WorldWideScience

Sample records for erbb-2 overexpressing breast

  1. A combination of Trastuzumab and 17-AAG induces enhanced ubiquitinylation and lysosomal pathway-dependent ErbB2 degradation and cytotoxicity in ErbB2-overexpressing breast cancer cells.

    Science.gov (United States)

    Raja, Srikumar M; Clubb, Robert J; Bhattacharyya, Mitra; Dimri, Manjari; Cheng, Hao; Pan, Wei; Ortega-Cava, Cesar; Lakku-Reddi, Alagarsamy; Naramura, Mayumi; Band, Vimla; Band, Hamid

    2008-10-01

    ErbB2 (or Her2/Neu) overexpression in breast cancer signifies poorer prognosis, yet it has provided an avenue for targeted therapy as demonstrated by the success of the humanized monoclonal antibody Trastuzumab (Herceptin). Resistance to Trastuzumab and eventual failure in most cases, however, necessitate alternate ErbB2-targeted therapies. HSP90 inhibitors such as 17-allylaminodemethoxygeldanamycin (17-AAG), potently downregulate the cell surface ErbB2. While the precise mechanisms of Trastuzumab or 17-AAG action remain unclear, ubiquitinylation-dependent proteasomal or lysosomal degradation of ErbB2 appears to play a substantial role. As Trastuzumab and 17-AAG induce the recruitment of distinct E3 ubiquitin ligases, Cbl and CHIP respectively, to ErbB2, we hypothesized that 17-AAG and Trastuzumab combination could induce a higher level of ubiquitinylation and downregulation of ErbB2 as compared to single drug treatments. We present biochemical and cell biological evidence that combined 17-AAG and Trastuzumab treatment of ErbB2-overexpressing breast cancer cell lines leads to enhanced ubiquitinylation, downregulation from the cell surface and lysosomal degradation of ErbB2. Importantly, combined 17-AAG and Trastuzumab treatment induced synergistic growth arrest and cell death specifically in ErbB2-overexpressing but not in ErbB2-low breast cancer cells. Our results suggest the 17-AAG and Trastuzumab combination as a mechanism-based combinatorial targeted therapy for ErbB2-overexpressing breast cancer patients.

  2. Human CD3+ T-Cells with the Anti-ERBB2 Chimeric Antigen Receptor Exhibit Efficient Targeting and Induce Apoptosis in ERBB2 Overexpressing Breast Cancer Cells

    Science.gov (United States)

    Munisvaradass, Rusheni; Kumar, Suresh; Govindasamy, Chandramohan; Alnumair, Khalid S.; Mok, Pooi Ling

    2017-01-01

    Breast cancer is a common malignancy among women. The innate and adaptive immune responses failed to be activated owing to immune modulation in the tumour microenvironment. Decades of scientific study links the overexpression of human epidermal growth factor receptor 2 (ERBB2) antigen with aggressive tumours. The Chimeric Antigen Receptor (CAR) coding for specific tumour-associated antigens could initiate intrinsic T-cell signalling, inducing T-cell activation, and cytotoxic activity without the need for major histocompatibility complex recognition. This renders CAR as a potentially universal immunotherapeutic option. Herein, we aimed to establish CAR in CD3+ T-cells, isolated from human peripheral blood mononucleated cells that could subsequently target and induce apoptosis in the ERBB2 overexpressing human breast cancer cell line, SKBR3. Constructed CAR was inserted into a lentiviral plasmid containing a green fluorescent protein tag and produced as lentiviral particles that were used to transduce activated T-cells. Transduced CAR-T cells were then primed with SKBR3 cells to evaluate their functionality. Results showed increased apoptosis in SKBR3 cells co-cultured with CAR-T cells compared to the control (non–transduced T-cells). This study demonstrates that CAR introduction helps overcome the innate limitations of native T-cells leading to cancer cell apoptosis. We recommend future studies should focus on in vivo cytotoxicity of CAR-T cells against ERBB2 expressing tumours. PMID:28885562

  3. Novel Peptide/Protein Delivery System Targeting erbB2-Overexpressing Breast Cancer Cells

    National Research Council Canada - National Science Library

    Yu, Dihua

    2002-01-01

    .... During this funding year, we focused on the delivery of erbB2 signal-blocking ESP peptides (objective 2) . Because of the complexity of biotin-penetratin-AHNP-ESP, the synthesis was unsuccessful...

  4. Polysomy of chromosome 17 in breast cancer tumors showing an overexpression of ERBB2: a study of 175 cases using fluorescence in situ hybridization and immunohistochemistry

    International Nuclear Information System (INIS)

    Salido, Marta; Solé, Francesc; Tusquets, Ignasi; Corominas, Josep M; Suarez, Marta; Espinet, Blanca; Corzo, Cristina; Bellet, Meritxell; Fabregat, Xavier; Serrano, Sergi

    2005-01-01

    One of the most common genetic aberrations associated with breast cancer is the amplification and overexpression of the ERBB2 proto-oncogene located at chromosome 17, bands q12-21. The amplification/overexpression occurs in 25 to 30% of all breast cancers. In breast cancer, aneusomy of chromosome 17, either monosomy or polysomy, is frequently observed by conventional cytogenetics and fluorescence in situ hybridization (FISH). The aim of this study was to discover whether or not numerical aberrations on chromosome 17 have a correlation to the amplification or overexpression of the ERBB2 gene and to analyze their clinical implications in subgroups showing 2+ or 3+ positive scores by immunohistochemistry (IHC). We used FISH on a series of 175 formalin-fixed paraffin-embedded breast carcinomas to detect ERBB2 amplification, using a dual-probe system for the simultaneous enumeration of the ERBB2 gene and the centromeric region of chromosome 17, as well as using IHC to detect overexpression. We analyzed clinical and pathological variables in a subgroup of patients with 2+ and 3+ IHC scores (147 patients), to describe any differences in clinicopathological characteristics between polysomic and non-polysomic cases with the use of the χ 2 test. We found 13% of cases presenting polysomy, and three cases presented monosomy 17 (2%). According to the status of the ERBB2 gene, instances of polysomy 17 were more frequently observed in non-amplified cases than in FISH-amplified cases, suggesting that the mechanism for ERBB2 amplification is independent of polysomy 17. Polysomy 17 was detected in patients with 2+ and 3+ IHC scores. We found that nodal involvement was more frequent in polysomic than in non-polysomic cases (P = 0.046). The determination of the copy number of chromosome 17 should be incorporated into the assesment of ERBB2 status. It might also be helpful to differentiate a subgroup of breast cancer patients with polysomy of chromosome 17 and overexpression of ERBB2

  5. Increased level of phosphorylated akt measured by chemiluminescence-linked immunosorbent assay is a predictor of poor prognosis in primary breast cancer overexpressing ErbB-2

    International Nuclear Information System (INIS)

    Cicenas, Jonas; Urban, Patrick; Vuaroqueaux, Vincent; Labuhn, Martin; Küng, Willy; Wight, Edward; Mayhew, Mark; Eppenberger, Urs; Eppenberger-Castori, Serenella

    2005-01-01

    Akt1, Akt2 and Akt3 kinases are downstream components of phosphoinositol 3-kinase derived signals from receptor tyrosine kinases, which influence cell growth, proliferation and survival. Akt2 overexpression and amplification have been described in breast, ovarian and pancreatic cancers. The present study was designed to investigate the prognostic significance of activated Akt in primary breast cancer and its association with other tumour biomarkers. Using a two-site chemiluminescence-linked immunosorbent assay, we measured the quantitative expression levels of total phosphorylated (P-S473) Akt (Akt1/Akt2/Akt3) on cytosol fractions obtained from fresh frozen tissue samples of 156 primary breast cancer patients. Akt phosphorylation was not associated with nodal status or ErbB-2 protein expression levels. High levels of phosphorylated Akt correlated (P < 0.01) with poor prognosis, and the significance of this correlation increased (P < 0.001) in the subset of patients with ErbB-2 overexpressing tumours. In addition, phosphorylated Akt was found to be associated with mRNA expression levels of several proliferation markers (e.g. thymidylate synthase), measured using quantitative real-time RT-PCR. Our findings demonstrate that, in breast cancer patients, Akt activation is associated with tumour proliferation and poor prognosis, particularly in the subset of patients with ErbB2-overexpressing tumours

  6. Role of Erbin in ErbB2-dependent breast tumor growth

    Science.gov (United States)

    Tao, Yanmei; Shen, Chengyong; Luo, Shiwen; Traoré, Wilfried; Marchetto, Sylvie; Santoni, Marie-Josée; Xu, Linlin; Wu, Biao; Shi, Chao; Mei, Jinghong; Bates, Ryan; Liu, Xihui; Zhao, Kai; Xiong, Wen-Cheng; Borg, Jean-Paul; Mei, Lin

    2014-01-01

    ErbB2 (v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2), a receptor tyrosine kinase of the ErbB family, is overexpressed in around 25% of breast cancers. In addition to forming a heterodimer with other ErbB receptors in response to ligand stimulation, ErbB2 can be activated in a ligand-independent manner. We report here that Erbin, an ErbB2-interacting protein that was thought to act as an antitumor factor, is specifically expressed in mammary luminal epithelial cells and facilitates ErbB2-dependent proliferation of breast cancer cells and tumorigenesis in MMTV-neu transgenic mice. Disruption of their interaction decreases ErbB2-dependent proliferation, and deletion of the PDZ domain in Erbin hinders ErbB2-dependent tumor development in MMTV-neu mice. Mechanistically, Erbin forms a complex with ErbB2, promotes its interaction with the chaperon protein HSP90, and thus prevents its degradation. Finally, ErbB2 and Erbin expression correlates in human breast tumor tissues. Together, these observations establish Erbin as an ErbB2 regulator for breast tumor formation and progression. PMID:25288731

  7. Breast cancer metastasis driven by ErbB2 and 14-3-3ξ: A division of labor

    OpenAIRE

    Wang, Yingqun

    2010-01-01

    Metastasis remains the leading cause of cancer morbidity and mortality. ErbB2, a metastasis-promoting oncoprotein, is overexpressed in 50–60% of noninvasive ductal carcinoma in situ (DCIS). However, only 25% of invasive breast cancer (IBC) overexpress ErbB2, indicating that ErbB2 alone is not sufficient to drive metastasis and additional risk factors are necessary for the progression of ErbB2-overexpressing DCIS to IBC. A recent study published in Cancer Cell identified 14-3-3ξ as a risk fact...

  8. ERBB-2 overexpression as a risk factor for malignant phaeochromocytomas and paraganglinomas.

    Science.gov (United States)

    Wang, Weiqing; Zhong, Xu; Ye, Lei; Qi, Yan; Su, TingWei; Wei, Qing; Xie, Jing; Jiang, Lei; Jiang, Yiran; Zhou, Weiwei; Cui, Bin; Ning, Guang

    2016-06-01

    There are currently no good histological or molecular markers to differentiate benign from malignant phaeochromocytomas and paraganglinomas (PPGLs). Our previous cross-sectional study observed that ERBB-2 overexpression was associated with malignant PPGLs. This study aimed to evaluate the predictive value of ERBB-2 overexpression for metastasis in PPGLs in a large population. A total of 262 patients diagnosed as PPGLs in our institution between 2002 and 2012 were included. We analysed ERBB-2 protein expression in the primary PPGL tumours by immunohistochemistry (IHC) and ERBB-2 amplification by fluorescence in situ hybridization (FISH). Direct Sanger sequencing was performed to examine ERBB-2 exon 20 mutations. The occurrence of malignant PPGLs was documented in the follow-up period. Kaplan-Meier analysis and Cox proportional hazard models were used to evaluate the association between ERBB-2 overexpression and metastasis of PPGLs. Twenty-six (9·9%) patients had ERBB-2 overexpression in their primary PPGL tumours, which was significantly associated with ERBB-2 amplification (17/25, 68%). No ERBB-2 mutation was found. At a median follow-up of 4·5 years, a total of 23 malignant PPGLs were documented, including eight (30·8%) patients in the ERBB-2 overexpression group and 15 (6·4%) patients in the ERBB-2-negative group. The incidence rate of metastasis was 5·3 per 100 person-years vs 1·4 per 100 person-years in the ERBB-2 overexpression and ERBB-2-negative groups (P overexpression was associated with decreased metastasis-free survival (P = 0·001, log-rank test). After adjusting for primary tumour size and location, Cox regression analysis revealed that ERBB-2 overexpression was independently associated with risk of malignant PPGLs (HR = 2·78; 95% CI, 1·12-6·90; P = 0·028). Patients harbouring tumours with ERBB-2 overexpression have a significantly higher risk of developing malignant PPGLs. © 2016 John Wiley & Sons Ltd.

  9. ERBB2 in Cat Mammary Neoplasias Disclosed a Positive Correlation between RNA and Protein Low Expression Levels: A Model for erbB-2 Negative Human Breast Cancer

    Science.gov (United States)

    Abreu, Rui M. V.; Bastos, Estela; Amorim, Irina; Gut, Ivo G.; Gärtner, Fátima; Chaves, Raquel

    2013-01-01

    Human ERBB2 is a proto-oncogene that codes for the erbB-2 epithelial growth factor receptor. In human breast cancer (HBC), erbB-2 protein overexpression has been repeatedly correlated with poor prognosis. In more recent works, underexpression of this gene has been described in HBC. Moreover, it is also recognised that oncogenes that are commonly amplified or deleted encompass point mutations, and some of these are associated with HBC. In cat mammary lesions (CMLs), the overexpression of ERBB2 (27%–59.6%) has also been described, mostly at the protein level and although cat mammary neoplasias are considered to be a natural model of HBC, molecular information is still scarce. In the present work, a cat ERBB2 fragment, comprising exons 10 to 15 (ERBB2_10–15) was achieved for the first time. Allelic variants and genomic haplotype analyses were also performed, and differences between normal and CML populations were observed. Three amino acid changes, corresponding to 3 non-synonymous genomic sequence variants that were only detected in CMLs, were proposed to damage the 3D structure of the protein. We analysed the cat ERBB2 gene at the DNA (copy number determination), mRNA (expression levels assessment) and protein levels (in extra- and intra protein domains) in CML samples and correlated the last two evaluations with clinicopathological features. We found a positive correlation between the expression levels of the ERBB2 RNA and erbB-2 protein, corresponding to the intracellular region. Additionally, we detected a positive correlation between higher mRNA expression and better clinical outcome. Our results suggest that the ERBB2 gene is post-transcriptionally regulated and that proteins with truncations and single point mutations are present in cat mammary neoplastic lesions. We would like to emphasise that the recurrent occurrence of low erbB-2 expression levels in cat mammary tumours, suggests the cat mammary neoplasias as a valuable model for erbB-2 negative HBC

  10. ErbB-2 nuclear function in breast cancer growth, metastasis and resistance to therapy.

    Science.gov (United States)

    Elizalde, Patricia V; Cordo Russo, Rosalía I; Chervo, Maria F; Schillaci, Roxana

    2016-12-01

    Approximately 15-20% of breast cancers (BC) show either membrane overexpression of ErbB-2 (MErbB-2), a member of the ErbBs family of receptor tyrosine kinases, or ERBB2 gene amplification. Until the development of MErbB-2-targeted therapies, this BC subtype, called ErbB-2-positive, was associated with increased metastatic potential and poor prognosis. Although these therapies have significantly improved overall survival and cure rates, resistance to available drugs is still a major clinical issue. In its classical mechanism, MErbB-2 activates downstream signaling cascades, which transduce its effects in BC. The fact that ErbB-2 is also present in the nucleus of BC cells was discovered over twenty years ago. Also, compelling evidence revealed a non-canonical function of nuclear ErbB-2 as a transcriptional regulator. As a deeper understanding of nuclear ErbB-2 actions would be crucial to the disclosure of its role as a biomarker and a target of therapy in BC, we will here review its function in BC, in particular, its role in growth, metastatic spreading and response to currently available MErbB-2-positive BC therapies. © 2016 Society for Endocrinology.

  11. ERBB2 mutations associated with solid variant of high-grade invasive lobular breast carcinomas.

    Science.gov (United States)

    Deniziaut, Gabrielle; Tille, Jean Christophe; Bidard, François-Clément; Vacher, Sophie; Schnitzler, Anne; Chemlali, Walid; Trémoulet, Laurence; Fuhrmann, Laetitia; Cottu, Paul; Rouzier, Roman; Bièche, Ivan; Vincent-Salomon, Anne

    2016-11-08

    ERBB2 and ERBB3 somatic gain-of-function mutations, which may be targeted by anti-ERBB2 therapies, were reported by high-throughput sequencing studies in 1% and 2% of invasive breast cancers respectively. Our study aims to determine ERBB2 and ERBB3 mutations frequencies in grade 3 and/or ERBB2-positive invasive lobular breast carcinomas (ILC). All the 529 ILC surgically-excised registered at Institut Curie in the years 2005 to 2008 were reviewed. Thirty-nine grade 3 ERBB2-negative ILC and 16 ERBB2-positive ILC were retrieved and subjected to Sanger sequencing of the ERBB2 and ERBB3 activation mutation hotspots (ERBB2: exons 8, 17, 19, 20, 21; ERBB3: exons 3, 6, 7, 8). Among the 39 grade 3 ERBB2-negative ILC, six tumors were found to have at least one detectable ERBB2 activating mutation (incidence rate: 15%, 95%CI [4%-27%]). No ERBB2 mutation was found among the 16 ERBB2-positive ILC. No ERBB3 mutation was found in any of the 55 ILC. ERBB2 mutations were statistically associated with solid ILC features (p=0.01). Survival analyses showed no significant prognostic impact of ERBB2 mutations. Our study demonstrates that high grade ERBB2-negative ILC display a high frequency of ERBB2 mutations, and should be subjected to systematic genetic screening.

  12. Vitamin E analogs trigger apoptosis in HER2/erbB2-overexpressing breast cancer cells by signaling via the mitochondrial pathway

    Czech Academy of Sciences Publication Activity Database

    Wang, X.-F.; Witting, P. K.; Salvatore, B.A.; Neužil, Jiří

    2005-01-01

    Roč. 326, č. 4 (2005), s. 282-289 ISSN 0006-291X Institutional research plan: CEZ:AV0Z5052915; CEZ:AV0Z50520514 Keywords : vitamin E analogs * apoptosis * ErbB2 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.000, year: 2005

  13. Poly (A+ transcriptome assessment of ERBB2-induced alterations in breast cell lines.

    Directory of Open Access Journals (Sweden)

    Dirce Maria Carraro

    Full Text Available We report the first quantitative and qualitative analysis of the poly (A⁺ transcriptome of two human mammary cell lines, differentially expressing (human epidermal growth factor receptor an oncogene over-expressed in approximately 25% of human breast tumors. Full-length cDNA populations from the two cell lines were digested enzymatically, individually tagged according to a customized method for library construction, and simultaneously sequenced by the use of the Titanium 454-Roche-platform. Comprehensive bioinformatics analysis followed by experimental validation confirmed novel genes, splicing variants, single nucleotide polymorphisms, and gene fusions indicated by RNA-seq data from both samples. Moreover, comparative analysis showed enrichment in alternative events, especially in the exon usage category, in ERBB2 over-expressing cells, data indicating regulation of alternative splicing mediated by the oncogene. Alterations in expression levels of genes, such as LOX, ATP5L, GALNT3, and MME revealed by large-scale sequencing were confirmed between cell lines as well as in tumor specimens with different ERBB2 backgrounds. This approach was shown to be suitable for structural, quantitative, and qualitative assessment of complex transcriptomes and revealed new events mediated by ERBB2 overexpression, in addition to potential molecular targets for breast cancer that are driven by this oncogene.

  14. Neratinib induces ErbB2 ubiquitylation and endocytic degradation via HSP90 dissociation in breast cancer cells.

    Science.gov (United States)

    Zhang, Yingqiu; Zhang, Jinrui; Liu, Congcong; Du, Sha; Feng, Lu; Luan, Xuelin; Zhang, Yayun; Shi, Yulin; Wang, Taishu; Wu, Yue; Cheng, Wei; Meng, Songshu; Li, Man; Liu, Han

    2016-11-28

    Receptor tyrosine kinase ErbB2/HER2 is frequently observed to be overexpressed in human cancers, leading to over activation of downstream signaling modules. HER2 positive is a major type of breast cancer for which ErbB2 targeting is already proving to be an effective therapeutic strategy. Apart from antibodies against ErbB2, the small molecule tyrosine kinase inhibitor lapatinib has had successful clinical outcomes, and other inhibitors such as neratinib are currently undergoing clinical investigations. In this study we report the effects of lapatinib and neratinib on the mRNA and protein levels of the ErbB2 receptor. We provide evidence that neratinib-induced down regulation of ErbB2 occurs through ubiquitin-mediated endocytic sorting and lysosomal degradation. At the mechanistic level, neratinib treatment leads to HSP90 release from ErbB2 and its subsequent ubiquitylation and endocytic degradation. Our findings provide novel insights into the mechanism of ErbB2 inhibition by neratinib. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Hsp90 inhibitor 17-AAG reduces ErbB2 levels and inhibits proliferation of the trastuzumab resistant breast tumor cell line JIMT-1.

    Science.gov (United States)

    Zsebik, Barbara; Citri, Ami; Isola, Jorma; Yarden, Yosef; Szöllosi, János; Vereb, György

    2006-04-15

    ErbB2, a member of the EGF receptor family of tyrosine kinases is overexpressed on many tumor cells of epithelial origin and is the molecular target of trastuzumab (Herceptin), the first humanized antibody used in the therapy of solid tumors. Trastuzumab, which is thought to act, at least in part, by downregulating ErbB2 expression is only effective in approximately 30-40% of ErbB2 positive breast tumors. Geldanamycin and its derivative 17-AAG are potential antitumor agents capable of downregulating client proteins of Hsp90, including ErbB2. To investigate the ability of 17-AAG to downregulate ErbB2 in trastuzumab resistant breast cancer cells and the possibility of 17-AAG and trastuzumab potentiating each other's effect, the recently established trastuzumab resistant breast cancer cell line, JIMT-1 was compared to the known trastuzumab sensitive SKBR-3 line. Baseline and stimulus-evoked dimerization and activation levels of ErbB2, and the effects of trastuzumab and 17-AAG alone and in combination on cell proliferation and apoptosis, as well as on ErbB2 expression and phosphorylation have been measured. Baseline activation and amenability to activation and downregulation by trastuzumab was much lower in the resistant line. However, 17-AAG enhanced ErbB2 homodimerization after 5-10 min of treatment in both cell lines, and decreased proliferation with an IC50 of 70 nM for SKBR-3 and 10nM for JIMT-1. Thus, 17-AAG may be a useful drug in trastuzumab resistant ErbB2 overexpressing tumors. The antiproliferative effect of 17-AAG was positively correlated with phosphorylation and downregulation of ErbB2 and was dominated by apoptosis, although, especially at higher doses, necrosis was also present. Interestingly, IC50 values for ErbB2 downregulation and phosphorylation, in the 30-40 nM range, were not significantly different for the two cell lines. This observation and the negative correlation between resting ErbB2 levels and the antiproliferative effect of 17-AAG may

  16. Aberrations of ERBB2 and TOP2A Genes in Breast Cancer

    DEFF Research Database (Denmark)

    Nielsen, Kirsten Vang; Müller, Sven; Møller, Susanne

    2009-01-01

    genes and the other by having amplification of ERBB2 and deletion of TOP2A. The characteristics are compared to findings on paired ERBB2 and TOP2A data from 649 patients with invasive breast cancer from a previously published biomarker study. The physical localization of FISH signals in metaphase...... spreads from cell lines showed that simultaneous amplification is not a simple co-amplification of a whole amplicon containing both genes. Most gene signals are translocated to abnormal marker chromosomes. ERBB2 genes but not TOP2A genes are present in tandem amplicons, leading to a higher ERBB2 ratio....... This observation was confirmed by patient FISH data: among 276 (43% of all patients) abnormal tumors, 67% had different ERBB2 and TOP2A status. ERBB2 amplification with normal TOP2A status was found in 36% of the abnormal tumors (15% of all patients). Simultaneous amplification of both genes was found in 28...

  17. Clinical relevance of ErbB-2/HER2 nuclear expression in breast cancer

    International Nuclear Information System (INIS)

    Schillaci, Roxana; Charreau, Eduardo H; Maronna, Esteban; Roa, Juan C; Elizalde, Patricia V; Guzmán, Pablo; Cayrol, Florencia; Beguelin, Wendy; Díaz Flaqué, María C; Proietti, Cecilia J; Pineda, Viviana; Palazzi, Jorge; Frahm, Isabel

    2012-01-01

    The biological relevance of nuclear ErbB-2/HER2 (NuclErbB-2) presence in breast tumors remains unexplored. In this study we assessed the clinical significance of ErbB-2 nuclear localization in primary invasive breast cancer. The reporting recommendations for tumor marker prognostic studies (REMARK) guidelines were used as reference. Tissue microarrays from a cohort of 273 primary invasive breast carcinomas from women living in Chile, a Latin American country, were examined for membrane (MembErbB-2) and NuclErbB-2 expression by an immunofluorescence (IF) protocol we developed. ErbB-2 expression was also evaluated by immunohistochemistry (IHC) with a series of antibodies. Correlation between NuclErbB-2 and MembErbB-2, and between NuclErbB-2 and clinicopathological characteristics of tumors was studied. The prognostic value of NuclErbB-2 in overall survival (OS) was evaluated using Kaplan-Meier method, and Cox model was used to explore NuclErbB-2 as independent prognostic factor for OS. The IF protocol we developed showed significantly higher sensitivity for detection of NuclErbB-2 than IHC procedures, while its specificity and sensitivity to detect MembErbB-2 were comparable to those of IHC procedures. We found 33.6% NuclErbB-2 positivity, 14.2% MembErbB-2 overexpression by IF, and 13.0% MembErbB-2 prevalence by IHC in our cohort. We identified NuclErbB-2 positivity as a significant independent predictor of worse OS in patients with MembErbB-2 overexpression. NuclErbB-2 was also a biomarker of lower OS in tumors that overexpress MembErbB-2 and lack steroid hormone receptors. We revealed a novel role for NuclErbB-2 as an independent prognostic factor of poor clinical outcome in MembErbB-2-positive breast tumors. Our work indicates that patients presenting NuclErbB-2 may need new therapeutic strategies involving specific blockage of ErbB-2 nuclear migration

  18. Clinical relevance of ErbB-2/HER2 nuclear expression in breast cancer

    Directory of Open Access Journals (Sweden)

    Schillaci Roxana

    2012-02-01

    Full Text Available Abstract Background The biological relevance of nuclear ErbB-2/HER2 (NuclErbB-2 presence in breast tumors remains unexplored. In this study we assessed the clinical significance of ErbB-2 nuclear localization in primary invasive breast cancer. The reporting recommendations for tumor marker prognostic studies (REMARK guidelines were used as reference. Methods Tissue microarrays from a cohort of 273 primary invasive breast carcinomas from women living in Chile, a Latin American country, were examined for membrane (MembErbB-2 and NuclErbB-2 expression by an immunofluorescence (IF protocol we developed. ErbB-2 expression was also evaluated by immunohistochemistry (IHC with a series of antibodies. Correlation between NuclErbB-2 and MembErbB-2, and between NuclErbB-2 and clinicopathological characteristics of tumors was studied. The prognostic value of NuclErbB-2 in overall survival (OS was evaluated using Kaplan-Meier method, and Cox model was used to explore NuclErbB-2 as independent prognostic factor for OS. Results The IF protocol we developed showed significantly higher sensitivity for detection of NuclErbB-2 than IHC procedures, while its specificity and sensitivity to detect MembErbB-2 were comparable to those of IHC procedures. We found 33.6% NuclErbB-2 positivity, 14.2% MembErbB-2 overexpression by IF, and 13.0% MembErbB-2 prevalence by IHC in our cohort. We identified NuclErbB-2 positivity as a significant independent predictor of worse OS in patients with MembErbB-2 overexpression. NuclErbB-2 was also a biomarker of lower OS in tumors that overexpress MembErbB-2 and lack steroid hormone receptors. Conclusions We revealed a novel role for NuclErbB-2 as an independent prognostic factor of poor clinical outcome in MembErbB-2-positive breast tumors. Our work indicates that patients presenting NuclErbB-2 may need new therapeutic strategies involving specific blockage of ErbB-2 nuclear migration.

  19. A novel mouse monoclonal antibody targeting ErbB2 suppresses breast cancer growth

    Energy Technology Data Exchange (ETDEWEB)

    Kawa, Seiji [Division of Oncology, Institute of Medical Science, University of Tokyo, Shirokanedai 4-6-1, Minato-ku, Tokyo 108-8639 (Japan); Matsushita, Hirohisa; Ohbayashi, Hirokazu [Department of Research and Development, Nichirei Biosciences Inc., Tokyo 104-8402 (Japan); Semba, Kentaro [Department of Life Science and Medical Bio-Science, School of Science and Engineering, Waseda University, Tokyo 169-8555 (Japan); Yamamoto, Tadashi, E-mail: tyamamot@ims.u-tokyo.ac.jp [Division of Oncology, Institute of Medical Science, University of Tokyo, Shirokanedai 4-6-1, Minato-ku, Tokyo 108-8639 (Japan)

    2009-07-03

    Overexpression of ErbB2 in breast cancer is associated with increased recurrence and worse prognosis. Accumulating evidences suggest that molecular targeted therapy is a promising anticancer strategy. In this study, we produced a novel anti-ErbB2 monoclonal antibody, 6G10, that recognized an epitope distinct from the trastuzumab binding site. 6G10 induced aggregation of BT474 breast cancer cells and inhibited proliferation of various breast cancer cell lines including BT474. A growth inhibition assay showed that 6G10 had EC{sub 50} values comparable to trastuzumab, indicating that the drugs have a similar level of potency. Furthermore, intraperitoneal administration of 6G10 completely inhibited the growth of xenografted tumors derived from BT474 and SK-BR-3 cells. These data suggested that 6G10 has great therapeutic potential and could be administered to patients alternatively, or synergistically, with trastuzumab.

  20. Anti-metastasis activity of black rice anthocyanins against breast cancer: analyses using an ErbB2 positive breast cancer cell line and tumoral xenograft model.

    Science.gov (United States)

    Luo, Li-Ping; Han, Bin; Yu, Xiao-Ping; Chen, Xiang-Yan; Zhou, Jie; Chen, Wei; Zhu, Yan-Feng; Peng, Xiao-Li; Zou, Qiang; Li, Sui-Yan

    2014-01-01

    Increasing evidence from animal, epidemiological and clinical investigations suggest that dietary anthocyanins have potential to prevent chronic diseases, including cancers. It is also noteworthy that human epidermal growth factor receptor 2 (ErbB2) protein overexpression or ErbB2 gene amplification has been included as an indicator for metastasis and higher risk of recurrence for breast cancer. The present experiments investigated the anti-metastasis effects of black rice anthocyanins (BRACs) on ErbB2 positive breast cancer cells in vivo and in vitro. Oral administration of BRACs (150 mg/kg/day) reduced transplanted tumor growth, inhibited pulmonary metastasis, and decreased lung tumor nodules in BALB/c nude mice bearing ErbB2 positive breast cancer cell MDA-MB-453 xenografts. The capacity for migration, adhesion, motility and invasion was also inhibited by BRACs in MDA-MB-453 cells in a concentration dependent manner, accompanied by decreased activity of a transfer promoting factor, urokinase-type plasminogen activator (u-PA). Together, our results indicated that BRACs possess anti-metastasis potential against ErbB2 positive human breast cancer cells in vivo and in vitro through inhibition of metastasis promoting molecules.

  1. Cannabinoids reduce ErbB2-driven breast cancer progression through Akt inhibition

    Directory of Open Access Journals (Sweden)

    Flores Juana M

    2010-07-01

    Full Text Available Abstract Background ErbB2-positive breast cancer is characterized by highly aggressive phenotypes and reduced responsiveness to standard therapies. Although specific ErbB2-targeted therapies have been designed, only a small percentage of patients respond to these treatments and most of them eventually relapse. The existence of this population of particularly aggressive and non-responding or relapsing patients urges the search for novel therapies. The purpose of this study was to determine whether cannabinoids might constitute a new therapeutic tool for the treatment of ErbB2-positive breast tumors. We analyzed their antitumor potential in a well established and clinically relevant model of ErbB2-driven metastatic breast cancer: the MMTV-neu mouse. We also analyzed the expression of cannabinoid targets in a series of 87 human breast tumors. Results Our results show that both Δ9-tetrahydrocannabinol, the most abundant and potent cannabinoid in marijuana, and JWH-133, a non-psychotropic CB2 receptor-selective agonist, reduce tumor growth, tumor number, and the amount/severity of lung metastases in MMTV-neu mice. Histological analyses of the tumors revealed that cannabinoids inhibit cancer cell proliferation, induce cancer cell apoptosis, and impair tumor angiogenesis. Cannabinoid antitumoral action relies, at least partially, on the inhibition of the pro-tumorigenic Akt pathway. We also found that 91% of ErbB2-positive tumors express the non-psychotropic cannabinoid receptor CB2. Conclusions Taken together, these results provide a strong preclinical evidence for the use of cannabinoid-based therapies for the management of ErbB2-positive breast cancer.

  2. Prolyl isomerase Pin1 is highly expressed in Her2-positive breast cancer and regulates erbB2 protein stability

    Directory of Open Access Journals (Sweden)

    Lu Kun

    2008-12-01

    Full Text Available Abstract Overexpression of HER-2/Neu occurs in about 25–30% of breast cancer patients and is indicative of poor prognosis. While Her2/Neu overexpression is primarily a result of erbB2 amplification, it has recently been recognized that erbB2 levels are also regulated on the protein level. However, factors that regulate Her2/Neu protein stability are less well understood. The prolyl isomerase Pin1 catalyzes the isomerization of specific pSer/Thr-Pro motifs that have been phosphorylated in response to mitogenic signaling. We have previously reported that Pin1-catalyzed post-phosphorylational modification of signal transduction modulates the oncogenic pathways downstream from c-neu. The goal of this study was to examine the expression of prolyl isomerase Pin1 in human Her2+ breast cancer, and to study if Pin1 affects the expression of Her2/Neu itself. Methods Immunohistochemistry for Her2 and Pin1 were performed on two hundred twenty-three human breast cancers, with 59% of the specimen from primary cancers and 41% from metastatic sites. Pin1 inhibition was achieved using siRNA in Her2+ breast cancer cell lines, and its effects were studied using cell viability assays, immunoblotting and immunofluorescence. Results Sixty-four samples (28.7% stained positive for Her2 (IHC 3+, and 54% (122/223 of all breast cancers stained positive for Pin1. Of the Her2-positive cancers 40 (62.5% were also Pin1-positive, based on strong nuclear or nuclear and cytoplasmic staining. Inhibition of Pin1 via RNAi resulted in significant suppression of Her2-positive tumor cell growth in BT474, SKBR3 and AU565 cells. Pin1 inhibition greatly increased the sensitivity of Her2-positive breast cancer cells to the mTOR inhibitor Rapamycin, while it did not increase their sensitivity to Trastuzumab, suggesting that Pin1 might act on Her2 signaling. We found that Pin1 interacted with the protein complex that contains ubiquitinated erbB2 and that Pin1 inhibition accelerated erbB2

  3. ErbB2-Driven Breast Cancer Cell Invasion Depends on a Complex Signaling Network Activating Myeloid Zinc Finger-1-Dependent Cathepsin B Expression

    DEFF Research Database (Denmark)

    Rafn, Bo; Nielsen, Christian Thomas Friberg; Andersen, Sofie Hagel

    2012-01-01

    Aberrant ErbB2 receptor tyrosine kinase activation in breast cancer is strongly linked to an invasive disease. The molecular basis of ErbB2-driven invasion is largely unknown. We show that cysteine cathepsins B and L are elevated in ErbB2 positive primary human breast cancer and function...... as effectors of ErbB2-induced invasion in vitro. We identify Cdc42-binding protein kinase beta, extracellular regulated kinase 2, p21-activated protein kinase 4, and protein kinase C alpha as essential mediators of ErbB2-induced cysteine cathepsin expression and breast cancer cell invasiveness. The identified...

  4. Negative transcriptional control of ERBB2 gene by MBP-1 and HDAC1: diagnostic implications in breast cancer

    International Nuclear Information System (INIS)

    Contino, Flavia; Mazzarella, Claudia; Ferro, Arianna; Lo Presti, Mariavera; Roz, Elena; Lupo, Carmelo; Perconti, Giovanni; Giallongo, Agata; Feo, Salvatore

    2013-01-01

    The human ERBB2 gene is frequently amplified in breast tumors, and its high expression is associated with poor prognosis. We previously reported a significant inverse correlation between Myc promoter-binding protein-1 (MBP-1) and ERBB2 expression in primary breast invasive ductal carcinoma (IDC). MBP-1 is a transcriptional repressor of the c-MYC gene that acts by binding to the P2 promoter; only one other direct target of MBP-1, the COX2 gene, has been identified so far. To gain new insights into the functional relationship linking MBP-1 and ERBB2 in breast cancer, we have investigated the effects of MBP-1 expression on endogenous ERBB2 transcript and protein levels, as well as on transcription promoter activity, by transient-transfection of SKBr3 cells. Reporter gene and chromatin immunoprecipitation assays were used to dissect the ERBB2 promoter and identify functional MBP-1 target sequences. We also investigated the relative expression of MBP-1 and HDAC1 in IDC and normal breast tissues by immunoblot analysis and immunohistochemistry. Transfection experiments and chromatin immunoprecipitation assays in SKBr3 cells indicated that MBP-1 negatively regulates the ERBB2 gene by binding to a genomic region between nucleotide −514 and −262 of the proximal promoter; consistent with this, a concomitant recruitment of HDAC1 and loss of acetylated histone H4 was observed. In addition, we found high expression of MBP-1 and HDAC1 in normal tissues and a statistically significant inverse correlation with ErbB2 expression in the paired tumor samples. Altogether, our in vitro and in vivo data indicate that the ERBB2 gene is a novel MBP-1 target, and immunohistochemistry analysis of primary tumors suggests that the concomitant high expression of MBP-1 and HDAC1 may be considered a diagnostic marker of cancer progression for breast IDC

  5. A peptide conjugate of vitamin E succinate targets breast cancer cells with high erbB2 expression

    Czech Academy of Sciences Publication Activity Database

    Wang, X. F.; Birringer, M.; Dong, L.F.; Vepřek, Pavel; Low, P.; Swettenham, E.; Stantic, M.; Yuan, L. H.; Zobalová, Renata; Wu, K.; Ledvina, Miroslav; Ralph, S.J.; Neužil, Jiří

    2007-01-01

    Roč. 67, č. 7 (2007), s. 3337-3344 ISSN 0008-5472 R&D Projects: GA MZe QF3115 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50520514 Keywords : vitamin e E * erbB2 * breast cancer Subject RIV: CC - Organic Chemistry Impact factor: 7.672, year: 2007

  6. Common ERBB2 polymorphisms and risk of breast cancer in a white British population: a case–control study

    International Nuclear Information System (INIS)

    Benusiglio, Patrick R; Ponder, Bruce AJ; Lesueur, Fabienne; Luccarini, Craig; Conroy, Donald M; Shah, Mitul; Easton, Douglas F; Day, Nick E; Dunning, Alison M; Pharoah, Paul D

    2005-01-01

    About two-thirds of the excess familial risk associated with breast cancer is still unaccounted for and may be explained by multiple weakly predisposing alleles. A gene thought to be involved in low-level predisposition to the disease is ERBB2 (HER2). This gene is involved in cell division, differentiation, and apoptosis and is frequently amplified in breast tumours. Its amplification correlates with poor prognosis. Moreover, the coding polymorphism I655V has previously been associated with an increased risk of breast cancer. We aimed to determine if common polymorphisms (frequency ≥ 5%) in ERBB2 were associated with breast cancer risk in a white British population. Five single-nucleotide polymorphisms (SNPs) were selected for study: SNP 1 near the promoter, SNP 2 in intron 1, SNP 3 in intron 4, SNP 4 in exon 17 (I655V), and SNP 5 in exon 27 (A1170P). We tested their association with breast cancer in a large case–control study (n = 2192 cases and 2257 controls). There were no differences in genotype frequencies between cases and controls for any of the SNPs examined. To investigate the possibility that a common polymorphism not included in our study might be involved in breast cancer predisposition, we also constructed multilocus haplotypes. Our set of SNPs generated all existing (n = 6) common haplotypes and no differences were seen in haplotype frequencies between cases and controls (P = 0.44). In our population, common ERBB2 polymorphisms are not involved in predisposition to breast cancer

  7. Hyaluronan-induced masking of ErbB2 and CD44-enhanced trastuzumab internalisation in trastuzumab resistant breast cancer.

    Science.gov (United States)

    Pályi-Krekk, Zsuzsanna; Barok, Márk; Isola, Jorma; Tammi, Markku; Szöllosi, János; Nagy, Peter

    2007-11-01

    Although trastuzumab, a recombinant humanised anti-ErbB2 antibody, is widely used in the treatment of breast cancer, neither its mechanism of action, nor the factors leading to resistance are fully understood. We have previously shown that antibody-dependent cellular cytotoxicity is pivotal in the in vivo effect of trastuzumab against JIMT-1, a cell line showing in vitro resistance to the antibody, and suggested that masking of the trastuzumab-binding epitope by MUC-4, a cell surface mucin, took place. Here, we further explored the role of masking of ErbB2 in connection with CD44 expression and synthesis of its ligand, hyaluronan. We show that high expression of CD44 observed in JIMT-1 cells correlates with ErbB2 downregulation in vivo, while siRNA-mediated inhibition of CD44 expression leads to decreased rate of trastuzumab internalisation and low cell proliferation in vitro. An inhibitor of hyaluronan synthesis, 4-methylumbelliferon (4-MU) significantly reduced the hyaluronan level of JIMT-1 cells both in vivo and in vitro leading to enhanced binding of trastuzumab to ErbB2 and increased ErbB2 down-regulation. Furthermore, the inhibitory effect of trastuzumab on the growth of JIMT-1 xenografts was significantly increased by 4-MU treatment. Our results point to the importance of the CD44-hyaluronan pathway in the escape of tumour cells from receptor-oriented therapy.

  8. Polypeptide-based nanogels co-encapsulating a synergistic combination of doxorubicin with 17-AAG show potent anti-tumor activity in ErbB2-driven breast cancer models.

    Science.gov (United States)

    Desale, Swapnil S; Raja, Srikumar M; Kim, Jong Oh; Mohapatra, Bhopal; Soni, Kruti S; Luan, Haitao; Williams, Stetson H; Bielecki, Timothy A; Feng, Dan; Storck, Matthew; Band, Vimla; Cohen, Samuel M; Band, Hamid; Bronich, Tatiana K

    2015-06-28

    ErbB2-driven breast cancers constitute 20-25% of the cases diagnosed within the USA. The humanized anti-ErbB2 monoclonal antibody, Trastuzumab (Herceptin™; Genentech), with chemotherapy is the current standard of treatment. Novel agents and strategies continue to be explored, given the challenges posed by Trastuzumab-resistance development in most patients. The HSP90 inhibitor, 17-allylaminodemethoxygeldanamycin (17-AAG), which induces ErbB2 degradation and attenuates downstream oncogenic signaling, is one such agent that showed significant promise in early phase I and II clinical trials. Its low water solubility, potential toxicities and undesirable side effects observed in patients, partly due to the Cremophor-based formulation, have been discouraging factors in the advancement of this promising drug into clinical use. Encapsulation of 17-AAG into polymeric nanoparticle formulations, particularly in synergistic combination with conventional chemotherapeutics, represents an alternative approach to overcome these problems. Herein, we report an efficient co-encapsulation of 17-AAG and doxorubicin, a clinically well-established and effective modality in breast cancer treatment, into biodegradable and biocompatible polypeptide-based nanogels. Dual drug-loaded nanogels displayed potent cytotoxicity in a breast cancer cell panel and exerted selective synergistic anticancer activity against ErbB2-overexpressing breast cancer cell lines. Analysis of ErbB2 degradation confirmed efficient 17-AAG release from nanogels with activity comparable to free 17-AAG. Furthermore, nanogels containing both 17-AAG and doxorubicin exhibited superior antitumor efficacy in vivo in an ErbB2-driven xenograft model compared to the combination of free drugs. These studies demonstrate that polypeptide-based nanogels can serve as novel nanocarriers for encapsulating 17-AAG along with other chemotherapeutics, providing an opportunity to overcome solubility issues and thereby exploit its full

  9. Electrocardiographic Characterization of Cardiac Hypertrophy in Mice that Overexpress the ErbB2 Receptor Tyrosine Kinase

    DEFF Research Database (Denmark)

    Sysa-Shah, Polina; Sørensen, Lars L; Abraham, M Roselle

    2015-01-01

    , the ECG recordings of ErbB2(tg) mice were characterized by higher P- and R-wave amplitudes, broader QRS complexes, inverted T waves, and ST interval depression. Pearson's correlation matrix analysis of combined WT and ErbB2(tg) data revealed significant correlation between heart weight and the ECG...... parameters of QT interval (corrected for heart rate), QRS interval, ST height, R amplitude, P amplitude, and PR interval. In addition, the left ventricular posterior wall thickness as determined by echocardiography correlated with ECG-determined ST height, R amplitude, QRS interval; echocardiographic left...... ventricular mass correlated with ECG-determined ST height and PR interval. In summary, we have determined phenotypic ECG criteria to differentiate ErbB2(tg) from WT genotypes in 98.8% of mice. This inexpensive and time-efficient ECG-based phenotypic method might be applied to differentiate between genotypes...

  10. ErbB2 and NFκB overexpression as predictors of chemoradiation resistance and putative targets to overcome resistance in muscle-invasive bladder cancer.

    Directory of Open Access Journals (Sweden)

    Fumitaka Koga

    Full Text Available Radical cystectomy for muscle-invasive bladder cancer (MIBC patients frequently impairs their quality of life (QOL due to urinary diversion. To improve their QOL, a bladder-sparing alternative strategy using chemoradiation has been developed. In bladder-sparing protocols, complete response (CR to induction chemoradiation is a prerequisite for bladder preservation and favorable survival. Thus predicting chemoradiation resistance and overcoming it would increase individual MIBC patients' chances of bladder preservation. The aim of this study is to investigate putative molecular targets for treatment aimed at improving chemoradiation response. Expression levels of erbB2, NFκB, p53, and survivin were evaluated immunohistochemically in pretreatment biopsy samples from 35 MIBC patients in whom chemoradiation sensitivity had been pathologically evaluated in cystectomy specimens, and associations of these expression levels with chemoradiation sensitivity and cancer-specific survival (CSS were investigated. Of the 35 patients, 11 (31% achieved pathological CR, while tumors in the remaining 24 patients (69% were chemoradiation-resistant. Multivariate analysis identified erbB2 and NFκB overexpression and hydronephrosis as significant and independent risk factors for chemoradiation resistance with respective relative risks of 11.8 (P = 0.014, 15.4 (P = 0.024 and 14.3 (P = 0.038. The chemoradiation resistance rate was 88.5% for tumors overexpressing erbB2 and/or NFκB, but only 11.1% for those negative for both (P <0.0001. The 5-year CSS rate was 74% overall. Through multivariate analysis, overexpression of erbB2 and/or NFκB was identified as an independent risk factor for bladder cancer death with marginal significance (hazard ratio 21.5, P = 0.056 along with chemoradiation resistance (P = 0.003 and hydronephrosis (P = 0.018. The 5-year CSS rate for the 11 patients achieving pathological CR was 100%, while that for the 24 with

  11. Ibrutinib (ImbruvicaTM) potently inhibits ErbB receptor phosphorylation and cell viability of ErbB2-positive breast cancer cells.

    Science.gov (United States)

    Grabinski, Nicole; Ewald, Florian

    2014-12-01

    Ibrutinib (formerly PCI-32765) is a specific, irreversible, and potent inhibitor of Burton's tyrosine kinase (BTK) developed for the treatment of several forms of blood cancer. It is now an FDA-approved drug marketed under the name Imbruvica(TM) (Pharmacyclics, Inc.) and successfully used as an orally administered second-line drug in the treatment of mantle cell lymphoma. Since BTK is predominantly expressed in hematopoietic cells, the sensitivity of solid tumor cells to Ibrutinib has not been analyzed. In this study, we determined the effect of Ibrutinib on breast cancer cells. We demonstrate that Ibrutinib efficiently reduces the phosphorylation of the receptor tyrosine kinases ErbB1, ErbB2 and ErbB3, thereby suppressing AKT and MAPK signaling in ErbB2-positive (ErbB2+) breast cancer cell lines. Treatment with Ibrutinib significantly reduced the viability of ErbB2+ cell lines with IC50 values at nanomolar concentrations, suggesting therapeutic potential of Ibrutinib in breast cancer. Combined treatment with Ibrutinib and the dual PI3K/mTOR inhibitor BEZ235 synergistically reduces cell viability of ErbB2+ breast cancer cells. Combination indices below 0.25 at 50% inhibition of cell viability were determined by the Chou-Talalay method. Therefore, the combination of Ibrutinib and canonical PI3K pathway inhibitors could be a new and effective approach in the treatment of breast cancer with activated ErbB receptors. Ibrutinib could thus become a valuable component of targeted therapy in aggressive ErbB2+ breast cancer.

  12. Stable RNA interference of ErbB-2 gene synergistic with epirubicin suppresses breast cancer growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Hu Xiaoqu; Su Fengxi; Qin Li; Jia Weijuan; Gong Chang; Yu Fengyan; Guo Jujiang; Song Erwei

    2006-01-01

    Overexpression of human epidermal growth factor receptor-2 (Her2, ErbB-2) contributes to the progression and metastasis of breast cancer, implying that Her2 gene is a suitable target of RNA interference (RNAi) for breast cancer therapy. Here, we employed plasmid-mediated expression of 2 different Her2-shRNAs (pU6-Her2shRNAs) efficiently silenced the target gene expression on Her2 expressing SKBR-3 breast cancer cells in both mRNA and protein levels. Consequently, pU6-Her2shRNA increased apoptosis and reduced proliferation of SKBR-3 cells assayed by TUNEL and MTT, respectively. In vivo, intra-tumor injection of pU6-Her2shRNA inhibited the growth of SKBR-3 tumors inoculated subcutaneously in nude mice. Furthermore, pU6-Her2shRNA synergized the tumor suppression effect of epirubicin to SKBR-3 cells in vitro and implanted subcutaneously in nude mice. Therefore, we concluded that stable silencing of Her2 gene expression with plasmid expressing shRNA may hold great promise as a novel therapy for Her2 expressing breast cancers alone or in combination with anthracycline chemotherapy

  13. Significance of ERBB2 overexpression in therapeutic resistance and cancer-specific survival in muscle-invasive bladder cancer patients treated with chemoradiation-based selective bladder-sparing approach.

    Science.gov (United States)

    Inoue, Masaharu; Koga, Fumitaka; Yoshida, Soichiro; Tamura, Tomoki; Fujii, Yasuhisa; Ito, Eisaku; Kihara, Kazunori

    2014-10-01

    To investigate the associations of ERBB 2 overexpression with chemoradiation therapy (CRT) resistance and cancer-specific survival (CSS) in muscle-invasive bladder cancer (MIBC) patients treated with the CRT-based bladder-sparing protocol. From 1997 to 2012, 201 patients with cT2-4aN0M0 bladder cancer were treated with CRT (40 Gy with concurrent cisplatin) following transurethral resection of bladder tumor (TURBT). Basically, patients with tumors that showed good CRT response and were amenable to segmental resection underwent partial cystectomy (PC) with pelvic lymph node dissection for bladder preservation; otherwise, radical cystectomy (RC) was recommended. Included in this study were 119 patients in whom TURBT specimens were available for immunohistochemical analysis of ERBB 2 expression. Following CRT, 30 and 65 patients underwent PC or RC, respectively; the remaining 24 patients did not undergo cystectomy. Tumors were defined as CRT-resistant when patients did not achieve complete response after CRT. Associations of ERBB 2 overexpression with CRT resistance and CSS were evaluated. CRT resistance was observed clinically in 56% (67 of 119 patients) and pathologically (in cystectomy specimens) in 55% (52 of 95 patients). ERBB 2 overexpression was observed in 45 patients (38%). On multivariate analysis, ERBB 2 overexpression was an independent predictor for CRT resistance clinically (odds ratio, 3.6; P=.002) and pathologically (odds ratio, 2.9; P=.031). ERBB 2 overexpression was associated with shorter CSS (5-year CSS rates, 56% vs 87% for the ERBB 2 overexpression group vs the others; P=.001). ERBB 2 overexpression was also an independent risk factor for bladder cancer death at all time points of our bladder-sparing protocol (pre-CRT, post-CRT, and post-cystectomy). ERBB 2 overexpression appears relevant to CRT resistance and unfavorable CSS in MIBC patients treated with the CRT-based bladder-sparing protocol. ERBB 2-targeting treatment may improve the outcomes

  14. Significance of ERBB2 Overexpression in Therapeutic Resistance and Cancer-Specific Survival in Muscle-Invasive Bladder Cancer Patients Treated With Chemoradiation-Based Selective Bladder-Sparing Approach

    International Nuclear Information System (INIS)

    Inoue, Masaharu; Koga, Fumitaka; Yoshida, Soichiro; Tamura, Tomoki; Fujii, Yasuhisa; Ito, Eisaku; Kihara, Kazunori

    2014-01-01

    Purpose: To investigate the associations of ERBB 2 overexpression with chemoradiation therapy (CRT) resistance and cancer-specific survival (CSS) in muscle-invasive bladder cancer (MIBC) patients treated with the CRT-based bladder-sparing protocol. Methods and Materials: From 1997 to 2012, 201 patients with cT2-4aN0M0 bladder cancer were treated with CRT (40 Gy with concurrent cisplatin) following transurethral resection of bladder tumor (TURBT). Basically, patients with tumors that showed good CRT response and were amenable to segmental resection underwent partial cystectomy (PC) with pelvic lymph node dissection for bladder preservation; otherwise, radical cystectomy (RC) was recommended. Included in this study were 119 patients in whom TURBT specimens were available for immunohistochemical analysis of ERBB 2 expression. Following CRT, 30 and 65 patients underwent PC or RC, respectively; the remaining 24 patients did not undergo cystectomy. Tumors were defined as CRT-resistant when patients did not achieve complete response after CRT. Associations of ERBB 2 overexpression with CRT resistance and CSS were evaluated. Results: CRT resistance was observed clinically in 56% (67 of 119 patients) and pathologically (in cystectomy specimens) in 55% (52 of 95 patients). ERBB 2 overexpression was observed in 45 patients (38%). On multivariate analysis, ERBB 2 overexpression was an independent predictor for CRT resistance clinically (odds ratio, 3.6; P=.002) and pathologically (odds ratio, 2.9; P=.031). ERBB 2 overexpression was associated with shorter CSS (5-year CSS rates, 56% vs 87% for the ERBB 2 overexpression group vs the others; P=.001). ERBB 2 overexpression was also an independent risk factor for bladder cancer death at all time points of our bladder-sparing protocol (pre-CRT, post-CRT, and post-cystectomy). Conclusions: ERBB 2 overexpression appears relevant to CRT resistance and unfavorable CSS in MIBC patients treated with the CRT-based bladder

  15. Screening to Identify Commonly Used Chinese Herbs That Affect ERBB2 and ESR1 Gene Expression Using the Human Breast Cancer MCF-7 Cell Line

    Directory of Open Access Journals (Sweden)

    Jen-Hwey Chiu

    2014-01-01

    Full Text Available Aim. Our aim the was to screen the commonly used Chinese herbs in order to detect changes in ERBB2 and ESR1 gene expression using MCF-7 cells. Methods. Using the MCF-7 human breast cancer cell line, cell cytotoxicity and proliferation were evaluated by MTT and trypan blue exclusion assays, respectively. A luciferase reporter assay was established by transient transfecting MCF-7 cells with plasmids containing either the ERBB2 or the ESR1 promoter region linked to the luciferase gene. Chinese herbal extracts were used to treat the cells at 24 h after transfection, followed by measurement of their luciferase activity. The screening results were verified by Western blotting to measure HER2 and ERα protein expression. Results. At concentrations that induced little cytotoxicity, thirteen single herbal extracts and five compound recipes were found to increase either ERBB2 or ESR1 luciferase activity. By Western blotting, Si-Wu-Tang, Kuan-Shin-Yin, and Suan-Tsao-Ren-Tang were found to increase either HER2 or ERα protein expression. In addition, Ligusticum chuanxiong was shown to have a great effect on ERBB2 gene expression and synergistically with estrogen to stimulate MCF-7 cell growth. Conclusion. Our results provide important information that should affect clinical treatment strategies among breast cancer patients who are receiving hormonal or targeted therapies.

  16. Pertuzumab Increases 17-AAG-Induced Degradation of ErbB2, and This Effect Is Further Increased by Combining Pertuzumab with Trastuzumab

    Science.gov (United States)

    Hughes, Juliana Bentes; Rødland, Marianne Skeie; Hasmann, Max; Madshus, Inger Helene; Stang, Espen

    2012-01-01

    ErbB2 is an important oncogenic protein involved in carcinogenesis of, among others, breast, gastric, and ovarian carcinoma. Over-expression of ErbB2 is found in almost 20% of breast cancers, and this results in proliferative and anti-apoptotic signalling. ErbB2 is therefore an important treatment target. Antibodies recognizing full-length ErbB2 are clinically established, and drugs targeting the ErbB2 stabilizing heat shock protein 90 (Hsp90) are under clinical evaluation. We have investigated effects of the ErbB2-binding antibodies trastuzumab and pertuzumab alone and in combination, as well as the effect of the antibodies in combination with the Hsp90 inhibitor 17-AAG. Our results confirm the notion that combination of different ErbB2-binding antibodies more efficiently down-regulates ErbB2 than does one antibody in isolation. Additionally, our data demonstrate that ErbB2 is most efficiently down-regulated upon incubation with anti-ErbB2 antibodies in combination with Hsp90 inhibitors. The combination of anti-ErbB2 antibodies, and especially the combination of antibodies with 17-AAG, did also increase the inhibition of Akt activation of either agent, which could suggest an anti-proliferative effect. In such case, combining these agents could be beneficial in treatment of tumors not responding to trastuzumab only. PMID:24281706

  17. Pertuzumab Increases 17-AAG-Induced Degradation of ErbB2, and This Effect Is Further Increased by Combining Pertuzumab with Trastuzumab

    Directory of Open Access Journals (Sweden)

    Juliana Bentes Hughes

    2012-06-01

    Full Text Available ErbB2 is an important oncogenic protein involved in carcinogenesis of, among others, breast, gastric, and ovarian carcinoma. Over-expression of ErbB2 is found in almost 20% of breast cancers, and this results in proliferative and anti-apoptotic signalling. ErbB2 is therefore an important treatment target. Antibodies recognizing full-length ErbB2 are clinically established, and drugs targeting the ErbB2 stabilizing heat shock protein 90 (Hsp90 are under clinical evaluation. We have investigated effects of the ErbB2-binding antibodies trastuzumab and pertuzumab alone and in combination, as well as the effect of the antibodies in combination with the Hsp90 inhibitor 17-AAG. Our results confirm the notion that combination of different ErbB2-binding antibodies more efficiently down-regulates ErbB2 than does one antibody in isolation. Additionally, our data demonstrate that ErbB2 is most efficiently down-regulated upon incubation with anti-ErbB2 antibodies in combination with Hsp90 inhibitors. The combination of anti-ErbB2 antibodies, and especially the combination of antibodies with 17-AAG, did also increase the inhibition of Akt activation of either agent, which could suggest an anti-proliferative effect. In such case, combining these agents could be beneficial in treatment of tumors not responding to trastuzumab only.

  18. ERBB2 mutation is associated with a worse prognosis in patients with CDH1 altered invasive lobular cancer of the breast.

    Science.gov (United States)

    Ping, Zheng; Siegal, Gene P; Harada, Shuko; Eltoum, Isam-Eldin; Youssef, Mariam; Shen, Tiansheng; He, Jianbo; Huang, Yingjie; Chen, Dongquan; Li, Yiping; Bland, Kirby I; Chang, Helena R; Shen, Dejun

    2016-12-06

    E-cadherin (CDH1) is a glycoprotein that mediates adhesion between epithelial cells and also suppresses cancer invasion. Mutation or deletion of the CDH1 gene has been reported in 30-60% cases of invasive lobular carcinoma (ILC). However, little is known about genomic differences between ILC with and without a CDH1 alteration. Therefore, we analyzed whole genome sequencing data of 169 ILC cases from The Cancer Genome Atlas (TCGA) to address this deficiency. Our study shows that CDH1 gene was altered in 59.2% (100/169) of ILC. No significant difference was identified between CDH1-altered and -unaltered ILC cases for any of the examined demographic, clinical or pathologic characteristics, including histologic grade, tumor stage, lymph node metastases, or ER/PR/HER2 states. Seven recurrent mutations (PTEN, MUC16, ERBB2, FAT4, PCDHGA2, HERC1 and FLNC) and four chromosomal changes with recurrent copy number variation (CNV) (11q13, 17q12-21, 8p11 and 8q11) were found in ILC, which correlated with a positive or negative CDH1 alteration status, respectively. The prevalence of the most common breast cancer driver abnormalities including TP53 and PIK3CA mutations and MYC and ERBB2 amplifications showed no difference between the two groups. However, CDH1-altered ILC with an ERBB2 mutation shows a significantly worse prognosis compared to its counterparts without such a mutation. Our study suggests that CDH1-altered ILC patients with ERBB2 mutations may represent an actionable group of patients who could benefit from targeted breast cancer therapy.

  19. Small Molecule Tyrosine Kinase Inhibitors of ErbB2/HER2/Neu in the Treatment of Aggressive Breast Cancer

    Directory of Open Access Journals (Sweden)

    Richard L. Schroeder

    2014-09-01

    Full Text Available The human epidermal growth factor receptor 2 (HER2 is a member of the erbB class of tyrosine kinase receptors. These proteins are normally expressed at the surface of healthy cells and play critical roles in the signal transduction cascade in a myriad of biochemical pathways responsible for cell growth and differentiation. However, it is widely known that amplification and subsequent overexpression of the HER2 encoding oncogene results in unregulated cell proliferation in an aggressive form of breast cancer known as HER2-positive breast cancer. Existing therapies such as trastuzumab (Herceptin® and lapatinib (Tyverb/Tykerb®, a monoclonal antibody inhibitor and a dual EGFR/HER2 kinase inhibitor, respectively, are currently used in the treatment of HER2-positive cancers, although issues with high recurrence and acquired resistance still remain. Small molecule tyrosine kinase inhibitors provide attractive therapeutic targets, as they are able to block cell signaling associated with many of the proposed mechanisms for HER2 resistance. In this regard we aim to present a review on the available HER2 tyrosine kinase inhibitors, as well as those currently in development. The use of tyrosine kinase inhibitors as sequential or combinatorial therapeutic strategies with other HER family inhibitors is also discussed.

  20. Neratinib, an irreversible ErbB receptor tyrosine kinase inhibitor, in patients with advanced ErbB2-positive breast cancer.

    Science.gov (United States)

    Burstein, Harold J; Sun, Yan; Dirix, Luc Y; Jiang, Zefei; Paridaens, Robert; Tan, Antoinette R; Awada, Ahmad; Ranade, Anantbhushan; Jiao, Shunchang; Schwartz, Gary; Abbas, Richat; Powell, Christine; Turnbull, Kathleen; Vermette, Jennifer; Zacharchuk, Charles; Badwe, Rajendra

    2010-03-10

    Neratinib is an oral, irreversible pan-ErbB receptor tyrosine kinase inhibitor. The efficacy and safety of neratinib were evaluated in two cohorts of patients with advanced ErbB2-positive breast cancer-those with and those without prior trastuzumab treatment-in an open-label, multicenter, phase II trial. Patients in the two cohorts (prior trastuzumab, n = 66; no prior trastuzumab, n = 70) received oral neratinib 240 mg once daily. The primary end point was the 16-week progression-free survival (PFS) rate for the evaluable population (prior trastuzumab, n = 63; no prior trastuzumab, n = 64), as assessed by independent review. The 16-week PFS rates were 59% for patients with prior trastuzumab treatment and 78% for patients with no prior trastuzumab treatment. Median PFS was 22.3 and 39.6 weeks, respectively. Objective response rates were 24% among patients with prior trastuzumab treatment and 56% in the trastuzumab-naïve cohort. The most common adverse events were diarrhea, nausea, vomiting, and fatigue. Diarrhea was the most frequent grades 3 to 4 adverse event, occurring in 30% of patients with prior trastuzumab treatment and in 13% of patients with no prior trastuzumab treatment, which prompted dose reductions in 29% and 4% of patients, respectively, but treatment discontinuation in only one patient. No neratinib-related, grades 3 or 4 cardiotoxicity was reported. Oral neratinib showed substantial clinical activity and was reasonably well tolerated among both heavily pretreated and trastuzumab-naïve patients who had advanced, ErbB2-positive breast cancer. Diarrhea was the most common adverse effect but was manageable with antidiarrheal agents and dose modification.

  1. Neratinib Plus Paclitaxel vs Trastuzumab Plus Paclitaxel in Previously Untreated Metastatic ERBB2-Positive Breast Cancer: The NEfERT-T Randomized Clinical Trial.

    Science.gov (United States)

    Awada, Ahmad; Colomer, Ramon; Inoue, Kenichi; Bondarenko, Igor; Badwe, Rajendra A; Demetriou, Georgia; Lee, Soo-Chin; Mehta, Ajay O; Kim, Sung-Bae; Bachelot, Thomas; Goswami, Chanchal; Deo, Suryanarayan; Bose, Ron; Wong, Alvin; Xu, Feng; Yao, Bin; Bryce, Richard; Carey, Lisa A

    2016-12-01

    Efficacious ERBB2 (formerly HER2 or HER2/neu)-directed treatments, in addition to trastuzumab and lapatinib, are needed. To determine whether neratinib, an irreversible pan-ERBB tyrosine kinase inhibitor, plus paclitaxel improves progression-free survival compared with trastuzumab plus paclitaxel in the first-line treatment of recurrent and/or metastatic ERBB2-positive breast cancer. In the randomized, controlled, open-label NEfERT-T trial conducted from August 2009 to December 2014 at 188 centers in 34 countries in Europe, Asia, Africa, and North America, 479 women with previously untreated recurrent and/or metastatic ERBB2-positive breast cancer were randomized to 1 of 2 treatment arms (neratinib-paclitaxel [n = 242] or trastuzumab-paclitaxel [n = 237]). Women with asymptomatic central nervous system metastases were eligible, and randomization was stratified by prior trastuzumab and lapatinib exposure, hormone-receptor status, and region. Women received neratinib (240 mg/d orally) or trastuzumab (4 mg/kg then 2 mg/kg weekly), each combined with paclitaxel (80 mg/m2 on days 1, 8, and 15 every 28 days). Primary prophylaxis for diarrhea was not mandatory. The primary outcome was progression-free survival. Secondary end points were response rate, clinical benefit rate, duration of response, frequency, and time to symptomatic and/or progressive central nervous system lesions, and safety. The intent-to-treat population comprised 479 women 18 years or older (neratinib-paclitaxel, n = 242; trastuzumab-paclitaxel, n = 237) randomized and stratified in their respective treatment arms by prior trastuzumab and lapatinib exposure, hormone-receptor status, and region. Median progression-free survival was 12.9 months (95% CI, 11.1-14.9) with neratinib-paclitaxel and 12.9 months (95% CI, 11.1-14.8) with trastuzumab-paclitaxel (hazard ratio [HR], 1.02; 95% CI, 0.81-1.27; P =.89). With neratinib-paclitaxel, the incidence of central nervous system recurrences was

  2. A Novel Screen for Suppressors of Breast Tumor Cell Growth Using an Oriented Random Peptide Library Method to Identify Inhibitors of the ErbB2 Tyrosine Kinase

    National Research Council Canada - National Science Library

    Carraway, Kermit

    1998-01-01

    .... To identify potential antagonists, the extracellular ligand binding domain of the ErbB2 is immobilized on a column support, and used to affinity purify cyclic peptides from oriented random peptide libraries...

  3. A Novel Screen for Suppressors of Breast Tumor Cell Growth Using an Oriented Random Peptide Library Method to Identify Inhibitors of the ErbB2 Tyrosine Kinase

    National Research Council Canada - National Science Library

    Carraway, Kermit

    1999-01-01

    .... To identify potential antagonists, the extracellular ligand binding domain of the ErbB2 is immobilized on a column support, and used to affinity purify cyclic peptides from oriented random peptide libraries...

  4. Change in HER2 (ERBB2) gene status after taxane-based chemotherapy for breast cancer: polyploidization can lead to diagnostic pitfalls with potential impact for clinical management.

    Science.gov (United States)

    Valent, Alexander; Penault-Llorca, Frédérique; Cayre, Anne; Kroemer, Guido

    2013-01-01

    The status of the HER2 (ERBB2) gene in breast cancer is not static and may change among the primary tumor, lymph node metastases, and distant metastases. This status change can be a consequence of the natural evolution of the tumor or can be induced by therapy. The HER2 gene status is, in the majority of cases, established at the moment of diagnosis. After chemotherapy, monitoring HER2 status can be a challenge because of ploidy changes induced by drugs. The cytogeneticist or the pathologist can face real difficulties in distinguishing between a true HER2 amplification and HER2 copy number increase by polyploidization. We performed a HER2 genetic examination by fluorescence in situ hybridization (FISH) of invasive breast cancers before and after taxane treatment. The majority of patients (91%) were HER2-negative both at diagnosis and after treatment. Thirty of 344 patients (9%) whose tumors were initially HER2-negative were found by FISH to have supernumerary HER2 gene copies (up to 15 copies) after neoadjuvant chemotherapy. This HER2 copy increase could not be attributed to true gene amplifications and instead reflected polyploidization events, which presumably affected all chromosomes. Indeed, when we used other FISH probes, we found other gene copy numbers to parallel those of HER2. We recommend careful checking of invasive breast carcinomas by supplementary FISH probes if the copy number of the HER2 gene is >6. This procedure allows the discrimination of specific HER2 gene amplifications and global increases in ploidy. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. The Role of Notch Signaling Pathway in Breast Cancer Pathogenesis

    Science.gov (United States)

    2005-07-01

    breast cancer cells, I tested whether ErbB2 overexpression will cooperate with Notch in HMLE cells. While overexpression of activated Notch1 failed to...tyrosine kinase upstream of Ras normally found overexpressed in many breast cancers , also failed to transform HMLE cells. These observations suggested...cooperation between Notch1IC and ErbB2 signaling in transforming HMLE cells. Breast cancers typically do not harbor oncogenic Ras mutations; nevertheless

  6. Update on HER-2 as a target for cancer therapy: The ERBB2 promoter and its exploitation for cancer treatment

    International Nuclear Information System (INIS)

    Hurst, Helen C

    2001-01-01

    Overexpression of the ERBB2 proto-oncogene is associated with amplification of the gene in breast cancer but increased activity of the promoter also plays a significant role. Members of two transcription factor families (AP-2 and Ets) show increased binding to the promoter in over-expressing cells. Consequently, strategies have been devised to target promoter activity, either through the DNA binding sites for these factors, or through another promoter sequence, a polypurine-polypyrimidine repeat structure. The promoter has also been exploited for its tumour-specific activity to direct the accumulation of cytotoxic compounds selectively within cancer cells. Our current understanding of the ERBB2 promoter is reviewed and the status of these therapeutic avenues is discussed

  7. Bloch Surface Waves Biosensors for High Sensitivity Detection of Soluble ERBB2 in a Complex Biological Environment.

    Science.gov (United States)

    Sinibaldi, Alberto; Sampaoli, Camilla; Danz, Norbert; Munzert, Peter; Sonntag, Frank; Centola, Fabio; Occhicone, Agostino; Tremante, Elisa; Giacomini, Patrizio; Michelotti, Francesco

    2017-08-17

    We report on the use of one-dimensional photonic crystals to detect clinically relevant concentrations of the cancer biomarker ERBB2 in cell lysates. Overexpression of the ERBB2 protein is associated with aggressive breast cancer subtypes. To detect soluble ERBB2, we developed an optical set-up which operates in both label-free and fluorescence modes. The detection approach makes use of a sandwich assay, in which the one-dimensional photonic crystals sustaining Bloch surface waves are modified with monoclonal antibodies, in order to guarantee high specificity during the biological recognition. We present the results of exemplary protein G based label-free assays in complex biological matrices, reaching an estimated limit of detection of 0.5 ng/mL. On-chip and chip-to-chip variability of the results is addressed too, providing repeatability rates. Moreover, results on fluorescence operation demonstrate the capability to perform high sensitive cancer biomarker assays reaching a resolution of 0.6 ng/mL, without protein G assistance. The resolution obtained in both modes meets international guidelines and recommendations (15 ng/mL) for ERBB2 quantification assays, providing an alternative tool to phenotype and diagnose molecular cancer subtypes.

  8. ErbB2, but not ErbB1, reinitiates proliferation and induces luminal repopulation in epithelial acini

    Energy Technology Data Exchange (ETDEWEB)

    Muthuswamy, Senthil K; Li, Dongmei; Lelievre, Sophie; Bissell, Mina J; Brugge, Joan S

    2001-08-08

    Both ErbB1 and ErbB2 are overexpressed or amplified in breast tumors. To examine the effects of activating ErbB receptors in a context that mimics polarized epithelial cells in vivo, we activated ErbB1 and ErbB2 homodimers in preformed, growth-arrested mammary acini cultured in three-dimensional basement membrane gels. Activation of ErbB2, but not that of ErbB1, led to a reinitiation of cell proliferation and altered the properties of mammary acinar structures. These altered structures share several properties with early-stage tumors, including a loss of proliferative suppression, an absence of lumen, retention of the basement membrane and a lack of invasive properties. ErbB2 activation also disrupted tight junctions and the cell polarity of polarized epithelia, whereas ErbB1 activation did not have any effect. Our results indicate that ErbB receptors differ in their ability to induce early stages of mammary carcinogenesis in vitro and this three-dimensional model system can reveal biological activities of oncogenes that cannot be examined in vitro in standard transformation assays.

  9. Preubiquitinated chimeric ErbB2 is constitutively endocytosed and subsequently degraded in lysosomes

    Energy Technology Data Exchange (ETDEWEB)

    Vuong, Tram Thu [Institute of Clinical Medicine, University of Oslo, Rikshospitalet, 0027 Oslo (Norway); Berger, Christian [Department of Pathology, Oslo University Hospital, Rikshospitalet, P.O. Box 4950 Nydalen, 0424 Oslo (Norway); Bertelsen, Vibeke; Rødland, Marianne Skeie [Institute of Clinical Medicine, University of Oslo, Rikshospitalet, 0027 Oslo (Norway); Stang, Espen [Department of Pathology, Oslo University Hospital, Rikshospitalet, P.O. Box 4950 Nydalen, 0424 Oslo (Norway); Madshus, Inger Helene, E-mail: i.h.madshus@medisin.uio.no [Institute of Clinical Medicine, University of Oslo, Rikshospitalet, 0027 Oslo (Norway); Department of Pathology, Oslo University Hospital, Rikshospitalet, P.O. Box 4950 Nydalen, 0424 Oslo (Norway)

    2013-02-01

    The oncoprotein ErbB2 is endocytosis-deficient, probably due to its interaction with Heat shock protein 90. We previously demonstrated that clathrin-dependent endocytosis of ErbB2 is induced upon incubation of cells with Ansamycin derivatives, such as geldanamycin and its derivative 17-AAG. Furthermore, we have previously demonstrated that a preubiquitinated chimeric EGFR (EGFR-Ub{sub 4}) is constitutively endocytosed in a clathrin-dependent manner. We now demonstrate that also an ErbB2-Ub{sub 4} chimera is endocytosed constitutively and clathrin-dependently. Upon expression, the ErbB2-Ub{sub 4} was further ubiquitinated, and by Western blotting, we demonstrated the formation of both Lys48-linked and Lys63-linked polyubiquitin chains. ErbB2-Ub{sub 4} was constitutively internalized and eventually sorted to late endosomes and lysosomes where the fusion protein was degraded. ErbB2-Ub{sub 4} was not cleaved prior to internalization. Interestingly, over-expression of Ubiquitin Interaction Motif-containing dominant negative fragments of the clathrin adaptor proteins epsin1 and Eps15 negatively affected endocytosis of ErbB2. Altogether, this argues that ubiquitination is sufficient to induce clathrin-mediated endocytosis and lysosomal degradation of the otherwise plasma membrane localized ErbB2. Also, it appears that C-terminal cleavage is not required for endocytosis. -- Highlights: ► A chimera containing ErbB2 and a tetra-Ubiquitin chain internalizes constitutively. ► Receptor fragmentation is not required for endocytosis of ErbB2. ► Ubiquitination is sufficient to induce endocytosis and degradation of ErbB2. ► ErbB2-Ub4 is internalized clathrin-dependently.

  10. Preubiquitinated chimeric ErbB2 is constitutively endocytosed and subsequently degraded in lysosomes

    International Nuclear Information System (INIS)

    Vuong, Tram Thu; Berger, Christian; Bertelsen, Vibeke; Rødland, Marianne Skeie; Stang, Espen; Madshus, Inger Helene

    2013-01-01

    The oncoprotein ErbB2 is endocytosis-deficient, probably due to its interaction with Heat shock protein 90. We previously demonstrated that clathrin-dependent endocytosis of ErbB2 is induced upon incubation of cells with Ansamycin derivatives, such as geldanamycin and its derivative 17-AAG. Furthermore, we have previously demonstrated that a preubiquitinated chimeric EGFR (EGFR-Ub 4 ) is constitutively endocytosed in a clathrin-dependent manner. We now demonstrate that also an ErbB2-Ub 4 chimera is endocytosed constitutively and clathrin-dependently. Upon expression, the ErbB2-Ub 4 was further ubiquitinated, and by Western blotting, we demonstrated the formation of both Lys48-linked and Lys63-linked polyubiquitin chains. ErbB2-Ub 4 was constitutively internalized and eventually sorted to late endosomes and lysosomes where the fusion protein was degraded. ErbB2-Ub 4 was not cleaved prior to internalization. Interestingly, over-expression of Ubiquitin Interaction Motif-containing dominant negative fragments of the clathrin adaptor proteins epsin1 and Eps15 negatively affected endocytosis of ErbB2. Altogether, this argues that ubiquitination is sufficient to induce clathrin-mediated endocytosis and lysosomal degradation of the otherwise plasma membrane localized ErbB2. Also, it appears that C-terminal cleavage is not required for endocytosis. -- Highlights: ► A chimera containing ErbB2 and a tetra-Ubiquitin chain internalizes constitutively. ► Receptor fragmentation is not required for endocytosis of ErbB2. ► Ubiquitination is sufficient to induce endocytosis and degradation of ErbB2. ► ErbB2-Ub4 is internalized clathrin-dependently.

  11. NUCKS overexpression in breast cancer

    Directory of Open Access Journals (Sweden)

    Kittas Christos

    2009-08-01

    Full Text Available Abstract Background NUCKS (Nuclear, Casein Kinase and Cyclin-dependent Kinase Substrate is a nuclear, DNA-binding and highly phosphorylated protein. A number of reports show that NUCKS is highly expressed on the level of mRNA in several human cancers, including breast cancer. In this work, NUCKS expression on both RNA and protein levels was studied in breast tissue biopsies consisted of invasive carcinomas, intraductal proliferative lesions, benign epithelial proliferations and fibroadenomas, as well as in primary cultures derived from the above biopsies. Specifically, in order to evaluate the level of NUCKS protein in correlation with the histopathological features of breast disease, immunohistochemistry was employed on paraffin sections of breast biopsies of the above types. In addition, NUCKS expression was studied by means of Reverse Transcription PCR (RT-PCR, real-time PCR (qRT-PCR and Western immunoblot analyses in the primary cell cultures developed from the same biopsies. Results The immunohistochemical Results showed intense NUCKS staining mostly in grade I and II breast carcinomas compared to normal tissues. Furthermore, NUCKS was moderate expressed in benign epithelial proliferations, such as adenosis and sclerosing adenosis, and highly expressed in intraductal lesions, specifically in ductal carcinomas in situ (DCIS. It is worth noting that all the fibroadenoma tissues examined were negative for NUCKS staining. RT-PCR and qRT-PCR showed an increase of NUCKS expression in cells derived from primary cultures of proliferative lesions and cancerous tissues compared to the ones derived from normal breast tissues and fibroadenomas. This increase was also confirmed by Western immunoblot analysis. Although NUCKS is a cell cycle related protein, its expression does not correlate with Ki67 expression, neither in tissue sections nor in primary cell cultures. Conclusion The results show overexpression of the NUCKS protein in a number of non

  12. Adjuvant letrozole versus tamoxifen according to centrally-assessed ERBB2 status for postmenopausal women with endocrine-responsive early breast cancer: supplementary results from the BIG 1-98 randomised trial

    DEFF Research Database (Denmark)

    Regan, M.M.; Lykkesfeldt, A.E.; Dell'Orto, P.

    2008-01-01

    Background The Breast International Group (BIG) 1-98 trial (a randomised double-blind phase III trial) has shown that letrozole significantly improves disease-free survival (DFS) compared with tamoxifen in postmenopausal women with endocrine-responsive early breast cancer. Our aim was to establish...... whether the benefit of letrozole versus tamoxifen differs according to the ERBB2 status of tumours. Methods The BIG 1-98 trial consists of four treatment groups that compare 5 years of monotherapy with letrozole or tamoxifen, and sequential administration of one drug for 2 years followed by the other drug...... for 3 years. Our study includes data from the 4922 patients randomly assigned to the two monotherapy treatment groups (letrozole or tamoxifen for 5 years; 51 months median follow-up [range

  13. Erbb2 up-regulation of ADAM12 expression accelerates skin cancer progression.

    Science.gov (United States)

    Rao, Velidi H; Vogel, Kristen; Yanagida, Jodi K; Marwaha, Nitin; Kandel, Amrit; Trempus, Carol; Repertinger, Susan K; Hansen, Laura A

    2015-10-01

    Solar ultraviolet (UV) radiation can cause severe damage to the skin and is the primary cause of most skin cancer. UV radiation causes DNA damage leading to mutations and also activates the Erbb2/HER2 receptor through indirect mechanisms involving reactive oxygen species. We hypothesized that Erbb2 activation accelerates the malignant progression of UV-induced skin cancer. Following the induction of benign squamous papillomas by UV exposure of v-ras(Ha) transgenic Tg.AC mice, mice were treated topically with the Erbb2 inhibitor AG825 and tumor progression monitored. AG825 treatment reduced tumor volume, increased tumor regression, and delayed the development of malignant squamous cell carcinoma (SCC). Progression to malignancy was associated with increased Erbb2 and ADAM12 (A Disintegin And Metalloproteinase 12) transcripts and protein, while inhibition of Erbb2 blocked the increase in ADAM12 message upon malignant progression. Similarly, human SCC and SCC cell lines had increased ADAM12 protein and transcripts when compared to normal controls. To determine whether Erbb2 up-regulation of ADAM12 contributed to malignant progression of skin cancer, Erbb2 expression was modulated in cultured SCC cells using forced over-expression or siRNA targeting, demonstrating up-regulation of ADAM12 by Erbb2. Furthermore, ADAM12 transfection or siRNA targeting revealed that ADAM12 increased both the migration and invasion of cutaneous SCC cells. Collectively, these results suggest Erbb2 up-regulation of ADAM12 as a novel mechanism contributing to the malignant progression of UV-induced skin cancer. Inhibition of Erbb2/HER2 reduced tumor burden, increased tumor regression, and delayed the progression of benign skin tumors to malignant SCC in UV-exposed mice. Inhibition of Erbb2 suppressed the increase in metalloproteinase ADAM12 expression in skin tumors, which in turn increased migration and tumor cell invasiveness. © 2014 Wiley Periodicals, Inc.

  14. Imaging biomarkers to predict response to anti-HER2 (ErbB2) therapy in preclinical models of breast cancer

    Science.gov (United States)

    Shah, Chirayu; Miller, Todd W.; Wyatt, Shelby K.; McKinley, Eliot T.; Olivares, Maria Graciela; Sanchez, Violeta; Nolting, Donald D.; Buck, Jason R.; Zhao, Ping; Ansari, M. Sib; Baldwin, Ronald M.; Gore, John C.; Schiff, Rachel; Arteaga, Carlos L.; Manning, H. Charles

    2010-01-01

    Purpose To evaluate non-invasive imaging methods as predictive biomarkers of response to trastuzumab in mouse models of HER2-overexpressing breast cancer. The correlation between tumor regression and molecular imaging of apoptosis, glucose metabolism, and cellular proliferation was evaluated longitudinally in responding and non-responding tumor-bearing cohorts. Experimental Design Mammary tumors from MMTV/HER2 transgenic female mice were transplanted into syngeneic female mice. BT474 human breast carcinoma cell line xenografts were grown in athymic nude mice. Tumor cell apoptosis (NIR700-Annexin-V accumulation), glucose metabolism ([18F]FDG-PET), and proliferation ([18F]FLT-PET) were evaluated throughout a bi-weekly trastuzumab regimen. Imaging metrics were validated by direct measurement of tumor size and immunohistochemical (IHC) analysis of cleaved caspase-3, phosphorylated AKT (p-AKT) and Ki67. Results NIR700-Annexin-V accumulated significantly in trastuzumab-treated MMTV/HER2 and BT474 tumors that ultimately regressed, but not in non-responding or vehicle-treated tumors. Uptake of [18F]FDG was not affected by trastuzumab treatment in MMTV/HER2 or BT474 tumors. [18F]FLT PET imaging predicted trastuzumab response in BT474 tumors but not in MMTV/HER2 tumors, which exhibited modest uptake of [18F]FLT. Close agreement was observed between imaging metrics and IHC analysis. Conclusions Molecular imaging of apoptosis accurately predicts trastuzumab-induced regression of HER2(+) tumors and may warrant clinical exploration to predict early response to neoadjuvant trastuzumab. Trastuzumab does not appear to alter glucose metabolism substantially enough to afford [18F]FDG-PET significant predictive value in this setting. Although promising in one preclinical model, further studies are required to determine the overall value of [18F]FLT-PET as a biomarker of response to trastuzumab in HER2+ breast cancer. PMID:19584166

  15. The Na+/H+ exchanger NHE1, but not the Na+, HCO3- cotransporter NBCn1, regulates motility of MCF7 breast cancer cells expressing constitutively active ErbB2

    DEFF Research Database (Denmark)

    Lauritzen, Gitte; Stock, Christian-Martin; Lemaire, Justine

    2012-01-01

    We and others have shown central roles of the Na(+)/H(+) exchanger NHE1 in cell motility. The aim of this study was to determine the roles of NHE1 and of the Na(+), HCO(3)(-) cotransporter NBCn1 in motility of serum-starved MCF-7 breast cancer cells expressing constitutively active ErbB2 (¿NErbB2...

  16. Safety and efficacy of neratinib (HKI-272) plus vinorelbine in the treatment of patients with ErbB2-positive metastatic breast cancer pretreated with anti-HER2 therapy.

    Science.gov (United States)

    Awada, A; Dirix, L; Manso Sanchez, L; Xu, B; Luu, T; Diéras, V; Hershman, D L; Agrapart, V; Ananthakrishnan, R; Staroslawska, E

    2013-01-01

    Neratinib (HKI-272) is a potent irreversible pan-ErbB tyrosine kinase inhibitor with clinical activity in patients with ErbB2/HER2-positive breast cancer. Phase I of this open-label, phase I/II study investigated the maximum tolerated dose (MTD) of oral neratinib (160 or 240 mg/day) plus vinorelbine (25 mg/m2; days 1 and 8 of each 21-day cycle) in patients with solid tumors. Phase II assessed the safety, clinical activity, and pharmacokinetics of the combination in patients with HER2-positive metastatic breast cancer; the primary efficacy end point was objective response (OR). In phase I (n=12), neratinib (240 mg) plus vinorelbine (25 mg/m2) was established as the MTD. In phase II, 79 patients with HER2-positive metastatic breast cancer were treated at the MTD. The most common treatment-related adverse events were diarrhea (96%), neutropenia (54%), and nausea (50%). Three patients discontinued treatment due to diarrhea. No clinically important skin side-effects were observed. The OR rate in assessable phase II patients was 41% (no prior lapatinib) and 8% (prior lapatinib). There was no evidence of pharmacokinetic interaction between neratinib and vinorelbine. Neratinib plus vinorelbine showed promising antitumor activity and no unexpected toxic effects in HER2-positive metastatic breast cancer patients. Trial registration ClinicalTrials.gov #NCT00706030.

  17. ErbB2 resembles an autoinhibited invertebrate epidermal growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado, Diego; Klein, Daryl E.; Lemmon, Mark A.; (UPENN-MED)

    2009-09-25

    The orphan receptor tyrosine kinase ErbB2 (also known as HER2 or Neu) transforms cells when overexpressed, and it is an important therapeutic target in human cancer. Structural studies have suggested that the oncogenic (and ligand-independent) signalling properties of ErbB2 result from the absence of a key intramolecular 'tether' in the extracellular region that autoinhibits other human ErbB receptors, including the epidermal growth factor (EGF) receptor. Although ErbB2 is unique among the four human ErbB receptors, here we show that it is the closest structural relative of the single EGF receptor family member in Drosophila melanogaster (dEGFR). Genetic and biochemical data show that dEGFR is tightly regulated by growth factor ligands, yet a crystal structure shows that it, too, lacks the intramolecular tether seen in human EGFR, ErbB3 and ErbB4. Instead, a distinct set of autoinhibitory interdomain interactions hold unliganded dEGFR in an inactive state. All of these interactions are maintained (and even extended) in ErbB2, arguing against the suggestion that ErbB2 lacks autoinhibition. We therefore suggest that normal and pathogenic ErbB2 signalling may be regulated by ligands in the same way as dEGFR. Our findings have important implications for ErbB2 regulation in human cancer, and for developing therapeutic approaches that target novel aspects of this orphan receptor.

  18. Chimeric DNA Vaccines against ErbB2{sup +} Carcinomas: From Mice to Humans

    Energy Technology Data Exchange (ETDEWEB)

    Quaglino, Elena; Riccardo, Federica; Macagno, Marco; Bandini, Silvio; Cojoca, Rodica; Ercole, Elisabetta [Molecular Biotechnology Center, Department of Clinical and Biological Sciences, University of Turin, 10126 Turin (Italy); Amici, Augusto [Department of Molecular Cellular and Animal Biology, University of Camerino, 62032 Camerino (Italy); Cavallo, Federica, E-mail: federica.cavallo@unito.it [2 Department of Molecular Cellular and Animal Biology, University of Camerino, 62032 Camerino (Italy)

    2011-08-10

    DNA vaccination exploits a relatively simple and flexible technique to generate an immune response against microbial and tumor-associated antigens (TAAs). Its effectiveness is enhanced by the application of an electrical shock in the area of plasmid injection (electroporation). In our studies we exploited a sophisticated electroporation device approved for clinical use (Cliniporator, IGEA, Carpi, Italy). As the target antigen is an additional factor that dramatically modulates the efficacy of a vaccine, we selected ErbB2 receptor as a target since it is an ideal oncoantigen. It is overexpressed on the cell membrane by several carcinomas for which it plays an essential role in driving their progression. Most oncoantigens are self-tolerated molecules. To circumvent immune tolerance we generated two plasmids (RHuT and HuRT) coding for chimeric rat/human ErbB2 proteins. Their immunogenicity was compared in wild type mice naturally tolerant for mouse ErbB2, and in transgenic mice that are also tolerant for rat or human ErbB2. In several of these mice, RHuT and HuRT elicited a stronger anti-tumor response than plasmids coding for fully human or fully rat ErbB2. The ability of heterologous moiety to blunt immune tolerance could be exploited to elicit a significant immune response in patients. A clinical trial to delay the recurrence of ErbB2{sup +} carcinomas of the oral cavity, oropharynx and hypopharynx is awaiting the approval of the Italian authorities.

  19. Gene Expression Meta-Analysis identifies Cytokine Pathways and 5q Aberrations involved in Metastasis of ERBB2 Amplified and Basal Breast Cancer

    DEFF Research Database (Denmark)

    Thomassen, Mads; Tan, Qihua; Burton, Mark

    2013-01-01

    Background: Breast tumors have been described by molecular subtypes characterized by pervasively different gene expression profiles. The subtypes are associated with different clinical parameters and origin of precursor cells. However, the biological pathways and chromosomal aberrations that differ...... the subgroups impact metastasis. Results: We have scrutinized publicly available gene expression datasets and identified molecular subtypes in 1,394 breast tumors with outcome data. By analysis of chromosomal regions and pathways using “Gene set enrichment analysis” followed by a meta-analysis, we identified...... between the subgroups are less well characterized. The molecular subtypes are associated with different risk of metastatic recurrence of the disease. Nevertheless, the performance of these overall patterns to predict outcome is far from optimal, suggesting that biological mechanisms that extend beyond...

  20. The Role of Novel Substituted Diindolyl Methane Analogues in the Treatment of Triple-Negative and ErbB2-Positive Breast Cancer

    Science.gov (United States)

    2016-05-01

    among FAMU researchers and African American Community about breast cancer biology and therapy. The outcome of this proposal will lead to novel oral...drastically reduced from -23.22 mV to -2.64 mV on addition of 1:0.5 molar DOGS -NTA-Ni:CREKA. Surface complexation of CREKA increased the zeta potential of...Hydrodynamic diameter of DPL after separation of mannitol was 189.3 ± 5.7 nm. However, particle size was nearly similar at all the DOGS -NTA-Ni:CREKA ratios

  1. Engineering of bispecific affinity proteins with high affinity for ERBB2 and adaptable binding to albumin.

    Directory of Open Access Journals (Sweden)

    Johan Nilvebrant

    Full Text Available The epidermal growth factor receptor 2, ERBB2, is a well-validated target for cancer diagnostics and therapy. Recent studies suggest that the over-expression of this receptor in various cancers might also be exploited for antibody-based payload delivery, e.g. antibody drug conjugates. In such strategies, the full-length antibody format is probably not required for therapeutic effect and smaller tumor-specific affinity proteins might be an alternative. However, small proteins and peptides generally suffer from fast excretion through the kidneys, and thereby require frequent administration in order to maintain a therapeutic concentration. In an attempt aimed at combining ERBB2-targeting with antibody-like pharmacokinetic properties in a small protein format, we have engineered bispecific ERBB2-binding proteins that are based on a small albumin-binding domain. Phage display selection against ERBB2 was used for identification of a lead candidate, followed by affinity maturation using second-generation libraries. Cell surface display and flow-cytometric sorting allowed stringent selection of top candidates from pools pre-enriched by phage display. Several affinity-matured molecules were shown to bind human ERBB2 with sub-nanomolar affinity while retaining the interaction with human serum albumin. Moreover, parallel selections against ERBB2 in the presence of human serum albumin identified several amino acid substitutions that dramatically modulate the albumin affinity, which could provide a convenient means to control the pharmacokinetics. The new affinity proteins competed for ERBB2-binding with the monoclonal antibody trastuzumab and recognized the native receptor on a human cancer cell line. Hence, high affinity tumor targeting and tunable albumin binding were combined in one small adaptable protein.

  2. Cdk2-Null Mice Are Resistant to ErbB-2-Induced Mammary Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Dipankar Ray

    2011-05-01

    Full Text Available The concept of targeting G1 cyclin-dependent kinases (CDKs in breast cancer treatments is supported by the fact that the genetic ablation of Cdk4 had minimal impacts on normal cell proliferation in majority of cell types, resulting in near-normal mouse development, whereas such loss of Cdk4 completely abrogated ErbB-2/neu-induced mammary tumorigenesis in mice. In most human breast cancer tissues, another G1-regulatory CDK, CDK2, is also hyperactivated by various mechanisms and is believed to be an important therapeutic target. In this report, we provide genetic evidence that CDK2 is essential for proliferation and oncogenesis of murine mammary epithelial cells. We observed that 87% of Cdk2-null mice were protected from ErbB-2-induced mammary tumorigenesis. Mouse embryonic fibroblasts isolated from Cdk2-null mouse showed resistance to various oncogene-induced transformation. Previously, we have reported that hemizygous loss of Cdc25A, the major activator of CDK2, can also protect mice from ErbB-2-induced mammary tumorigenesis [Cancer Res (2007 67(14: 6605–11]. Thus, we propose that CDC25A-CDK2 pathway is critical for the oncogenic action of ErbB-2 in mammary epithelial cells, in a manner similar to Cyclin D1/CDK4 pathway.

  3. Genetic Polymorphisms in the EGFR (R521K and Estrogen Receptor (T594T Genes, EGFR and ErbB-2 Protein Expression, and Breast Cancer Risk in Tunisia

    Directory of Open Access Journals (Sweden)

    Imen Kallel

    2009-01-01

    Full Text Available We evaluated the association of epidermal growth factor receptor (EGFR 142285G>A (R521K and estrogen receptor alpha (ESR1 2014G>A (T594T single nucleotide polymorphisms with breast cancer risk and prognosis in Tunisian patients. EGFR 142285G>A and ESR1 2014G>A were genotyped in a sample of 148 Tunisian breast cancer patients and 303 controls using PCR-RFLP method. Immunohistochemitsry was used to evaluate the expression levels of EGFR, HER2, ESR1, progesterone receptor and BCL2 in tumors. We found no evidence for an association between EGFR R521K polymorphism and breast cancer risk. However, we found that the homozygous GG (Arg genotype was more prevalent in patients with lymph node metastasis (=.03 and high grade tumors (=.011. The ESR1 2014G allele showed significant association with breast cancer risk (=.025. The GG genotype was associated with HER2 overexpression and this association withstood univariate and multivariate analyses (=.009; =.021, resp.. These data suggest that the R521K might be a prognostic factor, because it correlates with both tumor grade and nodule status. The higher expression of HER2 in ESR1 T594T GG patients suggests the possibility that ESR1 gene polymorphisms accompanied by HER2 expression might influence the pathogenesis of breast cancers.

  4. OCAM regulates embryonic spinal cord stem cell proliferation by modulating ErbB2 receptor.

    Directory of Open Access Journals (Sweden)

    Loïc Deleyrolle

    Full Text Available The proliferation and differentiation of neural stem cells are tightly controlled by intrinsic and extrinsic cues. Cell adhesion molecules are increasingly recognized as regulators of these processes. Here we report the expression of the olfactory cell adhesion molecule (OCAM/NCAM2/RNCAM during mouse spinal cord development and in neural stem cells cultured as neurospheres. OCAM is also weakly expressed in the dormant adult stem cell niche around the central canal and is overexpressed after spinal cord injury. Both transmembrane (TM and glycosylphosphatidylinositol (GPI-linked isoforms are present in neurospheres. Electron microscopy and internalisation experiments revealed a dynamic trafficking of OCAM between the membrane and intracellular compartments. After differentiation, OCAM remains in neurons and oligodendrocytes whereas no expression is detected in astrocytes. Using OCAM knockout (KO mice, we found that mutant spinal cord stem cells showed an increased proliferation and self-renewal rates although no effect on differentiation was observed. This effect was reversed by lentivirus-mediated re-introduction of OCAM. Mechanistically, we identified the ErbB2/Neu/HER2 protein as being implicated in the enhanced proliferation of mutant cells. ErbB2 protein expression and phosphorylation level were significantly increased in KO cells whereas no difference was observed at the mRNA level. Overexpression of ErbB2 in wild-type and mutant cells also increased their growth while reintroduction of OCAM in mutant cells reduced the level of phosphorylated ErbB2. These results indicate that OCAM exerts a posttranscriptional control on the ErbB2 signalling in spinal cord stem cells. This study adds further support for considering cell adhesion molecules as regulators of the ErbB signalling.

  5. Role of Notch Signaling in Human Breast Cancer Pathogenesis

    Science.gov (United States)

    2006-11-01

    transform HMLE cells. Similarly, overexpression of ErbB2, a receptor tyrosine kinase upstream of Ras normally found overexpressed in many breast cancers ...Assess Notch-Ras cooperation in breast cancers in vivo: Since the major observation in this project has been the cooperation of Notch and Ras in HMLE ...metastasis. The in vitro cooperation between Notch and Ras in HMLE cells is mimicked in naturally arising breast cancers in vivo. Further dissection of the

  6. ErbB4 Overexpression as an Antagonist of ErbB2/HER2/Neu Induced Human Breast Cancer Cell Proliferation

    Science.gov (United States)

    2006-08-01

    advantage and evade therapeutic eradication. Death decisions within mammalian cells are primarily regulated by the interplay between proapoptotic and...BH3 domains either sensitize or activate mitochondrial apoptosis, serving as prototype cancer therapeutics . Cancer Cell 2002;2:183–92. 28. Bouillet P...Agricultural University, P. R. China, BS, Horticulture Positions and Honors 2005.5-Present Postdoctoral Fellow, Department of Molecular and Cellular

  7. The role of ERBB2 gene polymorphisms in leprosy susceptibility

    Directory of Open Access Journals (Sweden)

    Jamile Leão Rêgo

    2015-03-01

    Full Text Available Mycobacterium leprae infects skin and peripheral nerves causing deformities and disability. The M. leprae bacterium binds to ErbB2 on the Schwann cell surface causing demyelination and favoring spread of the bacilli and causing nerve injury. Polymorphisms at the ERBB2 gene were previously investigated as genetic risk factors for leprosy in two Brazilian populations but with inconsistent results. Herein we extend the analysis of ERBB2 variants to a third geographically distinct population in Brazil. Our results show that there is no association between the genotyped SNPs and the disease (p > 0.05 in this population. A gene set or pathway analysis under the genomic region of ERBB2 will be necessary to clarify its regulation under M. leprae stimulus.

  8. Technical validation of an RT-qPCR in vitro diagnostic test system for the determination of breast cancer molecular subtypes by quantification of ERBB2, ESR1, PGR and MKI67 mRNA levels from formalin-fixed paraffin-embedded breast tumor specimens.

    Science.gov (United States)

    Laible, Mark; Schlombs, Kornelia; Kaiser, Katharina; Veltrup, Elke; Herlein, Stefanie; Lakis, Sotiris; Stöhr, Robert; Eidt, Sebastian; Hartmann, Arndt; Wirtz, Ralph M; Sahin, Ugur

    2016-07-07

    MammaTyper is a novel CE-marked in vitro diagnostic RT-qPCR assay which assigns routinely processed breast cancer specimens into the molecular subtypes Luminal A-like, Luminal B-like (HER2 positive or negative), HER2 positive (non-luminal) and Triple negative (ductal) according to the mRNA expression of ERBB2, ESR1, PGR and MKI67 and the St Gallen consensus surrogate clinical definition. Until now and regarding formalin-fixed, paraffin-embedded material (FFPE), this has been a task mostly accomplished by immunohistochemistry (IHC). However the discrepancy rates of IHC for the four breast cancer biomarkers are frequently under debate, especially for Ki-67 which carries the highest degree of inter- and even intra-observer variability. Herein we describe a series of studies in FFPE specimens which aim to fully validate the analytical performance of the MammaTyper assay, including the site to site reproducibility of the individual marker measurements. Tumor RNA was extracted with the novel RNXtract RNA extraction kit. Synthetic RNA was used to assess the sensitivity of the RNXtract kit. DNA and RNA specific qPCR assays were used so as to determine analyte specificity of RNXtract. For the assessment of limit of blank, limit of detection, analytical measurement range and PCR efficiency of the MammaTyper kit serial dilutions of samples were used. Analytical precision studies of MammaTyper were built around two different real time PCR platforms and involved breast tumor samples belonging to different subtypes analyzed across multiple sites and under various stipulated conditions. The MammaTyper assay robustness was tested against RNA input variations, alternative extraction methods and tumor cell content. Individual assays were linear up to at least 32.33 and 33.56 Cqs (quantification cycles) for the two qPCR platforms tested. PCR efficiency ranged from 99 to 109 %. In qPCR platform 1, estimates for assay specific inter-site standard deviations (SD) were between 0.14 and

  9. Technical validation of an RT-qPCR in vitro diagnostic test system for the determination of breast cancer molecular subtypes by quantification of ERBB2, ESR1, PGR and MKI67 mRNA levels from formalin-fixed paraffin-embedded breast tumor specimens

    International Nuclear Information System (INIS)

    Laible, Mark; Schlombs, Kornelia; Kaiser, Katharina; Veltrup, Elke; Herlein, Stefanie; Lakis, Sotiris; Stöhr, Robert; Eidt, Sebastian; Hartmann, Arndt; Wirtz, Ralph M.; Sahin, Ugur

    2016-01-01

    MammaTyper is a novel CE-marked in vitro diagnostic RT-qPCR assay which assigns routinely processed breast cancer specimens into the molecular subtypes Luminal A-like, Luminal B-like (HER2 positive or negative), HER2 positive (non-luminal) and Triple negative (ductal) according to the mRNA expression of ERBB2, ESR1, PGR and MKI67 and the St Gallen consensus surrogate clinical definition. Until now and regarding formalin-fixed, paraffin-embedded material (FFPE), this has been a task mostly accomplished by immunohistochemistry (IHC). However the discrepancy rates of IHC for the four breast cancer biomarkers are frequently under debate, especially for Ki-67 which carries the highest degree of inter- and even intra-observer variability. Herein we describe a series of studies in FFPE specimens which aim to fully validate the analytical performance of the MammaTyper assay, including the site to site reproducibility of the individual marker measurements. Tumor RNA was extracted with the novel RNXtract RNA extraction kit. Synthetic RNA was used to assess the sensitivity of the RNXtract kit. DNA and RNA specific qPCR assays were used so as to determine analyte specificity of RNXtract. For the assessment of limit of blank, limit of detection, analytical measurement range and PCR efficiency of the MammaTyper kit serial dilutions of samples were used. Analytical precision studies of MammaTyper were built around two different real time PCR platforms and involved breast tumor samples belonging to different subtypes analyzed across multiple sites and under various stipulated conditions. The MammaTyper assay robustness was tested against RNA input variations, alternative extraction methods and tumor cell content. Individual assays were linear up to at least 32.33 and 33.56 Cqs (quantification cycles) for the two qPCR platforms tested. PCR efficiency ranged from 99 to 109 %. In qPCR platform 1, estimates for assay specific inter-site standard deviations (SD) were between 0.14 and 0

  10. A moderate elevation of circulating levels of IGF-I does not alter ErbB2 induced mammary tumorigenesis

    International Nuclear Information System (INIS)

    Dearth, Robert K; Kuiatse, Isere; Wang, Yu-Fen; Liao, Lan; Hilsenbeck, Susan G; Brown, Powel H; Xu, Jianming; Lee, Adrian V

    2011-01-01

    Epidemiological evidence suggests that moderately elevated levels of circulating insulin-like growth factor-I (IGF-I) are associated with increased risk of breast cancer in women. How circulating IGF-I may promote breast cancer incidence is unknown, however, increased IGF-I signaling is linked to trastuzumab resistance in ErbB2 positive breast cancer. Few models have directly examined the effect of moderately high levels of circulating IGF-I on breast cancer initiation and progression. The purpose of this study was to assess the ability of circulating IGF-I to independently initiate mammary tumorigenesis and/or accelerate the progression of ErbB2 mediated mammary tumor growth. We crossed heterozygous TTR-IGF-I mice with heterozygous MMTV-ErbB2 mice to generate 4 different genotypes: TTR-IGF-I/MMTV-ErbB2 (bigenic), TTR-IGF-I only, MMTV-ErbB2 only, and wild type (wt). Virgin females were palpated twice a week and harvested when tumors reached 1000 mm 3 . For study of normal development, blood and tissue were harvested at 4, 6 and 9 weeks of age in TTR-IGF-I and wt mice. TTR-IGF-I and TTR-IGF-I/ErbB2 bigenic mice showed a moderate 35% increase in circulating total IGF-I compared to ErbB2 and wt control mice. Elevation of circulating IGF-I had no effect upon pubertal mammary gland development. The transgenic increase in IGF-I alone wasn't sufficient to initiate mammary tumorigenesis. Elevated circulating IGF-I had no effect upon ErbB2-induced mammary tumorigenesis or metastasis, with median time to tumor formation being 30 wks and 33 wks in TTR-IGF-I/ErbB2 bigenic and ErbB2 mice respectively (p = 0.65). Levels of IGF-I in lysates from ErbB2/TTR-IGF-I tumors compared to ErbB2 was elevated in a similar manner to the circulating IGF-I, however, there was no effect on the rate of tumor growth (p = 0.23). There were no morphological differences in tumor type (solid adenocarcinomas) between bigenic and ErbB2 mammary glands. Using the first transgenic animal model to

  11. Defining the ATM-mediated barrier to tumorigenesis in somatic mammary cells following ErbB2 activation.

    Science.gov (United States)

    Reddy, Jay P; Peddibhotla, Sirisha; Bu, Wen; Zhao, Jing; Haricharan, Svasti; Du, Yi-Chieh Nancy; Podsypanina, Katrina; Rosen, Jeffrey M; Donehower, Larry A; Li, Yi

    2010-02-23

    p53, apoptosis, and senescence are frequently activated in preneoplastic lesions and are barriers to progression to malignancy. These barriers have been suggested to result from an ATM-mediated DNA damage response (DDR), which may follow oncogene-induced hyperproliferation and ensuing DNA replication stress. To elucidate the currently untested role of DDR in breast cancer initiation, we examined the effect of oncogene expression in several murine models of breast cancer. We did not observe a detectable DDR in early hyperplastic lesions arising in transgenic mice expressing several different oncogenes. However, DDR signaling was strongly induced in preneoplastic lesions arising from individual mammary cells transduced in vivo by retroviruses expressing either PyMT or ErbB2. Thus, activation of an oncogene after normal tissue development causes a DDR. Furthermore, in this somatic ErbB2 tumor model, ATM, and thus DDR, is required for p53 stabilization, apoptosis, and senescence. In palpable tumors in this model, p53 stabilization and apoptosis are lost, but unexpectedly senescence remains in many tumor cells. Thus, this murine model fully recapitulates early DDR signaling; the eventual suppression of its endpoints in tumorigenesis provides compelling evidence that ErbB2-induced aberrant mammary cell proliferation leads to an ATM-mediated DDR that activates apoptosis and senescence, and at least the former must be overcome to progress to malignancy. This in vivo study also uncovers an unexpected effect of ErbB2 activation previously known for its prosurvival roles, and suggests that protection of the ATM-mediated DDR-p53 signaling pathway may be important in breast cancer prevention.

  12. Transducer of ERBB2.1 (TOB1) as a Tumor Suppressor: A Mechanistic Perspective.

    Science.gov (United States)

    Lee, Hun Seok; Kundu, Juthika; Kim, Ryong Nam; Shin, Young Kee

    2015-12-15

    Transducer of ERBB2.1 (TOB1) is a tumor-suppressor protein, which functions as a negative regulator of the receptor tyrosine-kinase ERBB2. As most of the other tumor suppressor proteins, TOB1 is inactivated in many human cancers. Homozygous deletion of TOB1 in mice is reported to be responsible for cancer development in the lung, liver, and lymph node, whereas the ectopic overexpression of TOB1 shows anti-proliferation, and a decrease in the migration and invasion abilities on cancer cells. Biochemical studies revealed that the anti-proliferative activity of TOB1 involves mRNA deadenylation and is associated with the reduction of both cyclin D1 and cyclin-dependent kinase (CDK) expressions and the induction of CDK inhibitors. Moreover, TOB1 interacts with an oncogenic signaling mediator, β-catenin, and inhibits β-catenin-regulated gene transcription. TOB1 antagonizes the v-akt murine thymoma viral oncogene (AKT) signaling and induces cancer cell apoptosis by activating BCL2-associated X (BAX) protein and inhibiting the BCL-2 and BCL-XL expressions. The tumor-specific overexpression of TOB1 results in the activation of other tumor suppressor proteins, such as mothers against decapentaplegic homolog 4 (SMAD4) and phosphatase and tensin homolog-10 (PTEN), and blocks tumor progression. TOB1-overexpressing cancer cells have limited potential of growing as xenograft tumors in nude mice upon subcutaneous implantation. This review addresses the molecular basis of TOB1 tumor suppressor function with special emphasis on its regulation of intracellular signaling pathways.

  13. Transducer of ERBB2.1 (TOB1 as a Tumor Suppressor: A Mechanistic Perspective

    Directory of Open Access Journals (Sweden)

    Hun Seok Lee

    2015-12-01

    Full Text Available Transducer of ERBB2.1 (TOB1 is a tumor-suppressor protein, which functions as a negative regulator of the receptor tyrosine-kinase ERBB2. As most of the other tumor suppressor proteins, TOB1 is inactivated in many human cancers. Homozygous deletion of TOB1 in mice is reported to be responsible for cancer development in the lung, liver, and lymph node, whereas the ectopic overexpression of TOB1 shows anti-proliferation, and a decrease in the migration and invasion abilities on cancer cells. Biochemical studies revealed that the anti-proliferative activity of TOB1 involves mRNA deadenylation and is associated with the reduction of both cyclin D1 and cyclin-dependent kinase (CDK expressions and the induction of CDK inhibitors. Moreover, TOB1 interacts with an oncogenic signaling mediator, β-catenin, and inhibits β-catenin-regulated gene transcription. TOB1 antagonizes the v-akt murine thymoma viral oncogene (AKT signaling and induces cancer cell apoptosis by activating BCL2-associated X (BAX protein and inhibiting the BCL-2 and BCL-XL expressions. The tumor-specific overexpression of TOB1 results in the activation of other tumor suppressor proteins, such as mothers against decapentaplegic homolog 4 (SMAD4 and phosphatase and tensin homolog-10 (PTEN, and blocks tumor progression. TOB1-overexpressing cancer cells have limited potential of growing as xenograft tumors in nude mice upon subcutaneous implantation. This review addresses the molecular basis of TOB1 tumor suppressor function with special emphasis on its regulation of intracellular signaling pathways.

  14. Inhibition of ErbB2 by receptor tyrosine kinase inhibitors causes myofibrillar structural damage without cell death in adult rat cardiomyocytes

    International Nuclear Information System (INIS)

    Pentassuglia, Laura; Graf, Michael; Lane, Heidi; Kuramochi, Yukio; Cote, Gregory; Timolati, Francesco; Sawyer, Douglas B.; Zuppinger, Christian; Suter, Thomas M.

    2009-01-01

    Inhibition of ErbB2 (HER2) with monoclonal antibodies, an effective therapy in some forms of breast cancer, is associated with cardiotoxicity, the pathophysiology of which is poorly understood. Recent data suggest, that dual inhibition of ErbB1 (EGFR) and ErbB2 signaling is more efficient in cancer therapy, however, cardiac safety of this therapeutic approach is unknown. We therefore tested an ErbB1-(CGP059326) and an ErbB1/ErbB2-(PKI166) tyrosine kinase inhibitor in an in-vitro system of adult rat ventricular cardiomyocytes and assessed their effects on 1. cell viability, 2. myofibrillar structure, 3. contractile function, and 4. MAPK- and Akt-signaling alone or in combination with Doxorubicin. Neither CGP nor PKI induced cardiomyocyte necrosis or apoptosis. PKI but not CGP caused myofibrillar structural damage that was additive to that induced by Doxorubicin at clinically relevant doses. These changes were associated with an inhibition of excitation-contraction coupling. PKI but not CGP decreased p-Erk1/2, suggesting a role for this MAP-kinase signaling pathway in the maintenance of myofibrils. These data indicate that the ErbB2 signaling pathway is critical for the maintenance of myofibrillar structure and function. Clinical studies using ErbB2-targeted inhibitors for the treatment of cancer should be designed to include careful monitoring for cardiac dysfunction.

  15. BRCA1-IRIS Overexpression Promotes Formation of Aggressive Breast Cancers

    Science.gov (United States)

    Shimizu, Yoshiko; Luk, Hugh; Horio, David; Miron, Penelope; Griswold, Michael; Iglehart, Dirk; Hernandez, Brenda; Killeen, Jeffrey; ElShamy, Wael M.

    2012-01-01

    Introduction Women with HER2+ or triple negative/basal-like (TN/BL) breast cancers succumb to their cancer rapidly due, in part to acquired Herceptin resistance and lack of TN/BL-targeted therapies. BRCA1-IRIS is a recently discovered, 1399 residue, BRCA1 locus alternative product, which while sharing 1365 residues with the full-length product of this tumor suppressor gene, BRCA1/p220, it has oncoprotein-like properties. Here, we examine whether BRCA1-IRIS is a valuable treatment target for HER2+ and/or TN/BL tumors. Methodology/Principal Findings Immunohistochemical staining of large cohort of human breast tumor samples using new monoclonal anti-BRCA1-IRIS antibody, followed by correlation of BRCA1-IRIS expression with that of AKT1, AKT2, p-AKT, survivin and BRCA1/p220, tumor status and age at diagnosis. Generation of subcutaneous tumors in SCID mice using human mammary epithelial (HME) cells overexpressing TERT/LT/BRCA1-IRIS, followed by comparing AKT, survivin, and BRCA1/p220 expression, tumor status and aggressiveness in these tumors to that in tumors developed using TERT/LT/RasV12-overexpressing HME cells. Induction of primary and invasive rat mammary tumors using the carcinogen N-methyl-N-nitrosourea (NMU), followed by analysis of rat BRCA1-IRIS and ERα mRNA levels in these tumors. High BRCA1-IRIS expression was detected in the majority of human breast tumors analyzed, which was positively correlated with that of AKT1-, AKT2-, p-AKT-, survivin, but negatively with BRCA1/p220 expression. BRCA1-IRIS-positivity induced high-grade, early onset and metastatic HER2+ or TN/BL tumors. TERT/LT/BRCA1-IRIS overexpressing HME cells formed invasive subcutaneous tumors that express high AKT1, AKT2, p-AKT and vimentin, but no CK19, p63 or BRCA1/p220. NMU-induced primary and invasive rat breast cancers expressed high levels of rat BRCA1-IRIS mRNA but low levels of rat ERα mRNA. Conclusion/Significance BRCA1-IRIS overexpression triggers aggressive breast tumor formation

  16. Growth inhibitory effects of the dual ErbB1/ErbB2 tyrosine kinase inhibitor PKI-166 on human prostate cancer xenografts.

    Science.gov (United States)

    Mellinghoff, Ingo K; Tran, Chris; Sawyers, Charles L

    2002-09-15

    Experiments with human prostate cancer cell lines have shown that forced overexpression of the ErbB2-receptor tyrosine kinase (RTK) promotes androgen-independent growth and increases androgen receptor-transcriptional activity in a ligand-independent fashion. To investigate the relationship between ErbB-RTK signaling and androgen in genetically unmanipulated human prostate cancer, we performed biochemical and biological studies with the dual ErbB1/ErbB2 RTK inhibitor PKI-166 using human prostate cancer xenograft models with isogenic sublines reflecting the transition from androgen-dependent to androgen-independent growth. In the presence of low androgen concentrations, PKI-166 showed profound growth-inhibitory effects on tumor growth, which could be partially reversed by androgen add-back. At physiological androgen concentrations, androgen withdrawal greatly enhanced the ability of PKI-166 to retard tumor growth. The level of extracellular signal-regulated kinase activation correlated with the response to PKI-166 treatment, whereas the expression levels of ErbB1 and ErbB2 did not. These results suggest that ErbB1/ErbB2 RTKs play an important role in the biology of androgen-independent prostate cancer and provide a rationale for clinical evaluation of inhibitors targeted to this pathway.

  17. The ectodomain of cadherin-11 binds to erbB2 and stimulates Akt phosphorylation to promote cranial neural crest cell migration.

    Directory of Open Access Journals (Sweden)

    Ketan Mathavan

    Full Text Available During development, a multi-potent group of cells known as the cranial neural crest (CNC migrate to form craniofacial structures. Proper migration of these cells requires proteolysis of cell adhesion molecules, such as cadherins. In Xenopus laevis, preventing extracellular cleavage of cadherin-11 impairs CNC migration. However, overexpression of the soluble cleavage product (EC1-3 is capable of rescuing this phenotype. The mechanism by which EC1-3 promotes CNC migration has not been investigated until now. Here we show that EC1-3 stimulates phosphorylation of Akt, a target of PI3K, in X.laevis CNC. Through immunoprecipitation experiments, we determined that EC1-3 interacts with all ErbB receptors, PDGFRα, and FGFR1. Of these receptors, only ErbB2 was able to produce an increase in Akt phosphorylation upon treatment with a recombinant EC1-3. This increase was abrogated by mubritinib, an inhibitor of ErbB2. We were able to recapitulate this decrease in Akt phosphorylation in vivo by knocking down ErbB2 in CNC cells. Knockdown of the receptor also significantly reduced CNC migration in vivo. We confirmed the importance of ErbB2 and ErbB receptor signaling in CNC migration using mubritinib and canertinib, respectively. Mubritinib and the PI3K inhibitor LY294002 significantly decreased cell migration while canertinib nearly prevented it altogether. These data show that ErbB2 and Akt are important for CNC migration and implicate other ErbB receptors and Akt-independent signaling pathways. Our findings provide the first example of a functional interaction between the extracellular domain of a type II classical cadherin and growth factor receptors.

  18. Overexpression of prostate tumor overexpressed 1 correlates with tumor progression and predicts poor prognosis in breast cancer

    International Nuclear Information System (INIS)

    Lei, Fangyong; Zhang, Longjuan; Li, Xinghua; Lin, Xi; Wu, Shu; Li, Fengyan; Liu, Junling

    2014-01-01

    Prostate tumor overexpressed 1 (PTOV1) was demonstrated to play an important role in cancer progression and was correlated with unfavorable clinical outcome. However, the clinical role of PTOV1 in cancer remains largely unknown. This study aimed to investigate the expression and clinicopathological significance of PTOV1 in breast cancer. The mRNA and protein expression levels of PTOV1 were analyzed in 12 breast cancer cell lines and eight paired breast cancer tumors by semi-quantitative real time-PCR and western blotting, respectively. Immunohistochemistry was performed to assess PTOV1 protein expression in 169 paraffin-embedded, archived breast cancer samples. Survival analysis and Cox regression analysis were performed to investigate the clinicopathological significance of PTOV1 expression. Our data revealed that PTOV1 was frequently overexpressed in breast cancer cell lines compared to normal human breast epithelial cells and in primary breast cancer samples compared to adjacent noncancerous breast tissues, at both the mRNA and protein levels. Moreover, high expression of PTOV1 in breast cancer is strongly associated with clinicopathological characteristics and estrogen receptor expression status (P = 0.003). Breast cancer patients with higher PTOV1 expression had substantially shorter survival times than patients with lower PTOV1 expression (P < 0.001). Univariate and multivariate analysis revealed that PTOV1 might be an independent prognostic factor for breast cancer patients (P = 0.005). Our study showed that PTOV1 is upregulated in breast cancer cell lines and clinical samples, and its expression was positively associated with progression and aggressiveness of breast cancer, suggesting that PTOV1 could serve as an independent prognostic marker

  19. Comparative immunohistochemical expression of β-catenin, EGFR, ErbB2, and p63 in adamantinomatous and papillary craniopharyngiomas

    International Nuclear Information System (INIS)

    Eshebaa, Gh.E.; Hassan, A.A.

    2015-01-01

    Craniopharyngiomas (CPs) are rare epithelial tumors located mainly in the sellar/parasellar region. CPs have been classified into histopathologically, genetically, clinically and prognostically two distinctive subtypes: adamantinomatous and papillary variants. Aim To determine the immunohistochemical expression of β-catenin, EGFR, ErbB2, and p63 in adamantinomatous and papillary CPs. Materials and methods β-Catenin, EGFR, ErbB2, and p63 immunostaining was performed on paraffin embedded tissue sections of 25 CPs including 18 adamantinomatous craniopharyngioma (ACP) and 7 cases of papillary craniopharyngiomas (PCPs). Results 17 cases (94%) of ACP exhibited strong nuclear/cytoplasmic expression of β-catenin. On the contrary, all cases of PCP showed exclusively membranous expression (ρ value <0.0001). Regarding EGFR, 15 (83%) and 5 cases (71%) of APC and PCP respectively were positive. On the other hand, only 3 cases (17%) of APC and none of PCP exhibited positivity for ErbB2. p63 over-expression was observed in 16 cases of ACP (89%) and 6 cases of PCP (86%). However, the distribution of p63 staining was diffuse in ACP, while in PCP; the staining was mainly restricted to the basal cell layer. Conclusion Nuclear accumulation of β-catenin is a diagnostic hallmark of the ACP and is very helpful in the differential diagnosis between both ACP and PCP in the setting of small biopsies. Moreover, the restricted nuclear β-catenin accumulation in the cohesive cell clusters within the whorl-like areas supports that aberrant β-catenin expression may play a role in the morphogenesis of ACP.

  20. FOXP3 is a novel transcriptional repressor for the breast cancer oncogene SKP2.

    Science.gov (United States)

    Zuo, Tao; Liu, Runhua; Zhang, Huiming; Chang, Xing; Liu, Yan; Wang, Lizhong; Zheng, Pan; Liu, Yang

    2007-12-01

    S-phase kinase-associated protein 2 (SKP2) is a component of the E3 ubiquitin ligase SKP1-Cul1-Fbox complex. Overexpression of SKP2 results in cell cycle dysregulation and carcinogenesis; however, the genetic lesions that cause this upregulation are poorly understood. We recently demonstrated that forkhead box P3 (FOXP3) is an X-linked breast cancer suppressor and an important repressor of the oncogene ERBB2/HER2. Since FOXP3 suppresses tumor growth regardless of whether the tumors overexpress ERBB2/HER2, additional FOXP3 targets may be involved in its tumor suppressor activity. Here, we show that mammary carcinomas from mice heterozygous for a Foxp3 mutation exhibited increased Skp2 expression. Ectopic expression of FOXP3 in mouse mammary cancer cells repressed SKP2 expression with a corresponding increase in p27 and polyploidy. Conversely, siRNA silencing of the FOXP3 gene in human mammary epithelial cells increased SKP2 expression. We also show that Foxp3 directly interacted with and repressed the Skp2 promoter. Moreover, the analysis of over 200 primary breast cancer samples revealed an inverse correlation between FOXP3 and SKP2 levels. Finally, we demonstrated that downregulation of SKP2 was critical for FOXP3-mediated growth inhibition in breast cancer cells that do not overexpress ERBB2/HER2. Our data provide genetic, biochemical, and functional evidence that FOXP3 is a novel transcriptional repressor for the oncogene SKP2.

  1. Characterization of fibroblast growth factor receptor 2 overexpression in the human breast cancer cell line SUM-52PE

    International Nuclear Information System (INIS)

    Tannheimer, Stacey L; Rehemtulla, Alnawaz; Ethier, Stephen P

    2000-01-01

    The fibroblast growth factor receptor (FGFR)2 gene has been shown to be amplified in 5-10% of breast cancer patients. A breast cancer cell line developed in our laboratory, SUM-52PE, was shown to have a 12-fold amplification of the FGFR2 gene, and FGFR2 message was found to be overexpressed 40-fold in SUM-52PE cells as compared with normal human mammary epithelial (HME) cells. Both human breast cancer (HBC) cell lines and HME cells expressed two FGFR2 isoforms, whereas SUM-52PE cells overexpressed those two isoforms, as well as several unique FGFR2 polypeptides. SUM-52PE cells expressed exclusively FGFR2-IIIb isoforms, which are high-affinity receptors for fibroblast growth factor (FGF)-1 and FGF-7. Differences were identified in the expression of the extracellular Ig-like domains, acid box and carboxyl termini, and several variants not previously reported were isolated from these cells. The FGFR family of receptor tyrosine kinases includes four members, all of which are highly alternatively spliced and glycosylated. For FGFR2, alternative splicing of the second half of the third Ig-like domain, involving exons IIIb and IIIc, is a mutually exclusive choice that affects ligand binding specificity and affinity [1,2,3]. It appears that the second half of the third Ig-like domain can dictate high affinity for FGF-2 or keratinocyte growth factor (KGF), whereas affinity for FGF-1 appears to remain the same [3]. Alternative splicing of the carboxyl terminus has been shown to involve at least two different exons that can produce at least three different variants. The C1-type and C2-type carboxyl termini are encoded by the same exon, and have two different splice acceptor sites, whereas the C3-type carboxyl terminus is encoded by a separate exon [4]. The biologic significance of the C1 carboxyl terminus, as compared with the shorter C3 variant found primarily in tumorigenic samples, has been studied in NIH3T3 transfection assays, in which C3 variants were able to produce

  2. Overexpression of a novel cell cycle regulator ecdysoneless in breast cancer: a marker of poor prognosis in HER2/neu-overexpressing breast cancer patients.

    Science.gov (United States)

    Zhao, Xiangshan; Mirza, Sameer; Alshareeda, Alaa; Zhang, Ying; Gurumurthy, Channabasavaiah Basavaraju; Bele, Aditya; Kim, Jun Hyun; Mohibi, Shakur; Goswami, Monica; Lele, Subodh M; West, William; Qiu, Fang; Ellis, Ian O; Rakha, Emad A; Green, Andrew R; Band, Hamid; Band, Vimla

    2012-07-01

    Uncontrolled proliferation is one of the hallmarks of breast cancer. We have previously identified the human Ecd protein (human ortholog of Drosophila Ecdysoneless, hereafter called Ecd) as a novel promoter of mammalian cell cycle progression, a function related to its ability to remove the repressive effects of Rb-family tumor suppressors on E2F transcription factors. Given the frequent dysregulation of cell cycle regulatory components in human cancer, we used immunohistochemistry of paraffin-embedded tissues to examine Ecd expression in normal breast tissue versus tissues representing increasing breast cancer progression. Initial studies of a smaller cohort without outcomes information showed that Ecd expression was barely detectable in normal breast tissue and in hyperplasia of breast, but high levels of Ecd were detected in benign breast hyperplasia, ductal carcinoma in situ (DCIS) and infiltrating ductal carcinoma (IDCs) of the breast. In this cohort of 104 IDC patients, Ecd expression levels showed a positive correlation with higher grade (P=0.04). Further analyses of Ecd expression using a larger, independent cohort (954) confirmed these results, with a strong positive correlation of elevated Ecd expression with higher histological grade (P=0.013), mitotic index (P=0.032), and Nottingham Prognostic Index score (P=0.014). Ecd expression was positively associated with HER2/neu (P=0.002) overexpression, a known marker of poor prognosis in breast cancer. Significantly, increased Ecd expression showed a strong positive association with shorter breast cancer specific survival (BCSS) (P=0.008) and disease-free survival (DFS) (P=0.003) in HER2/neu overexpressing patients. Taken together, our results reveal Ecd as a novel marker for breast cancer progression and show that levels of Ecd expression predict poorer survival in Her2/neu overexpressing breast cancer patients.

  3. Crystallization and preliminary crystallographic studies of the single-chain variable fragment of antibody chA21 in complex with an N-terminal fragment of ErbB2

    International Nuclear Information System (INIS)

    Liu, Yang; Zhou, Huihao; Zhu, Juanjuan; Gao, Yongxiang; Niu, Liwen; Liu, Jing; Teng, Maikun

    2009-01-01

    An antibody–antigen complex consisting of a single-chain variable fragment of the potential therapeutic antibody chA21 and an N-terminal fragment (residues 1–192) of the human ErbB2 extracellular domain was expressed, purified and crystallized. X-ray diffraction data were collected to 2.45 Å resolution. ErbB2 is a transmembrane tyrosine kinase, the overexpression of which causes abnormality and disorder in cell signalling and leads to cell transformation. Previously, an anti-ErbB2 single-chain chimeric antibody chA21 that specifically inhibits the growth of ErbB2-overexpressing cancer cells in vitro and in vivo was developed. Here, an antibody–antigen complex consisting of the single-chain variable fragment (scFv) of chA21 and an N-terminal fragment (residues 1–192, named EP I) of the ErbB2 extracellular domain was crystallized using the sitting-drop vapour-diffusion method. An X-ray diffraction data set was collected to 2.45 Å resolution from a single flash-cooled crystal; the crystal belonged to space group P2 1 2 1 2 1

  4. High frequency of HIF-1 alpha overexpression in BRCA1 related breast cancer

    NARCIS (Netherlands)

    van der Groep, Petra; Bouter, Alwin; Menko, Fred H.; van der Wall, Elsken; van Diest, Paul J.

    2008-01-01

    Hypoxia is a hallmark of cancer. Hypoxia inducible factor-1 alpha (HIF-1 alpha) is the key regulator of the hypoxia response. HIF-1 alpha is overexpressed during sporadic breast carcinogenesis and correlated with poor prognosis. Little is known on the role of HIF-1 alpha in hereditary breast

  5. tabAnti-HER2 (erbB-2) oncogene effects of phenolic compounds directly isolated from commercial Extra-Virgin Olive Oil (EVOO)

    International Nuclear Information System (INIS)

    Menendez, Javier A; Vazquez-Martin, Alejandro; Garcia-Villalba, Rocio; Carrasco-Pancorbo, Alegria; Oliveras-Ferraros, Cristina; Fernandez-Gutierrez, Alberto; Segura-Carretero, Antonio

    2008-01-01

    The effects of the olive oil-rich Mediterranean diet on breast cancer risk might be underestimated when HER2 (ERBB2) oncogene-positive and HER2-negative breast carcinomas are considered together. We here investigated the anti-HER2 effects of phenolic fractions directly extracted from Extra Virgin Olive Oil (EVOO) in cultured human breast cancer cell lines. Solid phase extraction followed by semi-preparative high-performance liquid chromatography (HPLC) was used to isolate phenolic fractions from commercial EVOO. Analytical capillary electrophoresis coupled to mass spectrometry was performed to check for the composition and to confirm the identity of the isolated fractions. EVOO polyphenolic fractions were tested on their tumoricidal ability against HER2-negative and HER2-positive breast cancer in vitro models using MTT, crystal violet staining, and Cell Death ELISA assays. The effects of EVOO polyphenolic fractions on the expression and activation status of HER2 oncoprotein were evaluated using HER2-specific ELISAs and immunoblotting procedures, respectively. Among the fractions mainly containing the single phenols hydroxytyrosol and tyrosol, the polyphenol acid elenolic acid, the lignans (+)-pinoresinol and 1-(+)-acetoxypinoresinol, and the secoiridoids deacetoxy oleuropein aglycone, ligstroside aglycone, and oleuropein aglycone, all the major EVOO polyphenols (i.e. secoiridoids and lignans) were found to induce strong tumoricidal effects within a micromolar range by selectively triggering high levels of apoptotic cell death in HER2-overexpressors. Small interfering RNA-induced depletion of HER2 protein and lapatinib-induced blockade of HER2 tyrosine kinase activity both significantly prevented EVOO polyphenols-induced cytotoxicity. EVOO polyphenols drastically depleted HER2 protein and reduced HER2 tyrosine autophosphorylation in a dose- and time-dependent manner. EVOO polyphenols-induced HER2 downregulation occurred regardless the molecular mechanism

  6. tabAnti-HER2 (erbB-2 oncogene effects of phenolic compounds directly isolated from commercial Extra-Virgin Olive Oil (EVOO

    Directory of Open Access Journals (Sweden)

    Carrasco-Pancorbo Alegria

    2008-12-01

    Full Text Available Abstract Background The effects of the olive oil-rich Mediterranean diet on breast cancer risk might be underestimated when HER2 (ERBB2 oncogene-positive and HER2-negative breast carcinomas are considered together. We here investigated the anti-HER2 effects of phenolic fractions directly extracted from Extra Virgin Olive Oil (EVOO in cultured human breast cancer cell lines. Methods Solid phase extraction followed by semi-preparative high-performance liquid chromatography (HPLC was used to isolate phenolic fractions from commercial EVOO. Analytical capillary electrophoresis coupled to mass spectrometry was performed to check for the composition and to confirm the identity of the isolated fractions. EVOO polyphenolic fractions were tested on their tumoricidal ability against HER2-negative and HER2-positive breast cancer in vitro models using MTT, crystal violet staining, and Cell Death ELISA assays. The effects of EVOO polyphenolic fractions on the expression and activation status of HER2 oncoprotein were evaluated using HER2-specific ELISAs and immunoblotting procedures, respectively. Results Among the fractions mainly containing the single phenols hydroxytyrosol and tyrosol, the polyphenol acid elenolic acid, the lignans (+-pinoresinol and 1-(+-acetoxypinoresinol, and the secoiridoids deacetoxy oleuropein aglycone, ligstroside aglycone, and oleuropein aglycone, all the major EVOO polyphenols (i.e. secoiridoids and lignans were found to induce strong tumoricidal effects within a micromolar range by selectively triggering high levels of apoptotic cell death in HER2-overexpressors. Small interfering RNA-induced depletion of HER2 protein and lapatinib-induced blockade of HER2 tyrosine kinase activity both significantly prevented EVOO polyphenols-induced cytotoxicity. EVOO polyphenols drastically depleted HER2 protein and reduced HER2 tyrosine autophosphorylation in a dose- and time-dependent manner. EVOO polyphenols-induced HER2 downregulation

  7. Selective Inhibition of Tumor Growth by Clonal NK Cells Expressing an ErbB2/HER2-Specific Chimeric Antigen Receptor

    Science.gov (United States)

    Schönfeld, Kurt; Sahm, Christiane; Zhang, Congcong; Naundorf, Sonja; Brendel, Christian; Odendahl, Marcus; Nowakowska, Paulina; Bönig, Halvard; Köhl, Ulrike; Kloess, Stephan; Köhler, Sylvia; Holtgreve-Grez, Heidi; Jauch, Anna; Schmidt, Manfred; Schubert, Ralf; Kühlcke, Klaus; Seifried, Erhard; Klingemann, Hans G; Rieger, Michael A; Tonn, Torsten; Grez, Manuel; Wels, Winfried S

    2015-01-01

    Natural killer (NK) cells are an important effector cell type for adoptive cancer immunotherapy. Similar to T cells, NK cells can be modified to express chimeric antigen receptors (CARs) to enhance antitumor activity, but experience with CAR-engineered NK cells and their clinical development is still limited. Here, we redirected continuously expanding and clinically usable established human NK-92 cells to the tumor-associated ErbB2 (HER2) antigen. Following GMP-compliant procedures, we generated a stable clonal cell line expressing a humanized CAR based on ErbB2-specific antibody FRP5 harboring CD28 and CD3ζ signaling domains (CAR 5.28.z). These NK-92/5.28.z cells efficiently lysed ErbB2-expressing tumor cells in vitro and exhibited serial target cell killing. Specific recognition of tumor cells and antitumor activity were retained in vivo, resulting in selective enrichment of NK-92/5.28.z cells in orthotopic breast carcinoma xenografts, and reduction of pulmonary metastasis in a renal cell carcinoma model, respectively. γ-irradiation as a potential safety measure for clinical application prevented NK cell replication, while antitumor activity was preserved. Our data demonstrate that it is feasible to engineer CAR-expressing NK cells as a clonal, molecularly and functionally well-defined and continuously expandable cell therapeutic agent, and suggest NK-92/5.28.z cells as a promising candidate for use in adoptive cancer immunotherapy. PMID:25373520

  8. Overexpression of Oct4 suppresses the metastatic potential of breast cancer cells via Rnd1 downregulation.

    Science.gov (United States)

    Shen, Long; Qin, Kunhua; Wang, Dekun; Zhang, Yan; Bai, Nan; Yang, Shengyong; Luo, Yunping; Xiang, Rong; Tan, Xiaoyue

    2014-11-01

    Although Oct4 is known as a critical transcription factor involved in maintaining "stemness", its role in tumor metastasis is still controversial. Herein, we overexpressed and silenced Oct4 expression in two breast cancer cell lines, MDA-MB-231 and 4T1, separately. Our data showed that ectopic overexpression of Oct4 suppressed cell migration and invasion in vitro and the formation of metastatic lung nodules in vivo. Conversely, Oct4 downregulation increased the metastatic potential of breast cancer cells both in vitro and in vivo. Furthermore, we identified Rnd1 as the downstream target of Oct4 by ribonucleic acid sequencing (RNA-seq) analysis, which was significantly downregulated upon Oct4 overexpression. Chromatin immunoprecipitation assays revealed the binding of Oct4 to the promoter region of Rnd1 by ectopic overexpression of Oct4. Dual luciferase assays indicated that Oct4 overexpression suppressed transcriptional activity of the Rnd1 promoter. Moreover, overexpression of Rnd1 partially rescued the inhibitory effects of Oct4 on the migration and invasion of breast cancer cells. Overexpression of Rnd1 counteracted the influence of Oct4 on the formation of cell adhesion and lamellipodia, which implied a potential underlying mechanism involving Rnd1. In addition, we also found that overexpression of Oct4 led to an elevation of E-cadherin expression, even in 4T1 cells that possess a relatively high basal level of E-cadherin. Rnd1 overexpression impaired the promoting effects of Oct4 on E-cadherin expression in MDA-MB-231 cells. These results suggest that Oct4 affects the metastatic potential of breast cancer cells through Rnd1-mediated effects that influence cell motility and E-cadherin expression. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Vav3 oncogene activates estrogen receptor and its overexpression may be involved in human breast cancer

    International Nuclear Information System (INIS)

    Lee, Kiwon; Liu, Yin; Mo, Jun Qin; Zhang, Jinsong; Dong, Zhongyun; Lu, Shan

    2008-01-01

    Our previous study revealed that Vav3 oncogene is overexpressed in human prostate cancer, activates androgen receptor, and stimulates growth in prostate cancer cells. The current study is to determine a potential role of Vav3 oncogene in human breast cancer and impact on estrogen receptor a (ERα)-mediated signaling axis. Immunohistochemistry analysis was performed in 43 breast cancer specimens and western blot analysis was used for human breast cancer cell lines to determine the expression level of Vav3 protein. The impact of Vav3 on breast cancer cell growth was determined by siRNA knockdown of Vav3 expression. The role of Vav3 in ERα activation was examined in luciferase reporter assays. Deletion mutation analysis of Vav3 protein was performed to localize the functional domain involved in ERα activation. Finally, the interaction of Vav3 and ERα was assessed by GST pull-down analysis. We found that Vav3 was overexpressed in 81% of human breast cancer specimens, particularly in poorly differentiated lesions. Vav3 activated ERα partially via PI3K-Akt signaling and stimulated growth of breast cancer cells. Vav3 also potentiated EGF activity for cell growth and ERα activation in breast cancer cells. More interestingly, we found that Vav3 complexed with ERα. Consistent with its function for AR, the DH domain of Vav3 was essential for ERα activation. Vav3 oncogene is overexpressed in human breast cancer. Vav3 complexes with ERα and enhances ERα activity. These findings suggest that Vav3 overexpression may aberrantly enhance ERα-mediated signaling axis and play a role in breast cancer development and/or progression

  10. Mammary gland cancer in a colony of beagle dogs: Inheritance, and p53 ampersand erbB-2 expression

    International Nuclear Information System (INIS)

    Kelly, G.; Griffith, W.C.; Muggenburg, Tierney, L.A.; Lechner, J.F.; Hahn, F.F.

    1994-01-01

    One American woman in nine will be diagnosed with breast cancer in her lifetime. This somber statistic translates into 182,000 new diagnoses and 46,000 deaths per year. Efforts to decrease breast cancer mortality have focused on early detection and improved treatment. Such efforts would be facilitated by the identification of individuals predisposed to the disease. A family history of the disease can increase a woman's risk for developing breast cancer by two- to six-fold. Inheritance of this disease is consistent with at least one susceptibility locus on chromosome 17 (17q12-21) with incomplete penetrance. However, other mechanisms of inherited susceptibility also contribute to the high incidence of the disease. The purpose of the present study was to characterize familial pattern of mammary cancer development in the dog colony. In addition, the expression of the p53 tumor supressor gene and c-erbB2 (p185 erbB2 ) oncogene proteins, which are frequently altered in human breast cancer, were examined in dogs susceptible and resistant to mammary cancer

  11. Critical role of c-Jun overexpression in liver metastasis of human breast cancer xenograft model

    International Nuclear Information System (INIS)

    Zhang, Yan; Hu, Meiru; Shen, Beifen; Guo, Ning; Pu, Xiaoyun; Shi, Ming; Chen, Liyong; Song, Yuhua; Qian, Lu; Yuan, Guogang; Zhang, Hao; Yu, Ming

    2007-01-01

    c-Jun/AP-1 has been linked to invasive properties of aggressive breast cancer. Recently, it has been reported that overexpression of c-Jun in breast cancer cell line MCF-7 resulted in increased AP-1 activity, motility and invasiveness of the cells in vitro and tumor formation in nude mice. However, the role of c-Jun in metastasis of human breast cancer in vivo is currently unknown. To further investigate the direct involvement of c-Jun in tumorigenesis and metastasis, in the present study, the effects of c-Jun overexpression were studied in both in vitro and in nude mice. Ectopic overexpression of c-Jun promoted the growth of MCF-7 cells and resulted in a significant increase in the percentage of cells in S phase and increased motility and invasiveness. Introduction of c-Jun gene alone into weakly invasive MCF-7 cells resulted in the transfected cells capable of metastasizing to the nude mouse liver following tail vein injection. The present study confirms that overexpression of c-Jun contributes to a more invasive phenotype in MCF-7 cells. It indicates an interesting relationship between c-Jun expression and increased property of adhesion, migration and in vivo liver metastasis of MCF-7/c-Jun cells. The results provide further evidence that c-Jun is involved in the metastasis of breast cancer. The finding also opens an opportunity for development of anti-c-Jun strategies in breast cancer therapy

  12. Endocytic down-regulation of ErbB2 is stimulated by cleavage of its C-terminus

    DEFF Research Database (Denmark)

    Lerdrup, Mads; Bruun, Silas; Grandal, Michael Vibo

    2007-01-01

    inhibition of HSP90 with geldanamycin this cleavage is accompanied by proteasome-dependent endocytosis of ErbB2. However, it is unknown whether C-terminal cleavage is linked to endocytosis. To study ErbB2 cleavage and endocytic trafficking, we fused yellow fluorescent protein (YFP) and cyan fluorescent...

  13. Overexpressed Genes/ESTs and Characterization of Distinct Amplicons on 17823 in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Ayse E. Erson

    2001-01-01

    Full Text Available 17823 is a frequent site of gene amplification in breast cancer. Several lines of evidence suggest the presence of multiple amplicons on 17823. To characterize distinct amplicons on 17823 and localize putative oncogenes, we screened genes and expressed sequence tags (ESTs in existing physical and radiation hybrid maps for amplification and overexpression in breast cancer cell lines by semiquantitative duplex PCR, semiquantitative duplex RT-PCR, Southern blot, Northern blot analyses. We identified two distinct amplicons on 17823, one including TBX2 and another proximal region including RPS6KB1 (PS6K and MUL. In addition to these previously reported overexpressed genes, we also identified amplification and overexpression of additional uncharacterized genes and ESTs, some of which suggest potential oncogenic activity. In conclusion, we have further defined two distinct regions of gene amplification and overexpression on 17823 with identification of new potential oncogene candidates. Based on the amplification and overexpression patterns of known and as of yet unrecognized genes on 17823, it is likely that some of these genes mapping to the discrete amplicons function as oncogenes and contribute to tumor progression in breast cancer cells.

  14. Detection of erbB2 copy number variations in plasma of patients with esophageal carcinoma

    International Nuclear Information System (INIS)

    Andolfo, Immacolata; Orditura, Michele; Ciardiello, Fortunato; De Vita, Fernando; Zollo, Massimo; Petrosino, Giuseppe; Vecchione, Loredana; De Antonellis, Pasqualino; Capasso, Mario; Montanaro, Donatella; Gemei, Marica; Troncone, Giancarlo; Iolascon, Achille

    2011-01-01

    Mortality is high in patients with esophageal carcinoma as tumors are rarely detected before the disease has progressed to an advanced stage. Here, we sought to isolate cell-free DNA released into the plasma of patients with esophageal carcinoma, to analyze copy number variations of marker genes in the search for early detection of tumor progression. Plasma of 41 patients with esophageal carcinoma was prospectively collected before tumor resection and chemotherapy. Our dataset resulted heterogeneous for clinical data, resembling the characteristics of the tumor. DNA from the plasma was extracted to analyze copy number variations of the erbB2 gene using real-time PCR assays. The real-time PCR assays for erbB2 gene showed significant (P = 0.001) copy number variations in the plasma of patients with esophageal carcinoma, as compared to healthy controls with high sensitivity (80%) and specificity (95%). These variations in erbB2 were negatively correlated to the progression free survival of these patients (P = 0.03), and revealed a further risk category stratification of patients with low VEGF expression levels. The copy number variation of erbB2 gene from plasma can be used as prognostic marker for early detection of patients at risk of worse clinical outcome in esophageal cancer

  15. ErbB2 Pathway Activation upon Smad4 Loss Promotes Lung Tumor Growth and Metastasis

    Directory of Open Access Journals (Sweden)

    Jian Liu

    2015-03-01

    Full Text Available Lung cancer remains the leading cause of cancer death. Genome sequencing of lung tumors from patients with squamous cell carcinoma has identified SMAD4 to be frequently mutated. Here, we use a mouse model to determine the molecular mechanisms by which Smad4 loss leads to lung cancer progression. Mice with ablation of Pten and Smad4 in airway epithelium develop metastatic adenosquamous tumors. Comparative transcriptomic and in vivo cistromic analyses determine that loss of PTEN and SMAD4 results in ELF3 and ErbB2 pathway activation due to decreased expression of ERRFI1, a negative regulator of ERBB2 in mouse and human cells. The combinatorial inhibition of ErbB2 and Akt signaling attenuate tumor progression and cell invasion, respectively. Expression profile analysis of human lung tumors substantiated the importance of the ErbB2/Akt/ELF3 signaling pathway as both a prognostic biomarker and a therapeutic drug target for treating lung cancer.

  16. ErbB2 Pathway Activation upon Smad4 Loss Promotes Lung Tumor Growth and Metastasis.

    Science.gov (United States)

    Liu, Jian; Cho, Sung-Nam; Akkanti, Bindu; Jin, Nili; Mao, Jianqiang; Long, Weiwen; Chen, Tenghui; Zhang, Yiqun; Tang, Ximing; Wistub, Ignacio I; Creighton, Chad J; Kheradmand, Farrah; DeMayo, Francesco J

    2015-03-03

    Lung cancer remains the leading cause of cancer death. Genome sequencing of lung tumors from patients with squamous cell carcinoma has identified SMAD4 to be frequently mutated. Here, we use a mouse model to determine the molecular mechanisms by which Smad4 loss leads to lung cancer progression. Mice with ablation of Pten and Smad4 in airway epithelium develop metastatic adenosquamous tumors. Comparative transcriptomic and in vivo cistromic analyses determine that loss of PTEN and SMAD4 results in ELF3 and ErbB2 pathway activation due to decreased expression of ERRFI1, a negative regulator of ERBB2 in mouse and human cells. The combinatorial inhibition of ErbB2 and Akt signaling attenuate tumor progression and cell invasion, respectively. Expression profile analysis of human lung tumors substantiated the importance of the ErbB2/Akt/ELF3 signaling pathway as both a prognostic biomarker and a therapeutic drug target for treating lung cancer. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  17. A novel mutation in the tyrosine kinase domain of ERBB2 in hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Bekaii-Saab, Tanios; Williams, Nita; Plass, Christoph; Calero, Miguel Villalona; Eng, Charis

    2006-01-01

    Several studies showed that gain-of-function somatic mutations affecting the catalytic domain of EGFR in non-small cell lung carcinomas were associated with response to gefitinib and erlotinib, both EGFR-tyrosine kinase inhibitors. In addition, 4% of non-small cell lung carcinomas were shown to have ERBB2 mutations in the kinase domain. In our study, we sought to determine if similar respective gain-of-function EGFR and ERBB2 mutations were present in hepatoma and/or biliary cancers. We extracted genomic DNA from 40 hepatoma (18) and biliary cancers (22) samples, and 44 adenocarcinomas of the lung, this latter as a positive control for mutation detection. We subjected those samples to PCR-based semi-automated double stranded nucleotide sequencing targeting exons 18–21 of EGFR and ERBB2. All samples were tested against matched normal DNA. We found 11% of hepatoma, but no biliary cancers, harbored a novel ERBB2 H878Y mutation in the activating domain. These newly described mutations may play a role in predicting response to EGFR-targeted therapy in hepatoma and their role should be explored in prospective studies

  18. Alternative splicing enriched cDNA libraries identify breast cancer-associated transcripts

    Science.gov (United States)

    2010-01-01

    Background Alternative splicing (AS) is a central mechanism in the generation of genomic complexity and is a major contributor to transcriptome and proteome diversity. Alterations of the splicing process can lead to deregulation of crucial cellular processes and have been associated with a large spectrum of human diseases. Cancer-associated transcripts are potential molecular markers and may contribute to the development of more accurate diagnostic and prognostic methods and also serve as therapeutic targets. Alternative splicing-enriched cDNA libraries have been used to explore the variability generated by alternative splicing. In this study, by combining the use of trapping heteroduplexes and RNA amplification, we developed a powerful approach that enables transcriptome-wide exploration of the AS repertoire for identifying AS variants associated with breast tumor cells modulated by ERBB2 (HER-2/neu) oncogene expression. Results The human breast cell line (C5.2) and a pool of 5 ERBB2 over-expressing breast tumor samples were used independently for the construction of two AS-enriched libraries. In total, 2,048 partial cDNA sequences were obtained, revealing 214 alternative splicing sequence-enriched tags (ASSETs). A subset with 79 multiple exon ASSETs was compared to public databases and reported 138 different AS events. A high success rate of RT-PCR validation (94.5%) was obtained, and 2 novel AS events were identified. The influence of ERBB2-mediated expression on AS regulation was evaluated by capillary electrophoresis and probe-ligation approaches in two mammary cell lines (Hb4a and C5.2) expressing different levels of ERBB2. The relative expression balance between AS variants from 3 genes was differentially modulated by ERBB2 in this model system. Conclusions In this study, we presented a method for exploring AS from any RNA source in a transcriptome-wide format, which can be directly easily adapted to next generation sequencers. We identified AS transcripts

  19. Overexpression of p53 in Nigerian breast cancers and its ...

    African Journals Online (AJOL)

    This study sought to determine the expression of p53 protein as well as the relationship with oestrogen receptor (ER) and progesterone receptor (PR) proteins. Methodology: Formalin-fixed, paraffin-embedded tissue samples of diagnosed invasive breast cancer were obtained from the Department of Anatomic and ...

  20. p53, erbB-2 and K-ras gene alterations are rare in spontaneous and plutonium-239-induced canine lung neoplasia

    International Nuclear Information System (INIS)

    Tierney, L.A.; Hahn, F.F.; Lechner, J.F.

    1996-01-01

    Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to 239 PuO 2 and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185 erbB2 ) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and 239 PuO 2 -induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs

  1. Targeting GPR110 in HER2-Overexpressing Breast Cancers

    Science.gov (United States)

    2015-10-01

    34assay"using"the"transwell" inserts"with" (A)"or"without" (B)"matrigel" for"SKBR3" cells "transfected"with"nonAtarge1ng"( NT1 )"orŗ"independent"GPR110"siRNAs...HER2 drug resistant cells and in tumorigenic population using a broad panel of cell line models. We have successfully generated inducible lentiviral...plasmids with GPR110 cDNA and cell lines that inducibly overexpress GPR110. Generation of cell lines with lentiviral plasmids containing GPR110

  2. Gene therapy for carcinoma of the breast: Genetic ablation strategies

    International Nuclear Information System (INIS)

    Curiel, David T

    2000-01-01

    The gene therapy strategy of mutation compensation is designed to rectify the molecular lesions that are etiologic for neoplastic transformation. For dominant oncogenes, such approaches involve the functional knockout of the dysregulated cellular control pathways provoked by the overexpressed oncoprotein. On this basis, molecular interventions may be targeted to the transcriptional level of expression, via antisense or ribozymes, or post-transcriptionally, via intracellular single chain antibodies (intrabodies). For carcinoma of the breast, these approaches have been applied in the context of the disease linked oncogenes erbB-2 and cyclin D 1 , as well as the estrogen receptor. Neoplastic revision accomplished in modal systems has rationalized human trials on this basis

  3. Bcl-2 overexpression prevents 99mTc-MIBI uptake in breast cancer cell lines

    International Nuclear Information System (INIS)

    Aloj, Luigi; Zannetti, Antonella; Caraco, Corradina; Del Vecchio, Silvana; Salvatore, Marco

    2004-01-01

    We have previously shown a correlation between the absence of technetium-99m methoxyisobutylisonitrile ( 99m Tc-MIBI) uptake and overexpression of the anti-apoptotic protein Bcl-2 in human breast carcinoma. To establish a direct cause-effect relationship between Bcl-2 overexpression and reduced 99m Tc-MIBI uptake, MCF-7 and T47D breast cancer cell lines were stably transfected with the human Bcl-2 gene to increase intracellular protein levels and tested for 99m Tc-MIBI uptake. All clones overexpressing Bcl-2 showed a dramatic reduction of 99m Tc-MIBI uptake as compared with mock transfected control cells. Tracer uptake was promptly and partially restored by induction of apoptosis with staurosporine treatment. After 4.5 h of staurosporine treatment, a tenfold increase in 99m Tc-MIBI uptake was observed in treated as compared with untreated Bcl-2 overexpressing cells. Our findings provide a rational basis for the development of an in vivo test to detect Bcl-2 overexpression in human tumours. (orig.)

  4. Effects of clusterin over-expression on metastatic progression and therapy in breast cancer

    International Nuclear Information System (INIS)

    Flanagan, Louise; Whyte, Lorna; Chatterjee, Namita; Tenniswood, Martin

    2010-01-01

    Clusterin is a secreted glycoprotein that is upregulated in a variety of cell lines in response to stress, and enhances cell survival. A second nuclear isoform of clusterin that is associated with cell death has also been identified. The aim of this study was to determine the role(s) of the secretory isoform in breast tumor progression and metastasis. To investigate the role of secretory clusterin in the biology of breast cancer tumor growth and resistance to therapy we have engineered an MCF-7 cell line (MCF-7CLU) that over-expresses clusterin. We have measured the in vitro effects of clusterin over-expression on cell cycle, cell death, and sensitivity to TNFalpha and tamoxifen. Using an orthotopic model of breast cancer, we have also determined the effects of over-expression of clusterin on tumor growth and metastatic progression. In vitro, over-expression of secretory clusterin alters the cell cycle kinetics and decreases the rate of cell death, resulting in the enhancement of cell growth. Over-expression of secretory clusterin also blocks the TNFalpha-mediated induction of p21 and abrogates the cleavage of Bax to t-Bax, rendering the MCF-7CLU cells significantly more resistant to the cytokine than the parental cells. Orthotopic primary tumors derived from MCF-7CLU cells grow significantly more rapidly than tumors derived from parental MCF-7 cells and, unlike the parental cells, metastasize frequently to the lungs. These data suggest that secretory clusterin, which is frequently up-regulated in breast cancers by common therapies, including anti-estrogens, may play a significant role in tumor growth, metastatic progression and subsequent drug resistance in surviving cells

  5. Effects of clusterin over-expression on metastatic progression and therapy in breast cancer

    Directory of Open Access Journals (Sweden)

    Chatterjee Namita

    2010-03-01

    Full Text Available Abstract Background Clusterin is a secreted glycoprotein that is upregulated in a variety of cell lines in response to stress, and enhances cell survival. A second nuclear isoform of clusterin that is associated with cell death has also been identified. The aim of this study was to determine the role(s of the secretory isoform in breast tumor progression and metastasis. Methods To investigate the role of secretory clusterin in the biology of breast cancer tumor growth and resistance to therapy we have engineered an MCF-7 cell line (MCF-7CLU that over-expresses clusterin. We have measured the in vitro effects of clusterin over-expression on cell cycle, cell death, and sensitivity to TNFalpha and tamoxifen. Using an orthotopic model of breast cancer, we have also determined the effects of over-expression of clusterin on tumor growth and metastatic progression. Results In vitro, over-expression of secretory clusterin alters the cell cycle kinetics and decreases the rate of cell death, resulting in the enhancement of cell growth. Over-expression of secretory clusterin also blocks the TNFalpha-mediated induction of p21 and abrogates the cleavage of Bax to t-Bax, rendering the MCF-7CLU cells significantly more resistant to the cytokine than the parental cells. Orthotopic primary tumors derived from MCF-7CLU cells grow significantly more rapidly than tumors derived from parental MCF-7 cells and, unlike the parental cells, metastasize frequently to the lungs. Conclusions These data suggest that secretory clusterin, which is frequently up-regulated in breast cancers by common therapies, including anti-estrogens, may play a significant role in tumor growth, metastatic progression and subsequent drug resistance in surviving cells.

  6. PAX2 is activated by estradiol in breast cancer cells of the luminal subgroup selectively, to confer a low invasive phenotype

    Science.gov (United States)

    2011-01-01

    Background Metastasis is the leading cause of death among breast cancer patients. Identifying key cellular factors controlling invasion and metastasis of breast cancer cells should pave the way to new therapeutic strategies efficiently interfering with the metastatic process. PAX2 (paired box 2) transcription factor is expressed by breast cancer cells in vivo and recently, it was shown to negatively regulate the expression of ERBB2 (erythroblastic leukemia viral oncogene homolog 2, HER-2/neu), a well-documented pro-invasive and pro-metastastic gene, in luminal/ERalpha-positive (ERα+) breast cancer cells. The objective of the present study was to investigate a putative role for PAX2 in the control of luminal breast cancer cells invasion, and to begin to characterize its regulation. Results PAX2 activity was higher in cell lines from luminal compared to non-luminal subtype, and activation of PAX2 by estradiol was selectively achieved in breast cancer cell lines of the luminal subtype. This process was blocked by ICI 182780 and could be antagonized by IGF-1. Knockdown of PAX2 in luminal MCF-7 cells completely abrogated estradiol-induced downregulation of ERBB2 and decrease of cell invasion, whereas overexpression of PAX2 in these cells enhanced estradiol effects on ERBB2 levels and cell invasion. Conclusions The study demonstrates that PAX2 activation by estradiol is selectively achieved in breast cancer cells of the luminal subtype, via ERα, and identifies IGF-1 as a negative regulator of PAX2 activity in these cells. Further, it reveals a new role for PAX2 in the maintenance of a low invasive behavior in luminal breast cancer cells upon exposure to estradiol, and shows that overexpression and activation of PAX2 in these cells is sufficient to reduce their invasive ability. PMID:22168360

  7. Prognostic and predictive values of EGFR overexpression and EGFR copy number alteration in HER2-positive breast cancer.

    Science.gov (United States)

    Lee, H J; Seo, A N; Kim, E J; Jang, M H; Kim, Y J; Kim, J H; Kim, S-W; Ryu, H S; Park, I A; Im, S-A; Gong, G; Jung, K H; Kim, H J; Park, S Y

    2015-01-06

    Epidermal growth factor receptor (EGFR) is overexpressed in a subset of human epidermal growth factor receptor 2 (HER2)-positive breast cancers, and coexpression of HER2 and EGFR has been reported to be associated with poor clinical outcome. Moreover, interaction between HER2 and EGFR has been suggested to be a possible basis for trastuzumab resistance. We analysed the clinical significance of EGFR overexpression and EGFR gene copy number alterations in 242 HER2-positive primary breast cancers. In addition, we examined the correlations between EGFR overexpression, trastuzumab response and clinical outcome in 447 primary, and 112 metastatic HER2-positive breast cancer patients treated by trastuzumab. Of the 242 primary cases, the level of EGFR overexpression was 2+ in 12.7% and 3+ in 11.8%. High EGFR gene copy number was detected in 10.3%. Epidermal growth factor receptor overexpression was associated with hormone receptor negativity and high Ki-67 proliferation index. In survival analyses, EGFR overexpression, but not high EGFR copy number, was associated with poor disease-free survival in all patients, and in the subgroup not receiving adjuvant trastuzumab. In 447 HER2-positive primary breast cancer patients treated with adjuvant trastuzumab, EGFR overexpression was also an independent poor prognostic factor. However, EGFR overexpression was not associated with trastuzumab response, progression-free survival or overall survival in the metastatic setting. Epidermal growth factor receptor overexpression, but not high EGFR copy number, is a poor prognostic factor in HER2-positive primary breast cancer. Epidermal growth factor receptor overexpression is a predictive factor for trastuzumab response in HER2-positive primary breast cancer, but not in metastatic breast cancer.

  8. Identification of target genes of transcription factor activator protein 2 gamma in breast cancer cells

    International Nuclear Information System (INIS)

    Ailan, He; Shuanglin, Xiang; Xiangwen, Xiao; Daolong, Ren; Lu, Gan; Xiaofeng, Ding; Xi, Qiao; Xingwang, Hu; Rushi, Liu; Jian, Zhang

    2009-01-01

    Activator protein 2 gamma (AP-2γ) is a member of the transcription factor activator protein-2 (AP-2) family, which is developmentally regulated and plays a role in human neoplasia. AP-2γ has been found to be overexpressed in most breast cancers, and have a dual role to inhibit tumor initiation and promote tumor progression afterwards during mammary tumorigensis. To identify the gene targets that mediate its effects, we performed chromatin immunoprecipitation (ChIP) to isolate AP-2γ binding sites on genomic DNA from human breast cancer cell line MDA-MB-453. 20 novel DNA fragments proximal to potential AP-2γ targets were obtained. They are categorized into functional groups of carcinogenesis, metabolism and others. A combination of sequence analysis, reporter gene assays, quantitative real-time PCR, electrophoretic gel mobility shift assays and immunoblot analysis further confirmed the four AP-2γ target genes in carcinogenesis group: ErbB2, CDH2, HPSE and IGSF11. Our results were consistent with the previous reports that ErbB2 was the target gene of AP-2γ. Decreased expression and overexpression of AP-2γ in human breast cancer cells significantly altered the expression of these four genes, indicating that AP-2γ directly regulates them. This suggested that AP-2γ can coordinate the expression of a network of genes, involving in carcinogenesis, especially in breast cancer. They could serve as therapeutic targets against breast cancers in the future

  9. Segmentation of HER2 protein overexpression in immunohistochemically stained breast cancer images using Support Vector Machines

    Science.gov (United States)

    Pezoa, Raquel; Salinas, Luis; Torres, Claudio; Härtel, Steffen; Maureira-Fredes, Cristián; Arce, Paola

    2016-10-01

    Breast cancer is one of the most common cancers in women worldwide. Patient therapy is widely supported by analysis of immunohistochemically (IHC) stained tissue sections. In particular, the analysis of HER2 overexpression by immunohistochemistry helps to determine when patients are suitable to HER2-targeted treatment. Computational HER2 overexpression analysis is still an open problem and a challenging task principally because of the variability of immunohistochemistry tissue samples and the subjectivity of the specialists to assess the samples. In addition, the immunohistochemistry process can produce diverse artifacts that difficult the HER2 overexpression assessment. In this paper we study the segmentation of HER2 overexpression in IHC stained breast cancer tissue images using a support vector machine (SVM) classifier. We asses the SVM performance using diverse color and texture pixel-level features including the RGB, CMYK, HSV, CIE L*a*b* color spaces, color deconvolution filter and Haralick features. We measure classification performance for three datasets containing a total of 153 IHC images that were previously labeled by a pathologist.

  10. Overexpression of peroxiredoxin I and thioredoxin1 in human breast carcinoma

    Directory of Open Access Journals (Sweden)

    Kim Il-Han

    2009-06-01

    Full Text Available Abstract Background Peroxiredoxins (Prxs are a novel group of peroxidases containing high antioxidant efficiency. The mammalian Prx family has six distinct members (Prx I-VI in various subcellular locations, including peroxisomes and mitochondria, places where oxidative stress is most evident. The function of Prx I in particular has been implicated in regulating cell proliferation, differentiation, and apoptosis. Since thioredoxin1 (Trx1 as an electron donor is functionally associated with Prx I, we investigated levels of expression of both Prx I and Trx1. Methods We investigated levels of expression of both Prx I and Trx1 in breast cancer by real-time polymerase chain reaction (RT-PCR and Western blot. Results Levels of messenger RNA (mRNA for both Prx I and Trx1 in normal human breast tissue were very low compared to other major human tissues, whereas their levels in breast cancer exceeded that in other solid cancers (colon, kidney, liver, lung, ovary, prostate, and thyroid. Among members of the Prx family (Prx I-VI and Trx family (Trx1, Trx2, Prx I and Trx1 were preferentially induced in breast cancer. Moreover, the expression of each was associated with progress of breast cancer and correlated with each other. Western blot analysis of different and paired breast tissues revealed consistent and preferential expression of Prx I and Trx1 protein in breast cancer tissue. Conclusion Prx I and Trx1 are overexpressed in human breast carcinoma and the expression levels are associated with tumor grade. The striking induction of Prx I and Trx1 in breast cancer may enable their use as breast cancer markers.

  11. CRISPR-assisted receptor deletion reveals distinct roles for ERBB2 and ERBB3 in skin keratinocytes.

    Science.gov (United States)

    Dahlhoff, Maik; Gaborit, Nadège; Bultmann, Sebastian; Leonhardt, Heinrich; Yarden, Yosef; Schneider, Marlon R

    2017-10-01

    While the epidermal growth factor receptor (EGFR) is an established regulator of skin development and homeostasis, the functions of the related tyrosine kinase receptors ERBB2 and ERBB3 in this tissue have only recently been examined. Previously reported, skin-specific deletion of each of these receptors in mice resulted in similar defects in keratinocyte proliferation and migration, resulting in impaired wound healing and tumorigenesis. Because both ERBB2 and ERBB3 are targets for treating an array of cancer types, it is important to examine the consequences of receptor inhibition in human keratinocytes. Here, we employed the CRISPR/Cas9 technology to generate HaCaT cells (an established human keratinocyte cell line) lacking ERBB2 or ERBB3. HaCaT clones lacking ERBB2 or ERBB3 showed comparable reductions in cell proliferation as assessed by BrdU staining. Apoptosis, in contrast, was reduced in ERBB3-deficient HaCaT cells only. Assessment of cell migration using a wound healing (scratch) assay showed that the closure of the wound gaps was completed by 48 h in mock and in ERBB3 knockout clones. In contrast, this process was considerably delayed in ERBB2 knockout clones, and a complete closure of the gap in the latter cells did not occur before 72 h. In conclusion, both ERBB2 and ERBB3 are essential for normal proliferation of skin keratinocytes, but in contrast to ERBB3, ERBB2 is essential for migration of human keratinocytes. These observations might bear significance to patient adverse effects of therapeutic agents targeting ERBB2 and ERBB3. © 2017 Federation of European Biochemical Societies.

  12. FRA-1 protein overexpression is a feature of hyperplastic and neoplastic breast disorders

    International Nuclear Information System (INIS)

    Chiappetta, Gennaro; Pierantoni, Giovanna Maria; Fusco, Alfredo; Ferraro, Angelo; Botti, Gerardo; Monaco, Mario; Pasquinelli, Rosa; Vuttariello, Emilia; Arnaldi, Liliane; Di Bonito, Maurizio; D'Aiuto, Giuseppe

    2007-01-01

    Fos-related antigen 1 (FRA-1) is an immediate early gene encoding a member of AP-1 family of transcription factors involved in cell proliferation, differentiation, apoptosis, and other biological processes. fra-1 gene overexpression has an important role in the process of cellular transformation, and our previous studies suggest FRA-1 protein detection as a useful tool for the diagnosis of thyroid neoplasias. Here we investigate the expression of the FRA-1 protein in benign and malignant breast tissues by immunohistochemistry, Western blot, RT-PCR and qPCR analysis, to evaluate its possible help in the diagnosis and prognosis of breast neoplastic diseases. We investigate the expression of the FRA-1 protein in 70 breast carcinomas and 30 benign breast diseases by immunohistochemistry, Western blot, RT-PCR and qPCR analysis. FRA-1 protein was present in all of the carcinoma samples with an intense staining in the nucleus. Positive staining was also found in most of fibroadenomas, but in this case the staining was present both in the nucleus and cytoplasm, and the number of positive cells was lower than in carcinomas. Similar results were obtained from the analysis of breast hyperplasias, with no differences in FRA-1 expression level between typical and atypical breast lesions; however the FRA-1 protein localization is mainly nuclear in the atypical hyperplasias. In situ breast carcinomas showed a pattern of FRA-1 protein expression very similar to that observed in atypical hyperplasias. Conversely, no FRA-1 protein was detectable in 6 normal breast tissue samples used as controls. RT-PCR and qPCR analysis confirmed these results. Similar results were obtained analysing FRA-1 expression in fine needle aspiration biopsy (FNAB) samples. The data shown here suggest that FRA-1 expression, including its intracellular localization, may be considered a useful marker for hyperplastic and neoplastic proliferative breast disorders

  13. miR-125b acts as a tumor suppressor in chondrosarcoma cells by the sensitization to doxorubicin through direct targeting the ErbB2-regulated glucose metabolism.

    Science.gov (United States)

    Tang, Xian-ye; Zheng, Wei; Ding, Min; Guo, Kai-jin; Yuan, Feng; Feng, Hu; Deng, Bin; Sun, Wei; Hou, Yang; Gao, Lu

    2016-01-01

    Chondrosarcoma is the second most common type of primary bone malignancy in the United States after osteosarcoma. Surgical resections of these tumors are the only effective treatment to chondrosarcoma patients due to their resistance to conventional chemo- and radiotherapy. In this study, miR-125b was found to perform its tumor-suppressor function to inhibit glucose metabolism via the direct targeting of oncogene, ErbB2. We report miR-125b was downregulated in both chondrosarcoma patient samples and cell lines. The total 20 Asian chondrosarcoma patients showed significantly downregulated miR-125b expression compared with normal tissues. Meanwhile, miR-125 was downregulated in chondrosarcoma cells and doxorubicin resistant cells. Overexpression of miR-125 enhanced the sensitivity of both parental and doxorubicin resistant cells to doxorubicin through direct targeting on the ErbB2-mediated upregulation of glycolysis in chondrosarcoma cells. Moreover, restoration of the expression of ErbB2 and glucose metabolic enzymes in miR-125 pretransfected cells recovered the susceptibility to doxorubicin. Our study will provide a novel aspect on the overcoming chemoresistance in human chondrosarcoma cells and may help in the development of therapeutic strategies for the treatments of patients.

  14. FOXP3 is a novel transcriptional repressor for the breast cancer oncogene SKP2

    OpenAIRE

    Zuo, Tao; Liu, Runhua; Zhang, Huiming; Chang, Xing; Liu, Yan; Wang, Lizhong; Zheng, Pan; Liu, Yang

    2007-01-01

    S-phase kinase-associated protein 2 (SKP2) is a component of the E3 ubiquitin ligase SKP1-Cul1-Fbox complex. Overexpression of SKP2 results in cell cycle dysregulation and carcinogenesis; however, the genetic lesions that cause this upregulation are poorly understood. We recently demonstrated that forkhead box P3 (FOXP3) is an X-linked breast cancer suppressor and an important repressor of the oncogene ERBB2/HER2. Since FOXP3 suppresses tumor growth regardless of whether the tumors overexpres...

  15. Overexpressed ubiquitin ligase Cullin7 in breast cancer promotes cell proliferation and invasion via down-regulating p53

    International Nuclear Information System (INIS)

    Guo, Hongsheng; Wu, Fenping; Wang, Yan; Yan, Chong; Su, Wenmei

    2014-01-01

    Highlights: • Cullin7 is overexpressed in human breast cancer samples. • Cullin7 stimulated proliferation and invasion of breast cancer cells. • Inhibition of p53 contributes to Cullin7-induced proliferation and invasion. - Abstract: Ubiquitin ligase Cullin7 has been identified as an oncogene in some malignant diseases such as choriocarcinoma and neuroblastoma. However, the role of Cullin7 in breast cancer carcinogenesis remains unclear. In this study, we compared Cullin7 protein levels in breast cancer tissues with normal breast tissues and identified significantly higher expression of Cullin7 protein in breast cancer specimens. By overexpressing Cullin7 in breast cancer cells HCC1937, we found that Cullin7 could promote cell growth and invasion in vitro. In contrast, the cell growth and invasion was inhibited by silencing Cullin7 in breast cancer cell BT474. Moreover, we demonstrated that Cullin7 promoted breast cancer cell proliferation and invasion via down-regulating p53 expression. Thus, our study provided evidence that Cullin7 functions as a novel oncogene in breast cancer and may be a potential therapeutic target for breast cancer management

  16. Overexpressed ubiquitin ligase Cullin7 in breast cancer promotes cell proliferation and invasion via down-regulating p53

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Hongsheng [Department of Histology and Embryology, Guangdong Medical College, Dongguan 523808, Guangdong (China); Wu, Fenping [The 7th People’s Hospital of Chengdu, Chengdu 610041, Sichuan (China); Wang, Yan [The Second School of Clinical Medicine, Guangdong Medical College, Dongguan 523808, Guangdong (China); Yan, Chong [School of Pharmacy, Guangdong Medical College, Dongguan 523808, Guangdong (China); Su, Wenmei, E-mail: wenmeisutg@126.com [Oncology of Affiliated Hospital Guangdong Medical College, Zhanjiang 524000, Guangdong (China)

    2014-08-08

    Highlights: • Cullin7 is overexpressed in human breast cancer samples. • Cullin7 stimulated proliferation and invasion of breast cancer cells. • Inhibition of p53 contributes to Cullin7-induced proliferation and invasion. - Abstract: Ubiquitin ligase Cullin7 has been identified as an oncogene in some malignant diseases such as choriocarcinoma and neuroblastoma. However, the role of Cullin7 in breast cancer carcinogenesis remains unclear. In this study, we compared Cullin7 protein levels in breast cancer tissues with normal breast tissues and identified significantly higher expression of Cullin7 protein in breast cancer specimens. By overexpressing Cullin7 in breast cancer cells HCC1937, we found that Cullin7 could promote cell growth and invasion in vitro. In contrast, the cell growth and invasion was inhibited by silencing Cullin7 in breast cancer cell BT474. Moreover, we demonstrated that Cullin7 promoted breast cancer cell proliferation and invasion via down-regulating p53 expression. Thus, our study provided evidence that Cullin7 functions as a novel oncogene in breast cancer and may be a potential therapeutic target for breast cancer management.

  17. Reliable PCR quantitation of estrogen, progesterone and ERBB2 receptor mRNA from formalin-fixed, paraffin-embedded tissue is independent of prior macro-dissection

    DEFF Research Database (Denmark)

    Tramm, Trine; Hennig, Guido; Kyndi, Marianne

    2013-01-01

    Gene expression analysis on messenger RNA (mRNA) purified from formalin-fixed, paraffin-embedded tissue is increasingly used for research purposes. Tissue heterogeneity may question specificity and interpretation of results from mRNA isolated from a whole slide section, and thresholds for minimal...... tumor content in the paraffin block or macrodissection are used to avoid contamination from non-neoplastic tissue. The aim was to test if mRNA from tissue surrounding breast cancer affected quantification of estrogen receptor α (ESR1), progesterone receptor (PGR) and human epidermal growth factor...... receptor 2 (ERBB2), by comparing gene expression from whole slide and tumor-enriched sections, and correlating gene expression from whole slide sections with corresponding immunohistochemistry. Gene expression, based on mRNA extracted from a training set (36 paraffin blocks) and two validation sets (133...

  18. Activation of EGFR and ERBB2 by Helicobacter pylori Results in Survival of Gastric Epithelial Cells with DNA Damage

    Science.gov (United States)

    Chaturvedi, Rupesh; Asim, Mohammad; Piazuelo, M. Blanca; Yan, Fang; Barry, Daniel P.; Sierra, Johanna Carolina; Delgado, Alberto G.; Hill, Salisha; Casero, Robert A.; Bravo, Luis E.; Dominguez, Ricardo L.; Correa, Pelayo; Polk, D. Brent; Washington, M. Kay; Rose, Kristie L.; Schey, Kevin L.; Morgan, Douglas R.; Peek, Richard M.; Wilson, Keith T.

    2014-01-01

    BACKGROUND & AIMS The gastric cancer-causing pathogen Helicobacter pylori upregulates spermine oxidase (SMOX) in gastric epithelial cells, causing oxidative stress-induced apoptosis and DNA damage. A subpopulation of SMOXhigh cells are resistant to apoptosis, despite their high levels of DNA damage. Because epidermal growth factor receptor (EGFR) activation can regulate apoptosis, we determined its role in SMOX-mediated effects. METHODS SMOX, apoptosis, and DNA damage were measured in gastric epithelial cells from H pylori-infected Egfrwa5 mice (which have attenuated EGFR activity), Egfr wild-type mice, or in infected cells incubated with EGFR inhibitors or deficient in EGFR. Phosphoproteomic analysis was performed. Two independent tissue microarrays containing each stage of disease, from gastritis to carcinoma, and gastric biopsies from Colombian and Honduran cohorts were analyzed by immunohistochemistry. RESULTS SMOX expression and DNA damage were decreased, and apoptosis increased in H pylori-infected Egfrwa5 mice. H pylori-infected cells with deletion or inhibition of EGFR had reduced levels of SMOX, DNA damage, and DNA damagehigh apoptosislow cells. Phosphoproteomic analysis revealed increased EGFR and ERBB2 signaling. Immunoblot analysis demonstrated the presence of a phosphorylated (p)EGFR–ERBB2 heterodimer and pERBB2; knockdown of ErbB2 facilitated apoptosis of DNA damagehigh apoptosislow cells. SMOX was increased in all stages of gastric disease, peaking in tissues with intestinal metaplasia, whereas pEGFR, pEGFR–ERBB2, and pERBB2 were increased predominantly in tissues demonstrating gastritis or atrophic gastritis. Principal component analysis separated gastritis tissues from patients with cancer vs those without cancer. pEGFR, pEGFR–ERBB2, pERBB2, and SMOX were increased in gastric samples from patients whose disease progressed to intestinal metaplasia or dysplasia, compared with patients whose disease did not progress. CONCLUSIONS In an analysis

  19. Overexpression of SERBP1 (Plasminogen activator inhibitor 1 RNA binding protein) in human breast cancer is correlated with favourable prognosis

    International Nuclear Information System (INIS)

    Serce, Nuran Bektas; Knuechel, Ruth; Beckmann, Matthias W; Fasching, Peter A; Dahl, Edgar; Boesl, Andreas; Klaman, Irina; Serényi, Sonja von; Noetzel, Erik; Press, Michael F; Dimmler, Arno; Hartmann, Arndt; Sehouli, Jalid

    2012-01-01

    Plasminogen activator inhibitor 1 (PAI-1) overexpression is an important prognostic and predictive biomarker in human breast cancer. SERBP1, a protein that is supposed to regulate the stability of PAI-1 mRNA, may play a role in gynaecological cancers as well, since upregulation of SERBP1 was described in ovarian cancer recently. This is the first study to present a systematic characterisation of SERBP1 expression in human breast cancer and normal breast tissue at both the mRNA and the protein level. Using semiquantitative realtime PCR we analysed SERBP1 expression in different normal human tissues (n = 25), and in matched pairs of normal (n = 7) and cancerous breast tissues (n = 7). SERBP1 protein expression was analysed in two independent cohorts on tissue microarrays (TMAs), an initial evaluation set, consisting of 193 breast carcinomas and 48 normal breast tissues, and a second large validation set, consisting of 605 breast carcinomas. In addition, a collection of benign (n = 2) and malignant (n = 6) mammary cell lines as well as breast carcinoma lysates (n = 16) were investigated for SERBP1 expression by Western blot analysis. Furthermore, applying non-radioisotopic in situ hybridisation a subset of normal (n = 10) and cancerous (n = 10) breast tissue specimens from the initial TMA were analysed for SERBP1 mRNA expression. SERBP1 is not differentially expressed in breast carcinoma compared to normal breast tissue, both at the RNA and protein level. However, recurrence-free survival analysis showed a significant correlation (P = 0.008) between abundant SERBP1 expression in breast carcinoma and favourable prognosis. Interestingly, overall survival analysis also displayed a tendency (P = 0.09) towards favourable prognosis when SERBP1 was overexpressed in breast cancer. The RNA-binding protein SERBP1 is abundantly expressed in human breast cancer and may represent a novel breast tumour marker with prognostic significance. Its potential involvement in the

  20. Overexpression of the E2F target gene CENPI promotes chromosome instability and predicts poor prognosis in estrogen receptor-positive breast cancer.

    Science.gov (United States)

    Thangavelu, Pulari U; Lin, Cheng-Yu; Vaidyanathan, Srividya; Nguyen, Thu H M; Dray, Eloise; Duijf, Pascal H G

    2017-09-22

    During cell division, chromosome segregation is facilitated by the mitotic checkpoint, or spindle assembly checkpoint (SAC), which ensures correct kinetochore-microtubule attachments and prevents premature sister-chromatid separation. It is well established that misexpression of SAC components on the outer kinetochores promotes chromosome instability (CIN) and tumorigenesis. Here, we study the expression of CENP-I, a key component of the HIKM complex at the inner kinetochores, in breast cancer, including ductal, lobular, medullary and male breast carcinomas. CENPI mRNA and protein levels are significantly elevated in estrogen receptor-positive (ER+) but not in estrogen receptor-negative (ER-) breast carcinoma. Well-established prognostic tests indicate that CENPI overexpression constitutes a powerful independent marker for poor patient prognosis and survival in ER+ breast cancer. We further demonstrate that CENPI is an E2F target gene. Consistently, it is overexpressed in RB1 -deficient breast cancers. However, CENP-I overexpression is not purely due to cell cycle-associated expression. In ER+ breast cancer cells, CENP-I overexpression promotes CIN, especially chromosome gains. In addition, in ER+ breast carcinomas the degree of CENPI overexpression is proportional to the level of aneuploidy and CENPI overexpression is one of the strongest markers for CIN identified to date. Our results indicate that overexpression of the inner kinetochore protein CENP-I promotes CIN and forecasts poor prognosis for ER+ breast cancer patients. These observations provide novel mechanistic insights and have important implications for breast cancer diagnostics and potentially therapeutic targeting.

  1. Expression of oncogen c-erbB-2 (neu/HER-2) in human breast cancer

    International Nuclear Information System (INIS)

    Michelin, Severino C.; Mayo, Jose

    2000-01-01

    Breast cancer continues to be one of the leading causes of death from cancer among women and represents the most serious challenge to therapeutic control. Amplification and overexpression of the c-erbB-2 proto-oncogene occurs in as many as 30 % of all breast cancers and has been correlated with lymph node metastasis and poor prognosis in breast cancer patients. This gene know as neu, HER-2 or c-erbB-2 in among those most frequently altered in human cancer. It was first identified as a transforming gene activated in chemically induced rat neuroectodermal tumors. Early critical studies linked changes in erbB-2 expression and gene copy number to several human cancer, notably breast, ovarian and gastric cancer. Owing to its accessible location at the cell surface, erbB-2 is now under intensive scrutiny as a therapeutic target. In this review we will summarize the involvement of the c-erbB-2 gene in tumorigenesis. (author)

  2. Cytoplasmic localization of alteration/deficiency in activation 3 (ADA3) predicts poor clinical outcome in breast cancer patients.

    Science.gov (United States)

    Mirza, Sameer; Rakha, Emad A; Alshareeda, Alaa; Mohibi, Shakur; Zhao, Xiangshan; Katafiasz, Bryan J; Wang, Jun; Gurumurthy, Channabasavaiah Basavaraju; Bele, Aditya; Ellis, Ian O; Green, Andrew R; Band, Hamid; Band, Vimla

    2013-02-01

    Transcriptional activation by estrogen receptor (ER) is a key step to breast oncogenesis. Given previous findings that ADA3 is a critical component of HAT complexes that regulate ER function and evidence that overexpression of other ER coactivators such as SRC-3 is associated with clinical outcomes in breast cancer, the current study was designed to assess the potential significance of ADA3 expression/localization in human breast cancer patients. In this study, we analyzed ADA3 expression in breast cancer tissue specimens and assessed the correlation of ADA3 staining with cancer progression and patient outcome. Tissue microarrays prepared from large series of breast cancer patients with long-term follow-ups were stained with anti-ADA3 monoclonal antibody using immunohistochemistry. Samples were analyzed for ADA3 expression followed by correlation with various clinicopathological parameters and patients' outcomes. We report that breast cancer specimens show predominant nuclear, cytoplasmic, or mixed nuclear + cytoplasmic ADA3 staining patterns. Predominant nuclear ADA3 staining correlated with ER+ status. While predominant cytoplasmic ADA3 staining negatively correlated with ER+ status, but positively correlated with ErbB2, EGFR, and Ki67. Furthermore, a positive correlation of cytoplasmic ADA3 was observed with higher histological grade, mitotic counts, Nottingham Prognostic Index, and positive vascular invasion. Patients with nuclear ADA3 and ER positivity have better breast cancer specific survival and distant metastasis free survival. Significantly, cytoplasmic expression of ADA3 showed a strong positive association with reduced BCSS and DMFS in ErbB2+/EGFR+ patients. Although in multivariate analyses ADA3 expression was not an independent marker of survival, predominant nuclear ADA3 staining in breast cancer tissues correlates with ER+ expression and together serves as a marker of good prognosis, whereas predominant cytoplasmic ADA3 expression correlates with

  3. A single amino acid substitution is sufficient to modify the mitogenic properties of the epidermal growth factor receptor to resemble that of gp185erbB-2

    DEFF Research Database (Denmark)

    Di Fiore, P P; Helin, K; Kraus, M H

    1992-01-01

    The epidermal growth factor (EGF) receptor (EGFR) and the erbB-2 gene product, gp185erbB-2, exhibit distinct abilities to stimulate mitogenesis in different target cells. By using chimeric molecules between these two receptors, we have previously shown that their intracellular juxtamembrane regio...

  4. Autophagy Protects from Trastuzumab-Induced Cytotoxicity in HER2 Overexpressing Breast Tumor Spheroids.

    Directory of Open Access Journals (Sweden)

    Cristina E Rodríguez

    Full Text Available Multicellular tumor spheroids represent a 3D in vitro model that mimics solid tumor essential properties including assembly and development of extracellular matrix and nutrient, oxygen and proliferation gradients. In the present study, we analyze the impact of 3D spatial organization of HER2-overexpressing breast cancer cells on the response to Trastuzumab. We cultured human mammary adenocarcinoma cell lines as spheroids with the hanging drop method and we observed a gradient of proliferating, quiescent, hypoxic, apoptotic and autophagic cells towards the inner core. This 3D organization decreased Trastuzumab sensitivity of HER2 over-expressing cells compared to monolayer cell cultures. We did not observe apoptosis induced by Trastuzumab but found cell arrest in G0/G1 phase. Moreover, the treatment downregulated the basal apoptosis only found in tumor spheroids, by eliciting protective autophagy. We were able to increase sensitivity to Trastuzumab by autophagy inhibition, thus exposing the interaction between apoptosis and autophagy. We confirmed this result by developing a resistant cell line that was more sensitive to autophagy inhibition than the parental BT474 cells. In summary, the development of Trastuzumab resistance relies on the balance between death and survival mechanisms, characteristic of 3D cell organization. We propose the use of spheroids to further improve the understanding of Trastuzumab antitumor activity and overcome resistance.

  5. Epidermal growth factor receptor overexpression and outcomes in early breast cancer: A systematic review and a meta-analysis.

    Science.gov (United States)

    Gonzalez-Conchas, Galileo A; Rodriguez-Romo, Laura; Hernandez-Barajas, David; Gonzalez-Guerrero, Juan F; Rodriguez-Fernandez, Ivan A; Verdines-Perez, Adrian; Templeton, Arnoud J; Ocana, Alberto; Seruga, Bostjan; Tannock, Ian F; Amir, Eitan; Vera-Badillo, Francisco E

    2018-01-01

    The epidermal growth factor receptor (EGFR) is a member of the ErbB family of membrane tyrosine-kinase receptors. Studies exploring the prognostic role of EGFR-overexpression in early breast cancer have shown variable results, and the true prognostic value of EGFR is unknown. A systematic review of identified publications exploring the association between EGFR-overexpression (as defined from different techniques and cut-offs) and outcomes [disease-free (DFS) and, overall survival (OS)] in women with early breast cancer. The hazard ratios (HR) for DFS and OS were weighted and pooled in a meta-analysis using generic inverse variance and random effects modeling. Fifty-three studies comprising 21,418 women were included. EGFR-overexpression was found in 27% of the patients. Primary analysis included studies reporting HRs from multivariable analyses (10 studies including 4857 patients with HRs for OS and 17 studies comprising 8747 patients with HRs for DFS), EGFR-overexpression was associated with worse OS (HR 1.98, 95% CI: 1.59-2.47, p overexpression on DFS was greater in women with triple negative tumors compared to women with non-triple negative tumors (HR 2.35 versus HR 1.45, respectively; p = .01). Analysis looking at odd ratios for both 5-year and 10-year for DFS and OS showed similar results. EGFR-overexpression appears to be associated with reduced OS and DFS in women with early breast cancer. Patients with triple negative and EGFR-overexpression have poorer OS and DFS than those with triple negative tumors and normal EGFR expression. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Brain metastases in patients who receive trastuzumab-containing chemotherapy for HER2-overexpressing metastatic breast cancer

    International Nuclear Information System (INIS)

    Ono, Makiko; Ando, Masashi; Yunokawa, Mayu

    2009-01-01

    Recently, a high rate of brain metastases has been reported among patients with human epidermal growth factor receptor (HER2)-overexpressing metastatic breast cancer who were treated with trastuzumab. The present study examined risk factors for the development of brain metastasis in patients with HER2-overexpressing breast cancer who were treated with trastuzumab. We retrospectively reviewed 204 patients with HER-2-overexpressing breast cancer who were treated with a trastuzumab-containing regimen between 1999 and 2006. Patients with clinical symptoms were diagnosed as having brain metastases when brain magnetic resonance imaging (MRI) or a computed tomography (CT) scan revealed positive findings for brain metastases. The median follow-up time of this cohort was 53.6 months. Among the patients who received a trastuzumab-containing regimen, 74 patients (36.3%) developed brain metastases. The median survival from the diagnosis of brain metastases was 13.5 months (95% confidence interval [CI], 12.2-14.7 months). The median time interval between the beginning of trastuzumab treatment and the diagnosis of brain metastases was 13.6 months (range, 0.0-45.8 months). Among patients with brain metastases, the median overall survival period was 39 months. A multivariate logistic regression analysis showed that age (≤50 years), recurrent breast cancer, and liver metastases were significant risk factors for the development of brain metastases. Patients with HER2-overexpressing breast cancer treated with trastuzumab had a high incidence of brain metastases (36.3%). Routine screening for brain metastases 1 year after the start of trastuzumab treatment, may be warranted in younger patients (≤50 years) who had recurrent breast cancer with liver metastases. (author)

  7. Role of Integrin Alpha 5 in ErbB2-Mediated Breast Cancer

    Science.gov (United States)

    2009-09-01

    AD__ ( Leave blank) _______________ Award Number: W81XWH-08-1...3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 using Guava Technologies EasyCyte Plus, and data analyzed with Guava ...dilution, washed, and incubated with secondary antibody (AlexaFluor mouse 488, Invitrogen) at a 1:200 dilution. Cells were read on a Guava Technologies

  8. The Effects of Bisphenol A (BPA) on ErbB2 Positive Breast Cancer

    Science.gov (United States)

    2010-11-01

    adolescence [2]. As this population of women prenatally exposed to DES has aged, it has become increasingly apparent that they are also more susceptible...of action is implicated. Fertil Steril, 2008. 89(2 Suppl): p. e41. 27. Timms, B.G., et al., Estrogenic chemicals in plastic and oral contraceptives

  9. Role of Stat3 and ErbB2 in Breast Cancer

    Science.gov (United States)

    2013-12-01

    Nemoto, K.E. Pestell , K. Cooley, E.C. Southwick, D.A. Mitchell, W. Furey, R. Gussio, D.W. Zaharevitz, B. Joo, P. Wipf, Identification of a potent...7). Inorg Chem 2008, 47:2798–2804. 26. Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C, et al: Stat3 as an oncogene. Cell...Biochem Biophys Res Commun 382: 440-444, 2009. 7 Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C and Darnell JE Jr.: Stat3 as an

  10. Role of Stat3 and ErbB2 in Breast Cancer

    Science.gov (United States)

    2011-10-01

    49631-49637 (2002). 35. Razani,B. et al. Caveolin-1 expression is down-regulated in cells transformed by the human papilloma virus in a p53...polio vaccines, whose prevalence in humans is not clear (Garcea and Imperiale, 2003). The response of cultured cells to DNA tumor virus infection... human papilloma viruses 16 and 18 have been implicated in the development of epithelial malignancies, especially cancer of the uterine cervix and other

  11. Activation of SNAT1/SLC38A1 in human breast cancer: correlation with p-Akt overexpression

    International Nuclear Information System (INIS)

    Wang, Kuo; Cao, Fang; Fang, Wenzheng; Hu, Yongwei; Chen, Ying; Ding, Houzhong; Yu, Guanzhen

    2013-01-01

    SNAT1 is a subtype of the amino acid transport system A that has been implicated to play a potential role in cancer development and progression, yet its role in breast cancer remains unclear. In present study, we detected SNAT1 expression in breast cancers and explored its underlying mechanism in promoting breast carcinogenesis. RT-PCR and Western blotting were performed to analyze the transcription and protein levels of SNAT1 in breast cancer cell lines and fresh tissues. Tissue microarray blocks containing breast cancer specimens obtained from 210 patients were constructed. Expression of SNAT1 in these specimens was analyzed using immunohistochemical studies. SNAT1 was down-regulated by SNAT1-shRNA in breast cancer cells and the functional significance was measured. SNAT1 was up-regulated in breast cancer cell lines and breast cancer tissues. Overexpression of SNAT1 was observed in 127 cases (60.5%). Expression of SNAT1 was significantly associated with tumor size, nodal metastasis, advanced disease stage, Ki-67, and ER status. Suppression of endogenous SNAT1 leads to cell growth inhibition, cell cycle arrest, and apoptosis of 4T1 cells and lowered the phosphorylation level of Akt. SNAT1 expression correlated significantly with p-Akt expression in human breast cancer samples. The cross-talk between Akt signaling and SNAT1 might play a critical role in the development and progression of breast cancer, providing an important molecular basis for novel diagnostic markers and new attractive targets in the treatment of breast cancer patients

  12. Detection of survivin, carcinoembryonic antigen and ErbB2 level in oral squamous cell carcinoma patients.

    Science.gov (United States)

    Li, Shu-Xia; Yang, Yan-Qi; Jin, Li-Jian; Cai, Zhi-Gang; Sun, Zheng

    2016-01-01

    The aim of this study was to detect the survivin, carcinoembryonic antigen (CEA) and ErbB2 in the saliva, serum and local tumor-exfoliated cells of oral squamous cell carcinoma (OSCC) patients, for providing reliable tumor markers for the early detection of oral malignant cancer. The saliva, serum, and local tumor-exfoliated cell samples of 26 OSCC patients without chemotherapy and 10 non-cancer patients were collected in Department of Oral and Maxillofacial Surgery, School of Stomatology, Peking University. The contents of survivin, CEA and ErbB2 using were detected usingenzyme-linked immunosorbent assay. The survivin and CEA levels in saliva and local tumor-exfoliated cells of OSCC patients were significantly higher than those in the non-cancer patients (P oral malignant cancer.

  13. [Construction of the lentiviral expression vector for anti-p185(erbB2) mouse/human chimeric antibody].

    Science.gov (United States)

    Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi

    2013-04-01

    This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.

  14. High eIF4E Overexpression in Node Negative Breast Cancer as Predictor for Recurrence

    National Research Council Canada - National Science Library

    Li, Benjamin

    2002-01-01

    .... EIF4E overexpression has been found in human malignancies (Li, 1997; Nathan, 1997). Furthermore, there appears to be an association of eIF4E overexpression and clinical outcomes (Li, 1998; Nathan, 1997; Li, 2001...

  15. Biologic role of activated leukocyte cell adhesion molecule overexpression in breast cancer cell lines and clinical tumor tissue.

    Science.gov (United States)

    Hein, Sibyll; Müller, Volkmar; Köhler, Nadine; Wikman, Harriet; Krenkel, Sylke; Streichert, Thomas; Schweizer, Michaela; Riethdorf, Sabine; Assmann, Volker; Ihnen, Maike; Beck, Katrin; Issa, Rana; Jänicke, Fritz; Pantel, Klaus; Milde-Langosch, Karin

    2011-09-01

    The activated leukocyte cell adhesion molecule (ALCAM) is overexpressed in many mammary tumors, but controversial results about its role and prognostic impact in breast cancer have been reported. Therefore, we evaluated the biologic effects of ALCAM expression in two breast cancer cell lines and a larger cohort of mammary carcinomas. By stable transfections, MCF7 cells with ALCAM overexpression and MDA-MB231 cells with reduced ALCAM levels were generated and analyzed in functional assays and cDNA microarrays. In addition, an immunohistochemical study on 347 patients with breast cancer with long-term follow-up and analysis of disseminated tumor cells (DTCs) was performed. In both cell lines, high ALCAM expression was associated with reduced cell motility. In addition, ALCAM silencing in MDA-MB231 cells resulted in lower invasive potential, whereas high ALCAM expression was associated with increased apoptosis in both cell lines. Among genes which were differentially expressed in clones with altered ALCAM expression, there was an overlap of 15 genes between both cell lines, among them cathepsin D, keratin 7, gelsolin, and ets2 whose deregulation was validated by western blot analysis. In MDA-MB231 cells, we observed a correlation with VEGF expression which was validated by enzyme-linked immuno sorbent assay (ELISA). Our IHC results on primary breast carcinomas showed that ALCAM expression was associated with an estrogen receptor-positive phenotype. In addition, strong ALCAM immunostaining correlated with nodal involvement and the presence of tumor cells in bone marrow. By Kaplan-Meier analysis, strong ALCAM expression in ductal carcinomas correlated with shorter recurrence-free intervals (P=0.048) and overall survival (OAS, P=0.003). Our results indicate that the biologic role of ALCAM in breast cancer is complex, but overexpression might be relevant for outcome in ductal carcinomas.

  16. Overexpression of miR-206 suppresses glycolysis, proliferation and migration in breast cancer cells via PFKFB3 targeting

    Energy Technology Data Exchange (ETDEWEB)

    Ge, Xin; Lyu, Pengwei; Cao, Zhang; Li, Jingruo; Guo, Guangcheng; Xia, Wanjun; Gu, Yuanting, E-mail: zzyuantinggu@126.com

    2015-08-07

    miRNAs, sorting as non-coding RNAs, are differentially expressed in breast tumor and act as tumor promoters or suppressors. miR-206 could suppress the progression of breast cancer, the mechanism of which remains unclear. The study here was aimed to investigate the effect of miR-206 on human breast cancers. We found that miR-206 was down-regulated while one of its predicted targets, 6-Phosphofructo-2-kinase (PFKFB3) was up-regulated in human breast carcinomas. 17β-estradiol dose-dependently decreased miR-206 expression as well as enhanced PFKFB3 mRNA and protein expression in estrogen receptor α (ERα) positive breast cancer cells. Furthermore, we identified that miR-206 directly interacted with 3′-untranslated region (UTR) of PFKFB3 mRNA. miR-206 modulated PFKFB3 expression in MCF-7, T47D and SUM159 cells, which was influenced by 17β-estradiol depending on ERα expression. In addition, miR-206 overexpression impeded fructose-2,6-bisphosphate (F2,6BP) production, diminished lactate generation and reduced cell proliferation and migration in breast cancer cells. In conclusion, our study demonstrated that miR-206 regulated PFKFB3 expression in breast cancer cells, thereby stunting glycolysis, cell proliferation and migration. - Highlights: • miR-206 was down-regulated and PFKFB3 was up-regulated in human breast carcinomas. • 17β-estradiol regulated miR-206 and PFKFB3 expression in ERα+ cancer cells. • miR-206directly interacted with 3′-UTR of PFKFB3 mRNA. • miR-206 fructose-2,6-bisphosphate (F2,6BP) impeded production and lactate generation. • miR-206 reduced cell proliferation and migration in breast cancer cells.

  17. PTEN expression as a predictor for the response to trastuzumab-based therapy in Her-2 overexpressing metastatic breast cancer.

    Directory of Open Access Journals (Sweden)

    Daphne Gschwantler-Kaulich

    Full Text Available Even though trastuzumab is an effective therapy in early stage Her-2+ breast cancer, 40-50% of advanced Her-2+ breast cancer patients develop trastuzumab resistance. A potential resistance mechanism is aberrant downstream signal transmission due to loss of phosphatase and tensin homologue (PTEN. This study investigated the relationship between the expression of PTEN and trastuzumab response in Her-2 overexpressing metastatic breast cancer patients.Between 2000 and 2007, 164 patients with Her-2+ metastatic breast cancer received trastuzumab-based therapy in our institution. We analyzed PTEN status by immunohistochemistry of 115 available tumor tissues and analyzed associations with other histopathological parameters, response rate, progression free survival (PFS and overall survival (OS with a median follow-up of 60 months.Eighty patients were PTEN positive (69.6% and 35 patients PTEN negative (30.4%. We found a significant association of the expression of PTEN and p53 (p = 0.041, while there was no association with grading, hormone receptor status, IGFR or MIB. We found significantly more cases with progressive disease under trastuzumab-based therapy in patients with PTEN positive breast cancers (p = 0.018, while there was no significant correlation with PFS or OS.In Her-2-positive metastatic breast cancers, PTEN positivity was significantly associated with progressive disease, but not with PFS or OS.

  18. Cytosolic phospholipase A2 activation correlates with HER2 overexpression and mediates estrogen-dependent breast cancer cell growth.

    LENUS (Irish Health Repository)

    Caiazza, Francesco

    2010-05-01

    Cytosolic phospholipase A(2)alpha (cPLA(2)alpha) catalyzes the hydrolysis of membrane glycerol-phospholipids to release arachidonic acid as the first step of the eicosanoid signaling pathway. This pathway contributes to proliferation in breast cancer, and numerous studies have demonstrated a crucial role of cyclooxygenase 2 and prostaglandin E(2) release in breast cancer progression. The role of cPLA(2)alpha activation is less clear, and we recently showed that 17beta-estradiol (E2) can rapidly activate cPLA(2)alpha in MCF-7 breast cancer cells. Overexpression or gene amplification of HER2 is found in approximately 30% of breast cancer patients and correlates with a poor clinical outcome and resistance to endocrine therapy. This study reports the first evidence for a correlation between cPLA(2)alpha enzymatic activity and overexpression of the HER2 receptor. The activation of cPLA(2)alpha in response to E2 treatment was biphasic with the first phase dependent on trans-activation through the matrix metalloproteinase-dependent release of heparin-bound epidermal growth factor. EGFR\\/HER2 heterodimerization resulted in downstream signaling through the ERK1\\/2 cascade to promote cPLA(2)alpha phosphorylation at Ser505. There was a correlation between HER2 and cPLA(2)alpha expression in six breast cancer cell lines examined, and inhibition of HER2 activation or expression in the SKBR3 cell line using herceptin or HER2-specific small interfering RNA, respectively, resulted in decreased activation and expression of cPLA(2)alpha. Pharmacological blockade of cPLA(2)alpha using a specific antagonist suppressed the growth of both MCF-7 and SKBR3 cells by reducing E2-induced proliferation and by stimulating cellular apoptosis and necrosis. This study highlights cPLAalpha(2) as a potential target for therapeutic intervention in endocrine-dependent and endocrine-independent breast cancer.

  19. Docosahexaenoic Acid Modulates a HER2-Associated Lipogenic Phenotype, Induces Apoptosis, and Increases Trastuzumab Action in HER2-Overexpressing Breast Carcinoma Cells

    OpenAIRE

    Ravacci, Graziela Rosa; Brentani, Maria Mitzi; Tortelli, Tharcisio Citrângulo; Torrinhas, Raquel Suzana M. M.; Santos, Jéssica Reis; Logullo, Angela Flávia; Waitzberg, Dan Linetzky

    2015-01-01

    In breast cancer, lipid metabolic alterations have been recognized as potential oncogenic stimuli that may promote malignancy. To investigate whether the oncogenic nature of lipogenesis closely depends on the overexpression of HER2 protooncogene, the normal breast cell line, HB4a, was transfected with HER2 cDNA to obtain HER2-overexpressing HB4aC5.2 cells. Both cell lines were treated with trastuzumab and docosahexaenoic acid. HER2 overexpression was accompanied by an increase in the expressi...

  20. Overexpression of ETV4 protein in triple-negative breast cancer is associated with a higher risk of distant metastasis

    Directory of Open Access Journals (Sweden)

    Yuan ZY

    2014-09-01

    Full Text Available Zhong-Yu Yuan,1–3,* Ting Dai,1,2,* Shu-Sen Wang,1–3 Rou-Jun Peng,1–3 Xing-Hua Li,1,2 Tao Qin,1–3 Li-Bing Song,1,2 Xi Wang1,2,41State Key Laboratory of Oncology in South China, Guangzhou, People's Republic of China; 2Collaborative Innovation Center for Cancer Medicine, Guangzhou, People's Republic of China; 3Department of Medical Oncology, Sun Yat-Sen University Cancer Center, Guangzhou, People's Republic of China; 4Department of Breast Oncology, Sun Yat-Sen University Cancer Center, Guangzhou, People's Republic of China  *These authors contributed equally to this work Background: Patients with triple-negative breast cancer (TNBC present a higher probability of distant metastasis and lack of effective targeted therapy. ETS translocation variant 4 (ETV4 is an ETS (E-26 transcription factor and has been associated with tumor metastasis. However, the clinical and functional significance of ETV4 in TNBC still remains unclear. Methods: A human tumor metastasis polymerase chain reaction array was used to profile differential expression of tumor metastasis-related genes in TNBC tissue. Real-time reverse transcription and Western blot analyses were performed to verify ETV4 expression in TNBC cells and tissue. Immunohistochemistry was used to detect expression of ETV4 protein in 135 TNBC tissue samples for association between ETV4 protein expression and clinical outcomes. Results: A total total of eight upregulated (CCL7, KISS1, MET, MMP7, NR4A3, ETV4, TIMP3, and TSHR and three downregulated (ITGA7, SSTR, and MMP2 genes were identified between TNBC tissue and the luminal subtype of breast cancer tissue. ETV4 messenger ribonucleic acid was more than five-fold upregulated in TNBC tissue compared with the control tissue. ETV4 overexpression was found in 57.0% of 135 TNBC cases. Overexpression of ETV4 protein was associated with an advanced stage and a higher proportion of positive lymph node and lymphovascular invasion. Patients with an ETV4

  1. http://www.bioline.org.br/js 37 The Prevalence Overexpression Of C ...

    African Journals Online (AJOL)

    jen

    The Prevalence Overexpression Of C-Erbb-2 Oncoprotein In Carcinoma Of The Prostate-. Mulago Hospital. R. Alenyo1, M. Odida2, S Watya1. 1Department of Surgery, 2Department of Pathology, Makerere University, Kampala – Uganda. Correpondence to: Dr. Rose Alenyo, Email: Rose Alenyo ,.

  2. In vivo examination of {sup 188}Re(I)-tricarbonyl-labeled trastuzumab to target HER2-overexpressing breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chen, K.-T. [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Hsinchu 30013, Taiwan (China); Lee, T.-W. [Institute of Nuclear Energy Research, Longtan 32546, Taiwan (China); Lo, Jem-Mau [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Hsinchu 30013, Taiwan (China); Institute of Nuclear Engineering and Science, National Tsing Hua University, Hsinchu 30013, Taiwan (China)], E-mail: jmlo@mx.nthu.edu.tw

    2009-05-15

    Introduction: Trastuzumab (Herceptin), a humanized IgG1 monoclonal antibody directed against the extracellular domain of the HER2 protein, acts as an immunotherapeutic agent for HER2-overexpressing human breast cancers. Radiolabeled trastuzumab with {beta}- or {alpha} emitters can be used as radioimmunotherapeutic agent for the similar purpose but with additional radiation effect. Methods: In this study, trastuzumab was labeled with {sup 188}Re for radioimmunotherapy of HER2/neu-positive breast cancer. {sup 188}Re(I)-tricarbonyl ion, [{sup 188}Re(OH{sub 2}){sub 3}(CO){sub 3}]{sup +}, was employed as a precursor for directly labeling the monoclonal antibody with {sup 188}Re. The immunoreactivity of {sup 188}Re(I)-trastuzumab was estimated by competition receptor-binding assay using HER2/neu-overexpressive BT-474 human breast cancer cells. The localization properties of {sup 188}Re(I)-trastuzumab within both tumor and normal tissues of athymic mice bearing BT-474 human breast cancer xenografts (HER2/neu-overexpressive) and similar mice bearing MCF-7 human breast cancer xenografts (HER2/neu-low expressive) were investigated. Results: When incubated with human serum albumin and histidine at 25{sup o}C, {sup 188}Re(I)-trastuzumab was found to be stable within 24 h. The IC{sub 50} of {sup 188}Re(I)-trastuzumab was found to be 22.63{+-}4.57 nM. {sup 188}Re(I)-trastuzumab was shown to accumulate specifically in BT-474 tumor tissue in in vivo biodistribution studies. By microSPECT/CT, the image of {sup 188}Re localized BT-474 tumor was clearly visualized within 24 h. In contrast, {sup 188}Re(I)-trastuzumab uptake in HER2-low-expressing MCF-7 tumor was minimal, and the {sup 188}Re image at the localization of the tumor was dim. Conclusion: These results reveal that {sup 188}Re(I)-trastuzumab could be an appropriate radioimmunotherapeutic agent for the treatment of HER2/neu-overexpressing cancers.

  3. Poly(ADP-ribose polymerase 1 (PARP1 overexpression in human breast cancer stem cells and resistance to olaparib.

    Directory of Open Access Journals (Sweden)

    Marine Gilabert

    Full Text Available BACKGROUND: Breast cancer stem cells (BCSCs have been recognized as playing a major role in various aspects of breast cancer biology. To identify specific biomarkers of BCSCs, we have performed comparative proteomics of BCSC-enriched and mature cancer cell populations from the human breast cancer cell line (BCL, BrCA-MZ-01. METHODS: ALDEFLUOR assay was used to sort BCSC-enriched (ALDH+ and mature cancer (ALDH- cell populations. Total proteins were extracted from both fractions and subjected to 2-Dimensional Difference In-Gel Electrophoresis (2-D DIGE. Differentially-expressed spots were excised and proteins were gel-extracted, digested and identified using MALDI-TOF MS. RESULTS: 2-D DIGE identified poly(ADP-ribose polymerase 1 (PARP1 as overexpressed in ALDH+ cells from BrCA-MZ-01. This observation was confirmed by western blot and extended to four additional human BCLs. ALDH+ cells from BRCA1-mutated HCC1937, which had the highest level of PARP1 overexpression, displayed resistance to olaparib, a specific PARP1 inhibitor. CONCLUSION: An unbiased proteomic approach identified PARP1 as upregulated in ALDH+, BCSC-enriched cells from various human BCLs, which may contribute to clinical resistance to PARP inhibitors.

  4. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2.

    Science.gov (United States)

    Slamon, D J; Leyland-Jones, B; Shak, S; Fuchs, H; Paton, V; Bajamonde, A; Fleming, T; Eiermann, W; Wolter, J; Pegram, M; Baselga, J; Norton, L

    2001-03-15

    The HER2 gene, which encodes the growth factor receptor HER2, is amplified and HER2 is overexpressed in 25 to 30 percent of breast cancers, increasing the aggressiveness of the tumor. We evaluated the efficacy and safety of trastuzumab, a recombinant monoclonal antibody against HER2, in women with metastatic breast cancer that overexpressed HER2. We randomly assigned 234 patients to receive standard chemotherapy alone and 235 patients to receive standard chemotherapy plus trastuzumab. Patients who had not previously received adjuvant (postoperative) therapy with an anthracycline were treated with doxorubicin (or epirubicin in the case of 36 women) and cyclophosphamide alone (138 women) or with trastuzumab (143 women). Patients who had previously received adjuvant anthracycline were treated with paclitaxel alone (96 women) or paclitaxel with trastuzumab (92 women). The addition of trastuzumab to chemotherapy was associated with a longer time to disease progression (median, 7.4 vs. 4.6 months; P<0.001), a higher rate of objective response (50 percent vs. 32 percent, P<0.001), a longer duration of response (median, 9.1 vs. 6.1 months; P<0.001), a lower rate of death at 1 year (22 percent vs. 33 percent, P=0.008), longer survival (median survival, 25.1 vs. 20.3 months; P=0.01), and a 20 percent reduction in the risk of death. The most important adverse event was cardiac dysfunction of New York Heart Association class III or IV, which occurred in 27 percent of the group given an anthracycline, cyclophosphamide, and trastuzumab; 8 percent of the group given an anthracycline and cyclophosphamide alone; 13 percent of the group given paclitaxel and trastuzumab; and 1 percent of the group given paclitaxel alone. Although the cardiotoxicity was potentially severe and, in some cases, life-threatening, the symptoms generally improved with standard medical management. Trastuzumab increases the clinical benefit of first-line chemotherapy in metastatic breast cancer that

  5. XIAP over-expression is an independent poor prognostic marker in Middle Eastern breast cancer and can be targeted to induce efficient apoptosis.

    Science.gov (United States)

    Hussain, Azhar R; Siraj, Abdul Khalid; Ahmed, Maqbool; Bu, Rong; Pratheeshkumar, Poyil; Alrashed, Alanood M; Qadri, Zeeshan; Ajarim, Dahish; Al-Dayel, Fouad; Beg, Shaham; Al-Kuraya, Khawla S

    2017-09-11

    Breast cancer is the most common cancer in females and is ranked second in cancer-related deaths all over the world in women. Despite improvement in diagnosis, the survival rate of this disease has still not improved. X-linked Inhibitor of Apoptosis (XIAP) has been shown to be over-expressed in various cancers leading to poor overall survival. However, the role of XIAP in breast cancer from Middle Eastern region has not been fully explored. We examined the expression of XIAP in more than 1000 Middle Eastern breast cancer cases by immunohistochemistry. Apoptosis was measured by flow cytometry. Protein expression was determined by western blotting. Finally, in vivo studies were performed on nude mice following xenografting and treatment with inhibitors. XIAP was found to be over-expressed in 29.5% of cases and directly associated with clinical parameters such as tumor size, extra nodal extension, triple negative breast cancer and poorly differentiated breast cancer subtype. In addition, XIAP over-expression was also significantly associated with PI3-kinase pathway protein; p-AKT, proliferative marker; Ki-67 and anti-apoptotic marker; PARP. XIAP over-expression in our cohort of breast cancer was an independent poor prognostic marker in multivariate analysis. Next, we investigated inhibition of XIAP using a specific inhibitor; embelin and found that embelin treatment led to inhibition of cell viability and induction of apoptosis in breast cancer cells. Finally, breast cancer cells treated with combination of embelin and PI3-kinase inhibitor; LY294002 synergistically induced apoptosis and caused tumor growth regression in vivo. These data suggest that XIAP may be playing an important role in the pathogenesis of breast cancer and can be therapeutically targeted either alone or in combination with PI3-kinase inhibition to induce efficient apoptosis in breast cancer cells.

  6. Prostate-Derived Ets Transcription Factor Overexpression is Associated with Nodal Metastasis, Hormone Receptor Positivity in Invasive Breast Cancer

    Directory of Open Access Journals (Sweden)

    Simon Turcotte

    2007-10-01

    Full Text Available Prostate-derived Ets transcription factor (PDEF has recently been associated with invasive breast cancer, but no expression profile has been defined in clinical specimens. We undertook a comprehensive PDEF transcriptional expression study of 86 breast cancer clinical specimens, several cell lines, normal tissues. PDEF expression profile was analyzed according to standard clinicopathologic parameters, compared with hormonal receptor, HER-2/neu status, to the expression of the new tumor biomarker Dikkopf-1 (DKK1. Wide ranging PDEF overexpression was observed in 74% of tested tumors, at higher levels than the average expression found in normal breasts. High PDEF expression was associated with hormone receptor positivity (P < .001, moderate to good differentiation (less than grade III, P = .01, dissemination to axillary lymph nodes (P = .002. PDEF was an independent risk factor for nodal involvement (multivariate analysis, odds ratio 1.250, P = .002. It was expressed in a different subgroup compared to DKK1-expressing tumors (P < .001. Our data imply that PDEF mRNA expression could be useful in breast cancer molecular staging. Further insights into PDEF functions at the protein level, possible links with hormone receptors biology, bear great potential for new therapeutic avenues.

  7. Disruption of ERBB2IP is not associated with dystrophic epidermolysis bullosa in both father and son carrying a balanced 5;13 translocation.

    Science.gov (United States)

    Stefanova, Margarita; Zemke, Katrin; Dimitrov, Boyan; Has, Christina; Kern, Johannes S; Bruckner-Tuderman, Leena; Kutsche, Kerstin

    2005-10-01

    Mutations in the type VII collagen gene (COL7A1) cause autosomal recessive and autosomal dominant inherited dystrophic epidermolysis bullosa (DEB). We report a family with three individuals who present blistering, scarring, hypo- and hyperpigmentation, and nail dystrophy suggestive for DEB. Whereas father and son carry a 5;13 translocation, the daughter shows a normal karyotype. Segregation analysis revealed that all affected family members inherited the same COL7A1 allele. Mutation analysis disclosed a heterozygous missense mutation, c.6227G > A (p.G2076D), in COL7A1 in all affected individuals. Delineation of the translocation breakpoints showed that the ERBB2IP (erbb2 interacting protein or Erbin) gene is disrupted in 5q13.1 and GPC6 in 13q32. GPC6 encodes glypican 6 belonging to a family of cell surface heparan sulfate proteoglycans. The binding partners of Erbin, BP230 (BPAG1) and the integrin beta4 subunit, both involved in hemidesmosome (HD) function, and the presence of Erbin in HD suggested that it plays a role in establishment and maintenance of cell-basement membrane adhesions. However, loss of function of one ERBB2IP copy or expression of a putative novel ERBB2IP fusion protein did not apparently modulate the DEB phenotype in both translocation patients. Nonetheless, one cannot yet exclude that ERBB2IP is a candidate for human blistering disorders such as epidermolysis bullosa.

  8. RUNX1 positively regulates the ErbB2/HER2 signaling pathway through modulating SOS1 expression in gastric cancer cells.

    Science.gov (United States)

    Mitsuda, Yoshihide; Morita, Ken; Kashiwazaki, Gengo; Taniguchi, Junichi; Bando, Toshikazu; Obara, Moeka; Hirata, Masahiro; Kataoka, Tatsuki R; Muto, Manabu; Kaneda, Yasufumi; Nakahata, Tatsutoshi; Liu, Pu Paul; Adachi, Souichi; Sugiyama, Hiroshi; Kamikubo, Yasuhiko

    2018-04-23

    The dual function of runt-related transcriptional factor 1 (RUNX1) as an oncogene or oncosuppressor has been extensively studied in various malignancies, yet its role in gastric cancer remains elusive. Up-regulation of the ErbB2/HER2 signaling pathway is frequently-encountered in gastric cancer and contributes to the maintenance of these cancer cells. This signaling cascade is partly mediated by son of sevenless homolog (SOS) family, which function as adaptor proteins in the RTK cascades. Herein we report that RUNX1 regulates the ErbB2/HER2 signaling pathway in gastric cancer cells through transactivating SOS1 expression, rendering itself an ideal target in anti-tumor strategy toward this cancer. Mechanistically, RUNX1 interacts with the RUNX1 binding DNA sequence located in SOS1 promoter and positively regulates it. Knockdown of RUNX1 led to the decreased expression of SOS1 as well as dephosphorylation of ErbB2/HER2, subsequently suppressed the proliferation of gastric cancer cells. We also found that our novel RUNX inhibitor (Chb-M') consistently led to the deactivation of the ErbB2/HER2 signaling pathway and was effective against several gastric cancer cell lines. Taken together, our work identified a novel interaction of RUNX1 and the ErbB2/HER2 signaling pathway in gastric cancer, which can potentially be exploited in the management of this malignancy.

  9. Overview of the trastuzumab (Herceptin) anti-HER2 monoclonal antibody clinical program in HER2-overexpressing metastatic breast cancer. Herceptin Multinational Investigator Study Group.

    Science.gov (United States)

    Shak, S

    1999-08-01

    The recombinant humanized anti-HER2 monoclonal antibody trastuzumab (Herceptin; Genentech, San Francisco, CA) was evaluated in human clinical trials for treatment of women with metastatic breast cancer who have tumors that overexpress HER2. The trastuzumab clinical program consisted of a series of phase I, phase II, and phase III clinical trials. Clinical experience with this novel biologic has been obtained in more than 1,000 women with HER2-overexpressing metastatic breast cancer. Two pivotal trials were performed to evaluate trastuzumab efficacy and safety: (1) trastuzumab in combination with chemotherapy as first-line therapy and (2) trastuzumab as a single agent in second- and third-line chemotherapy. Preliminary results of the pivotal clinical trials that have been presented at national meetings are summarized below. The data suggest that trastuzumab will be an important new treatment option for women with HER2-overexpressing metastatic breast cancer.

  10. The negative cell cycle regulator, Tob (transducer of ErbB-2), is involved in motor skill learning

    International Nuclear Information System (INIS)

    Wang Xinming; Gao Xiang; Zhang Xuehan; Tu Yanyang; Jin Meilei; Zhao Guoping; Yu Lei; Jing Naihe; Li Baoming

    2006-01-01

    Tob (transducer of ErbB-2) is a negative cell cycle regulator with anti-proliferative activity in peripheral tissues. Our previous study identified Tob as a protein involved in hippocampus-dependent memory consolidation (M.L. Jin, X.M. Wang, Y.Y. Tu, X.H. Zhang, X. Gao, N. Guo, Z.Q. Xie, G.P. Zhao, N.H. Jing, B.M. Li, Y.Yu, The negative cell cycle regulator, Tob (Transducer of ErbB-2), is a multifunctional protein involved in hippocampus-dependent learning and memory, Neuroscience 131 (2005) 647-659). Here, we provide evidence that Tob in the central nervous system is engaged in acquisition of motor skill. Tob has a relatively high expression in the cerebellum. Tob expression is up-regulated in the cerebellum after rats receive training on a rotarod-running task. Rats infused with Tob antisense oligonucleotides into the 4th ventricle exhibit a severe deficit in running on a rotating rod or walking across a horizontally elevated beam

  11. Overexpression of p65 attenuates celecoxib-induced cell death in MDA-MB-231 human breast cancer cell line

    Directory of Open Access Journals (Sweden)

    Wang Ling

    2013-02-01

    Full Text Available Abstract Background Celecoxib is a selective cyclooxygenase (COX-2 inhibitor that has been reported to reduce the risk of breast cancer. In our previous study, celecoxib induced apoptosis and caused cell cycle arrest at the G0/G1 phase in the breast cancer cell line MDA-MB-231, and its effects were mediated by downregulation of NF-κB signaling. The NF-κB p65/RelA subunit may play a role in cell death through the activation of anti-apoptotic target genes including the inhibitor of apoptosis (IAP and Bcl-2 families, and inhibition of protein kinase B/Akt. The aim of the present study was to investigate p65 as the potential target of celecoxib treatment and determine whether p65 overexpression can override the inhibitory effect of celecoxib on NF-κB activity and affect cell survival. Methods The effects of p65 overexpression on celecoxib-inhibited NF-κB transcriptional activity were examined by western blotting, electrophoretic mobility shift assay (EMSA and luciferase reporter gene assay. Cell viability and cell death were evaluated by the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazoliumbromide (MTT assay, and the levels of cleaved poly(ADP-ribose polymerase (PARP and caspase. Anti-apoptotic NF-κB target genes and cell cycle regulators were examined by western blotting to screen for the expression of target genes under direct regulation by p65. Results Overexpression of p65 increased NF-κB transcriptional activity and interfered with celecoxib-mediated apoptosis as assessed by MTT assay and caspase-3, caspase-9, and PARP expressions. Exogenously overexpressed p65 upregulated NF-κB-responsive genes, including anti-apoptotic genes such as survivin and XIAP, and the cell cycle regulatory gene cyclin D1. However, p65 overexpression did not affect celecoxib-induced p-Akt inactivation, suggesting that celecoxib might have separate molecular mechanisms for regulating Akt signaling independently of its inhibition of NF-κB transcriptional

  12. Overexpression of KCNJ3 gene splice variants affects vital parameters of the malignant breast cancer cell line MCF-7 in an opposing manner.

    Science.gov (United States)

    Rezania, S; Kammerer, S; Li, C; Steinecker-Frohnwieser, B; Gorischek, A; DeVaney, T T J; Verheyen, S; Passegger, C A; Tabrizi-Wizsy, N Ghaffari; Hackl, H; Platzer, D; Zarnani, A H; Malle, E; Jahn, S W; Bauernhofer, T; Schreibmayer, W

    2016-08-12

    Overexpression the KCNJ3, a gene that encodes subunit 1 of G-protein activated inwardly rectifying K(+) channel (GIRK1) in the primary tumor has been found to be associated with reduced survival times and increased lymph node metastasis in breast cancer patients. In order to survey possible tumorigenic properties of GIRK1 overexpression, a range of malignant mammary epithelial cells, based on the MCF-7 cell line that permanently overexpress different splice variants of the KCNJ3 gene (GIRK1a, GIRK1c, GIRK1d and as a control, eYFP) were produced. Subsequently, selected cardinal neoplasia associated cellular parameters were assessed and compared. Adhesion to fibronectin coated surface as well as cell proliferation remained unaffected. Other vital parameters intimately linked to malignancy, i.e. wound healing, chemoinvasion, cellular velocities / motilities and angiogenesis were massively affected by GIRK1 overexpression. Overexpression of different GIRK1 splice variants exerted differential actions. While GIRK1a and GIRK1c overexpression reinforced the affected parameters towards malignancy, overexpression of GIRK1d resulted in the opposite. Single channel recording using the patch clamp technique revealed functional GIRK channels in the plasma membrane of MCF-7 cells albeit at very low frequency. We conclude that GIRK1d acts as a dominant negative constituent of functional GIRK complexes present in the plasma membrane of MCF-7 cells, while overexpression of GIRK1a and GIRK1c augmented their activity. The core component responsible for the cancerogenic action of GIRK1 is apparently presented by a segment comprising aminoacids 235-402, that is present exclusively in GIRK1a and GIRK1c, but not GIRK1d (positions according to GIRK1a primary structure). The current study provides insight into the cellular and molecular consequences of KCNJ3 overexpression in breast cancer cells and the mechanism upon clinical outcome in patients suffering from breast cancer.

  13. Current therapeutic strategies of anti-HER2 treatment in advanced breast cancer patients

    Directory of Open Access Journals (Sweden)

    Joanna Huszno

    2016-03-01

    Full Text Available The HER2/neu ( ERBB2 oncogene is amplified and/or overexpressed in approximately 20% of breast cancers, and is a strong prognostic factor for relapse and poor overall survival, particularly in node-positive patients. It is also an important predictor for response to trastuzumab, which has established efficacy against breast cancer with overexpression or amplification of the HER2 oncogene. Treatment with the anti-HER2 humanized monoclonal antibody – trastuzumab significantly improves progression-free and overall survival among patients with HER2-positive breast cancer. However, in most patients with HER2-positive metastatic breast cancer, the disease progresses occurred, what cause the need for new targeted therapies for advanced disease. In clinical trials, there are tested new drugs to improve the results of treatment for this group of patients. This paper presents new drugs introduced into clinical practice for treatment of advanced breast cancer, whose molecular target are receptors of the HER2 family. In addition, new therapeutic strategies and drugs that are currently in clinical researches are discussed.

  14. Characterization of MCF mammary epithelial cells overexpressing the Arylhydrocarbon receptor (AhR)

    International Nuclear Information System (INIS)

    Wong, Patrick S; Li, Wen; Vogel, Christoph F; Matsumura, Fumio

    2009-01-01

    Recent reports indicate the existence of breast cancer cells expressing very high levels of the Arylhydrocarbon receptor (AhR), a ubiquitous intracellular receptor best known for mediating toxic action of dioxin and related pollutants. Positive correlation between the degree of AhR overexpression and states of increasing transformation of mammary epithelial cells appears to occur in the absence of any exogenous AhR ligands. These observations have raised many questions such as why and how AhR is overexpressed in breast cancer and its physiological roles in the progression to advanced carcinogenic transformation. To address those questions, we hypothesized that AhR overexpression occurs in cells experiencing deficiencies in normally required estrogen receptor (ER) signaling, and the basic role of AhR in such cases is to guide the affected cells to develop orchestrated cellular changes aimed at substituting the normal functions of ER. At the same time, the AhR serves as the mediator of the cell survival program in the absence of ER signaling. We subjected two lines of Michigan Cancer Foundation (MCF) mammary epithelial cells to 3 different types ER interacting agents for a number of passages and followed the changes in the expression of AhR mRNA. The resulting sublines were analyzed for phenotypical changes and unique molecular characteristics. MCF10AT1 cells continuously exposed to 17-beta-estradiol (E2) developed sub-lines that show AhR overexpression with the characteristic phenotype of increased proliferation, and distinct resistance to apoptosis. When these chemically selected cell lines were treated with a specific AhR antagonist, 3-methoxy-4-nitroflavone (MNF), both of the above abnormal cellular characteristics disappeared, indicating the pivotal role of AhR in expressing those cellular phenotypes. The most prominent molecular characteristics of these AhR overexpressing MCF cells were found to be overexpression of ErbB2 and COX-2. Furthermore, we could

  15. Neuroligin 4X overexpression in human breast cancer is associated with poor relapse-free survival.

    Directory of Open Access Journals (Sweden)

    Henry J Henderson

    Full Text Available The molecular mechanisms involved in breast cancer progression and metastasis still remain unclear to date. It is a heterogeneous disease featuring several different phenotypes with consistently different biological characteristics. Neuroligins are neural cell adhesion molecules that have been implicated in heterotopic cell adhesion. In humans, alterations in neuroligin genes are implicated in autism and other cognitive diseases. Until recently, neuroligins have been shown to be abundantly expressed in blood vessels and also play a role implicated in the growth of glioma cells. Here we report increased expression of neuroligin 4X (NLGN4X in breast cancer. We found NLGN4X was abundantly expressed in breast cancer tissues. NLGN4X expression data for all breast cancer cell lines in the Cancer Cell Line Encyclopedia (CCLE was analyzed. Correlation between NLGN4X levels and clinicopathologic parameters were analyzed within Oncomine datasets. Evaluation of these bioinfomatic datasets results revealed that NLGN4X expression was higher in triple negative breast cancer cells, particularly the basal subtype and tissues versus non-triple-negative sets. Its level was also observed to be higher in metastatic tissues. RT-PCR, flow cytometry and immunofluorescence study of MDA-MB-231 and MCF-7 breast cancer cells validated that NLGN4X was increased in MDA-MB-231. Knockdown of NLGN4X expression by siRNA decreased cell proliferation and migration significantly in MDA-MB-231 breast cancer cells. NLGN4X knockdown in MDA-MB-231 cells resulted in induction of apoptosis as determined by annexin staining, elevated caspase 3/7 and cleaved PARP by flow cytometry. High NLGN4X expression highly correlated with decrease in relapse free-survival in TNBC. NLGN4X might represent novel biomarkers and therapeutic targets for breast cancer. Inhibition of NLGN4X may be a new target for the prevention and treatment of breast cancer.

  16. The dog as a naturally-occurring model for insulin-like growth factor type 1 receptor-overexpressing breast cancer: an observational cohort study

    International Nuclear Information System (INIS)

    Jaillardon, Laetitia; Abadie, Jérome; Godard, Tiffanie; Campone, Mario; Loussouarn, Delphine; Siliart, Brigitte; Nguyen, Frédérique

    2015-01-01

    Dogs spontaneously develop invasive mammary carcinoma with a high prevalence of the triple-negative (TN) subtype (lack of ER-Estrogen Receptor and PR-Progesterone Receptor expression, lack of HER2-Human Epidermal Growth Factor Receptor 2 overexpression), making this animal model relevant for investigating new therapeutic pathways. Insulin-like growth factor Type-1 receptor (IGF1R) is frequently overexpressed in primary human breast cancers, with a growing role in the TN phenotype. The purpose of this study was to investigate the Dog as a candidate model for IGF1R-overexpressing mammary carcinoma. 150 bitches with canine mammary carcinoma (CMC) and a known 2-year follow-up were retrospectively included. IGF1R expression was assessed by immunohistochemistry (IHC) using a similar scoring system as for HER2 in breast cancer. The prognostic value of the IGF1R expression was assessed in terms of overall and specific survival as well as disease-free interval (DFI). 47 CMC (31 %) were classified as luminal and 103 (69 %) as triple-negative (TN-CMC). 41 % of CMC overexpressed IGF1R (IHC score 3+) of which 76 % were TN-CMC and 62 % grade III. IGF1R overexpression was associated with aggressive features including lymphovascular invasion, histological grade III, low ER expression and the TN phenotype. Univariate and multivariate analyses revealed that IGF1R overexpression was associated with shorter overall and specific survivals and shorter DFI in TN-CMC. IGF1R overexpression is common and related to a poor outcome in canine invasive mammary carcinoma, particularly in the triple negative subtype, as in human breast cancer. Preclinical studies using the Dog as a spontaneous animal model could be considered to investigate new therapies targeting IGF1R in triple-negative breast cancer. The online version of this article (doi:10.1186/s12885-015-1670-6) contains supplementary material, which is available to authorized users

  17. Promoter Regions Determining Over-Expression of Metalloproteinase Genes in Breast Cancer

    National Research Council Canada - National Science Library

    Lyons, James

    2000-01-01

    .... It was determined that breast cancer cells can be classified into two types: one type retains its epithelial characteristics, the other has lost them by undergoing an epithelial-mesenchymal transition (EMT...

  18. Promoter Regions Determining Over-expression of Metalloproteinase Genes in Breast Cancer

    National Research Council Canada - National Science Library

    Lyons, James

    2001-01-01

    .... It was determined that breast cancer cells can be classified into two types: one type retains its epithelial characteristics, the other has lost them by undergoing an epithelial-mesenchymal transition (EMT...

  19. Examining the protective role of ErbB2 modulation in human-induced pluripotent stem cell-derived cardiomyocytes.

    Science.gov (United States)

    Eldridge, Sandy; Guo, Liang; Mussio, Jodie; Furniss, Mike; Hamre, John; Davis, Myrtle

    2014-10-01

    Human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are being used as an in vitro model system in cardiac biology and in drug discovery (e.g., cardiotoxicity testing). Qualification of these cells for use in mechanistic investigations will require detailed evaluations of cardiomyocyte signaling pathways and cellular responses. ErbB signaling and the ligand neuregulin play critical roles in survival and functional integrity of cardiac myocytes. As such, we sought to characterize the expression and activity of the ErbB family of receptors. Antibody microarray analysis performed on cell lysates derived from maturing hiPSC-CMs detected expression of ∼570 signaling proteins. EGFR/ErbB1, HER2/ErbB2, and ErbB4, but not ErbB3 receptors, of the epidermal growth factor receptor family were confirmed by Western blot. Activation of ErbB signaling by neuregulin-1β (NRG, a natural ligand for ErbB4) and its modulation by trastuzumab (a monoclonal anti-ErbB2 antibody) and lapatinib (a small molecule ErbB2 tyrosine kinase inhibitor) were evaluated through assessing phosphorylation of AKT and Erk1/2, two major downstream kinases of ErbB signaling, using nanofluidic proteomic immunoassay. Downregulation of ErbB2 expression by siRNA silencing attenuated NRG-induced AKT and Erk1/2 phosphorylation. Activation of ErbB signaling with NRG, or inhibition with trastuzumab, alleviated or aggravated doxorubicin-induced cardiomyocyte damage, respectively, as assessed by a real-time cellular impedance analysis and ATP measurement. Collectively, these results support the expanded use of hiPSC-CMs to examine mechanisms of cardiotoxicity and support the value of using these cells in early assessments of cardiotoxicity or efficacy. Published by Oxford University Press on behalf of Toxicological Sciences 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  20. The Potential Utility of Curcumin in the Treatment of HER-2-Overexpressed Breast Cancer: An In Vitro and In Vivo Comparison Study with Herceptin

    Directory of Open Access Journals (Sweden)

    Hung-Wen Lai

    2012-01-01

    Full Text Available HER-2 is an important oncoprotein overexpressed in about 15–25% of breast cancers. We hypothesized that the ability of curcumin to downregulate HER-2 oncoprotein and inhibit the signal transduction pathway of PI3K/Akt, MAPK, and NF-κB activation may be important in the treatment of HER-2-overexpressed breast cancer. To examine the effect of curcumin on breast cancer cells, MCF-7, MDA-MB-231, MCF-10A, BT-474, and SK-BR-3-hr (a herceptin resistant strain from SK-BR-3 cells were used for in vitro analysis. The in vivo effect of curcumin on HER-2-overexpressed breast cancer was investigated with the HER-2-overexpressed BT-474 xenograft model. Cell growth, cell cycle change, the antimobility effect, signal transduction, and xenograft volume analysis between groups treated with herceptin and/or curcumin were tested. Curcumin decreased the cell growth of various breast cancer cell lines (MCF-7, MDA-MB-231, MCF-10A, BT-474, and SK-BR-3-hr. In Western blot analysis, the phosphorylation of Akt, MAPK, and expression of NF-κB were reduced in BT-474 cells, but not in SK-BR-3-hr cells, after treatment with herceptin. When treated with curcumin, the HER-2 oncoprotein, phosphorylation of Akt, MAPK and expression of NF-κB were decreased in both BT-474 and SK-BR-3-hr cells. In the BT-474 xenograft model, though not as much as herceptin, curcumin did effectively decrease the tumor size. The combination of curcumin with herceptin was not better than herceptin alone; however, the combination of taxol and curcumin had an antitumor effect comparable with taxol and herceptin. The results suggested that curcumin has potential as a treatment for HER-2-overexpressed breast cancer.

  1. Brain metastases from breast cancer: prognostic significance of HER-2 overexpression, effect of trastuzumab and cause of death

    International Nuclear Information System (INIS)

    Le Scodan, Romuald; Jouanneau, Ludivine; Massard, Christophe; Gutierrez, Maya; Kirova, Youlia; Cherel, Pascal; Gachet, Julie; Labib, Alain; Mouret-Fourme, Emmanuelle

    2011-01-01

    To access the prognostic significance of HER-2 overexpression, the effect of trastuzumab and the cause of death in patients with brain metastases (BM) from breast cancer (BC). We analyzed the outcome of 130 patients with BM from BC who received whole-brain radiotherapy (WBRT) (without surgery or radiosurgery) between January 1998 and April 2006. Demographic data, tumor characteristics, and treatments were prospectively recorded. The impact of HER-2 overexpression and trastuzumab-based therapy on overall survival (OS) and the cause of death were evaluated. The median follow-up for the whole population was 6.25 months (mean: 9.15; range: 0.23-53). The median survival time and 1-year survival rates after BM diagnosis were 7.43 months and 35.8% (95% CI: 28-45.7) respectively. The median survival time for HER-2 negative patients (n = 78), HER-2 positive patients not treated with trastuzumab (n = 20) and HER-2 positive patients treated with trastuzumab (n = 32) were 5.9 months, 5.6 months and 19.53 months, respectively. The 1-year survival rates were 26.1%, 29.2% and 62.6% respectively, (p < 0.004). Among the 18 HER-2 positive patients treated with trastuzumab who died, 11 (61%) apparently succumbed from CNS progression, in the face of stable or responsive non-CNS disease. Trastuzumab-based therapy was associated with a 51% reduction in the risk of death (multiadjusted hazard ratio: 0.49; 95% CI, 0.29-0.83). In our experience, trastuzumab-based therapy for HER-overexpressing tumors was associated with improved survival in BM BC patients. This subgroup of patients may benefit from innovative approaches, in order to obtain better intra cerebral control

  2. LOXL2 induces aberrant acinar morphogenesis via ErbB2 signaling

    DEFF Research Database (Denmark)

    Chang, Joan; Nicolau, Monica; Cox, Thomas R

    2013-01-01

    Lysyl oxidase-like 2 (LOXL2) is a matrix remodeling enzyme that has been shown to play a key role in invasion and metastasis of breast carcinoma cells. However, very little is known about its role in normal tissue homeostasis. Here, we investigate the effects of LOXL2 expression in normal mammary...... epithelial cells in order to gain insight into how LOXL2 mediates cancer progression....

  3. Translation elongation factor eEF1A2 is a potential oncoprotein that is overexpressed in two-thirds of breast tumours

    Directory of Open Access Journals (Sweden)

    Miller William R

    2005-09-01

    Full Text Available Abstract Background The tissue-specific translation elongation factor eEF1A2 was recently shown to be a potential oncogene that is overexpressed in ovarian cancer. Although there is no direct evidence for an involvement of eEF1A2 in breast cancer, the genomic region to which EEF1A2 maps, 20q13, is frequently amplified in breast tumours. We therefore sought to establish whether eEF1A2 expression might be upregulated in breast cancer. Methods eEF1A2 is highly similar (98% to the near-ubiquitously expressed eEF1A1 (formerly known as EF1-α making analysis with commercial antibodies difficult. We have developed specific anti-eEF1A2 antibodies and used them in immunohistochemical analyses of tumour samples. We report the novel finding that although eEF1A2 is barely detectable in normal breast it is moderately to strongly expressed in two-thirds of breast tumours. This overexpression is strongly associated with estrogen receptor positivity. Conclusion eEF1A2 should be considered as a putative oncogene in breast cancer that may be a useful diagnostic marker and therapeutic target for a high proportion of breast tumours. The oncogenicity of eEF1A2 may be related to its role in protein synthesis or to its potential non-canonical functions in cytoskeletal remodelling or apoptosis.

  4. Translation elongation factor eEF1A2 is a potential oncoprotein that is overexpressed in two-thirds of breast tumours

    International Nuclear Information System (INIS)

    Tomlinson, Victoria AL; Newbery, Helen J; Wray, Naomi R; Jackson, Juliette; Larionov, Alexey; Miller, William R; Dixon, J Michael; Abbott, Catherine M

    2005-01-01

    The tissue-specific translation elongation factor eEF1A2 was recently shown to be a potential oncogene that is overexpressed in ovarian cancer. Although there is no direct evidence for an involvement of eEF1A2 in breast cancer, the genomic region to which EEF1A2 maps, 20q13, is frequently amplified in breast tumours. We therefore sought to establish whether eEF1A2 expression might be upregulated in breast cancer. eEF1A2 is highly similar (98%) to the near-ubiquitously expressed eEF1A1 (formerly known as EF1-α) making analysis with commercial antibodies difficult. We have developed specific anti-eEF1A2 antibodies and used them in immunohistochemical analyses of tumour samples. We report the novel finding that although eEF1A2 is barely detectable in normal breast it is moderately to strongly expressed in two-thirds of breast tumours. This overexpression is strongly associated with estrogen receptor positivity. eEF1A2 should be considered as a putative oncogene in breast cancer that may be a useful diagnostic marker and therapeutic target for a high proportion of breast tumours. The oncogenicity of eEF1A2 may be related to its role in protein synthesis or to its potential non-canonical functions in cytoskeletal remodelling or apoptosis

  5. Intermittent hypoxia induces the proliferation of rat vascular smooth muscle cell with the increases in epidermal growth factor family and erbB2 receptor

    Energy Technology Data Exchange (ETDEWEB)

    Kyotani, Yoji, E-mail: cd147@naramed-u.ac.jp [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Department of Pharmacy, Nara Medical University Hospital, Kashihara 634-8522 (Japan); Ota, Hiroyo [Second Department of Internal Medicine, Nara Medical University School of Medicine, Kashihara 634-8522 (Japan); Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Itaya-Hironaka, Asako; Yamauchi, Akiyo; Sakuramoto-Tsuchida, Sumiyo [Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Zhao, Jing; Ozawa, Kentaro; Nagayama, Kosuke; Ito, Satoyasu [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Takasawa, Shin [Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Kimura, Hiroshi [Second Department of Internal Medicine, Nara Medical University School of Medicine, Kashihara 634-8522 (Japan); Uno, Masayuki [Department of Pharmacy, Nara Medical University Hospital, Kashihara 634-8522 (Japan); Yoshizumi, Masanori [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan)

    2013-11-15

    Obstructive sleep apnea is characterized by intermittent hypoxia (IH), and associated with cardiovascular diseases, such as stroke and heart failure. These cardiovascular diseases have a relation to atherosclerosis marked by the proliferation of vascular smooth muscle cells (VSMCs). In this study, we investigated the influence of IH on cultured rat aortic smooth muscle cell (RASMC). The proliferation of RASMC was significantly increased by IH without changing the level of apoptosis. In order to see what induces RASMC proliferation, we investigated the influence of normoxia (N)-, IH- and sustained hypoxia (SH)-treated cell conditioned media on RASMC proliferation. IH-treated cell conditioned medium significantly increased RASMC proliferation compared with N-treated cell conditioned medium, but SH-treated cell conditioned medium did not. We next investigated the epidermal growth factor (EGF) family as autocrine growth factors. Among the EGF family, we found significant increases in mRNAs for epiregulin (ER), amphiregulin (AR) and neuregulin-1 (NRG1) in IH-treated cells and mature ER in IH-treated cell conditioned medium. We next investigated the changes in erbB family receptors that are receptors for ER, AR and NRG1, and found that erbB2 receptor mRNA and protein expressions were increased by IH, but not by SH. Phosphorylation of erbB2 receptor at Tyr-1248 that mediates intracellular signaling for several physiological effects including cell proliferation was increased by IH, but not by SH. In addition, inhibitor for erbB2 receptor suppressed IH-induced cell proliferation. These results provide the first demonstration that IH induces VSMC proliferation, and suggest that EGF family, such as ER, AR and NRG1, and erbB2 receptor could be involved in the IH-induced VSMC proliferation. - Highlights: ●In vitro system for intermittent hypoxia (IH) and sustained hypoxia (SH). ●IH, but not SH, induces the proliferation of rat vascular smooth muscle cell. ●Epiregulin mRNA and protein are up-regulated in IH, but not in SH. ●IH-induced erbB2 phosphorylation is attenuated by erbB2 inhibitor. ●EGF family and erbB2 receptor may be involved in IH-induced cell proliferation.

  6. Intermittent hypoxia induces the proliferation of rat vascular smooth muscle cell with the increases in epidermal growth factor family and erbB2 receptor

    International Nuclear Information System (INIS)

    Kyotani, Yoji; Ota, Hiroyo; Itaya-Hironaka, Asako; Yamauchi, Akiyo; Sakuramoto-Tsuchida, Sumiyo; Zhao, Jing; Ozawa, Kentaro; Nagayama, Kosuke; Ito, Satoyasu; Takasawa, Shin; Kimura, Hiroshi; Uno, Masayuki; Yoshizumi, Masanori

    2013-01-01

    Obstructive sleep apnea is characterized by intermittent hypoxia (IH), and associated with cardiovascular diseases, such as stroke and heart failure. These cardiovascular diseases have a relation to atherosclerosis marked by the proliferation of vascular smooth muscle cells (VSMCs). In this study, we investigated the influence of IH on cultured rat aortic smooth muscle cell (RASMC). The proliferation of RASMC was significantly increased by IH without changing the level of apoptosis. In order to see what induces RASMC proliferation, we investigated the influence of normoxia (N)-, IH- and sustained hypoxia (SH)-treated cell conditioned media on RASMC proliferation. IH-treated cell conditioned medium significantly increased RASMC proliferation compared with N-treated cell conditioned medium, but SH-treated cell conditioned medium did not. We next investigated the epidermal growth factor (EGF) family as autocrine growth factors. Among the EGF family, we found significant increases in mRNAs for epiregulin (ER), amphiregulin (AR) and neuregulin-1 (NRG1) in IH-treated cells and mature ER in IH-treated cell conditioned medium. We next investigated the changes in erbB family receptors that are receptors for ER, AR and NRG1, and found that erbB2 receptor mRNA and protein expressions were increased by IH, but not by SH. Phosphorylation of erbB2 receptor at Tyr-1248 that mediates intracellular signaling for several physiological effects including cell proliferation was increased by IH, but not by SH. In addition, inhibitor for erbB2 receptor suppressed IH-induced cell proliferation. These results provide the first demonstration that IH induces VSMC proliferation, and suggest that EGF family, such as ER, AR and NRG1, and erbB2 receptor could be involved in the IH-induced VSMC proliferation. - Highlights: ●In vitro system for intermittent hypoxia (IH) and sustained hypoxia (SH). ●IH, but not SH, induces the proliferation of rat vascular smooth muscle cell. ●Epiregulin mRNA and protein are up-regulated in IH, but not in SH. ●IH-induced erbB2 phosphorylation is attenuated by erbB2 inhibitor. ●EGF family and erbB2 receptor may be involved in IH-induced cell proliferation

  7. Mutations in p53, p53 protein overexpression and breast cancer survival

    Czech Academy of Sciences Publication Activity Database

    Rössner ml., Pavel; Gammon, M. D.; Zhang, Y.J.; Terry, M. B.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Gabrowski, G.; Agrawal, M.; Kalra, T.S.; Teitelbaum, S. L.; Neugut, A. I.; Santella, R. M.

    2009-01-01

    Roč. 13, č. 9B (2009), s. 3847-3857 ISSN 1582-1838 Institutional research plan: CEZ:AV0Z50390512 Keywords : Breast cancer * p53 mutations * Survival Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.228, year: 2009

  8. Predicting the Toxicity of Adjuvant Breast Cancer Drug Combination Therapy

    Science.gov (United States)

    2013-03-01

    Neratinib Versus Lapatinib Plus Capecitabine For ErbB2 Positive Advanced Breast Cancer Active, not recruiting No Results Available YES neratinib -9...Drug: Neratinib |Drug: Lapatinib|Drug: Capecitabine Efficacy and Safety of BMS-690514 in Combination With Letrozole to Treat Metastatic Breast Cancer

  9. Overexpression of calreticulin in malignant and benign breast tumors: relationship with humoral immunity

    Czech Academy of Sciences Publication Activity Database

    Eric-Nikolic, A.; Milanovic, Z.; Sánchez, Daniel; Pekáriková, Aneta; Džodic, R.; Matic, I. Z.; Tučková, Ludmila; Jevric, M.; Buta, M.; Raškovic, S.; Juranic, Z.

    2012-01-01

    Roč. 82, č. 1 (2012), s. 48-55 ISSN 0030-2414 R&D Projects: GA AV ČR IAA500200709; GA MŠk 2B06155; GA ČR GD310/08/H077 Institutional research plan: CEZ:AV0Z50200510 Keywords : Breast tumor * Calreticulin * ELISA anti-calreticulin antibodies Subject RIV: EC - Immunology Impact factor: 2.165, year: 2012

  10. Overexpression of CD44 accompanies acquired tamoxifen resistance in MCF7 cells and augments their sensitivity to the stromal factors, heregulin and hyaluronan

    Directory of Open Access Journals (Sweden)

    Hiscox Stephen

    2012-10-01

    Full Text Available Abstract Background Acquired resistance to endocrine therapy in breast cancer is a significant problem with relapse being associated with local and/or regional recurrence and frequent distant metastases. Breast cancer cell models reveal that endocrine resistance is accompanied by a gain in aggressive behaviour driven in part through altered growth factor receptor signalling, particularly involving erbB family receptors. Recently we identified that CD44, a transmembrane cell adhesion receptor known to interact with growth factor receptors, is upregulated in tamoxifen-resistant (TamR MCF7 breast cancer cells. The purpose of this study was to explore the consequences of CD44 upregulation in an MCF7 cell model of acquired tamoxifen resistance, specifically with respect to the hypothesis that CD44 may influence erbB activity to promote an adverse phenotype. Methods CD44 expression in MCF7 and TamR cells was assessed by RT-PCR, Western blotting and immunocytochemistry. Immunofluorescence and immunoprecipitation studies revealed CD44-erbB associations. TamR cells (± siRNA-mediated CD44 suppression or MCF7 cells (± transfection with the CD44 gene were treated with the CD44 ligand, hyaluronon (HA, or heregulin and their in vitro growth (MTT, migration (Boyden chamber and wound healing and invasion (Matrigel transwell migration determined. erbB signalling was assessed using Western blotting. The effect of HA on erbB family dimerisation in TamR cells was determined by immunoprecipitation in the presence or absence of CD44 siRNA. Results TamR cells overexpressed CD44 where it was seen to associate with erbB2 at the cell surface. siRNA-mediated suppression of CD44 in TamR cells significantly attenuated their response to heregulin, inhibiting heregulin-induced cell migration and invasion. Furthermore, TamR cells exhibited enhanced sensitivity to HA, with HA treatment resulting in modulation of erbB dimerisation, ligand-independent activation of erbB2

  11. Overexpression of CD44 accompanies acquired tamoxifen resistance in MCF7 cells and augments their sensitivity to the stromal factors, heregulin and hyaluronan

    International Nuclear Information System (INIS)

    Hiscox, Stephen; Gee, Julia; Baruha, Bedanta; Smith, Chris; Bellerby, Rebecca; Goddard, Lindy; Jordan, Nicola; Poghosyan, Zaruhi; Nicholson, Robert I; Barrett-Lee, Peter

    2012-01-01

    Acquired resistance to endocrine therapy in breast cancer is a significant problem with relapse being associated with local and/or regional recurrence and frequent distant metastases. Breast cancer cell models reveal that endocrine resistance is accompanied by a gain in aggressive behaviour driven in part through altered growth factor receptor signalling, particularly involving erbB family receptors. Recently we identified that CD44, a transmembrane cell adhesion receptor known to interact with growth factor receptors, is upregulated in tamoxifen-resistant (TamR) MCF7 breast cancer cells. The purpose of this study was to explore the consequences of CD44 upregulation in an MCF7 cell model of acquired tamoxifen resistance, specifically with respect to the hypothesis that CD44 may influence erbB activity to promote an adverse phenotype. CD44 expression in MCF7 and TamR cells was assessed by RT-PCR, Western blotting and immunocytochemistry. Immunofluorescence and immunoprecipitation studies revealed CD44-erbB associations. TamR cells (± siRNA-mediated CD44 suppression) or MCF7 cells (± transfection with the CD44 gene) were treated with the CD44 ligand, hyaluronon (HA), or heregulin and their in vitro growth (MTT), migration (Boyden chamber and wound healing) and invasion (Matrigel transwell migration) determined. erbB signalling was assessed using Western blotting. The effect of HA on erbB family dimerisation in TamR cells was determined by immunoprecipitation in the presence or absence of CD44 siRNA. TamR cells overexpressed CD44 where it was seen to associate with erbB2 at the cell surface. siRNA-mediated suppression of CD44 in TamR cells significantly attenuated their response to heregulin, inhibiting heregulin-induced cell migration and invasion. Furthermore, TamR cells exhibited enhanced sensitivity to HA, with HA treatment resulting in modulation of erbB dimerisation, ligand-independent activation of erbB2 and EGFR and induction of cell migration

  12. Overexpression of synuclein-γ predicts lack of benefit from radiotherapy for breast cancer patients

    International Nuclear Information System (INIS)

    Min, Li; Zhang, Cheng; Ma, Ruolan; Li, Xiaofan; Yuan, Hua; Li, Yihao; Chen, Ruxuan; Liu, Caiyun; Guo, Jianping; Qu, Like; Shou, Chengchao

    2016-01-01

    Although radiotherapy following mastectomy was demonstrated to reduce the recurring risk and improve the prognosis of patients with breast cancer, it is also notorious for comprehensive side effects, hence only a selected group of patients can benefit. Therefore, the screening of molecular markers capable of predicting the efficacy of radiotherapy is essential. We have established a cohort of 454 breast cancer cases and selected 238 patients with indications for postoperative radiotherapy. Synuclein-γ (SNCG) protein levels were assessed by immunohistochemistry, and SNCG status was retrospectively correlated with clinical features and survival in patients treated or not treated with radiotherapy. Gene Set Enrichment Analysis (GSEA) and survival analysis for online datasets were also performed for further validation. Among patients that received radiotherapy (82/238), those demonstrating positive SNCG expression had a 55.0 month shorter median overall survival (OS) in comparison to those demonstrating negative SNCG expression (78.4 vs. 133.4 months, log rank χ 2 = 16.13; p < 0.001). Among the patients that received no radiotherapy (156/238), SNCG status was not correlated with OS (log rank χ 2 = 2.40; p = 0.121). A COX proportional hazard analysis confirmed SNCG as an independent predictor of OS, only for patients who have received radiotherapy. Similar results were also obtained for distant metastasis-free survival (DMFS). A GSEA analysis indicated that SNCG was strongly associated with genes related to a radiation stress response. A survival analysis was performed with online databases consisting of breast cancer, lung cancer, and glioblastoma and further confirmed SNCG’s significance in predicting the survival of patients that have received radiotherapy. A positive SNCG may serve as a potential marker to identify breast cancer patients who are less likely to benefit from radiotherapy and may also be extended to other types of cancer. However, the role of SNCG

  13. Overexpression of KCNJ3 gene splice variants affects vital parameters of the malignant breast cancer cell line MCF-7 in an opposing manner

    International Nuclear Information System (INIS)

    Rezania, S.; Kammerer, S.; Li, C.; Steinecker-Frohnwieser, B.; Gorischek, A.; DeVaney, T. T. J.; Verheyen, S.; Passegger, C. A.; Tabrizi-Wizsy, N. Ghaffari; Hackl, H.; Platzer, D.; Zarnani, A. H.; Malle, E.; Jahn, S. W.; Bauernhofer, T.; Schreibmayer, W.

    2016-01-01

    Overexpression the KCNJ3, a gene that encodes subunit 1 of G-protein activated inwardly rectifying K + channel (GIRK1) in the primary tumor has been found to be associated with reduced survival times and increased lymph node metastasis in breast cancer patients. In order to survey possible tumorigenic properties of GIRK1 overexpression, a range of malignant mammary epithelial cells, based on the MCF-7 cell line that permanently overexpress different splice variants of the KCNJ3 gene (GIRK1a, GIRK1c, GIRK1d and as a control, eYFP) were produced. Subsequently, selected cardinal neoplasia associated cellular parameters were assessed and compared. Adhesion to fibronectin coated surface as well as cell proliferation remained unaffected. Other vital parameters intimately linked to malignancy, i.e. wound healing, chemoinvasion, cellular velocities / motilities and angiogenesis were massively affected by GIRK1 overexpression. Overexpression of different GIRK1 splice variants exerted differential actions. While GIRK1a and GIRK1c overexpression reinforced the affected parameters towards malignancy, overexpression of GIRK1d resulted in the opposite. Single channel recording using the patch clamp technique revealed functional GIRK channels in the plasma membrane of MCF-7 cells albeit at very low frequency. We conclude that GIRK1d acts as a dominant negative constituent of functional GIRK complexes present in the plasma membrane of MCF-7 cells, while overexpression of GIRK1a and GIRK1c augmented their activity. The core component responsible for the cancerogenic action of GIRK1 is apparently presented by a segment comprising aminoacids 235–402, that is present exclusively in GIRK1a and GIRK1c, but not GIRK1d (positions according to GIRK1a primary structure). The current study provides insight into the cellular and molecular consequences of KCNJ3 overexpression in breast cancer cells and the mechanism upon clinical outcome in patients suffering from breast cancer. The online

  14. GP88 (PC-Cell Derived Growth Factor, progranulin stimulates proliferation and confers letrozole resistance to aromatase overexpressing breast cancer cells

    Directory of Open Access Journals (Sweden)

    Sabnis Gauri

    2011-06-01

    Full Text Available Abstract Background Aromatase inhibitors (AI that inhibit breast cancer cell growth by blocking estrogen synthesis have become the treatment of choice for post-menopausal women with estrogen receptor positive (ER+ breast cancer. However, some patients display de novo or acquired resistance to AI. Interactions between estrogen and growth factor signaling pathways have been identified in estrogen-responsive cells as one possible reason for acquisition of resistance. Our laboratory has characterized an autocrine growth factor overexpressed in invasive ductal carcinoma named PC-Cell Derived Growth Factor (GP88, also known as progranulin. In the present study, we investigated the role GP88 on the acquisition of resistance to letrozole in ER+ breast cancer cells Methods We used two aromatase overexpressing human breast cancer cell lines MCF-7-CA cells and AC1 cells and their letrozole resistant counterparts as study models. Effect of stimulating or inhibiting GP88 expression on proliferation, anchorage-independent growth, survival and letrozole responsiveness was examined. Results GP88 induced cell proliferation and conferred letrozole resistance in a time- and dose-dependent fashion. Conversely, naturally letrozole resistant breast cancer cells displayed a 10-fold increase in GP88 expression when compared to letrozole sensitive cells. GP88 overexpression, or exogenous addition blocked the inhibitory effect of letrozole on proliferation, and stimulated survival and soft agar colony formation. In letrozole resistant cells, silencing GP88 by siRNA inhibited cell proliferation and restored their sensitivity to letrozole. Conclusion Our findings provide information on the role of an alternate growth and survival factor on the acquisition of aromatase inhibitor resistance in ER+ breast cancer.

  15. Estrogen receptor positive breast tumors resist chemotherapy by the overexpression of P53 in Cancer Stem Cells

    Directory of Open Access Journals (Sweden)

    Fatma Ashour

    2018-06-01

    Full Text Available Background and Objectives: Breast cancer (BC is classified according to estrogen receptor (ER status into ER+ and ER− tumors. ER+ tumors have a worse response to chemotherapy compared to ER− tumors. BCL-2, TP53, BAX and NF-ΚB are involved in drug resistance in the ER+ tumors. Recently it was shown that Cancer Stem Cells (CSCs play an important role in drug resistance. In this study we tested the hypothesis that CSCs of the ER+ tumors resist drug through the overexpression of BCL-2, TP53, BAX and NF-ΚB. Methods: CSCs were isolated by anoikis resistance assay from MCF7 (ER+ and MDA-MB-231 (ER− cell lines. Isolated CSCs were treated with doxorubicin (DOX and the mRNA expression levels of BCL-2, TP53, BAX and NFKB were investigated by quantitative real time PCR (qPCR with and without treatment. Results: BCL-2, BAX and NF-ΚB showed decreased expression in MCF7 bulk cancer cells after DOX treatment whereas only BCL-2 and BAX showed decreased expression in MDA-MB-231 bulk cancer cells. Interestingly TP53 was the only gene showed a considerable increase in its expression in CSCs of the ER+ MCF7 cell line compared to bulk cancer cells. Moreover, TP53 was the only gene showing exceptionally higher level of expression in MCF7-CSCs compared to MDA-MB-231-CSCs. Conclusion: Our results suggest that CSCs in the ER+ cells escape the effect of DOX treatment by the elevation of p53 expression. Keywords: Breast cancer, Cancer Stem Cells, Drug resistance, Estrogen receptors

  16. Her-2/neu expression in node-negative breast cancer: direct tissue quantitation by computerized image analysis and association of overexpression with increased risk of recurrent disease.

    Science.gov (United States)

    Press, M F; Pike, M C; Chazin, V R; Hung, G; Udove, J A; Markowicz, M; Danyluk, J; Godolphin, W; Sliwkowski, M; Akita, R

    1993-10-15

    The HER-2/neu proto-oncogene (also known as c-erb B-2) is homologous with, but distinct from, the epidermal growth factor receptor. Amplification of this gene in node-positive breast cancers has been shown to correlate with both earlier relapse and shorter overall survival. In node-negative breast cancer patients, the subgroup for which accurate prognostic data could make a significant contribution to treatment decisions, the prognostic utility of HER-2/neu amplification and/or overexpression has been controversial. The purpose of this report is to address the issues surrounding this controversy and to evaluate the prognostic utility of overexpression in a carefully followed group of patients using appropriately characterized reagents and methods. In this report we present data from a study of HER-2/neu expression designed specifically to test whether or not overexpression is associated with an increased risk of recurrence in node-negative breast cancers. From a cohort of 704 women with node-negative breast cancer who experienced recurrent disease (relapsed cases) 105 were matched with 105 women with no recurrence (disease-free controls) after the equivalent follow-up period. Immunohistochemistry was used to assess HER-2/neu expression in archival tissue blocks from both relapsed cases and their matched disease-free controls. Importantly, a series of molecularly characterized breast cancer specimens were used to confirm that the antibody used was of sufficient sensitivity and specificity to identify those cancers overexpressing the HER-2/neu protein in this formalin-fixed, paraffin-embedded tissue cohort. In addition, a quantitative approach was developed to more accurately assess the amount of HER-2/neu protein identified by immunostaining tumor tissue. This was done using a purified HER-2/neu protein synthesized in a bacterial expression vector and protein lysates derived from a series of cell lines, engineered to express a defined range of HER-2/neu oncoprotein

  17. BAG3 Overexpression and Cytoprotective Autophagy Mediate Apoptosis Resistance in Chemoresistant Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Chandan Kanta Das

    2018-03-01

    Full Text Available Target-specific treatment modalities are currently not available for triple-negative breast cancer (TNBC, and acquired chemotherapy resistance is a primary obstacle for the treatment of these tumors. Here we employed derivatives of BT-549 and MDA-MB-468 TNBC cell lines that were adapted to grow in the presence of either 5-Fluorouracil, Doxorubicin or Docetaxel in an aim to identify molecular pathways involved in the adaptation to drug-induced cell killing. All six drug-adapted BT-549 and MDA-MB-468 cell lines displayed cross resistance to chemotherapy and decreased apoptosis sensitivity. Expression of the anti-apoptotic co-chaperone BAG3 was notably enhanced in two thirds (4/6 of the six resistant lines simultaneously with higher expression of HSP70 in comparison to parental controls. Doxorubicin-resistant BT-549 (BT-549rDOX20 and 5-Fluorouracil-resistant MDA-MB-468 (MDA-MB-468r5-FU2000 cells were chosen for further analysis with the autophagy inhibitor Bafilomycin A1 and lentiviral depletion of ATG5, indicating that enhanced cytoprotective autophagy partially contributes to increased drug resistance and cell survival. Stable lentiviral BAG3 depletion was associated with a robust down-regulation of Mcl-1, Bcl-2 and Bcl-xL, restoration of drug-induced apoptosis and reduced cell adhesion in these cells, and these death-sensitizing effects could be mimicked with the BAG3/Hsp70 interaction inhibitor YM-1 and by KRIBB11, a selective transcriptional inhibitor of HSF-1. Furthermore, BAG3 depletion was able to revert the EMT-like transcriptional changes observed in BT-549rDOX20 and MDA-MB-468r5-FU2000 cells. In summary, genetic and pharmacological interference with BAG3 is capable to resensitize TNBC cells to treatment, underscoring its relevance for cell death resistance and as a target to overcome therapy resistance of breast cancer.

  18. New developments in the treatment of HER2-positive breast cancer

    Directory of Open Access Journals (Sweden)

    Nahta R

    2012-05-01

    Full Text Available Rita NahtaDepartments of Pharmacology and Hematology and Medical Oncology, Winship Cancer Institute, Emory University, Atlanta, GA, USAAbstract: Approximately 20%–30% of metastatic breast cancers show increased expression of the human epidermal growth factor receptor-2 (HER2 tyrosine kinase. Two HER2-specific therapies are currently approved for clinical treatment of patients with HER2-overexpressing metastatic breast cancer. Trastuzumab is a monoclonal antibody against HER2 and is approved for first-line treatment of HER2-positive metastatic breast cancer. Lapatinib is a small molecule dual inhibitor of epidermal growth factor receptor and HER2 tyrosine kinases, and is approved for trastuzumab-refractory disease. Although trastuzumab is a highly effective therapy for patients with HER2-overexpressing metastatic breast cancer, a significant number of patients in the initial clinical trials of trastuzumab monotherapy showed resistance to trastuzumab-based therapy. Further, among those who did respond, the initial trials indicated that the median time to progression was less than 1 year. Similarly, lapatinib is effective in a subset of trastuzumab-refractory cases, but the majority of patients display resistance. This review discusses the multiple molecular mechanisms of resistance that have been proposed in the literature. In addition, novel agents that are being tested for efficacy against HER2-positive breast cancer, including the antibodies pertuzumab and trastuzumab-DM1 and the immunotoxin affitoxin, are reviewed. The introduction of trastuzumab has revolutionized the clinical care of patients with HER2-positive metastatic breast cancer and has resulted in dramatic reductions in recurrences of early-stage HER2-positive breast cancer. The development and implementation of gene- and protein-based assays that measure potential molecular predictors of trastuzumab resistance will allow individualization of HER2-targeted therapeutic approaches

  19. ErbB2 regulates NHEJ repair pathway by affecting erbB1-triggered IR-induced Akt activity

    International Nuclear Information System (INIS)

    Toulany, Mahmoud; Peter Rodemann, H.

    2009-01-01

    We have already reported that erbBl-PI3K-AKT signaling is an important pathway in regulating radiation sensitivity and DNA double strand break repair of human tumor cells. In the present study using small interfering RNA and pharmacological inhibitors in non-small cell lung cancer cell lines we investigated the role of Aktl on radiation-induced DNA-PKcs activity and DNA-double strand break (DNA-DSB) repair. Likewise, the function of erbB2 as hetrodimerization partner of erbBl in radiation-induced Akt activity and regulation of DNA-dsb repair through DNA-PKcs was evaluated. In A549 and H460 transfected with AKTl-siRNA radiation-induced phosphorylation of DNA-PKcs the key enzyme regulating NHEJ repair pathway was markedly inhibited. In both cell lines downregulation of Aktl led to a significant enhancement of residual DNA-DSB, i.e. impaired DNA-DSB repair. Interestingly, in cells transfected with DNA-PKcs-siRNA a lack of effect of AKTl-siRNA on enhancement of residual DNA-DSBs was observed. This results indicate that Aktl regulates NHEJ repair in a DNA-PKcs dependent manner

  20. Predictive role of the overexpression for CXCR4, C-Met, and VEGF-C among breast cancer patients: A meta-analysis.

    Science.gov (United States)

    Wang, Fang; Li, Shanshan; Zhao, Yueguang; Yang, Kunxian; Chen, Minju; Niu, Heng; Yang, Jingyu; Luo, Ying; Tang, Wenru; Sheng, Miaomiao

    2016-08-01

    The overexpression of CXCR4, C-Met and VEGF-C present widely in breast tumors, they may be markers of resistance to treatment. However, the studies are still controversial. Thus, this meta-analysis aims to research the relationship between the overexpression of CXCR4, C-Met, VEGF-C and clinical prognosis among breast cancer patients. PubMed and EMBASE databases were searched for eligible literature. The outcomes of interest were progression-free survival (PFS), relapse-free survival (RFS) and overall survival (OS). All tests of statistical significance were two sided. A total of 7830 patients from 28 eligible studies were assessed. The overexpression of the CXCR4 and C-Met both implied significantly worse PFS compared with normal expression [HR = 2.56, 95% CI = 1.34-4.91, P = 0.005; and HR = 1.63 95% CI = 1.20-2.22, P = 0.002]. Meanwhile, if patients had high expression of CXCR4, they would have worse OS [HR = 2.56 95% CI = 1.52-4.31, P = 0.000]. However, the overexpression of C-Met did not relate to OS for breast cancer patients [HR = 1.16, 95% CI = 0.69-1.95, P = 0.570]. Meanwhile, no statistically significant different was observed with respect to PFS and OS between VEGF-C overexpression and normal expression [HR = 0.99, 95% CI = 0.64-1.52, P = 0.968; and HR = 0.76, 95% CI = 0.43-1.33, P = 0.333]. Our meta-analysis showed that CXCR4 and C-Met were efficient prognostic factors for breast cancer. Nevertheless, highly expressing VEGF-C was not related to progression-free survival and overall survival. Due to the small samples and insufficient date, further studies should be conducted to clarify the association between the overexpression of CXCR4 or C-Met or VEGF-C and the prognosis about breast cancer patients. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Docosahexaenoic Acid Modulates a HER2-Associated Lipogenic Phenotype, Induces Apoptosis, and Increases Trastuzumab Action in HER2-Overexpressing Breast Carcinoma Cells

    Directory of Open Access Journals (Sweden)

    Graziela Rosa Ravacci

    2015-01-01

    Full Text Available In breast cancer, lipid metabolic alterations have been recognized as potential oncogenic stimuli that may promote malignancy. To investigate whether the oncogenic nature of lipogenesis closely depends on the overexpression of HER2 protooncogene, the normal breast cell line, HB4a, was transfected with HER2 cDNA to obtain HER2-overexpressing HB4aC5.2 cells. Both cell lines were treated with trastuzumab and docosahexaenoic acid. HER2 overexpression was accompanied by an increase in the expression of lipogenic genes involved in uptake (CD36, transport (FABP4, and storage (DGAT of exogenous fatty acids (FA, as well as increased activation of “de novo” FA synthesis (FASN. We further investigate whether this lipogenesis reprogramming might be regulated by mTOR/PPARγ pathway. Inhibition of the mTORC1 pathway markers, p70S6 K1, SREBP1, and LIPIN1, as well as an increase in DEPTOR expression (the main inhibitor of the mTOR was detected in HB4aC5.2. Based on these results, a PPARγ selective antagonist, GW9662, was used to treat both cells lines, and the lipogenic genes remained overexpressed in the HB4aC5.2 but not HB4a cells. DHA treatment inhibited all lipogenic genes (except for FABP4 in both cell lines yet only induced death in the HB4aC5.2 cells, mainly when associated with trastuzumab. Neither trastuzumab nor GW9662 alone was able to induce cell death. In conclusion, oncogenic transformation of breast cells by HER2 overexpression may require a reprogramming of lipogenic genetic that is independent of mTORC1 pathway and PPARγ activity. This reprogramming was inhibited by DHA.

  2. Docosahexaenoic Acid Modulates a HER2-Associated Lipogenic Phenotype, Induces Apoptosis, and Increases Trastuzumab Action in HER2-Overexpressing Breast Carcinoma Cells.

    Science.gov (United States)

    Ravacci, Graziela Rosa; Brentani, Maria Mitzi; Tortelli, Tharcisio Citrângulo; Torrinhas, Raquel Suzana M M; Santos, Jéssica Reis; Logullo, Angela Flávia; Waitzberg, Dan Linetzky

    2015-01-01

    In breast cancer, lipid metabolic alterations have been recognized as potential oncogenic stimuli that may promote malignancy. To investigate whether the oncogenic nature of lipogenesis closely depends on the overexpression of HER2 protooncogene, the normal breast cell line, HB4a, was transfected with HER2 cDNA to obtain HER2-overexpressing HB4aC5.2 cells. Both cell lines were treated with trastuzumab and docosahexaenoic acid. HER2 overexpression was accompanied by an increase in the expression of lipogenic genes involved in uptake (CD36), transport (FABP4), and storage (DGAT) of exogenous fatty acids (FA), as well as increased activation of "de novo" FA synthesis (FASN). We further investigate whether this lipogenesis reprogramming might be regulated by mTOR/PPARγ pathway. Inhibition of the mTORC1 pathway markers, p70S6 K1, SREBP1, and LIPIN1, as well as an increase in DEPTOR expression (the main inhibitor of the mTOR) was detected in HB4aC5.2. Based on these results, a PPARγ selective antagonist, GW9662, was used to treat both cells lines, and the lipogenic genes remained overexpressed in the HB4aC5.2 but not HB4a cells. DHA treatment inhibited all lipogenic genes (except for FABP4) in both cell lines yet only induced death in the HB4aC5.2 cells, mainly when associated with trastuzumab. Neither trastuzumab nor GW9662 alone was able to induce cell death. In conclusion, oncogenic transformation of breast cells by HER2 overexpression may require a reprogramming of lipogenic genetic that is independent of mTORC1 pathway and PPARγ activity. This reprogramming was inhibited by DHA.

  3. Efficacy and safety of trastuzumab as a single agent in first-line treatment of HER2-overexpressing metastatic breast cancer.

    Science.gov (United States)

    Vogel, Charles L; Cobleigh, Melody A; Tripathy, Debu; Gutheil, John C; Harris, Lyndsay N; Fehrenbacher, Louis; Slamon, Dennis J; Murphy, Maureen; Novotny, William F; Burchmore, Michael; Shak, Steven; Stewart, Stanford J; Press, Michael

    2002-02-01

    To evaluate the efficacy and safety of first-line, single-agent trastuzumab in women with HER2-overexpressing metastatic breast cancer. One hundred fourteen women with HER2-overexpressing metastatic breast cancer were randomized to receive first-line treatment with trastuzumab 4 mg/kg loading dose, followed by 2 mg/kg weekly, or a higher 8 mg/kg loading dose, followed by 4 mg/kg weekly. The objective response rate was 26% (95% confidence interval [CI], 18.2% to 34.4%), with seven complete and 23 partial responses. Response rates in 111 assessable patients with 3+ and 2+ HER2 overexpression by immunohistochemistry (IHC) were 35% (95% CI, 24.4% to 44.7%) and none (95% CI, 0% to 15.5%), respectively. The clinical benefit rates in assessable patients with 3+ and 2+ HER2 overexpression were 48% and 7%, respectively. The response rates in 108 assessable patients with and without HER2 gene amplification by fluorescence in situ hybridization (FISH) analysis were 34% (95% CI, 23.9% to 45.7%) and 7% (95% CI, 0.8% to 22.8%), respectively. Seventeen (57%) of 30 patients with an objective response and 22 (51%) of 43 patients with clinical benefit had not experienced disease progression at follow-up at 12 months or later. The most common treatment-related adverse events were chills (25% of patients), asthenia (23%), fever (22%), pain (18%), and nausea (14%). Cardiac dysfunction occurred in two patients (2%); both had histories of cardiac disease and did not require additional intervention after discontinuation of trastuzumab. There was no clear evidence of a dose-response relationship for response, survival, or adverse events. Single-agent trastuzumab is active and well tolerated as first-line treatment of women with metastatic breast cancer with HER2 3+ overexpression by IHC or gene amplification by FISH.

  4. Differential Control of ErbB2 Surface Expression in Breast Cancer Cells by an Alternatively Spliced Form of ERBIN

    National Research Council Canada - National Science Library

    Ching, Kathryn

    2004-01-01

    .... Following ligand binding and receptor activation, many cell surface receptors enter the Multivesicular Body pathway, where they are sorted and either targeted for degradation or recycled back to the plasma membrane...

  5. FoxA1 as a lineage-specific oncogene in luminal type breast cancer

    International Nuclear Information System (INIS)

    Yamaguchi, Noritaka; Ito, Emi; Azuma, Sakura; Honma, Reiko; Yanagisawa, Yuka; Nishikawa, Akira; Kawamura, Mika; Imai, Jun-ichi

    2008-01-01

    The forkhead transcription factor FoxA1 is thought to be involved in mammary tumorigenesis. However, the precise role of FoxA1 in breast cancer development is controversial. We examined expression of FoxA1 in 35 human breast cancer cell lines and compared it with that of ErbB2, a marker of poor prognosis in breast cancer. We found that FoxA1 is expressed at high levels in all ErbB2-positive cell lines and a subset of ErbB2-negative cell lines. Down-regulation of FoxA1 by RNA interference significantly suppressed proliferation of ErbB2-negative and FoxA1-positive breast cancer cell lines. Down-regulation of FoxA1 also enhanced the toxic effect of Herceptin on ErbB2-positive cell lines through induction of apoptosis. Taken together with previous data that FoxA1 is a marker of luminal cells in mammary gland, our present results suggest that FoxA1 plays an important role as a lineage-specific oncogene in proliferation of cancer cells derived from mammary luminal cells

  6. BAG3 Overexpression and Cytoprotective Autophagy Mediate Apoptosis Resistance in Chemoresistant Breast Cancer Cells.

    Science.gov (United States)

    Das, Chandan Kanta; Linder, Benedikt; Bonn, Florian; Rothweiler, Florian; Dikic, Ivan; Michaelis, Martin; Cinatl, Jindrich; Mandal, Mahitosh; Kögel, Donat

    2018-03-01

    Target-specific treatment modalities are currently not available for triple-negative breast cancer (TNBC), and acquired chemotherapy resistance is a primary obstacle for the treatment of these tumors. Here we employed derivatives of BT-549 and MDA-MB-468 TNBC cell lines that were adapted to grow in the presence of either 5-Fluorouracil, Doxorubicin or Docetaxel in an aim to identify molecular pathways involved in the adaptation to drug-induced cell killing. All six drug-adapted BT-549 and MDA-MB-468 cell lines displayed cross resistance to chemotherapy and decreased apoptosis sensitivity. Expression of the anti-apoptotic co-chaperone BAG3 was notably enhanced in two thirds (4/6) of the six resistant lines simultaneously with higher expression of HSP70 in comparison to parental controls. Doxorubicin-resistant BT-549 (BT-549 r DOX 20 ) and 5-Fluorouracil-resistant MDA-MB-468 (MDA-MB-468 r 5-FU 2000 ) cells were chosen for further analysis with the autophagy inhibitor Bafilomycin A1 and lentiviral depletion of ATG5, indicating that enhanced cytoprotective autophagy partially contributes to increased drug resistance and cell survival. Stable lentiviral BAG3 depletion was associated with a robust down-regulation of Mcl-1, Bcl-2 and Bcl-xL, restoration of drug-induced apoptosis and reduced cell adhesion in these cells, and these death-sensitizing effects could be mimicked with the BAG3/Hsp70 interaction inhibitor YM-1 and by KRIBB11, a selective transcriptional inhibitor of HSF-1. Furthermore, BAG3 depletion was able to revert the EMT-like transcriptional changes observed in BT-549 r DOX 20 and MDA-MB-468 r 5-FU 2000 cells. In summary, genetic and pharmacological interference with BAG3 is capable to resensitize TNBC cells to treatment, underscoring its relevance for cell death resistance and as a target to overcome therapy resistance of breast cancer. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Overexpression of YB1 C-terminal domain inhibits proliferation, angiogenesis and tumorigenicity in a SK-BR-3 breast cancer xenograft mouse model.

    Science.gov (United States)

    Shi, Jian-Hong; Cui, Nai-Peng; Wang, Shuo; Zhao, Ming-Zhi; Wang, Bing; Wang, Ya-Nan; Chen, Bao-Ping

    2016-01-01

    Y-box-binding protein 1 (YB1) is a multifunctional transcription factor with vital roles in proliferation, differentiation and apoptosis. In this study, we have examined the role of its C-terminal domain (YB1 CTD) in proliferation, angiogenesis and tumorigenicity in breast cancer. Breast cancer cell line SK-BR-3 was infected with GFP-tagged YB1 CTD adenovirus expression vector. An 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) proliferation assay showed that YB1 CTD decreased SK-BR-3 cell proliferation, and down-regulated cyclin B1 and up-regulated p21 levels in SK-BR-3 cells. YB1 CTD overexpression changed the cytoskeletal organization and slightly inhibited the migration of SK-BR-3 cells. YB1 CTD also inhibited secreted VEGF expression in SK-BR-3 cells, which decreased SK-BR-3-induced EA.hy926 endothelial cell angiogenesis in vitro. YB1 CTD overexpression attenuated the ability of SK-BR-3 cells to form tumours in nude mice, and decreased in vivo VEGF levels and angiogenesis in the xenografts in SK-BR-3 tumour-bearing mice. Taken together, our findings demonstrate the vital role of YB1 CTD overexpression in inhibiting proliferation, angiogenesis and tumorigenicity of breast cancer cell line SK-BR-3.

  8. KRAS rs61764370 is associated with HER2-overexpressed and poorly-differentiated breast cancer in hormone replacement therapy users: a case control study

    Directory of Open Access Journals (Sweden)

    Cerne Jasmina-Ziva

    2012-03-01

    Full Text Available Abstract Background A single nucleotide polymorphism located in the 3'-untranslated region of the KRAS oncogene (KRAS variant; rs61764370 disrupts a let-7 miRNA binding and was recently reported to act as a genetic marker for increased risk of developing human cancers. We aimed to investigate an association of the KRAS variant with sporadic and familial breast cancer and breast tumor characteristics. Methods Genotyping was accomplished in 530 sporadic postmenopausal breast cancer cases, 165 familial breast cancer cases (including N = 29, who test positive for BRCA1/2 mutations and 270 postmenopausal control women using the flurogenic 5' nuclease assay. Information on hormone replacement therapy (HRT use and tumor characteristics in sporadic breast cancer cases was ascertained from a postal questionnaire and pathology reports, respectively. Associations between the KRAS genotype and breast cancer or breast tumor characteristics were assessed using chi-square test and logistic regression models. Results No evidence of association was observed between the KRAS variant and risk of sporadic and familial breast cancer - either among BRCA carriers or non-BRCA carriers. The KRAS variant was statistically significantly more often associated with human epidermal growth factor receptor 2 (HER2 - positive tumors and tumors of higher histopathologic grade. However, both associations were detected only in HRT users. Conclusion Our data do not support the hypothesis that the KRAS variant rs61764370 is implicated in the aetiology of sporadic or of familial breast cancer. In postmenopausal women using HRT, the KRAS variant might lead to HER2 overexpressed and poorly-differentiated breast tumors, both indicators of a worse prognosis.

  9. KRAS rs61764370 is associated with HER2-overexpressed and poorly-differentiated breast cancer in hormone replacement therapy users: a case control study

    International Nuclear Information System (INIS)

    Cerne, Jasmina-Ziva; Stegel, Vida; Gersak, Ksenija; Novakovic, Srdjan

    2012-01-01

    A single nucleotide polymorphism located in the 3'-untranslated region of the KRAS oncogene (KRAS variant; rs61764370) disrupts a let-7 miRNA binding and was recently reported to act as a genetic marker for increased risk of developing human cancers. We aimed to investigate an association of the KRAS variant with sporadic and familial breast cancer and breast tumor characteristics. Genotyping was accomplished in 530 sporadic postmenopausal breast cancer cases, 165 familial breast cancer cases (including N = 29, who test positive for BRCA1/2 mutations) and 270 postmenopausal control women using the flurogenic 5' nuclease assay. Information on hormone replacement therapy (HRT) use and tumor characteristics in sporadic breast cancer cases was ascertained from a postal questionnaire and pathology reports, respectively. Associations between the KRAS genotype and breast cancer or breast tumor characteristics were assessed using chi-square test and logistic regression models. No evidence of association was observed between the KRAS variant and risk of sporadic and familial breast cancer - either among BRCA carriers or non-BRCA carriers. The KRAS variant was statistically significantly more often associated with human epidermal growth factor receptor 2 (HER2) - positive tumors and tumors of higher histopathologic grade. However, both associations were detected only in HRT users. Our data do not support the hypothesis that the KRAS variant rs61764370 is implicated in the aetiology of sporadic or of familial breast cancer. In postmenopausal women using HRT, the KRAS variant might lead to HER2 overexpressed and poorly-differentiated breast tumors, both indicators of a worse prognosis

  10. Solution structure of the human Grb7-SH2 domain/erbB2 peptide complex and structural basis for Grb7 binding to ErbB2

    International Nuclear Information System (INIS)

    Ivancic, Monika; Daly, Roger J.; Lyons, Barbara A.

    2003-01-01

    The solution structure of the hGrb7-SH2 domain in complex with a ten amino acid phosphorylated peptide ligand representative of the erbB2 receptor tyrosine kinase (pY1139) is presented as determined by nuclear magnetic resonance methods. The hGrb7-SH2 domain structure reveals the Src homology 2 domain topology consisting of a central β-sheet capped at each end by an α-helix. The presence of a four residue insertion in the region between β-strand E and the EF loop and resulting influences on the SH2 domain/peptide complex structure are discussed. The binding conformation of the erbB2 peptide is in a β-turn similar to that found in phosphorylated tyrosine peptides bound to the Grb2-SH2 domain. To our knowledge this is only the second example of an SH2 domain binding its naturally occurring ligands in a turn, instead of extended, conformation. Close contacts between residues responsible for binding specificity in hGrb7-SH2 and the erbB2 peptide are characterized and the potential effect of mutation of these residues on the hGrb7-SH2 domain structure is discussed

  11. RhNRG-1β Protects the Myocardium against Irradiation-Induced Damage via the ErbB2-ERK-SIRT1 Signaling Pathway.

    Directory of Open Access Journals (Sweden)

    Anxin Gu

    Full Text Available Radiation-induced heart disease (RIHD, which is a serious side effect of the radiotherapy applied for various tumors due to the inevitable irradiation of the heart, cannot be treated effectively using current clinical therapies. Here, we demonstrated that rhNRG-1β, an epidermal growth factor (EGF-like protein, protects myocardium tissue against irradiation-induced damage and preserves cardiac function. rhNRG-1β effectively ameliorated irradiation-induced myocardial nuclear damage in both cultured adult rat-derived cardiomyocytes and rat myocardium tissue via NRG/ErbB2 signaling. By activating ErbB2, rhNRG-1β maintained mitochondrial integrity, ATP production, respiratory chain function and the Krebs cycle status in irradiated cardiomyocytes. Moreover, the protection of irradiated cardiomyocytes and myocardium tissue by rhNRG-1β was at least partly mediated by the activation of the ErbB2-ERK-SIRT1 signaling pathway. Long-term observations further showed that rhNRG-1β administered in the peri-irradiation period exerts continuous protective effects on cardiac pump function, the myocardial energy metabolism, cardiomyocyte volume and interstitial fibrosis in the rats receiving radiation via NRG/ErbB2 signaling. Our findings indicate that rhNRG-1β can protect the myocardium against irradiation-induced damage and preserve cardiac function via the ErbB2-ERK-SIRT1 signaling pathway.

  12. Durable Clinical Benefit of Pertuzumab in a Young Patient with BRCA2 Mutation and HER2-Overexpressing Breast Cancer Involving the Brain

    Directory of Open Access Journals (Sweden)

    Anna Koumarianou

    2016-01-01

    Full Text Available Patients with HER2-positive breast cancer and brain metastases have limited treatment options, and, as a result of their poor performance status and worse prognosis, they are underrepresented in clinical trials. Not surprisingly, these patients may not be fit enough to receive any active treatment and are offered supportive therapy. BRCA2 mutations are reported to be rarely associated with HER2-overexpressing advanced breast cancer and even more rarely with brain metastases at diagnosis. We report on a BRCA2-positive breast cancer patient with metastatic disease in multiple sites, including the brain, and poor performance status who exhibited an extraordinary clinical and imaging response to the novel anti-HER2 therapy pertuzumab after multiple lines of therapy including anti-HER2 targeting. To our knowledge, the clinicopathologic and therapeutic characteristics of this patient point to a unique case and an urgent need for further investigation of pertuzumab in patients with brain metastases.

  13. Targeted Agents Active Against Breast Cancer: Q&A

    Science.gov (United States)

    ALTTO was a clinical trial designed to determine whether the combination of the monoclonal antibody trastuzumab (Herceptin) and the drug lapatinib (Tykerb) was more effective in treating HER2/ErbB2-positive breast cancer when combined with chemotherapy than either agent alone. Results from ALTTO did not show additional benefit from combining lapatinib and trastuzumab compared with trastuzumab treatment alone.

  14. Stromelysin-3 over-expression enhances tumourigenesis in MCF-7 and MDA-MB-231 breast cancer cell lines: involvement of the IGF-1 signalling pathway

    Directory of Open Access Journals (Sweden)

    Mennerich Detlev

    2007-01-01

    Full Text Available Abstract Background Stromelysin-3 (ST-3 is over-expressed in the majority of human carcinomas including breast carcinoma. Due to its known effect in promoting tumour formation, but its impeding effect on metastasis, a dual role of ST-3 in tumour progression, depending on the cellular grade of dedifferentiation, was hypothesized. Methods The present study was designed to investigate the influence of ST-3 in vivo and in vitro on the oestrogen-dependent, non-invasive MCF-7 breast carcinoma cell line as well as on the oestrogen-independent, invasive MDA-MB-231 breast carcinoma cell line. Therefore an orthotopic human xenograft tumour model in nude mice, as well as a 3D matrigel cell culture system, were employed. Results Using both in vitro and in vivo techniques, we have demonstrated that over-expression of ST-3 in MCF-7 and MDA-MB-231 cells leads to both increased cell numbers and tumour volumes. This observation was dependent upon the presence of growth factors. In particular, the enhanced proliferative capacity was in MCF-7/ST-3 completely and in MDA-MB-231/ST-3 cells partially dependent on the IGF-1 signalling pathway. Microarray analysis of ST-3 over-expressing cells revealed that in addition to cell proliferation, further biological processes seemed to be affected, such as cell motility and stress response. The MAPK-pathway as well as the Wnt and PI3-kinase pathways, appear to also play a potential role. Furthermore, we have demonstrated that breast cancer cell lines of different differentiation status, as well as the non-tumourigenic cell line MCF-10A, have a comparable capability to induce endogenous ST-3 expression in fibroblasts. Conclusion These data reveal that ST-3 is capable of enhancing tumourigenesis in highly differentiated "early stage" breast cancer cell lines as well as in further progressed breast cancer cell lines that have already undergone epithelial-mesenchymal transition. We propose that ST-3 induction in tumour

  15. Stromelysin-3 over-expression enhances tumourigenesis in MCF-7 and MDA-MB-231 breast cancer cell lines: involvement of the IGF-1 signalling pathway

    International Nuclear Information System (INIS)

    Kasper, Grit; Lehmann, Kerstin E; Reule, Matthias; Tschirschmann, Miriam; Dankert, Niels; Stout-Weider, Karen; Lauster, Roland; Schrock, Evelin; Mennerich, Detlev; Duda, Georg N

    2007-01-01

    Stromelysin-3 (ST-3) is over-expressed in the majority of human carcinomas including breast carcinoma. Due to its known effect in promoting tumour formation, but its impeding effect on metastasis, a dual role of ST-3 in tumour progression, depending on the cellular grade of dedifferentiation, was hypothesized. The present study was designed to investigate the influence of ST-3 in vivo and in vitro on the oestrogen-dependent, non-invasive MCF-7 breast carcinoma cell line as well as on the oestrogen-independent, invasive MDA-MB-231 breast carcinoma cell line. Therefore an orthotopic human xenograft tumour model in nude mice, as well as a 3D matrigel cell culture system, were employed. Using both in vitro and in vivo techniques, we have demonstrated that over-expression of ST-3 in MCF-7 and MDA-MB-231 cells leads to both increased cell numbers and tumour volumes. This observation was dependent upon the presence of growth factors. In particular, the enhanced proliferative capacity was in MCF-7/ST-3 completely and in MDA-MB-231/ST-3 cells partially dependent on the IGF-1 signalling pathway. Microarray analysis of ST-3 over-expressing cells revealed that in addition to cell proliferation, further biological processes seemed to be affected, such as cell motility and stress response. The MAPK-pathway as well as the Wnt and PI3-kinase pathways, appear to also play a potential role. Furthermore, we have demonstrated that breast cancer cell lines of different differentiation status, as well as the non-tumourigenic cell line MCF-10A, have a comparable capability to induce endogenous ST-3 expression in fibroblasts. These data reveal that ST-3 is capable of enhancing tumourigenesis in highly differentiated 'early stage' breast cancer cell lines as well as in further progressed breast cancer cell lines that have already undergone epithelial-mesenchymal transition. We propose that ST-3 induction in tumour fibroblasts leads to the stimulation of the IGF-1R pathway in

  16. Self-renewal of human embryonic stem cells requires insulin-like growth factor-1 receptor and ERBB2 receptor signaling

    Science.gov (United States)

    Wang, Linlin; Schulz, Thomas C.; Sherrer, Eric S.; Dauphin, Derek S.; Shin, Soojung; Nelson, Angelique M.; Ware, Carol B.; Zhan, Mei; Song, Chao-Zhong; Chen, Xiaoji; Brimble, Sandii N.; McLean, Amanda; Galeano, Maria J.; Uhl, Elizabeth W.; D'Amour, Kevin A.; Chesnut, Jonathan D.; Rao, Mahendra S.

    2007-01-01

    Despite progress in developing defined conditions for human embryonic stem cell (hESC) cultures, little is known about the cell-surface receptors that are activated under conditions supportive of hESC self-renewal. A simultaneous interrogation of 42 receptor tyrosine kinases (RTKs) in hESCs following stimulation with mouse embryonic fibroblast (MEF) conditioned medium (CM) revealed rapid and prominent tyrosine phosphorylation of insulin receptor (IR) and insulin-like growth factor-1 receptor (IGF1R); less prominent tyrosine phosphorylation of epidermal growth factor receptor (EGFR) family members, including ERBB2 and ERBB3; and trace phosphorylation of fibroblast growth factor receptors. Intense IGF1R and IR phosphorylation occurred in the absence of MEF conditioning (NCM) and was attributable to high concentrations of insulin in the proprietary KnockOut Serum Replacer (KSR). Inhibition of IGF1R using a blocking antibody or lentivirus-delivered shRNA reduced hESC self-renewal and promoted differentiation, while disruption of ERBB2 signaling with the selective inhibitor AG825 severely inhibited hESC proliferation and promoted apoptosis. A simple defined medium containing an IGF1 analog, heregulin-1β (a ligand for ERBB2/ERBB3), fibroblast growth factor-2 (FGF2), and activin A supported long-term growth of multiple hESC lines. These studies identify previously unappreciated RTKs that support hESC proliferation and self-renewal, and provide a rationally designed medium for the growth and maintenance of pluripotent hESCs. PMID:17761519

  17. Impact of somatic PI3K pathway and ERBB family mutations on pathological complete response (pCR) in HER2-positive breast cancer patients who received neoadjuvant HER2-targeted therapies.

    LENUS (Irish Health Repository)

    Toomey, Sinead

    2017-07-27

    The Cancer Genome Atlas analysis revealed that somatic EGFR, receptor tyrosine-protein kinase erbB-2 (ERBB2), Erb-B2 receptor tyrosine kinase 3 (ERBB3) and Erb-B2 receptor tyrosine kinase 4 (ERBB4) gene mutations (ERBB family mutations) occur alone or co-occur with somatic mutations in the gene encoding the phosphatidylinositol 3-kinase (PI3K) catalytic subunit (PIK3CA) in 19% of human epidermal growth factor receptor 2 (HER2)-positive breast cancers. Because ERBB family mutations can activate the PI3K\\/AKT pathway and likely have similar canonical signalling effects to PI3K pathway mutations, we investigated their combined impact on response to neoadjuvant HER2-targeted therapies.

  18. Vesicular stomatitis virus expressing a chimeric Sindbis glycoprotein containing an Fc antibody binding domain targets to Her2/neu overexpressing breast cancer cells

    International Nuclear Information System (INIS)

    Bergman, Ira; Whitaker-Dowling, Patricia; Gao Yanhua; Griffin, Judith A.; Watkins, Simon C.

    2003-01-01

    Vesicular stomatitis virus (VSV) is a candidate for development for cancer therapy. It is an oncolytic virus that is safe in humans. Recombinant virus can be made directly from plasmid components. We attempted to create a virus that targeted specifically to breast cancer cells. Nonreplicating and replicating pseudotype VSV were created whose only surface glycoprotein (gp) was a Sindbis gp, called Sindbis-ZZ, modified to severely reduce its native binding function and to contain the Fc-binding domain of Staphylococcus aureus protein A. When titered on Her2/neu overexpressing SKBR3 human breast cancer cells, pseudotype VSV coated with Sindbis-ZZ had 5 /ml. This work demonstrates the ability to easily create, directly from plasmid components, an oncolytic replicating VSV with a restricted host cell range

  19. Efficacy and mechanism of action of Proellex, an antiprogestin in aromatase overexpressing and Letrozole resistant T47D breast cancer cells.

    Science.gov (United States)

    Gupta, Akash; Mehta, Rajeshwari; Alimirah, Fatouma; Peng, Xinjian; Murillo, Genoveva; Wiehle, Ronald; Mehta, Rajendra G

    2013-01-01

    Aromatase inhibitors (AI) are considered as a first line therapy for ER+PR+ breast cancers. However, many patients acquire resistance to AI. In this study, we determined the response of antiprogestin CDB-4124 (Proellex) on the aromatase overexpressing and Letrozole resistant cell lines and also studies its mechanism of action in inhibition of breast cancer cell proliferation. For these studies we generated aromatase overexpressing T47D (T47Darom) and respective control (T47Dcon) breast cancer cell lines by stable transfection with plasmid containing CYP19A1 gene, or empty vector respectively. Letrozole resistant cell line (T47DaromLR) was generated by incubating T47Darom for 75 weeks in the presence of 10 μM Letrozole. Cell proliferation was determined by MTT or crystal violet assays. Gene expressions were quantified by QRT-PCR whereas proteins were identified by western blot analyses, flow cytometry and immunofluorescence staining. Aromatase activity was determined by estradiol ELISA. The effects of Proellex on the anchorage independent growth were measured by soft agar colony formation. Statistical differences between the various groups were determined by Student's 't' test or ANOVA followed by Bonferroni's post hoc test. Results showed that T47Darom and T47DaromLR cell lines had significantly higher aromatase expression (mRNA; 80-90 fold and protein) and as a result exhibited increased aromatization of testosterone to estradiol as compared to T47Dcon. Both these cell lines showed enhanced growth in the presence of Testosterone (50-60%). In T47DaromLR cells increased PR-B and EGFR expression as compared to T47Dcon cells was observed. Proellex and other known aromatase inhibitors (Letrozole, Anastrozole, and Exemestane) inhibited testosterone induced cell proliferation and anchorage independent growth of T47Darom cells. Cell growth inhibition was significantly greater when cells were treated with Proellex alone or in combination with other AIs as compared to AIs

  20. Silencing of the HER2/neu Gene by siRNA Inhibits Proliferation and Induces Apoptosis in HER2/neu-Overexpressing Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Timo Faltus

    2004-11-01

    Full Text Available In eukaryotes, double-stranded (ds RNA induces sequence-specific inhibition of gene expression referred to as RNA interference (RNAi. We exploited RNAi to define the role of HER2/neu in the neoplastic proliferation of human breast cancer cells. We transfected SK-BR-3, BT-474, MCF-7, and MDA-MB-468 breast cancer cells with short interfering RNA (siRNA targeted against human HER2/neu and analyzed the specific inhibition of HER2/neu expression by Northern and Western blots. Transfection with HER2/neu-specific siRNA resulted in a sequence-specific decrease in HER2/neu mRNA and protein levels. Moreover, transfection with HER2/neu siRNA caused cell cycle arrest at G0/G1 in the breast cancer cell lines SKBR-3 and BT-474, consistent with a powerful RNA silencing effect. siRNA treatment resulted in an antiproliferative and apoptotic response in cells overexpressing HER2/neu, but had no influence in cells with almost no expression of HER2/neu proteins like MDA-MB-468 cells. These data indicate that HER2/neu function is essential for the proliferation of HER2/neuoverexpressing breast cancer cells. Our observations suggest that siRNA targeted against human HER2/neu may be valuable tools as anti proliferative agents that display activity against neoplastic cells at very low doses.

  1. Correlation between HER2 gene amplification and protein overexpression through fluorescence in situ hybridization and immunohistochemistry in breast carcinoma patients

    OpenAIRE

    R N Makroo; Mohit Chowdhry; Manoj Kumar; Priyanka Srivastava; Richa Tyagi; Preeti Bhadauria; Sumaid Kaul; Ramesh Sarin; P K Das; Harsh Dua

    2012-01-01

    Background : In India, the incidence of breast cancer has increased in the urban population, with 1 in every 22 women diagnosed with breast cancer. It is important to know the HER2/neu gene status for a better prognostication of these patients. Aim : The aim of this study was to compare the efficacy of fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) for determining HER2/neu alteration in breast carcinoma. Materials and Methods : A total of 188 histologically proven br...

  2. Methylation of PLCD1 and adenovirus-mediated PLCD1 overexpression elicits a gene therapy effect on human breast cancer

    International Nuclear Information System (INIS)

    Mu, Haixi; Wang, Na; Zhao, Lijuan; Li, Shuman; Li, Qianqian; Chen, Ling; Luo, Xinrong; Qiu, Zhu; Li, Lili; Ren, Guosheng; Xu, Yongzhu; Zhou, Xiangyang; Xiang, Tingxiu

    2015-01-01

    Our previous study showed that PLCD1 significantly decreases cell proliferation and affects cell cycle progression in breast cancer cells. In the present study, we aimed to investigate its functional and molecular mechanisms, and whether or not can become a new target for gene therapies. We found reduced PLCD1 protein expression in breast tumor tissues compared with paired surgical margin tissues. PLCD1 promoter CpG methylation was detected in 55 of 96 (57%) primary breast tumors, but not in surgical-margin tissues and normal breast tissues. Ectopic expression of PLCD1 inhibited breast tumor cell proliferation in vivo by inducing apoptosis and suppressed tumor cell migration by regulating cytoskeletal reorganization proteins including RhoA and phospho-cofilin. Furthermore, we found that PLCD1 induced p53 accumulation, increased p27 and p21 protein levels, and cleaved PARP. Finally, we constructed an adenoviral vector expressing PLCD1 (AdH5-PLCD1), which exhibited strong cytotoxicity in breast cancer cells. Our findings provide insights into the development of PLCD1 gene therapies for breast cancer and perhaps, other human cancers. - Highlights: • PLCD1 is downregulated via hypermethylation in breast cancer. • PLCD1 suppressed cell migration by regulating cytoskeletal reorganization proteins. • Adenovirus AdHu5-PLCD1 may be a novel therapeutic option for breast cancer

  3. Methylation of PLCD1 and adenovirus-mediated PLCD1 overexpression elicits a gene therapy effect on human breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Mu, Haixi [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Department of Endocrine and breast Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016 (China); Wang, Na; Zhao, Lijuan; Li, Shuman; Li, Qianqian; Chen, Ling; Luo, Xinrong; Qiu, Zhu [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Li, Lili [Cancer Epigenetics Laboratory, Department of Clinical Oncology, Sir YK Pao Center for Cancer and Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong and CUHK Shenzhen Research Institute (Hong Kong); Ren, Guosheng [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Department of Endocrine and breast Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016 (China); Xu, Yongzhu [Chongqing Health Service Center, Chongqing 400020 (China); Zhou, Xiangyang [The Wistar Institute, Philadelphia, PA (United States); Xiang, Tingxiu, E-mail: xiangtx1@gmail.com [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China)

    2015-03-15

    Our previous study showed that PLCD1 significantly decreases cell proliferation and affects cell cycle progression in breast cancer cells. In the present study, we aimed to investigate its functional and molecular mechanisms, and whether or not can become a new target for gene therapies. We found reduced PLCD1 protein expression in breast tumor tissues compared with paired surgical margin tissues. PLCD1 promoter CpG methylation was detected in 55 of 96 (57%) primary breast tumors, but not in surgical-margin tissues and normal breast tissues. Ectopic expression of PLCD1 inhibited breast tumor cell proliferation in vivo by inducing apoptosis and suppressed tumor cell migration by regulating cytoskeletal reorganization proteins including RhoA and phospho-cofilin. Furthermore, we found that PLCD1 induced p53 accumulation, increased p27 and p21 protein levels, and cleaved PARP. Finally, we constructed an adenoviral vector expressing PLCD1 (AdH5-PLCD1), which exhibited strong cytotoxicity in breast cancer cells. Our findings provide insights into the development of PLCD1 gene therapies for breast cancer and perhaps, other human cancers. - Highlights: • PLCD1 is downregulated via hypermethylation in breast cancer. • PLCD1 suppressed cell migration by regulating cytoskeletal reorganization proteins. • Adenovirus AdHu5-PLCD1 may be a novel therapeutic option for breast cancer.

  4. Suppression of WIF-1 through promoter hypermethylation causes accelerated proliferation of the aryl hydrocarbon receptor (AHR) overexpressing MCF10AT1 breast cancer cells

    International Nuclear Information System (INIS)

    Wu, Dalei; Wong, Patrick; Li, Wen; Vogel, Christoph F.; Matsumura, Fumio

    2011-01-01

    Highlights: → 5-Aza-2'-deoxycytidine (AZ) causes proliferation suppression and ERα recovery. → AZ down-regulates Wnt/β-catenin pathway mainly by increasing WIF-1 expression. → Both ERα and AhR have some effects on DNA methylation in breast cancer cells. → Artificial overexpression of ERα in ER negative cells increases WIF-1 expression. → WIF-1 promoter hypermethylation is one of the major causes for accelerated proliferation. -- Abstract: The cause for increased cell proliferation in AHR overexpressing breast cancer cells still remains unknown. Here we studied the molecular basis of aggressive cell proliferation of an AHR overexpressing and ERα functionally down-regulated MCF10AT1 cell line, designated as P20E, in comparison to a matched sub-line, P20C with normal AHR expression and ERα function. We found that a 4-day treatment of P20E cells with 5-aza-2'-deoxycytidine (AZ) caused a significant suppression of cell proliferation. Such an effect of AZ was accompanied with the significant recovery of ERα function. Among diagnostic markers of AZ-induced cellular changes we found conspicuous up-regulation of mRNA expression of Wnt inhibitory factor-1 (WIF-1), particularly in P20E. The possibility of AZ-induced demethylation on the promoter of WIF-1 gene was confirmed through methylation specific PCR assay. Such AZ-induced changes in P20E cells were also accompanied with the decrease in the binding of nuclear proteins to the 32 P labeled TRE (TCF response element) and the reduced accumulation of β-catenin protein in the cell nucleus, indicating the importance of Wnt/β-catenin pathway in maintaining the increased cell proliferation in P20E line over P20C line. The importance of WIF-1 in this regard has been validated by transfecting cells with siRNA against WIF-1, which caused an increase in cell proliferation. Moreover, artificial overexpression of ERα in both P20E as well as MDA-MB-231 cells increased the mRNA expression of WIF-1. Together these

  5. Profilin-1 overexpression in MDA-MB-231 breast cancer cells is associated with alterations in proteomics biomarkers of cell proliferation, survival, and motility as revealed by global proteomics analyses.

    Science.gov (United States)

    Coumans, Joëlle V F; Gau, David; Poljak, Anne; Wasinger, Valerie; Roy, Partha; Moens, Pierre D J

    2014-12-01

    Despite early screening programs and new therapeutic strategies, metastatic breast cancer is still the leading cause of cancer death in women in industrialized countries and regions. There is a need for novel biomarkers of susceptibility, progression, and therapeutic response. Global analyses or systems science approaches with omics technologies offer concrete ways forward in biomarker discovery for breast cancer. Previous studies have shown that expression of profilin-1 (PFN1), a ubiquitously expressed actin-binding protein, is downregulated in invasive and metastatic breast cancer. It has also been reported that PFN1 overexpression can suppress tumorigenic ability and motility/invasiveness of breast cancer cells. To obtain insights into the underlying molecular mechanisms of how elevating PFN1 level induces these phenotypic changes in breast cancer cells, we investigated the alteration in global protein expression profiles of breast cancer cells upon stable overexpression of PFN1 by a combination of three different proteome analysis methods (2-DE, iTRAQ, label-free). Using MDA-MB-231 as a model breast cancer cell line, we provide evidence that PFN1 overexpression is associated with alterations in the expression of proteins that have been functionally linked to cell proliferation (FKPB1A, HDGF, MIF, PRDX1, TXNRD1, LGALS1, STMN1, LASP1, S100A11, S100A6), survival (HSPE1, HSPB1, HSPD1, HSPA5 and PPIA, YWHAZ, CFL1, NME1) and motility (CFL1, CORO1B, PFN2, PLS3, FLNA, FLNB, NME2, ARHGDIB). In view of the pleotropic effects of PFN1 overexpression in breast cancer cells as suggested by these new findings, we propose that PFN1-induced phenotypic changes in cancer cells involve multiple mechanisms. Our data reported here might also offer innovative strategies for identification and validation of novel therapeutic targets and companion diagnostics for persons with, or susceptibility to, breast cancer.

  6. HER-2/neu Overexpression as a Predictor for the Transition from In situ to Invasive Breast Cancer

    Science.gov (United States)

    Roses, Robert E.; Paulson, E. Carter; Sharma, Anupama; Schueller, Jeanne E.; Nisenbaum, Harvey; Weinstein, Susan; Fox, Kevin R.; Zhang, Paul J.; Czerniecki, Brian J.

    2009-01-01

    The clinical implications of HER-2/neu (HER2) expression in ductal carcinoma in situ (DCIS) lesions have yet to be clearly elucidated; this despite the more frequent expression of HER2 in high-grade DCIS lesions compared with invasive cancers. We hypothesized that HER2 overexpression in DCIS is associated with more rapid progression to invasive disease. Immunohistochemical staining for estrogen receptor, progesterone receptor, and HER2 was done on DCIS specimens. Univariate analysis and a multivariate logistic regression were done to determine whether estrogen receptor, progesterone receptor, or HER2 status, comedo necrosis, nuclear grade, lesion size, or patient age predicted the presence of associated invasive disease in patients with DCIS. Invasive foci were found in association with HER2 overexpressing DCIS at a higher frequency than with DCIS that did not overexpress HER2. Although high nuclear grade, large lesion size, and HER2 overexpression were all associated with the presence of invasive disease on univariate analysis, HER2 was the only significant predictor for the presence of invasive disease after multivariate adjustment (odds ratio, 6.4; P = 0.01). These data indicate that HER2 overexpression in DCIS lesions predicts the presence of invasive foci in patients with DCIS and suggest that targeting of HER2 in an early disease setting may forestall or prevent disease progression. PMID:19383888

  7. Neoadjuvant therapy for early-stage breast cancer: the clinical utility of pertuzumab

    International Nuclear Information System (INIS)

    Gollamudi, Jahnavi; Parvani, Jenny G; Schiemann, William P; Vinayak, Shaveta

    2016-01-01

    Approximately 20% of breast cancer patients harbor tumors that overexpress human epidermal growth factor receptor 2 (HER2; also known as ErbB2), a receptor tyrosine kinase that belongs to the epidermal growth factor receptor family of receptor tyrosine kinases. HER2 amplification and hyperactivation drive the growth and survival of breast cancers through the aberrant activation of proto-oncogenic signaling systems, particularly the Ras/MAP kinase and PI3K/AKT pathways. Although HER2-positive (HER2 + ) breast cancer was originally considered to be a highly aggressive form of the disease, the clinical landscape of HER2 + breast cancers has literally been transformed by the approval of anti-HER2 agents for adjuvant and neoadjuvant settings. Indeed, pertuzumab is a novel monoclonal antibody that functions as an anti-HER2 agent by targeting the extracellular dimerization domain of the HER2 receptor; it is also the first drug to receive an accelerated approval by the US Food and Drug Administration for use in neoadjuvant settings in early-stage HER2 + breast cancer. Here, we review the molecular and cellular factors that contribute to the pathophysiology of HER2 in breast cancer, as well as summarize the landmark preclinical and clinical findings underlying the approval and use of pertuzumab in the neoadjuvant setting. Finally, the molecular mechanisms operant in mediating resistance to anti-HER2 agents, and perhaps to pertuzumab as well, will be discussed, as will the anticipated clinical impact and future directions of pertuzumab in breast cancer patients

  8. Overexpression of molecular chaperons GRP78 and GRP94 in CD44(hi)/CD24(lo) breast cancer stem cells.

    Science.gov (United States)

    Nami, Babak; Ghasemi-Dizgah, Armin; Vaseghi, Akbar

    2016-01-01

    Breast cancer stem cell with CD44(hi)/CD24(lo) phonotype is described having stem cell properties and represented as the main driving factor in breast cancer initiation, growth, metastasis and low response to anti-cancer agents. Glucoseregulated proteins (GRPs) are heat shock protein family chaperons that are charged with regulation of protein machinery and modulation of endoplasmic reticulum homeostasis whose important roles in stem cell development and invasion of various cancers have been demonstrated. Here, we investigated the expression levels of GRP78 and GRP94 in CD44(hi)/CD24(lo) phenotype breast cancer stem cells (BCSCs). MCF7, T-47D and MDA-MB-231 breast cancer cell lines were used. CD44(hi)/CD24(lo) phenotype cell population were analyzed and sorted by fluorescence-activated cell sorting (FACS). Transcriptional and translational expression of GRP78 and GRP94 were investigated by western blotting and quantitative real time PCR. RESULTS showed different proportion of CD44(hi)/CD24(lo) phenotype cell population in their original bulk cells. The ranking of the cell lines in terms of CD44(hi)/CD24(lo) phenotype cell population was as MCF7hi)/CD24(lo) phenotype cells exhibited higher mRNA and protein expression level of GRP78 and GRP94 compared to their original bulk cells. Our results show a relationship between overexpression of GRP78 and GRP94 and exhibiting CD44hi/CD24lo phenotype in breast cancer cells. We conclude that upregulation of GRPs may be an important factor in the emergence of CD44hi/CD24lo phenotype BCSCs features.

  9. The Ubiquitin-Conjugating Enzyme E2-EPF Is Overexpressed in Primary Breast Cancer and Modulates Sensitivity to Topoisomerase II Inhibition1

    Science.gov (United States)

    Tedesco, Donato; Zhang, Jianhuan; Trinh, Lan; Lalehzadeh, Guita; Meisner, Rene; Yamaguchi, Ken D; Ruderman, Daniel L; Dinter, Harald; Zajchowski, Deborah A

    2007-01-01

    We identified the ubiquitin-conjugating enzyme E2-EPF mRNA as differentially expressed in breast tumors relative to normal tissues and performed studies to elucidate its putative role in cancer. We demonstrated that overexpression of E2-EPF protein correlated with estrogen receptor (ER) negativity in breast cancer specimens and that its expression is cell cycle-regulated, suggesting a potential function for E2-EPF in cell cycle progression. However, reduction of E2-EPF protein levels by > 80% using RNAi had no significant effects on the proliferation of HeLa cervical cancer cells or ER- MDA-MB-231 or MDA-MB-453 breast cancer cells. Because E2-EPF protein levels were elevated during the G2/M phase of the cell cycle and because E2-EPF mRNA in tumor specimens was frequently coexpressed with genes involved in cell cycle control, spindle assembly, and mitotic surveillance, the possibility that E2-EPF might have a function in the cellular response to agents that induce a G2 checkpoint or an M checkpoint was investigated. E2-EPF knockdown sensitized HeLa cells to the topoisomerase (topo) II inhibitors etoposide and doxorubicin and also increased topo IIα protein levels. These data suggest that combined administration of topo II-directed drugs and E2-EPF inhibitors may enhance their clinical effectiveness. PMID:17710163

  10. The Ubiquitin-Conjugating Enzyme E2-EPF Is Overexpressed in Primary Breast Cancer and Modulates Sensitivity to Topoisomerase II Inhibition

    Directory of Open Access Journals (Sweden)

    Donato Tedesco

    2007-07-01

    Full Text Available We identified the ubiquitin-conjugating enzyme E2EPF mRNA as differentially expressed in breast tumors relative to normal tissues and performed studies to elucidate its putative role in cancer. We demonstrated that overexpression of E2-EPF protein correlated with estrogen receptor (ER negativity in breast cancer specimens and that its expression is cell cycleregulated, suggesting a potential function for E2-EPF in cell cycle progression. However, reduction of E2EPF protein levels by > 80% using RNAi had no significant effects on the proliferation of HeLa cervical cancer cells or ER- MDA-MB-231 or MDA-MB-453 breast cancer cells. Because E2-EPF protein levels were elevated during the G2/M phase of the cell cycle and because E2-EPF mRNA in tumor specimens was frequently coexpressed with genes involved in cell cycle control, spindle assembly, and mitotic surveillance, the possibility that E2-EPF might have a function in the cellular response to agents that induce a G2 checkpoint or an M checkpoint was investigated. E2-EPF knockdown sensitized HeLa cells to the topoisomerase (topo II inhibitors etoposide and doxorubicin and also increased topo IIα protein levels. These data suggest that combined administration of topo II-directed drugs and E2-EPF inhibitors may enhance their clinical effectiveness.

  11. The ubiquitin-conjugating enzyme E2-EPF is overexpressed in primary breast cancer and modulates sensitivity to topoisomerase II inhibition.

    Science.gov (United States)

    Tedesco, Donato; Zhang, Jianhuan; Trinh, Lan; Lalehzadeh, Guita; Meisner, Rene; Yamaguchi, Ken D; Ruderman, Daniel L; Dinter, Harald; Zajchowski, Deborah A

    2007-07-01

    We identified the ubiquitin-conjugating enzyme E2-EPF mRNA as differentially expressed in breast tumors relative to normal tissues and performed studies to elucidate its putative role in cancer. We demonstrated that overexpression of E2-EPF protein correlated with estrogen receptor (ER) negativity in breast cancer specimens and that its expression is cell cycle-regulated, suggesting a potential function for E2-EPF in cell cycle progression. However, reduction of E2-EPF protein levels by > 80% using RNAi had no significant effects on the proliferation of HeLa cervical cancer cells or ER(-) MDA-MB-231 or MDA-MB-453 breast cancer cells. Because E2-EPF protein levels were elevated during the G(2)/M phase of the cell cycle and because E2-EPF mRNA in tumor specimens was frequently coexpressed with genes involved in cell cycle control, spindle assembly, and mitotic surveillance, the possibility that E2-EPF might have a function in the cellular response to agents that induce a G(2) checkpoint or an M checkpoint was investigated. E2-EPF knockdown sensitized HeLa cells to the topoisomerase (topo) II inhibitors etoposide and doxorubicin and also increased topo IIalpha protein levels. These data suggest that combined administration of topo II-directed drugs and E2-EPF inhibitors may enhance their clinical effectiveness.

  12. Her-2/neu overexpression is associated with thrombospondin-1-related angiogenesis and thrombospondin-1-unrelated lymphangiogenesis in breast cancer

    Directory of Open Access Journals (Sweden)

    Ming-Chuan Hong

    2013-11-01

    Conclusion: Our in vivo results showed that Her-2/neu affects the biological manifestations of breast cancer by increasing angiogenesis (which is TSP-1-related and lymphangiogenesis, which is TSP-1-unrelated.

  13. Epidermal growth factor receptor coexpression modulates susceptibility to Herceptin in HER2/neu overexpressing breast cancer cells via specific erbB-receptor interaction and activation

    International Nuclear Information System (INIS)

    Diermeier, Simone; Horvath, Gabor; Knuechel-Clarke, Ruth; Hofstaedter, Ferdinand; Szoellosi, Janos; Brockhoff, Gero

    2005-01-01

    Background: Growth factors and Herceptin specifically and differentially modulate cell proliferation of tumor cells. However, the mechanism of action on erbB-receptor level is incompletely understood. We evaluated Herceptin's capacity to modulate erbB-receptor activation and interaction on the cell surface level and thereby potentially impair cell proliferation of HER2/neu (c-erbB2) overexpressing breast cancer cells, both in the presence and absence of relevant growth factors. Methods: BT474 and SK-BR-3 breast cancer cell lines were treated with Epidermal Growth Factor (EGF), Heregulin, and with Herceptin in different combinations. Kinetics of cell proliferation were evaluated flow cytometrically based on BrdU-labeling. Fluorescence Resonance Energy Transfer, ELISAs and phosphorylation site specific Western Blotting was performed to investigate erbB-receptor interaction and activation. Results: EGF induced EGFR/EGFR and EGFR/c-erbB2 interactions correlate with stimulation of cell proliferation in BT474 cells. Both homo- and heterodimerization are considerably less pronounced in SK-BR-3 cells and heterointeraction is additionally reduced by EGF treatment, causing inhibition of cell proliferation. Heregulin stimulates cell proliferation extensively in both cell lines. Herceptin drives BT474 cells more efficiently into quiescence than it does with SK-BR-3 cells and thereby blocks cell cycle progress. In SK-BR-3 Herceptin treatment causes c-erbB2 phosphorylation of Y877 and Y1248, EGF induces Y877 and Y1112 phosphorylation. The Y1112 phosphorylation site, activated by EGF in SK-BR-3 cell, is bypassed in BT474. In addition the inhibitory capacity of Herceptin on BT474 and SK-BR-3 cell proliferation depends on the presence and absence of growth factors to a various extent. Conclusion: The growth inhibitory effect of Herceptin on c-erbB2 overexpressing breast cancer cells is considerably modulated by EGFR coexpression and consequently EGFR/c-erbB2 homo- and

  14. A molecular analysis by gene expression profiling reveals Bik/NBK overexpression in sporadic breast tumor samples of Mexican females

    International Nuclear Information System (INIS)

    García, Normand; Salamanca, Fabio; Astudillo-de la Vega, Horacio; Curiel-Quesada, Everardo; Alvarado, Isabel; Peñaloza, Rosenda; Arenas, Diego

    2005-01-01

    Breast cancer is one of the most frequent causes of death in Mexican women over 35 years of age. At molecular level, changes in many genetic networks have been reported as associated with this neoplasia. To analyze these changes, we determined gene expression profiles of tumors from Mexican women with breast cancer at different stages and compared these with those of normal breast tissue samples. 32 P-radiolabeled cDNA was synthesized by reverse transcription of mRNA from fresh sporadic breast tumor biopsies, as well as normal breast tissue. cDNA probes were hybridized to microarrays and expression levels registered using a phosphorimager. Expression levels of some genes were validated by real time RT-PCR and immunohistochemical assays. We identified two subgroups of tumors according to their expression profiles, probably related with cancer progression. Ten genes, unexpressed in normal tissue, were turned on in some tumors. We found consistent high expression of Bik gene in 14/15 tumors with predominant cytoplasmic distribution. Recently, the product of the Bik gene has been associated with tumoral reversion in different neoplasic cell lines, and was proposed as therapy to induce apoptosis in cancers, including breast tumors. Even though a relationship among genes, for example those from a particular pathway, can be observed through microarrays, this relationship might not be sufficient to assign a definitive role to Bik in development and progression of the neoplasia. The findings herein reported deserve further investigation

  15. Lapatinib Resistance in Breast Cancer Cells Is Accompanied by Phosphorylation-Mediated Reprogramming of Glycolysis.

    Science.gov (United States)

    Ruprecht, Benjamin; Zaal, Esther A; Zecha, Jana; Wu, Wei; Berkers, Celia R; Kuster, Bernhard; Lemeer, Simone

    2017-04-15

    HER2/ERBB2-overexpressing breast cancers targeted effectively by the small-molecule kinase inhibitor lapatinib frequently acquire resistance to this drug. In this study, we employed explorative mass spectrometry to profile proteome, kinome, and phosphoproteome changes in an established model of lapatinib resistance to systematically investigate initial inhibitor response and subsequent reprogramming in resistance. The resulting dataset, which collectively contains quantitative data for >7,800 proteins, >300 protein kinases, and >15,000 phosphopeptides, enabled deep insight into signaling recovery and molecular reprogramming upon resistance. Our data-driven approach confirmed previously described mechanisms of resistance (e.g., AXL overexpression and PIK3 reactivation), revealed novel pharmacologically actionable targets, and confirmed the expectation of significant heterogeneity in molecular resistance drivers inducing distinct phenotypic changes. Furthermore, our approach identified an extensive and exclusively phosphorylation-mediated reprogramming of glycolytic activity, supported additionally by widespread changes of corresponding metabolites and an increased sensitivity towards glycolysis inhibition. Collectively, our multi-omic analysis offers deeper perspectives on cancer drug resistance and suggests new biomarkers and treatment options for lapatinib-resistant cancers. Cancer Res; 77(8); 1842-53. ©2017 AACR . ©2017 American Association for Cancer Research.

  16. Overexpression of β1-chain-containing laminins in capillary basement membranes of human breast cancer and its metastases

    International Nuclear Information System (INIS)

    Fujita, Manabu; Khazenzon, Natalya M; Bose, Shikha; Sekiguchi, Kiyotoshi; Sasaki, Takako; Carter, William G; Ljubimov, Alexander V; Black, Keith L; Ljubimova, Julia Y

    2005-01-01

    Laminins are the major components of vascular and parenchymal basement membranes. We previously documented a switch in the expression of vascular laminins containing the α4 chain from predominantly laminin-9 (α4β2γ1) to predominantly laminin-8 (α4β1γ1) during progression of human brain gliomas to high-grade glioblastoma multiforme. Here, differential expression of laminins was studied in blood vessels and ductal epithelium of the breast. In the present study the expressions of laminin isoforms α1–α5, β1–β3, γ1, and γ2 were examined during progression of breast cancer. Forty-five clinical samples of breast tissues including normal breast, ductal carcinomas in situ, invasive ductal carcinomas, and their metastases to the brain were compared using Western blot analysis and immunohistochemistry for various chains of laminin, in particular laminin-8 and laminin-9. Laminin α4 chain was observed in vascular basement membranes of most studied tissues, with the highest expression in metastases. At the same time, the expression of laminin β2 chain (a constituent of laminin-9) was mostly seen in normal breast and carcinomas in situ but not in invasive carcinomas or metastases. In contrast, laminin β1 chain (a constituent of laminin-8) was typically found in vessel walls of carcinomas and their metastases but not in those of normal breast. The expression of laminin-8 increased in a progression-dependent manner. A similar change was observed from laminin-11 (α5β2γ1) to laminin-10 (α5β1γ1) during breast tumor progression. Additionally, laminin-2 (α2β1γ1) appeared in vascular basement membranes of invasive carcinomas and metastases. Chains of laminin-5 (α3β3γ2) were expressed in the ductal epithelium basement membranes of the breast and diminished with tumor progression. These results suggest that laminin-2, laminin-8, and laminin-10 are important components of tumor microvessels and may associate with breast tumor progression. Angiogenic switch

  17. Overexpression of β1-chain-containing laminins in capillary basement membranes of human breast cancer and its metastases

    Science.gov (United States)

    Fujita, Manabu; Khazenzon, Natalya M; Bose, Shikha; Sekiguchi, Kiyotoshi; Sasaki, Takako; Carter, William G; Ljubimov, Alexander V; Black, Keith L; Ljubimova, Julia Y

    2005-01-01

    Introduction Laminins are the major components of vascular and parenchymal basement membranes. We previously documented a switch in the expression of vascular laminins containing the α4 chain from predominantly laminin-9 (α4β2γ1) to predominantly laminin-8 (α4β1γ1) during progression of human brain gliomas to high-grade glioblastoma multiforme. Here, differential expression of laminins was studied in blood vessels and ductal epithelium of the breast. Method In the present study the expressions of laminin isoforms α1–α5, β1–β3, γ1, and γ2 were examined during progression of breast cancer. Forty-five clinical samples of breast tissues including normal breast, ductal carcinomas in situ, invasive ductal carcinomas, and their metastases to the brain were compared using Western blot analysis and immunohistochemistry for various chains of laminin, in particular laminin-8 and laminin-9. Results Laminin α4 chain was observed in vascular basement membranes of most studied tissues, with the highest expression in metastases. At the same time, the expression of laminin β2 chain (a constituent of laminin-9) was mostly seen in normal breast and carcinomas in situ but not in invasive carcinomas or metastases. In contrast, laminin β1 chain (a constituent of laminin-8) was typically found in vessel walls of carcinomas and their metastases but not in those of normal breast. The expression of laminin-8 increased in a progression-dependent manner. A similar change was observed from laminin-11 (α5β2γ1) to laminin-10 (α5β1γ1) during breast tumor progression. Additionally, laminin-2 (α2β1γ1) appeared in vascular basement membranes of invasive carcinomas and metastases. Chains of laminin-5 (α3β3γ2) were expressed in the ductal epithelium basement membranes of the breast and diminished with tumor progression. Conclusion These results suggest that laminin-2, laminin-8, and laminin-10 are important components of tumor microvessels and may associate with breast

  18. Dual-Ligand Modified Polymer-Lipid Hybrid Nanoparticles for Docetaxel Targeting Delivery to Her2/neu Overexpressed Human Breast Cancer Cells.

    Science.gov (United States)

    Yang, Zhe; Tang, Wenxin; Luo, Xingen; Zhang, Xiaofang; Zhang, Chao; Li, Hao; Gao, Di; Luo, Huiyan; Jiang, Qing; Liu, Jie

    2015-08-01

    In this study, a dual-ligand polymer-lipid hybrid nanoparticle drug delivery vehicle comprised of an anti-HER2/neu peptide (AHNP) mimic with a modified HIV-1 Tat (mTAT) was established for the targeted treatment of Her2/neu-overexpressing cells. The resultant dual-ligand hybrid nanoparticles (NPs) consisted of a poly(lactide-co-glycolide) core, a near 90% surface coverage of the lipid monolayer, and a 5.7 nm hydrated polyethylene glycol shell. Ligand density optimization study revealed that cellular uptake efficiency of the hybrid NPs could be manipulated by controlling the surface-ligand densities. Furthermore, the cell uptake kinetics and mechanism studies showed that the dual-ligand modifications of hybrid NPs altered the cellular uptake pathway from caveolae-mediated endocytosis (CvME) to the multiple endocytic pathways, which would significantly enhance the NP internalization. Upon the systemic investigation of the cellular uptake behavior of dual-ligand hybrid NPs, docetaxel (DTX), a hydrophobic anticancer drug, was successfully encapsulated into dual-ligand hybrid NPs with high drug loading for Her2/neu-overexpressing SK-BR-3 breast cancer cell treatment. The DTX-loaded dual-ligand hybrid NPs showed a decreased burst release and a more gradual sustained drug release property. Because of the synergistic effect of dual-ligand modification, DTX-loaded dual-ligand hybrid NPs exerted substantially better therapeutic potency against SK-BR-3 cancer cells than other NP formulations and free DTX drugs. These results demonstrate that the dual-ligand hybrid NPs could be a promising vehicle for targeted drug delivery to treat breast cancer.

  19. Plasma membrane proteomics of human breast cancer cell lines identifies potential targets for breast cancer diagnosis and treatment.

    Directory of Open Access Journals (Sweden)

    Yvonne S Ziegler

    Full Text Available The use of broad spectrum chemotherapeutic agents to treat breast cancer results in substantial and debilitating side effects, necessitating the development of targeted therapies to limit tumor proliferation and prevent metastasis. In recent years, the list of approved targeted therapies has expanded, and it includes both monoclonal antibodies and small molecule inhibitors that interfere with key proteins involved in the uncontrolled growth and migration of cancer cells. The targeting of plasma membrane proteins has been most successful to date, and this is reflected in the large representation of these proteins as targets of newer therapies. In view of these facts, experiments were designed to investigate the plasma membrane proteome of a variety of human breast cancer cell lines representing hormone-responsive, ErbB2 over-expressing and triple negative cell types, as well as a benign control. Plasma membranes were isolated by using an aqueous two-phase system, and the resulting proteins were subjected to mass spectrometry analysis. Overall, each of the cell lines expressed some unique proteins, and a number of proteins were expressed in multiple cell lines, but in patterns that did not always follow traditional clinical definitions of breast cancer type. From our data, it can be deduced that most cancer cells possess multiple strategies to promote uncontrolled growth, reflected in aberrant expression of tyrosine kinases, cellular adhesion molecules, and structural proteins. Our data set provides a very rich and complex picture of plasma membrane proteins present on breast cancer cells, and the sorting and categorizing of this data provides interesting insights into the biology, classification, and potential treatment of this prevalent and debilitating disease.

  20. Expression of MLN64 influences cellular matrix adhesion of breast cancer cells, the role for focal adhesion kinase.

    Science.gov (United States)

    Cai, Wei; Ye, Lin; Sun, Jiabang; Mansel, Robert E; Jiang, Wen G

    2010-04-01

    The metastatic lymph node 64 (MLN64) gene was initially identified as highly expressed in the metastatic lymph node from breast cancer. It is localized in q12-q21 of the human chromosome 17 and is often co-amplified with erbB-2. However, the role played by MLN64 in breast cancer remains unclear. In the present study, the expression of MLN64 was examined in a breast cancer cohort using quantitative real-time PCR and immunohistochemical staining. It demonstrated that MLN64 was highly expressed in breast tumours compared to corresponding background tissues at both transcript level and protein level. The elevated level of MLN64 transcripts was correlated with the poor prognosis and overall survival of the patients. A panel of breast cancer cell sublines was subsequently developed by knockdown of MLN64 expression. Loss of MLN64 expression in MCF-7 cells resulted in a significant reduction of cell growth (absorbance for MCF-7DeltaMLN64 being 0.87+/-0.07, Padhesion assay, MDA-MB-231DeltaMLN64 cells showed a significant increase in adhesion (86+/-14), padhesion kinase (FAK) in MDA-MB-231DeltaMLN64 cells using Western blot analysis and immunofluorescent staining of FAK. Moreover, addition of FAK inhibitor to these cells diminished the effect of MLN64 on cell-matrix adhesion, suggesting that FAK contributed to the increased adhesion in MDA-MB-231DeltaMLN64 cells. In conclusion, MLN64 is overexpressed in breast cancer, and its level correlates with poor prognosis and patient survival. MLN64 contributes to the development and progression of breast cancer through the regulation of cell proliferation and adhesive capacity.

  1. Immunologic targeting of FOXP3 in inflammatory breast cancer cells.

    Directory of Open Access Journals (Sweden)

    Smita Nair

    Full Text Available The forkhead transcription factor FOXP3 is necessary for induction of regulatory T lymphocytes (Tregs and their immunosuppressive function. We have previously demonstrated that targeting Tregs by vaccination of mice with murine FOXP3 mRNA-transfected dendritic cells (DCs elicits FOXP3-specific T cell responses and enhances tumor immunity. It is clear that FOXP3 expression is not restricted to T-cell lineage and herein, using RT-PCR, flow cytometry, and western immunoblot we demonstrate for the first time that FOXP3 is expressed in inflammatory breast cancer (IBC cells, SUM149 (triple negative, ErbB1-activated and SUM190 (ErbB2-overexpressing. Importantly, FOXP3-specific T cells generated in vitro using human FOXP3 RNA-transfected DCs as stimulators efficiently lyse SUM149 cells. Interestingly, an isogenic model (rSUM149 derived from SUM149 with an enhanced anti-apoptotic phenotype was resistant to FOXP3-specific T cell mediated lysis. The MHC class I cellular processing mechanism was intact in both cell lines at the protein and transcription levels suggesting that the resistance to cytolysis by rSUM149 cells was not related to MHC class I expression or to the MHC class I antigen processing machinery in these cells. Our data suggest that FOXP3 may be an effective tumor target in IBC cells however increased anti-apoptotic signaling can lead to immune evasion.

  2. Correlation between HER2 gene amplification and protein overexpression through fluorescence in situ hybridization and immunohistochemistry in breast carcinoma patients.

    Science.gov (United States)

    Makroo, R N; Chowdhry, Mohit; Kumar, Manoj; Srivastava, Priyanka; Tyagi, Richa; Bhadauria, Preeti; Kaul, Sumaid; Sarin, Ramesh; Das, P K; Dua, Harsh

    2012-01-01

    In India, the incidence of breast cancer has increased in the urban population, with 1 in every 22 women diagnosed with breast cancer. It is important to know the HER2/neu gene status for a better prognostication of these patients. The aim of this study was to compare the efficacy of fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) for determining HER2/neu alteration in breast carcinoma. A total of 188 histologically proven breast carcinoma cases between the years 2007 and 2011 were retrospectively analyzed on the paraffin tissue sections by both IHC and FISH techniques. FISH for HER2/neu gene amplification was performed on cases where the IHC status was already known and the results were compared. A total of 64 (30%) patients were found to be amplified and the remaining 124 (65.9%) cases were found to be unamplified through FISH. Patients observed with 3+ reading on IHC were later confirmed as unamplified in 29.5% cases through FISH. It has been confirmed with the present study that IHC is a prudent first-step technique to screen tissue samples for HER2/neu gene status, but should be supplemented with the FISH technique especially in equivocal cases.

  3. Correlation between HER2 gene amplification and protein overexpression through fluorescence in situ hybridization and immunohistochemistry in breast carcinoma patients

    Directory of Open Access Journals (Sweden)

    R N Makroo

    2012-01-01

    Full Text Available Background : In India, the incidence of breast cancer has increased in the urban population, with 1 in every 22 women diagnosed with breast cancer. It is important to know the HER2/neu gene status for a better prognostication of these patients. Aim : The aim of this study was to compare the efficacy of fluorescence in situ hybridization (FISH and immunohistochemistry (IHC for determining HER2/neu alteration in breast carcinoma. Materials and Methods : A total of 188 histologically proven breast carcinoma cases between the years 2007 and 2011 were retrospectively analyzed on the paraffin tissue sections by both IHC and FISH techniques. FISH for HER2/neu gene amplification was performed on cases where the IHC status was already known and the results were compared. Results : A total of 64 (30% patients were found to be amplified and the remaining 124 (65.9% cases were found to be unamplified through FISH. Patients observed with 3+ reading on IHC were later confirmed as unamplified in 29.5% cases through FISH. Conclusion : It has been confirmed with the present study that IHC is a prudent first-step technique to screen tissue samples for HER2/neu gene status, but should be supplemented with the FISH technique especially in equivocal cases.

  4. Akt kinases in breast cancer and the results of adjuvant therapy

    International Nuclear Information System (INIS)

    Stål, Olle; Pérez-Tenorio, Gizeh; Åkerberg, Linda; Olsson, Birgit; Nordenskjöld, Bo; Skoog, Lambert; Rutqvist, Lars Erik

    2003-01-01

    The serine/threonine kinase Akt, or protein kinase B, has recently been a focus of interest because of its activity to inhibit apoptosis. It mediates cell survival by acting as a transducer of signals from growth factor receptors that activate phosphatidylinositol 3-kinase. We analysed the expression of the isoforms Akt1 and Akt2 as well as phosphorylated Akt (pAkt) by immunohistochemistry in frozen tumour samples from 280 postmenopausal patients who participated in a randomised trial comparing cyclophosphamide–methotrexate–5-fluorouracil chemotherapy and postoperative radiotherapy. The patients were simultaneously randomised to tamoxifen or to no endocrine treatment. Marked staining was found in 24% of the tumours for Akt1, but in only 4% for Akt2. A low frequency of Akt2-positive cells (1–10%) was observed in another 26% of the tumours. pAkt was significantly associated with both Akt1 and Akt2 expression. Overexpression of erbB2 correlated significantly with pAkt (P = 0.0028). The benefit from tamoxifen was analysed in oestrogen receptor (ER)-positive patients. Patients with a negative status of Akt (no overexpression of Akt1, Akt2 or pAkt) showed significant benefit from tamoxifen. The relative rate of distant recurrence, with versus without tamoxifen, was 0.44 (95% confidence interval [CI], 0.25–0.79) for ER+/Akt1- patients, while it was 0.72 (95% CI, 0.34–1.53) for ER+/Akt1+ patients. The difference in rate ratio did not reach statistical significance. The rate of locoregional recurrence was significantly decreased with radiotherapy versus chemotherapy for Akt-negative patients (rate ratio, 0.23; 95% CI, 0.08–0.67; P = 0.0074), while no benefit was evident for the Akt-positive subgroup (rate ratio, 0.77; 95% CI, 0.31–1.9; P = 0.58). The interaction between Akt and the efficacy of radiotherapy was significant in multivariate analysis (P = 0.042). Activation of the Akt pathway is correlated with erbB2 overexpression in breast cancer. The results

  5. Overexpression of MMP-3 and uPA with Diminished PAI-1 Related to Metastasis in Ductal Breast Cancer Patients Attending a Public Hospital in Mexico City

    Directory of Open Access Journals (Sweden)

    Luis Miguel Barajas-Castañeda

    2016-01-01

    Full Text Available Extracellular matrix metalloproteases and the fibrinolytic system are important protease systems interacting with each other in charge of remodeling and recycling of tissues. Their role in tumor invasion and metastasis is often discussed. In this study several metalloproteases such as MMP-1, MMP-3, MMP-9, and TIMP-1 together with molecules from the fibrinolytic system like uPA, its receptor uPAR, and its inhibitor, PAI-1, were studied by immune-histochemistry to establish a comparison with and without metastasis. From the (118 primary tumors of Mexican patients with ductal breast cancer studied, 56% were grade II and 69% were size T2; the group with metastatic ganglia included 64 samples (54.3%. In patients with metastasis the estimated expression of MMP-3 and uPA (resp., 28% and 45% was higher than that from no metastatic tumors; it means there is higher expression of both markers in metastatic tumors (p<0.05. At the same time, metastatic tumors showed statistically significant lower signal of PAI-1 (24% than tumors without metastasis (p<0.05. We concluded that overexpression of MMP-3 and uPA, altogether with diminished expression of PAI-1 from metastatic tumors, might be a crucial step towards metastasis in ductal breast cancer. Nevertheless, additional studies in different populations are necessary to establish a pattern.

  6. Macrophage Functions in Early Dissemination and Dormancy of Breast Cancer

    Science.gov (United States)

    2016-09-01

    mammary gland development 17,18, 69   arguing that normal mammary epithelial cells cooperate with these innate immune cells 70   for invasive... cells lacking 218     11   lymphoid and granulocytic markers (Supplementary Fig.3B). viSNE plots 30 of myelo-219   monocytic cells (Fig.5A...macrophages are actively recruited by pre-malignant ErbB2 overexpressing cancer cells and that these intra-epithelial macrophages then produce factors

  7. Invasive micropapillary carcinoma of the breast overexpresses MUC4 and is associated with poor outcome to adjuvant trastuzumab in HER2-positive breast cancer.

    Science.gov (United States)

    Mercogliano, María F; Inurrigarro, Gloria; De Martino, Mara; Venturutti, Leandro; Rivas, Martín A; Cordo-Russo, Rosalía; Proietti, Cecilia J; Fernández, Elmer A; Frahm, Isabel; Barchuk, Sabrina; Allemand, Daniel H; Figurelli, Silvina; Deza, Ernesto Gil; Ares, Sandra; Gercovich, Felipe G; Cortese, Eduardo; Amasino, Matías; Guzmán, Pablo; Roa, Juan C; Elizalde, Patricia V; Schillaci, Roxana

    2017-12-28

    Invasive micropapillary carcinoma of the breast (IMPC) is a histological tumor variant that occurs with low frequency characterized by an inside-out formation of tumor clusters with a pseudopapillary arrangement. IMPC is an aggressive tumor with poor clinical outcome. In addition, this histological subtype usually expresses human epidermal growth factor receptor 2 (HER2) which also correlates with a more aggressive tumor. In this work we studied the clinical significance of IMPC in HER2-positive breast cancer patients treated with adjuvant trastuzumab. We also analyzed mucin 4 (MUC4) expression as a novel biomarker to identify IMPC. We retrospectively studied 86 HER2-positive breast cancer patients treated with trastuzumab and chemotherapy in the adjuvant setting. We explored the association of the IMPC component with clinicopathological parameters at diagnosis and its prognostic value. We compared MUC4 expression in IMPC with respect to other histological breast cancer subtypes by immunohistochemistry. IMPC, either as a pure entity or associated with invasive ductal carcinoma (IDC), was present in 18.6% of HER2-positive cases. It was positively correlated with estrogen receptor expression and tumor size and inversely correlated with patient's age. Disease-free survival was significantly lower in patients with IMPC (hazard ratio = 2.6; 95%, confidence interval 1.1-6.1, P = 0.0340). MUC4, a glycoprotein associated with metastasis, was strongly expressed in all IMPC cases tested. IMPC appeared as the histological breast cancer subtype with the highest MUC4 expression compared to IDC, lobular and mucinous carcinoma. In HER2-positive breast cancer, the presence of IMPC should be carefully examined. As it is often not informed, because it is relatively difficult to identify or altogether overlooked, we propose MUC4 expression as a useful biomarker to highlight IMPC presence. Patients with MUC4-positive tumors with IMPC component should be more frequently

  8. Optimized high-throughput microRNA expression profiling provides novel biomarker assessment of clinical prostate and breast cancer biopsies

    Directory of Open Access Journals (Sweden)

    Fedele Vita

    2006-06-01

    Full Text Available Abstract Background Recent studies indicate that microRNAs (miRNAs are mechanistically involved in the development of various human malignancies, suggesting that they represent a promising new class of cancer biomarkers. However, previously reported methods for measuring miRNA expression consume large amounts of tissue, prohibiting high-throughput miRNA profiling from typically small clinical samples such as excision or core needle biopsies of breast or prostate cancer. Here we describe a novel combination of linear amplification and labeling of miRNA for highly sensitive expression microarray profiling requiring only picogram quantities of purified microRNA. Results Comparison of microarray and qRT-PCR measured miRNA levels from two different prostate cancer cell lines showed concordance between the two platforms (Pearson correlation R2 = 0.81; and extension of the amplification, labeling and microarray platform was successfully demonstrated using clinical core and excision biopsy samples from breast and prostate cancer patients. Unsupervised clustering analysis of the prostate biopsy microarrays separated advanced and metastatic prostate cancers from pooled normal prostatic samples and from a non-malignant precursor lesion. Unsupervised clustering of the breast cancer microarrays significantly distinguished ErbB2-positive/ER-negative, ErbB2-positive/ER-positive, and ErbB2-negative/ER-positive breast cancer phenotypes (Fisher exact test, p = 0.03; as well, supervised analysis of these microarray profiles identified distinct miRNA subsets distinguishing ErbB2-positive from ErbB2-negative and ER-positive from ER-negative breast cancers, independent of other clinically important parameters (patient age; tumor size, node status and proliferation index. Conclusion In sum, these findings demonstrate that optimized high-throughput microRNA expression profiling offers novel biomarker identification from typically small clinical samples such as breast

  9. Primary breast cancer imaging with technetium-99m sestamibi and its relation with P-glycoprotein overexpression

    Energy Technology Data Exchange (ETDEWEB)

    Moretti, J.L. [Medicine Nucleaire, CHU Bobigny, Paris (France); Azaloux, H. [Medicine Nucleaire Oncologie, Hopital P. Zobda Quitman, Fort de France (France); Boisseron, D. [Medicine Nucleaire Oncologie, Hopital P. Zobda Quitman, Fort de France (France); Kouyoumdjian, J.C. [Service de Biochemie, Hopital Henri Mondor, Creteil (France); Vilcoq, J. [Service de Cancerologie-Radiotherapie, Inst. Curie, Paris (France)

    1996-08-01

    The aim of this preliminary study was to evaluate retrospectively sestamibi scintigraphy in relation to the presence of the 170-kDa P-glycoprotein (Pgp), which represents an expression of multidrug resistance in patients with primary breast cancer. Fifteen women (age range 37-76 years) were referred for technetium-99m sestamibi scintigraphy because of suspicious breast lesions detected by mammography and ultrasonography, and subsequently assessed by fine-needle aspiration. Scintigraphy was performed 30 min following the injection of 500 MBq {sup 99m}Tc-sestamibi. Three planar anterior and oblique images were obtained with the patient in the supine position. Excised tumours were assessed for cytosolic CA 15.3, oestrogen (OR) and progesterone (PR) receptors and c-erb B2 neu oncogene. Pathology revealed that only 13 of the 15 patients had malignant tumours. The two benign tumours were sestamibi-negative and Pgp-positive. Sestamibi scintigraphy was positive in 10 of the 13 malignant lesions (including nine of ten infiltrating ductal carcinomas). Two of the three lesions with false-negative scintigraphy were Pgp-negative; in one of these cases histology revealed an invasive lobular carcinoma and in the other, mucinous adenocarcinoma. The third false-negative lesion was a Pgp-positive infiltrating ductal carcinoma which was c-erb B2 neu-negative but CA 15.3-, OR- and PR-positive. This preliminary study confirms that the resistance to chemotherapy which may occur in patients with primary breast cancer can be a cause of negative sestamibi scintigraphy. (orig.)

  10. A Novel Human Ghrelin Variant (In1-Ghrelin) and Ghrelin-O-Acyltransferase Are Overexpressed in Breast Cancer: Potential Pathophysiological Relevance

    Science.gov (United States)

    Gahete, Manuel D.; Córdoba-Chacón, José; Hergueta-Redondo, Marta; Martínez-Fuentes, Antonio J.; Kineman, Rhonda D.; Moreno-Bueno, Gema

    2011-01-01

    The human ghrelin gene, which encodes the ghrelin and obestatin peptides, contains 5 exons (Ex), with Ex1-Ex4 encoding a 117 amino-acid (aa) preproprotein that is known to be processed to yield a 28-aa (ghrelin) and/or a 23-aa (obestatin) mature peptides, which possess biological activities in multiple tissues. However, the ghrelin gene also encodes additional peptides through alternative splicing or post-translational modifications. Indeed, we previously identified a spliced mRNA ghrelin variant in mouse (In2-ghrelin-variant), which is regulated in a tissue-dependent manner by metabolic status and may thus be of biological relevance. Here, we have characterized a new human ghrelin variant that contains Ex0-1, intron (In) 1, and Ex2 and lacks Ex3-4. This human In1-ghrelin variant would encode a new prepropeptide that conserves the first 12aa of native-ghrelin (including the Ser3-potential octanoylation site) but has a different C-terminal tail. Expression of In1-variant was detected in 22 human tissues and its levels were positively correlated with those of ghrelin-O-acyltransferase (GOAT; p = 0.0001) but not with native-ghrelin expression, suggesting that In1-ghrelin could be a primary substrate for GOAT in human tissues. Interestingly, levels of In1-ghrelin variant expression in breast cancer samples were 8-times higher than those of normal mammary tissue, and showed a strong correlation in breast tumors with GOAT (p = 0.0001), ghrelin receptor-type 1b (GHSR1b; p = 0.049) and cyclin-D3 (a cell-cycle inducer/proliferation marker; p = 0.009), but not with native-ghrelin or GHSR1a expression. Interestingly, In1-ghrelin variant overexpression increased basal proliferation of MDA-MB-231 breast cancer cells. Taken together, our results provide evidence that In1-ghrelin is a novel element of the ghrelin family with a potential pathophysiological role in breast cancer. PMID:21829727

  11. Anti-HER2 immunoliposomes for selective delivery of electron paramagnetic resonance imaging probes to HER2-overexpressing breast tumor cells

    Science.gov (United States)

    Burks, Scott R.; Macedo, Luciana F.; Barth, Eugene D.; Tkaczuk, Katherine H.; Martin, Stuart S.; Rosen, Gerald M.; Halpern, Howard J.; Brodie, Angela M.

    2014-01-01

    Electron paramagnetic resonance (EPR) imaging is an emerging modality that can detect and localize paramagnetic molecular probes (so-called spin probes) in vivo. We previously demonstrated that nitroxide spin probes can be encapsulated in liposomes at concentrations exceeding 100 mM, at which nitroxides exhibit a concentration-dependent quenching of their EPR signal that is analogous to the self-quenching of fluorescent molecules. Therefore, intact liposomes encapsulating high concentrations of nitroxides exhibit greatly attenuated EPR spectral signals, and endocytosis of such liposomes represents a cell-activated contrast-generating mechanism. After endocytosis, the encapsulated nitroxide is liberated and becomes greatly diluted in the intracellular milieu. This dequenches the nitroxides to generate a robust intracellular EPR signal. It is therefore possible to deliver a high concentration of nitroxides to cells while minimizing background signal from unendocytosed liposomes. We report here that intracellular EPR signal can be selectively generated in a specific cell type by exploiting its expression of Human Epidermal Growth Factor Receptor 2 (HER2). When targeted by anti-HER2 immunoliposomes encapsulating quenched nitroxides, Hc7 cells, which are novel HER2-overexpressing cells derived from the MCF7 breast tumor cell line, endocytose the liposomes copiously, in contrast to the parent MCF7 cells or control CV1 cells, which do not express HER2. HER2-dependent liposomal delivery enables Hc7 cells to accumulate 750 μM nitroxide intracellularly. Through the use of phantom models, we verify that this concentration of nitroxides is more than sufficient for EPR imaging, thus laying the foundation for using EPR imaging to visualize HER2-overexpressing Hc7 tumors in animals. PMID:20066490

  12. Optimized preparation and preliminary evaluation of [64Cu]-DOTA-trastuzumab for targeting ErbB2/Neu expression

    International Nuclear Information System (INIS)

    Behrooz Alirezapour; Mohammad Javad Rasaee

    2013-01-01

    Breast cancer radioimmunoscintigraphy targeting HER2/neu expression is a growing field of work in nuclear medicine research. Trastuzumab is a monoclonal antibody that binds with high affinity to HER2/neu, which is over expressed on breast and other tumors. Developing new tracers for the detection of this cancer is of great interest. In this study, trastuzumab was successively labeled with [ 64 Cu]CuCl 2 after conjugation with DOTA-NHS-ester. The conjugate was purified by molecular filtration, the average number of DOTA conjugated per mAb was calculated and total concentration was determined by spectrophotometric method. DOTA-trastuzumab was labeled with 64 Cu produced by 68 Zn(p,αn) 64 Cu nuclear reaction (30 MeV protons at 180 μA). Radiochemical purity, integrity of protein after radiolabeling and immunoreactivity of radiolabeled mAb trastuzumab with HER2/neu antigen and SkBr3 cell line were performed by RIA. In vitro stability of radiolabeled mAb in human serum was determined by thin layer chromatography. In vitro internalization studies were performed with the SkBr3 cell line and the tissue biodistribution of the 64 Cu-DOTA-trastuzumab was evaluated in wild-type rat (90 ± 5.5 μCi, 2, 6, 12, 24 h p.i.). The radioimmunoconjugate was prepared with a radiochemical purity of higher than 96 ± 0.5 % (ITLC) and specific activity as high as 5.3 μCi/μg. The average number of chelators per antibody for the conjugate used in this study was 5.8/1. The sample was showed to have similar patterns of migration in the gel electrophoresis. The 64 Cu-DOTA-trastuzumab showed high immunoreactivity towards HER2/neu antigen and SkBr3 cell line. In vitro stability of the labeled product was found to be more than 94 % in PBS and 82 ± 0.5 % in human serum over 48 h. In vitro internalization studies of the 64 Cu-DOTA-trastuzumab showed that up to 11.5 % of the radioimmunoconjugate internalized after 10 h. The accumulation of the radiolabeled mAb in liver, skin, intestine, lung

  13. Efficacy of weekly trastuzumab and paclitaxel in the treatment of women with HER-2/neu overexpressing metastatic breast cancer. The impact of taxane free interval on treatment outcomes

    International Nuclear Information System (INIS)

    Janku, P.; Petruzelka, L.; Pribylova, O.; Honova, H.; Pecen, L.; Zimovjanova, M.; Pazdrova, G.; Safanda, M.; Konopasek, B.; Zemanova, M.; Vedralova, J.

    2002-01-01

    Purpose. Trastuzumab is known as an active agent in HER2/neu overexpressing metastatic breast cancer. In the prospective study we investigated efficacy, safety and toxicity of trastuzumab and paclitaxel in metastatic breast cancer progressing on previous therapy. Patients and methods. We accrued 17 patients with histologically confirmed breast cancer, Karnofsky performance status at least 60 %, median age 50 (36-66), pretreated with at least two regimens. HER-2/neu expression was tested by HercepTest (r) (DAKO) in all 17 patients. Fifteen specimens were 3+ positive and 2 specimens 2+ positive. All patients except one were pretreated with taxanes. Taxane free interval (TFI) was defined as a time from last taxane administration until the beginning of the study for every enrolled patient. TFI longer than 1 year was found in 7 patients. TFI shorter than 1 year was observed in 9 patients. Trastuzumab was given 4 mg/kg i.v. as a loading dose followed by 2 mg/kg i.v. weekly. Paclitaxel was given 80 mg/m 2 i.v. weekly until disease progression or unacceptable toxicity. We assessed the response rate (RR), the time to progression (TTP), the survival (OS) and toxicity. Results. In the intent to treat population we found objective response in 10 patients (59 %), including 2 complete responses (CR). In the subset with TFI > 1 year we observed response in 4 cases including 1 CR (RR 57 %). In TFI ≤ 1 year subgroup we observed response in 6 cases also with 1 CR (RR 67 %). TFI was not statistically significant for response (p 1 year tend to have longer TTP (p = 0,0201). Median OS has not been reached with 10 patients surviving. We administered 599 cycles including 473 cycles of trastuzumab and paclitaxel with no dose adjustment. One patient developed hypersensitivity reaction on the first trastuzumab infusion and was excluded from study. The most common toxicity was trastuzumab infusion related pyretic reaction observed in 6 patients. Dose limiting adverse effect which led to the

  14. Strong adverse effect of epidermal growth factor receptor 2 overexpression on prognosis of patients with invasive lobular breast cancer: a comparative study with invasive ductal breast cancer in Chinese population.

    Science.gov (United States)

    Wang, Tong; Ma, Yuanyuan; Wang, Liang; Liu, Hong; Chen, Meixuan; Niu, Ruifang

    2015-08-01

    The data on the outcome of breast invasive lobular carcinoma (ILC) are conflicting. In addition, the prognostic effect of molecular subtypes on ILC remains unclear. In this study, the clinicopathological and prognostic data between 269 ILC and 816 invasive ductal carcinoma (IDC) cases in a Chinese population were extensively compared, with a median follow-up time of 7.8 years. Compared with the IDC group, ILC tumors had more lymph node invasion, hormonal receptor positivity, and human epidermal growth factor receptor 2 (HER2) negativity. ILC patients showed overall survival (OS) and recurrence/metastasis-free survival (RFS) rates similar to those of IDC patients but exhibited worse disease-free survival (DFS) rate because of the higher rate of contralateral breast cancer (BC). Further analysis showed that OS, RFS, and DFS were similar between ILC and IDC patients in the subgroups of luminal A and triple-negative BC with HER2 negativity but were worse in ILC patients than those in IDC patients in the subgroups of luminal B and HER2 overexpression with positive HER2 expression. Multivariate analysis indicated HER2 positivity as an independent risk factor for OS, RFS, and DFS of ILC patients, which increased the risk in the ILC group than that in IDC group. The interaction of HER2 and ILC was also defined as an independent risk factor for OS, RFS, and DFS of the entire population. In conclusion, overexpression of HER2 exhibited stronger negative effect on the prognosis of ILC patients than that in IDC patients, suggesting that treatment targeting HER2 is crucial for this BC subgroup.

  15. Multiple facets of sialomucin complex/MUC4, a membrane mucin and erbb2 ligand, in tumors and tissues (Y2K update).

    Science.gov (United States)

    Carraway, K L; Price-Schiavi, S A; Komatsu, M; Idris, N; Perez, A; Li, P; Jepson, S; Zhu, X; Carvajal, M E; Carraway, C A

    2000-01-01

    Sialomucin complex (SMC, MUC4) is a high Mr glycoprotein heterodimer, composed of mucin (ASGP-1) and transmembrane (ASGP-2) subunits. ASGP-2 contains two EGF-like domains and acts as an intramembrane ligand for the receptor tyrosine kinase ErbB2. Transfection studies with SMC DNAs showed that SMC expression could markedly reduce both cell-cell and cell-matrix interactions in vitro and increase the growth of primary tumors and the formation of metastatic foci of human A375 melanoma cells as xenotransplants in nude mice, possibly through the ability to suppress apoptosis. SMC is expressed in most vulnerable epithelia as a protective agent, which is found in both membrane and soluble forms at luminal surfaces and secreted into fluids such as milk and tears. SMC appears to be constitutively expressed by most accessible epithelia, notable exceptions being the mammary gland and uterine luminal epithelium, in which it is tightly regulated during pregnancy. Down-regulation at the luminal uterine surface appears necessary for blastocyst implantation. TGF-b is a potent repressor of SMC expression in the mammary gland and uterus, though by different mechanisms. These combined results suggest that SMC has multiple functions in epithelia and is tightly regulated in those tissues where its special functions are required.

  16. Trichostatin A suppresses lung adenocarcinoma development in Grg1 overexpressing transgenic mice

    International Nuclear Information System (INIS)

    Liu, Ju; Li, Yan; Dong, Fengyun; Li, Liqun; Masuda, Takahiro; Allen, Thaddeus D.; Lobe, Corrinne G.

    2015-01-01

    Trichostatin A (TSA) is a histone deacetylase inhibitor and a potential therapeutic for various malignancies. The in vivo effect of TSA, however, has not been investigated in a transgenic lung cancer model. Previously, we generated transgenic mice with overexpression of Groucho-related-gene 1 (Grg1) and these mice all developed mucinous lung adenocarcinoma. Grg1 is a transcriptional co-repressor protein, the function of which is thought to depend on HDAC activity. However, functions outside the nucleus have also been proposed. We tested the supposition that Grg1-induced tumorigenesis is HDAC-dependent by assaying the therapeutic effect of TSA in the Grg1 transgenic mouse model. We found that TSA significantly inhibited lung tumorigenesis in Grg1 transgenic mice (p < 0.01). TSA did not affect overall Grg1 protein levels, but instead reduced ErbB1 and ErbB2 expression, which are upregulated by Grg1 in the absence of TSA. We confirmed this effect in A549 cells. Furthermore, lapatinib, an inhibitor of both ErbB1 and ErbB2, effectively masked the effect of TSA on the inhibition of A549 cell proliferation and migration, suggesting TSA does work, at least in part, by downregulating ErbB receptors. We additionally found that TSA reduced the expression of VEGF and VEGFR2, but not basic FGF and FGFR1. Our findings indicate that TSA effectively inhibits Grg1-induced lung tumorigenesis through the down-regulation of ErbB1 and ErbB2, as well as reduced VEGF signaling. This suggests TSA and other HDAC inhibitors could have therapeutic value in the treatment of lung cancers with Grg1 overexpression. - Highlights: • TSA suppresses lung tumorigenesis in Grg1 overexpressing transgenic mice. • TSA does not affect overall Grg1 protein levels in the mice and in A549 cells. • TSA reduces ErbB1 and ErbB2 expression in the mice and in A549 cells. • Lapatinib masks TSA-induced inhibition of A549 cell proliferation and migration. • TSA inhibits VEGF signaling, but not basic FGF

  17. Trichostatin A suppresses lung adenocarcinoma development in Grg1 overexpressing transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ju, E-mail: ju.liu@sdu.edu.cn [Medical Research Center, Shandong Provincial Qianfoshan Hospital, Shandong University, 16766 Jingshi Road, Jinan (China); Molecular and Cellular Biology Division, Sunnybrook Health Science Centre, University of Toronto, 2075 Bayview Avenue, Toronto, Ontario M4N 3M5 (Canada); Li, Yan [Children' s Health Care Center, Shandong Provincial Qianfoshan Hospital, Shandong University, 16766 Jingshi Road, Jinan, Shandong 250014 (China); Dong, Fengyun; Li, Liqun [Medical Research Center, Shandong Provincial Qianfoshan Hospital, Shandong University, 16766 Jingshi Road, Jinan (China); Masuda, Takahiro; Allen, Thaddeus D. [Molecular and Cellular Biology Division, Sunnybrook Health Science Centre, University of Toronto, 2075 Bayview Avenue, Toronto, Ontario M4N 3M5 (Canada); Lobe, Corrinne G. [Molecular and Cellular Biology Division, Sunnybrook Health Science Centre, University of Toronto, 2075 Bayview Avenue, Toronto, Ontario M4N 3M5 (Canada); Miami Mice Research Corp., MaRS Centre, Heritage Bldg., 101 College Street, Toronto, Ontario M5G 1L7 (Canada)

    2015-08-07

    Trichostatin A (TSA) is a histone deacetylase inhibitor and a potential therapeutic for various malignancies. The in vivo effect of TSA, however, has not been investigated in a transgenic lung cancer model. Previously, we generated transgenic mice with overexpression of Groucho-related-gene 1 (Grg1) and these mice all developed mucinous lung adenocarcinoma. Grg1 is a transcriptional co-repressor protein, the function of which is thought to depend on HDAC activity. However, functions outside the nucleus have also been proposed. We tested the supposition that Grg1-induced tumorigenesis is HDAC-dependent by assaying the therapeutic effect of TSA in the Grg1 transgenic mouse model. We found that TSA significantly inhibited lung tumorigenesis in Grg1 transgenic mice (p < 0.01). TSA did not affect overall Grg1 protein levels, but instead reduced ErbB1 and ErbB2 expression, which are upregulated by Grg1 in the absence of TSA. We confirmed this effect in A549 cells. Furthermore, lapatinib, an inhibitor of both ErbB1 and ErbB2, effectively masked the effect of TSA on the inhibition of A549 cell proliferation and migration, suggesting TSA does work, at least in part, by downregulating ErbB receptors. We additionally found that TSA reduced the expression of VEGF and VEGFR2, but not basic FGF and FGFR1. Our findings indicate that TSA effectively inhibits Grg1-induced lung tumorigenesis through the down-regulation of ErbB1 and ErbB2, as well as reduced VEGF signaling. This suggests TSA and other HDAC inhibitors could have therapeutic value in the treatment of lung cancers with Grg1 overexpression. - Highlights: • TSA suppresses lung tumorigenesis in Grg1 overexpressing transgenic mice. • TSA does not affect overall Grg1 protein levels in the mice and in A549 cells. • TSA reduces ErbB1 and ErbB2 expression in the mice and in A549 cells. • Lapatinib masks TSA-induced inhibition of A549 cell proliferation and migration. • TSA inhibits VEGF signaling, but not basic FGF

  18. Flavopiridol Synergizes with Sorafenib to Induce Cytotoxicity and Potentiate Antitumorigenic Activity in EGFR/HER-2 and Mutant RAS/RAF Breast Cancer Model Systems

    Directory of Open Access Journals (Sweden)

    Teddy S Nagaria

    2013-08-01

    Full Text Available Oncogenic receptor tyrosine kinase (RTK signaling through the Ras-Raf-Mek-Erk (Ras-MAPK pathway is implicated in a wide array of carcinomas, including those of the breast. The cyclin-dependent kinases (CDKs are implicated in regulating proliferative and survival signaling downstream of this pathway. Here, we show that CDK inhibitors exhibit an order of magnitude greater cytotoxic potency than a suite of inhibitors targeting RTK and Ras-MAPK signaling in cell lines representative of clinically recognized breast cancer (BC subtypes. Drug combination studies show that the pan-CDK inhibitor, flavopiridol (FPD, synergistically potentiated cytotoxicity induced by the Raf inhibitor, sorafenib (SFN. This synergy was most pronounced at sub-EC50 SFN concentrations in MDA-MB-231 (KRAS-G13D and BRAF-G464V mutations, MDA-MB-468 [epidermal growth factor receptor (EGFR overexpression], and SKBR3 [ErbB2/EGFR2 (HER-2 overexpression] cells but not in hormone-dependent MCF-7 and T47D cells. Potentiation of SFN cytotoxicity by FPD correlated with enhanced apoptosis, suppression of retinoblastoma (Rb signaling, and reduced Mcl-1 expression. SFN and FPD were also tested in an MDA-MB-231 mammary fat pad engraftment model of tumorigenesis. Mice treated with both drugs exhibited reduced primary tumor growth rates and metastatic tumor load in the lungs compared to treatment with either drug alone, and this correlated with greater reductions in Rb signaling and Mcl-1 expression in resected tumors. These findings support the development of CDK and Raf co-targeting strategies in EGFR/HER-2-overexpressing or RAS/RAF mutant BCs.

  19. Molecular genetics of breast cancer

    International Nuclear Information System (INIS)

    Radice, P.; Pierotti, M. A.

    1997-01-01

    In the last two decades, molecular studies have enlightened the complexity of the genetic alterations that occur in breast cancer cells. To date, more than 40 different genes or loci have been found to be altered in breast carcinomas. Although some of these genes, as for example ERBB2, appear to be mutated in a high proportion of cases, their mechanism of action and their role in the different stages of cancer development are still poorly understood. More recently, two major determinants of the inherited predisposition to breast cancer, BRCA1 and BRCA2, have been isolated. As a consequence, it is now possible to screen families with a positive history of breast carcinomas for the identification of mutations carriers, in order to address these individuals into adequate programs of cancer surveillance and prevention

  20. Constitutively active ErbB2 regulates cisplatin-induced cell death in breast cancer cells via pro- and antiapoptotic mechanisms

    DEFF Research Database (Denmark)

    Sigurðsson, Haraldur H; Olesen, Christina Wilkens; Dybboe, Rie

    2015-01-01

    cancer cell death, and determine how NHE1 regulates this process. Cisplatin treatment elicited apoptosis, ATM phosphorylation, upregulation of p53, Noxa (PMAIP1), and PUMA (BBC3), and cleavage of caspase-9, -7, fodrin, and PARP-1 in MCF-7 cells. Inducible ΔNErbB2 expression strongly reduced cisplatin...

  1. The Role of Novel Substituted Diindolyl Methane Analogues in the Treatment of Triple Negative and ErbB2 Positive Breast Cancer

    Science.gov (United States)

    2017-07-01

    0.34, 4.35 ± 0.48 and 5.61 ± 0.30 mm, respectively. All three cell lines showed more potency toward GA and GAL with little variations between their...such variation could be the passage number of injected MDA-MB- 231 cells. We have injected the cells which were freshly cultivated from tumor tissue...anticancer drugs berberine and betulinic acid, PLoS ONE 9 (3) (2014) e89919. [11] A.A. Goldberg , H. Draz, D. Montes-Grajales, J. Olivero-Verbel, S.H. Safe

  2. The Role of Novel Substituted Diindolyl Methane Analogues in the Treatment of Triple-Negative and ErbB2-Positive Breast Cancer

    Science.gov (United States)

    2015-05-01

    factor and mediates vascular smooth muscle cell proliferation, J. Biol. Chem. 281 (2006) 33467–33476. [175] T. Nomiyama, Y. Zhao, F. Gizard, H.M. Findeisen ...vascular injury, Circulation 119 (2009) 577–586. [176] F. Gizard, Y. Zhao, H.M. Findeisen , H. Qing, D. Cohn, E.B. Heywood, K.L. Jones, T. Nomiyama, D...cell growth, Atherosclerosis 184 (2006) 276–282. [180] Y. Zhao, D.A. Howatt, F. Gizard, T. Nomiyama, H.M. Findeisen , E.B. Heywood, K. L. Jones, O.M

  3. Overexpression of the ATP-binding cassette half-transporter, ABCG2 (Mxr/BCrp/ABCP1), in flavopiridol-resistant human breast cancer cells

    DEFF Research Database (Denmark)

    Robey, R W; Medina-Pérez, W Y; Nishiyama, K

    2001-01-01

    We sought to characterize the interactions of flavopiridol with members of the ATP-binding cassette (ABC) transporter family. Cells overexpressing multidrug resistance-1 (MDR-1) and multidrug resistance-associated protein (MRP) did not exhibit appreciable flavopiridol resistance, whereas cell lines...... overexpressing the ABC half-transporter, ABCG2 (MXR/BCRP/ABCP1), were found to be resistant to flavopiridol. Flavopiridol at a concentration of 10 microM was able to prevent MRP-mediated calcein efflux, whereas Pgp-mediated transport of rhodamine 123 was unaffected at flavopiridol concentrations of up to 100...... analysis revealed overexpression of the ABCG2 gene. Western blot confirmed overexpression of ABCG2; neither P-glycoprotein nor MRP overexpression was detected. These results suggest that ABCG2 plays a role in resistance to flavopiridol....

  4. Neoadjuvant therapy for early-stage breast cancer: the clinical utility of pertuzumab

    Directory of Open Access Journals (Sweden)

    Gollamudi J

    2016-02-01

    Full Text Available Jahnavi Gollamudi,1,* Jenny G Parvani,2,* William P Schiemann,3 Shaveta Vinayak3,4 1Department of Internal Medicine, 2Department of Biomedical Engineering, 3Case Comprehensive Cancer Center, Case Western Reserve University, 4Department of Hematology and Oncology, University Hospitals Case Medical Center, Cleveland, OH, USA *These authors contributed equally to this work Abstract: Approximately 20% of breast cancer patients harbor tumors that overexpress human epidermal growth factor receptor 2 (HER2; also known as ErbB2, a receptor tyrosine kinase that belongs to the epidermal growth factor receptor family of receptor tyrosine kinases. HER2 amplification and hyperactivation drive the growth and survival of breast cancers through the aberrant activation of proto-oncogenic signaling systems, particularly the Ras/MAP kinase and PI3K/AKT pathways. Although HER2-positive (HER2+ breast cancer was originally considered to be a highly aggressive form of the disease, the clinical landscape of HER2+ breast cancers has literally been transformed by the approval of anti-HER2 agents for adjuvant and neoadjuvant settings. Indeed, pertuzumab is a novel monoclonal antibody that functions as an anti-HER2 agent by targeting the extracellular dimerization domain of the HER2 receptor; it is also the first drug to receive an accelerated approval by the US Food and Drug Administration for use in neoadjuvant settings in early-stage HER2+ breast cancer. Here, we review the molecular and cellular factors that contribute to the pathophysiology of HER2 in breast cancer, as well as summarize the landmark preclinical and clinical findings underlying the approval and use of pertuzumab in the neoadjuvant setting. Finally, the molecular mechanisms operant in mediating resistance to anti-HER2 agents, and perhaps to pertuzumab as well, will be discussed, as will the anticipated clinical impact and future directions of pertuzumab in breast cancer patients. Keywords: breast cancer

  5. miR-630 targets IGF1R to regulate response to HER-targeting drugs and overall cancer cell progression in HER2 over-expressing breast cancer.

    Science.gov (United States)

    Corcoran, Claire; Rani, Sweta; Breslin, Susan; Gogarty, Martina; Ghobrial, Irene M; Crown, John; O'Driscoll, Lorraine

    2014-03-24

    While the treatment of HER2 over-expressing breast cancer with recent HER-targeted drugs has been highly effective for some patients, primary (also known as innate) or acquired resistance limits the success of these drugs. microRNAs have potential as diagnostic, prognostic and predictive biomarkers, as well as replacement therapies. Here we investigated the role of microRNA-630 (miR-630) in breast cancer progression and as a predictive biomarker for response to HER-targeting drugs, ultimately yielding potential as a therapeutic approach to add value to these drugs. We investigated the levels of intra- and extracellular miR-630 in cells and conditioned media from breast cancer cell lines with either innate- or acquired- resistance to HER-targeting lapatinib and neratinib, compared to their corresponding drug sensitive cell lines, using qPCR. To support the role of miR-630 in breast cancer, we examined the clinical relevance of this miRNA in breast cancer tumours versus matched peritumours. Transfection of miR-630 mimics and inhibitors was used to manipulate the expression of miR-630 to assess effects on response to HER-targeting drugs (lapatinib, neratinib and afatinib). Other phenotypic changes associated with cellular aggressiveness were evaluated by motility, invasion and anoikis assays. TargetScan prediction software, qPCR, immunoblotting and ELISAs, were used to assess miR-630's regulation of mRNA, proteins and their phosphorylated forms. We established that introducing miR-630 into cells with innate- or acquired- resistance to HER-drugs significantly restored the efficacy of lapatinib, neratinib and afatinib; through a mechanism which we have determined to, at least partly, involve miR-630's regulation of IGF1R. Conversely, we demonstrated that blocking miR-630 induced resistance/insensitivity to these drugs. Cellular motility, invasion, and anoikis were also observed as significantly altered by miR-630 manipulation, whereby introducing miR-630 into cells

  6. Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

    Science.gov (United States)

    Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

    2017-01-01

    Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

  7. Novel targeted approaches to treating biliary tract cancer: the dual epidermal growth factor receptor and ErbB-2 tyrosine kinase inhibitor NVP-AEE788 is more efficient than the epidermal growth factor receptor inhibitors gefitinib and erlotinib.

    Science.gov (United States)

    Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel

    2006-08-01

    Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer cell lines. Gefitinib, erlotinib and NVP-AEE788 caused a significant growth inhibition in vitro; however, there was a significant difference in efficacy (NVP-AEE788>erlotinib>gefitinib). After 14 days of in-vivo treatment, using the chimeric mouse model, tumors had a significantly reduced volume and mass after NVP-AEE788, but not after erlotinib treatment, as compared with placebo. Reduction of proliferation (signalling via the mitogen-activated protein kinase pathway), induction of apoptosis and inhibition of angiogenesis were the main mechanisms of drug action. No significant reduction of anti-apoptotic AKT phosphorylation, however, occurred, which may be a possible counter mechanism of the tumor. Epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 expression was detectable in biliary tract cancer, and receptor inhibition exerts marked effects on tumor growth in vitro and in vivo, which was strongest for the dual EGFR/ErbB-2 inhibitor NVP-AEE788. Therefore, further clinical evaluation of this new drug for the treatment of biliary tract cancer is recommended.

  8. Model-based global sensitivity analysis as applied to identification of anti-cancer drug targets and biomarkers of drug resistance in the ErbB2/3 network

    Science.gov (United States)

    Lebedeva, Galina; Sorokin, Anatoly; Faratian, Dana; Mullen, Peter; Goltsov, Alexey; Langdon, Simon P.; Harrison, David J.; Goryanin, Igor

    2012-01-01

    High levels of variability in cancer-related cellular signalling networks and a lack of parameter identifiability in large-scale network models hamper translation of the results of modelling studies into the process of anti-cancer drug development. Recently global sensitivity analysis (GSA) has been recognised as a useful technique, capable of addressing the uncertainty of the model parameters and generating valid predictions on parametric sensitivities. Here we propose a novel implementation of model-based GSA specially designed to explore how multi-parametric network perturbations affect signal propagation through cancer-related networks. We use area-under-the-curve for time course of changes in phosphorylation of proteins as a characteristic for sensitivity analysis and rank network parameters with regard to their impact on the level of key cancer-related outputs, separating strong inhibitory from stimulatory effects. This allows interpretation of the results in terms which can incorporate the effects of potential anti-cancer drugs on targets and the associated biological markers of cancer. To illustrate the method we applied it to an ErbB signalling network model and explored the sensitivity profile of its key model readout, phosphorylated Akt, in the absence and presence of the ErbB2 inhibitor pertuzumab. The method successfully identified the parameters associated with elevation or suppression of Akt phosphorylation in the ErbB2/3 network. From analysis and comparison of the sensitivity profiles of pAkt in the absence and presence of targeted drugs we derived predictions of drug targets, cancer-related biomarkers and generated hypotheses for combinatorial therapy. Several key predictions have been confirmed in experiments using human ovarian carcinoma cell lines. We also compared GSA-derived predictions with the results of local sensitivity analysis and discuss the applicability of both methods. We propose that the developed GSA procedure can serve as a refining tool in combinatorial anti-cancer drug discovery. PMID:22085636

  9. Keratin 17 is overexpressed and predicts poor survival in estrogen receptor-negative/human epidermal growth factor receptor-2-negative breast cancer.

    Science.gov (United States)

    Merkin, Ross D; Vanner, Elizabeth A; Romeiser, Jamie L; Shroyer, A Laurie W; Escobar-Hoyos, Luisa F; Li, Jinyu; Powers, Robert S; Burke, Stephanie; Shroyer, Kenneth R

    2017-04-01

    Clinicopathological features of breast cancer have limited accuracy to predict survival. By immunohistochemistry (IHC), keratin 17 (K17) expression has been correlated with triple-negative status (estrogen receptor [ER]/progesterone receptor/human epidermal growth factor receptor-2 [HER2] negative) and decreased survival, but K17 messenger RNA (mRNA) expression has not been evaluated in breast cancer. K17 is a potential prognostic cancer biomarker, targeting p27, and driving cell cycle progression. This study compared K17 protein and mRNA expression to ER/progesterone receptor/HER2 receptor status and event-free survival. K17 IHC was performed on 164 invasive breast cancers and K17 mRNA was evaluated in 1097 breast cancers. The mRNA status of other keratins (16/14/9) was evaluated in 113 ER - /HER2 - ductal carcinomas. IHC demonstrated intense cytoplasmic and membranous K17 localization in myoepithelial cells of benign ducts and lobules and tumor cells of ductal carcinoma in situ. In ductal carcinomas, K17 protein was detected in most triple-negative tumors (28/34, 82%), some non-triple-negative tumors (52/112, 46%), but never in lobular carcinomas (0/15). In ductal carcinomas, high K17 mRNA was associated with reduced 5-year event-free survival in advanced tumor stage (n = 149, hazard ratio [HR] = 3.68, P = .018), and large (n = 73, HR = 3.95, P = .047), triple-negative (n = 103, HR = 2.73, P = .073), and ER - /HER2 - (n = 113, HR = 2.99, P = .049) tumors. There were significant correlations among keratins 17, 16, 14, and 9 mRNA levels suggesting these keratins (all encoded on chromosome 17) could be coordinately expressed in breast cancer. Thus, K17 is expressed in a subset of triple-negative breast cancers, and is a marker of poor prognosis in patients with advanced stage and ER - /HER2 - breast cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Association of Screening and Treatment With Breast Cancer Mortality by Molecular Subtype in US Women, 2000-2012.

    Science.gov (United States)

    Plevritis, Sylvia K; Munoz, Diego; Kurian, Allison W; Stout, Natasha K; Alagoz, Oguzhan; Near, Aimee M; Lee, Sandra J; van den Broek, Jeroen J; Huang, Xuelin; Schechter, Clyde B; Sprague, Brian L; Song, Juhee; de Koning, Harry J; Trentham-Dietz, Amy; van Ravesteyn, Nicolien T; Gangnon, Ronald; Chandler, Young; Li, Yisheng; Xu, Cong; Ergun, Mehmet Ali; Huang, Hui; Berry, Donald A; Mandelblatt, Jeanne S

    2018-01-09

    Given recent advances in screening mammography and adjuvant therapy (treatment), quantifying their separate and combined effects on US breast cancer mortality reductions by molecular subtype could guide future decisions to reduce disease burden. To evaluate the contributions associated with screening and treatment to breast cancer mortality reductions by molecular subtype based on estrogen-receptor (ER) and human epidermal growth factor receptor 2 (ERBB2, formerly HER2 or HER2/neu). Six Cancer Intervention and Surveillance Network (CISNET) models simulated US breast cancer mortality from 2000 to 2012 using national data on plain-film and digital mammography patterns and performance, dissemination and efficacy of ER/ERBB2-specific treatment, and competing mortality. Multiple US birth cohorts were simulated. Screening mammography and treatment. The models compared age-adjusted, overall, and ER/ERBB2-specific breast cancer mortality rates from 2000 to 2012 for women aged 30 to 79 years relative to the estimated mortality rate in the absence of screening and treatment (baseline rate); mortality reductions were apportioned to screening and treatment. In 2000, the estimated reduction in overall breast cancer mortality rate was 37% (model range, 27%-42%) relative to the estimated baseline rate in 2000 of 64 deaths (model range, 56-73) per 100 000 women: 44% (model range, 35%-60%) of this reduction was associated with screening and 56% (model range, 40%-65%) with treatment. In 2012, the estimated reduction in overall breast cancer mortality rate was 49% (model range, 39%-58%) relative to the estimated baseline rate in 2012 of 63 deaths (model range, 54-73) per 100 000 women: 37% (model range, 26%-51%) of this reduction was associated with screening and 63% (model range, 49%-74%) with treatment. Of the 63% associated with treatment, 31% (model range, 22%-37%) was associated with chemotherapy, 27% (model range, 18%-36%) with hormone therapy, and 4% (model range, 1

  11. Ets2 in tumor fibroblasts promotes angiogenesis in breast cancer.

    Directory of Open Access Journals (Sweden)

    Julie A Wallace

    Full Text Available Tumor fibroblasts are active partners in tumor progression, but the genes and pathways that mediate this collaboration are ill-defined. Previous work demonstrates that Ets2 function in stromal cells significantly contributes to breast tumor progression. Conditional mouse models were used to study the function of Ets2 in both mammary stromal fibroblasts and epithelial cells. Conditional inactivation of Ets2 in stromal fibroblasts in PyMT and ErbB2 driven tumors significantly reduced tumor growth, however deletion of Ets2 in epithelial cells in the PyMT model had no significant effect. Analysis of gene expression in fibroblasts revealed a tumor- and Ets2-dependent gene signature that was enriched in genes important for ECM remodeling, cell migration, and angiogenesis in both PyMT and ErbB2 driven-tumors. Consistent with these results, PyMT and ErbB2 tumors lacking Ets2 in fibroblasts had fewer functional blood vessels, and Ets2 in fibroblasts elicited changes in gene expression in tumor endothelial cells consistent with this phenotype. An in vivo angiogenesis assay revealed the ability of Ets2 in fibroblasts to promote blood vessel formation in the absence of tumor cells. Importantly, the Ets2-dependent gene expression signatures from both mouse models were able to distinguish human breast tumor stroma from normal stroma, and correlated with patient outcomes in two whole tumor breast cancer data sets. The data reveals a key function for Ets2 in tumor fibroblasts in signaling to endothelial cells to promote tumor angiogenesis. The results highlight the collaborative networks that orchestrate communication between stromal cells and tumor cells, and suggest that targeting tumor fibroblasts may be an effective strategy for developing novel anti-angiogenic therapies.

  12. The CRKL gene encoding an adaptor protein is amplified, overexpressed, and a possible therapeutic target in gastric cancer

    Directory of Open Access Journals (Sweden)

    Natsume Hiroko

    2012-07-01

    Full Text Available Abstract Background Genomic DNA amplification is a genetic factor involved in cancer, and some oncogenes, such as ERBB2, are highly amplified in gastric cancer. We searched for the possible amplification of other genes in gastric cancer. Methods and Results A genome-wide single nucleotide polymorphism microarray analysis was performed using three cell lines of differentiated gastric cancers, and 22 genes (including ERBB2 in five highly amplified chromosome regions (with a copy number of more than 6 were identified. Particular attention was paid to the CRKL gene, the product of which is an adaptor protein containing Src homology 2 and 3 (SH2/SH3 domains. An extremely high CRKL copy number was confirmed in the MKN74 gastric cancer cell line using fluorescence in situ hybridization (FISH, and a high level of CRKL expression was also observed in the cells. The RNA-interference-mediated knockdown of CRKL in MKN74 disclosed the ability of CRKL to upregulate gastric cell proliferation. An immunohistochemical analysis revealed that CRKL protein was overexpressed in 24.4% (88/360 of the primary gastric cancers that were analyzed. The CRKL copy number was also examined in 360 primary gastric cancers using a FISH analysis, and CRKL amplification was found to be associated with CRKL overexpression. Finally, we showed that MKN74 cells with CRKL amplification were responsive to the dual Src/BCR-ABL kinase inhibitor BMS354825, likely via the inhibition of CRKL phosphorylation, and that the proliferation of MKN74 cells was suppressed by treatment with a CRKL-targeting peptide. Conclusion These results suggested that CRKL protein is overexpressed in a subset of gastric cancers and is associated with CRKL amplification in gastric cancer. Furthermore, our results suggested that CRKL protein has the ability to regulate gastric cell proliferation and has the potential to serve as a molecular therapy target for gastric cancer.

  13. Differentially expressed proteins in ER+ MCF7 and ER- MDA- MB-231 human breast cancer cells by RhoGDI-α silencing and overexpression.

    Science.gov (United States)

    Hooshmand, Somayeh; Ghaderi, Abbas; Yusoff, Khatijah; Thilakavathy, Karuppiah; Rosli, Rozita; Mojtahedi, Zahra

    2014-01-01

    The consequence of Rho GDP dissociation inhibitor alpha (RhoGDIα) activity on migration and invasion of estrogen receptor positive (ER+) and negative (ER-) breast cancer cells has not been studied using the proteomic approach. Changes in expression of RhoGDIα and other proteins interacting directly or indirectly with RhoGDIα in MCF7 and MDA-MB-231, with different metastatic potentials is of particular interest. ER+ MCF7 and ER- MDA-MB-231 cell lines were subjected to two-dimensional electrophoresis (2-DE) and spots of interest were identified by matrix-assisted laser desorption/ionization time of- flight/time- of-flight (MALDI-TOF/TOF) mass spectrometry (MS) analysis after downregulation of RhoGDIα using short interfering RNA (siRNA) and upregulated using GFP-tagged ORF clone of RhoGDIα. The results showed a total of 35 proteins that were either up- or down-regulated in these cells. Here we identifed 9 and 15 proteins differentially expressed with silencing of RhoGDIα in MCF-7 and the MDA-MB-231 cells, respectively. In addition, 10 proteins were differentially expressed in the upregulation of RhoGDIα in MCF7, while only one protein was identified in the upregulation of RhoGDIα in MDA-MB-231. Based on the biological functions of these proteins, the results revealed that proteins involved in cell migration are more strongly altered with RhoGDI-α activity. Although several of these proteins have been previously indicated in tumorigenesis and invasiveness of breast cancer cells, some ohave not been previously reported to be involved in breast cancer migration. Hence, these proteins may serve as useful candidate biomarkers for tumorigenesis and invasiveness of breast cancer cells. Future studies are needed to determine the mechanisms by which these proteins regulate cell migration. The combination of RhoGDIα with other potential biomarkers may be a more promising approach in the inhibition of breast cancer cell migration.

  14. Comparison of HER2 and phospho-HER2 expression between biopsy and resected breast cancer specimens using a quantitative assessment method.

    Directory of Open Access Journals (Sweden)

    Yalai Bai

    Full Text Available BACKGROUND: HER2/Neu (ErbB-2 overexpression, which occurs in 15-20% of breast cancer cases, is associated with better response to treatment with the drug trastuzumab. PhosphoHER2 (pHER2 has been evaluated for prediction of response to trastuzumab. Both markers are heterogeneously detected and are potentially subject to loss as a consequence of delayed time to fixation. Here, we quantitatively assess both markers in core needle biopsies (CNBs and matched tumor resections to assess concordance between the core and the resection and between HER2 and pHER2. METHODS: A selected retrospective collection of archival breast cancer cases yielded 67 cases with both core and resection specimens. Both HER2 and pTyr(1248HER2 were analyzed by the AQUA® method of quantitative immunofluorescence on each specimen pair. RESULTS: Both HER2 immunoreactivity (P<0.0001 and pTyr(1248HER2 immunoreactivity (P<0.0001 were lower in resections relative to CNB specimens. However, clinical implications of this change may not be evident since no case changed from 3+ (CNB to negative (resection. Assessment of pTyr(1248HER2 showed no direct correlation with HER2 in either CNB or resection specimens. CONCLUSIONS: The data suggest that measurement of both HER2 and phospho- Tyr(1248HER2, in formalin-fixed tissue by immunological methods is significantly affected by pre-analytic variables. The current study warrants the adequate handling of resected specimens for the reproducible evaluation of HER2 and pHER2. The level of pTyr(1248HER2, was not correlated to total HER2 protein. Further studies are required to determine the significance of these observations with respect to response to HER2 directed therapies.

  15. Breast

    International Nuclear Information System (INIS)

    Ribeiro, G.G.

    1985-01-01

    The treatment of malignant disease of the breast arouses more controversy and emotion than that of any other form of malignant disease. Many clinical trials have been carried out and others are still in progress. In addition, research work continues in regard to other aspects of the disease, such as epidemiology, population screening, and endocrine factors; yet little is really known about the true biological nature of carcinoma of the breast. A vast amount of literature has accumulated on the treatment of ''operable'' carcinoma of the breast, but it is not proposed to discuss here the merits or demerits of the various suggested treatments. Instead this chapter will be confined to the practical management of carcinoma of the breast as seen from the point of view of radiotherapist. For this reason greater attention will be paid to the radiotherapy techniques as practised at the Christie Hospital

  16. Inhibition of early 99mTc-MIBI uptake by Bcl-2 anti-apoptotic protein overexpression in untreated breast carcinoma

    International Nuclear Information System (INIS)

    Del Vecchio, Silvana; Zannetti, Antonella; Aloj, Luigi; Caraco, Corradina; Ciarmiello, Andrea; Salvatore, Marco

    2003-01-01

    Lack of technetium-99m methoxyisobutylisonitrile ( 99m Tc-MIBI) uptake is consistently reported to predict poor response to subsequent chemotherapy in a variety of human malignant tumours. Since 99m Tc-MIBI accumulates within mitochondria, which also play a central role in apoptosis through the integration of death signals by Bcl-2 family members, we tested whether early 99m Tc-MIBI uptake is affected by alterations of the apoptotic pathway. Forty-two breast cancer patients were intravenously injected with 740 MBq of 99m Tc-MIBI and planar images were obtained 10 min post injection with the patients in the prone lateral position. Ten carcinomas failed to accumulate 99m Tc-MIBI and could not be visualised on scintigraphic images despite being larger than 1.8 cm (MIBI negative). Thirty-two of the 42 breast carcinomas showed focal uptake of 99m Tc-MIBI (MIBI positive), and 10 min tumour-to-background ratios (T/B) varied between 1.14 and 6.93. The apoptotic index, the rate of proliferation, and the expression of the anti-apoptotic Bcl-2 protein and pro-apoptotic Bax protein were assessed in surgically excised tumours. All MIBI-negative carcinomas showed a dramatic and statistically significant reduction in the apoptotic index as compared with MIBI-positive lesions (mean±SD, 0.14±0.15 vs 1.28±0.83, P 99m Tc-MIBI in breast carcinomas is affected by alterations of apoptotic pathway. High levels of Bcl-2, despite the stabilisation of mitochondrial membrane potentials, prevent accumulation of 99m Tc-MIBI in tumour cells. In conclusion, absent or reduced early 99m Tc-MIBI uptake in large tumours may indicate a Bcl-2-mediated resistance to chemo- and radiotherapy. (orig.)

  17. Aberrant KDM5B expression promotes aggressive breast cancer through MALAT1 overexpression and downregulation of hsa-miR-448

    International Nuclear Information System (INIS)

    Bamodu, Oluwaseun Adebayo; Huang, Wen-Chien; Lee, Wei-Hwa; Wu, Alexander; Wang, Liang Shun; Hsiao, Michael; Yeh, Chi-Tai; Chao, Tsu-Yi

    2016-01-01

    Triple negative breast cancers (TNBC) possess cell dedifferentiation characteristics, carry out activities connate to those of cancer stem cells (CSCs) and are associated with increased metastasis, as well as, poor clinical prognosis. The regulatory mechanism of this highly malignant phenotype is still poorly characterized. Accruing evidence support the role of non-coding RNAs (ncRNAs) as potent regulators of CSC and metastatic gene expression, with their dysregulation implicated in tumorigenesis and disease progression. In this study, we investigated TNBC metastasis, metastasis-associated genes and potential inhibitory mechanisms using bioinformatics, tissue microarray analyses, immunoblotting, polymerase chain reaction, loss and gain of gene function assays and comparative analyses of data obtained. Compared with other breast cancer types, the highly metastatic MDA-MB-231 cells concurrently exhibited increased expression levels of Lysine-specific demethylase 5B protein (KDM5B) and long non-coding RNA (lncRNA), MALAT1, suggesting their functional association. KDM5B-silencing in the TNBC cells correlated with the upregulation of hsa-miR-448 and led to suppression of MALAT1 expression with decreased migration, invasion and clonogenic capacity in vitro, as well as, poor survival in vivo. This projects MALAT1 as a mediator of KDM5B oncogenic potential and highlights the critical role of this microRNA, lncRNA and histone demethylase in cancer cell motility and metastatic colonization. Increased expression of KDM5B correlating with disease progression and poor clinical outcome in breast cancer was reversed by hsa-miR-448. Our findings demonstrate the critical role of KDM5B and its negative regulator hsa-miR-448 in TNBC metastasis and progression. Hsa-miR-448 disrupting KDM5B-MALAT1 signalling axis and associated activities in TNBC cells, projects it as a putative therapeutic factor for selective eradication of TNBC cells

  18. AST1306, a novel irreversible inhibitor of the epidermal growth factor receptor 1 and 2, exhibits antitumor activity both in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Hua Xie

    Full Text Available Despite the initial response to the reversible, ATP-competitive quinazoline inhibitors that target ErbB-family, such a subset of cancer patients almost invariably develop resistance. Recent studies have provided compelling evidence that irreversible ErbB inhibitors have the potential to override this resistance. Here, we found that AST1306, a novel anilino-quinazoline compound, inhibited the enzymatic activities of wild-type epidermal growth factor receptor (EGFR and ErbB2 as well as EGFR resistant mutant in both cell-free and cell-based systems. Importantly, AST1306 functions as an irreversible inhibitor, most likely through covalent interaction with Cys797 and Cys805 in the catalytic domains of EGFR and ErbB2, respectively. Further studies showed that AST1306 inactivated pathways downstream of these receptors and thereby inhibited the proliferation of a panel of cancer cell lines. Although the activities of EGFR and ErbB2 were similarly sensitive to AST1306, ErbB2-overexpressing cell lines consistently exhibited more sensitivity to AST1306 antiproliferative effects. Consistent with this, knockdown of ErbB2, but not EGFR, decreased the sensitivity of SK-OV-3 cells to AST1306. In vivo, AST1306 potently suppressed tumor growth in ErbB2-overexpressing adenocarcinoma xenograft and FVB-2/N(neu transgenic breast cancer mouse models, but weakly inhibited the growth of EGFR-overexpressing tumor xenografts. Tumor growth inhibition induced by a single dose of AST1306 in the SK-OV-3 xenograft model was accompanied by a rapid (within 2 h and sustained (≥24 h inhibition of both EGFR and ErbB2, consistent with an irreversible inhibition mechanism. Taken together, these results establish AST1306 as a selective, irreversible ErbB2 and EGFR inhibitor whose growth-inhibitory effects are more potent in ErbB2-overexpressing cells.

  19. Increased Level of Phosphorylated ShcA Measured by Chemiluminescence-Linked Immunoassay Is a Predictor of Good Prognosis in Primary Breast Cancer Expressing Low Levels of Estrogen Receptor

    Directory of Open Access Journals (Sweden)

    Serenella Eppenberger-Castori

    2010-03-01

    Full Text Available The SH2 domain-containing adaptor protein ShcA is a proto-oncogene involved in growth factor receptor signaling. The role of phosphorylated ShcA is to link receptor tyrosine kinases with the SH2-containing adaptor protein Grb2, thus facilitating signal transduction from receptor tyrosine kinases to Ras, leading to MAPK activation. The present study was designed to investigate the prognostic significance of phosphorylated ShcA in primary breast cancer and its association in the interactions between the ER and ErbB2 pathways. Using a two-site chemiluminescence-linked immunosorbent assay, we detected the quantitative expression levels of total tyrosine- and threonine-phosphorylated ShcA in cytosol fractions obtained from fresh frozen tissue samples of 153 selected primary breast cancer patients. ShcA phosphorylation was not associated with nodal status, estrogen receptor (ER status or grading. High levels of both tyrosine (pYShcA and serine (pSShcA phosphorylated ShcA correlated with good prognosis (p < 0.01, with respect to both disease-free (DFS and overall survival (OS. In addition, pShcA levels were found to correlate with threonine-phosphorylated ErbB2 and inversely with phosphorylated Akt (pAkt, as well as ErbB2 and ER expression levels. Our findings demonstrate that ShcA activation in primary breast cancer patients correlates with low levels of ER, and is associated with good prognosis.

  20. Increased Level of Phosphorylated ShcA Measured by Chemiluminescence-Linked Immunoassay Is a Predictor of Good Prognosis in Primary Breast Cancer Expressing Low Levels of Estrogen Receptor

    International Nuclear Information System (INIS)

    Cicenas, Jonas; Küng, Willy; Eppenberger, Urs; Eppenberger-Castori, Serenella

    2010-01-01

    The SH2 domain-containing adaptor protein ShcA is a proto-oncogene involved in growth factor receptor signaling. The role of phosphorylated ShcA is to link receptor tyrosine kinases with the SH2-containing adaptor protein Grb2, thus facilitating signal transduction from receptor tyrosine kinases to Ras, leading to MAPK activation. The present study was designed to investigate the prognostic significance of phosphorylated ShcA in primary breast cancer and its association in the interactions between the ER and ErbB2 pathways. Using a two-site chemiluminescence-linked immunosorbent assay, we detected the quantitative expression levels of total tyrosine- and threonine-phosphorylated ShcA in cytosol fractions obtained from fresh frozen tissue samples of 153 selected primary breast cancer patients. ShcA phosphorylation was not associated with nodal status, estrogen receptor (ER) status or grading. High levels of both tyrosine (pYShcA) and serine (pSShcA) phosphorylated ShcA correlated with good prognosis (p < 0.01), with respect to both disease-free (DFS) and overall survival (OS). In addition, pShcA levels were found to correlate with threonine-phosphorylated ErbB2 and inversely with phosphorylated Akt (pAkt), as well as ErbB2 and ER expression levels. Our findings demonstrate that ShcA activation in primary breast cancer patients correlates with low levels of ER, and is associated with good prognosis

  1. Podoplanin-positive Cancer-associated Stromal Fibroblasts in Primary Tumor and Synchronous Lymph Node Metastases of HER2-overexpressing Breast Carcinomas.

    Science.gov (United States)

    Niemiec, Joanna; Adamczyk, Agnieszka; Harazin-Lechowska, Agnieszka; Ambicka, Aleksandra; Grela-Wojewoda, Aleksandra; Majchrzyk, Kaja; Kruczak, Anna; Sas-Korczyńska, Beata; Ryś, Janusz

    2018-04-01

    We compared the status of stromal podoplanin-positive cancer-associated fibroblasts (ppCAFs) between primary tumors and paired synchronous lymph node metastases (LNMs) and analyzed the prognostic significance of tumoral ppCAFs in 203 patients with human epidermal growth factor receptor 2-positive breast carcinoma. ppCAFs were found in 167/203 and in 35/87 tumors and LNM, respectively. ppCAFs were most frequently found in tumors and corresponding LNM (n=52, 59.8%; p=0.001). However, for all LNMs (n=12) without ppCAFs, their paired tumors also lacked ppCAFs. In both tumors and LNMs, ppCAFs were α-smooth muscle actin-positive and cluster of differentiation 21 protein-negative, suggesting them not to be resident lymph node cells. Moreover, in our series, the presence of ppCAFs in tumors was borderline related to poor disease-free survival (p=0.058). These results speak in favor of a hypothesis suggesting ppCAFs accompany metastatic cancer cells migrating from tumor to LNMs. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  2. Mammary Gland Tumor Development in Transgenic Mice Overexpressing Different Isoforms of the CDP/Cux Transcription Factor

    National Research Council Canada - National Science Library

    Cadieux, Chantal

    2008-01-01

    Short CUX1 isoforms were found to be overexpressed in breast cancer cell lines, in human breast tumors and in uterine leiomyomas, suggesting that these proteins play a key role in tumor development and progression...

  3. Mammary Gland Tumor Development in Transgenic Mice Overexpressing Different Isoforms of the CDP/Cux Transcription Factor

    National Research Council Canada - National Science Library

    Cadieux, Chantal

    2007-01-01

    Short CDP/Cux isoforms were found to be overexpressed in breast cancer cell lines, in human breast tumors and in uterine leiomyomas, suggesting that these proteins play a key role in tumor development and progression...

  4. Interference with Activator Protein-2 transcription factors leads to induction of apoptosis and an increase in chemo- and radiation- sensitivity in breast cancer cells

    LENUS (Irish Health Repository)

    Thewes, Verena

    2010-05-11

    Abstract Background Activator Protein-2 (AP-2) transcription factors are critically involved in a variety of fundamental cellular processes such as proliferation, differentiation and apoptosis and have also been implicated in carcinogenesis. Expression of the family members AP-2α and AP-2γ is particularly well documented in malignancies of the female breast. Despite increasing evaluation of single AP-2 isoforms in mammary tumors the functional role of concerted expression of multiple AP-2 isoforms in breast cancer remains to be elucidated. AP-2 proteins can form homo- or heterodimers, and there is growing evidence that the net effect whether a cell will proliferate, undergo apoptosis or differentiate is partly dependent on the balance between different AP-2 isoforms. Methods We simultaneously interfered with all AP-2 isoforms expressed in ErbB-2-positive murine N202.1A breast cancer cells by conditionally over-expressing a dominant-negative AP-2 mutant. Results We show that interference with AP-2 protein function lead to reduced cell number, induced apoptosis and increased chemo- and radiation-sensitivity. Analysis of global gene expression changes upon interference with AP-2 proteins identified 139 modulated genes (90 up-regulated, 49 down-regulated) compared with control cells. Gene Ontology (GO) investigations for these genes revealed Cell Death and Cell Adhesion and Migration as the main functional categories including 25 and 12 genes, respectively. By using information obtained from Ingenuity Pathway Analysis Systems we were able to present proven or potential connections between AP-2 regulated genes involved in cell death and response to chemo- and radiation therapy, (i.e. Ctgf, Nrp1, Tnfaip3, Gsta3) and AP-2 and other main apoptosis players and to create a unique network. Conclusions Expression of AP-2 transcription factors in breast cancer cells supports proliferation and contributes to chemo- and radiation-resistance of tumor cells by impairing the

  5. Interference with Activator Protein-2 transcription factors leads to induction of apoptosis and an increase in chemo- and radiation-sensitivity in breast cancer cells

    International Nuclear Information System (INIS)

    Thewes, Verena; Orso, Francesca; Jäger, Richard; Eckert, Dawid; Schäfer, Sabine; Kirfel, Gregor; Garbe, Stephan; Taverna, Daniela; Schorle, Hubert

    2010-01-01

    Activator Protein-2 (AP-2) transcription factors are critically involved in a variety of fundamental cellular processes such as proliferation, differentiation and apoptosis and have also been implicated in carcinogenesis. Expression of the family members AP-2α and AP-2γ is particularly well documented in malignancies of the female breast. Despite increasing evaluation of single AP-2 isoforms in mammary tumors the functional role of concerted expression of multiple AP-2 isoforms in breast cancer remains to be elucidated. AP-2 proteins can form homo- or heterodimers, and there is growing evidence that the net effect whether a cell will proliferate, undergo apoptosis or differentiate is partly dependent on the balance between different AP-2 isoforms. We simultaneously interfered with all AP-2 isoforms expressed in ErbB-2-positive murine N202.1A breast cancer cells by conditionally over-expressing a dominant-negative AP-2 mutant. We show that interference with AP-2 protein function lead to reduced cell number, induced apoptosis and increased chemo- and radiation-sensitivity. Analysis of global gene expression changes upon interference with AP-2 proteins identified 139 modulated genes (90 up-regulated, 49 down-regulated) compared with control cells. Gene Ontology (GO) investigations for these genes revealed Cell Death and Cell Adhesion and Migration as the main functional categories including 25 and 12 genes, respectively. By using information obtained from Ingenuity Pathway Analysis Systems we were able to present proven or potential connections between AP-2 regulated genes involved in cell death and response to chemo- and radiation therapy, (i.e. Ctgf, Nrp1, Tnfaip3, Gsta3) and AP-2 and other main apoptosis players and to create a unique network. Expression of AP-2 transcription factors in breast cancer cells supports proliferation and contributes to chemo- and radiation-resistance of tumor cells by impairing the ability to induce apoptosis. Therefore, interference

  6. Ron in Breast Development and Cancer

    National Research Council Canada - National Science Library

    Waltz, Susan E

    2004-01-01

    .... Virtually nothing is known regarding the function of Ron in the breast. However, two recent studies have shown that Ron is over-expressed and highly phosphorylated in a significant fraction of human and feline breast cancers...

  7. Ron in Breast Development and Cancer

    National Research Council Canada - National Science Library

    Waltz, Susan E

    2005-01-01

    ... in a murine model of human breast cancer. These results are in agreement with human cancer studies documenting an upregulation of this receptor in breast tumors as well as are consistent with the correlation between Ron overexpression...

  8. Inhibition of Cell Growth and Induction of Apoptosis by Antrodia camphorata in HER-2/neu-Overexpressing Breast Cancer Cells through the Induction of ROS, Depletion of HER-2/neu, and Disruption of the PI3K/Akt Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Chuan-Chen Lee

    2012-01-01

    Full Text Available Previously, we demonstrated that a submerged fermentation culture of Antrodia camphorata (AC promotes cell-cycle arrest and apoptosis in human estrogen receptor-positive/negative breast cancer cells. However, whether AC is effective against HER-2/neu-overexpressing breast cancers has not been thoroughly elucidated. In the present study, we showed that AC exhibited a significant cytotoxic effect against HER-2/neu-overexpressing MDA-MB-453 and BT-474 cells. Immunoblot analysis demonstrated that HER-2/neu and their tyrosine phosphorylation were inhibited by AC in a dose-dependent manner. An increase in intracellular reactive oxygen species (ROS was observed in AC-treated cells, whereas antioxidant N-acetylcysteine (NAC significantly prevented AC induced HER-2/neu depletion and cell death, which directly indicates that AC-induced HER-2/neu depletion and cell death was mediated by ROS generation. Also, AC significantly downregulated the expression of cyclin D1, cyclin E, and CDK4 followed by the suppression of PI3K/Akt, and their downstream effectors GSK-3β and β-catenin. Notably, AC-treatment induced apoptotic cell death, which was associated with sub-G1 accumulation, DNA fragmentation, mitochondrial dysfunction, cytochrome c release, caspase-3/-9 activation, PARP degradation, and Bcl-2/Bax dysregulation. Assays for colony formation also confirmed the growth-inhibitory effects of AC. This is the first report confirming the anticancer activity of this potentially beneficial mushroom against human HER-2/neu-overexpressing breast cancers.

  9. Identification and pathway analysis of microRNAs with no previous involvement in breast cancer.

    Directory of Open Access Journals (Sweden)

    Sandra Romero-Cordoba

    Full Text Available microRNA expression signatures can differentiate normal and breast cancer tissues and can define specific clinico-pathological phenotypes in breast tumors. In order to further evaluate the microRNA expression profile in breast cancer, we analyzed the expression of 667 microRNAs in 29 tumors and 21 adjacent normal tissues using TaqMan Low-density arrays. 130 miRNAs showed significant differential expression (adjusted P value = 0.05, Fold Change = 2 in breast tumors compared to the normal adjacent tissue. Importantly, the role of 43 of these microRNAs has not been previously reported in breast cancer, including several evolutionary conserved microRNA*, showing similar expression rates to that of their corresponding leading strand. The expression of 14 microRNAs was replicated in an independent set of 55 tumors. Bioinformatic analysis of mRNA targets of the altered miRNAs, identified oncogenes like ERBB2, YY1, several MAP kinases, and known tumor-suppressors like FOXA1 and SMAD4. Pathway analysis identified that some biological process which are important in breast carcinogenesis are affected by the altered microRNA expression, including signaling through MAP kinases and TP53 pathways, as well as biological processes like cell death and communication, focal adhesion and ERBB2-ERBB3 signaling. Our data identified the altered expression of several microRNAs whose aberrant expression might have an important impact on cancer-related cellular pathways and whose role in breast cancer has not been previously described.

  10. Promotion of breast cancer by β-Hexachlorocyclohexane in MCF10AT1 cells and MMTV-neu mice

    International Nuclear Information System (INIS)

    Wong, Patrick S; Matsumura, Fumio

    2007-01-01

    Exposure to β-Hexachlorocyclohexane (β-HCH), a contaminant of the hexachlorohexane pesticide lindane, has been implicated as a risk factor in the development of breast cancers in epidemiological studies. Previous studies in our laboratory have demonstrated the ability of β-HCH to elicit its actions via a ligand-independent activation of the estrogen receptor through increased c-Neu (= erbB 2 or HER-2) expression and kinase activation in both the BG-1 and MCF-7 cell lines. In addition, long term exposure (33 passages) to β-HCH was shown to promote the selection of MCF-7 cells which exhibit a more metastatic phenotype. In this current study, we decided to investigate the long-term effects of β-HCH in both the MCF10AT1 cell line which was derived from a normal epithelial cell line by stably transfecting a mutated c-Ha-ras and a MMTV-Neu mouse model for mammary cancer in vivo. MCF10AT1 cells were exposed for 20 passages with β-HCH, 4-OH-Tamoxifen (Tam), or 17-β-estradiol (E 2 ) after which cells were analyzed for proliferation rates and mRNA expression by RT-PCR. In our in vivo studies, MMTV-Neu mice were injected with β-HCH and observed for tumor formation over a 70 week period. β-HCH and Tam selected MCF10AT1 cells demonstrated increased mRNA expression of MMP-13 (collagenase-3) a marker of increased invasiveness. β-HCH treatment was also seen to increase the expression in a number of proto-oncogenes (c-Neu, Cyclin D1, p27), cell status markers (Met-1, CK19), and the inflammatory marker NFκB. Previous studies, have demonstrated the role of these markers as evidence of malignant transformations, and further illustrate the ability of β-HCH to be carcinogenic. To demonstrate β-HCH's tumorigenic properties in an in vivo system, we used an MMTV-Neu mouse model. MMTV-Neu is a c-Neu overexpressing strain which has been shown to spontaneously develop mammary tumors at later stages of aging. In this experiment, β-HCH exposure was shown to both accelerate

  11. Ancestry as a potential modifier of gene expression in breast tumors from Colombian women.

    Science.gov (United States)

    Serrano-Gómez, Silvia J; Sanabria-Salas, María Carolina; Garay, Jone; Baddoo, Melody C; Hernández-Suarez, Gustavo; Mejía, Juan Carlos; García, Oscar; Miele, Lucio; Fejerman, Laura; Zabaleta, Jovanny

    2017-01-01

    Hispanic/Latino populations are a genetically admixed and heterogeneous group, with variable fractions of European, Indigenous American and African ancestries. The molecular profile of breast cancer has been widely described in non-Hispanic Whites but equivalent knowledge is lacking in Hispanic/Latinas. We have previously reported that the most prevalent breast cancer intrinsic subtype in Colombian women was Luminal B as defined by St. Gallen 2013 criteria. In this study we explored ancestry-associated differences in molecular profiles of Luminal B tumors among these highly admixed women. We performed whole-transcriptome RNA-seq analysis in 42 Luminal tumors (21 Luminal A and 21 Luminal B) from Colombian women. Genetic ancestry was estimated from a panel of 80 ancestry-informative markers (AIM). We categorized patients according to Luminal subtype and to the proportion of European and Indigenous American ancestry and performed differential expression analysis comparing Luminal B against Luminal A tumors according to the assigned ancestry groups. We found 5 genes potentially modulated by genetic ancestry: ERBB2 (log2FC = 2.367, padjancestry (p = 0.02, B = 3.11). This association was not biased by the distribution of HER2+ tumors among the groups analyzed. Our results suggest that genetic ancestry in Hispanic/Latina women might modify ERBB2 gene expression in Luminal tumors. Further analyses are needed to confirm these findings and explore their prognostic value.

  12. Anoikis evasion in inflammatory breast cancer cells is mediated by Bim-EL sequestration.

    Science.gov (United States)

    Buchheit, C L; Angarola, B L; Steiner, A; Weigel, K J; Schafer, Z T

    2015-08-01

    Inflammatory breast cancer (IBC) is a rare and highly invasive type of breast cancer, and patients diagnosed with IBC often face a very poor prognosis. IBC is characterized by the lack of primary tumor formation and the rapid accumulation of cancerous epithelial cells in the dermal lymphatic vessels. Given that normal epithelial cells require attachment to the extracellular matrix (ECM) for survival, a comprehensive examination of the molecular mechanisms underlying IBC cell survival in the lymphatic vessels is of paramount importance to our understanding of IBC pathogenesis. Here we demonstrate that, in contrast to normal mammary epithelial cells, IBC cells evade ECM-detachment-induced apoptosis (anoikis). ErbB2 and EGFR knockdown in KPL-4 and SUM149 cells, respectively, causes decreased colony growth in soft agar and increased caspase activation following ECM detachment. ERK/MAPK signaling was found to operate downstream of ErbB2 and EGFR to protect cells from anoikis by facilitating the formation of a protein complex containing Bim-EL, LC8, and Beclin-1. This complex forms as a result of Bim-EL phosphorylation on serine 59, and thus Bim-EL cannot localize to the mitochondria and cause anoikis. These results reveal a novel mechanism that could be targeted with innovative therapeutics to induce anoikis in IBC cells.

  13. The biological age linked to oxidative stress modifies breast cancer aggressiveness.

    Science.gov (United States)

    Sáez-Freire, María Del Mar; Blanco-Gómez, Adrián; Castillo-Lluva, Sonia; Gómez-Vecino, Aurora; Galvis-Jiménez, Julie Milena; Martín-Seisdedos, Carmen; Isidoro-García, María; Hontecillas-Prieto, Lourdes; García-Cenador, María Begoña; García-Criado, Francisco Javier; Patino-Alonso, María Carmen; Galindo-Villardón, Purificación; Mao, Jian-Hua; Prieto, Carlos; Castellanos-Martín, Andrés; Kaderali, Lars; Pérez-Losada, Jesús

    2018-03-14

    The incidence of breast cancer increases with age until menopause, and breast cancer is more aggressive in younger women. The existence of epidemiological links between breast cancer and aging indicates that both processes share some common mechanisms of development. Oxidative stress is associated with both cancer susceptibility and aging. Here we observed that ERBB2-positive breast cancer, which developed in genetically heterogeneous ERBB2-positive transgenic mice generated by a backcross, is more aggressive in chronologically younger than in older mice (differentiated by the median survival of the cohort that was 79 weeks), similar to what occurs in humans. In this cohort, we estimated the oxidative biological age using a mathematical model that integrated several subphenotypes directly or indirectly related to oxidative stress. The model selected the serum levels of HDL-cholesterol and magnesium and total AKT1 and glutathione concentrations in the liver. The grade of aging was calculated as the difference between the predicted biological age and the chronological age. This comparison permitted the identification of biologically younger and older mice compared with their chronological age. Interestingly, biologically older mice developed more aggressive breast cancer than the biologically younger mice. Genomic regions on chromosomes 2 and 15 linked to the grade of oxidative aging were identified. The levels of expression of Zbp1 located on chromosome 2, a gene related to necroptosis and inflammation, positively correlated with the grade of aging and tumour aggressiveness. Moreover, the pattern of gene expression of genes linked to the inflammation and the response to infection pathways was enriched in the livers of biologically old mice. This study shows part of the complex interactions between breast cancer and aging. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Quantitative nature of overexpression experiments

    Science.gov (United States)

    Moriya, Hisao

    2015-01-01

    Overexpression experiments are sometimes considered as qualitative experiments designed to identify novel proteins and study their function. However, in order to draw conclusions regarding protein overexpression through association analyses using large-scale biological data sets, we need to recognize the quantitative nature of overexpression experiments. Here I discuss the quantitative features of two different types of overexpression experiment: absolute and relative. I also introduce the four primary mechanisms involved in growth defects caused by protein overexpression: resource overload, stoichiometric imbalance, promiscuous interactions, and pathway modulation associated with the degree of overexpression. PMID:26543202

  15. PAM50 Breast Cancer Subtyping by RT-qPCR and Concordance with Standard Clinical Molecular Markers

    Directory of Open Access Journals (Sweden)

    Bastien Roy RL

    2012-10-01

    Full Text Available Abstract Background Many methodologies have been used in research to identify the “intrinsic” subtypes of breast cancer commonly known as Luminal A, Luminal B, HER2-Enriched (HER2-E and Basal-like. The PAM50 gene set is often used for gene expression-based subtyping; however, surrogate subtyping using panels of immunohistochemical (IHC markers are still widely used clinically. Discrepancies between these methods may lead to different treatment decisions. Methods We used the PAM50 RT-qPCR assay to expression profile 814 tumors from the GEICAM/9906 phase III clinical trial that enrolled women with locally advanced primary invasive breast cancer. All samples were scored at a single site by IHC for estrogen receptor (ER, progesterone receptor (PR, and Her2/neu (HER2 protein expression. Equivocal HER2 cases were confirmed by chromogenic in situ hybridization (CISH. Single gene scores by IHC/CISH were compared with RT-qPCR continuous gene expression values and “intrinsic” subtype assignment by the PAM50. High, medium, and low expression for ESR1, PGR, ERBB2, and proliferation were selected using quartile cut-points from the continuous RT-qPCR data across the PAM50 subtype assignments. Results ESR1, PGR, and ERBB2 gene expression had high agreement with established binary IHC cut-points (area under the curve (AUC ≥ 0.9. Estrogen receptor positivity by IHC was strongly associated with Luminal (A and B subtypes (92%, but only 75% of ER negative tumors were classified into the HER2-E and Basal-like subtypes. Luminal A tumors more frequently expressed PR than Luminal B (94% vs 74% and Luminal A tumors were less likely to have high proliferation (11% vs 77%. Seventy-seven percent (30/39 of ER-/HER2+ tumors by IHC were classified as the HER2-E subtype. Triple negative tumors were mainly comprised of Basal-like (57% and HER2-E (30% subtypes. Single gene scoring for ESR1, PGR, and ERBB2 was more prognostic than the corresponding IHC markers as

  16. Understanding drugs in breast cancer through drug sensitivity screening.

    Science.gov (United States)

    Uhr, Katharina; Prager-van der Smissen, Wendy J C; Heine, Anouk A J; Ozturk, Bahar; Smid, Marcel; Göhlmann, Hinrich W H; Jager, Agnes; Foekens, John A; Martens, John W M

    2015-01-01

    With substantial numbers of breast tumors showing or acquiring treatment resistance, it is of utmost importance to develop new agents for the treatment of the disease, to know their effectiveness against breast cancer and to understand their relationships with other drugs to best assign the right drug to the right patient. To achieve this goal drug screenings on breast cancer cell lines are a promising approach. In this study a large-scale drug screening of 37 compounds was performed on a panel of 42 breast cancer cell lines representing the main breast cancer subtypes. Clustering, correlation and pathway analyses were used for data analysis. We found that compounds with a related mechanism of action had correlated IC50 values and thus grouped together when the cell lines were hierarchically clustered based on IC50 values. In total we found six clusters of drugs of which five consisted of drugs with related mode of action and one cluster with two drugs not previously connected. In total, 25 correlated and four anti-correlated drug sensitivities were revealed of which only one drug, Sirolimus, showed significantly lower IC50 values in the luminal/ERBB2 breast cancer subtype. We found expected interactions but also discovered new relationships between drugs which might have implications for cancer treatment regimens.

  17. Galectin-7 Expression Potentiates HER-2-Positive Phenotype in Breast Cancer.

    Directory of Open Access Journals (Sweden)

    Andrée-Anne Grosset

    Full Text Available HER-2 positive tumors are among the most aggressive subtypes of breast cancer and are frequently associated with metastasis and poor outcome. As with other aggressive subtypes of breast cancer, these tumors are associated with abnormally high expression of galectin-7 (gal-7, which confers metastatic breast tumor cells with increased invasive behavior. Although previous studies in the rat model of breast tumorigenesis have shown that gal-7 is also increased in primary breast tumor, its contribution to the development of the primary breast tumors remains unclear. In the present work, we have used genetically-engineered gal-7-deficient mice to examine the role of gal-7 in the development of the mammary gland and of breast cancer. Using histological and immunohistological analysis of whole mammary glands at different stages of development, we detected no significant changes between normal and gal-7-deficient mice. To test the involvement of gal-7 in breast cancer, we next examined the effects of loss of gal-7 on mammary tumor development by crossing gal-7-deficient mice with the mammary tumor transgenic mouse strain FVB-Tg(MMTV-Erbb2NK1Mul/J. Finally, assessment of mice survival and tumor volume showed a delay of mammary tumor growth in the absence of systemic gal-7. These data suggest that gal-7 could potentiate the phenotype of HER-2 positive primary breast cancer.

  18. 15-prostaglandin dehydrogenase expression alone or in combination with ACSM1 defines a subgroup of the apocrine molecular subtype of breast carcinoma

    DEFF Research Database (Denmark)

    Celis, J.E.; Gromov, P.; Cabezon, T.

    2008-01-01

    , papillary, medullary, metaplastic, and apocrine breast carcinomas. Molecular profiling technologies, on the other hand, subdivide breast tumors into five subtypes, basal-like, luminal A, luminal B, normal breast tissue-like, and ERBB2-positive, that have different prognostic characteristics. An additional......Established histopathological criteria divide invasive breast carcinomas into defined groups. Ductal of no specific type and lobular are the two major subtypes accounting for around 75 and 15% of all cases, respectively. The remaining 10% include rarer types such as tubular, cribriform, mucinous...... subclass termed "molecular apocrine" has recently been described, but these lesions did not exhibit all the histopathological features of classical invasive apocrine carcinomas (IACs). IACs make up 0.5-3% of the invasive ductal carcinomas, and despite the fact that they are morphologically distinct from...

  19. Sequencing-based breast cancer diagnostics as an alternative to routine biomarkers.

    Science.gov (United States)

    Rantalainen, Mattias; Klevebring, Daniel; Lindberg, Johan; Ivansson, Emma; Rosin, Gustaf; Kis, Lorand; Celebioglu, Fuat; Fredriksson, Irma; Czene, Kamila; Frisell, Jan; Hartman, Johan; Bergh, Jonas; Grönberg, Henrik

    2016-11-30

    Sequencing-based breast cancer diagnostics have the potential to replace routine biomarkers and provide molecular characterization that enable personalized precision medicine. Here we investigate the concordance between sequencing-based and routine diagnostic biomarkers and to what extent tumor sequencing contributes clinically actionable information. We applied DNA- and RNA-sequencing to characterize tumors from 307 breast cancer patients with replication in up to 739 patients. We developed models to predict status of routine biomarkers (ER, HER2,Ki-67, histological grade) from sequencing data. Non-routine biomarkers, including mutations in BRCA1, BRCA2 and ERBB2(HER2), and additional clinically actionable somatic alterations were also investigated. Concordance with routine diagnostic biomarkers was high for ER status (AUC = 0.95;AUC(replication) = 0.97) and HER2 status (AUC = 0.97;AUC(replication) = 0.92). The transcriptomic grade model enabled classification of histological grade 1 and histological grade 3 tumors with high accuracy (AUC = 0.98;AUC(replication) = 0.94). Clinically actionable mutations in BRCA1, BRCA2 and ERBB2(HER2) were detected in 5.5% of patients, while 53% had genomic alterations matching ongoing or concluded breast cancer studies. Sequencing-based molecular profiling can be applied as an alternative to histopathology to determine ER and HER2 status, in addition to providing improved tumor grading and clinically actionable mutations and molecular subtypes. Our results suggest that sequencing-based breast cancer diagnostics in a near future can replace routine biomarkers.

  20. Breast Cancer Immunotherapy

    Institute of Scientific and Technical Information of China (English)

    Juhua Zhou; Yin Zhong

    2004-01-01

    Breast cancer is a leading cause of cancer-related deaths in women worldwide. Although tumorectomy,radiotherapy, chemotherapy and hormone replacement therapy have been used for the treatment of breast cancer, there is no effective therapy for patients with invasive and metastatic breast cancer. Immunotherapy may be proved effective in treating patients with advanced breast cancer. Breast cancer immunotherapy includes antibody based immunotherapy, cancer vaccine immunotherapy, adoptive T cell transfer immunotherapy and T cell receptor gene transfer immunotherapy. Antibody based immunotherapy such as the monoclonal antibody against HER-2/neu (trastuzumab) is successfully used in the treatment of breast cancer patients with over-expressed HER-2/neu, however, HER-2/neu is over-expressed only in 25-30% of breast cancer patients. Cancer vaccine immunotherapy is a promising method to treat cancer patients. Cancer vaccines can be used to induce specific anti-tumor immunity in breast cancer patients, but cannot induce objective tumor regression. Adoptive T cell transfer immunotherapy is an effective method in the treatment of melanoma patients. Recent advances in anti-tumor T cell generation ex vivo and limited clinical trial data have made the feasibility of adoptive T cell transfer immunotherapy in the treatment of breast cancer patients. T cell receptor gene transfer can redirect the specificity of T cells. Chimeric receptor, scFv(anti-HER-2/neu)/zeta receptor, was successfully used to redirect cytotoxic T lymphocyte hybridoma cells to obtain anti-HER-2/neu positive tumor cells, suggesting the feasibility of treatment of breast cancer patients with T cell receptor gene transfer immunotherapy. Clinical trials will approve that immunotherapy is an effective method to cure breast cancer disease in the near future.

  1. Breast Cancer Immunotherapy

    Institute of Scientific and Technical Information of China (English)

    JuhuaZhou; YinZhong

    2004-01-01

    Breast cancer is a leading cause of cancer-related deaths in women worldwide. Although tumorectomy, radiotherapy, chemotherapy and hormone replacement therapy have been used for the treatment of breast cancer, there is no effective therapy for patients with invasive and metastatic breast cancer. Immunotherapy may be proved effective in treating patients with advanced breast cancer. Breast cancer immunotherapy includes antibody based immunotherapy, cancer vaccine immunotherapy, adoptive T cell transfer immunotherapy and T cell receptor gene transfer immunotherapy. Antibody based immunotherapy such as the monoclonal antibody against HER-2/neu (trastuzumab) is successfully used in the treatment of breast cancer patients with over-expressed HER-2/neu, however, HER-2/neu is over-expressed only in 25-30% of breast cancer patients. Cancer vaccine immunotherapy is a promising method to treat cancer patients. Cancer vaccines can be used to induce specific anti-tumor immunity in breast cancer patients, but cannot induce objective tumor regression. Adoptive T cell transfer immunotherapy is an effective method in the treatment of melanoma patients. Recent advances in anti-tumor T cell generation ex vivo and limited clinical trial data have made the feasibility of adoptive T cell transfer immunotherapy in the treatment of breast cancer patients. T cell receptor gene transfer can redirect the specificity of T cells. Chimeric receptor, scFv(anti-HER-2/neu)/zeta receptor, was successfully used to redirect cytotoxic T lymphocyte hybridoma cells to obtain anti-HER-2/neu positive tumor cells, suggesting the feasibility of treatment of breast cancer patients with T cell receptor gene transfer immunotherapy. Clinical trials will approve that immunotherapy is an effective method to cure breast cancer disease in the near future. Cellular & Molecular Immunology.

  2. TIMP-1 overexpression does not affect sensitivity to HER2-targeting drugs in the HER2-gene-amplified SK-BR-3 human breast cancer cell line

    DEFF Research Database (Denmark)

    Deng, Xiaohong; Fogh, Louise; Lademann, Ulrik Axel

    2013-01-01

    affect sensitivity to the HER2-targeting drugs trastuzumab and lapatinib. SK-BR-3 human breast cancer cells were stably transfected with TIMP-1, characterized with regard to TIMP-1 protein expression, proliferation, and functionality of the secreted TIMP-1, and the sensitivity to trastuzumab...... and lapatinib was studied in five selected single-cell subclones expressing TIMP-1 protein at various levels plus the parental SK-BR-3 cell line. Both trastuzumab and lapatinib reduced cell viability, as determined by MTT assay, but the sensitivity to the drugs was not associated with the expression level...... to trastuzumab and lapatinib....

  3. Contribution of an alveolar cell of origin to the high-grade malignant phenotype of pregnancy-associated breast cancer.

    Science.gov (United States)

    Haricharan, S; Hein, S M; Dong, J; Toneff, M J; Aina, O H; Rao, P H; Cardiff, R D; Li, Y

    2014-12-11

    Pregnancy-associated breast cancers (PABCs) are tumors diagnosed during pregnancy or up to 5 years following parturition, and are usually high-grade, connective tissue-rich, and estrogen receptor (ER)/progesterone receptor-negative. Little is known about the cellular origin of PABCs or the mechanisms by which PABCs are initiated. Using the RCAS retrovirus to deliver the ErbB2 oncogene into the mammary epithelium of our previously reported MMTV-tva transgenic mice, we detected high-grade, poorly differentiated, stroma-rich and ER-negative tumors during pregnancy and lactation. These high-grade and stroma-rich tumors were less frequent in involuted mice or in age-matched nulliparous mice. More importantly, by generating a WAP-tva transgenic line for expression of ErbB2 selectively in WAP(+) mammary alveolar cells, we found that tumors had similar morphological phenotypes (high grade, poorly differentiated, stroma-rich and ER-negative), irrespective of the time since pregnancy and even in the absence of pregnancy. These data suggest that PABCs arise preferentially from an alveolar cell population that expands during pregnancy and lactation. This somatic mouse model may also be useful for preclinical testing of new prophylactic and therapeutic strategies against PABC.

  4. Contribution of an alveolar cell of origin to the aggressive phenotype of pregnancy-associated breast cancer

    Science.gov (United States)

    Haricharan, Svasti; Hein, Sarah; Dong, Jie; Toneff, Michael; Aina, Olulana; Rao, Pulivarthi H.; Cardiff, Robert; Li, Yi

    2014-01-01

    Pregnancy-associated breast cancers (PABCs) are malignancies diagnosed during pregnancy or up to five years following parturition, and are usually aggressive, stroma-rich, and estrogen receptor/progesterone receptor-negative; but little is known about the cellular origin of PABCs or the mechanisms by which PABCs initiate. Using the RCAS retrovirus to deliver the ErbB2 oncogene into the mammary epithelium of our previous reported MMTV-tva transgenic mice, we detected human PABC-like tumors during pregnancy and lactation but not in involuted mice or in age-matched virgin mice. More importantly, by generating a WAP-tva transgenic line for expression of ErbB2 selectively in WAP+ mammary alveolar cells, we found that the resulting tumors exhibited the hallmarks of PABCs irrespective of the time since pregnancy and even in the absence of pregnancy. These data suggest that PABCs arise preferentially from an alveolar cell population that expands during pregnancy and lactation. This somatic mouse model may also be useful for preclinical testing of new prophylactic and therapeutic strategies against PABC. PMID:24317513

  5. An Anti-Oncogenic Role for Decorin in Mammary Carcinoma

    National Research Council Canada - National Science Library

    Iozzo, Renato V

    2004-01-01

    .... In the preliminary data that support the basis of this proposal, we discovered that decorin causes a functional inactivation of the oncogenic ErbB2 protein in mammary carcinoma cells overexpressing ErbB2...

  6. Health related quality of life of women in TEACH, a randomised placebo controlled adjuvant trial of lapatinib in early stage Human Epidermal Growth Factor Receptor (HER2) overexpressing breast cancer

    DEFF Research Database (Denmark)

    Boyle, Frances M; Smith, Ian E; O'Shaughnessy, Joyce

    2015-01-01

    BACKGROUND: To evaluate health related quality of life (HRQOL) in TEACH, a phase III randomized placebo controlled trial of 12 months of adjuvant lapatinib in HER2 positive (HER2+) early breast cancer which demonstrated marginal benefit in disease-free survival. METHODS: Women on TEACH completed...... (physical functioning, role physical, bodily pain, general health, vitality, social functioning, role emotional and mental health), and in patients discontinuing therapy. A five-point change was deemed a Minimally Clinically Important Difference (MCID). Response analysis compared the proportion of patients...... significant incidences of diarrhoea and rash in lapatinib treated patients. At six months, women receiving lapatinib had more significant reductions (p placebo) in social functioning. Early treatment discontinuations were more frequent on lapatinib (32% versus 18%), and were associated with more...

  7. The expression level of HJURP has an independent prognostic impact and predicts the sensitivity to radiotherapy in breast cancer

    International Nuclear Information System (INIS)

    Hu, Zhi; Huang, Ge; Sadanandam, Anguraj; Gu, Shenda; Lenburg, Marc E.; Pai, Melody; Bayani, Nora; Blakely, Eleanor A.; Gray, Joe W.; Mao, Jian-Hua

    2010-01-01

    HJURP (Holliday Junction Recognition Protein) is a newly discovered gene reported to function at centromeres and to interact with CENPA. However its role in tumor development remains largely unknown. The goal of this study was to investigate the clinical significance of HJURP in breast cancer and its correlation with radiotherapeutic outcome. We measured HJURP expression level in human breast cancer cell lines and primary breast cancers by Western blot and/or by Affymetrix Microarray; and determined its associations with clinical variables using standard statistical methods. Validation was performed with the use of published microarray data. We assessed cell growth and apoptosis of breast cancer cells after radiation using high-content image analysis. HJURP was expressed at higher level in breast cancer than in normal breast tissue. HJURP mRNA levels were significantly associated with estrogen receptor (ER), progesterone receptor (PR), Scarff-Bloom-Richardson (SBR) grade, age and Ki67 proliferation indices, but not with pathologic stage, ERBB2, tumor size, or lymph node status. Higher HJURP mRNA levels significantly decreased disease-free and overall survival. HJURP mRNA levels predicted the prognosis better than Ki67 proliferation indices. In a multivariate Cox proportional-hazard regression, including clinical variables as covariates, HJURP mRNA levels remained an independent prognostic factor for disease-free and overall survival. In addition HJURP mRNA levels were an independent prognostic factor over molecular subtypes (normal like, luminal, Erbb2 and basal). Poor clinical outcomes among patients with high HJURP expression were validated in five additional breast cancer cohorts. Furthermore, the patients with high HJURP levels were much more sensitive to radiotherapy. In vitro studies in breast cancer cell lines showed that cells with high HJURP levels were more sensitive to radiation treatment and had a higher rate of apoptosis than those with low levels

  8. The expression level of HJURP has an independent prognostic impact and predicts the sensitivity to radiotherapy in breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Zhi; Huang, Ge; Sadanandam, Anguraj; Gu, Shenda; Lenburg, Marc E; Pai, Melody; Bayani, Nora; Blakely, Eleanor A; Gray, Joe W; Mao, Jian-Hua

    2010-06-25

    Introduction: HJURP (Holliday Junction Recognition Protein) is a newly discovered gene reported to function at centromeres and to interact with CENPA. However its role in tumor development remains largely unknown. The goal of this study was to investigate the clinical significance of HJURP in breast cancer and its correlation with radiotherapeutic outcome. Methods: We measured HJURP expression level in human breast cancer cell lines and primary breast cancers by Western blot and/or by Affymetrix Microarray; and determined its associations with clinical variables using standard statistical methods. Validation was performed with the use of published microarray data. We assessed cell growth and apoptosis of breast cancer cells after radiation using high-content image analysis. Results: HJURP was expressed at higher level in breast cancer than in normal breast tissue. HJURP mRNA levels were significantly associated with estrogen receptor (ER), progesterone receptor (PR), Scarff-Bloom-Richardson (SBR) grade, age and Ki67 proliferation indices, but not with pathologic stage, ERBB2, tumor size, or lymph node status. Higher HJURP mRNA levels significantly decreased disease-free and overall survival. HJURP mRNA levels predicted the prognosis better than Ki67 proliferation indices. In a multivariate Cox proportional-hazard regression, including clinical variables as covariates, HJURP mRNA levels remained an independent prognostic factor for disease-free and overall survival. In addition HJURP mRNA levels were an independent prognostic factor over molecular subtypes (normal like, luminal, Erbb2 and basal). Poor clinical outcomes among patients with high HJURP expression werevalidated in five additional breast cancer cohorts. Furthermore, the patients with high HJURP levels were much more sensitive to radiotherapy. In vitro studies in breast cancer cell lines showed that cells with high HJURP levels were more sensitive to radiation treatment and had a higher rate of apoptosis

  9. Chapter 27 -- Breast Cancer Genomics, Section VI, Pathology and Biological Markers of Invasive Breast Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Spellman, Paul T.; Heiser, Laura; Gray, Joe W.

    2009-06-18

    Breast cancer is predominantly a disease of the genome with cancers arising and progressing through accumulation of aberrations that alter the genome - by changing DNA sequence, copy number, and structure in ways that that contribute to diverse aspects of cancer pathophysiology. Classic examples of genomic events that contribute to breast cancer pathophysiology include inherited mutations in BRCA1, BRCA2, TP53, and CHK2 that contribute to the initiation of breast cancer, amplification of ERBB2 (formerly HER2) and mutations of elements of the PI3-kinase pathway that activate aspects of epidermal growth factor receptor (EGFR) signaling and deletion of CDKN2A/B that contributes to cell cycle deregulation and genome instability. It is now apparent that accumulation of these aberrations is a time-dependent process that accelerates with age. Although American women living to an age of 85 have a 1 in 8 chance of developing breast cancer, the incidence of cancer in women younger than 30 years is uncommon. This is consistent with a multistep cancer progression model whereby mutation and selection drive the tumor's development, analogous to traditional Darwinian evolution. In the case of cancer, the driving events are changes in sequence, copy number, and structure of DNA and alterations in chromatin structure or other epigenetic marks. Our understanding of the genetic, genomic, and epigenomic events that influence the development and progression of breast cancer is increasing at a remarkable rate through application of powerful analysis tools that enable genome-wide analysis of DNA sequence and structure, copy number, allelic loss, and epigenomic modification. Application of these techniques to elucidation of the nature and timing of these events is enriching our understanding of mechanisms that increase breast cancer susceptibility, enable tumor initiation and progression to metastatic disease, and determine therapeutic response or resistance. These studies also

  10. Mammary gland tumor formation in transgenic mice overexpressing stromelysin-1

    Energy Technology Data Exchange (ETDEWEB)

    Sympson, Carolyn J; Bissell, Mina J; Werb, Zena

    1995-06-01

    An intact basement membrane (BM) is essential for the proper function, differentiation and morphology of many epithelial cells. The disruption or loss of this BM occurs during normal development as well as in the disease state. To examine the importance of BM during mammary gland development in vivo, we generated transgenic mice that inappropriately express autoactivating isoforms of the matrix metalloproteinase stromelysin-1. The mammary glands from these mice are both functionally and morphologically altered throughout development. We have now documented a dramatic incidence of breast tumors in several independent lines of these mice. These data suggest that overexpression of stromelysin-1 and disruption of the BM may be a key step in the multi-step process of breast cancer.

  11. HER2 overexpression elicits a proinflammatory IL-6 autocrine signaling loop that is critical for tumorigenesis.

    Science.gov (United States)

    Hartman, Zachary C; Yang, Xiao-Yi; Glass, Oliver; Lei, Gangjun; Osada, Takuya; Dave, Sandeep S; Morse, Michael A; Clay, Timothy M; Lyerly, Herbert K

    2011-07-01

    HER2 overexpression occurs in approximately 25% of breast cancers, where it correlates with poor prognosis. Likewise, systemic inflammation in breast cancer correlates with poor prognosis, although the process is not understood. In this study, we explored the relationship between HER2 and inflammation, comparing the effects of overexpressing wild-type or mutated inactive forms of HER2 in primary human breast cells. Wild-type HER2 elicited a profound transcriptional inflammatory profile, including marked elevation of interleukin-6 (IL-6) expression, which we established to be a critical determinant of HER2 oncogenesis. Mechanistic investigations revealed that IL-6 secretion induced by HER2 overexpression activated Stat3 and altered gene expression, enforcing an autocrine loop of IL-6/Stat3 expression. Both mouse and human in vivo models of HER2-amplified breast carcinoma relied critically on this HER2-IL-6-Stat3 signaling pathway. Our studies offer the first direct evidence linking HER2 to a systemic inflammatory mechanism that orchestrates HER2-mediated tumor growth. We suggest that the HER2-IL-6-STAT3 signaling axis we have defined in breast cancer could prompt new therapeutic or prevention strategies for treatment of HER2-amplified cancers. ©2011 AACR.

  12. A phase I open-label dose-escalation study of the anti-HER3 monoclonal antibody LJM716 in patients with advanced squamous cell carcinoma of the esophagus or head and neck and HER2-overexpressing breast or gastric cancer.

    Science.gov (United States)

    Reynolds, Kerry Lynn; Bedard, Philippe L; Lee, Se-Hoon; Lin, Chia-Chi; Tabernero, Josep; Alsina, Maria; Cohen, Ezra; Baselga, José; Blumenschein, George; Graham, Donna M; Garrido-Laguna, Ignacio; Juric, Dejan; Sharma, Sunil; Salgia, Ravi; Seroutou, Abdelkader; Tian, Xianbin; Fernandez, Rose; Morozov, Alex; Sheng, Qing; Ramkumar, Thiruvamoor; Zubel, Angela; Bang, Yung-Jue

    2017-09-12

    Human epidermal growth factor receptor 3 (HER3) is important in maintaining epidermal growth factor receptor-driven cancers and mediating resistance to targeted therapy. A phase I study of anti-HER3 monoclonal antibody LJM716 was conducted with the primary objective to identify the maximum tolerated dose (MTD) and/or recommended dose for expansion (RDE), and dosing schedule. Secondary objectives were to characterize safety/tolerability, pharmacokinetics, pharmacodynamics, and preliminary antitumor activity. This open-label, dose-finding study comprised dose escalation, followed by expansion in patients with squamous cell carcinoma of the head and neck or esophagus, and HER2-overexpressing metastatic breast cancer or gastric cancer. During dose escalation, patients received LJM716 intravenous once weekly (QW) or every two weeks (Q2W), in 28-day cycles. An adaptive Bayesian logistic regression model was used to guide dose escalation and establish the RDE. Exploratory pharmacodynamic tumor studies evaluated modulation of HER3 signaling. Patients received LJM716 3-40 mg/kg QW and 20 mg/kg Q2W (54 patients; 36 patients at 40 mg/kg QW). No dose-limiting toxicities (DLTs) were reported during dose-escalation. One patient experienced two DLTs (diarrhea, hypokalemia [both grade 3]) in the expansion phase. The RDE was 40 mg/kg QW, providing drug levels above the preclinical minimum effective concentration. One patient with gastric cancer had an unconfirmed partial response; 17/54 patients had stable disease, two lasting >30 weeks. Down-modulation of phospho-HER3 was observed in paired tumor samples. LJM716 was well tolerated; the MTD was not reached, and the RDE was 40 mg/kg QW. Further development of LJM716 is ongoing. Clinicaltrials.gov registry number NCT01598077 (registered on 4 May, 2012).

  13. Breast Pain

    Science.gov (United States)

    ... result in the development of breast cysts. Breast trauma, prior breast surgery or other factors localized to the breast can lead to breast pain. Breast pain may also start outside the breast — in the chest wall, muscles, joints or heart, for example — and ...

  14. Revolutionizing membrane protein overexpression in bacteria

    NARCIS (Netherlands)

    Schlegel, Susan; Klepsch, Mirjam; Gialama, Dimitra; Wickstrom, David; Slotboom, Dirk Jan; de Gier, Jan-Willem; Wickström, David

    The bacterium Escherichia coli is the most widely used expression host for overexpression trials of membrane proteins. Usually, different strains, culture conditions and expression regimes are screened for to identify the optimal overexpression strategy. However, yields are often not satisfactory,

  15. Low or undetectable TPO receptor expression in malignant tissue and cell lines derived from breast, lung, and ovarian tumors

    Directory of Open Access Journals (Sweden)

    Erickson-Miller Connie L

    2012-09-01

    Full Text Available Abstract Background Numerous efficacious chemotherapy regimens may cause thrombocytopenia. Thrombopoietin receptor (TPO-R agonists, such as eltrombopag, represent a novel approach for the treatment of chemotherapy-induced thrombocytopenia. The TPO-R MPL is expressed on megakaryocytes and megakaryocyte precursors, although little is known about its expression on other tissues. Methods Breast, lung, and ovarian tumor samples were analyzed for MPL expression by microarray and/or quantitative reverse transcription-polymerase chain reaction (qRT-PCR, and for TPO-R protein expression by immunohistochemistry (IHC. Cell line proliferation assays were used to analyze the in vitro effect of eltrombopag on breast, lung, and ovarian tumor cell proliferation. The lung carcinoma cell lines were also analyzed for TPO-R protein expression by Western blot. Results MPL mRNA was not detectable in 118 breast tumors and was detectable at only very low levels in 48% of 29 lung tumors studied by microarray analysis. By qRT-PCR, low but detectable levels of MPL mRNA were detectable in some normal (14-43% and malignant (3-17% breast, lung, and ovarian tissues. A comparison of MPL to EPOR, ERBB2, and IGF1R mRNA demonstrates that MPL mRNA levels were far lower than those of EPOR and ERBB2 mRNA in the same tissues. IHC analysis showed negligible TPO-R protein expression in tumor tissues, confirming mRNA analysis. Culture of breast, lung, and ovarian carcinoma cell lines showed no increase, and in fact, showed a decrease in proliferation following incubation with eltrombopag. Western blot analyses revealed no detectable TPO-R protein expression in the lung carcinoma cell lines. Conclusions Multiple analyses of breast, lung, and ovarian tumor samples and/or cell lines show no evidence of MPL mRNA or TPO-R protein expression. Eltrombopag does not stimulate growth of breast, lung, or ovarian tumor cell lines at doses likely to exert their actions on megakaryocytes and

  16. Harnessing Functional Genomics to Reverse Chemoresistance in Breast Cancer

    National Research Council Canada - National Science Library

    Bodemann, Brian

    2007-01-01

    .... An example of successful targeted therapy is trastuzumab, a humanized monoclonal antibody that binds to the extracellular domain of HER2, a receptor which is overexpressed in many breast cancers...

  17. Promotion of breast cancer by β-Hexachlorocyclohexane in MCF10AT1 cells and MMTV-neu mice

    Directory of Open Access Journals (Sweden)

    Matsumura Fumio

    2007-07-01

    Full Text Available Abstract Background Exposure to β-Hexachlorocyclohexane (β-HCH, a contaminant of the hexachlorohexane pesticide lindane, has been implicated as a risk factor in the development of breast cancers in epidemiological studies. Previous studies in our laboratory have demonstrated the ability of β-HCH to elicit its actions via a ligand-independent activation of the estrogen receptor through increased c-Neu (= erbB2 or HER-2 expression and kinase activation in both the BG-1 and MCF-7 cell lines. In addition, long term exposure (33 passages to β-HCH was shown to promote the selection of MCF-7 cells which exhibit a more metastatic phenotype. Methods In this current study, we decided to investigate the long-term effects of β-HCH in both the MCF10AT1 cell line which was derived from a normal epithelial cell line by stably transfecting a mutated c-Ha-ras and a MMTV-Neu mouse model for mammary cancer in vivo. MCF10AT1 cells were exposed for 20 passages with β-HCH, 4-OH-Tamoxifen (Tam, or 17-β-estradiol (E2 after which cells were analyzed for proliferation rates and mRNA expression by RT-PCR. In our in vivo studies, MMTV-Neu mice were injected with β-HCH and observed for tumor formation over a 70 week period. Results β-HCH and Tam selected MCF10AT1 cells demonstrated increased mRNA expression of MMP-13 (collagenase-3 a marker of increased invasiveness. β-HCH treatment was also seen to increase the expression in a number of proto-oncogenes (c-Neu, Cyclin D1, p27, cell status markers (Met-1, CK19, and the inflammatory marker NFκB. Previous studies, have demonstrated the role of these markers as evidence of malignant transformations, and further illustrate the ability of β-HCH to be carcinogenic. To demonstrate β-HCH's tumorigenic properties in an in vivo system, we used an MMTV-Neu mouse model. MMTV-Neu is a c-Neu overexpressing strain which has been shown to spontaneously develop mammary tumors at later stages of aging. In this experiment,

  18. SNEV overexpression extends the life span of human endothelial cells

    International Nuclear Information System (INIS)

    Voglauer, Regina; Chang, Martina Wei-Fen; Dampier, Brigitta; Wieser, Matthias; Baumann, Kristin; Sterovsky, Thomas; Schreiber, Martin; Katinger, Hermann; Grillari, Johannes

    2006-01-01

    In a recent screening for genes downregulated in replicatively senescent human umbilical vein endothelial cells (HUVECs), we have isolated the novel protein SNEV. Since then SNEV has proven as a multifaceted protein playing a role in pre-mRNA splicing, DNA repair, and the ubiquitin/proteosome system. Here, we report that SNEV mRNA decreases in various cell types during replicative senescence, and that it is increased in various immortalized cell lines, as well as in breast tumors, where SNEV transcript levels also correlate with the survival of breast cancer patients. Since these mRNA profiles suggested a role of SNEV in the regulation of cell proliferation, the effect of its overexpression was tested. Thereby, a significant extension of the cellular life span was observed, which was not caused by altered telomerase activity or telomere dynamics but rather by enhanced stress resistance. When SNEV overexpressing cells were treated with bleomycin or bleomycin combined with BSO, inducing DNA damage as well as reactive oxygen species, a significantly lower fraction of apoptotic cells was found in comparison to vector control cells. These data suggest that high levels of SNEV might extend the cellular life span by increasing the resistance to stress or by improving the DNA repair capacity of the cells

  19. Gene Overexpression: Uses, Mechanisms, and Interpretation

    Science.gov (United States)

    2012-01-01

    The classical genetic approach for exploring biological pathways typically begins by identifying mutations that cause a phenotype of interest. Overexpression or misexpression of a wild-type gene product, however, can also cause mutant phenotypes, providing geneticists with an alternative yet powerful tool to identify pathway components that might remain undetected using traditional loss-of-function analysis. This review describes the history of overexpression, the mechanisms that are responsible for overexpression phenotypes, tests that begin to distinguish between those mechanisms, the varied ways in which overexpression is used, the methods and reagents available in several organisms, and the relevance of overexpression to human disease. PMID:22419077

  20. Differences in radiosensitivity between three HER2 overexpressing cell lines

    International Nuclear Information System (INIS)

    Steffen, Ann-Charlott; Tolmachev, Vladimir; Stenerloew, Bo; Goestring, Lovisa; Palm, Stig; Carlsson, Joergen

    2008-01-01

    HER2 is a potential target for radionuclide therapy, especially when HER2 overexpressing breast cancer cells are resistant to Herceptin registered treatment. Therefore, it is of interest to analyse whether HER2 overexpressing tumour cells have different inherent radiosensitivity. The radiosensitivity of three often used HER2 overexpressing cell lines, SKOV-3, SKBR-3 and BT-474, was analysed. The cells were exposed to conventional photon irradiation, low linear energy transfer (LET), to characterise their inherent radiosensitivity. The analysis was made with clonogenic survival and growth extrapolation assays. The cells were also exposed to alpha particles, high LET, from 211 At decays using the HER2-binding affibody molecule 211 At-(Z HER2:4 ) 2 as targeting agent. Assays for studies of internalisation of the affibody molecule were applied. SKOV-3 cells were most radioresistant, SKBR-3 cells were intermediate and BT-474 cells were most sensitive as measured with the clonogenic and growth extrapolation assays after photon irradiation. The HER2 dependent cellular uptake of 211 At was qualitatively similar for all three cell lines. However, the sensitivity to the alpha particles from 211 At differed; SKOV-3 was most resistant, SKBR-3 intermediate and BT-474 most sensitive. These differences were unexpected because it is assumed that all types of cells should have similar sensitivity to high-LET radiation. The sensitivity to alpha particle exposure correlated with internalisation of the affibody molecule and with size of the cell nucleus. There can be differences in radiosensitivity, which, if they also exist between patient breast cancer cells, are important to consider for both conventional radiotherapy and for HER2-targeted radionuclide therapy. (orig.)

  1. Novel Drugs that Target ErbB2

    Science.gov (United States)

    2012-05-01

    of pharmacological properties including antiviral, antibacterial, anti-inflammatory, antimalarial and anticancer activities (1, 2). BA also inhibits...expression and the overall mechanisms associated with the anticancer activity of BA. We also investigated the role of BA in triple-negative MDA-MB-231...expression and the overall mechanisms associated with the anticancer activity of BA. In addition, we also investigated the role of BA in triple-negative

  2. ErbB2-associated changes in the lysosomal proteome

    DEFF Research Database (Denmark)

    Nylandsted, Jesper; Becker, Andrea C; Bunkenborg, Jakob

    2011-01-01

    Late endosomes and lysosomes (hereafter referred to as lysosomes) play an essential role in the turnover of cellular macromolecules and organelles. Their biochemical characterization has so far depended on purification methods based on either density gradient centrifugations or magnetic...... purification of iron-loaded organelles. Owing to dramatic changes in lysosomal density and stability associated with lysosomal diseases and cancer, these methods are not optimal for the comparison of normal and pathological lysosomes. Here, we introduce an efficient method for the purification of intact...... lysosomes by magnetic immunoprecipitation with antibodies against the vacuolar-type H(+) -ATPase. Quantitative MS-based proteomics analysis of the obtained lysosomal membranes identified 60 proteins, most of which have previously been associated with the lysosomal compartment. Interestingly, the lysosomal...

  3. Targeted overexpression of EZH2 in the mammary gland disrupts ductal morphogenesis and causes epithelial hyperplasia.

    Science.gov (United States)

    Li, Xin; Gonzalez, Maria E; Toy, Katherine; Filzen, Tracey; Merajver, Sofia D; Kleer, Celina G

    2009-09-01

    The Polycomb group protein enhancer of zeste homolog 2 (EZH2), which has roles during development of numerous tissues, is a critical regulator of cell type identity. Overexpression of EZH2 has been detected in invasive breast carcinoma tissue samples and is observed in human breast tissue samples of morphologically normal lobules up to 12 years before the development of breast cancer. The function of EZH2 during preneoplastic progression in the mammary gland is unknown. To investigate the role of EZH2 in the mammary gland, we targeted the expression of EZH2 to mammary epithelial cells using the mouse mammary tumor virus long terminal repeat. EZH2 overexpression resulted in aberrant terminal end bud architecture. By the age of 4 months, 100% of female mouse mammary tumor virus-EZH2 virgin mice developed intraductal epithelial hyperplasia resembling the human counterpart accompanied by premature differentiation of ductal epithelial cells and up-regulation of the luminal marker GATA-3. In addition, remodeling of the mammary gland after parturition was impaired and EZH2 overexpression caused delayed involution. Mechanistically, we found that EZH2 physically interacts with beta-catenin, inducing beta-catenin nuclear accumulation in mammary epithelial cells and activating Wnt/beta-catenin signaling. The biological significance of these data to human hyperplasias is demonstrated by EZH2 up-regulation and colocalization with beta-catenin in human intraductal epithelial hyperplasia, the earliest histologically identifiable precursor of breast carcinoma.

  4. Macrodissection prior to closed system RT-qPCR is not necessary for estrogen receptor and HER2 concordance with IHC/FISH in breast cancer.

    Science.gov (United States)

    Gupta, Swati; Mani, Navin R; Carvajal-Hausdorf, Daniel E; Bossuyt, Veerle; Ho, Kenneth; Weidler, Jodi; Wong, Wendy; Rhees, Brian; Bates, Michael; Rimm, David L

    2018-06-01

    An on-demand, closed RT-qPCR, the GeneXpert (GX) system, has the potential to provide biomarker information in low-resourced settings and elsewhere. We used this system with a research use only version of the Breast Cancer STRAT4 cartridge that measures the mRNA expression levels of ERBB2, ESR1, PGR, and MKi67. Here we evaluated the impact of non-macrodissected (non m-d) versus macrodissected (m-d) samples using STRAT4 on formalin-fixed, paraffin-embedded (FFPE) core needle biopsies. Two cohorts were assessed: (1) 60 FFPE infiltrating ductal carcinoma (IDCA) cases and (2) 20 FFPE IDCA cases with ductal carcinoma in situ (DCIS) with a range of HER2 expression as determined by clinical immunohistochemistry and fluorescence in situ hybridization (IHC/FISH). We observed about half of the core needle biopsy area as invasive tumor in both IDCA (mean = 51.5%) and IDCA with DCIS (mean = 53.5%) cohorts, but also found the mRNA levels were independent of tumor area. We found excellent agreement of the mRNA transcript level between the paired samples, m-d versus non m-d, for ERBB2, ESR1, PGR, and MKi67 for both the IDCA and IDCA with DCIS cohorts. No significant difference (P > 0.99) was observed when we compared the mRNA transcript level between the paired samples m-d versus non m-d. In addition, we noted a significant concordance (P < 0.001) between RT-qPCR and IHC/FISH for HER2-positivity, ER-positivity, and PR-positivity, independent of specimen dissection. These data suggest that mRNA expression for ERBB2, ESR, and PGR is sufficiently low in surrounding tissue cells such that macrodissection is not required for assessment of key breast cancer mRNA markers and is independent of the amount of input tumor. This approach may be valuable in settings lacking pathology expertise or using specimen types, such as fine-needle aspirates, where it may be challenging to separate non-tumor from tumor tissue.

  5. Coamplification of miR-4728 protects HER2-amplified breast cancers from targeted therapy

    Science.gov (United States)

    Floros, Konstantinos V.; Hu, Bin; Monterrubio, Carles; Hughes, Mark T.; Wells, Jason D.; Morales, Cristina Bernadó; Ghotra, Maninderjit S.; Costa, Carlotta; Souers, Andrew J.; Boikos, Sosipatros A.; Leverson, Joel D.; Tan, Ming; Serra, Violeta; Koblinski, Jennifer E.; Arribas, Joaquin; Prat, Aleix; Paré, Laia; Miller, Todd W.; Harada, Hisashi; Windle, Brad E.; Scaltriti, Maurizio; Faber, Anthony C.

    2018-01-01

    HER2 (ERBB2) amplification is a driving oncogenic event in breast cancer. Clinical trials have consistently shown the benefit of HER2 inhibitors (HER2i) in treating patients with both local and advanced HER2+ breast cancer. Despite this benefit, their efficacy as single agents is limited, unlike the robust responses to other receptor tyrosine kinase inhibitors like EGFR inhibitors in EGFR-mutant lung cancer. Interestingly, the lack of HER2i efficacy occurs despite sufficient intracellular signaling shutdown following HER2i treatment. Exploring possible intrinsic causes for this lack of response, we uncovered remarkably depressed levels of NOXA, an endogenous inhibitor of the antiapoptotic MCL-1, in HER2-amplified breast cancer. Upon investigation of the mechanism leading to low NOXA, we identified a micro-RNA encoded in an intron of HER2, termed miR-4728, that targets the mRNA of the Estrogen Receptor α (ESR1). Reduced ESR1 expression in turn prevents ERα-mediated transcription of NOXA, mitigating apoptosis following treatment with the HER2i lapatinib. Importantly, resistance can be overcome with pharmacological inhibition of MCL-1. More generally, while many cancers like EGFR-mutant lung cancer are driven by activated kinases that when drugged lead to robust monotherapeutic responses, we demonstrate that the efficacy of targeted therapies directed against oncogenes active through focal amplification may be mitigated by coamplified genes. PMID:29476008

  6. Rapid and sensitive phenotypic marker detection on breast cancer cells using surface-enhanced Raman scattering (SERS) imaging.

    Science.gov (United States)

    Lee, Sangyeop; Chon, Hyangah; Lee, Jiyoung; Ko, Juhui; Chung, Bong Hyun; Lim, Dong Woo; Choo, Jaebum

    2014-01-15

    We report a surface-enhanced Raman scattering (SERS)-based cellular imaging technique to detect and quantify breast cancer phenotypic markers expressed on cell surfaces. This technique involves the synthesis of SERS nano tags consisting of silica-encapsulated hollow gold nanospheres (SEHGNs) conjugated with specific antibodies. Hollow gold nanospheres (HGNs) enhance SERS signal intensity of individual particles by localizing surface electromagnetic fields through pinholes in the hollow particle structures. This capacity to enhance imaging at the level of single molecules permits the use of HGNs to detect specific biological markers expressed in living cancer cells. In addition, silica encapsulation greatly enhances the stability of nanoparticles. Here we applied a SERS-based imaging technique using SEHGNs in the multiplex imaging of three breast cancer cell phenotypes. Expression of epidermal growth factor (EGF), ErbB2, and insulin-like growth factor-1 (IGF-1) receptors were assessed in the MDA-MB-468, KPL4 and SK-BR-3 human breast cancer cell lines. SERS imaging technology described here can be used to test the phenotype of a cancer cell and quantify proteins expressed on the cell surface simultaneously. Based on results, this technique may enable an earlier diagnosis of breast cancer than is currently possible and offer guidance in treatment. © 2013 Elsevier B.V. All rights reserved.

  7. Rhenium-188 as an alternative to Iodine-131 for treatment of breast tumors expressing the sodium/iodide symporter (NIS)

    International Nuclear Information System (INIS)

    Dadachova, E.; Bouzahzah, B.; Zuckier, L.S.; Pestell, R.G.

    2002-01-01

    The sodium-iodide symporter (NIS), which transports iodine into the cell, is expressed in thyroid tissue and was recently found to be expressed in approximately 80% of human breast cancers but not in healthy breast tissue. These findings raised the possibility that therapeutics targeting uptake by NIS may be used for breast cancer treatment. To increase the efficacy of such therapy it would be ideal to identify a radioactive therapy with enhanced local emission. The feasibility of using the powerful beta-emitting radiometal 188 Re in the form of 188 Re-perrhenate was therefore compared with 131 I for treatment of NIS-expressing mammary tumors. In the current studies, using a xenografted breast cancer model induced by the ErbB2 oncogene in nude mice, 188 Re-perrhenate exhibited NIS-dependent uptake into the mammary tumor. Dosimetry calculations in the mammary tumor demonstrate that 188 Re-perrhenate is able to deliver a dose 4.5 times higher than 131 I suggesting it may provide enhanced therapeutic efficacy

  8. Trastuzumab Resistance: Role for Notch Signaling

    Directory of Open Access Journals (Sweden)

    Kinnari Mehta

    2009-01-01

    Full Text Available Epidermal growth factor receptor-2 (ErbB-2/HER2 is a potent breast oncogene that has been shown to be amplified in 20% of breast cancers. Overexpression of ErbB-2 predicts for aggressive tumor behavior, resistance to some cytotoxic and antihormonal therapies, and poor overall survival. Trastuzumab, the humanized, monoclonal antibody directed against ErbB-2 has shown tremendous efficacy and improved overall survival for women when combined with a taxane-based chemotherapy. However, resistance to trastuzumab remains a major concern, most notably in women with metastatic breast cancer. Numerous mechanisms that include overexpression of alternate receptor tyrosine kinases and/or loss of critical tumor suppressors have been proposed in the last several years to elucidate trastuzumab resistance. Here we review the many possible mechanisms of action that could contribute to resistance, and novel therapies to prevent or reverse the resistant phenotype. Moreover, we provide a critical role for Notch signaling cross-talk with overlapping or new signaling networks in trastuzumab-resistant breast.

  9. Human Epidermal Growth Factor Receptor 2 Overexpression in Micropapillary and Other Variants of Urothelial Carcinoma.

    Science.gov (United States)

    Behzatoğlu, Kemal; Yörükoğlu, Kutsal; Demir, Hale; Bal, Nebil

    2016-06-21

    Human epidermal growth factor receptor 2 (HER2) protein overexpression or gene amplification has been shown in urothelial bladder cancer. This could be helpful when using targeted anti-HER2 therapy on these tumors. To evaluate HER2 immunohistochemical expression in conventional urothelial carcinoma (UC), in situ UC, and UC variants primarily in micropapillary urothelial carcinoma (MPUC). The study evaluated 60 MPUC cases; 25 invasive, 20 low-grade noninvasive, and 10 high-grade noninvasive UC cases; 8 in situ UC cases; and 69 UC variant cases. The immunohistochemistry staining was scored according to recommendations of the American Society of Clinical Oncology/College of American Pathologists 2013 HER2 test guideline established for breast cancer and only 3+ staining was considered HER2 overexpression. HER2 overexpression was determined by 3+ staining. 34 of 60 MPUC cases (56%) showed HER2 overexpression (3+ staining). We observed 3+ staining HER2 overexpression in nine of 25 conventional invasive UC cases (36%), four of eight in situ UC cases (50%), and three of six lipid cell variant cases (50%). 3+ staining HER2 overexpression was not seen in eight glandular, six small cell, and five sarcomatoid variant cases. HER2 overexpression was negative in the 20 low-grade noninvasive UC cases but positive in two of the 10 high-grade noninvasive UC cases (20%). We observed HER2 overexpression most commonly in MPUC cases. We also found HER2 overexpression in conventional invasive and in situ UC cases. Pure in situ UC and conventional invasive UC, especially MPUC, could be candidate tumors for treatment with anti-HER2 antibody (trastuzumab therapy). Targeted therapy has a limited place in treatment of bladder cancer. In this study, human epidermal growth factor receptor 2 (HER2) overexpression in bladder carcinomas was evaluated in a large number of cases. Anti-HER2 therapy could be used in bladder cancers, as in breast and gastric cancers. Copyright © 2016 European

  10. Breast Tomosynthesis

    Science.gov (United States)

    ... in distinguishing non-cancerous breast conditions from breast cancers. Breast implants may also impede accurate mammogram readings because both ... view as much as possible without rupturing the implant. top of ... discuss breast cancer screening options with their doctors: Breast Density and ...

  11. Histopathological features of breast tumours in BRCA1, BRCA2 and mutation-negative breast cancer families

    International Nuclear Information System (INIS)

    Eerola, Hannaleena; Heikkilä, Päivi; Tamminen, Anitta; Aittomäki, Kristiina; Blomqvist, Carl; Nevanlinna, Heli

    2005-01-01

    Histopathological features of BRCA1 and BRCA2 tumours have previously been characterised and compared with unselected breast tumours; however, familial non-BRCA1/2 tumours are less well known. The aim of this study was to characterise familial non-BRCA1/2 tumours and to evaluate routine immunohistochemical and pathological markers that could help us to further distinguish families carrying BRCA1/2 mutations from other breast cancer families. Breast cancer tissue specimens (n = 262) from 25 BRCA1, 20 BRCA2 and 74 non-BRCA1/2 families were studied on a tumour tissue microarray. Immunohistochemical staining of oestrogen receptor (ER), progesterone receptor (PgR) and p53 as well as the histology and grade of these three groups were compared with each other and with the respective information on 862 unselected control patients from the archives of the Pathology Department of Helsinki University Central Hospital. Immunohistochemical staining of erbB2 was also performed among familial cases. BRCA1-associated cancers were diagnosed younger and were more ER-negative and PgR-negative, p53-positive and of higher grade than the other tumours. However, in multivariate analysis the independent factors compared with non-BRCA1/2 tumours were age, grade and PgR negativity. BRCA2 cases did not have such distinctive features compared with non-BRCA1/2 tumours or with unselected control tumours. Familial cases without BRCA1/2 mutations had tumours of lower grade than the other groups. BRCA1 families differed from mutation-negative families by age, grade and PgR status, whereas ER status was not an independent marker

  12. The Human Cell Surfaceome of Breast Tumors

    Science.gov (United States)

    da Cunha, Júlia Pinheiro Chagas; Galante, Pedro Alexandre Favoretto; de Souza, Jorge Estefano Santana; Pieprzyk, Martin; Carraro, Dirce Maria; Old, Lloyd J.; Camargo, Anamaria Aranha; de Souza, Sandro José

    2013-01-01

    Introduction. Cell surface proteins are ideal targets for cancer therapy and diagnosis. We have identified a set of more than 3700 genes that code for transmembrane proteins believed to be at human cell surface. Methods. We used a high-throuput qPCR system for the analysis of 573 cell surface protein-coding genes in 12 primary breast tumors, 8 breast cell lines, and 21 normal human tissues including breast. To better understand the role of these genes in breast tumors, we used a series of bioinformatics strategies to integrates different type, of the datasets, such as KEGG, protein-protein interaction databases, ONCOMINE, and data from, literature. Results. We found that at least 77 genes are overexpressed in breast primary tumors while at least 2 of them have also a restricted expression pattern in normal tissues. We found common signaling pathways that may be regulated in breast tumors through the overexpression of these cell surface protein-coding genes. Furthermore, a comparison was made between the genes found in this report and other genes associated with features clinically relevant for breast tumorigenesis. Conclusions. The expression profiling generated in this study, together with an integrative bioinformatics analysis, allowed us to identify putative targets for breast tumors. PMID:24195083

  13. Rhein Induces Apoptosis in Human Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Ching-Yao Chang

    2012-01-01

    Full Text Available Human breast cancers cells overexpressing HER2/neu are more aggressive tumors with poor prognosis, and resistance to chemotherapy. This study investigates antiproliferation effects of anthraquinone derivatives of rhubarb root on human breast cancer cells. Of 7 anthraquinone derivatives, only rhein showed antiproliferative and apoptotic effects on both HER2-overexpressing MCF-7 (MCF-7/HER2 and control vector MCF-7 (MCF-7/VEC cells. Rhein induced dose- and time-dependent manners increase in caspase-9-mediated apoptosis correlating with activation of ROS-mediated activation of NF-κB- and p53-signaling pathways in both cell types. Therefore, this study highlighted rhein as processing anti-proliferative activity against HER2 overexpression or HER2-basal expression in breast cancer cells and playing important roles in apoptotic induction of human breast cancer cells.

  14. Breast infection

    Science.gov (United States)

    Mastitis; Infection - breast tissue; Breast abscess ... must continue to breastfeed or pump to relieve breast swelling from milk production. In case if the abscess does not go away, needle aspiration under ultrasound ...

  15. Breast lump

    Science.gov (United States)

    ... with milk). These cysts can occur with breastfeeding. Breast abscess . These typically occur if you are breastfeeding or ... Breast infections are treated with antibiotics. Sometimes a breast abscess needs to be drained with a needle or ...

  16. Breast Diseases

    Science.gov (United States)

    ... bumps, and discharges (fluids that are not breast milk). If you have a breast lump, pain, discharge or skin irritation, see your health care provider. Minor and serious breast problems have similar ...

  17. Breast lift

    Science.gov (United States)

    ... and areola may be moved. Sometimes, women have breast augmentation (enlargement with implants) when they have a breast lift. Why the ... MD, FACS, general surgery practice specializing in breast cancer, Virginia Mason Medical Center, Seattle, WA. Also reviewed ...

  18. Breast cancer

    Science.gov (United States)

    ... can help you know how to prevent breast cancer. Breast implants, using antiperspirants, and wearing underwire bras do not increase the risk for breast cancer. There is also no evidence of a direct ...

  19. Fibroadenoma - breast

    Science.gov (United States)

    Breast lump - fibroadenoma; Breast lump - noncancerous; Breast lump - benign ... The cause of fibroadenomas is not known. They may be related to hormones. Girls who are going through puberty and women who are ...

  20. HER2 overexpression elicits a pro-inflammatory IL-6 autocrine signaling loop that is critical for tumorigenesis

    Science.gov (United States)

    Hartman, Zachary C.; Yang, Xiao-Yi; Glass, Oliver; Lei, Gangjun; Osada, Takuya; Dave, Sandeep S.; Morse, Michael A.; Clay, Timothy M.; Lyerly, Herbert Kim

    2011-01-01

    HER2 overexpression occurs in ~25% of breast cancers where it correlates with poor prognosis. Likewise, systemic inflammation in breast cancer correlates with poor prognosis although the process is not understood. In this study, we explored the relationship between HER2 and inflammation, comparing the effects of overexpressing wild-type or mutated inactive forms of HER2 in primary human breast cells. Wild-type HER2 elicited a profound transcriptional inflammatory profile, including marked elevation of IL-6 expression, which we established to be a critical determinant of HER2 oncogenesis. Mechanistic investigations revealed that IL-6 secretion induced by HER2 overexpression activated Stat3 and altered gene expression, enforcing an autocrine loop of IL-6/Stat3 expression. Both mouse and human in vivo models of HER2 amplified breast carcinoma relied critically on this HER2-IL-6-Stat3 signaling pathway. Our studies offer the first direct evidence linking HER2 to a systemic inflammatory mechanism that orchestrates HER2-mediated tumor growth. We suggest that the HER2-IL6-STAT3 signaling axis we have defined in breast cancer could prompt new therapeutic or prevention strategies for treatment of HER2-amplified cancers. PMID:21518778

  1. Breast reconstruction - implants

    Science.gov (United States)

    Breast implants surgery; Mastectomy - breast reconstruction with implants; Breast cancer - breast reconstruction with implants ... harder to find a tumor if your breast cancer comes back. Getting breast implants does not take as long as breast reconstruction ...

  2. The biochemical effects of nano tamoxifen and some bioactive components in experimental breast cancer.

    Science.gov (United States)

    Ezzat, Afaf; Abdelhamid, Abdou Osman; El Awady, Mostafa K; Abd El Azeem, Amal S; Mohammed, Dina Mostafa

    2017-11-01

    The effect of nano tamoxifen and some bioactive components such as yeast, isoflavone, and silymarin on the level of resistance and prevention of breast cancer progression in experimental animals is the target of this study. Thirty female Sprague-Dawley rats received a single medication dosage of 7,12-dimethylbenz[a]anthracene (DMBA) intragastrically. After fourteen days of DMBA admission, the procedure protocol started out. Finally, all the experimental results evaluated, tabulated and statistically analyzed. The results demonstrated a highly significant elevation in the 8-OHdG level in group 1 (nano yeast) and 3 (nano silymarin) while the results demonstrated a highly significant reduction in group 2 (nano tamoxifen). The apoptosis results demonstrated a significant elevation in group 3 (nano silymarin) where appeared significant reduction in group 4 (nano isoflavone). ErbB-2 results demonstrated a significant elevation in group 2 (nano tamoxifen) and a significant reduction in each of group 3 (nano silymarin) and 4 (nano isoflavone). The lipid peroxide level demonstrated an extremely significant reduction in group 4 (nano isoflavone). And a significant reduction of total antioxidant was observed in group 3 (nano silymarin) in comparison to injected animals control. This may be considered a new vision and strategy to resist breast cancer disease or prevent progression. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  3. Overexpression of AIB1 in nasopharyngeal carcinomas correlates closely with advanced tumor stage.

    Science.gov (United States)

    Liu, Meng-Zhong; Xie, Dan; Mai, Shi-Juan; Tong, Zhu-Ting; Shao, Jian-Yong; Fu, Yong-Shui; Xia, Wen-Jie; Kung, Hsian-Fu; Guan, Xin-Yuan; Zeng, Yi-Xin

    2008-05-01

    AIB1, a candidate oncogene in breast cancer, is commonly amplified and overexpressed in several types of human cancers. In this study, expression and amplification of AIB1 in nasopharyngeal carcinoma (NPC) were studied by immunohistochemical analysis and fluorescence in situ hybridization using tissue microarrays, including 80 specimens of NPC and 20 specimens of nonneoplastic nasopharyngeal mucosa. In this NPC cohort, overexpression and amplification of AIB1 was detected in 36 (51%) of 71 and 3 (7%) of 46 NPCs, respectively. Overexpression of AIB1 was observed more frequently in NPCs in late T stages (T3/T4, 24/35 [69%]) than in earlier stages (T1/T2, 12/36 [33%]; P < .05). In addition, 18 (72%) of 25 NPCs with lymph node metastasis (N1-3) showed overexpression of AIB1; the frequency was significantly higher than that in NPCs without node metastasis (N0, 18/49 [39%]; P < .05). These findings suggest that overexpression of AIB1 in NPCs may be important in the acquisition of an invasive and/or metastatic phenotype.

  4. Molecular biology of breast cancer stem cells: potential clinical applications.

    Science.gov (United States)

    Nguyen, Nam P; Almeida, Fabio S; Chi, Alex; Nguyen, Ly M; Cohen, Deirdre; Karlsson, Ulf; Vinh-Hung, Vincent

    2010-10-01

    Breast cancer stem cells (CSC) have been postulated recently as responsible for failure of breast cancer treatment. The purpose of this study is to review breast CSCs molecular biology with respect to their mechanism of resistance to conventional therapy, and to develop treatment strategies that may improve survival of breast cancer patients. A literature search has identified in vitro and in vivo studies of breast CSCs. Breast CSCs overexpress breast cancer resistance protein (BCRP) which allows cancer cells to transport actively chemotherapy agents out of the cells. Radioresistance is modulated through activation of Wnt signaling pathway and overexpression of genes coding for glutathione. Lapatinib can selectively target HER-2 positive breast CSCs and improves disease-free survival in these patients. Metformin may target basal type breast CSCs. Parthenolide and oncolytic viruses are promising targeting agents for breast CSCs. Future clinical trials for breast cancer should include anti-cancer stem cells targeting agents in addition to conventional chemotherapy. Hypofractionation radiotherapy may be indicated for residual disease post chemotherapy. 2010 Elsevier Ltd. All rights reserved.

  5. Epigenetic suppression of neprilysin regulates breast cancer invasion.

    Science.gov (United States)

    Stephen, H M; Khoury, R J; Majmudar, P R; Blaylock, T; Hawkins, K; Salama, M S; Scott, M D; Cosminsky, B; Utreja, N K; Britt, J; Conway, R E

    2016-03-07

    In women, invasive breast cancer is the second most common cancer and the second cause of cancer-related death. Therefore, identifying novel regulators of breast cancer invasion could lead to additional biomarkers and therapeutic targets. Neprilysin, a cell-surface enzyme that cleaves and inactivates a number of substrates including endothelin-1 (ET1), has been implicated in breast cancer, but whether neprilysin promotes or inhibits breast cancer cell progression and metastasis is unclear. Here, we asked whether neprilysin expression predicts and functionally regulates breast cancer cell invasion. RT-PCR and flow cytometry analysis of MDA-MB-231 and MCF-7 breast cancer cell lines revealed decreased neprilysin expression compared with normal epithelial cells. Expression was also suppressed in invasive ductal carcinoma (IDC) compared with normal tissue. In addition, in vtro invasion assays demonstrated that neprilysin overexpression decreased breast cancer cell invasion, whereas neprilysin suppression augmented invasion. Furthermore, inhibiting neprilysin in MCF-7 breast cancer cells increased ET1 levels significantly, whereas overexpressing neprilysin decreased extracellular-signal related kinase (ERK) activation, indicating that neprilysin negatively regulates ET1-induced activation of mitogen-activated protein kinase (MAPK) signaling. To determine whether neprilysin was epigenetically suppressed in breast cancer, we performed bisulfite conversion analysis of breast cancer cells and clinical tumor samples. We found that the neprilysin promoter was hypermethylated in breast cancer; chemical reversal of methylation in MDA-MB-231 cells reactivated neprilysin expression and inhibited cancer cell invasion. Analysis of cancer databases revealed that neprilysin methylation significantly associates with survival in stage I IDC and estrogen receptor-negative breast cancer subtypes. These results demonstrate that neprilysin negatively regulates the ET axis in breast cancer

  6. Therapeutic Potential of a Novel Smac/DIABLO in Breast Cancer

    National Research Council Canada - National Science Library

    Srivastava, Rakesh K

    2005-01-01

    ... potential of tamoxifen, doxorubicin and paclitaxel. Overexpression of Smac/DIABLO gene or Smac peptide enhances the apoptosis-inducing potential of tamoxifen, doxorubicin and paclitaxel, and sentitizes TRAiL-resistant breast cancer cell lines...

  7. Cooverexpression of EpCAM and c-myc genes in malignant breast

    Indian Academy of Sciences (India)

    oncogene, affects progression, treatment, and diagnosis of many adenocarcinomas. C-myc has been shown to be a downstream target of EpCAM and is also one of the most important proto-oncogenes routinely overexpressed in breast cancer.

  8. Differential peripheral blood gene expression profile based on Her2 expression on primary tumors of breast cancer patients.

    Directory of Open Access Journals (Sweden)

    Oana Tudoran

    Full Text Available Breast cancer prognosis and treatment is highly dependent on the molecular features of the primary tumors. These tumors release specific molecules into the environment that trigger characteristic responses into the circulatory cells. In this study we investigated the expression pattern of 84 genes known to be involved in breast cancer signaling in the peripheral blood of breast cancer patients with ER-, PR- primary tumors. The patients were grouped according to Her2 expression on the primary tumors in Her2+ and Her2- cohorts. Transcriptional analysis revealed 15 genes to be differentially expressed between the two groups highlighting that Her2 signaling in primary tumors could be associated with specific blood gene expression. We found CCNA1 to be up-regulated, while ERBB2, RASSF1, CDH1, MKI67, GATA3, GLI1, SFN, PTGS2, JUN, NOTCH1, CTNNB1, KRT8, SRC, and HIC1 genes were down-regulated in the blood of triple negative breast cancer patients compared to Her2+ cohort. IPA network analysis predicts that the identified genes are interconnected and regulate each other. These genes code for cell cycle regulators, cell adhesion molecules, transcription factors or signal transducers that modulate immune signaling, several genes being also associated with cancer progression and treatment response. These results indicate an altered immune signaling in the peripheral blood of triple negative breast cancer patients. The involvement of the immune system is necessary in favorable treatment response, therefore these results could explain the low response rates observed for triple negative breast cancer patients.

  9. Effects of HSP90 inhibitor 17-allylamino-17-demethoxygeldanamycin (17-AAG) on NEU/HER2 overexpressing mammary tumours in MMTV-NEU-NT mice monitored by Magnetic Resonance Spectroscopy.

    Science.gov (United States)

    Rodrigues, Loreta M; Chung, Yuen-Li; Al Saffar, Nada M S; Sharp, Swee Y; Jackson, Laura E; Banerji, Udai; Stubbs, Marion; Leach, Martin O; Griffiths, John R; Workman, Paul

    2012-05-23

    The importance of ERBB2/NEU/HER2 in the response of breast tumours to the heat shock protein 90 (HSP90) inhibitor 17-allylamino-17-demethoxygeldanamycin (17-AAG; tanespimycin) has been demonstrated in the clinic. ERBB2 is an oncoprotein client that is highly dependent on HSP90. This and other oncogenic client proteins (e.g. B-RAF, C-RAF, ALK and CDK4) are depleted by 17-AAG in both animal tumours and patients. Here we investigate by Magnetic Resonance Spectroscopy (MRS) the metabolic response of 17-AAG in spontaneous, NEU/HER2 driven mammary tumours in transgenic MMTV-NEU-NT mice and in cells isolated and cultured from these tumours. Mammary tumours were monitored by 31P MRS in vivo and in tumour extracts, comparing control and 17-AAG treated mice. A cell line derived from NEU/HER2 mammary tumours was also cultured and the effect of 17-AAG was measured by 31P MRS in cell extracts. Molecular biomarkers were assessed by immunoblotting in extracts from cells and tumours. For comparison of tumour volume, metabolite concentrations and Western blot band intensities, two-tailed unpaired t-tests were used. The NEU/HER2 mammary tumours were very sensitive to 17-AAG and responded in a dose-dependent manner to 3 daily doses of 20, 40 and 80mg/kg of 17-AAG, all of which caused significant regression. At the higher doses, 31P MRS of tumour extracts showed significant decreases in phosphocholine (PC) and phosphoethanolamine (PE) whereas no significant changes were seen at the 20mg/kg dose. Extracts of isolated cells cultured from the mammary carcinomas showed a significant decrease in viable cell number and total PME after 17-AAG treatment. Western blots confirmed the expected action of 17-AAG in inducing HSP72 and significantly depleting HSP90 client proteins, including NEU/HER2 both in tumours and in isolated cells. The data demonstrate the high degree of sensitivity of this clinically relevant NEU/HER2-driven tumour model to HSP90 inhibition by 17-AAG, consistent with the

  10. Developing Anti-HER2 Vaccines: Breast Cancer Experience.

    Science.gov (United States)

    Al-Awadhi, Aydah; Murray, James Lee; Ibrahim, Nuhad K

    2018-04-25

    Breast cancer accounts for more than one million new cases annually and is the leading cause of death in women globally. HER2 overexpression induces cellular and humoral immune responses against the HER2 protein and is associated with higher tumour proliferation rates. Trastuzumab-based therapies are effectively and widely used as standard of care in HER2-amplified/overexpressed breast cancer patients; one cited mechanism of action is the induction of passive immunity and antibody-dependent cellular cytotoxicity against malignant breast cancer cells. These findings drove the efforts to generate antigen-specific immunotherapy to trigger the patient's immune system to target HER2-overexpressing tumour cells, which led to the development of various vaccines against the HER2 antigen. This manuscript discusses the various anti-HER2 vaccine formulations and strategies and their potential role in the metastatic and adjuvant settings. This article is protected by copyright. All rights reserved. © 2018 UICC.

  11. Breast Gangrene

    Directory of Open Access Journals (Sweden)

    Husasin Irfan

    2011-08-01

    Full Text Available Abstract Background Breast gangrene is rare in surgical practice. Gangrene of breast can be idiopathic or secondary to some causative factor. Antibiotics and debridement are used for management. Acute inflammatory infiltrate, severe necrosis of breast tissue, necrotizing arteritis, and venous thrombosis is observed on histopathology. The aim of was to study patients who had breast gangrene. Methods A prospective study of 10 patients who had breast gangrene over a period of 6 years were analyzed Results All the patients in the study group were female. Total of 10 patients were encountered who had breast gangrene. Six patients presented with breast gangrene on the right breast whereas four had on left breast. Out of 10 patients, three had breast abscess after teeth bite followed by gangrene, one had iatrogenic trauma by needle aspiration of erythematous area of breast under septic conditions. Four had history of application of belladonna on cutaneous breast abscess and had then gangrene. All were lactating female. Amongst the rest two were elderly, one of which was a diabetic who had gangrene of breast and had no application of belladonna. All except one had debridement under cover of broad spectrum antibiotics. Three patients had grafting to cover the raw area. Conclusion Breast gangrene occurs rarely. Etiology is variable and mutifactorial. Teeth bite while lactation and the iatrogenic trauma by needle aspiration of breast abscess under unsterlised conditions could be causative. Uncontrolled diabetes can be one more causative factor for the breast gangrene. Belladonna application as a topical agent could be inciting factor. Sometimes gangrene of breast can be idiopathic. Treatment is antibiotics and debridement.

  12. Gene expression profiling of histologically normal breast tissue in females with human epidermal growth factor receptor 2‑positive breast cancer.

    Science.gov (United States)

    Zubor, Pavol; Hatok, Jozef; Moricova, Petra; Kapustova, Ivana; Kajo, Karol; Mendelova, Andrea; Sivonova, Monika Kmetova; Danko, Jan

    2015-02-01

    Gene expression profile‑based taxonomy of breast cancer (BC) has been described as a significant breakthrough in comprehending the differences in the origin and behavior of cancer to allow individually tailored therapeutic approaches. In line with this, we hypothesized that the gene expression profile of histologically normal epithelium (HNEpi) could harbor certain genetic abnormalities predisposing breast tissue cells to develop human epidermal growth factor receptor 2 (HER2)‑positive BC. Thus, the aim of the present study was to assess gene expression in normal and BC tissue (BCTis) from patients with BC in order to establish its value as a potential diagnostic marker for cancer development. An array study evaluating a panel of 84 pathway‑ and disease‑specific genes in HER2‑positive BC and tumor‑adjacent HNEpi was performed using quantitative polymerase chain reaction in 12 patients using microdissected samples from frozen tissue. Common prognostic and predictive parameters of BC were assessed by immunohistochemistry and in situ hybridization. In the BCTis and HNEpi samples of 12 HER2‑positive subjects with BC, the expression of 2,016 genes was assessed. A total of 39.3% of genes were deregulated at a minimal two‑fold deregulation rate and 10.7% at a five‑fold deregulation rate in samples of HNEpi or BCTis. Significant differences in gene expression between BCTis and HNEpi samples were revealed for BCL2L2, CD44, CTSD, EGFR, ERBB2, ITGA6, NGFB, RPL27, SCBG2A1 and SCGB1D2 genes (Pbreast tissue revealed gene expression abnormalities that may represent potential markers of increased risk for HER2‑positive malignant transformation of breast tissue, and may be able to be employed as predictors of prognosis.

  13. Breast Exam

    Science.gov (United States)

    ... ends. What you can expect Begin with a visual examination of your breasts Sit or stand shirtless ... to the next section. If you have a disability that makes it difficult to examine your breasts ...

  14. Breast cancer

    African Journals Online (AJOL)

    A collaborative article gives an overview of breast cancer in LICs, ... approach to the problem; therefore they are published as two separate ... attached to the diagnosis of breast cancer. ... Their founding statement in its early form is included.

  15. Protocadherin-7 induces bone metastasis of breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ai-Min [Department of Orthopedics, The 5th Central Hospital of Tianjin, Tianjin (China); Tian, Ai-Xian [Department of Biochemistry and Molecular Biology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Zhang, Rui-Xue [Department of Clinical Laboratory Diagnosis, Tianjin Medical University, Tianjin (China); Ge, Jie [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Sun, Xuan [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Cao, Xu-Chen, E-mail: caoxuch@126.com [Department of Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)

    2013-07-05

    Highlights: •PCDH7 is overexpression in high bone metastatic MDA-MB-231 cells. •PCDH7 is up-regulation in bone metastatic breast cancer tissues. •Suppression of PCDH7 inhibits cell proliferation, migration, and invasion in vitro. •PCDH7 induces breast cancer bone metastasis in vivo. -- Abstract: Breast cancer had a propensity to metastasize to bone, resulting in serious skeletal complications associated with poor outcome. Previous study showed that Protocadherin-7 (PCDH7) play an important role in brain metastatic breast cancer, however, the role of PCDH7 in bone metastatic breast cancer has never been explored. In the present study, we found that PCDH7 expression was up-regulation in bone metastatic breast cancer tissues by real-time PCR and immunohistochemistry assays. Furthermore, suppression of PCDH7 inhibits breast cancer cell proliferation, migration, and invasion in vitro by MTT, scratch, and transwell assays. Most importantly, overexpression of PCDH7 promotes breast cancer cell proliferation and invasion in vitro, and formation of bone metastasis in vivo. These data provide an important insight into the role of PCDH7 in bone metastasis of breast cancer.

  16. Protocadherin-7 induces bone metastasis of breast cancer

    International Nuclear Information System (INIS)

    Li, Ai-Min; Tian, Ai-Xian; Zhang, Rui-Xue; Ge, Jie; Sun, Xuan; Cao, Xu-Chen

    2013-01-01

    Highlights: •PCDH7 is overexpression in high bone metastatic MDA-MB-231 cells. •PCDH7 is up-regulation in bone metastatic breast cancer tissues. •Suppression of PCDH7 inhibits cell proliferation, migration, and invasion in vitro. •PCDH7 induces breast cancer bone metastasis in vivo. -- Abstract: Breast cancer had a propensity to metastasize to bone, resulting in serious skeletal complications associated with poor outcome. Previous study showed that Protocadherin-7 (PCDH7) play an important role in brain metastatic breast cancer, however, the role of PCDH7 in bone metastatic breast cancer has never been explored. In the present study, we found that PCDH7 expression was up-regulation in bone metastatic breast cancer tissues by real-time PCR and immunohistochemistry assays. Furthermore, suppression of PCDH7 inhibits breast cancer cell proliferation, migration, and invasion in vitro by MTT, scratch, and transwell assays. Most importantly, overexpression of PCDH7 promotes breast cancer cell proliferation and invasion in vitro, and formation of bone metastasis in vivo. These data provide an important insight into the role of PCDH7 in bone metastasis of breast cancer

  17. CENPI is overexpressed in colorectal cancer and regulates cell migration and invasion.

    Science.gov (United States)

    Ding, Na; Li, Rongxin; Shi, Wenhao; He, Cui

    2018-06-21

    Centromere protein I (CENPI),an important member of centromere protein family, has been suggest to serve as a oncogene in breast cancer, but the clinical significance and biological function of CENPI in colorectal cancer (CRC) is still unclear. In our results, we found CENPI was overexpressed in CRC tissues and cells, and associated with clinical stage, tumor depth, lymph node metastasis, distant metastasis and differentiation in CRC patients. However, there was no significant association between CENPI protein expression and overall survival time in colon cancer patients and rectal cancer patients through analyzing TCGA survival data. Moreover, CENPI mRNA and protein were increased in metastatic lymph nodes compared with primary CRC tissues. Down-regulation of CENPI expression suppresses CRC cell migration, invasion and epithelial mesenchymal transition process. In conclusion, CENPI is overexpressed in CRC and functions as oncogene in modulating CRC cell migration, invasion and EMT process. Copyright © 2018. Published by Elsevier B.V.

  18. MAL2 and tumor protein D52 (TPD52 are frequently overexpressed in ovarian carcinoma, but differentially associated with histological subtype and patient outcome

    Directory of Open Access Journals (Sweden)

    Fanayan Susan

    2010-09-01

    Full Text Available Abstract Background The four-transmembrane MAL2 protein is frequently overexpressed in breast carcinoma, and MAL2 overexpression is associated with gain of the corresponding locus at chromosome 8q24.12. Independent expression microarray studies predict MAL2 overexpression in ovarian carcinoma, but these had remained unconfirmed. MAL2 binds tumor protein D52 (TPD52, which is frequently overexpressed in ovarian carcinoma, but the clinical significance of MAL2 and TPD52 overexpression was unknown. Methods Immunohistochemical analyses of MAL2 and TPD52 expression were performed using tissue microarray sections including benign, borderline and malignant epithelial ovarian tumours. Inmmunohistochemical staining intensity and distribution was assessed both visually and digitally. Results MAL2 and TPD52 were significantly overexpressed in high-grade serous carcinomas compared with serous borderline tumours. MAL2 expression was highest in serous carcinomas relative to other histological subtypes, whereas TPD52 expression was highest in clear cell carcinomas. MAL2 expression was not related to patient survival, however high-level TPD52 staining was significantly associated with improved overall survival in patients with stage III serous ovarian carcinoma (log-rank test, p Conclusions MAL2 is frequently overexpressed in ovarian carcinoma, and TPD52 overexpression is a favourable independent prognostic marker of potential value in the management of ovarian carcinoma patients.

  19. Breast Cancer

    Science.gov (United States)

    Breast cancer affects one in eight women during their lives. No one knows why some women get breast cancer, but there are many risk factors. Risks that ... who have family members with breast or ovarian cancer may wish to be tested for the genes. ...

  20. Significance of Aurora B overexpression in hepatocellular carcinoma. Aurora B Overexpression in HCC

    International Nuclear Information System (INIS)

    Lin, Zhong-Zhe; Jeng, Yung-Ming; Hu, Fu-Chang; Pan, Hung-Wei; Tsao, Hsin-Wei; Lai, Po-Lin; Lee, Po-Huang; Cheng, Ann-Lii; Hsu, Hey-Chi

    2010-01-01

    To investigate the significance of Aurora B expression in hepatocellular carcinoma (HCC). The Aurora B and Aurora A mRNA level was measured in 160 HCCs and the paired nontumorous liver tissues by reverse transcription-polymerase chain reaction. Mutations of the p53 and β-catenin genes were analyzed in 134 and 150 tumors, respectively, by direct sequencing of exon 2 to exon 11 of p53 and exon 3 of β-catenin. Anticancer effects of AZD1152-HQPA, an Aurora B kinase selective inhibitor, were examined in Huh-7 and Hep3B cell lines. Aurora B was overexpressed in 98 (61%) of 160 HCCs and in all 7 HCC cell lines examined. The overexpression of Aurora B was associated with Aurora A overexpression (P = 0.0003) and p53 mutation (P = 0.002) and was inversely associated with β-catenin mutation (P = 0.002). Aurora B overexpression correlated with worse clinicopathologic characteristics. Multivariate analysis confirmed that Aurora B overexpression was an independent poor prognostic factor, despite its interaction with Aurora A overexpression and mutations of p53 and β-catenin. In Huh-7 and Hep3B cells, AZD1152-HQPA induced proliferation blockade, histone H3 (Ser10) dephosphorylation, cell cycle disturbance, and apoptosis. Aurora B overexpression is an independent molecular marker predicting tumor invasiveness and poor prognosis of HCC. Aurora B kinase selective inhibitors are potential therapeutic agents for HCC treatment

  1. Prognostic Impact of VEGFA Germline Polymorphisms in Patients with HER2-positive Primary Breast Cancer

    DEFF Research Database (Denmark)

    Maae, Else; Andersen, Rikke Fredslund; Dahl Steffensen, Karina

    2012-01-01

    Background: Vascular endothelial growth factor A (VEGFA) is essential in tumour angiogenesis, and polymorphisms in the VEGFA gene have been associated with breast cancer prognosis. The human epidermal growth factor receptor 2 (HER2) is overexpressed in breast tumours and is also associated with a...

  2. Overcoming resistance and restoring sensitivity to HER2-targeted therapies in breast cancer.

    LENUS (Irish Health Repository)

    Mohd Sharial, M S N

    2012-12-01

    Approximately 15%-23% of breast cancers overexpress human epidermal growth factor receptor 2 (HER2), which leads to the activation of signaling pathways that stimulate cell proliferation and survival. HER2-targeted therapy has substantially improved outcomes in patients with HER2-positive breast cancer. However, both de novo and acquired resistance are observed.

  3. The Role of Protein Elongation Factor EEF1A2 in Breast Cancer

    National Research Council Canada - National Science Library

    Lee, Jonathan M

    2004-01-01

    ... overexpression can be used as a breast cancer prognostic factor. In addition, we proposed to test the idea that EEF1A2 expression modulates sensitivity to cisplatin and taxol and that EEF1A2-inactivation could be used as a treatment for breast cancer...

  4. TOX3 (TNRC9) overexpression in bladder cancer cells decreases cellular proliferation and triggers an interferon-like response

    DEFF Research Database (Denmark)

    Birkenkamp-Demtröder, Karin; Mansilla, Francisco; Andersen, Lars Dyrskjøt

    2013-01-01

    Background Human TOX3 (TOX high mobility group box family member 3) regulates Ca2+-dependent transcription in neurons and has been associated with breast cancer susceptibility. Aim of the study was to investigate the expression of TOX3 in bladder cancer tissue samples and to identify genes...... urothelium. Microarray expression profiling of human bladder cancer cells overexpressing TOX3 followed by Pathway analysis showed that TOX3 overexpression mainly affected the Interferon Signaling Pathway. TOX3 upregulation induced the expression of several genes with a gamma interferon activation site (GAS......), e.g. STAT1. In vitro functional studies showed that TOX3 was able to bind to the GAS-sequence located at the STAT1 promoter. siRNA mediated knockdown of TOX3 in RT4 bladder cancer cells decreased STAT1 expression suggesting a direct impact of TOX3 on STAT1. Immunoprecipitation of TOX3 overexpressing...

  5. Hand1 overexpression inhibits medulloblastoma metastasis

    Energy Technology Data Exchange (ETDEWEB)

    Asuthkar, Swapna; Guda, Maheedhara R. [Department of Cancer Biology and Pharmacology, University of Illinois College of Medicine at Peoria, Peoria, IL 61656 (United States); Martin, Sarah E. [Department of Pathology, University of Illinois College of Medicine at Peoria, Peoria, IL 61656 (United States); Antony, Reuben; Fernandez, Karen [Department of Pediatrics, University of Illinois College of Medicine at Peoria, Peoria, IL 61656 (United States); Lin, Julian [Department of Neurosurgery, University of Illinois College of Medicine at Peoria, Peoria, IL 61656 (United States); Tsung, Andrew J. [Department of Cancer Biology and Pharmacology, University of Illinois College of Medicine at Peoria, Peoria, IL 61656 (United States); Department of Neurosurgery, University of Illinois College of Medicine at Peoria, Peoria, IL 61656 (United States); Illinois Neurological Institute, Peoria, IL 61656 (United States); Velpula, Kiran K., E-mail: velpula@uic.edu [Department of Cancer Biology and Pharmacology, University of Illinois College of Medicine at Peoria, Peoria, IL 61656 (United States); Department of Neurosurgery, University of Illinois College of Medicine at Peoria, Peoria, IL 61656 (United States)

    2016-08-19

    Medulloblastoma (MB) is the most frequent malignant pediatric brain tumor. Current treatment includes surgery, radiation and chemotherapy. However, ongoing treatment in patients is further classified according to the presence or absence of metastasis. Since metastatic medulloblastoma are refractory to current treatments, there is need to identify novel biomarkers that could be used to reduce metastatic potential, and more importantly be targeted therapeutically. Previously, we showed that ionizing radiation-induced uPAR overexpression is associated with increased accumulation of β-catenin in the nucleus. We further demonstrated that uPAR protein act as cytoplasmic sequestration factor for a novel basic helix-loop-helix transcription factor, Hand1. Among the histological subtypes classical and desmoplastic subtypes account for the majority while large cell/anaplastic variant is most commonly associated with metastatic disease. In this present study using immunohistochemical approach and patient data mining for the first time, we demonstrated that Hand1 expression is observed to be downregulated in all the subtypes of medulloblastoma. Previously we showed that Hand1 overexpression regulated medulloblastoma angiogenesis and here we investigated the role of Hand1 in the context of Epithelial-Mesenchymal Transition (EMT). Moreover, UW228 and D283 cells overexpressing Hand1 demonstrated decreased-expression of mesenchymal markers (N-cadherin, β-catenin and SOX2); metastatic marker (SMA); and increased expression of epithelial marker (E-cadherin). Strikingly, human pluripotent stem cell antibody array showed that Hand1 overexpression resulted in substantial decrease in pluripotency markers (Nanog, Oct3/4, Otx2, Flk1) suggesting that Hand1 expression may be essential to attenuate the EMT and our findings underscore a novel role for Hand1 in medulloblastoma metastasis. - Highlights: • Hand1 expression is downregulated in Medulloblastoma. • Hand1 over expression reduce

  6. Hand1 overexpression inhibits medulloblastoma metastasis

    International Nuclear Information System (INIS)

    Asuthkar, Swapna; Guda, Maheedhara R.; Martin, Sarah E.; Antony, Reuben; Fernandez, Karen; Lin, Julian; Tsung, Andrew J.; Velpula, Kiran K.

    2016-01-01

    Medulloblastoma (MB) is the most frequent malignant pediatric brain tumor. Current treatment includes surgery, radiation and chemotherapy. However, ongoing treatment in patients is further classified according to the presence or absence of metastasis. Since metastatic medulloblastoma are refractory to current treatments, there is need to identify novel biomarkers that could be used to reduce metastatic potential, and more importantly be targeted therapeutically. Previously, we showed that ionizing radiation-induced uPAR overexpression is associated with increased accumulation of β-catenin in the nucleus. We further demonstrated that uPAR protein act as cytoplasmic sequestration factor for a novel basic helix-loop-helix transcription factor, Hand1. Among the histological subtypes classical and desmoplastic subtypes account for the majority while large cell/anaplastic variant is most commonly associated with metastatic disease. In this present study using immunohistochemical approach and patient data mining for the first time, we demonstrated that Hand1 expression is observed to be downregulated in all the subtypes of medulloblastoma. Previously we showed that Hand1 overexpression regulated medulloblastoma angiogenesis and here we investigated the role of Hand1 in the context of Epithelial-Mesenchymal Transition (EMT). Moreover, UW228 and D283 cells overexpressing Hand1 demonstrated decreased-expression of mesenchymal markers (N-cadherin, β-catenin and SOX2); metastatic marker (SMA); and increased expression of epithelial marker (E-cadherin). Strikingly, human pluripotent stem cell antibody array showed that Hand1 overexpression resulted in substantial decrease in pluripotency markers (Nanog, Oct3/4, Otx2, Flk1) suggesting that Hand1 expression may be essential to attenuate the EMT and our findings underscore a novel role for Hand1 in medulloblastoma metastasis. - Highlights: • Hand1 expression is downregulated in Medulloblastoma. • Hand1 over expression reduce

  7. Molecular predictors of 3D morphogenesis by breast cancer cell lines in 3D culture.

    Directory of Open Access Journals (Sweden)

    Ju Han

    2010-02-01

    Full Text Available Correlative analysis of molecular markers with phenotypic signatures is the simplest model for hypothesis generation. In this paper, a panel of 24 breast cell lines was grown in 3D culture, their morphology was imaged through phase contrast microscopy, and computational methods were developed to segment and represent each colony at multiple dimensions. Subsequently, subpopulations from these morphological responses were identified through consensus clustering to reveal three clusters of round, grape-like, and stellate phenotypes. In some cases, cell lines with particular pathobiological phenotypes clustered together (e.g., ERBB2 amplified cell lines sharing the same morphometric properties as the grape-like phenotype. Next, associations with molecular features were realized through (i differential analysis within each morphological cluster, and (ii regression analysis across the entire panel of cell lines. In both cases, the dominant genes that are predictive of the morphological signatures were identified. Specifically, PPARgamma has been associated with the invasive stellate morphological phenotype, which corresponds to triple-negative pathobiology. PPARgamma has been validated through two supporting biological assays.

  8. Molecular Predictors of 3D Morphogenesis by Breast Cancer Cell Lines in 3D Culture

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ju; Chang, Hang; Giricz, Orsi; Lee, Genee; Baehner, Frederick; Gray, Joe; Bissell, Mina; Kenny, Paraic; Parvin, Bahram

    2010-02-01

    Correlative analysis of molecular markers with phenotypic signatures is the simplest model for hypothesis generation. In this paper, a panel of 24 breast cell lines was grown in 3D culture, their morphology was imaged through phase contrast microscopy, and computational methods were developed to segment and represent each colony at multiple dimensions. Subsequently, subpopulations from these morphological responses were identified through consensus clustering to reveal three clusters of round, grape-like, and stellate phenotypes. In some cases, cell lines with particular pathobiological phenotypes clustered together (e.g., ERBB2 amplified cell lines sharing the same morphometric properties as the grape-like phenotype). Next, associations with molecular features were realized through (i) differential analysis within each morphological cluster, and (ii) regression analysis across the entire panel of cell lines. In both cases, the dominant genes that are predictive of the morphological signatures were identified. Specifically, PPAR? has been associated with the invasive stellate morphological phenotype, which corresponds to triple-negative pathobiology. PPAR? has been validated through two supporting biological assays.

  9. Targeting the Ron-Dek Signaling Axis in Breast Cancer

    Science.gov (United States)

    2015-09-01

    Words 5 Accomplishments 5 Impact & Conclusion 8 Changes/Problems 9 Products 9 Participants and Other Collaborating Organizations 11 Special...may represent an important new therapeutic option for the treatment of breast cancer. 2. KEY WORDS Ron receptor, Dek, beta-catenin, breast cancer 3...Finally, our data showed that Dek overexpression promoted tumorigenic properties in immortalized human mammary epithelial MCF10A cells and in the context

  10. Breast Fibroadenoma With Increased Activity on 68Ga DOTATATE PET/CT.

    Science.gov (United States)

    Papadakis, Georgios Z; Millo, Corina; Sadowski, Samira M; Karantanas, Apostolos H; Bagci, Ulas; Patronas, Nicholas J

    2017-02-01

    Fibroadenoma is the most common benign breast tumor in women of reproductive age, carrying little to no risk of breast cancer development. We report on a case of a woman with history of neuroendocrine tumor who on follow-up imaging tests underwent whole-body PET/CT study using Ga DOTATATE. The scan showed increased focal activity in the right breast, which was biopsied revealing a fibroadenoma. The presented data suggests cell surface overexpression of somatostatin receptors by this benign breast tumor. Moreover, this finding emphasizes the need for cautious interpretation of Ga DOTATATE-avid breast lesions that could mimic malignancy in neuroendocrine tumor patients.

  11. Breast Reconstruction After Mastectomy

    Science.gov (United States)

    ... Cancer Prevention Genetics of Breast & Gynecologic Cancers Breast Cancer Screening Research Breast Reconstruction After Mastectomy On This Page What is breast reconstruction? How do surgeons use implants to reconstruct a woman’s breast? How do surgeons ...

  12. Breast cancer screening

    Science.gov (United States)

    Mammogram - breast cancer screening; Breast exam - breast cancer screening; MRI - breast cancer screening ... is performed to screen women to detect early breast cancer when it is more likely to be cured. ...

  13. Stages of Breast Cancer

    Science.gov (United States)

    ... of Breast & Gynecologic Cancers Breast Cancer Screening Research Breast Cancer Treatment (PDQ®)–Patient Version General Information About Breast Cancer Go to Health Professional Version Key Points Breast ...

  14. Breast Cancer Prevention

    Science.gov (United States)

    ... of Breast & Gynecologic Cancers Breast Cancer Screening Research Breast Cancer Prevention (PDQ®)–Patient Version What is prevention? Go ... from starting. Risk-reducing surgery . General Information About Breast Cancer Key Points Breast cancer is a disease in ...

  15. Breast Cancer Treatment

    Science.gov (United States)

    ... of Breast & Gynecologic Cancers Breast Cancer Screening Research Breast Cancer Treatment (PDQ®)–Patient Version General Information About Breast Cancer Go to Health Professional Version Key Points Breast ...

  16. Advancements of antisense oligonucleotides in treatment of breast cancer

    Institute of Scientific and Technical Information of China (English)

    YANGShuan-Ping; SONGSan-Tai; 等

    2003-01-01

    Breast cancer is one kind of multi-gene related malignancy.Overexpression of some oncogenes such as HER-2(c-erbB-2,Neu),bcl-2/bcl-xL,protein kinase A(PKA),and transferrin receptor gene(TfR gene),etc significantly affect the prognosis of breast cancer.It was shown that specific suppression of the overexpressed genes above resulted in the improvement of the therapy of breast cancer.Antisense interference.one of useful tools for inhibiting the overexpression of specific oncogenes,was involved in the therapy of breast cancer in recent years. Data indicated that antisense oligonucleotides(ON)could inhibit specially the expression of the target genes on mRNA or protein levels in most of cases;some ON candidates showed encouraging therapeutic effects in vitro and in vivo on breast cancer cell lines or xenografts.Furthermore,the combination use of the antisense ON and normal chemotherapeutic agents indicated synergistic antitumor effects,which was probably the best utilization of antisense ON in the treatment of breast cancer.

  17. Frequent epigenetic inactivation of Wnt antagonist genes in breast cancer

    Science.gov (United States)

    Suzuki, H; Toyota, M; Caraway, H; Gabrielson, E; Ohmura, T; Fujikane, T; Nishikawa, N; Sogabe, Y; Nojima, M; Sonoda, T; Mori, M; Hirata, K; Imai, K; Shinomura, Y; Baylin, S B; Tokino, T

    2008-01-01

    Although mutation of APC or CTNNB1 (β-catenin) is rare in breast cancer, activation of Wnt signalling is nonetheless thought to play an important role in breast tumorigenesis, and epigenetic silencing of Wnt antagonist genes, including the secreted frizzled-related protein (SFRP) and Dickkopf (DKK) families, has been observed in various tumours. In breast cancer, frequent methylation and silencing of SFRP1 was recently documented; however, altered expression of other Wnt antagonist genes is largely unknown. In the present study, we found frequent methylation of SFRP family genes in breast cancer cell lines (SFRP1, 7 out of 11, 64%; SFRP2, 11 out of 11, 100%; SFRP5, 10 out of 11, 91%) and primary breast tumours (SFRP1, 31 out of 78, 40%; SFRP2, 60 out of 78, 77%; SFRP5, 55 out of 78, 71%). We also observed methylation of DKK1, although less frequently, in cell lines (3 out of 11, 27%) and primary tumours (15 out of 78, 19%). Breast cancer cell lines express various Wnt ligands, and overexpression of SFRPs inhibited cancer cell growth. In addition, overexpression of a β-catenin mutant and depletion of SFRP1 using small interfering RNA synergistically upregulated transcriptional activity of T-cell factor/lymphocyte enhancer factor. Our results confirm the frequent methylation and silencing of Wnt antagonist genes in breast cancer, and suggest that their loss of function contributes to activation of Wnt signalling in breast carcinogenesis. PMID:18283316

  18. Do early premalignant changes in normal breast epithelial cells predict cancer development?

    International Nuclear Information System (INIS)

    Clarke, Robert B; Bundred, Nigel J

    2005-01-01

    A recent report suggests that, in an in vitro model of premalignant breast cells (vHMECs), silencing of INK4A gene is accompanied by over-expression of cyclo-oxygenase (COX)-2. This suggests that COX-2 over-expression may be an early event in breast cancer aetiology permitting clones within the normal epithelium to evade apoptosis, to increase their numbers and perhaps acquire further changes that promote the formation of hyperplasias, and eventually carcinomas. While COX-2 expression in normal breast epithelium in vivo has not been proven to be linked to an increased risk of breast cancer, its over-expression in the premalignant model in vitro does provide preliminary evidence that COX-2 inhibition may be a useful chemoprevention strategy

  19. Frequent Nek1 overexpression in human gliomas

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Jun [School of Biomedical Engineering, Shanghai Jiao Tong University, Shanghai (China); Neurosurgery Department, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai (China); Cai, Yu, E-mail: aihaozuqiu22@163.com [School of Biomedical Engineering, Shanghai Jiao Tong University, Shanghai (China); Neurosurgery Department, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai (China); Liu, Pin [Med-X Research Institute, Shanghai Jiao Tong University, Shanghai (China); Zhao, Weiguo [Neurosurgery Department, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai (China)

    2016-08-05

    Never in mitosis A (NIMA)-related kinase 1 (Nek1) regulates cell cycle progression to mitosis. Its expression and potential functions in human gliomas have not been studied. Here, our immunohistochemistry (IHC) assay and Western blot assay results showed that Nek1 expression was significantly upregulated in fresh and paraffin-embedded human glioma tissues. Its level in normal brain tissues was low. Nek1 overexpression in human gliomas was correlated with the proliferation marker (Ki-67), tumor grade, Karnofsky performance scale (KPS) and more importantly, patients’ poor survival. Further studies showed that Nek1 expression level was also increased in multiple human glioma cell lines (U251-MG, U87-MG, U118, H4 and U373). Significantly, siRNA-mediated knockdown of Nek1 inhibited glioma cell (U87-MG/U251-MG) growth. Nek1 siRNA also sensitized U87-MG/U251-MG cells to temozolomide (TMZ), causing a profound apoptosis induction and growth inhibition. The current study indicates Nek1 might be a novel and valuable oncotarget of glioma, it is important for glioma cell growth and TMZ-resistance. - Highlights: • Nek1 is upregulated in multiple human glioma tissues and cell lines. • Nek1 overexpression correlates with glioma grades and patients’ KPS score. • Nek1 overexpression correlates with patients’ poor overall survival. • siRNA knockdown of Nek1 inhibits glioma cell growth. • siRNA knockdown of Nek1 sensitizes human glioma cells to temozolomide.

  20. Frequent Nek1 overexpression in human gliomas

    International Nuclear Information System (INIS)

    Zhu, Jun; Cai, Yu; Liu, Pin; Zhao, Weiguo

    2016-01-01

    Never in mitosis A (NIMA)-related kinase 1 (Nek1) regulates cell cycle progression to mitosis. Its expression and potential functions in human gliomas have not been studied. Here, our immunohistochemistry (IHC) assay and Western blot assay results showed that Nek1 expression was significantly upregulated in fresh and paraffin-embedded human glioma tissues. Its level in normal brain tissues was low. Nek1 overexpression in human gliomas was correlated with the proliferation marker (Ki-67), tumor grade, Karnofsky performance scale (KPS) and more importantly, patients’ poor survival. Further studies showed that Nek1 expression level was also increased in multiple human glioma cell lines (U251-MG, U87-MG, U118, H4 and U373). Significantly, siRNA-mediated knockdown of Nek1 inhibited glioma cell (U87-MG/U251-MG) growth. Nek1 siRNA also sensitized U87-MG/U251-MG cells to temozolomide (TMZ), causing a profound apoptosis induction and growth inhibition. The current study indicates Nek1 might be a novel and valuable oncotarget of glioma, it is important for glioma cell growth and TMZ-resistance. - Highlights: • Nek1 is upregulated in multiple human glioma tissues and cell lines. • Nek1 overexpression correlates with glioma grades and patients’ KPS score. • Nek1 overexpression correlates with patients’ poor overall survival. • siRNA knockdown of Nek1 inhibits glioma cell growth. • siRNA knockdown of Nek1 sensitizes human glioma cells to temozolomide.

  1. Hierarchical clustering of breast cancer methylomes revealed differentially methylated and expressed breast cancer genes.

    Directory of Open Access Journals (Sweden)

    I-Hsuan Lin

    Full Text Available Oncogenic transformation of normal cells often involves epigenetic alterations, including histone modification and DNA methylation. We conducted whole-genome bisulfite sequencing to determine the DNA methylomes of normal breast, fibroadenoma, invasive ductal carcinomas and MCF7. The emergence, disappearance, expansion and contraction of kilobase-sized hypomethylated regions (HMRs and the hypomethylation of the megabase-sized partially methylated domains (PMDs are the major forms of methylation changes observed in breast tumor samples. Hierarchical clustering of HMR revealed tumor-specific hypermethylated clusters and differential methylated enhancers specific to normal or breast cancer cell lines. Joint analysis of gene expression and DNA methylation data of normal breast and breast cancer cells identified differentially methylated and expressed genes associated with breast and/or ovarian cancers in cancer-specific HMR clusters. Furthermore, aberrant patterns of X-chromosome inactivation (XCI was found in breast cancer cell lines as well as breast tumor samples in the TCGA BRCA (breast invasive carcinoma dataset. They were characterized with differentially hypermethylated XIST promoter, reduced expression of XIST, and over-expression of hypomethylated X-linked genes. High expressions of these genes were significantly associated with lower survival rates in breast cancer patients. Comprehensive analysis of the normal and breast tumor methylomes suggests selective targeting of DNA methylation changes during breast cancer progression. The weak causal relationship between DNA methylation and gene expression observed in this study is evident of more complex role of DNA methylation in the regulation of gene expression in human epigenetics that deserves further investigation.

  2. Breast cancer

    OpenAIRE

    Gablerová, Pavlína

    2010-01-01

    In this work the topic of breast cancer treated more generally and mainly focused on risk factors for the development. The theoretical part describes the general knowledge about breast cancer as a stage or treatment. The practical part is to have clarified the risk factors that have some bearing on the diagnosis of breast cancer. What level are involved in the probability of occurrence? Can we eliminate them? As a comparison of risk factors examined in the Czech Republic, England, Australia a...

  3. Gram-scale solution-phase synthesis of selective sodium bicarbonate co-transport inhibitor S0859: in vitro efficacy studies in breast cancer cells.

    Science.gov (United States)

    Larsen, Ann M; Krogsgaard-Larsen, Niels; Lauritzen, Gitte; Olesen, Christina W; Honoré Hansen, Steen; Boedtkjer, Ebbe; Pedersen, Stine F; Bunch, Lennart

    2012-10-01

    Na(+)-coupled HCO(3)(-) transporters (NBCs) mediate the transport of bicarbonate ions across cell membranes and are thus ubiquitous regulators of intracellular pH. NBC dysregulation is associated with a range of diseases; for instance, NBCn1 is strongly up-regulated in a model of ErbB2-dependent breast cancer, a malignant and widespread cancer with no targeted treatment options, and single-nucleotide polymorphisms in NBCn1 genetically link to breast cancer development and hypertension. The N-cyanosulfonamide S0859 has been shown to selectively inhibit NBCs, and its availability on the gram scale is therefore of significant interest to the scientific community. Herein we describe a short and efficient synthesis of S0859 with an overall yield of 45 % from commercially available starting materials. The inhibitory effect of S0859 on recovery of intracellular pH after an acid load was verified in human and murine cancer cell lines in Ringer solutions. However, S0859 binds very strongly to components in plasma, and accordingly, measurements on isolated murine tissues showed no effect of S0859 at concentrations up to 50 μM. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Triple-negative breast cancer: present challenges and new perspectives

    NARCIS (Netherlands)

    Podo, Franca; Buydens, Lutgarde M. C.; Degani, Hadassa; Hilhorst, Riet; Klipp, Edda; Gribbestad, Ingrid S.; van Huffel, Sabine; van Laarhoven, Hanneke W. M.; Luts, Jan; Monleon, Daniel; Postma, Geert J.; Schneiderhan-Marra, Nicole; Santoro, Filippo; Wouters, Hans; Russnes, Hege G.; Sørlie, Therese; Tagliabue, Elda; Børresen-Dale, Anne-Lise

    2010-01-01

    Triple-negative breast cancers (TNBC), characterized by absence of estrogen receptor (ER), progesterone receptor (PR) and lack of overexpression of human epidermal growth factor receptor 2 (HER2), are typically associated with poor prognosis, due to aggressive tumor phenotype(s), only partial

  5. Overexpression of endothelin B receptor in glioblastoma: a prognostic marker and therapeutic target?

    KAUST Repository

    Vasaikar, Suhas

    2018-02-06

    BackgroundGlioblastoma (GBM) is the most common malignant brain tumor with median survival of 12-15 months. Owing to uncertainty in clinical outcome, additional prognostic marker(s) apart from existing markers are needed. Since overexpression of endothelin B receptor (ETBR) has been demonstrated in gliomas, we aimed to test whether ETBR is a useful prognostic marker in GBM and examine if the clinically available endothelin receptor antagonists (ERA) could be useful in the disease treatment.MethodsData from The Cancer Genome Atlas and the Gene Expression Omnibus database were analyzed to assess ETBR expression. For survival analysis, glioblastoma samples from 25 Swedish patients were immunostained for ETBR, and the findings were correlated with clinical history. The druggability of ETBR was assessed by protein-protein interaction network analysis. ERAs were analyzed for toxicity in in vitro assays with GBM and breast cancer cells.ResultsBy bioinformatics analysis, ETBR was found to be upregulated in glioblastoma patients, and its expression levels were correlated with reduced survival. ETBR interacts with key proteins involved in cancer pathogenesis, suggesting it as a druggable target. In vitro viability assays showed that ERAs may hold promise to treat glioblastoma and breast cancer.ConclusionsETBR is overexpressed in glioblastoma and other cancers and may be a prognostic marker in glioblastoma. ERAs may be useful for treating cancer patients.

  6. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    Directory of Open Access Journals (Sweden)

    de Souza Emanuel M

    2009-03-01

    Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma

  7. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    International Nuclear Information System (INIS)

    Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de

    2009-01-01

    ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this difference was

  8. Targeting Aberrant p70S6K Activation for Estrogen Receptor-Negative Breast Cancer Prevention.

    Science.gov (United States)

    Wang, Xiao; Yao, Jun; Wang, Jinyang; Zhang, Qingling; Brady, Samuel W; Arun, Banu; Seewaldt, Victoria L; Yu, Dihua

    2017-11-01

    The prevention of estrogen receptor-negative (ER-) breast cancer remains a major challenge in the cancer prevention field, although antiestrogen and aromatase inhibitors have shown adequate efficacy in preventing estrogen receptor-positive (ER + ) breast cancer. Lack of commonly expressed, druggable targets is a major obstacle for meeting this challenge. Previously, we detected the activation of Akt signaling pathway in atypical hyperplasic early-stage lesions of patients. In the current study, we found that Akt and the downstream 70 kDa ribosomal protein S6 kinase (p70S6K) signaling pathway was highly activated in ER - premalignant breast lesions and ER - breast cancer. In addition, p70S6K activation induced transformation of ER - human mammary epithelial cells (hMEC). Therefore, we explored the potential of targeting Akt/p70S6K in the p70S6K activated, ER - hMEC models and mouse mammary tumor models for the prevention of ER - breast cancer. We found that a clinically applicable Akt/p70S6K dual inhibitor, LY2780301, drastically decreased proliferation of hMECs with ErbB2-induced p70S6K activation via Cyclin B1 inhibition and cell-cycle blockade at G 0 -G 1 phase, while it did not significantly reverse the abnormal acinar morphology of these hMECs. In addition, a brief treatment of LY2780301 in MMTV- neu mice that developed atypical hyperplasia (ADH) and mammary intraepithelial neoplasia (MIN) lesions with activated p70S6K was sufficient to suppress S6 phosphorylation and decrease cell proliferation in hyperplasic MECs. In summary, targeting the aberrant Akt/p70S6K activation in ER - hMEC models in vitro and in the MMTV- neu transgenic mouse model in vivo effectively inhibited Akt/S6K signaling and reduced proliferation of hMECs in vitro and ADH/MIN lesions in vivo , indicating its potential in prevention of p70S6K activated ER - breast cancer. Cancer Prev Res; 10(11); 641-50. ©2017 AACR . ©2017 American Association for Cancer Research.

  9. Breast cancer in young women.

    Science.gov (United States)

    Radecka, Barbara; Litwiniuk, Maria

    2016-01-01

    Breast cancer (BC) in young women is rare, affecting only 4-6% of women under the age of 40. Regardless, BC remains the most common malignancy among younger patients. Recently, a significant increase in BC rates has been observed among pre-menopausal subjects. Breast cancer in young women requires special attention due to its specific morphologic and prognostic characteristics and unique aspects, including fertility preservation and psychosocial issues (e.g. its impact on family life and career). Young women are more likely to have tumors with higher incidence of negative clinicopathologic features (higher histological grade, more lymph node positivity, lower estrogen receptor (ER) positivity, higher rates of Her2/neu overexpression). Also, they tend to be diagnosed at more advanced stages of the disease. That, in turn, contributes to less favorable prognosis as compared to older women. Young women are generally treated similarly to older patients. Surgical management includes mastectomy or breast-conserving surgery, followed by radiation therapy (younger women have higher local recurrence rates than older women, especially after breast-conserving therapy). Although the basics of chemotherapy are the same for patients of all ages, younger women have some special considerations. It is important to consider options for fertility preservation before starting systemic treatment. Patients should have access to genetic testing as their results may affect the choice of therapy. Younger women and their families should receive adequate psychological support and counselling.

  10. The bone morphogenetic protein antagonist gremlin 1 is overexpressed in human cancers and interacts with YWHAH protein

    International Nuclear Information System (INIS)

    Namkoong, Hong; Shin, Seung Min; Kim, Hyun Kee; Ha, Seon-Ah; Cho, Goang Won; Hur, Soo Young; Kim, Tae Eung; Kim, Jin Woo

    2006-01-01

    Basic studies of oncogenesis have demonstrated that either the elevated production of particular oncogene proteins or the occurrence of qualitative abnormalities in oncogenes can contribute to neoplastic cellular transformation. The purpose of our study was to identify an unique gene that shows cancer-associated expression, and characterizes its function related to human carcinogenesis. We used the differential display (DD) RT-PCR method using normal cervical, cervical cancer, metastatic cervical tissues, and cervical cancer cell lines to identify genes overexpressed in cervical cancers and identified gremlin 1 which was overexpressed in cervical cancers. We determined expression levels of gremlin 1 using Northern blot analysis and immunohistochemical study in various types of human normal and cancer tissues. To understand the tumorigenesis pathway of identified gremlin 1 protein, we performed a yeast two-hybrid screen, GST pull down assay, and immunoprecipitation to identify gremlin 1 interacting proteins. DDRT-PCR analysis revealed that gremlin 1 was overexpressed in uterine cervical cancer. We also identified a human gremlin 1 that was overexpressed in various human tumors including carcinomas of the lung, ovary, kidney, breast, colon, pancreas, and sarcoma. PIG-2-transfected HEK 293 cells exhibited growth stimulation and increased telomerase activity. Gremlin 1 interacted with homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide (14-3-3 eta; YWHAH). YWHAH protein binding site for gremlin 1 was located between residues 61–80 and gremlin 1 binding site for YWHAH was found to be located between residues 1 to 67. Gremlin 1 may play an oncogenic role especially in carcinomas of the uterine cervix, lung, ovary, kidney, breast, colon, pancreas, and sarcoma. Over-expressed gremlin 1 functions by interaction with YWHAH. Therefore, Gremlin 1 and its binding protein YWHAH could be good targets for developing diagnostic and

  11. Progress in HER2 testing in breast cancer: multiplex ligation-dependent probe amplification and automated immunohistochemistry

    NARCIS (Netherlands)

    Moelans, C.B.

    2009-01-01

    One of the most frequent genetic changes in sporadic breast cancer is amplification of the HER2 gene, usually resulting in protein overexpression on the cell membrane and growth activation of the cells. Breast cancer patients that have this HER2 amplification have a worse prognosis but can be

  12. Breast asymmetry and predisposition to breast cancer

    OpenAIRE

    Scutt, Diane; Lancaster, Gillian A; Manning, John T

    2006-01-01

    INTRODUCTION: It has been shown in our previous work that breast asymmetry is related to several of the known risk factors for breast cancer, and that patients with diagnosed breast cancer have more breast volume asymmetry, as measured from mammograms, than age-matched healthy women. METHODS: In the present study, we compared the breast asymmetry of women who were free of breast disease at time of mammography, but who had subsequently developed breast cancer, with that of age-matched healthy ...

  13. Characterization of Two Novel Oncogenic Pathways Collaborating With Loss of P53 or Activated Neu in Mouse Models of Breast Cancer

    National Research Council Canada - National Science Library

    Lu, Jianrong; Leder, Philip

    2005-01-01

    .... The viral integrations result in marked overexpression of a novel, naturally occurring Fbw4 short isoform, which is also spontaneously enriched in several mouse and human breast cancer cell lines...

  14. Overexpressed TP73 induces apoptosis in medulloblastoma

    International Nuclear Information System (INIS)

    Castellino, Robert C; De Bortoli, Massimiliano; Lin, Linda L; Skapura, Darlene G; Rajan, Jessen A; Adesina, Adekunle M; Perlaky, Laszlo; Irwin, Meredith S; Kim, John YH

    2007-01-01

    Medulloblastoma is the most common malignant brain tumor of childhood. Children who relapse usually die of their disease, which reflects resistance to radiation and/or chemotherapy. Improvements in outcome require a better understanding of the molecular basis of medulloblastoma growth and treatment response. TP73 is a member of the TP53 tumor suppressor gene family that has been found to be overexpressed in a variety of tumors and mediates apoptotic responses to genotoxic stress. In this study, we assessed expression of TP73 RNA species in patient tumor specimens and in medulloblastoma cell lines, and manipulated expression of full-length TAp73 and amino-terminal truncated ΔNp73 to assess their effects on growth. We analyzed medulloblastoma samples from thirty-four pediatric patients and the established medulloblastoma cell lines, Daoy and D283MED, for expression of TP73 RNA including the full-length transcript and the 5'-terminal variants that encode the ΔNp73 isoform, as well as TP53 RNA using quantitative real time-RTPCR. Protein expression of TAp73 and ΔNp73 was quantitated with immunoblotting methods. Clinical outcome was analyzed based on TP73 RNA and p53 protein expression. To determine effects of overexpression or knock-down of TAp73 and ΔNp73 on cell cycle and apoptosis, we analyzed transiently transfected medulloblastoma cell lines with flow cytometric and TUNEL methods. Patient medulloblastoma samples and cell lines expressed full-length and 5'-terminal variant TP73 RNA species in 100-fold excess compared to non-neoplastic brain controls. Western immunoblot analysis confirmed their elevated levels of TAp73 and amino-terminal truncated ΔNp73 proteins. Kaplan-Meier analysis revealed trends toward favorable overall and progression-free survival of patients whose tumors display TAp73 RNA overexpression. Overexpression of TAp73 or ΔNp73 induced apoptosis under basal growth conditions in vitro and sensitized them to cell death in response to

  15. Overexpressed TP73 induces apoptosis in medulloblastoma

    Directory of Open Access Journals (Sweden)

    Perlaky Laszlo

    2007-07-01

    Full Text Available Abstract Background Medulloblastoma is the most common malignant brain tumor of childhood. Children who relapse usually die of their disease, which reflects resistance to radiation and/or chemotherapy. Improvements in outcome require a better understanding of the molecular basis of medulloblastoma growth and treatment response. TP73 is a member of the TP53 tumor suppressor gene family that has been found to be overexpressed in a variety of tumors and mediates apoptotic responses to genotoxic stress. In this study, we assessed expression of TP73 RNA species in patient tumor specimens and in medulloblastoma cell lines, and manipulated expression of full-length TAp73 and amino-terminal truncated ΔNp73 to assess their effects on growth. Methods We analyzed medulloblastoma samples from thirty-four pediatric patients and the established medulloblastoma cell lines, Daoy and D283MED, for expression of TP73 RNA including the full-length transcript and the 5'-terminal variants that encode the ΔNp73 isoform, as well as TP53 RNA using quantitative real time-RTPCR. Protein expression of TAp73 and ΔNp73 was quantitated with immunoblotting methods. Clinical outcome was analyzed based on TP73 RNA and p53 protein expression. To determine effects of overexpression or knock-down of TAp73 and ΔNp73 on cell cycle and apoptosis, we analyzed transiently transfected medulloblastoma cell lines with flow cytometric and TUNEL methods. Results Patient medulloblastoma samples and cell lines expressed full-length and 5'-terminal variant TP73 RNA species in 100-fold excess compared to non-neoplastic brain controls. Western immunoblot analysis confirmed their elevated levels of TAp73 and amino-terminal truncated ΔNp73 proteins. Kaplan-Meier analysis revealed trends toward favorable overall and progression-free survival of patients whose tumors display TAp73 RNA overexpression. Overexpression of TAp73 or ΔNp73 induced apoptosis under basal growth conditions in vitro and

  16. Breast cancer

    International Nuclear Information System (INIS)

    Tokunaga, Masayoshi

    1992-01-01

    More than 20-year follow-up of A-bomb survivors in Hiroshima and Nagasaki has a crucial role in determining the relationship of radiation to the occurrence of breast cancer. In 1967, Wanebo et al have first reported 27 cases of breast cancer during the period 1950-1966 among the Adult Health Study population of A-bomb survivors. Since then, follow-up surveys for breast cancer have been made using the Life Span Study (LSS) cohort, and the incidence of breast cancer has increased year by year; that is breast cancer was identified in 231 cases by the first LSS series (1950-1969), 360 cases by the second LSS series (1950-1974), 564 cases by the third LSS series (1950-1980), and 816 cases in the fourth LSS series (1950-1085). The third LSS series have revealed a high risk for radiation-induced breast cancer in women aged 10 or less at the time of exposure (ATE). Both relative and absolute risks are found to be decreased with increasing ages ATE. Based on the above-mentioned findings and other studies on persons exposed medical radiation, radiation-induced breast cancer is characterized by the following: (1) the incidence of breast cancer is linearly increased with increasing radiation doses; (2) both relative and absolute risks for breast cancer are high in younger persons ATE; (3) age distribution of breast cancer in proximally exposed A-bomb survivors is the same as that in both distally A-bomb survivors and non-exposed persons, and there is no difference in histology between the former and latter groups. Thus, immature mammary gland cells before the age of puberty are found to be most radiosensitive. (N.K.)

  17. Complex Landscape of Germline Variants in Brazilian Patients With Hereditary and Early Onset Breast Cancer

    Directory of Open Access Journals (Sweden)

    Giovana T. Torrezan

    2018-05-01

    Full Text Available Pathogenic variants in known breast cancer (BC predisposing genes explain only about 30% of Hereditary Breast Cancer (HBC cases, whereas the underlying genetic factors for most families remain unknown. Here, we used whole-exome sequencing (WES to identify genetic variants associated to HBC in 17 patients of Brazil with familial BC and negative for causal variants in major BC risk genes (BRCA1/2, TP53, and CHEK2 c.1100delC. First, we searched for rare variants in 27 known HBC genes and identified two patients harboring truncating pathogenic variants in ATM and BARD1. For the remaining 15 negative patients, we found a substantial vast number of rare genetic variants. Thus, for selecting the most promising variants we used functional-based variant prioritization, followed by NGS validation, analysis in a control group, cosegregation analysis in one family and comparison with previous WES studies, shrinking our list to 23 novel BC candidate genes, which were evaluated in an independent cohort of 42 high-risk BC patients. Rare and possibly damaging variants were identified in 12 candidate genes in this cohort, including variants in DNA repair genes (ERCC1 and SXL4 and other cancer-related genes (NOTCH2, ERBB2, MST1R, and RAF1. Overall, this is the first WES study applied for identifying novel genes associated to HBC in Brazilian patients, in which we provide a set of putative BC predisposing genes. We also underpin the value of using WES for assessing the complex landscape of HBC susceptibility, especially in less characterized populations.

  18. A sparse regulatory network of copy-number driven gene expression reveals putative breast cancer oncogenes.

    Science.gov (United States)

    Yuan, Yinyin; Curtis, Christina; Caldas, Carlos; Markowetz, Florian

    2012-01-01

    Copy number aberrations are recognized to be important in cancer as they may localize to regions harboring oncogenes or tumor suppressors. Such genomic alterations mediate phenotypic changes through their impact on expression. Both cis- and transacting alterations are important since they may help to elucidate putative cancer genes. However, amidst numerous passenger genes, trans-effects are less well studied due to the computational difficulty in detecting weak and sparse signals in the data, and yet may influence multiple genes on a global scale. We propose an integrative approach to learn a sparse interaction network of DNA copy-number regions with their downstream transcriptional targets in breast cancer. With respect to goodness of fit on both simulated and real data, the performance of sparse network inference is no worse than other state-of-the-art models but with the advantage of simultaneous feature selection and efficiency. The DNA-RNA interaction network helps to distinguish copy-number driven expression alterations from those that are copy-number independent. Further, our approach yields a quantitative copy-number dependency score, which distinguishes cis- versus trans-effects. When applied to a breast cancer data set, numerous expression profiles were impacted by cis-acting copy-number alterations, including several known oncogenes such as GRB7, ERBB2, and LSM1. Several trans-acting alterations were also identified, impacting genes such as ADAM2 and BAGE, which warrant further investigation. An R package named lol is available from www.markowetzlab.org/software/lol.html.

  19. Unique molecular signatures as a hallmark of patients with metastatic breast cancer: implications for current treatment paradigms.

    Science.gov (United States)

    Wheler, Jennifer J; Parker, Barbara A; Lee, Jack J; Atkins, Johnique T; Janku, Filip; Tsimberidou, Apostolia M; Zinner, Ralph; Subbiah, Vivek; Fu, Siqing; Schwab, Richard; Moulder, Stacy; Valero, Vicente; Schwaederle, Maria; Yelensky, Roman; Miller, Vincent A; Stephens, M Philip J; Meric-Bernstam, Funda; Kurzrock, Razelle

    2014-05-15

    Our analysis of the tumors of 57 women with metastatic breast cancer with next generation sequencing (NGS) demonstrates that each patient's tumor is unique in its molecular fingerprint. We observed 216 somatic aberrations in 70 different genes, including 131 distinct aberrations. The most common gene alterations (in order of decreasing frequency) included: TP53, PIK3CA, CCND1, MYC, HER2 (ERBB2), MCL1, PTEN, FGFR1, GATA3, NF1, PIK3R1, BRCA2, EGFR, IRS2, CDH1, CDKN2A, FGF19, FGF3 and FGF4. Aberrations included mutations (46%), amplifications (45%), deletions (5%), splices (2%), truncations (1%), fusions (0.5%) and rearrangements (0.5%), with multiple distinct variants within the same gene. Many of these aberrations represent druggable targets, either through direct pathway inhibition or through an associated pathway (via 'crosstalk'). The 'molecular individuality' of these tumors suggests that a customized strategy, using an "N-of-One" model of precision medicine, may represent an optimal approach for the treatment of patients with advanced tumors.

  20. Cigarette smoking habit does not reduce the benefit from first line trastuzumab-based treatment in advanced breast cancer patients.

    Science.gov (United States)

    Santini, Daniele; Vincenzi, Bruno; Adamo, Vincenzo; Addeo, Raffaele; Fusco, Vittorio; Russo, Antonio; Montemurro, Filippo; Roato, Ilaria; Redana, Stefania; Lanzetta, Gaetano; Satolli, Maria Antonietta; Berruti, Alfredo; Leoni, Valentina; Galluzzo, Sara; Antimi, Mauro; Ferraro, Giuseppa; Rossi, Maura; Del Prete, Salvatore; Valerio, Maria Rosaria; Marra, Monica; Caraglia, Michele; Tonini, Giuseppe

    2011-06-01

    Many ErbB2-positive cancers may show intrinsic resistance, and the frequent development of acquired resistance to ErbB-targeted agents represents a substantial clinical problem. The constitutive NF-κB activation in some HER-2/neu positive breast cancer may represent a potential cause of resistance to trastuzumab therapy. Preclinical data revealed that 4-(N-Methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone (NNK), the tobacco-specific nitrosamine is able to enhance NF-κB DNA binding activity and theoretically to increase the resistance to trastuzumab. Two hundred and forty-eight women with pathologically confirmed, uni- or bidimensionally measurable, HER-2-positive metastatic breast cancer (MBC) treated with trastuzumab-based therapy as first line combination for metastatic disease were considered eligible. For all included patients data on smoking habit were detectable from medical records. We retrospectively analysed the smoking habits of 248 MBC patients and correlated these habits with activity and efficacy of trastuzumab-based therapy. No statistically significant difference in terms of response rate (RR), time to progression (TTP) and overall survival (OS) was identified between smokers (former plus active smokers) and never smokers. Moreover, no statistically significant difference in terms of RR, TTP and OS was identified either comparing active smokers and former smokers. Moreover, we did not observed any significant statistical difference in terms of TTP and OS between smokers ≥10 cigarettes/day and smoking habit and both activity and efficacy of trastuzumab-based first line therapy in metastatic HER2/neu positive breast cancer patients.

  1. EHMT2 is a metastasis regulator in breast cancer.

    Science.gov (United States)

    Kim, Kwangho; Son, Mi-Young; Jung, Cho-Rok; Kim, Dae-Soo; Cho, Hyun-Soo

    2018-02-05

    Various modes of epigenetic regulation of breast cancer proliferation and metastasis have been investigated, but epigenetic mechanisms involved in breast cancer metastasis remain elusive. Thus, in this study, EHMT2 (a histone methyltransferase) was determined to be significantly overexpressed in breast cancer tissues and in Oncomine data. In addition, knockdown of EHMT2 reduced cell migration/invasion and regulated the expression of EMT-related markers (E-cadherin, Claudin 1, and Vimentin). Furthermore, treatment with BIX-01294, a specific inhibitor of EHMT2, affected migration/invasion in MDA-MB-231 cells. Therefore, our findings demonstrate functions of EHMT2 in breast cancer metastasis and suggest that targeting EHMT2 may be an effective therapeutic strategy for preventing breast cancer metastasis. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Interleukin-6 overexpression induces pulmonary hypertension.

    Science.gov (United States)

    Steiner, M Kathryn; Syrkina, Olga L; Kolliputi, Narasaish; Mark, Eugene J; Hales, Charles A; Waxman, Aaron B

    2009-01-30

    Inflammatory cytokine interleukin (IL)-6 is elevated in the serum and lungs of patients with pulmonary artery hypertension (PAH). Several animal models of PAH cite the potential role of inflammatory mediators. We investigated role of IL-6 in the pathogenesis of pulmonary vascular disease. Indices of pulmonary vascular remodeling were measured in lung-specific IL-6-overexpressing transgenic mice (Tg(+)) and compared to wild-type (Tg(-)) controls in both normoxic and chronic hypoxic conditions. The Tg(+) mice exhibited elevated right ventricular systolic pressures and right ventricular hypertrophy with corresponding pulmonary vasculopathic changes, all of which were exacerbated by chronic hypoxia. IL-6 overexpression increased muscularization of the proximal arterial tree, and hypoxia enhanced this effect. It also reproduced the muscularization and proliferative arteriopathy seen in the distal arteriolar vessels of PAH patients. The latter was characterized by the formation of occlusive neointimal angioproliferative lesions that worsened with hypoxia and were composed of endothelial cells and T-lymphocytes. IL-6-induced arteriopathic changes were accompanied by activation of proangiogenic factor, vascular endothelial growth factor, the proproliferative kinase extracellular signal-regulated kinase, proproliferative transcription factors c-MYC and MAX, and the antiapoptotic proteins survivin and Bcl-2 and downregulation of the growth inhibitor transforming growth factor-beta and proapoptotic kinases JNK and p38. These findings suggest that IL-6 promotes the development and progression of pulmonary vascular remodeling and PAH through proproliferative antiapoptotic mechanisms.

  3. Breast reconstruction - natural tissue

    Science.gov (United States)

    ... flap; TRAM; Latissimus muscle flap with a breast implant; DIEP flap; DIEAP flap; Gluteal free flap; Transverse upper gracilis flap; TUG; Mastectomy - breast reconstruction with natural tissue; Breast cancer - breast reconstruction with natural tissue

  4. Breast Cancer: Treatment Options

    Science.gov (United States)

    ... Breast Cancer > Breast Cancer: Treatment Options Request Permissions Breast Cancer: Treatment Options Approved by the Cancer.Net Editorial ... can be addressed as quickly as possible. Recurrent breast cancer If the cancer does return after treatment for ...

  5. Study on predictive role of AR and EGFR family genes with response to neoadjuvant chemotherapy in locally advanced breast cancer in Indian women.

    Science.gov (United States)

    Singh, L C; Chakraborty, Anurupa; Mishra, Ashwani K; Devi, Thoudam Regina; Sugandhi, Nidhi; Chintamani, Chintamani; Bhatnagar, Dinesh; Kapur, Sujala; Saxena, Sunita

    2012-06-01

    Locally advanced breast cancer (LABC) remains a clinical challenge as the majority of patients with this diagnosis develop distant metastases despite appropriate therapy. We analyzed expression of steroid and growth hormone receptor genes as well as gene associated with metabolism of chemotherapeutic drugs in locally advanced breast cancer before and after neoadjuvant chemotherapy (NACT) to study whether there is a change in gene expression induced by chemotherapy and whether such changes are associated with tumor response or non-response. Fifty patients were included with locally advanced breast cancer treated with cyclophosphamide, adriamycin, 5-fluorouracil (CAF)-based neoadjuvant chemotherapy before surgery. Total RNA was extracted from 50 match samples of pre- and post-NACT tumor tissues. RNA expression levels of epidermal growth factor receptor family genes including EGFR, ERBB2, ERBB3, androgen receptor (AR), and multidrug-resistance gene 1 (MDR1) were determined by quantitative real-time reverse transcriptase-polymerase chain reaction. Responders show significantly high levels of pre-NACT AR gene expression (P = 0.016), which reduces following NACT (P = 0.008), and hence can serve as a useful tool for the prediction of the success of neoadjuvant chemotherapy in individual cancer patients with locally advanced breast carcinoma. Moreover, a significant post-therapeutic increase in the expression levels of EGFR and MDR1 gene in responders (P = 0.026 and P < 0.001) as well as in non-responders (P = 0.055, P = 0.001) suggests that expression of these genes changes during therapy but they do not have any impact on tumor response, whereas a post-therapeutic reduction was observed in AR in responders. This indicates an independent predictive role of AR with response to NACT.

  6. Breast cancer

    International Nuclear Information System (INIS)

    Delgado, L.; Krygier, G.; Castillo, C.

    2009-01-01

    This article is about the diagnosis, treatment and monitoring of breast cancer. Positive diagnosis is based on clinical mammary exam, mammography, mammary ultrasonography, and histological study. Before the chemotherapy and radiotherapy treatment are evaluated the risks

  7. Breast Augmentation

    Science.gov (United States)

    ... Administration (FDA) has identified a possible association between breast implants and the development of anaplastic large cell lymphoma (ALCL), a rare cancer of the immune system. The FDA believes that ...

  8. Breast Augmentation

    African Journals Online (AJOL)

    1974-04-13

    Apr 13, 1974 ... Complications encountered after breast augmentation are dealt with in .... in Phisohex or other suitable preparation for a few days before surgery ... In all cases, the prosthesis causes a fibrous tissue capsule to form around it.

  9. Breast Cancer

    Science.gov (United States)

    ... modulators and aromatase inhibitors, reduce the risk of breast cancer in women with a high risk of the disease. These medications carry a risk of side effects, so doctors reserve these medications for women who ...

  10. Study of the G2/M cell cycle checkpoint in irradiated mammary epithelial cells overexpressing Cul-4A gene

    International Nuclear Information System (INIS)

    Gupta, Anu; Yang, L.-X.; Chen, L.-C.

    2002-01-01

    Purpose: Members of the cullin gene family are known to be involved in cell cycle control. One of the cullin genes, Cul-4A, is amplified and overexpressed in breast cancer cells. This study investigates the effect of Cul-4A overexpression upon G2/M cell cycle checkpoint after DNA damage induced by either ionizing or nonionizing radiation. Methods and Materials: The normal mammary epithelial cell line MCF10A was stably transfected with full-length Cul-4A cDNA. Independent clones of MCF10A cells that overexpress Cul-4A proteins were selected and treated with either 8 Gy of ionizing radiation or 7 J/M 2 of UV radiation. The profile of cell cycle progression and the accumulation of several cell cycle proteins were analyzed. Results: We found that overexpression of Cul-4A in MCF10A cells abrogated the G2/M cell cycle checkpoint in response to DNA damage induced by ionizing irradiation, but not to DNA damage induced by nonionizing radiation. Analysis of cell cycle proteins showed that after ionizing irradiation, p53 accumulated in the mock-transfected MCF10A cells, but not in the Cul-4A transfectants. Conclusion: Our results suggest a role for Cul-4A in tumorigenesis and/or tumor progression, possibly through disruption of cell cycle control

  11. RAC1b overexpression stimulates proliferation and NF-kB-mediated anti-apoptotic signaling in thyroid cancer cells.

    Science.gov (United States)

    Faria, Márcia; Matos, Paulo; Pereira, Teresa; Cabrera, Rafael; Cardoso, Bruno A; Bugalho, Maria João; Silva, Ana Luísa

    2017-01-01

    Overexpression of tumor-associated RAC1b has been recently highlighted as one of the most promising targets for therapeutic intervention in colon, breast, lung and pancreatic cancer. RAC1b is a hyperactive variant of the small GTPase RAC1 and has been recently shown to be overexpressed in a subset of papillary thyroid carcinomas associated with unfavorable outcome. Using the K1 PTC derived cell line as an in vitro model, we observed that both RAC1 and RAC1b were able to induce a significant increase on NF-kB and cyclin D1 reporter activity. A clear p65 nuclear localization was found in cells transfected with RAC1b-WT, confirming NF-kB canonical pathway activation. Consistently, we observed a RAC1b-mediated decrease in IκBα (NF-kB inhibitor) protein levels. Moreover, we show that RAC1b overexpression stimulates G1/S progression and protects thyroid cells against induced apoptosis, the latter through a process involving the NF-kB pathway. Present data support previous findings suggesting an important role for RAC1b in the development of follicular cell-derived thyroid malignancies and point out NF-kB activation as one of the molecular mechanisms associated with the pro-tumorigenic advantage of RAC1b overexpression in thyroid carcinomas.

  12. EXPRESSION AND SIGNIFICANCE OF ERK PROTEIN IN HUMAN BREAST CARCINOMA

    Institute of Scientific and Technical Information of China (English)

    张秀梅; 李柏林; 宋敏; 宋继谒

    2004-01-01

    Objective: To investigate the expression of ERK and p-ERK protein in human breast cancer and their corresponding tissue, to assess the significance of ERK signal pathway in tumorigenesis and progression of breast carcinoma. Methods: 40 breast cancer cases were used in S-P immunohistochemistry technique and Western Blot study. Results: The expression of ERK1, ERK2, and p- ERK protein levels increased remarkably in breast cancer tissues in comparison to normal tissues (P<0.01). The expression was upregulated by 1.32-, 1.53-and 4.27-fold, respectively. The overexpressions of ERK1, ERK2, and p- ERK proteins were obviously correlated with clinical stage of breast cancer. Protein levels of ERK and p-ERK were higher in stage III patients than in stage I and stage II patients (P<0.05). These proteins were strongly related with axillary lymph node metastasis of breast cancer, but not correlated with histopathological type and status of ER and PR of breast cancer. Expression of ERK1, and ERK2, protein showed a positive linear correlation. Conclusion: ERK signal transduction pathway is a key factor during human breast tumorigenesis and breast cancer progression.

  13. FLI1 Expression in Breast Cancer Cell Lines and Primary Breast Carcinomas is Correlated with ER, PR and HER2

    Directory of Open Access Journals (Sweden)

    Inam Jasim Lafta

    2017-12-01

    Full Text Available FLI1 is a member of ETS family of transcription factors that regulate a variety of normal biologic activities including cell proliferation, differentiation, and apoptosis. The expression of FLI1 and its correlation with well-known breast cancer prognostic markers (ER, PR and HER2 was determined in primary breast tumors as well as four breast cancer lines including: MCF-7, T47D, MDA-MB-231 and MDA-MB-468 using RT-qPCR with either 18S rRNA or ACTB (β-actin for normalization of data. FLI1 mRNA level was decreased in the breast cancer cell lines under study compared to the normal breast tissue; however, Jurkat cells, which were used as a positive control, showed overexpression compared to the normal breast. Regarding primary breast carcinomas, FLI1 is significantly under expressed in all of the stages of breast cancer upon using 18S as an internal control. This FLI1 expression was correlated with ER, PR and HER2 status. In conclusion FLI1 can be exploited as a preliminary marker that can predict the status of ER, PR and HER2 in primary breast tumors.

  14. CHL1 is involved in human breast tumorigenesis and progression

    Energy Technology Data Exchange (ETDEWEB)

    He, Li-Hong [Medical Department of Breast Oncology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Ma, Qin [Department of Oncology, The General Hospital of Tianjin Medical University, Tianjin (China); Shi, Ye-Hui [Medical Department of Breast Oncology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Ge, Jie; Zhao, Hong-Meng [Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Breast Surgery, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Li, Shu-Fen [Medical Department of Breast Oncology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Tong, Zhong-Sheng, E-mail: 83352162@qq.com [Medical Department of Breast Oncology, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China); Key Laboratory of Breast Cancer Prevention and Treatment of the Ministry of Education, Tianjin Medical University Cancer Institute and Hospital, Tianjin (China)

    2013-08-23

    Highlights: •CHL1 is down-regulation in breast cancer tissues. •Down-regulation of CHL1 is related to high grade. •Overexpression of CHL1 inhibits breast cancer cell proliferation and invasion in vitro. •CHL1 deficiency induces breast cancer cell proliferation and invasion both in vitro and in vivo. -- Abstract: Neural cell adhesion molecules (CAM) play important roles in the development and regeneration of the nervous system. The L1 family of CAMs is comprised of L1, Close Homolog of L1 (CHL1, L1CAM2), NrCAM, and Neurofascin, which are structurally related trans-membrane proteins in vertebrates. Although the L1CAM has been demonstrated play important role in carcinogenesis and progression, the function of CHL1 in human breast cancer is limited. Here, we found that CHL1 is down-regulated in human breast cancer and related to lower grade. Furthermore, overexpression of CHL1 suppresses proliferation and invasion in MDA-MB-231 cells and knockdown of CHL1 expression results in increased proliferation and invasion in MCF7 cells in vitro. Finally, CHL1 deficiency promotes tumor formation in vivo. Our results may provide a strategy for blocking breast carcinogenesis and progression.

  15. CHL1 is involved in human breast tumorigenesis and progression

    International Nuclear Information System (INIS)

    He, Li-Hong; Ma, Qin; Shi, Ye-Hui; Ge, Jie; Zhao, Hong-Meng; Li, Shu-Fen; Tong, Zhong-Sheng

    2013-01-01

    Highlights: •CHL1 is down-regulation in breast cancer tissues. •Down-regulation of CHL1 is related to high grade. •Overexpression of CHL1 inhibits breast cancer cell proliferation and invasion in vitro. •CHL1 deficiency induces breast cancer cell proliferation and invasion both in vitro and in vivo. -- Abstract: Neural cell adhesion molecules (CAM) play important roles in the development and regeneration of the nervous system. The L1 family of CAMs is comprised of L1, Close Homolog of L1 (CHL1, L1CAM2), NrCAM, and Neurofascin, which are structurally related trans-membrane proteins in vertebrates. Although the L1CAM has been demonstrated play important role in carcinogenesis and progression, the function of CHL1 in human breast cancer is limited. Here, we found that CHL1 is down-regulated in human breast cancer and related to lower grade. Furthermore, overexpression of CHL1 suppresses proliferation and invasion in MDA-MB-231 cells and knockdown of CHL1 expression results in increased proliferation and invasion in MCF7 cells in vitro. Finally, CHL1 deficiency promotes tumor formation in vivo. Our results may provide a strategy for blocking breast carcinogenesis and progression

  16. Functional genomic mRNA profiling of a large cancer data base demonstrates mesothelin overexpression in a broad range of tumor types.

    Science.gov (United States)

    Lamberts, Laetitia E; de Groot, Derk Jan A; Bense, Rico D; de Vries, Elisabeth G E; Fehrmann, Rudolf S N

    2015-09-29

    The membrane bound glycoprotein mesothelin (MSLN) is a highly specific tumor marker, which is currently exploited as target for drugs. There are only limited data available on MSLN expression by human tumors. Therefore we determined overexpression of MSLN across different tumor types with Functional Genomic mRNA (FGM) profiling of a large cancer database. Results were compared with data in articles reporting immunohistochemical (IHC) MSLN tumor expression. FGM profiling is a technique that allows prediction of biologically relevant overexpression of proteins from a robust data set of mRNA microarrays. This technique was used in a database comprising 19,746 tumors to identify for 41 tumor types the percentage of samples with an overexpression of MSLN compared to a normal background. A literature search was performed to compare the FGM profiling data with studies reporting IHC MSLN tumor expression. FGM profiling showed MSLN overexpression in gastrointestinal (12-36%) and gynecological tumors (20-66%), non-small cell lung cancer (21%) and synovial sarcomas (30%). The overexpression found in thyroid cancers (5%) and renal cell cancers (10%) was not yet reported with IHC analyses. We observed that MSLN amplification rate within esophageal cancer depends on the histotype (31% for adenocarcinomas versus 3% for squamous-cell carcinomas). Subset analysis in breast cancer showed MSLN amplification rates of 28% in triple-negative breast cancer (TNBC) and 33% in basal-like breast cancer. Further subtype analysis of TNBCs showed the highest amplification rate (42%) in the basal-like 1 subtype and the lowest amplification rate (9%) in the luminal androgen receptor subtype.

  17. MAL2 and tumor protein D52 (TPD52) are frequently overexpressed in ovarian carcinoma, but differentially associated with histological subtype and patient outcome

    International Nuclear Information System (INIS)

    Byrne, Jennifer A; Sutherland, Robert L; Fazio, Anna de; O'Brien, Philippa M; Maleki, Sanaz; Hardy, Jayne R; Gloss, Brian S; Murali, Rajmohan; Scurry, James P; Fanayan, Susan; Emmanuel, Catherine; Hacker, Neville F

    2010-01-01

    The four-transmembrane MAL2 protein is frequently overexpressed in breast carcinoma, and MAL2 overexpression is associated with gain of the corresponding locus at chromosome 8q24.12. Independent expression microarray studies predict MAL2 overexpression in ovarian carcinoma, but these had remained unconfirmed. MAL2 binds tumor protein D52 (TPD52), which is frequently overexpressed in ovarian carcinoma, but the clinical significance of MAL2 and TPD52 overexpression was unknown. Immunohistochemical analyses of MAL2 and TPD52 expression were performed using tissue microarray sections including benign, borderline and malignant epithelial ovarian tumours. Inmmunohistochemical staining intensity and distribution was assessed both visually and digitally. MAL2 and TPD52 were significantly overexpressed in high-grade serous carcinomas compared with serous borderline tumours. MAL2 expression was highest in serous carcinomas relative to other histological subtypes, whereas TPD52 expression was highest in clear cell carcinomas. MAL2 expression was not related to patient survival, however high-level TPD52 staining was significantly associated with improved overall survival in patients with stage III serous ovarian carcinoma (log-rank test, p < 0.001; n = 124) and was an independent predictor of survival in the overall carcinoma cohort (hazard ratio (HR), 0.498; 95% confidence interval (CI), 0.34-0.728; p < 0.001; n = 221), and in serous carcinomas (HR, 0.440; 95% CI, 0.294-0.658; p < 0.001; n = 182). MAL2 is frequently overexpressed in ovarian carcinoma, and TPD52 overexpression is a favourable independent prognostic marker of potential value in the management of ovarian carcinoma patients

  18. Association of PTP1B with Outcomes of Breast Cancer Patients Who Underwent Neoadjuvant Chemotherapy.

    Science.gov (United States)

    Rivera Franco, Monica M; Leon Rodriguez, Eucario; Martinez Benitez, Braulio; Villanueva Rodriguez, Luisa G; de la Luz Sevilla Gonzalez, Maria; Armengol Alonso, Alejandra

    2016-01-01

    PTP1B is involved in the oncogenesis of breast cancer. In addition, neoadjuvant therapy has been widely used in breast cancer; thus, a measurement to assess survival improvement could be pathological complete response (pCR). Our objective was to associate PTP1B overexpression with outcomes of breast cancer patients who underwent neoadjuvant chemotherapy. Forty-six specimens were included. Diagnostic biopsies were immunostained using anti-PTP1B antibody. Expression was categorized as negative (<5%) and overexpression (≥5%). Patients' responses were graded according to the Miller-Payne system. Sixty-three percent of patients overexpressed PTP1B. There was no significant association between PTP1B overexpression and pCR ( P = 0.2). However, when associated with intrinsic subtypes, overexpression was higher in human epidermal growth factor receptor 2-positive-enriched specimens ( P = 0.02). Ten-year progression-free survival showed no differences. Our preliminary results do not show an association between PTP1B over-expression and pCR; however, given the limited sample and heterogeneous treatment in our cohort, this hypothesis cannot be excluded.

  19. Association of PTP1B with Outcomes of Breast Cancer Patients who Underwent Neoadjuvant Chemotherapy

    Directory of Open Access Journals (Sweden)

    Monica M. Rivera Franco

    2016-01-01

    Full Text Available PTP1B is involved in the oncogenesis of breast cancer. In addition, neoadjuvant therapy has been widely used in breast cancer; thus, a measurement to assess survival improvement could be pathological complete response (pCR. Our objective was to associate PTP1B overexpression with outcomes of breast cancer patients who underwent neoadjuvant chemotherapy. Forty-six specimens were included. Diagnostic biopsies were immunostained using anti-PTP1B antibody. Expression was categorized as negative (<5% and overexpression (≥5%. Patients' responses were graded according to the Miller-Payne system. Sixty-three percent of patients overexpressed PTP1B. There was no significant association between PTP1B overexpression and pCR (P = 0.2. However, when associated with intrinsic subtypes, overexpression was higher in human epidermal growth factor receptor 2-positive-enriched specimens (P = 0.02. Ten-year progression-free survival showed no differences. Our preliminary results do not show an association between PTP1B overexpression and pCR; however, given the limited sample and heterogeneous treatment in our cohort, this hypothesis cannot be excluded.

  20. A receptor tyrosine kinase, UFO/Axl, and other genes isolated by a modified differential display PCR are overexpressed in metastatic prostatic carcinoma cell line DU145.

    Science.gov (United States)

    Jacob, A N; Kalapurakal, J; Davidson, W R; Kandpal, G; Dunson, N; Prashar, Y; Kandpal, R P

    1999-01-01

    We have used a modified differential display PCR protocol for isolating 3' restriction fragments of cDNAs specifically expressed or overexpressed in metastatic prostate carcinoma cell line DU145. Several cDNA fragments were identified that matched to milk fat globule protein, UFO/Axl, a receptor tyrosine kinase, human homologue of a Xenopus maternal transcript, laminin and laminin receptor, human carcinoma-associated antigen, and some expressed sequence tags. The transcript for milk fat globule protein, a marker protein shown to be overexpressed in breast tumors, was elevated in DU145 cells. The expression of UFO/Axl, a receptor tyrosine kinase, was considerably higher in DU145 cells as compared to normal prostate cells and prostatic carcinoma cell line PC-3. The overexpression of UFO oncogene in DU145 cells is discussed in the context of prostate cancer metastasis.

  1. Role of ornithine decarboxylase in breast cancer

    Institute of Scientific and Technical Information of China (English)

    Wensheng Deng; Xian Jiang; Yu Mei; Jingzhong Sun; Rong Ma; Xianxi Liu; Hui Sun; Hui Tian; Xueying Sun

    2008-01-01

    Ornithine decarboxylase (ODC), the rate-limiting enzyme in polyamine biosynthesis that decarboxylates ornithine to putrescine, has become a promising target for cancer research. The aim of this study is to investigate the role of ODC in breast cancer. We detected expression of ODC in breast cancer tissues and four breast cancer cell lines, and transfected breast cancer cells with an adenoviral vector carrying antisense ODC (rAd-ODC/Ex3as) and examined their growth and migration.ODC was overexpressed in breast cancer tissues and cell lines compared with non-tumor tissues and normal breast epithelial celis,and there was a positive correlation between the level of ODC mRNA and the staging of tumors.The expression of ODC correlated with cyclin D1,a cell cycle protein,in synchronized breast cancer MDA-MB-231 cells.Gene transfection of rAd-ODC/Ex3as markedly down-regulated expression Of ODC and cyclin D1,resulting in suppression of proliferation and cell cycle arrest at G0-G1 phase,and the inhibifion of colony formation,an anchorage-independent growth pattern,and the migratory ability of MDA-MB-231 cells.rAd-ODC/Ex3as also markedly reduced the concentration of putrescine,but not spermidine or spermine,in MDA-MB-231 cells.The results suggested that the ODC gene might act as aprognostic factor for breast cancer and it could be a promising therapeutic target.

  2. Long-Term Follow-Up of Cardiac Function and Quality of Life for Patients in NSABP Protocol B-31/NRG Oncology: A Randomized Trial Comparing the Safety and Efficacy of Doxorubicin and Cyclophosphamide (AC) Followed by Paclitaxel With AC Followed by Paclitaxel and Trastuzumab in Patients With Node-Positive Breast Cancer With Tumors Overexpressing Human Epidermal Growth Factor Receptor 2.

    Science.gov (United States)

    Ganz, Patricia A; Romond, Edward H; Cecchini, Reena S; Rastogi, Priya; Geyer, Charles E; Swain, Sandra M; Jeong, Jong-Hyeon; Fehrenbacher, Louis; Gross, Howard M; Brufsky, Adam M; Flynn, Patrick J; Wahl, Tanya A; Seay, Thomas E; Wade, James L; Biggs, David D; Atkins, James N; Polikoff, Jonathan; Zapas, John L; Mamounas, Eleftherios P; Wolmark, Norman

    2017-12-10

    Purpose Early cardiac toxicity is a risk associated with adjuvant chemotherapy plus trastuzumab. However, objective measures of cardiac function and health-related quality of life are lacking in long-term follow-up of patients who remain cancer free after completion of adjuvant treatment. Patients and Methods Patients in NSABP Protocol B-31 received anthracycline and taxane chemotherapy with or without trastuzumab for adjuvant treatment of node-positive, human epidermal growth factor receptor 2-positive early-stage breast cancer. A long-term follow-up assessment was undertaken for patients who were alive and disease free, which included measurement of left ventricular ejection fraction by multigated acquisition scan along with patient-reported outcomes using the Duke Activity Status Index (DASI), the Medical Outcomes Study questionnaire, and a review of current medications and comorbid conditions. Results At a median follow-up of 8.8 years among eligible participants, five (4.5%) of 110 in the control group and 10 (3.4%) of 297 in the trastuzumab group had a > 10% decline in left ventricular ejection fraction from baseline to a value < 50%. Lower DASI scores correlated with age and use of medications for hypertension, cardiac conditions, diabetes, and hyperlipidemia, but not with whether patients had received trastuzumab. Conclusion In patients without underlying cardiac disease at baseline, the addition of trastuzumab to adjuvant anthracycline and taxane-based chemotherapy does not result in long-term worsening of cardiac function, cardiac symptoms, or health-related quality of life. The DASI questionnaire may provide a simple and useful tool for monitoring patient-reported changes that reflect cardiac function.

  3. Overexpression of osteoprotegerin promotes preosteoblast differentiation to mature osteoblasts

    NARCIS (Netherlands)

    Yu, Hongyou; de Vos, Paul; Ren, Yijin

    OBJECTIVE: The hypothesis of the present study is that overexpression of osteoprotegerin (OPG) promotes preosteoblast maturation. MATERIALS AND METHODS: The preosteoblast cell line MC3T3-E1 was transfected with OPG overexpression. OPG expression was confirmed by enzyme-linked immunosorbent assay

  4. Modeling ERBB receptor-regulated G1/S transition to find novel targets for de novo trastuzumab resistance

    Directory of Open Access Journals (Sweden)

    Thieffry Denis

    2009-01-01

    Full Text Available Abstract Background In breast cancer, overexpression of the transmembrane tyrosine kinase ERBB2 is an adverse prognostic marker, and occurs in almost 30% of the patients. For therapeutic intervention, ERBB2 is targeted by monoclonal antibody trastuzumab in adjuvant settings; however, de novo resistance to this antibody is still a serious issue, requiring the identification of additional targets to overcome resistance. In this study, we have combined computational simulations, experimental testing of simulation results, and finally reverse engineering of a protein interaction network to define potential therapeutic strategies for de novo trastuzumab resistant breast cancer. Results First, we employed Boolean logic to model regulatory interactions and simulated single and multiple protein loss-of-functions. Then, our simulation results were tested experimentally by producing single and double knockdowns of the network components and measuring their effects on G1/S transition during cell cycle progression. Combinatorial targeting of ERBB2 and EGFR did not affect the response to trastuzumab in de novo resistant cells, which might be due to decoupling of receptor activation and cell cycle progression. Furthermore, examination of c-MYC in resistant as well as in sensitive cell lines, using a specific chemical inhibitor of c-MYC (alone or in combination with trastuzumab, demonstrated that both trastuzumab sensitive and resistant cells responded to c-MYC perturbation. Conclusion In this study, we connected ERBB signaling with G1/S transition of the cell cycle via two major cell signaling pathways and two key transcription factors, to model an interaction network that allows for the identification of novel targets in the treatment of trastuzumab resistant breast cancer. Applying this new strategy, we found that, in contrast to trastuzumab sensitive breast cancer cells, combinatorial targeting of ERBB receptors or of key signaling intermediates does not

  5. Selective genomic copy number imbalances and probability of recurrence in early-stage breast cancer.

    Directory of Open Access Journals (Sweden)

    Patricia A Thompson

    Full Text Available A number of studies of copy number imbalances (CNIs in breast tumors support associations between individual CNIs and patient outcomes. However, no pattern or signature of CNIs has emerged for clinical use. We determined copy number (CN gains and losses using high-density molecular inversion probe (MIP arrays for 971 stage I/II breast tumors and applied a boosting strategy to fit hazards models for CN and recurrence, treating chromosomal segments in a dose-specific fashion (-1 [loss], 0 [no change] and +1 [gain]. The concordance index (C-Index was used to compare prognostic accuracy between a training (n = 728 and test (n = 243 set and across models. Twelve novel prognostic CNIs were identified: losses at 1p12, 12q13.13, 13q12.3, 22q11, and Xp21, and gains at 2p11.1, 3q13.12, 10p11.21, 10q23.1, 11p15, 14q13.2-q13.3, and 17q21.33. In addition, seven CNIs previously implicated as prognostic markers were selected: losses at 8p22 and 16p11.2 and gains at 10p13, 11q13.5, 12p13, 20q13, and Xq28. For all breast cancers combined, the final full model including 19 CNIs, clinical covariates, and tumor marker-approximated subtypes (estrogen receptor [ER], progesterone receptor, ERBB2 amplification, and Ki67 significantly outperformed a model containing only clinical covariates and tumor subtypes (C-Index(full model, train[test]  =  0.72[0.71] ± 0.02 vs. C-Index(clinical + subtype model, train[test]  =  0.62[0.62] ± 0.02; p<10(-6. In addition, the full model containing 19 CNIs significantly improved prognostication separately for ER-, HER2+, luminal B, and triple negative tumors over clinical variables alone. In summary, we show that a set of 19 CNIs discriminates risk of recurrence among early-stage breast tumors, independent of ER status. Further, our data suggest the presence of specific CNIs that promote and, in some cases, limit tumor spread.

  6. Dimethylarginine Dimethylaminohydrolase Overexpression enhances Insulin Sensitivity

    Science.gov (United States)

    Sydow, Karsten; Mondon, Carl E.; Schrader, Joerg; Konishi, Hakuoh; Cooke, John P.

    2011-01-01

    Objective Previous studies suggest that nitric oxide (NO) may modulate insulin-induced uptake of glucose in insulin-sensitive tissues. Asymmetric dimethylarginine (ADMA) is an endogenous inhibitor of NO synthase (NOS). We hypothesized that a reduction in endogenous ADMA would increase NO synthesis and thereby enhance insulin sensitivity. Methods and Results To test this hypothesis we employed a transgenic mouse in which we overexpressed human dimethylarginine dimethylaminohydrolase (DDAH-I). The DDAH-I mice had lower plasma ADMA at all ages (22–70 weeks) by comparison to wild-type (WT) littermates. With a glucose challenge, WT mice showed a prompt increase in ADMA, whereas DDAH-I mice had a blunted response. Furthermore, DDAH-I mice had a blunted increase in plasma insulin and glucose levels after glucose challenge, with a 50% reduction in the insulin resistence index, consistent with enhanced sensitivity to insulin. In liver, we observed an increased Akt phosphorylation in the DDAH-I mice after i.p. glucose challenge. Incubation of skeletal muscle from WT mice ex vivo with ADMA (2μM) markedly suppressed insulin-induced glycogen synthesis in fast-twitch but not slow-twitch muscle. Conclusions These findings suggest that the endogenous NOS inhibitor ADMA reduces insulin sensitivity, consistent with previous observations that NO plays a role in insulin sensitivity. PMID:18239148

  7. Oxidative stress specifically downregulates survivin to promote breast tumour formation.

    Science.gov (United States)

    Pervin, S; Tran, L; Urman, R; Braga, M; Parveen, M; Li, S A; Chaudhuri, G; Singh, R

    2013-03-05

    Breast cancer, a heterogeneous disease has been broadly classified into oestrogen receptor positive (ER+) or oestrogen receptor negative (ER-) tumour types. Each of these tumours is dependent on specific signalling pathways for their progression. While high levels of survivin, an anti-apoptotic protein, increases aggressive behaviour in ER- breast tumours, oxidative stress (OS) promotes the progression of ER+ breast tumours. Mechanisms and molecular targets by which OS promotes tumourigenesis remain poorly understood. DETA-NONOate, a nitric oxide (NO)-donor induces OS in breast cancer cell lines by early re-localisation and downregulation of cellular survivin. Using in vivo models of HMLE(HRAS) xenografts and E2-induced breast tumours in ACI rats, we demonstrate that high OS downregulates survivin during initiation of tumourigenesis. Overexpression of survivin in HMLE(HRAS) cells led to a significant delay in tumour initiation and tumour volume in nude mice. This inverse relationship between survivin and OS was also observed in ER+ human breast tumours. We also demonstrate an upregulation of NADPH oxidase-1 (NOX1) and its activating protein p67, which are novel markers of OS in E2-induced tumours in ACI rats and as well as in ER+ human breast tumours. Our data, therefore, suggest that downregulation of survivin could be an important early event by which OS initiates breast tumour formation.

  8. Targeting tumour re-wiring by triple blockade of mTORC1, epidermal growth factor, and oestrogen receptor signalling pathways in endocrine-resistant breast cancer.

    Science.gov (United States)

    Ribas, Ricardo; Pancholi, Sunil; Rani, Aradhana; Schuster, Eugene; Guest, Stephanie K; Nikitorowicz-Buniak, Joanna; Simigdala, Nikiana; Thornhill, Allan; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Dowsett, Mitch; Johnston, Stephen R; Martin, Lesley-Ann

    2018-06-08

    Endocrine therapies are the mainstay of treatment for oestrogen receptor (ER)-positive (ER + ) breast cancer (BC). However, resistance remains problematic largely due to enhanced cross-talk between ER and growth factor pathways, circumventing the need for steroid hormones. Previously, we reported the anti-proliferative effect of everolimus (RAD001-mTORC1 inhibitor) with endocrine therapy in resistance models; however, potential routes of escape from treatment via ERBB2/3 signalling were observed. We hypothesised that combined targeting of three cellular nodes (ER, ERBB, and mTORC1) may provide enhanced long-term clinical utility. A panel of ER + BC cell lines adapted to long-term oestrogen deprivation (LTED) and expressing ESR1 wt or ESR1 Y537S , modelling acquired resistance to an aromatase-inhibitor (AI), were treated in vitro with a combination of RAD001 and neratinib (pan-ERBB inhibitor) in the presence or absence of oestradiol (E2), tamoxifen (4-OHT), or fulvestrant (ICI182780). End points included proliferation, cell signalling, cell cycle, and effect on ER-mediated transactivation. An in-vivo model of AI resistance was treated with monotherapies and combinations to assess the efficacy in delaying tumour progression. RNA-seq analysis was performed to identify changes in global gene expression as a result of the indicated therapies. Here, we show RAD001 and neratinib (pan-ERBB inhibitor) caused a concentration-dependent decrease in proliferation, irrespective of the ESR1 mutation status. The combination of either agent with endocrine therapy further reduced proliferation but the maximum effect was observed with a triple combination of RAD001, neratinib, and endocrine therapy. In the absence of oestrogen, RAD001 caused a reduction in ER-mediated transcription in the majority of the cell lines, which associated with a decrease in recruitment of ER to an oestrogen-response element on the TFF1 promoter. Contrastingly, neratinib increased both ER

  9. Overexpression of SAMD9 suppresses tumorigenesis and progression during non small cell lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Qing; Yu, Tao; Ren, Yao-Yao; Gong, Ting; Zhong, Dian-Sheng, E-mail: zhongdsyx@126.com

    2014-11-07

    Highlights: • SAMD9 is down-regulated in human non-small cell lung cancer (NSCLC). • Knockdown of SAMD9 expression is increased the invasion, migration and proliferation in H1299 cells in vitro. • Overexpression of SAMD9 suppressed proliferation and invasion in A549 cells in vitro. • Depletion of SAMD9 increases tumor formation in vivo. - Abstract: The Sterile Alpha Motif Domain-containing 9 (SAMD9) gene has been recently emphasized during the discovery that it is expressed at a lower level in aggressive fibromatosis and some cases of breast and colon cancer, however, the underlying mechanisms are poorly understood. Here, we found that SAMD9 is down-regulated in human non-small cell lung cancer (NSCLC). Furthermore, knockdown of SAMD9 expression is increased the invasion, migration and proliferation in H1299 cells in vitro and overexpression of SAMD9 suppressed proliferation and invasion in A549 cells. Finally, depletion of SAMD9 increases tumor formation in vivo. Our results may provide a strategy for blocking NSCLC tumorigenesis and progression.

  10. Genetic and genomic analysis modeling of germline c-MYC overexpression and cancer susceptibility

    Directory of Open Access Journals (Sweden)

    Nunes Virginia

    2008-01-01

    Full Text Available Abstract Background Germline genetic variation is associated with the differential expression of many human genes. The phenotypic effects of this type of variation may be important when considering susceptibility to common genetic diseases. Three regions at 8q24 have recently been identified to independently confer risk of prostate cancer. Variation at 8q24 has also recently been associated with risk of breast and colorectal cancer. However, none of the risk variants map at or relatively close to known genes, with c-MYC mapping a few hundred kilobases distally. Results This study identifies cis-regulators of germline c-MYC expression in immortalized lymphocytes of HapMap individuals. Quantitative analysis of c-MYC expression in normal prostate tissues suggests an association between overexpression and variants in Region 1 of prostate cancer risk. Somatic c-MYC overexpression correlates with prostate cancer progression and more aggressive tumor forms, which was also a pathological variable associated with Region 1. Expression profiling analysis and modeling of transcriptional regulatory networks predicts a functional association between MYC and the prostate tumor suppressor KLF6. Analysis of MYC/Myc-driven cell transformation and tumorigenesis substantiates a model in which MYC overexpression promotes transformation by down-regulating KLF6. In this model, a feedback loop through E-cadherin down-regulation causes further transactivation of c-MYC. Conclusion This study proposes that variation at putative 8q24 cis-regulator(s of transcription can significantly alter germline c-MYC expression levels and, thus, contribute to prostate cancer susceptibility by down-regulating the prostate tumor suppressor KLF6 gene.

  11. Dual blockade of HER2 in HER2-overexpressing tumor cells does not completely eliminate HER3 function.

    Science.gov (United States)

    Garrett, Joan T; Sutton, Cammie R; Kuba, María Gabriela; Cook, Rebecca S; Arteaga, Carlos L

    2013-02-01

    Dual blockade of HER2 with trastuzumab and lapatinib or with pertuzumab is a superior treatment approach compared with single-agent HER2 inhibitors. However, many HER2-overexpressing breast cancers still escape from this combinatorial approach. Inhibition of HER2 and downstream phosphoinositide 3-kinase (PI3K)/AKT causes a transcriptional and posttranslational upregulation of HER3 which, in turn, counteracts the antitumor action of the HER2-directed therapies. We hypothesized that suppression of HER3 would synergize with dual blockade of HER2 in breast cancer cells sensitive and refractory to HER2 antagonists. Inhibition of HER2/HER3 in HER2(+) breast cancer cell lines was evaluated by Western blotting. We analyzed drug-induced apoptosis and two- and three-dimensional growth in vitro. Growth inhibition of PI3K was examined in vivo in xenografts treated with combinations of trastuzumab, lapatinib, and the HER3-neutralizing monoclonal antibody U3-1287. Treatment with U3-1287 blocked the upregulation of total and phosphorylated HER3 that followed treatment with lapatinib and trastuzumab and, in turn, enhanced the antitumor action of the combination against trastuzumab-sensitive and -resistant cells. Mice bearing HER2(+) xenografts treated with lapatinib, trastuzumab, and U3-1287 exhibited fewer recurrences and better survival than mice treated with lapatinib and trastuzumab. Dual blockade of HER2 with trastuzumab and lapatinib does not eliminate the compensatory upregulation of HER3. Therapeutic inhibitors of HER3 should be considered as part of multidrug combinations aimed at completely and rapidly disabling the HER2 network in HER2-overexpressing breast cancers.

  12. Estrogen receptor (ESR1) mRNA expression and benefit from tamoxifen in the treatment and prevention of estrogen receptor-positive breast cancer.

    Science.gov (United States)

    Kim, Chungyeul; Tang, Gong; Pogue-Geile, Katherine L; Costantino, Joseph P; Baehner, Frederick L; Baker, Joffre; Cronin, Maureen T; Watson, Drew; Shak, Steven; Bohn, Olga L; Fumagalli, Debora; Taniyama, Yusuke; Lee, Ahwon; Reilly, Megan L; Vogel, Victor G; McCaskill-Stevens, Worta; Ford, Leslie G; Geyer, Charles E; Wickerham, D Lawrence; Wolmark, Norman; Paik, Soonmyung

    2011-11-01

    Several mechanisms have been proposed to explain tamoxifen resistance of estrogen receptor (ER) -positive tumors, but a clinically useful explanation for such resistance has not been described. Because the ER is the treatment target for tamoxifen, a linear association between ER expression levels and the degree of benefit from tamoxifen might be expected. However, such an association has never been demonstrated with conventional clinical ER assays, and the ER is currently used clinically as a dichotomous marker. We used gene expression profiling and ER protein assays to help elucidate molecular mechanism(s) responsible for tamoxifen resistance in breast tumors. We performed gene expression profiling of paraffin-embedded tumors from National Surgical Adjuvant Breast and Bowel Project (NSABP) trials that tested the worth of tamoxifen as an adjuvant systemic therapy (B-14) and as a preventive agent (P-1). This was a retrospective subset analysis based on available materials. In B-14, ESR1 was the strongest linear predictor of tamoxifen benefit among 16 genes examined, including PGR and ERBB2. On the basis of these data, we hypothesized that, in the P-1 trial, a lower level of ESR1 mRNA in the tamoxifen arm was the main difference between the two study arms. Only ESR1 was downregulated by more than two-fold in ER-positive cancer events in the tamoxifen arm (P < .001). Tamoxifen did not prevent ER-positive tumors with low levels of ESR1 expression. These data suggest that low-level expression of ESR1 is a determinant of tamoxifen resistance in ER-positive breast cancer. Strategies should be developed to identify, treat, and prevent such tumors.

  13. Estrogen Receptor (ESR1) mRNA Expression and Benefit From Tamoxifen in the Treatment and Prevention of Estrogen Receptor–Positive Breast Cancer

    Science.gov (United States)

    Kim, Chungyeul; Tang, Gong; Pogue-Geile, Katherine L.; Costantino, Joseph P.; Baehner, Frederick L.; Baker, Joffre; Cronin, Maureen T.; Watson, Drew; Shak, Steven; Bohn, Olga L.; Fumagalli, Debora; Taniyama, Yusuke; Lee, Ahwon; Reilly, Megan L.; Vogel, Victor G.; McCaskill-Stevens, Worta; Ford, Leslie G.; Geyer, Charles E.; Wickerham, D. Lawrence; Wolmark, Norman; Paik, Soonmyung

    2011-01-01

    Purpose Several mechanisms have been proposed to explain tamoxifen resistance of estrogen receptor (ER) –positive tumors, but a clinically useful explanation for such resistance has not been described. Because the ER is the treatment target for tamoxifen, a linear association between ER expression levels and the degree of benefit from tamoxifen might be expected. However, such an association has never been demonstrated with conventional clinical ER assays, and the ER is currently used clinically as a dichotomous marker. We used gene expression profiling and ER protein assays to help elucidate molecular mechanism(s) responsible for tamoxifen resistance in breast tumors. Patients and Methods We performed gene expression profiling of paraffin-embedded tumors from National Surgical Adjuvant Breast and Bowel Project (NSABP) trials that tested the worth of tamoxifen as an adjuvant systemic therapy (B-14) and as a preventive agent (P-1). This was a retrospective subset analysis based on available materials. Results In B-14, ESR1 was the strongest linear predictor of tamoxifen benefit among 16 genes examined, including PGR and ERBB2. On the basis of these data, we hypothesized that, in the P-1 trial, a lower level of ESR1 mRNA in the tamoxifen arm was the main difference between the two study arms. Only ESR1 was downregulated by more than two-fold in ER-positive cancer events in the tamoxifen arm (P < .001). Tamoxifen did not prevent ER-positive tumors with low levels of ESR1 expression. Conclusion These data suggest that low-level expression of ESR1 is a determinant of tamoxifen resistance in ER-positive breast cancer. Strategies should be developed to identify, treat, and prevent such tumors. PMID:21947828

  14. Fluorescent polymer-based post-translational differentiation and subtyping of breast cancer cells.

    Science.gov (United States)

    Scott, Michael D; Dutta, Rinku; Haldar, Manas K; Wagh, Anil; Gustad, Thomas R; Law, Benedict; Friesner, Daniel L; Mallik, Sanku

    2012-12-07

    Herein, we report the application of synthesized fluorescent, water soluble polymers for post-translational subtyping and differentiation of breast cancer cells in vitro. The fluorescence emission spectra from these polymers were modulated differently in the presence of conditioned cell culture media from various breast cancer cells. These polymers differentiate at a post-translation level possibly due to their ability to interact with extracellular enzymes that are over-expressed in cancerous conditions.

  15. Breast MRI scan

    Science.gov (United States)

    ... or breast ultrasound Evaluate for possible rupture of breast implants Find any cancer that remains after surgery or chemotherapy Show blood ... Mean Abnormal results may be due to: Breast cancer Cysts Leaking or ruptured breast implants Abnormal breast tissue that is not cancer Scar ...

  16. Breast Cancer Surgery

    Science.gov (United States)

    FACTS FOR LIFE Breast Cancer Surgery The goal of breast cancer surgery is to remove the whole tumor from the breast. Some lymph nodes ... might still be in the body. Types of breast cancer surgery There are two types of breast cancer ...

  17. GSE1 negative regulation by miR-489-5p promotes breast cancer cell proliferation and invasion

    International Nuclear Information System (INIS)

    Chai, Peng; Tian, Jingzhong; Zhao, Deyin; Zhang, Hongyan; Cui, Jian; Ding, Keshuo; Liu, Bin

    2016-01-01

    Gse1 coiled-coil protein (GSE1), also known as KIAA0182, is a proline rich protein. However, the function of GSE1 is largely unknown. In this study, we reported that GSE1 is overexpression in breast cancer and silencing of GSE1 significantly suppressed breast cancer cells proliferation, migration and invasion. Furthermore, GSE1 was identified as a direct target of miR-489-5p, which is significantly reduced in breast cancer tissues. In addition, forced expression of miR-489-5p suppressed breast cancer cells proliferation, migration and invasion. Moreover, depletion of GSE1 by siRNAs significantly abrogated the enhanced proliferation, migration and invasion of breast cancer cells consequent to miR-489-5p depletion. Taken together, these findings suggest that GSE1 may function as a novel oncogene in breast cancer and it can be regulated by miR-489-5p. - Highlights: • GSE1 is overexpressed in breast cancer and increased GSE1 expression predicts poor prognosis in breast cancer patients. • Knockdown of GSE1 inhibits breast cancer cell proliferation, migration and invasion. • GSE1 is a direct target of miR-489-5p. • Forced expression of miR-489-5p inhibits breast cancer cell proliferation, migration and invasion.

  18. C-MET overexpression and amplification in gliomas.

    Science.gov (United States)

    Kwak, Yoonjin; Kim, Seong-Ik; Park, Chul-Kee; Paek, Sun Ha; Lee, Soon-Tae; Park, Sung-Hye

    2015-01-01

    We investigated c-Met overexpression and MET gene amplification in gliomas to determine their incidence and prognostic significance. c-Met immunohistochemistry and MET gene fluorescence in situ hybridization were carried out on tissue microarrays from 250 patients with gliomas (137 grade IV GBMs and 113 grade II and III diffuse gliomas). Clinicopathological features of these cases were reviewed. c-Met overexpression and MET gene amplification were detected in 13.1% and 5.1% of the GBMs, respectively. All the MET-amplified cases showed c-Met overexpression, but MET amplification was not always concordant with c-Met overexpression. None of grade II and III gliomas demonstrated c-Met overexpression or MET gene amplification. Mean survival of the GBM patients with MET amplification was not significantly different from patients without MET amplification (P=0.155). However, GBM patients with c-Met overexpression survived longer than patients without c-Met overexpression (P=0.035). Although MET amplification was not related to poor GBM prognosis, it is partially associated with the aggressiveness of gliomas, as MET amplification was found only in grade IV, not in grade II and III gliomas. We suggest that MET inhibitor therapy may be beneficial in about 5% GBMs, which was the incidence of MET gene amplification found in the patients included in this study.

  19. Neuroglobin Overexpression Inhibits AMPK Signaling and Promotes Cell Anabolism.

    Science.gov (United States)

    Cai, Bin; Li, Wenjun; Mao, XiaoOu; Winters, Ali; Ryou, Myoung-Gwi; Liu, Ran; Greenberg, David A; Wang, Ning; Jin, Kunlin; Yang, Shao-Hua

    2016-03-01

    Neuroglobin (Ngb) is a recently discovered globin with preferential localization to neurons. Growing evidence indicates that Ngb has distinct physiological functions separate from the oxygen storage and transport roles of other globins, such as hemoglobin and myoglobin. We found increased ATP production and decreased glycolysis in Ngb-overexpressing immortalized murine hippocampal cell line (HT-22), in parallel with inhibition of AMP-activated protein kinase (AMPK) signaling and activation of acetyl-CoA carboxylase (ACC). In addition, lipid and glycogen content was increased in Ngb-overexpressing HT-22 cells. AMPK signaling was also inhibited in the brain and heart from Ngb-overexpressing transgenic mice. Although Ngb overexpression did not change glycogen content in whole brain, glycogen synthase was activated in cortical neurons of Ngb-overexpressing mouse brain and Ngb overexpression primary neurons. Moreover, lipid and glycogen content was increased in hearts derived from Ngb-overexpressing mice. These findings suggest that Ngb functions as a metabolic regulator and enhances cellular anabolism through the inhibition of AMPK signaling.

  20. In vitro evaluation of a specific radiochemical compound based on 99mTc-labeled DARPinG3 for radionuclide imaging of tumors overexpressing Her-2/neu

    Science.gov (United States)

    Bragina, O.; Larkina, M.; Stasyuk, E.; Chernov, V.; Zelchan, R.; Medvedeva, A.; Sinilkin, I.; Yusubov, M.; Skuridin, V.; Deyev, S.; Buldakov, M.

    2017-09-01

    It is still necessary to search for new informative diagnostic methods to detect malignant tumors with overexpression of Her-2/neu, which are characterized by the aggressive course of the disease, rapid rate of tumor growth and low rates of relapse-free and overall survival. In recent years, the radioisotope techniques for detection of specific tumor targets have been developing actively. Purpose: to develop a chemically stable radiochemical compound for the targeted imaging of cells overexpressing Her-2/neu. Material and methods: The study was performed using 2 cell lines. The human breast adenocarcinoma HER2-overexpressing cell line BT-474 was chosen to detect specific binding. As a control, HER2-negative human breast adenocarcinoma MCF-7 was used. The human breast adenocarcinoma BT-474 and MCF-7 cell lines were seeded in chamber-slides at the density of 35,000 cells/ml in trypsin-EDTA (PanEco) medium and grown overnight at 37°C. After that both cell lines were washed with Phosphate buffered saline (PBS) and distributed into test tubes to 1 ml (5 millions cells in each). After adding 100 µl (70 MBq) studied complex of 99mTc-DPAH- DARPinG3 was incubated for 40 min at +4°C. Washing was performed three times with buffer PBS and 5% Bovine Serum Albumin (BSA). The characteristics of the binding specificity of the test set with the HER-2/neu receptor were determined by direct radiometric and planar scintigraphy. Nonparametric Mann-Whitney test was used to assess the differences in the quantitative characteristics between groups. Results: The output of the labeled complex was more than 91%, with a radiochemical purity of more than 94%. When carrying out a visual scintigraphic assessment much greater intensity accumulation of radiotracer was observed in the studied cell culture surface receptor overexpressing Her-2/neu. The results of direct radiometric also showed higher accumulation of the radiopharmaceutical in the adenocarcinoma cell line BT-474 human breast

  1. Cloning, overexpression, and characterization of cobrotoxin

    International Nuclear Information System (INIS)

    Hsieh, H.-C.; Kumar, Thallampuranam Krishnaswamy S.; Yu Chin

    2004-01-01

    Cobrotoxin (CBTX) is a highly toxic short neurotoxin, isolated from the Taiwan cobra (Naja naja atra) venom. In the present study for the first time we report the cloning and expression of CBTX in high yields (12 mg/L) in Escherichia coli. CBTX fused to the IgG-binding domain of protein A (IgG-CBTX) was expressed in the soluble form. The misfolded CBTX portion (of the overexpressed fusion protein) was refolded under optimal redox conditions. The fusion protein (IgG-CBTX) was observed to undergo autocatalytic cleavage to yield CBTX with additional 5 amino acids upstream of its N-terminal end. The far UV and near UV circular dichroism spectra of the recombinant CBTX were identical to those of the toxin isolated from the crude venom source. Recombinant CBTX was isotope labeled ( 15 N and 13 C) and all the resonances ( 1 H, 13 C, and 15 N) in the protein have been unambiguously assigned. 1 H- 15 N HSQC spectrum of recombinant CBTX revealed that the protein is in a biologically active conformation. 1 H- 15 N chemical shift perturbation data showed that recombinant CBTX binds to a peptide derived from the α7 subunit of the Torpedo acetylcholine receptor (AchR) with high affinity. The AchR peptide is found to bind to residues located at the tip of Loop-2 in CBTX. The results of the present study provide an avenue to understand the structural basis for the high toxicity exhibited by CBTX. In addition, complete resonance assignments in CBTX (reported in this study) are expected to trigger intensive research towards the design of new pharmacological agents against certain neural disorders

  2. Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

    Directory of Open Access Journals (Sweden)

    Knüchel Ruth

    2008-05-01

    cancer, ERH overexpression may be implicated in the initiation and/or progression of certain human malignancies. Further studies on large breast cancer tissue cohorts should determine whether ERH could function as a prognostic factor or even a drug target in the treatment of human breast cancer.

  3. Chemokine CXCL16 Expression Suppresses Migration and Invasiveness and Induces Apoptosis in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Yeying Fang

    2014-01-01

    Full Text Available Background. Increasing evidence argues that soluble CXCL16 promotes proliferation, migration, and invasion of cancer cells in vitro. However, the role of transmembrane or cellular CXCL16 in cancer remains relatively unknown. In this study, we determine the function of cellular CXCL16 as tumor suppressor in breast cancer cells. Methods. Expression of cellular CXCL16 in breast cancer cell lines was determined at both RNA and protein levels. In vitro and in vivo studies that overexpressed or downregulated CXCL16 were conducted in breast cancer cells. Results. We report differential expression of cellular CXCL16 in breast cancer cell lines that was negatively correlated with cell invasiveness and migration. Overexpression of CXCL16 in MDA-MB-231 cells led to a decrease in cell invasion and migration and induced apoptosis of the cells; downregulation of CXCL16 in MCF-7 cells increased cell migration and invasiveness. Consistent with the in vitro data, CXCL16 overexpression inhibited tumorigenesis in vivo. Conclusions. Cellular CXCL16 suppresses invasion and metastasis of breast cancer cells in vitro and inhibits tumorigenesis in vivo. Targeting of cellular CXCL16 expression is a potential therapeutic strategy for breast cancer.

  4. BREAST RECONSTRUCTIONS AFTER BREAST CANCER TREATING

    Directory of Open Access Journals (Sweden)

    Erik Vrabič

    2018-02-01

    Full Text Available Background. Breasts are an important symbol of physical beauty, feminity, mothering and sexual desire through the entire history of mankind. Lost of the whole or part of the breast is functional and aesthetic disturbance for woman. It is understandable, that the woman, who is concerned over breast loss, is as appropriate as another person´s concern over the loss of a limb or other body part. Before the 1960, breast reconstruction was considered as a dangerous procedure and it was almost prohibited. Considering the psychological importance of the breast in modern society, the possibility of breast reconstruction for the woman about to undergo a mastectomy is a comforting alternative. We can perform breast reconstruction with autologous tissue (autologous reconstruction, with breast implants and combination of both methods. For autologous reconstruction we can use local tissue (local flaps, or tissue from distant parts of the body (free vascular tissue transfer. Tissue expansion must be performed first, in many cases of breast reconstructions with breast implants. Conclusions. Possibility of breast reconstruction made a big progress last 3 decades. Today we are able to reconstruct almost every defect of the breast and the entire breast. Breast reconstruction rise the quality of life for breast cancer patients. Breast reconstruction is a team work of experts from many medicine specialites. In Slovenia we can offer breast reconstruction for breast cancer patients in Ljubljana, where plastic surgeons from Clinical Department for Plastic Surgery and Burns cooperate with oncologic surgeons. Ten years ago a similar cooperation between plastic surgeons and surgeons of the Centre for Breast Diseases was established in Maribor.

  5. Breast pain

    Science.gov (United States)

    ... that reducing the amount of fat, caffeine, or chocolate in your diet helps reduce breast pain. Vitamin ... harmful, but most studies have not shown any benefit. Talk to your provider before starting any medicine or ... Louisiana State University Health Sciences Center-Shreveport, Shreveport, LA. Review provided by ...

  6. Breast Cancer

    Science.gov (United States)

    ... right away. He or she will do a physical exam. They will ask you about your health history and your family’s history of breast cancer. ... and Wellness Staying Healthy Healthy Living Travel Occupational Health First Aid and ... Pets and Animals myhealthfinder Food and Nutrition Healthy Food ...

  7. Breast lymphoma

    African Journals Online (AJOL)

    To fulfil the criteria for primary breast lymphoma, the following characteristics were reqUired: (I) technically adequate specimens; (iI) mammary tissue and lymphomatous infiltrate in close association; (iil) no evidence of concurrent widespread disease; and (iv) no previous. Haematology/Oncology Division, Department of ...

  8. Breast cancer

    CERN Multimedia

    2002-01-01

    "Cancer specialists will soon be able to compare mammograms with computerized images of breast cancer from across Europe, in a bid to improve diagnosis and treatment....The new project, known as MammoGrid, brings together computer and medical imaging experts, cancer specialists, radiologists and epidemiologists from Bristol, Oxford, Cambridge, France and Italy" (1 page).

  9. Obesity-associated Breast Cancer: Analysis of risk factors.

    Science.gov (United States)

    Engin, Atilla

    2017-01-01

    Several studies show that a significantly stronger association is obvious between increased body mass index (BMI) and higher breast cancer incidence. Furthermore, obese women are at higher risk of all-cause and breast cancer specific mortality when compared to non-obese women with breast cancer. In this context, increased levels of estrogens due to excessive aromatization activity of the adipose tissue, overexpression of pro-inflammatory cytokines, insulin resistance, hyperactivation of insulin-like growth factors (IGFs) pathways, adipocyte-derived adipokines, hypercholesterolemia and excessive oxidative stress contribute to the development of breast cancer in obese women. While higher breast cancer risk with hormone replacement therapy is particularly evident among lean women, in postmenopausal women who are not taking exogenous hormones, general obesity is a significant predictor for breast cancer. Moreover, increased plasma cholesterol leads to accelerated tumor formation and exacerbates their aggressiveness. In contrast to postmenopausal women, premenopausal women with high BMI are inversely associated with breast cancer risk. Nevertheless, life-style of women for breast cancer risk is regulated by avoiding the overweight and a high-fat diet. Estrogen-plus-progestin hormone therapy users for more than 5 years have elevated risks of both invasive ductal and lobular breast cancer. Additionally, these cases are more commonly node-positive and have a higher cancer-related mortality. Collectively, in this chapter, the impacts of obesity-related estrogen, cholesterol, saturated fatty acid, leptin and adiponectin concentrations, aromatase activity, leptin and insulin resistance on breast cancer patients are evaluated. Obesity-related prognostic factors of breast cancer also are discussed at molecular basis.

  10. Heat Shock Protein 90 (Hsp90 Expression and Breast Cancer

    Directory of Open Access Journals (Sweden)

    Christos A. Papadimitriou

    2012-09-01

    Full Text Available Hsp90 is an abundant protein in mammalian cells. It forms several discrete complexes, each containing distinct groups of co-chaperones that assist protein folding and refolding during stress, protein transport and degradation. It interacts with a variety of proteins that play key roles in breast neoplasia including estrogen receptors, tumor suppressor p53 protein, angiogenesis transcription factor HIF-1alpha, antiapoptotic kinase Akt, Raf-1 MAP kinase and a variety of receptor tyrosine kinases of the erbB family. Elevated Hsp90 expression has been documented in breast ductal carcinomas contributing to the proliferative activity of breast cancer cells; whilst a significantly decreased Hsp90 expression has been shown in infiltrative lobular carcinomas and lobular neoplasia. Hsp90 overexpression has been proposed as a component of a mechanism through which breast cancer cells become resistant to various stress stimuli. Therefore, pharmacological inhibition of HSPs can provide therapeutic opportunities in the field of cancer treatment. 17-allylamino,17-demethoxygeldanamycin is the first Hsp90 inhibitor that has clinically been investigated in phase II trial, yielding promising results in patients with HER2-overexpressing metastatic breast cancer, whilst other Hsp90 inhibitors (retaspimycin HCL, NVP-AUY922, NVP-BEP800, CNF2024/BIIB021, SNX-5422, STA-9090, etc. are currently under evaluation.

  11. An exploratory study of host polymorphisms in genes that clinically characterize breast cancer tumors and pretreatment cognitive performance in breast cancer survivors

    Directory of Open Access Journals (Sweden)

    Koleck TA

    2017-03-01

    Full Text Available Theresa A Koleck,1,2 Catherine M Bender,1 Beth Z Clark,3,4 Christopher M Ryan,5,6 Puja Ghotkar,1 Adam Brufsky,4,7,8 Priscilla F McAuliffe,4,8,9 Priya Rastogi,4,7 Susan M Sereika,1,10,11 Yvette P Conley,1,12 1School of Nursing, University of Pittsburgh, Pittsburgh, PA, 2School of Nursing, Columbia University, New York, NY, 3Division of Gynecologic Pathology, Magee-Womens Hospital of University of Pittsburgh Medical Center (UPMC, 4School of Medicine, 5Department of Psychiatry, University of Pittsburgh, Pittsburgh, PA, 6Department of Psychiatry, University of California San Francisco, San Francisco, CA, 7Division of Hematology/Oncology, Magee-Womens Hospital of UPMC, 8University of Pittsburgh Cancer Institute, 9Division of Breast Surgical Oncology, Magee-Womens Hospital of UPMC, 10Department of Biostatistics, 11Department of Epidemiology, 12Department of Human Genetics, Graduate School of Public Health, University of Pittsburgh, Pittsburgh, PA, USA Purpose: Inspired by the hypothesis that heterogeneity in the biology of breast cancers at the cellular level may account for cognitive dysfunction symptom variability in survivors, the current study explored relationships between host single-nucleotide polymorphisms (SNPs in 25 breast cancer-related candidate genes (AURKA, BAG1, BCL2, BIRC5, CCNB1, CD68, CENPA, CMC2, CTSL2, DIAPH3, ERBB2, ESR1, GRB7, GSTM1, MELK, MKI67, MMP11, MYBL2, NDC80, ORC6, PGR, RACGAP1, RFC4, RRM2, and SCUBE2, identified from clinically relevant prognostic multigene-expression profiles for breast cancer, and pretreatment cognitive performance.Patients and methods: The sample (n=220 was comprised of 138 postmenopausal women newly diagnosed with early stage breast cancer and 82 postmenopausal age- and education-matched healthy controls without breast cancer. Cognitive performance was assessed after primary surgery but prior to initiation of adjuvant chemotherapy and/or hormonal therapy using a comprehensive battery of

  12. Targeting HER 1 and 2 in breast cancer with lapatinib

    Directory of Open Access Journals (Sweden)

    Gerald M. Higa

    2011-12-01

    Full Text Available Numerous clinical trials support the biological relevance of the HER2 oncoprotein in breast cancer. In spite of improved outcomes, overexpression of the receptor is associated with increased risks of disease relapse, even in patients with early, and potentially curable, disease. Until recently, development of resistance to trastuzumab left patients with no therapeutic option other than specifically targeted HER2. This paper provides an in-depth review of lapatinib, a dual HER kinase inhibitor, as well as some insight into three HER family members, in breast cancer.

  13. Insulin-like growth factor-1 receptor overexpression is associated with outcome in invasive urothelial carcinoma of urinary bladder: a retrospective study of patients treated using radical cystectomy.

    Science.gov (United States)

    Gonzalez-Roibon, Nilda; Kim, Jenny J; Faraj, Sheila F; Chaux, Alcides; Bezerra, Stephania M; Munari, Enrico; Ellis, Carla; Sharma, Rajni; Keizman, Daniel; Bivalacqua, Trinity J; Schoenberg, Mark; Eisenberger, Mario; Carducci, Michael; Netto, George J

    2014-06-01

    To assess the insulin-like growth factor-1 receptor (IGF1R) expression in urothelial carcinoma (UC) and its prognostic role in relation to clinicopathologic parameters. A total of 100 cases of invasive UC were evaluated using tissue microarrays. Membranous IGF1R staining was evaluated using immunohistochemistry. A scoring method analogous to that of HER2 expression in breast carcinoma was used, and the highest score was assigned in each tumor. IGF1R was considered overexpressed in cases with score≥1. We found IGF1R overexpression in 62% of invasive UC. IGF1R overexpression was associated with race (P=.04) and pT category (P=.03). Median follow-up was 29 months (range, 0.5-212). Progression rate was 60%, and overall mortality and cancer-specific mortality rates were 69% and 51%, respectively. In invasive UC, IGF1R overexpression was significantly associated with overall mortality and cancer-specific mortality (Mantel Cox P=.0002 and P=.006, respectively). IGF1R overexpression was associated with increased hazard ratios (HRs) for overall mortality (HR=2.63, P=.001) and cancer-specific mortality (HR=2.45, P=.01), independently and after adjusting for clinicopathologic features and treatment modalities. We found IGF1R overexpression in 62% of bladder UC. More importantly, IGF1R overexpression was a significant predictor of overall mortality and cancer-specific mortality, suggesting its potential role as a prognosticator in UC of bladder. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Male Breast Cancer

    Science.gov (United States)

    Although breast cancer is much more common in women, men can get it too. It happens most often to men between ... 60 and 70. Breast lumps usually aren't cancer. However, most men with breast cancer have lumps. ...

  15. Breast biopsy -- stereotactic

    Science.gov (United States)

    ... org/-/media/ACR/Files/Practice-Parameters/stereo-breast.pdf . Updated 2016. Accessed March 14, 2017. Parker C, Umphrey H, Bland K. The role of stereotactic breast biopsy in the management of breast disease. In: Cameron ...

  16. Breast Cancer in Men

    Science.gov (United States)

    ... ultrasound or a breast MRI cannot rule out breast cancer then you will need a biopsy to confirm diagnosis. If diagnosed When first diagnosed with breast cancer, many men are in shock. After all, ...

  17. MRI of the Breast

    Science.gov (United States)

    ... in evaluating women at high risk for breast cancer. MRI can successfully image the dense breast tissue common in younger women, and it can successfully image breast implants. Both of these are difficult to image using ...

  18. Male Breast Cancer

    Science.gov (United States)

    ... types of breast cancer that can occur in men include Paget's disease of the nipple and inflammatory breast cancer. Inherited genes that increase breast cancer risk Some men inherit abnormal (mutated) genes from their parents that ...

  19. Plasmacytoma of the Breast

    African Journals Online (AJOL)

    GB

    2015-10-04

    Oct 4, 2015 ... The clinical diagnosis of a breast plasmacytoma is ... lead to a diagnosis of breast plasmacytoma (1-3). Bone marrow ... breast cancer cases present at an advanced stage, ... pelvic ultrasonography, were normal, Bence Jones.

  20. Breast Cancer Disparities

    Science.gov (United States)

    ... 2.65 MB] Read the MMWR Science Clips Breast Cancer Black Women Have Higher Death Rates from Breast ... of Page U.S. State Info Number of Additional Breast Cancer Deaths Among Black Women, By State SOURCE: National ...

  1. The role of lipolysis stimulated lipoprotein receptor in breast cancer and directing breast cancer cell behavior.

    Directory of Open Access Journals (Sweden)

    Denise K Reaves

    Full Text Available The claudin-low molecular subtype of breast cancer is of particular interest for clinically the majority of these tumors are poor prognosis, triple negative, invasive ductal carcinomas. Claudin-low tumors are characterized by cancer stem cell-like features and low expression of cell junction and adhesion proteins. Herein, we sought to define the role of lipolysis stimulated lipoprotein receptor (LSR in breast cancer and cancer cell behavior as LSR was recently correlated with tumor-initiating features. We show that LSR was expressed in epithelium, endothelium, and stromal cells within the healthy breast tissue, as well as in tumor epithelium. In primary breast tumor bioposies, LSR expression was significantly correlated with invasive ductal carcinomas compared to invasive lobular carcinomas, as well as ERα positive tumors and breast cancer cell lines. LSR levels were significantly reduced in claudin-low breast cancer cell lines and functional studies illustrated that re-introduction of LSR into a claudin-low cell line suppressed the EMT phenotype and reduced individual cell migration. However, our data suggest that LSR may promote collective cell migration. Re-introduction of LSR in claudin-low breast cancer cell lines reestablished tight junction protein expression and correlated with transepithelial electrical resistance, thereby reverting claudin-low lines to other intrinsic molecular subtypes. Moreover, overexpression of LSR altered gene expression of pathways involved in transformation and tumorigenesis as well as enhanced proliferation and survival in anchorage independent conditions, highlighting that reestablishment of LSR signaling promotes aggressive/tumor initiating cell behaviors. Collectively, these data highlight a direct role for LSR in driving aggressive breast cancer behavior.

  2. Pseudomonal breast infection

    Science.gov (United States)

    Rastall, S; Catchpole, C; Bright-Thomas, R; Thrush, S

    2010-01-01

    Breast infection and breast sepsis secondary to Pseudomonas aeruginosa is uncommon. We report two cases of pseudomonal breast infection leading to septic shock and abscess formation in women with non-responding breast infection. The management of breast infection is broad-spectrum antibiotics and ultrasound with aspiration of any collection. To treat breast infection effectively, the causative organism must be isolated to enable appropriate antibiotic therapy. PMID:20412664

  3. [Overexpression of FKS1 to improve yeast autolysis-stress].

    Science.gov (United States)

    Li, Jia; Wang, Jinjing; Li, Qi

    2015-09-01

    With the development of high gravity brewing, yeast cells are exposed to multiple brewing-associated stresses, such as increased osmotic pressure, enhanced alcohol concentration and nutritional imbalance. These will speed up yeast autolysis, which seriously influence beer flavor and quality. To increase yeast anti-autolytic ability, FKS1 overexpression strain was constructed by 18S rDNA. The concentration of β-1,3-glucan of overexpression strain was 62% higher than that of wild type strain. Meantime, FKS1 overexpression strain increased anti-stress ability at 8% ethanol, 0.4 mol/L NaCl and starvation stress. Under simulated autolysis, FKS1 showed good anti-autolytic ability by slower autolysis. These results confirms the potential of FKS1 overexpression to tackle yeast autolysis in high-gravity brewing.

  4. Transgenic overexpression of BAFF regulates the expression of ...

    Indian Academy of Sciences (India)

    To investigate whether transgenic overexpression of the zebrafish BAFF leads to ... and BAFF proteins were expressed separately and confirmed in HeLa cells. ... body homogenate of zebrafish and demonstrated a significant increase in ...

  5. Breast Reduction Surgery

    Science.gov (United States)

    ... considering breast reduction surgery, consult a board-certified plastic surgeon. It's important to understand what breast reduction surgery entails — including possible risks and complications — as ...

  6. DREW-UCLA Breast Cancer Research and Training Program: Molecular/Cellular Pathogenesis Model

    Science.gov (United States)

    2007-03-01

    RHS1764-9209568) were designed corresponding to nucleotides 575 to 595 of the coding region (gccctggccgtgctagacaat) of Homo sapiens ERBB2 transcript...variant 1, mRNA sequence (NM_004448, NCBI database), and 2896 to 2917 of the coding region (gctgaactggtgtatgcagatt) of Homo sapiens ERBB2, transcript...responsible for alanine transport. Springer Apoptosis (2007) 12:593–612 599 * T ra n sp o rt V el o ci ty (n m o l/m g p ro te in /m in ) 0.0 0.5 1.0

  7. In Vivo Measurement of Drug Efficacy in Breast Cancer

    Science.gov (United States)

    2016-10-01

    term for breast cancer treatment. During Year 2, this project has focused on developing drug and NP drug delivery methods for testing in animal...Nanoformulations for drug delivery Months GSU % Complete Subtask 2a: In vitro validation and comparison of nano encapsulated and unencapsulated versions of...overexpressing the protein target, CSF-1R, with various forms of the drug via a Presto-Blue assay (Figure 2). For other drugs , such as Afatinib Page 6

  8. miR-411-5p inhibits proliferation and metastasis of breast cancer cell via targeting GRB2

    International Nuclear Information System (INIS)

    Zhang, Yunda; Xu, Guoxing; Liu, Gang; Ye, Yongzhi; Zhang, Chuankai; Fan, Chuannan; Wang, Haibin; Cai, Huali; Xiao, Rui; Huang, Zhengjie; Luo, Qi

    2016-01-01

    miR-411-5p (previously called miR-411) is severely involved in human diseases, however, the relationship between miR-411-5p and breast cancer has not been investigated thoroughly. Here, we found that the expression of miR-411-5p was downregulated in breast cancer tissues compared with their matched adjacent non-neoplastic tissues. In addition, the expression of miR-411-5p was also lower in breast cancer cell lines in contrast with MCF-10A. Moreover, we investigated the target and mechanism of miR-411-5p in breast cancer using mimic and inhibitor, and demonstrated the involvement of GRB2 and Ras activation. Ectopic expression of miR-411-5p suppressed the breast cancer cell proliferation, migration and invasion while low expression of miR-411-5p exhibited the opposite effect. Furthermore, GRB2 was demonstrated to be significantly overexpressed in breast cancer tissues compared with normal tissues, and low expression of GRB2 had a longer overall survival compared with high expression of GRB2 in breast cancer. In general, our study shed light on the miR-411-5p related mechanism in the progression of breast cancer and, miR-411-5p/GRB2/Ras axis is potential to be molecular target for breast cancer therapy. - Highlights: • miR-411-5p is downregulated in breast cancer tissues and cell lines. • miR-411-5p inhibits breast cancer cells growth, migration and invasion in vitro. • GRB2 is a direct target of miR-411-5p in breast cancer. • GRB2 is overexpressed in breast cancer and associates with disease outcome. • miR-411-5p suppresses breast cancer progression though GRB2-SOS-Ras pathway.

  9. miR-411-5p inhibits proliferation and metastasis of breast cancer cell via targeting GRB2

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yunda [Department of Gastrointestinal Surgery, First Affiliated Hospital of Xiamen University, Xiamen 361003 (China); State Key Laboratory of Cellular Stress Biology, Innovation Center for Cell Signaling Network, School of Life Sciences, Xiamen University, Xiamen 361102 (China); Xu, Guoxing [Department of Gastrointestinal Surgery, First Affiliated Hospital of Xiamen University, Xiamen 361003 (China); Department of Gastrointestinal Surgery, First Clinical Medical College of Fujian Medical University, Fuzhou 350005 (China); Liu, Gang; Ye, Yongzhi [Department of Gastrointestinal Surgery, First Affiliated Hospital of Xiamen University, Xiamen 361003 (China); Zhang, Chuankai [Department of Gastrointestinal Surgery, First Affiliated Hospital of Xiamen University, Xiamen 361003 (China); State Key Laboratory of Cellular Stress Biology, Innovation Center for Cell Signaling Network, School of Life Sciences, Xiamen University, Xiamen 361102 (China); Fan, Chuannan [State Key Laboratory of Cellular Stress Biology, Innovation Center for Cell Signaling Network, School of Life Sciences, Xiamen University, Xiamen 361102 (China); Wang, Haibin; Cai, Huali; Xiao, Rui [Department of Gastrointestinal Surgery, First Affiliated Hospital of Xiamen University, Xiamen 361003 (China); Department of Gastrointestinal Surgery, First Clinical Medical College of Fujian Medical University, Fuzhou 350005 (China); Huang, Zhengjie, E-mail: huangzhengjie@xmu.edu.cn [Department of Gastrointestinal Surgery, First Affiliated Hospital of Xiamen University, Xiamen 361003 (China); Department of Gastrointestinal Surgery, First Clinical Medical College of Fujian Medical University, Fuzhou 350005 (China); Luo, Qi, E-mail: luoqixmzsh@126.com [Department of Gastrointestinal Surgery, First Affiliated Hospital of Xiamen University, Xiamen 361003 (China); Department of Gastrointestinal Surgery, First Clinical Medical College of Fujian Medical University, Fuzhou 350005 (China)

    2016-08-05

    miR-411-5p (previously called miR-411) is severely involved in human diseases, however, the relationship between miR-411-5p and breast cancer has not been investigated thoroughly. Here, we found that the expression of miR-411-5p was downregulated in breast cancer tissues compared with their matched adjacent non-neoplastic tissues. In addition, the expression of miR-411-5p was also lower in breast cancer cell lines in contrast with MCF-10A. Moreover, we investigated the target and mechanism of miR-411-5p in breast cancer using mimic and inhibitor, and demonstrated the involvement of GRB2 and Ras activation. Ectopic expression of miR-411-5p suppressed the breast cancer cell proliferation, migration and invasion while low expression of miR-411-5p exhibited the opposite effect. Furthermore, GRB2 was demonstrated to be significantly overexpressed in breast cancer tissues compared with normal tissues, and low expression of GRB2 had a longer overall survival compared with high expression of GRB2 in breast cancer. In general, our study shed light on the miR-411-5p related mechanism in the progression of breast cancer and, miR-411-5p/GRB2/Ras axis is potential to be molecular target for breast cancer therapy. - Highlights: • miR-411-5p is downregulated in breast cancer tissues and cell lines. • miR-411-5p inhibits breast cancer cells growth, migration and invasion in vitro. • GRB2 is a direct target of miR-411-5p in breast cancer. • GRB2 is overexpressed in breast cancer and associates with disease outcome. • miR-411-5p suppresses breast cancer progression though GRB2-SOS-Ras pathway.

  10. Is overexpression of HER-2 a predictor of prognosis in colorectal cancer?

    International Nuclear Information System (INIS)

    Kavanagh, Dara O; Chambers, Gillian; O' Grady, Liam; Barry, Kevin M; Waldron, Ronan P; Bennani, Fadel; Eustace, Paul W; Tobbia, Iqdam

    2009-01-01

    The development of novel chemotherapeutic agents in colorectal cancer has improved survival. Following initial response to chemotherapeutic strategies many patients develop refractory disease. This poses a significant challenge common to many cancer subtypes. Newer agents such as Bevacizumab have successfully targeted the tyrosine kinase receptor epidermal growth factor receptor in metastatic colorectal cancer. Human epidermal growth factor receptor-2 is another member of the tyrosine kinase receptor family which has been successfully targeted in breast cancer. This may play a role in colorectal cancer. We conducted a clinicopathological study to determine if overexpression of human epidermal growth factor receptor-2 is a predictor of outcome in a cohort of patients with colorectal cancer. Clinicopathological data and paraffin-embedded specimens were collected on 132 consecutive patients who underwent colorectal resections over a 24-month period at Mayo General Hospital. Twenty-six contained non-malignant disease. Her-2/neu protein overexpression was detected using immunohistochemistry (IHC). The HER-2 4B5 Ventana monoclonal antibody was used. Fluorescent insitu hybridisation (FISH) was performed using INFORM HER-2/Neu Plus. Results were correlated with established clinical and pathological predictors of outcome including TNM stage. Statistical analysis was performed using SPSS version 11.5. 114 were HER-2/Neu negative using IHC, 7 showed barely perceptible positivity (1+), 9 showed moderate staining (2+) and 2 were strongly positive (3+). There was no correlation with gender, age, grade, Dukes' stage, TNM stage, time to recurrence and 5-year survival (p > 0.05). FISH was applied to all 2+ and 3+ cases as well as some negative cases selected at random. Three were amplified (2 were 3+ and 1 was 2+). Similarly, HER-2 gene overexpression did not correlate with established prognostic indicators. HER-2 protein is over expressed in 11% of colorectal cancer patients

  11. Is overexpression of HER-2 a predictor of prognosis in colorectal cancer?

    LENUS (Irish Health Repository)

    Kavanagh, Dara O

    2012-01-31

    BACKGROUND: The development of novel chemotherapeutic agents in colorectal cancer has improved survival. Following initial response to chemotherapeutic strategies many patients develop refractory disease. This poses a significant challenge common to many cancer subtypes. Newer agents such as Bevacizumab have successfully targeted the tyrosine kinase receptor epidermal growth factor receptor in metastatic colorectal cancer. Human epidermal growth factor receptor-2 is another member of the tyrosine kinase receptor family which has been successfully targeted in breast cancer. This may play a role in colorectal cancer. We conducted a clinicopathological study to determine if overexpression of human epidermal growth factor receptor-2 is a predictor of outcome in a cohort of patients with colorectal cancer. METHODS: Clinicopathological data and paraffin-embedded specimens were collected on 132 consecutive patients who underwent colorectal resections over a 24-month period at Mayo General Hospital. Twenty-six contained non-malignant disease. Her-2\\/neu protein overexpression was detected using immunohistochemistry (IHC). The HER-2 4B5 Ventana monoclonal antibody was used. Fluorescent insitu hybridisation (FISH) was performed using INFORM HER-2\\/Neu Plus. Results were correlated with established clinical and pathological predictors of outcome including TNM stage. Statistical analysis was performed using SPSS version 11.5. RESULTS: 114 were HER-2\\/Neu negative using IHC, 7 showed barely perceptible positivity (1+), 9 showed moderate staining (2+) and 2 were strongly positive (3+). There was no correlation with gender, age, grade, Dukes\\' stage, TNM stage, time to recurrence and 5-year survival (p > 0.05). FISH was applied to all 2+ and 3+ cases as well as some negative cases selected at random. Three were amplified (2 were 3+ and 1 was 2+). Similarly, HER-2 gene overexpression did not correlate with established prognostic indicators. CONCLUSION: HER-2 protein is over

  12. Prognostic implication of aquaporin 1 overexpression in resected lung adenocarcinoma.

    Science.gov (United States)

    Bellezza, Guido; Vannucci, Jacopo; Bianconi, Fortunato; Metro, Giulio; Del Sordo, Rachele; Andolfi, Marco; Ferri, Ivana; Siccu, Paola; Ludovini, Vienna; Puma, Francesco; Sidoni, Angelo; Cagini, Lucio

    2017-12-01

    Aquaporins (AQPs) are a group of transmembrane water-selective channel proteins thought to play a role in the regulation of water permeability for plasma membranes. Indeed, high AQP levels have been suggested to promote the progression, invasion and metastasis of tumours. Specifically, AQP1 and AQP5 overexpression in lung adenocarcinoma (AC) have been suggested to be involved in molecular mechanisms in lung cancer. The aim of this retrospective cohort single-centre study was to assess both the levels of expression and therein the prognostic significance, regarding outcome of AQP1 and AQP5 in resected AC patients. Patients with histological diagnoses of lung AC submitted to pulmonary resection were included in this cohort study. Tissue microarrays containing cores from 185 ACs were prepared. AQP1 and AQP5 expressions were assessed by immunohistochemistry. Results were scored as either low (Score 0-2) or high (Score 3-9). Clinical data, pathological tumour-node-metastasis staging and follow-up were recorded. Multivariate Cox survival analysis and Fisher's t-test were performed. AQP1 overexpression was detected in 85 (46%) patients, while AQP5 overexpression was observed in 45 (24%) patients. AQP1 did not result being significantly correlated with clinical and pathological parameters, while AQP5 resulted more expressed in AC with mucinous and papillary predominant patterns. Patients with AQP1 overexpression had shorter disease-free survival (P = 0.001) compared with patients without AQP1 overexpression. Multivariate analysis confirmed that AQP1 overexpression was significantly associated with shorter disease-free survival (P = 0.001). Our results evidenced that AQP1 overexpression resulted in a shorter disease-free survival in lung AC patients. Being so, AQP1 overexpression might be an important prognostic marker in lung AC. © The Author 2017. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights

  13. Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia

    International Nuclear Information System (INIS)

    Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina

    2003-01-01

    The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence

  14. Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

    Science.gov (United States)

    Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

    2015-05-25

    Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

  15. Clinicopathologic and prognostic implications of progranulin in breast carcinoma.

    Science.gov (United States)

    Li, Li-qin; Huang, Hui-lian; Ping, Jin-liang; Wang, Xiao-hong; Zhong, Jing; Dai, Li-cheng

    2011-07-05

    Progranulin is a newly discovered 88-kDa glycoprotein originally purified from the highly tumorigenic mouse teratoma-derived cell line PC. Its expression is closely correlated with the development and metastasis of several cancers. However, no immunohistochemical evidence currently exists to correlate progranulin expression with clinicopathologic features in breast carcinoma biopsies, and the role of progranulin as a new marker of metastatic risk and prognosis in breast cancer has not yet been studied. The aim of this study was to investigate the clinicopathologic and prognostic implications of progranulin expression in breast carcinoma and its correlation with tumor angiogenesis. Progranulin expression was determined immunohistochemically in 183 surgical specimens from patients with breast cancer and 20 tissue samples from breast fibroadenomas. The tumor angiogenesis-related biomarker, vascular endothelial growth factor was assayed and microvessel density was assessed by counting vascular endothelial cells in tumor tissues labeled with endoglin antibody. The relationship between progranulin expression and the clinicopathologic data were analyzed. Progranulin proteins were overexpressed in breast cancer. The level of progranulin expression was significantly correlated with tumor size (P = 0.004), lymph node metastasis (P progranulin expression was associated with higher tumor angiogenesis, reflected by increased vascular endothelial growth factor expression (P Progranulin may be a valuable marker for assessing the metastasis and prognosis of breast cancer, and could provide the basis for new combination regimens with antiangiogenic activity.

  16. Cooverexpression of EpCAM and c-myc genes in malignant breast ...

    Indian Academy of Sciences (India)

    RT-qPCR method, our results showed that EpCAM was overexpressed in 48% of malignant and 11.1% of benign .... to 45% of patients with breast cancer in different studies ..... in cancer maintenance, development, drug resistance, as well.

  17. Associations between Polycyclic Aromatic Hydrocarbon-Related Exposures and p53 Mutations in Breast Tumors