Kenneth C. [Steward Observatory, University of Arizona, 933 N. Cherry Ave., Tucson, AZ 85721 (United States); Zhu Guangtun [Department of Physics and Astronomy, Johns Hopkins University, 3400 N. Charles Street, Baltimore, MD 21218 (United States)

    2013-06-10

    We present a study of Spitzer/IRAC and X-ray active galactic nucleus (AGN) selection techniques in order to quantify the overlap, uniqueness, contamination, and completeness of each. We investigate how the overlap and possible contamination of the samples depend on the depth of both the IR and X-ray data. We use Spitzer/IRAC imaging, Chandra and XMM-Newton X-ray imaging, and spectroscopic redshifts from the PRism MUlti-object Survey to construct galaxy and AGN samples at 0.2 < z < 1.2 over 8 deg{sup 2}. We construct samples over a wide range of IRAC flux limits (SWIRE to GOODS depth) and X-ray flux limits (10 ks to 2 Ms). We compare IR-AGN samples defined using both the IRAC color selection of Stern et al. and Donley et al. with X-ray-detected AGN samples. For roughly similar depth IR and X-ray surveys, we find that {approx}75% of IR-selected AGNs are also identified as X-ray AGNs. This fraction increases to {approx}90% when comparing against the deepest X-ray data, indicating that at most {approx}10% of IR-selected AGNs may be heavily obscured. The IR-AGN selection proposed by Stern et al. suffers from contamination by star-forming galaxies at various redshifts when using deeper IR data, though the selection technique works well for shallow IR data. While similar overall, the IR-AGN samples preferentially contain more luminous AGNs, while the X-ray AGN samples identify a wider range of AGN accretion rates including low specific accretion rate AGNs, where the host galaxy light dominates at IR wavelengths. The host galaxy populations of the IR and X-ray AGN samples have similar rest-frame colors and stellar masses; both selections identify AGNs in blue, star-forming and red, quiescent galaxies.

  8. Allosteric small-molecule kinase inhibitors

    DEFF Research Database (Denmark)

    Wu, Peng; Clausen, Mads Hartvig; Nielsen, Thomas E.

    2015-01-01

    current barriers of kinase inhibitors, including poor selectivity and emergence of drug resistance. In spite of the small number of identified allosteric inhibitors in comparison with that of inhibitors targeting the ATP pocket, encouraging results, such as the FDA-approval of the first small...

  9. Afatinib versus methotrexate as second-line treatment in patients with recurrent or metastatic squamous-cell carcinoma of the head and neck progressing on or after platinum-based therapy (LUX-Head & Neck 1)

    DEFF Research Database (Denmark)

    Machiels, Jean-Pascal H; Haddad, Robert I; Fayette, Jérôme

    2015-01-01

    BACKGROUND: Patients with recurrent or metastatic squamous-cell carcinoma of the head and neck (HNSCC) progressing after first-line platinum regimens have a poor prognosis and few treatment options. Afatinib, an irreversible ERBB family blocker, has shown efficacy in a phase 2 study in this setting......%]), and neutropenia (1 [... provide important new insights into the treatment of this patient population and support further investigations with irreversible ERBB family blockers in HNSCC. FUNDING: Boehringer Ingelheim....

  10. Space Density of Optically Selected Type 2 Quasars

    Science.gov (United States)

    Reyes, Reinabelle; Zakamska, Nadia L.; Strauss, Michael A.; Green, Joshua; Krolik, Julian H.; Shen, Yue; Richards, Gordon T.; Anderson, Scott F.; Schneider, Donald P.

    2008-12-01

    Type 2 quasars are luminous active galactic nuclei whose central regions are obscured by large amounts of gas and dust. In this paper, we present a catalog of type 2 quasars from the Sloan Digital Sky Survey, selected based on their optical emission lines. The catalog contains 887 objects with redshifts z < 0.83; this is 6 times larger than the previous version and is by far the largest sample of type 2 quasars in the literature. We derive the [O III]5007 luminosity function (LF) for 108.3 L sun < L [O III] < 1010 L sun (corresponding to intrinsic luminosities up to M[2500 Å] ~= -28 mag or bolometric luminosities up to 4 × 1047 erg s-1). This LF provides robust lower limits to the actual space density of obscured quasars due to our selection criteria, the details of the spectroscopic target selection, and other effects. We derive the equivalent LF for the complete sample of type 1 (unobscured) quasars and determine the ratio of type 2 to type 1 quasar number densities. Our data constrain this ratio to be at least ~1.5:1 for 108.3 L sun < L [O III] < 109.5 L sun at z < 0.3, and at least ~1.2:1 for L [O III] ~ 1010 L sun at 0.3 < z < 0.83. Type 2 quasars are at least as abundant as type 1 quasars in the relatively nearby universe (z <~ 0.8) for the highest luminosities.

  11. Informative gene selection using Adaptive Analytic Hierarchy Process (A2HP

    Directory of Open Access Journals (Sweden)

    Abhishek Bhola

    2017-12-01

    Full Text Available Gene expression dataset derived from microarray experiments are marked by large number of genes, which contains the gene expression values at different sample conditions/time-points. Selection of informative genes from these large datasets is an issue of major concern for various researchers and biologists. In this study, we propose a gene selection and dimensionality reduction method called Adaptive Analytic Hierarchy Process (A2HP. Traditional analytic hierarchy process is a multiple-criteria based decision analysis method whose result depends upon the expert knowledge or decision makers. It is mainly used to solve the decision problems in different fields. On the other hand, A2HP is a fused method that combines the outcomes of five individual gene selection ranking methods t-test, chi-square variance test, z-test, wilcoxon test and signal-to-noise ratio (SNR. At first, the preprocessing of gene expression dataset is done and then the reduced number of genes obtained, will be fed as input for A2HP. A2HP utilizes both quantitative and qualitative factors to select the informative genes. Results demonstrate that A2HP selects efficient number of genes as compared to the individual gene selection methods. The percentage of deduction in number of genes and time complexity are taken as the performance measure for the proposed method. And it is shown that A2HP outperforms individual gene selection methods.

  12. [Small renal mass].

    Science.gov (United States)

    Prokofiev, D; Kreutzer, N; Kress, A; Wissing, F; Pfeifer, H; Stolzenburg, J-U; Dietel, A; Schwalenberg, T; Do, M; Truß, M C

    2012-10-01

    The frequent application of ultrasound and radiological imaging for non-urological indications in recent years has resulted in an increase in the diagnosis of small renal masses. The treatment options for patients with a small renal mass include active surveillance, surgery (both open and minimally invasive) as well as ablative techniques. As there is a risk for metastatic spread even in small renal masses surgical extirpation remains the treatment of choice in most patients. Ablative procedures, such as cryoablation and radiofrequency ablation are appropriate for old and multi-morbid patients who require active treatment of a small renal mass. Active surveillance is an alternative for high-risk patients. Meticulous patient selection by the urologist and patient preference will determine the choice of treatment option in the future.

  13. Small hepatocellular carcinoma versus small cavernous hemangioma

    International Nuclear Information System (INIS)

    Choi, B.I.; Park, H.W.; Kim, S.H.; Han, M.C.; Kim, C.W.

    1989-01-01

    To determine the optimal pulse sequence for detection and differential diagnosis of small hepatocellular carcinomas and cavernous hemangiomas less than 5 cm in diameter, the authors have analyzed spin-echo (SE) images of 15 small hepatocellular carcinomas and 31 small cavernous hemangiomas obtained at 2.0 T. Pulse sequences used included repetition times (TRs) of 500 and 2,000 msec and echo times (TEs) of 30,60,90,120,150, and 180 msec. Mean tumor-liver contrast-to-noise ratios on the SE 2,000/60 (TR msec/TE msec) sequence were 23.90 ± 16.33 and 62.10 ± 25.94 for small hepatocellular carcinomas and hemangiomas, respectively, and were significantly greater than for all other pulse sequences. Mean tumor-liver signal intensity ratios on the SE 2,000/150 sequence were 2.34 ± 1.72 and 6.04 ± 2.72 for small hepatocellular carcinomas and hemangiomas, respectively, and were significantly greater than for all other pulse sequences in hemangiomas

  14. Selective Assembly of Na,K-ATPase α2β2 Heterodimers in the Heart

    Science.gov (United States)

    Habeck, Michael; Tokhtaeva, Elmira; Nadav, Yotam; Ben Zeev, Efrat; Ferris, Sean P.; Kaufman, Randal J.; Bab-Dinitz, Elizabeta; Kaplan, Jack H.; Dada, Laura A.; Farfel, Zvi; Tal, Daniel M.; Katz, Adriana; Sachs, George; Vagin, Olga; Karlish, Steven J. D.

    2016-01-01

    The Na,K-ATPase α2 subunit plays a key role in cardiac muscle contraction by regulating intracellular Ca2+, whereas α1 has a more conventional role of maintaining ion homeostasis. The β subunit differentially regulates maturation, trafficking, and activity of α-β heterodimers. It is not known whether the distinct role of α2 in the heart is related to selective assembly with a particular one of the three β isoforms. We show here by immunofluorescence and co-immunoprecipitation that α2 is preferentially expressed with β2 in T-tubules of cardiac myocytes, forming α2β2 heterodimers. We have expressed human α1β1, α2β1, α2β2, and α2β3 in Pichia pastoris, purified the complexes, and compared their functional properties. α2β2 and α2β3 differ significantly from both α2β1 and α1β1 in having a higher K0.5K+ and lower K0.5Na+ for activating Na,K-ATPase. These features are the result of a large reduction in binding affinity for extracellular K+ and shift of the E1P-E2P conformational equilibrium toward E1P. A screen of perhydro-1,4-oxazepine derivatives of digoxin identified several derivatives (e.g. cyclobutyl) with strongly increased selectivity for inhibition of α2β2 and α2β3 over α1β1 (range 22–33-fold). Molecular modeling suggests a possible basis for isoform selectivity. The preferential assembly, specific T-tubular localization, and low K+ affinity of α2β2 could allow an acute response to raised ambient K+ concentrations in physiological conditions and explain the importance of α2β2 for cardiac muscle contractility. The high sensitivity of α2β2 to digoxin derivatives explains beneficial effects of cardiac glycosides for treatment of heart failure and potential of α2β2-selective digoxin derivatives for reducing cardiotoxicity. PMID:27624940

  15. CYT387, a selective JAK1/JAK2 inhibitor: in vitro assessment of kinase selectivity and preclinical studies using cell lines and primary cells from polycythemia vera patients.

    Science.gov (United States)

    Pardanani, A; Lasho, T; Smith, G; Burns, C J; Fantino, E; Tefferi, A

    2009-08-01

    Somatic mutations in Janus kinase 2 (JAK2), including JAK2V617F, result in dysregulated JAK-signal transducer and activator transcription (STAT) signaling, which is implicated in myeloproliferative neoplasm (MPN) pathogenesis. CYT387 is an ATP-competitive small molecule that potently inhibits JAK1/JAK2 kinases (IC(50)=11 and 18 nM, respectively), with significantly less activity against other kinases, including JAK3 (IC(50)=155 nM). CYT387 inhibits growth of Ba/F3-JAK2V617F and human erythroleukemia (HEL) cells (IC(50) approximately 1500 nM) or Ba/F3-MPLW515L cells (IC(50)=200 nM), but has considerably less activity against BCR-ABL harboring K562 cells (IC=58 000 nM). Cell lines harboring mutated JAK2 alleles (CHRF-288-11 or Ba/F3-TEL-JAK2) were inhibited more potently than the corresponding pair harboring mutated JAK3 alleles (CMK or Ba/F3-TEL-JAK3), and STAT-5 phosphorylation was inhibited in HEL cells with an IC(50)=400 nM. Furthermore, CYT387 selectively suppressed the in vitro growth of erythroid colonies harboring JAK2V617F from polycythemia vera (PV) patients, an effect that was attenuated by exogenous erythropoietin. Overall, our data indicate that the JAK1/JAK2 selective inhibitor CYT387 has potential for efficacious treatment of MPN harboring mutated JAK2 and MPL alleles.

  16. Nanomagnets La0.8Pb0.2(Fe0.8Co0.2)O3 assembled with a bonded surface graphene oxide: sensitive for sensing small gas molecules.

    Science.gov (United States)

    Bhargav, K K; Ram, S; Majumder, S B

    2012-04-01

    Nanocrystallites La0.8Pb0.2(Fe0.8Co0.2)O3 (LPFC) when bonded through a surface layer (carbon) in small ensembles display surface sensitive magnetism useful for biological probes, electrodes, and toxic gas sensors. A simple dispersion and hydrolysis of the salts in ethylene glycol (EG) in water is explored to form ensembles of the nanocrystallites (NCs) by combustion of a liquid precursor gel slowly in microwave at 70-80 dgrees C (apparent) in a closed container in air. In a dilute sample, the EG molecules mediate hydrolyzed species to configure in small groups in process to form a gel. Proposed models describe how a residual carbon bridges a stable bonded layer of a graphene-oxide-like hybrid structure on the LPFC-NCs in attenuating the magnetic structure. SEM images, measured from a pelletized sample which was used to study the gas sensing features in terms of the electrical resistance, describe plate shaped NCs, typically 30-60 nm widths, 60-180 nm lengths and -50 m2/g surface area (after heating at -750 degrees C). These NCs are arranged in ensembles (200-900 nm size). As per the X-ray diffraction, the plates (a Pnma orthorhombic structure) bear only small strain -0.0023 N/m2 and oxygen vacancies. The phonon and electronic bands from a bonded surface layer disappear when it is etched out slowly by heating above 550 degrees C in air. The surface layer actively promotes selective H2 gas sensor properties.

  17. Can mt2 much-gt mb2 arise from small corrections in four-family models

    International Nuclear Information System (INIS)

    Mendel, R.R.; Margolis, B.; Therrien, E.; Valin, P.

    1989-01-01

    This paper proposes a general dynamical scheme capable of explaining naturally the main properties of the observed spectrum, namely the strong inter-family mass hierarchies and the mixing pattern. The authors illustrate these properties in the three-family case with a simple toy model. There is an indication that large values of m t may be required in order to obtain |V by |much-lt|V bc ; the fact the m 2 much-gt m 2 could be due to small corrections in a four-family model where m' ∼ m'. The authors point out possible natural explanations for the small mass of the e, μ and τ neutrinos in the three and four family cases

  18. Microporous carbonaceous adsorbents for CO2 separation via selective adsorption

    KAUST Repository

    Zhao, Yunfeng

    2015-01-01

    Selective adsorption of CO2 has important implications for many energy and environment-related processes, which require the separation of CO2 from other gases (e.g. N2 and CH4) with high uptakes and selectivity. The development of high-performance adsorbents is one of the most promising solutions to the success of these processes. The present review is focused on the state-of-the-art of carbon-based (carbonaceous) adsorbents, covering microporous inorganic carbons and microporous organic polymers, with emphasis on the correlation between their textural and compositional properties and their CO2 adsorption/separation performance. Special attention is given to the most recently developed materials that were not covered in previous reviews. We summarize various effective strategies (N-doping, surface functionalization, extra-framework ions, molecular design, and pore size engineering) for enhancing the CO2 adsorption capacity and selectivity of carbonaceous adsorbents. Our discussion focuses on CO2/N2 separation and CO2/CH4 separation, while including an introduction to the methods and criteria used for evaluating the performance of the adsorbents. Critical issues and challenges regarding the development of high-performance adsorbents as well as some overlooked facts and misconceptions are also discussed, with the aim of providing important insights into the design of novel carbonaceous porous materials for various selective adsorption based applications. This journal is © The Royal Society of Chemistry.

  19. Possible role of IGF2 receptors in regulating selection of 2 dominant follicles in cattle selected for twin ovulations and births

    Science.gov (United States)

    Abundance of IGF-2 receptor (IGF2R), FSH receptor (FSHR), and LH receptor (LHCGR) mRNA in granulosa cells (GCs) or theca cells (TCs) or both cells as well as estradiol (E2), progesterone (P4), and androstenedione concentrations in follicular fluid were compared in cows genetically selected (Twinner)...

  20. Small-molecule inhibitors of phosphatidylcholine transfer protein/StarD2 identified by high-throughput screening.

    Science.gov (United States)

    Wagle, Neil; Xian, Jun; Shishova, Ekaterina Y; Wei, Jie; Glicksman, Marcie A; Cuny, Gregory D; Stein, Ross L; Cohen, David E

    2008-12-01

    Phosphatidylcholine transfer protein (PC-TP, also referred to as StarD2) is a highly specific intracellular lipid-binding protein that catalyzes the transfer of phosphatidylcholines between membranes in vitro. Recent studies have suggested that PC-TP in vivo functions to regulate fatty acid and glucose metabolism, possibly via interactions with selected other proteins. To begin to address the relationship between activity in vitro and biological function, we undertook a high-throughput screen to identify small-molecule inhibitors of the phosphatidylcholine transfer activity of PC-TP. After adapting a fluorescence quench assay to measure phosphatidylcholine transfer activity, we screened 114,752 compounds of a small-molecule library. The high-throughput screen identified 14 potential PC-TP inhibitors. Of these, 6 compounds exhibited characteristics consistent with specific inhibition of PC-TP activity, with IC(50) values that ranged from 4.1 to 95.0muM under conditions of the in vitro assay. These compounds should serve as valuable reagents to elucidate the biological function of PC-TP. Because mice with homozygous disruption of the PC-TP gene (Pctp) are sensitized to insulin action and relatively resistant to the development of atherosclerosis, these inhibitors may also prove to be of value in the management of diabetes and atherosclerotic cardiovascular diseases.

  1. CO2-selective PEO–PBT (PolyActive™)/graphene oxide composite membranes

    KAUST Repository

    Karunakaran, Madhavan; Shevate, Rahul; Kumar, Mahendra; Peinemann, Klaus-Viktor

    2015-01-01

    CO2-selective graphene oxide (GO) nano-composite membranes were prepared for the first time by embedding GO into a commercially available poly(ethylene oxide)–poly(butylene terephthalate) (PEO–PBT) copolymer (PolyActive™). The as-prepared GO membrane shows high CO2 permeability (143 Barrer) and CO2/N2 selectivity (α = 73).

  2. CO2-selective PEO–PBT (PolyActive™)/graphene oxide composite membranes

    KAUST Repository

    Karunakaran, Madhavan

    2015-07-31

    CO2-selective graphene oxide (GO) nano-composite membranes were prepared for the first time by embedding GO into a commercially available poly(ethylene oxide)–poly(butylene terephthalate) (PEO–PBT) copolymer (PolyActive™). The as-prepared GO membrane shows high CO2 permeability (143 Barrer) and CO2/N2 selectivity (α = 73).

  3. Space Access for Small Satellites on the K-1

    Science.gov (United States)

    Faktor, L.

    Affordable access to space remains a major obstacle to realizing the increasing potential of small satellites systems. On a per kilogram basis, small launch vehicles are simply too expensive for the budgets of many small satellite programs. Opportunities for rideshare with larger payloads on larger launch vehicles are still rare, given the complications associated with coordinating delivery schedules and deployment orbits. Existing contractual mechanisms are also often inadequate to facilitate the launch of multiple payload customers on the same flight. Kistler Aerospace Corporation is committed to lowering the price and enhancing the availability of space access for small satellite programs through the fully-reusable K-1 launch vehicle. Kistler has been working with a number of entities, including Astrium Ltd., AeroAstro, and NASA, to develop innovative approaches to small satellite missions. The K-1 has been selected by NASA as a Flight Demonstration Vehicle for the Space Launch Initiative. NASA has purchased the flight results during the first four K-1 launches on the performance of 13 advanced launch vehicle technologies embedded in the K-1 vehicle. On K-1 flights #2-#4, opportunities exist for small satellites to rideshare to low-earth orbit for a low-launch price. Kistler's flight demonstration contract with NASA also includes options to fly Add-on Technology Experiment flights. Opportunities exist for rideshare payloads on these flights as well. Both commercial and government customers may take advantage of the rideshare pricing. Kistler is investigating the feasibility of flying dedicated, multiple small payload missions. Such a mission would launch multiple small payloads from a single customer or small payloads from different customers. The orbit would be selected to be compatible with the requirements of as many small payload customers as possible, and make use of reusable hardware, standard interfaces (such as the existing MPAS) and verification plans

  4. Selective adsorption of thiophenic compounds from fuel over TiO2/SiO2 under UV-irradiation.

    Science.gov (United States)

    Miao, Guang; Ye, Feiyan; Wu, Luoming; Ren, Xiaoling; Xiao, Jing; Li, Zhong; Wang, Haihui

    2015-12-30

    This study investigates selective adsorption of thiophenic compounds from fuel over TiO2/SiO2 under UV-irradiation. The TiO2/SiO2 adsorbents were prepared and then characterized by N2 adsorption, X-ray diffraction and X-ray photoelectron spectroscopy. Adsorption isotherms, selectivity and kinetics of TiO2/SiO2 were measured in a UV built-in batch reactor. It was concluded that (a) with the employment of UV-irradiation, high organosulfur uptake of 5.12 mg/g was achieved on the optimized 0.3TiO2/0.7SiO2 adsorbent at low sulfur concentration of 15 ppmw-S, and its adsorption selectivity over naphthalene was up to 325.5; (b) highly dispersed TiO2 served as the photocatalytic sites for DBT oxidation, while SiO2 acted as the selective adsorption sites for the corresponding oxidized DBT using TiO2 as a promoter, the two types of active sites worked cooperatively to achieve the high adsorption selectivity of TiO2/SiO2; (c) The kinetic rate-determining step for the UV photocatalysis-assisted adsorptive desulfurization (PADS) over TiO2/SiO2 was DBT oxidation; (d) consecutive adsorption-regeneration cycles suggested that the 0.3TiO2/0.7SiO2 adsorbent can be regenerated by acetonitrile washing followed with oxidative air treatment. This work demonstrated an effective PADS approach to greatly enhance adsorption capacity and selectivity of thiophenic compounds at low concentrations for deep desulfurization under ambient conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Defining RNA-Small Molecule Affinity Landscapes Enables Design of a Small Molecule Inhibitor of an Oncogenic Noncoding RNA.

    Science.gov (United States)

    Velagapudi, Sai Pradeep; Luo, Yiling; Tran, Tuan; Haniff, Hafeez S; Nakai, Yoshio; Fallahi, Mohammad; Martinez, Gustavo J; Childs-Disney, Jessica L; Disney, Matthew D

    2017-03-22

    RNA drug targets are pervasive in cells, but methods to design small molecules that target them are sparse. Herein, we report a general approach to score the affinity and selectivity of RNA motif-small molecule interactions identified via selection. Named High Throughput Structure-Activity Relationships Through Sequencing (HiT-StARTS), HiT-StARTS is statistical in nature and compares input nucleic acid sequences to selected library members that bind a ligand via high throughput sequencing. The approach allowed facile definition of the fitness landscape of hundreds of thousands of RNA motif-small molecule binding partners. These results were mined against folded RNAs in the human transcriptome and identified an avid interaction between a small molecule and the Dicer nuclease-processing site in the oncogenic microRNA (miR)-18a hairpin precursor, which is a member of the miR-17-92 cluster. Application of the small molecule, Targapremir-18a, to prostate cancer cells inhibited production of miR-18a from the cluster, de-repressed serine/threonine protein kinase 4 protein (STK4), and triggered apoptosis. Profiling the cellular targets of Targapremir-18a via Chemical Cross-Linking and Isolation by Pull Down (Chem-CLIP), a covalent small molecule-RNA cellular profiling approach, and other studies showed specific binding of the compound to the miR-18a precursor, revealing broadly applicable factors that govern small molecule drugging of noncoding RNAs.

  6. How to successfully select and implement electronic health records (EHR) in small ambulatory practice settings.

    Science.gov (United States)

    Lorenzi, Nancy M; Kouroubali, Angelina; Detmer, Don E; Bloomrosen, Meryl

    2009-02-23

    Adoption of EHRs by U.S. ambulatory practices has been slow despite the perceived benefits of their use. Most evaluations of EHR implementations in the literature apply to large practice settings. While there are similarities relating to EHR implementation in large and small practice settings, the authors argue that scale is an important differentiator. Focusing on small ambulatory practices, this paper outlines the benefits and barriers to EHR use in this setting, and provides a "field guide" for these practices to facilitate successful EHR implementation. The benefits of EHRs in ambulatory practices include improved patient care and office efficiency, and potential financial benefits. Barriers to EHRs include costs; lack of standardization of EHR products and the design of vendor systems for large practice environments; resistance to change; initial difficulty of system use leading to productivity reduction; and perceived accrual of benefits to society and payers rather than providers. The authors stress the need for developing a flexible change management strategy when introducing EHRs that is relevant to the small practice environment; the strategy should acknowledge the importance of relationship management and the role of individual staff members in helping the entire staff to manage change. Practice staff must create an actionable vision outlining realistic goals for the implementation, and all staff must buy into the project. The authors detail the process of implementing EHRs through several stages: decision, selection, pre-implementation, implementation, and post-implementation. They stress the importance of identifying a champion to serve as an advocate of the value of EHRs and provide direction and encouragement for the project. Other key activities include assessing and redesigning workflow; understanding financial issues; conducting training that is well-timed and meets the needs of practice staff; and evaluating the implementation process. The EHR

  7. How to successfully select and implement electronic health records (EHR in small ambulatory practice settings

    Directory of Open Access Journals (Sweden)

    Detmer Don E

    2009-02-01

    Full Text Available Abstract Background Adoption of EHRs by U.S. ambulatory practices has been slow despite the perceived benefits of their use. Most evaluations of EHR implementations in the literature apply to large practice settings. While there are similarities relating to EHR implementation in large and small practice settings, the authors argue that scale is an important differentiator. Focusing on small ambulatory practices, this paper outlines the benefits and barriers to EHR use in this setting, and provides a "field guide" for these practices to facilitate successful EHR implementation. Discussion The benefits of EHRs in ambulatory practices include improved patient care and office efficiency, and potential financial benefits. Barriers to EHRs include costs; lack of standardization of EHR products and the design of vendor systems for large practice environments; resistance to change; initial difficulty of system use leading to productivity reduction; and perceived accrual of benefits to society and payers rather than providers. The authors stress the need for developing a flexible change management strategy when introducing EHRs that is relevant to the small practice environment; the strategy should acknowledge the importance of relationship management and the role of individual staff members in helping the entire staff to manage change. Practice staff must create an actionable vision outlining realistic goals for the implementation, and all staff must buy into the project. The authors detail the process of implementing EHRs through several stages: decision, selection, pre-implementation, implementation, and post-implementation. They stress the importance of identifying a champion to serve as an advocate of the value of EHRs and provide direction and encouragement for the project. Other key activities include assessing and redesigning workflow; understanding financial issues; conducting training that is well-timed and meets the needs of practice staff

  8. Fluoroethoxy-1,4-diphenethylpiperidine and piperazine derivatives: Potent and selective inhibitors of [3H]dopamine uptake at the vesicular monoamine transporter-2.

    Science.gov (United States)

    Hankosky, Emily R; Joolakanti, Shyam R; Nickell, Justin R; Janganati, Venumadhav; Dwoskin, Linda P; Crooks, Peter A

    2017-12-15

    A small library of fluoroethoxy-1,4-diphenethyl piperidine and fluoroethoxy-1,4-diphenethyl piperazine derivatives were designed, synthesized and evaluated for their ability to inhibit [ 3 H]dopamine (DA) uptake at the vesicular monoamine transporter-2 (VMAT2) and dopamine transporter (DAT), [ 3 H]serotonin (5-HT) uptake at the serotonin transporter (SERT), and [ 3 H]dofetilide binding at the human-ether-a-go-go-related gene (hERG) channel. The majority of the compounds exhibited potent inhibition of [ 3 H]DA uptake at VMAT2, Ki changes in the nanomolar range (K i  = 0.014-0.073 µM). Compound 15d exhibited the highest affinity (K i  = 0.014 µM) at VMAT2, and had 160-, 5-, and 60-fold greater selectivity for VMAT2 vs. DAT, SERT and hERG, respectively. Compound 15b exhibited the greatest selectivity (>60-fold) for VMAT2 relative to all the other targets evaluated, and 15b had high affinity for VMAT2 (K i  = 0.073 µM). Compound 15b was considered the lead compound from this analog series due to its high affinity and selectivity for VMAT2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Modulation in selectivity and allosteric properties of small-molecule ligands for CC-chemokine receptors

    DEFF Research Database (Denmark)

    Thiele, Stefanie; Malmgaard-Clausen, Mikkel; Engel-Andreasen, Jens

    2012-01-01

    Among 18 human chemokine receptors, CCR1, CCR4, CCR5, and CCR8 were activated by metal ion Zn(II) or Cu(II) in complex with 2,2'-bipyridine or 1,10-phenanthroline with similar potencies (EC(50) from 3.9 to 172 μM). Besides being agonists, they acted as selective allosteric enhancers of CCL3. Thes...

  10. Sexual selection halts the relaxation of protamine 2 among rodents.

    Directory of Open Access Journals (Sweden)

    Lena Lüke

    Full Text Available Sexual selection has been proposed as the driving force promoting the rapid evolutionary changes observed in some reproductive genes including protamines. We test this hypothesis in a group of rodents which show marked differences in the intensity of sexual selection. Levels of sperm competition were not associated with the evolutionary rates of protamine 1 but, contrary to expectations, were negatively related to the evolutionary rate of cleaved- and mature-protamine 2. Since both domains were found to be under relaxation, our findings reveal an unforeseen role of sexual selection: to halt the degree of degeneration that proteins within families may experience due to functional redundancy. The degree of relaxation of protamine 2 in this group of rodents is such that in some species it has become dysfunctional and it is not expressed in mature spermatozoa. In contrast, protamine 1 is functionally conserved but shows directed positive selection on specific sites which are functionally relevant such as DNA-anchoring domains and phosphorylation sites. We conclude that in rodents protamine 2 is under relaxation and that sexual selection removes deleterious mutations among species with high levels of sperm competition to maintain the protein functional and the spermatozoa competitive.

  11. Triazine containing N-rich microporous organic polymers for CO2 capture and unprecedented CO2/N2 selectivity

    International Nuclear Information System (INIS)

    Bhunia, Subhajit; Bhanja, Piyali; Das, Sabuj Kanti; Sen, Tapas; Bhaumik, Asim

    2017-01-01

    Targeted synthesis of microporous adsorbents for CO 2 capture and storage is very challenging in the context of remediation from green house gases. Herein we report two novel N-rich microporous networks SB-TRZ-CRZ and SB-TRZ-TPA by extensive incorporation of triazine containing tripodal moiety in the porous polymer framework. These materials showed excellent CO 2 storage capacities: SB-TRZ-CRZ displayed the CO 2 uptake capacity of 25.5 wt% upto 1 bar at 273 K and SB-TRZ-TPA gave that of 16 wt% under identical conditions. The substantial dipole quadruple interaction between network (polar triazine) and CO 2 boosts the selectivity for CO 2 /N 2 . SB-TRZ-CRZ has this CO 2 /N 2 selectivity ratio of 377, whereas for SB-TRZ-TPA it was 97. Compared to other porous polymers, these materials are very cost effective, scalable and very promising material for clean energy application and environmental issues. - Graphical abstract: We report two novel N-rich microporous polymeric materials by doping of triazine containing tripodal dopant in the organic framework. These materials showed excellent CO 2 storage capacities as high as 25.5 wt% under 1 bar pressure with exceptional CO 2 /N 2 selectivity of 377. - Highlights: • Triazine containing trimodal moiety incorporated in polycarbazolic and poly triphenylamine networks. • N-rich crosslinked polymers with high BET surface area and 1.5–1.7 nm size large micropores. • CO 2 uptake capacity of 25.5 wt% upto 1 bar at 273 K. • These crosslinked porous polymers showed exceptional CO 2 /N 2 selectivity.

  12. Activity and Selectivity for O-2 Reduction to H2O2 on Transition Metal Surfaces

    DEFF Research Database (Denmark)

    Siahrostami, Samira; Verdaguer Casadevall, Arnau; Karamad, Mohammadreza

    2013-01-01

    Industrially viable electrochemical production of H2O2 requires active, selective and stable electrocatalyst materials to catalyse the oxygen reduction reaction to H2O2. On the basis of density functional theory calculations, we explain why single site catalysts such as Pd/Au show improved...

  13. Small incision guarded hydroaspiration of iris lesions.

    Science.gov (United States)

    Singh, Arun D

    2017-11-01

    To describe the technique and results of a minimally invasive surgical technique for resection of small iris lesions. Consecutive case series of 22 patients with localised, small iris lesions that were resected using the described surgical technique that composed of multiple, small corneal incisions created to allow for internal iris resection with 23-gauge horizontal vitrectomy scissors, followed by guarded tumour aspiration through a clear plastic tubing (diameter 3.5 mm) primed with viscoelastic agent. The mean largest basal diameter was 3.0 mm (range 1.5-5.0 mm; median 3.0 mm) and mean thickness was 1.3 mm (range 0.5-2.5 mm; median 1.0 mm). Use of multiple (2-4) small corneal incisions (range 2.0-3.0 mm; mean 2.8 mm) allowed reduced postoperative morbidity (significant hyphema (0%), hypotony (0%), wound leak (0%), >2 line change in best corrected visual acuity at postoperative 1 week (4.5%) and mean corneal astigmatism of 1.0 D (range 0.14-2.99 D; median 0.8 D) at postoperative 4-12 weeks. The tumour could be resected with clear surgical margins in all neoplastic cases (benign (2), borderline (1) and malignant (16)). Local recurrence or metastases were not observed in any melanoma case over a mean follow-up of 33.0 months (range 1.0-90.0 months; median 33.5 months). Small incision guarded hydroaspiration is a minimally invasive surgical technique for resection of select small iris lesions. Use of multiple small corneal incisions avoids morbidity associated with a single large corneoscleral incision, and use of guarded aspiration may eliminate the risk of wound contamination by the malignant tumour. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  14. Implications of the formation of small polarons in Li2O2 for Li-air batteries

    Science.gov (United States)

    Kang, Joongoo; Jung, Yoon Seok; Wei, Su-Huai; Dillon, Anne C.

    2012-01-01

    Lithium-air batteries (LABs) are an intriguing next-generation technology due to their high theoretical energy density of ˜11 kWh/kg. However, LABs are hindered by both poor rate capability and significant polarization in cell voltage, primarily due to the formation of Li2O2 in the air cathode. Here, by employing hybrid density functional theory, we show that the formation of small polarons in Li2O2 limits electron transport. Consequently, the low electron mobility μ = 10-10-10-9 cm2/V s contributes to both the poor rate capability and the polarization that limit the LAB power and energy densities. The self-trapping of electrons in the small polarons arises from the molecular nature of the conduction band states of Li2O2 and the strong spin polarization of the O 2p state. Our understanding of the polaronic electron transport in Li2O2 suggests that designing alternative carrier conduction paths for the cathode reaction could significantly improve the performance of LABs at high current densities.

  15. Selective mGAT2 (BGT-1) GABA Uptake Inhibitor

    DEFF Research Database (Denmark)

    Vogensen, Stine Byskov; Jørgensen, Lars; Madsen, Karsten Kirkegaard

    2013-01-01

    β-Amino acids sharing a lipophilic diaromatic side chain were synthesized and characterized pharmacologically on mouse GABA transporter subtypes mGAT1−4. The parent amino acids were also characterized. Compounds 13a, 13b, and 17b displayed more than 6-fold selectivity for mGAT2 over mGAT1. Compou...... 17b displayed anticonvulsive properties inferring a role of mGAT2 in epileptic disorders. These results provide new neuropharmacological tools and a strategy for designing subtype selective GABA transport inhibitors....

  16. Glioma Association and Balancing Selection of ZFPM2.

    Directory of Open Access Journals (Sweden)

    Shui-Ying Tsang

    Full Text Available ZFPM2, encoding a zinc finger protein and abundantly expressed in the brain, uterus and smooth muscles, plays important roles in cardiac and gonadal development. Abnormal expression of ZFPM2 in ovarian tumors and neuroblastoma has been reported but hitherto its genetic association with cancer and effects on gliomas have not been studied. In the present study, the hexamer insertion-deletion polymorphism rs71305152, located within a large haplotype block spanning intron 1 to intron 3 of ZFPM2, was genotyped in Chinese cohorts of glioma (n = 350, non-glioma cancer (n = 354 and healthy control (n = 463 by direct sequencing and length polymorphism in gel electrophoresis, and ZFPM2 expression in glioma tissues (n = 69 of different grades was quantified by real-time RT-PCR. Moreover, potential natural selection pressure acting on the gene was investigated. Disease-association analysis showed that the overall genotype of rs71305152 was significantly associated with gliomas (P = 0.016, and the heterozygous genotype compared to the combined homozygous genotypes was less frequent in gliomas than in controls (P = 0.005 or non-glioma cancers (P = 0.020. ZFPM2 mRNA expression was negatively correlated with the grades of gliomas (P = 0.002, with higher expression levels in the low-grade gliomas. In the astrocytoma subtype, higher ZFPM2 expression was also correlated with the rs71305152 heterozygous genotype (P = 0.028. In addition, summary statistics tests gave highly positive values, demonstrating that the gene is under the influence of balancing selection. These findings suggest that ZFPM2 is a glioma susceptibility gene, its genotype and expression showing associations with incidence and severity, respectively. Moreover, the balancing selection acting on ZFPM2 may be related to the important roles it has to play in multiple organ development or associated disease etiology.

  17. Selective activation of heme oxygenase-2 by menadione.

    Science.gov (United States)

    Vukomanovic, Dragic; McLaughlin, Brian E; Rahman, Mona N; Szarek, Walter A; Brien, James F; Jia, Zongchao; Nakatsu, Kanji

    2011-11-01

    While substantial progress has been made in elucidating the roles of heme oxygenases-1 (HO-1) and -2 (HO-2) in mammals, our understanding of the functions of these enzymes in health and disease is still incomplete. A significant amount of our knowledge has been garnered through the use of nonselective inhibitors of HOs, and our laboratory has recently described more selective inhibitors for HO-1. In addition, our appreciation of HO-1 has benefitted from the availability of tools for increasing its activity through enzyme induction. By comparison, there is a paucity of information about HO-2 activation, with only a few reports appearing in the literature. This communication describes our observations of the up to 30-fold increase in the in-vitro activation of HO-2 by menadione. This activation was due to an increase in Vmax and was selective, in that menadione did not increase HO-1 activity.

  18. A genome-wide RNAi screen identifies novel targets of neratinib resistance leading to identification of potential drug resistant genetic markers.

    Science.gov (United States)

    Seyhan, Attila A; Varadarajan, Usha; Choe, Sung; Liu, Wei; Ryan, Terence E

    2012-04-01

    Neratinib (HKI-272) is a small molecule tyrosine kinase inhibitor of the ErbB receptor family currently in Phase III clinical trials. Despite its efficacy, the mechanism of potential cellular resistance to neratinib and genes involved with it remains unknown. We have used a pool-based lentiviral genome-wide functional RNAi screen combined with a lethal dose of neratinib to discover chemoresistant interactions with neratinib. Our screen has identified a collection of genes whose inhibition by RNAi led to neratinib resistance including genes involved in oncogenesis (e.g. RAB33A, RAB6A and BCL2L14), transcription factors (e.g. FOXP4, TFEC, ZNF), cellular ion transport (e.g. CLIC3, TRAPPC2P1, P2RX2), protein ubiquitination (e.g. UBL5), cell cycle (e.g. CCNF), and genes known to interact with breast cancer-associated genes (e.g. CCNF, FOXP4, TFEC, several ZNF factors, GNA13, IGFBP1, PMEPA1, SOX5, RAB33A, RAB6A, FXR1, DDO, TFEC, OLFM2). The identification of novel mediators of cellular resistance to neratinib could lead to the identification of new or neoadjuvant drug targets. Their use as patient or treatment selection biomarkers could make the application of anti-ErbB therapeutics more clinically effective.

  19. Simulating molecular mechanisms of the MDM2-mediated regulatory interactions: a conformational selection model of the MDM2 lid dynamics.

    Directory of Open Access Journals (Sweden)

    Gennady M Verkhivker

    Full Text Available Diversity and complexity of MDM2 mechanisms govern its principal function as the cellular antagonist of the p53 tumor suppressor. Structural and biophysical studies have demonstrated that MDM2 binding could be regulated by the dynamics of a pseudo-substrate lid motif. However, these experiments and subsequent computational studies have produced conflicting mechanistic models of MDM2 function and dynamics. We propose a unifying conformational selection model that can reconcile experimental findings and reveal a fundamental role of the lid as a dynamic regulator of MDM2-mediated binding. In this work, structure, dynamics and energetics of apo-MDM2 are studied as a function of posttranslational modifications and length of the lid. We found that the dynamic equilibrium between "closed" and "semi-closed" lid forms may be a fundamental characteristic of MDM2 regulatory interactions, which can be modulated by phosphorylation, phosphomimetic mutation as well as by the lid size. Our results revealed that these factors may regulate p53-MDM2 binding by fine-tuning the thermodynamic equilibrium between preexisting conformational states of apo-MDM2. In agreement with NMR studies, the effect of phosphorylation on MDM2 interactions was more pronounced with the truncated lid variant that favored the thermodynamically dominant closed form. The phosphomimetic mutation S17D may alter the lid dynamics by shifting the thermodynamic equilibrium towards the ensemble of "semi-closed" conformations. The dominant "semi-closed" lid form and weakened dependence on the phosphorylation seen in simulations with the complete lid can provide a rationale for binding of small p53-based mimetics and inhibitors without a direct competition with the lid dynamics. The results suggested that a conformational selection model of preexisting MDM2 states may provide a robust theoretical framework for understanding MDM2 dynamics. Probing biological functions and mechanisms of MDM2

  20. EFFICIENT SELECTION AND CLASSIFICATION OF INFRARED EXCESS EMISSION STARS BASED ON AKARI AND 2MASS DATA

    Energy Technology Data Exchange (ETDEWEB)

    Huang Yafang; Li Jinzeng [National Astronomical Observatories, Chinese Academy of Sciences, 20A Datun Road, Chaoyang District, Beijing 100012 (China); Rector, Travis A. [University of Alaska, 3211 Providence Drive, Anchorage, AK 99508 (United States); Mallamaci, Carlos C., E-mail: ljz@nao.cas.cn [Observatorio Astronomico Felix Aguilar, Universidad Nacional de San Juan (Argentina)

    2013-05-15

    The selection of young stellar objects (YSOs) based on excess emission in the infrared is easily contaminated by post-main-sequence stars and various types of emission line stars with similar properties. We define in this paper stringent criteria for an efficient selection and classification of stellar sources with infrared excess emission based on combined Two Micron All Sky Survey (2MASS) and AKARI colors. First of all, bright dwarfs and giants with known spectral types were selected from the Hipparcos Catalogue and cross-identified with the 2MASS and AKARI Point Source Catalogues to produce the main-sequence and the post-main-sequence tracks, which appear as expected as tight tracks with very small dispersion. However, several of the main-sequence stars indicate excess emission in the color space. Further investigations based on the SIMBAD data help to clarify their nature as classical Be stars, which are found to be located in a well isolated region on each of the color-color (C-C) diagrams. Several kinds of contaminants were then removed based on their distribution in the C-C diagrams. A test sample of Herbig Ae/Be stars and classical T Tauri stars were cross-identified with the 2MASS and AKARI catalogs to define the loci of YSOs with different masses on the C-C diagrams. Well classified Class I and Class II sources were taken as a second test sample to discriminate between various types of YSOs at possibly different evolutionary stages. This helped to define the loci of different types of YSOs and a set of criteria for selecting YSOs based on their colors in the near- and mid-infrared. Candidate YSOs toward IC 1396 indicating excess emission in the near-infrared were employed to verify the validity of the new source selection criteria defined based on C-C diagrams compiled with the 2MASS and AKARI data. Optical spectroscopy and spectral energy distributions of the IC 1396 sample yield a clear identification of the YSOs and further confirm the criteria defined

  1. EFFICIENT SELECTION AND CLASSIFICATION OF INFRARED EXCESS EMISSION STARS BASED ON AKARI AND 2MASS DATA

    International Nuclear Information System (INIS)

    Huang Yafang; Li Jinzeng; Rector, Travis A.; Mallamaci, Carlos C.

    2013-01-01

    The selection of young stellar objects (YSOs) based on excess emission in the infrared is easily contaminated by post-main-sequence stars and various types of emission line stars with similar properties. We define in this paper stringent criteria for an efficient selection and classification of stellar sources with infrared excess emission based on combined Two Micron All Sky Survey (2MASS) and AKARI colors. First of all, bright dwarfs and giants with known spectral types were selected from the Hipparcos Catalogue and cross-identified with the 2MASS and AKARI Point Source Catalogues to produce the main-sequence and the post-main-sequence tracks, which appear as expected as tight tracks with very small dispersion. However, several of the main-sequence stars indicate excess emission in the color space. Further investigations based on the SIMBAD data help to clarify their nature as classical Be stars, which are found to be located in a well isolated region on each of the color-color (C-C) diagrams. Several kinds of contaminants were then removed based on their distribution in the C-C diagrams. A test sample of Herbig Ae/Be stars and classical T Tauri stars were cross-identified with the 2MASS and AKARI catalogs to define the loci of YSOs with different masses on the C-C diagrams. Well classified Class I and Class II sources were taken as a second test sample to discriminate between various types of YSOs at possibly different evolutionary stages. This helped to define the loci of different types of YSOs and a set of criteria for selecting YSOs based on their colors in the near- and mid-infrared. Candidate YSOs toward IC 1396 indicating excess emission in the near-infrared were employed to verify the validity of the new source selection criteria defined based on C-C diagrams compiled with the 2MASS and AKARI data. Optical spectroscopy and spectral energy distributions of the IC 1396 sample yield a clear identification of the YSOs and further confirm the criteria defined

  2. Safety and efficacy of neratinib in combination with weekly paclitaxel and trastuzumab in women with metastatic HER2‑positive breast cancer: an NSABP Foundation Research Program phase I study.

    Science.gov (United States)

    Jankowitz, Rachel C; Abraham, Jame; Tan, Antoinette R; Limentani, Steven A; Tierno, Marni B; Adamson, Laura M; Buyse, Marc; Wolmark, Norman; Jacobs, Samuel A

    2013-12-01

    Neratinib is an oral, small-molecule inhibitor that irreversibly binds to pan-HER (ErbB) receptor tyrosine kinases. Studies suggest that dual anti-HER therapies utilized in breast cancer patients are more efficacious than single agents in both the metastatic and neoadjuvant settings. In this phase I study, neratinib was combined with trastuzumab and paclitaxel in metastatic HER2-positive patients. Twenty-one patients entered this dose-escalation study to determine the maximum-tolerated dose, safety, and efficacy of neratinib (120 up to 240 mg/day) with trastuzumab (4 mg/kg IV loading dose, then 2 mg/kg IV weekly), and paclitaxel (80 mg/m(2) IV days 1, 8, and 15 of a 28-day cycle) in women with HER2-positive metastatic breast cancer previously treated with anti-HER agent(s) and a taxane. The recommended phase II dose of neratinib with trastuzumab and paclitaxel was 200 mg/day. Common grade 3/4 adverse events were diarrhea (38 %), dehydration (14 %), electrolyte imbalance (19 %), and fatigue (19 %). With mandated primary diarrheal prophylaxis, ≥grade 3 diarrhea was not observed. Objective responses, complete (CR) and partial (PR), occurred in eight patients (38 %), with a clinical benefit of CR + PR+ stable disease (SD) ≥24 weeks in 11 patients (52 %). Median time-to-disease progression was 3.7 months. Dual anti-HER blockade with neratinib and trastuzumab resulted in significant clinical benefit despite prior exposure to trastuzumab, lapatinib, T-DM1, a taxane, and multiple lines of chemotherapy. In selected populations, inhibiting multiple ErbB-family receptors may be more advantageous than single-agent inhibition. Based on favorable tolerance and efficacy, this three-drug combination will be further assessed in a randomized phase II neoadjuvant trial (NSABP FB-7:NCT01008150).

  3. The effects of selected flavonoids on cytochromes P450 in rat liver and small intestine

    Czech Academy of Sciences Publication Activity Database

    Křížková, J.; Burdová, K.; Stiborová, M.; Křen, Vladimír; Hodek, P.

    2009-01-01

    Roč. 2, č. 3 (2009), s. 201-204 ISSN 1337-6853 R&D Projects: GA ČR GD305/09/H008 Institutional research plan: CEZ:AV0Z50200510 Keywords : flavonoids * cytochrome p450 * small intestine Subject RIV: EE - Microbiology, Virology

  4. Staphylococcus aureus Adapts to Oxidative Stress by Producing H2O2-Resistant Small-Colony Variants via the SOS Response

    Science.gov (United States)

    Painter, Kimberley L.; Strange, Elizabeth; Bamford, Kathleen B.; Armstrong-James, Darius

    2015-01-01

    The development of chronic and recurrent Staphylococcus aureus infections is associated with the emergence of slow-growing mutants known as small-colony variants (SCVs), which are highly tolerant of antibiotics and can survive inside host cells. However, the host and bacterial factors which underpin SCV emergence during infection are poorly understood. Here, we demonstrate that exposure of S. aureus to sublethal concentrations of H2O2 leads to a specific, dose-dependent increase in the population frequency of gentamicin-resistant SCVs. Time course analyses revealed that H2O2 exposure caused bacteriostasis in wild-type cells during which time SCVs appeared spontaneously within the S. aureus population. This occurred via a mutagenic DNA repair pathway that included DNA double-strand break repair proteins RexAB, recombinase A, and polymerase V. In addition to triggering SCV emergence by increasing the mutation rate, H2O2 also selected for the SCV phenotype, leading to increased phenotypic stability and further enhancing the size of the SCV subpopulation by reducing the rate of SCV reversion to the wild type. Subsequent analyses revealed that SCVs were significantly more resistant to the toxic effects of H2O2 than wild-type bacteria. With the exception of heme auxotrophs, gentamicin-resistant SCVs displayed greater catalase activity than wild-type bacteria, which contributed to their resistance to H2O2. Taken together, these data reveal a mechanism by which S. aureus adapts to oxidative stress via the production of a subpopulation of H2O2-resistant SCVs with enhanced catalase production. PMID:25690100

  5. Laser surgery for selected small animal soft-tissue conditions

    Science.gov (United States)

    Bartels, Kenneth E.

    1991-05-01

    With the acquisition of a Nd:YAG and a CO2 laser in the College of Veterinary Medicine at Oklahoma State University in 1989, over 100 small animal clinical cases have been managed with these modern modalities for surgical excision and tissue vaporization. Most procedures have been for oncologic problems, but inflammatory, infectious, or congenital conditions including vaporization of acral lick 'granulomas,' excision/vaporization of foreign body induced, infected draining tracts, and resection of elongated soft palates have been successfully accomplished. Laser excision or vaporization of both benign and malignant neoplasms have effectively been performed and include feline nasal squamous cell carcinoma, mast cell tumors, and rectal/anal neoplasms. Results to date have been excellent with animals exhibiting little postoperative pain, swelling, and inflammation. Investigations involving application of laser energy for tissue welding of esophageal lacerations and hepatitic interstitial hyperthermia for metastatic colorectal cancer have also shown potential. A review of cases with an emphasis on survival time and postoperative morbidity suggests that carefully planned laser surgical procedures in clinical veterinary practice done with standardized protocols and techniques offer an acceptable means of treating conditions that were previously considered extremely difficult or virtually impossible to perform.

  6. Selection in the dopamine receptor 2 gene: a candidate SNP study

    Directory of Open Access Journals (Sweden)

    Tobias Göllner

    2015-08-01

    Full Text Available Dopamine is a major neurotransmitter in the human brain and is associated with various diseases. Schizophrenia, for example, is treated by blocking the dopamine receptors type 2. Shaner, Miller & Mintz (2004 stated that schizophrenia was the low fitness variant of a highly variable mental trait. We therefore explore whether the dopamine receptor 2 gene (DRD2 underwent any selection processes. We acquired genotype data of the 1,000 Genomes project (phase I, which contains 1,093 individuals from 14 populations. We included single nucleotide polymorphisms (SNPs with two minor allele frequencies (MAFs in the analysis: MAF over 0.05 and over 0.01. This is equivalent to 151 SNPs (MAF > 0.05 and 246 SNPs (MAF > 0.01 for DRD2. We used two different approaches (an outlier approach and a Bayesian approach to detect loci under selection. The combined results of both approaches yielded nine (MAF > 0.05 and two candidate SNPs (MAF > 0.01, under balancing selection. We also found weak signs for directional selection on DRD2, but in our opinion these were too weak to draw any final conclusions on directional selection in DRD2. All candidates for balancing selection are in the intronic region of the gene and only one (rs12574471 has been mentioned in the literature. Two of our candidate SNPs are located in specific regions of the gene: rs80215768 lies within a promoter flanking region and rs74751335 lies within a transcription factor binding site. We strongly encourage research on our candidate SNPs and their possible effects.

  7. Comparative immunohistochemical expression of β-catenin, EGFR, ErbB2, and p63 in adamantinomatous and papillary craniopharyngiomas

    Directory of Open Access Journals (Sweden)

    Ghada E. Esheba

    2015-09-01

    Conclusion: Nuclear accumulation of β-catenin is a diagnostic hallmark of the ACP and is very helpful in the differential diagnosis between both ACP and PCP in the setting of small biopsies. Moreover, the restricted nuclear β-catenin accumulation in the cohesive cell clusters within the whorl-like areas supports that aberrant β-catenin expression may play a role in the morphogenesis of ACP.

  8. Reactions of small negative ions with O2(a 1[Delta]g) and O2(X 3[Sigma]g-)

    Science.gov (United States)

    Midey, Anthony; Dotan, Itzhak; Seeley, J. V.; Viggiano, A. A.

    2009-02-01

    The rate constants and product ion branching ratios were measured for the reactions of various small negative ions with O2(X 3[Sigma]g-) and O2(a 1[Delta]g) in a selected ion flow tube (SIFT). Only NH2- and CH3O- were found to react with O2(X) and both reactions were slow. CH3O- reacted by hydride transfer, both with and without electron detachment. NH2- formed both OH-, as observed previously, and O2-, the latter via endothermic charge transfer. A temperature study revealed a negative temperature dependence for the former channel and Arrhenius behavior for the endothermic channel, resulting in an overall rate constant with a minimum at 500 K. SF6-, SF4-, SO3- and CO3- were found to react with O2(a 1[Delta]g) with rate constants less than 10-11 cm3 s-1. NH2- reacted rapidly with O2(a 1[Delta]g) by charge transfer. The reactions of HO2- and SO2- proceeded moderately with competition between Penning detachment and charge transfer. SO2- produced a SO4- cluster product in 2% of reactions and HO2- produced O3- in 13% of the reactions. CH3O- proceeded essentially at the collision rate by hydride transfer, again both with and without electron detachment. These results show that charge transfer to O2(a 1[Delta]g) occurs readily if the there are no restrictions on the ion beyond the reaction thermodynamics. The SO2- and HO2- reactions with O2(a) are the only known reactions involving Penning detachment besides the reaction with O2- studied previously [R.S. Berry, Phys. Chem. Chem. Phys., 7 (2005) 289-290].

  9. The Effects of Bisphenol A (BPA) on ErbB2 Positive Breast Cancer

    Science.gov (United States)

    2010-11-01

    adolescence [2]. As this population of women prenatally exposed to DES has aged, it has become increasingly apparent that they are also more susceptible...of action is implicated. Fertil Steril, 2008. 89(2 Suppl): p. e41. 27. Timms, B.G., et al., Estrogenic chemicals in plastic and oral contraceptives

  10. 44 CFR 321.2 - Selection of the mobilization base.

    Science.gov (United States)

    2010-10-01

    ... base. 321.2 Section 321.2 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT OF HOMELAND SECURITY PREPAREDNESS MAINTENANCE OF THE MOBILIZATION BASE (DEPARTMENT OF DEFENSE, DEPARTMENT OF ENERGY, MARITIME ADMINISTRATION) § 321.2 Selection of the mobilization base. (a) The Department...

  11. A synopsis of experimental activities on small-break LOCA

    International Nuclear Information System (INIS)

    Hein, D.

    1984-01-01

    Through reactor safety studies like WASH 1400 or the ''Deutsche Risiko-Studie'' the attention has turned from large break loss of coolant accidents to small breaks because of the high contribution of this type of accidents to core meltdown. But only after the TMI-2 accident were also the main activities in the experimental fields shifted world-wide to the small break LOCAs. Since TMI numerous research programs have either been finished or are underway. This review paper presents: a classification of the various types of transients according to break size; a discussion of major physical phenomena associated with a small break LOCA, and a description of a few selected research programs and the most important results achieved. (author)

  12. Comparison of HER2 and phospho-HER2 expression between biopsy and resected breast cancer specimens using a quantitative assessment method.

    Directory of Open Access Journals (Sweden)

    Yalai Bai

    Full Text Available BACKGROUND: HER2/Neu (ErbB-2 overexpression, which occurs in 15-20% of breast cancer cases, is associated with better response to treatment with the drug trastuzumab. PhosphoHER2 (pHER2 has been evaluated for prediction of response to trastuzumab. Both markers are heterogeneously detected and are potentially subject to loss as a consequence of delayed time to fixation. Here, we quantitatively assess both markers in core needle biopsies (CNBs and matched tumor resections to assess concordance between the core and the resection and between HER2 and pHER2. METHODS: A selected retrospective collection of archival breast cancer cases yielded 67 cases with both core and resection specimens. Both HER2 and pTyr(1248HER2 were analyzed by the AQUA® method of quantitative immunofluorescence on each specimen pair. RESULTS: Both HER2 immunoreactivity (P<0.0001 and pTyr(1248HER2 immunoreactivity (P<0.0001 were lower in resections relative to CNB specimens. However, clinical implications of this change may not be evident since no case changed from 3+ (CNB to negative (resection. Assessment of pTyr(1248HER2 showed no direct correlation with HER2 in either CNB or resection specimens. CONCLUSIONS: The data suggest that measurement of both HER2 and phospho- Tyr(1248HER2, in formalin-fixed tissue by immunological methods is significantly affected by pre-analytic variables. The current study warrants the adequate handling of resected specimens for the reproducible evaluation of HER2 and pHER2. The level of pTyr(1248HER2, was not correlated to total HER2 protein. Further studies are required to determine the significance of these observations with respect to response to HER2 directed therapies.

  13. Culture-Related Topic Selection in Small Talk Conversations across Germany and Japan

    DEFF Research Database (Denmark)

    Endrass, Birgit; Nakano, Yukiko; Lipi, Afia Akhter

    2011-01-01

    Small talk can be used in order to build a positive relationship towards a virtual character. However the choice of topics in a conversation can be dependent on social backgrounds such as culture. In this paper, we explore culture-related differences in small talk for the German and Japanese...... cultures. Based on findings from the literature and verified by a corpus analysis, we integrated prototypical German and Japanese small talk conversations into a multiagent system. In evaluation studies conducted in the two target cultures, we investigated whether participants prefer agent dialogs...

  14. Characterization of acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) enzyme of human small intestine.

    Science.gov (United States)

    Hiramine, Yasushi; Tanabe, Toshizumi

    2011-06-01

    Acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) enzyme plays a significant role in dietary triacylglycerol (TAG) absorption in the small intestine. However, the characteristics of human intestinal DGAT enzyme have not been examined in detail. The aim of our study was to characterize the human intestinal DGAT enzyme by examining acyl-CoA specificity, temperature dependency, and selectivity for 1,2-diacylglycerol (DAG) or 1,3-DAG. We detected DGAT activity of human intestinal microsome and found that the acyl-CoA specificity and temperature dependency of intestinal DGAT coincided with those of recombinant human DGAT1. To elucidate the selectivity of human intestinal DGAT to 1,2-DAG or 1,3-DAG, we conducted acyl-coenzyme A:monoacylglycerol acyltransferase assays using 1- or 2-monoacylglycerol (MAG) as substrates. When 2-MAG was used as acyl acceptor, both 1,2-DAG and TAG were generated; however, when 1-MAG was used, 1,3-DAG was predominantly observed and little TAG was detected. These findings suggest that human small intestinal DGAT, which is mainly encoded by DGAT1, utilizes 1,2-DAG as the substrate to form TAG. This study will contribute to understand the lipid absorption profile in the small intestine.

  15. New Technique for Cryogenically Cooling Small Test Articles

    Science.gov (United States)

    Rodriquez, Karen M.; Henderson, Donald J.

    2011-01-01

    Convective heat removal techniques to rapidly cool small test articles to Earth-Moon L2 temperatures of 77 K were accomplished through the use of liquid nitrogen (LN2). By maintaining a selected pressure range on the saturation curve, test articles were cooled below the LN2 boiling point at ambient pressure in less than 30 min. Difficulties in achieving test pressures while maintaining the temperature tolerance necessitated a modification to the original system to include a closed loop conductive cold plate and cryogenic shroud

  16. ETORICOXIB IS A NEW SELECTIVE CYCLOOXYGENASE-2 INHIBITOR

    Directory of Open Access Journals (Sweden)

    A E Karateev

    2009-01-01

    Full Text Available The paper provides the clinical characteristics of etoricoxib (Arcoxia, a new selective cyclooxygenase-2 inhibitor having unique properties, which permits it to be distinguished among other nonsteroidal anti-inflammatory agents.

  17. ETORICOXIB IS A NEW SELECTIVE CYCLOOXYGENASE-2 INHIBITOR

    Directory of Open Access Journals (Sweden)

    A E Karateev

    2009-06-01

    Full Text Available The paper provides the clinical characteristics of etoricoxib (Arcoxia, a new selective cyclooxygenase-2 inhibitor having unique properties, which permits it to be distinguished among other nonsteroidal anti-inflammatory agents.

  18. Identification and characterization of small molecule modulators of the Epstein-Barr virus-induced gene 2 (EBI2) receptor

    DEFF Research Database (Denmark)

    Gessier, Francois; Preuss, Inga; Yin, Hong

    2014-01-01

    immune response and has been genetically linked to autoimmune diseases such as type I diabetes ( Nature 2010 , 467 , 460 ). Here we describe the isolation of a potent small molecule antagonist for the EBI2 receptor. First, we identified a small molecule agonist NIBR51 (1), which enabled identification...

  19. Small Molecule Inhibitors That Selectively Block Dengue Virus Methyltransferase*

    Science.gov (United States)

    Lim, Siew Pheng; Sonntag, Louis Sebastian; Noble, Christian; Nilar, Shahul H.; Ng, Ru Hui; Zou, Gang; Monaghan, Paul; Chung, Ka Yan; Dong, Hongping; Liu, Boping; Bodenreider, Christophe; Lee, Gladys; Ding, Mei; Chan, Wai Ling; Wang, Gang; Jian, Yap Li; Chao, Alexander Theodore; Lescar, Julien; Yin, Zheng; Vedananda, T. R.; Keller, Thomas H.; Shi, Pei-Yong

    2011-01-01

    Crystal structure analysis of Flavivirus methyltransferases uncovered a flavivirus-conserved cavity located next to the binding site for its cofactor, S-adenosyl-methionine (SAM). Chemical derivatization of S-adenosyl-homocysteine (SAH), the product inhibitor of the methylation reaction, with substituents that extend into the identified cavity, generated inhibitors that showed improved and selective activity against dengue virus methyltransferase (MTase), but not related human enzymes. Crystal structure of dengue virus MTase with a bound SAH derivative revealed that its N6-substituent bound in this cavity and induced conformation changes in residues lining the pocket. These findings demonstrate that one of the major hurdles for the development of methyltransferase-based therapeutics, namely selectivity for disease-related methyltransferases, can be overcome. PMID:21147775

  20. Selecting Advanced Software Technology in Two Small Manufacturing Enterprises

    National Research Council Canada - National Science Library

    Anderson, Bill; Estrin, Len; Buhman, Charles

    2004-01-01

    .... These challenges may include the lack of awareness of the specific technologies and commercial products available, the lack of ability to select the appropriate product, and the lack of skill sets...

  1. Mutational analysis of EGFR and related signaling pathway genes in lung adenocarcinomas identifies a novel somatic kinase domain mutation in FGFR4.

    Directory of Open Access Journals (Sweden)

    Jenifer L Marks

    2007-05-01

    Full Text Available Fifty percent of lung adenocarcinomas harbor somatic mutations in six genes that encode proteins in the EGFR signaling pathway, i.e., EGFR, HER2/ERBB2, HER4/ERBB4, PIK3CA, BRAF, and KRAS. We performed mutational profiling of a large cohort of lung adenocarcinomas to uncover other potential somatic mutations in genes of this signaling pathway that could contribute to lung tumorigenesis.We analyzed genomic DNA from a total of 261 resected, clinically annotated non-small cell lung cancer (NSCLC specimens. The coding sequences of 39 genes were screened for somatic mutations via high-throughput dideoxynucleotide sequencing of PCR-amplified gene products. Mutations were considered to be somatic only if they were found in an independent tumor-derived PCR product but not in matched normal tissue. Sequencing of 9MB of tumor sequence identified 239 putative genetic variants. We further examined 22 variants found in RAS family genes and 135 variants localized to exons encoding the kinase domain of respective proteins. We identified a total of 37 non-synonymous somatic mutations; 36 were found collectively in EGFR, KRAS, BRAF, and PIK3CA. One somatic mutation was a previously unreported mutation in the kinase domain (exon 16 of FGFR4 (Glu681Lys, identified in 1 of 158 tumors. The FGFR4 mutation is analogous to a reported tumor-specific somatic mutation in ERBB2 and is located in the same exon as a previously reported kinase domain mutation in FGFR4 (Pro712Thr in a lung adenocarcinoma cell line.This study is one of the first comprehensive mutational analyses of major genes in a specific signaling pathway in a sizeable cohort of lung adenocarcinomas. Our results suggest the majority of gain-of-function mutations within kinase genes in the EGFR signaling pathway have already been identified. Our findings also implicate FGFR4 in the pathogenesis of a subset of lung adenocarcinomas.

  2. Selective adsorption of thiophenic compounds from fuel over TiO{sub 2}/SiO{sub 2} under UV-irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Miao, Guang [School of Chemistry and Chemical Engineering, South China University of Technology, Guangzhou 510640 (China); Ye, Feiyan [Key Laboratory of Enhanced Heat Transfer and Energy Conservation of the Ministry of Education South China University of Technology, Guangzhou 510640 (China); Wu, Luoming; Ren, Xiaoling [School of Chemistry and Chemical Engineering, South China University of Technology, Guangzhou 510640 (China); Xiao, Jing, E-mail: cejingxiao@scut.edu.cn [School of Chemistry and Chemical Engineering, South China University of Technology, Guangzhou 510640 (China); Li, Zhong, E-mail: cezhli@scut.edu.cn [Key Laboratory of Enhanced Heat Transfer and Energy Conservation of the Ministry of Education South China University of Technology, Guangzhou 510640 (China); Wang, Haihui [Key Laboratory of Enhanced Heat Transfer and Energy Conservation of the Ministry of Education South China University of Technology, Guangzhou 510640 (China)

    2015-12-30

    Highlights: • TiO{sub 2}/SiO{sub 2} was developed for selective adsorption of DBTs under UV irradiation. • Remarkable adsorption uptake and selectivity were achieved for deep desulfurization. • Introduction of TiO{sub 2} into SiO{sub 2} enhanced its adsorption for DBTO{sub 2}. • Adsorption mechanism using TiO{sub 2}/SiO{sub 2} under UV irradiation was elucidated. - Abstract: This study investigates selective adsorption of thiophenic compounds from fuel over TiO{sub 2}/SiO{sub 2} under UV-irradiation. The TiO{sub 2}/SiO{sub 2} adsorbents were prepared and then characterized by N{sub 2} adsorption, X-ray diffraction and X-ray photoelectron spectroscopy. Adsorption isotherms, selectivity and kinetics of TiO{sub 2}/SiO{sub 2} were measured in a UV built-in batch reactor. It was concluded that (a) with the employment of UV-irradiation, high organosulfur uptake of 5.12 mg/g was achieved on the optimized 0.3TiO{sub 2}/0.7SiO{sub 2} adsorbent at low sulfur concentration of 15 ppmw-S, and its adsorption selectivity over naphthalene was up to 325.5; (b) highly dispersed TiO{sub 2} served as the photocatalytic sites for DBT oxidation, while SiO{sub 2} acted as the selective adsorption sites for the corresponding oxidized DBT using TiO{sub 2} as a promoter, the two types of active sites worked cooperatively to achieve the high adsorption selectivity of TiO{sub 2}/SiO{sub 2}; (c) The kinetic rate-determining step for the UV photocatalysis-assisted adsorptive desulfurization (PADS) over TiO{sub 2}/SiO{sub 2} was DBT oxidation; (d) consecutive adsorption-regeneration cycles suggested that the 0.3TiO{sub 2}/0.7SiO{sub 2} adsorbent can be regenerated by acetonitrile washing followed with oxidative air treatment. This work demonstrated an effective PADS approach to greatly enhance adsorption capacity and selectivity of thiophenic compounds at low concentrations for deep desulfurization under ambient conditions.

  3. Imidazopyridine CB2 agonists: optimization of CB2/CB1 selectivity and implications for in vivo analgesic efficacy.

    Science.gov (United States)

    Trotter, B Wesley; Nanda, Kausik K; Burgey, Christopher S; Potteiger, Craig M; Deng, James Z; Green, Ahren I; Hartnett, John C; Kett, Nathan R; Wu, Zhicai; Henze, Darrell A; Della Penna, Kimberly; Desai, Reshma; Leitl, Michael D; Lemaire, Wei; White, Rebecca B; Yeh, Suzie; Urban, Mark O; Kane, Stefanie A; Hartman, George D; Bilodeau, Mark T

    2011-04-15

    A new series of imidazopyridine CB2 agonists is described. Structural optimization improved CB2/CB1 selectivity in this series and conferred physical properties that facilitated high in vivo exposure, both centrally and peripherally. Administration of a highly selective CB2 agonist in a rat model of analgesia was ineffective despite substantial CNS exposure, while administration of a moderately selective CB2/CB1 agonist exhibited significant analgesic effects. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Five Novel Selection Policies for N2R Network Structures

    DEFF Research Database (Denmark)

    Pedersen, Jens Myrup; Riaz, Muhammad Tahir; Madsen, Ole Brun

    2006-01-01

    This paper shows how 5 new selection policies can be applied to N2R structures. For each number of nodes, a selection policy determines which topology is chosen. Compared to approaches taken previously, the policies proposed in this paper allow us to choose structures which are significantly easi...... to implement, while having only slightly longer distances. The 5 policies reflect different trade-offs between distances and ease of implementation, and two of them explore the potentials of using N2R(p; q; r) instead of N2R(p; q) structures....

  5. Differential Nanos 2 protein stability results in selective germ cell accumulation in the sea urchin.

    Science.gov (United States)

    Oulhen, Nathalie; Wessel, Gary M

    2016-10-01

    Nanos is a translational regulator required for the survival and maintenance of primordial germ cells. In the sea urchin, Strongylocentrotus purpuratus (Sp), Nanos 2 mRNA is broadly transcribed but accumulates specifically in the small micromere (sMic) lineage, in part because of the 3'UTR element GNARLE leads to turnover in somatic cells but retention in the sMics. Here we found that the Nanos 2 protein is also selectively stabilized; it is initially translated throughout the embryo but turned over in the future somatic cells and retained only in the sMics, the future germ line in this animal. This differential stability of Nanos protein is dependent on the open reading frame (ORF), and is independent of the sumoylation and ubiquitylation pathways. Manipulation of the ORF indicates that 68 amino acids in the N terminus of the Nanos protein are essential for its stability in the sMics whereas a 45 amino acid element adjacent to the zinc fingers targets its degradation. Further, this regulation of Nanos protein is cell autonomous, following formation of the germ line. These results are paradigmatic for the unique presence of Nanos in the germ line by a combination of selective RNA retention, distinctive translational control mechanisms (Oulhen et al., 2013), and now also by defined Nanos protein stability. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Selective Nodal Irradiation on Basis of 18FDG-PET Scans in Limited-Disease Small-Cell Lung Cancer: A Prospective Study

    International Nuclear Information System (INIS)

    Loon, Judith van; De Ruysscher, Dirk; Wanders, Rinus; Boersma, Liesbeth; Simons, Jean; Oellers, Michel; Dingemans, Anne-Marie C.; Hochstenbag, Monique; Bootsma, Gerben; Geraedts, Wiel; Pitz, Cordula; Teule, Jaap; Rhami, Ali; Thimister, Willy; Snoep, Gabriel; Dehing-Oberije, Cary; Lambin, Philippe

    2010-01-01

    Purpose: To evaluate the results of selective nodal irradiation on basis of 18 F-deoxyglucose positron emission tomography (PET) scans in patients with limited-disease small-cell lung cancer (LD-SCLC) on isolated nodal failure. Methods and Materials: A prospective study was performed of 60 patients with LD-SCLC. Radiotherapy was given to a dose of 45 Gy in twice-daily fractions of 1.5 Gy, concurrent with carboplatin and etoposide chemotherapy. Only the primary tumor and the mediastinal lymph nodes involved on the pretreatment PET scan were irradiated. A chest computed tomography (CT) scan was performed 3 months after radiotherapy completion and every 6 months thereafter. Results: A difference was seen in the involved nodal stations between the pretreatment 18 F-deoxyglucose PET scans and computed tomography scans in 30% of patients (95% confidence interval, 20-43%). Of the 60 patients, 39 (65%; 95% confidence interval [CI], 52-76%) developed a recurrence; 2 patients (3%, 95% CI, 1-11%) experienced isolated regional failure. The median actuarial overall survival was 19 months (95% CI, 17-21). The median actuarial progression-free survival was 14 months (95% CI, 12-16). 12% (95% CI, 6-22%) of patients experienced acute Grade 3 (Common Terminology Criteria for Adverse Events, version 3.0) esophagitis. Conclusion: PET-based selective nodal irradiation for LD-SCLC resulted in a low rate of isolated nodal failures (3%), with a low percentage of acute esophagitis. These findings are in contrast to those from our prospective study of CT-based selective nodal irradiation, which resulted in an unexpectedly high percentage of isolated nodal failures (11%). Because of the low rate of isolated nodal failures and toxicity, we believe that our data support the use of PET-based SNI for LD-SCLC.

  7. 17 CFR 270.3c-2 - Definition of beneficial ownership in small business investment companies.

    Science.gov (United States)

    2010-04-01

    ... 1940 § 270.3c-2 Definition of beneficial ownership in small business investment companies. For the... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Definition of beneficial ownership in small business investment companies. 270.3c-2 Section 270.3c-2 Commodity and Securities...

  8. To Selection of Small-Capacity Turbine Type and Rated Conditions

    Directory of Open Access Journals (Sweden)

    N. B. Karnitsky

    2010-01-01

    Full Text Available Profitability of industrial-heating boiler transition to mini-TPP is revealed in the paper. The paper presents a comparative analysis of high- and low-speed turbines of small capacity.

  9. Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands

    DEFF Research Database (Denmark)

    Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein

    2014-01-01

    G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...

  10. Expression of ErbB3-binding protein-1 (EBP1 during primordial follicle formation: role of estradiol-17ß.

    Directory of Open Access Journals (Sweden)

    Anindit Mukherjee

    Full Text Available The formation of primordial follicles involves the interaction between the oocytes and surrounding somatic cells, which differentiate into granulosa cells. Estradiol-17ß (E promotes primordial follicle formation in vivo and in vitro; however, the underlying mechanisms are poorly understood. The expression of an ERBB3-binding protein 1 (EBP1 is downregulated in 8-day old hamster ovaries concurrent with the increase in serum estradiol levels and the formation of primordial follicles. The objectives of the present study were to determine the spatio-temporal expression and putative E regulation of EBP1 in ovarian cells during perinatal development with respect to primordial follicle formation. Hamster EBP1 nucleic acid and amino acid sequences were more than 93% and 98% similar, respectively, to those of mouse and human, and contained nucleolar localization signal, RNA-binding domain and several phosphorylation sites. EBP1 protein was present in somatic cells and oocytes from E15, and declined in oocytes by P1 and in somatic cells by P5. Thereafter, EBP1 expression increased through P7 with a transient decline on P8 primarily in interstitial cells. EBP1 mRNA levels mirrored protein expression pattern. E treatment on P1 and P4 upregulated EBP1 expression by P8 whereas E treatment on P4 downregulated it by 72 h suggesting a compensatory upregulation due to E pretreatment. Treatment with an FSH-antiserum, which suppressed primordial follicle formation, prevented the decline in EBP1 levels, and the effect was reversed by E treatment. Therefore, the results provide the first evidence that EBP1 may play an important role in mediating the effect of E in the differentiation of somatic cells into granulosa cells during primordial follicle formation.

  11. vuv fluorescence from selective high-order multiphoton excitation of N2

    International Nuclear Information System (INIS)

    Coffee, Ryan N.; Gibson, George N.

    2004-01-01

    Recent fluorescence studies suggest that ultrashort pulse laser excitation may be highly selective. Selective high-intensity laser excitation holds important consequences for the physics of multiphoton processes. To establish the extent of this selectivity, we performed a detailed comparative study of the vacuum ultraviolet fluorescence resulting from the interaction of N 2 and Ar with high-intensity infrared ultrashort laser pulses. Both N 2 and Ar reveal two classes of transitions, inner-valence ns ' l ' . From their pressure dependence, we associate each transition with either plasma or direct laser excitation. Furthermore, we qualitatively confirm such associations with the time dependence of the fluorescence signal. Remarkably, only N 2 presents evidence of direct laser excitation. This direct excitation produces ionic nitrogen fragments with inner-valence (2s) holes, two unidentified transitions, and one molecular transition, the N 2 + :X 2 Σ g + 2 Σ u + . We discuss these results in the light of a recently proposed model for multiphoton excitation

  12. Icotinib, a selective EGF receptor tyrosine kinase inhibitor, for the treatment of non-small-cell lung cancer.

    Science.gov (United States)

    Tan, Fenlai; Shi, Yuankai; Wang, Yinxiang; Ding, Lieming; Yuan, Xiaobin; Sun, Yan

    2015-01-01

    Advanced non-small-cell lung cancer (NSCLC) is the main cause for cancer-related mortality. Treatments for advanced NSCLC are largely palliative and a benefit plateau appears to have reached with the platinum-based chemotherapy regimens. EGF receptor (EGFR) tyrosine kinase inhibitors gefitinib, erlotinib and afatinib came up with prolonged progression-free survival and improved quality of life, especially in EGFR-mutated patients. Icotinib is an oral selective EGFR tyrosine kinase, which was approved by China Food and Drug administration in June 2011 for treating advanced NSCLC. Its approval was based on the registered Phase III trial (ICOGEN), which showed icotinib is noninferior to gefitinib. This review will discuss the role of icotinib in NSCLC, and its potential application and ongoing investigations.

  13. A solution to the vertical barΔI/sup →/vertical bar = 1/2 rule and other dynamical selection rules in particle physics

    International Nuclear Information System (INIS)

    Oneda, S.; Terasaki, K.

    1984-01-01

    Algebraic approach is developed in the framework of QCD and Electroweak theories. It is stressed that many seemingly different dynamical selection rules can share the same origin. In particular, derivation of vertical bar Δ I → vertical bar = 1/2 rule and explicit identification of its small violation are made for the Κ → 2 π decays, using new much milder soft-pion extrapolation. As a byproduct, the Β → ωπ decays are predicted to be predominantly λ = +-1 transitions in consistency with experiment

  14. Design and synthesis of small molecule agonists of EphA2 receptor.

    Science.gov (United States)

    Petty, Aaron; Idippily, Nethrie; Bobba, Viharika; Geldenhuys, Werner J; Zhong, Bo; Su, Bin; Wang, Bingcheng

    2018-01-01

    Ligand-independent activation of EphA2 receptor kinase promotes cancer metastasis and invasion. Activating EphA2 receptor tyrosine kinase with small molecule agonist is a novel strategy to treat EphA2 overexpressing cancer. In this study, we performed a lead optimization of a small molecule Doxazosin that was identified as an EphA2 receptor agonist. 33 new analogs were developed and evaluated; a structure-activity relationship was summarized based on the EphA2 activation of these derivatives. Two new derivative compounds 24 and 27 showed much improved activity compared to Doxazosin. Compound 24 possesses a bulky amide moiety, and compound 27 has a dimeric structure that is very different to the parental compound. Compound 27 with a twelve-carbon linker of the dimer activated the kinase and induced receptor internalization and cell death with the best potency. Another dimer with a six-carbon linker has significantly reduced potency compared to the dimer with a longer linker, suggesting that the length of the linker is critical for the activity of the dimeric agonist. To explore the receptor binding characteristics of the new molecules, we applied a docking study to examine how the small molecule binds to the EphA2 receptor. The results reveal that compounds 24 and 27 form more hydrogen bonds to EphA2 than Doxazosin, suggesting that they may have higher binding affinity to the receptor. Published by Elsevier Masson SAS.

  15. Cycloxygenase-2(cox-2) - a potential target for screening of small molecules as radiation countermeasure agents: an in silico study

    International Nuclear Information System (INIS)

    Joshi, Jayadev; Shrivastava, Nitisha; Dimri, Manali; Ghosh, Subhajit; Mandal, Rahul Shubhra; Prem Kumar, I.; Barik, Tapan Kumar

    2012-01-01

    COX-2 is well established for its role in inflammation and cancer, and has also been reported to play a significant role in radiation induced inflammation and by standard effect. It's already reported to have a role in protection against radiation induced damage suggesting it to be an important target for identifying novel radiation countermeasure agents. Present study aims at identifying novel small molecules from pharmacopoeia using COX-2 as target in-silico. Systematic search of the reported molecules exhibiting radiation protection revealed lat around 29 % (40 in 138) of them have a role in inflammation and a small percentage of these molecules (20 %; 8 in 40) are reported to as non steroidal anti-inflammatory drugs (NSAIDS). Docking studies performed further clarified that all these 8 radioprotective molecules shows high binding affinity and inhibit COX-2. Further Johns Hopkins clinical compound library (JHCCL), a collection of small molecule clinical compounds, were screened virtually for COX-2 inhibition by docking approach. Docking of around 1400 small molecules against COX-2 lead to identification of a number of previously unreported molecules which are likely to act as radioprotectors. (author)

  16. Cycloxygenase-2(cox-2) - a potential target for screening of small molecules as radiation countermeasure agents: an in silico study

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Jayadev; Shrivastava, Nitisha; Dimri, Manali; Ghosh, Subhajit; Mandal, Rahul Shubhra; Prem Kumar, I., E-mail: prem_indra@yahoo.co.in [Radiation Biosciences Division, Institute of Nuclear Medicine and Allied Sciences, Delhi (India); Barik, Tapan Kumar [P.G. Department of Zoology, Berhampur University, Berhampur (India)

    2012-07-01

    COX-2 is well established for its role in inflammation and cancer, and has also been reported to play a significant role in radiation induced inflammation and by standard effect. It's already reported to have a role in protection against radiation induced damage suggesting it to be an important target for identifying novel radiation countermeasure agents. Present study aims at identifying novel small molecules from pharmacopoeia using COX-2 as target in-silico. Systematic search of the reported molecules exhibiting radiation protection revealed lat around 29 % (40 in 138) of them have a role in inflammation and a small percentage of these molecules (20 %; 8 in 40) are reported to as non steroidal anti-inflammatory drugs (NSAIDS). Docking studies performed further clarified that all these 8 radioprotective molecules shows high binding affinity and inhibit COX-2. Further Johns Hopkins clinical compound library (JHCCL), a collection of small molecule clinical compounds, were screened virtually for COX-2 inhibition by docking approach. Docking of around 1400 small molecules against COX-2 lead to identification of a number of previously unreported molecules which are likely to act as radioprotectors. (author)

  17. The Lyman Continuum Escape Fraction of Emission Line-selected z ∼ 2.5 Galaxies Is Less Than 15%

    Energy Technology Data Exchange (ETDEWEB)

    Rutkowski, Michael J.; Hayes, Matthew [Department of Astronomy, AlbaNova University Centre, Stockholm University, SE-10691 Stockholm (Sweden); Scarlata, Claudia; Mehta, Vihang [Minnesota Institute for Astrophysics, University of Minnesota, 116 Church Street SE, Minneapolis, MN 55455 (United States); Henry, Alaina; Hathi, Nimish; Koekemoer, Anton M. [Space Telescope Science Institute, Baltimore, MD 21218 (United States); Cohen, Seth; Windhorst, Rogier [School of Earth and Space Exploration, Arizona State University, Tempe, AZ 85281 (United States); Teplitz, Harry I. [Infrared Processing and Analysis Center, California Institute of Technology, Pasadena, CA 91125 (United States); Haardt, Francesco [DiSAT, Università dellInsubria, via Valleggio 11, I-22100 Como (Italy); Siana, Brian [Department of Physics, University of California, Riverside, CA 92521 (United States)

    2017-06-01

    Recent work suggests that strong emission line, star-forming galaxies (SFGs) may be significant Lyman continuum leakers. We combine archival Hubble Space Telescope broadband ultraviolet and optical imaging (F275W and F606W, respectively) with emission line catalogs derived from WFC3 IR G141 grism spectroscopy to search for escaping Lyman continuum (LyC) emission from homogeneously selected z ∼ 2.5 SFGs. We detect no escaping Lyman continuum from SFGs selected on [O ii] nebular emission ( N = 208) and, within a narrow redshift range, on [O iii]/[O ii]. We measure 1 σ upper limits to the LyC escape fraction relative to the non-ionizing UV continuum from [O ii] emitters, f {sub esc} ≲ 5.6%, and strong [O iii]/[O ii] > 5 ELGs, f {sub esc} ≲ 14.0%. Our observations are not deep enough to detect f {sub esc} ∼ 10% typical of low-redshift Lyman continuum emitters. However, we find that this population represents a small fraction of the star-forming galaxy population at z ∼ 2. Thus, unless the number of extreme emission line galaxies grows substantially to z ≳ 6, such galaxies may be insufficient for reionization. Deeper survey data in the rest-frame ionizing UV will be necessary to determine whether strong line ratios could be useful for pre-selecting LyC leakers at high redshift.

  18. The Lyman Continuum Escape Fraction of Emission Line-selected z ∼ 2.5 Galaxies Is Less Than 15%

    International Nuclear Information System (INIS)

    Rutkowski, Michael J.; Hayes, Matthew; Scarlata, Claudia; Mehta, Vihang; Henry, Alaina; Hathi, Nimish; Koekemoer, Anton M.; Cohen, Seth; Windhorst, Rogier; Teplitz, Harry I.; Haardt, Francesco; Siana, Brian

    2017-01-01

    Recent work suggests that strong emission line, star-forming galaxies (SFGs) may be significant Lyman continuum leakers. We combine archival Hubble Space Telescope broadband ultraviolet and optical imaging (F275W and F606W, respectively) with emission line catalogs derived from WFC3 IR G141 grism spectroscopy to search for escaping Lyman continuum (LyC) emission from homogeneously selected z ∼ 2.5 SFGs. We detect no escaping Lyman continuum from SFGs selected on [O ii] nebular emission ( N = 208) and, within a narrow redshift range, on [O iii]/[O ii]. We measure 1 σ upper limits to the LyC escape fraction relative to the non-ionizing UV continuum from [O ii] emitters, f _e_s_c ≲ 5.6%, and strong [O iii]/[O ii] > 5 ELGs, f _e_s_c ≲ 14.0%. Our observations are not deep enough to detect f _e_s_c ∼ 10% typical of low-redshift Lyman continuum emitters. However, we find that this population represents a small fraction of the star-forming galaxy population at z ∼ 2. Thus, unless the number of extreme emission line galaxies grows substantially to z ≳ 6, such galaxies may be insufficient for reionization. Deeper survey data in the rest-frame ionizing UV will be necessary to determine whether strong line ratios could be useful for pre-selecting LyC leakers at high redshift.

  19. Selectivity enhancement of indium-doped SnO2 gas sensors

    International Nuclear Information System (INIS)

    Salehi, A.

    2002-01-01

    Indium doping was used to enhance the selectivity of SnO 2 gas sensor. Both indium-doped and undoped SnO 2 gas sensors fabricated with different deposition techniques were investigated. The changes in the sensitivity of the sensors caused by selective gases (hydrogen and wood smoke) ranging from 500 to 3000 ppm were measured at different temperatures from 50 to 300 deg. C. The sensitivity peaks of the samples exhibit different values for selective gases with a response time of approximately 0.5 s. Thermally evaporated indium-doped SnO 2 gas sensor shows a considerable increase in the sensitivity peak of 27% in response to wood smoke, whereas it shows a sensitivity peak of 7% to hydrogen. This is in contrast to the sputter deposited indium-doped SnO 2 gas sensor, which exhibits a much lower sensitivity peak of approximately 2% to hydrogen and wood smoke compared to undoped SnO 2 gas sensors fabricated by chemical vapor deposition and spray pyrolysis. Scanning electron microscopy shows that different deposition techniques result in different porosity of the films. It is observed that the thermally evaporated indium-doped SnO 2 gas sensor shows high porosity, while the sputtered sample exhibits almost no porosity

  20. Assessment and Selection of Materials for Melbourne City Council House 2

    Directory of Open Access Journals (Sweden)

    Dominique Hes

    2012-11-01

    Full Text Available This paper highlights the role of material selection in the development and contribution toward environmental excellence in the building project Council House 2 (CH2. The paper focuses on the assessment of material and the strategies used by the design team in CH2to ensure the best environmental result. The paper then goes on to explore in a case study the application of these strategies in the selection and specification of concrete on CH2. The purpose of the paper is to explore the difficulties and rewards of careful research of manufacturers' claims and the relative benefits of different materials. The paper concludes that the process of material selection adopted on this project has increased the education of architects and manufacturers alike as well as being environmentally beneficial.